trail cell



Overview

Ovo+ neoblasts and post-mitotic eye progenitors that simultaneously migrate and differentiate into photoreceptor neurons and non-neuronal pigment cup cells comprising the optic cup.

 

trail cell

 

"TRAIL CELL" TERM REFERENCES

PMID:22884275

 

back to top


 

In Situ Hybridization Data

Smed IDAccessionNameAliasEnriched during stage(s)Tissue/PatternImages
SMED30018592AFP48372.1ovoovoStage 6, Stage 7, Stage 8eye, photoreceptor neuron, pigment cup, trail cell

 

back to top


Sequences

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30018592 ID=SMED30018592|Name=ovo|organism=Schmidtea mediterranea sexual|type=transcript|length=1211bp
GTCATATTGAACACTGAGACTAGCTATCAATAGCTGACAATTAGACGTATAAAATGTTAGGGTACGCCTTTTTGGCCATT
ATTTCACACCAAAATTTCCATGAGTATTTTTCTAATAAGCACTCTACTCGCAAACGATGACGAAATGCCCACAGATTTGT
CATCGAAAACTGAAAAGATTGAAAACCATGAAAAATCTGAAAGGAATCTCTGCAAGTATTCCAGTCAGTTTCTTTCCTGT
TTTTATTCACAGGAAATGTTGACACTACTTATGAGAAAAAATTTCATCAATCAATATTCATTTTATTTAAAGATTTTCTC
GGGGTTTCCACAATTCGTCGATAACTTCAACTTAGTAAATCCAACAGATTTCACCGTCAATTCAAATTCAACAACAATTT
TGCCCTCATTCAACTTCCATAAAACGTCATTGAATATCGAAATGAACACCTCACTGGCCAATTCTTCAAGCACTGGTAGG
TCGTCTCCAACTGAAACTGTGTCTGAAAATCTTTGGTTAGAAAAAGTAAAGGTGGAAAAATATTTCCATTTAATTGAAAA
TCTATCACAATCCCAAGAGAACATTGAAGACATTGTCAAAACGATCAAAGTCAAACGAAGAAATTTTGCTGAATATATTA
AGAAACTTTACCTAAGTGATCCAGCCAAATTTAAGTTGACAAATGGTGGAGATGGAATAGTAAATCCATTTAGAAAACAA
TTCAAAGAAGAACGAGATAAATCTATGGACAAATTTTGCATCGAAGTTAATCACAATTATCAATGTAAGATATGTAACAA
GGTGTTTCCTTCCAAAAAGCACATGCAACGTCATATACGTTCACACGGTGTAAATTTTGATTGGTTGTGTAAATATTGTT
TTAAACCGTTTATTGATTCCTACGATTTAAAACGACATACGAGAGTCCATACAGGAGTTCAACCATACAAATGTCAAAGT
TGCACAAGAAAATTCAGTCAACGATGCTCATTGGAAAGTCATCAGGTGAAAATCCATGGAGTAGCACTGAATTATCTATA
CAAAGAAAGAAGGAACAAGTTGTATCCGTGTGAAATCTGCAGTTATAGTACGTCTTGTAAAGCAACTTGGTTGAGTCACA
TCATTCAGGAGCACCCGAATTCACTTTATGCAAAAGAAGAAGCACTCAAAGGAAAATACAACTGACTTTGAAAAATATTG
ATTTTTCAAGC

 

back to top