Temporary embryonic pharynx



Overview

Temporary Embryonic Pharynx (PLANA:0000023). An innervated, muscular pump that ingests yolk cells into the gut cavity. The temporary embryonic pharynx is an extraembryonic tissue that forms during Stage 2, functions during Stages 3-5, and degenerates during Stages 6-7.

 

temporary embryonic pharynx

 

back to top


 

Tissue Description

 

The temporary embryonic pharynx is an innervated, muscular pump that ingests yolk into the gut cavity (Figure 1 – figure supplement 12 A-B). It forms during S2 and likely functions during S3 through S5. Temporary embryonic pharynx-specific markers were identified among the S2-S4 enriched transcripts, including VAL-like (Figure 1 – figure supplement 12 C-D), netrin-like (Figure 1 – figure supplement 12 C,E), MPEG1-like-1 (Figure 1 – figure supplement 12 C,F), MPEG1-like-2 (Figure 1 – figure supplement 12 C,G). Expression of foxA1, a developmental transcription factor required for maintenance and regeneration of the pharynx during adulthood (Adler et al., 2014; Scimone et al., 2014), was detected in the epithelial cells lining the lumen of the temporary embryonic pharynx during S3-S5 (Figure 1 – figure supplement 14 A, black arrowheads). The temporary embryonic pharynx degenerates during S6, as the definitive pharynx primordium develops beneath it (Martín-Durán and Romero, 2011). Temporary embryonic pharynx markers are no longer detectable by S7 (Figure 1 – figure supplement 12 C-D).

 

back to top


 

Figures

Figure 1 – figure supplement 12: Molecular markers for the temporary embryonic pharynx

A-B: The temporary embryonic pharynx is innervated by PC-2+ neurons (A) and contains mhc-1+ radial muscle fibers (B). For simplicity, only S4 is shown. The image shown in B is also shown in Figure 1 – figure supplement 17 C.

C: Average RPKM values per embryo for the temporary embryonic pharynx markers venom allergen-like (VAL-like; SMED30015313), macrophage expressed gene 1 like-1 (MPEG1-like 1; SMED30000139), MPEG1-like 2 (SMED30034696) and netrin-like (SMED30023593) during embryogenesis, Y (yolk), Stage (S) S2-S8.  

D-G: Expression of temporary embryonic pharynx specific markers VAL-like (D, S3-S7), netrin-like (E, S2-S7), MPEG1-like-1 (F, S3-S4) and MPEG1-like-2 (G, S3-S4). 

A-B, D-G: Anterior: top (S6-S8). Black arrowheads: temporary embryonic pharynx. Red arrowheads: definitive pharynx. O: oral hemisphere. A: aboral hemisphere. D: dorsal. V: ventral. Scale bars: 100 µm.

 

 

back to top


 

In Situ Hybridization Data

Smed IDAccessionNameAliasEnriched during stage(s)Tissue/PatternImages
SMED30018602ATP-dependent RNA helicase dbp2DDX5-likeStage 2, Stage 3, Stage 4blastomere, blastomere compartment, embryonic digestive system, primitive ectoderm, temporary embryonic pharynx
SMED30023322Cathepsin LCTSL-likeStage 5embryonic digestive system, embryonic gut cell, primitive gut cell, temporary embryonic pharynx
SMED30015313Cysteine-rich secretory protein LCCL domain-containing 2VAL-likeStage 2, Stage 3, Stage 4embryonic digestive system, temporary embryonic pharynx
SMED30003202Eukaryotic initiation factor 4A-IeIF4a-likeStage 2, Stage 3, Stage 4blastomere, blastomere compartment, embryonic digestive system, primitive ectoderm, temporary embryonic pharynx
SMED30027428AFJ24799.1forkhead box A-1foxA1definitive pharynx, definitive pharynx progenitor cell, digestive system, embryonic digestive system, temporary embryonic pharynx
SMED30007290AFF18488.1GATA456gata456adefinitive gut, digestive system, embryonic digestive system, gamma neoblast, temporary embryonic pharynx
SMED30014940Gelsolingelsolin-likeStage 2, Stage 3, Stage 4embryonic digestive system, primitive ectoderm, primitive ectoderm cell, temporary embryonic pharynx
SMED30033466Histone H4blastomere, blastomere compartment, embryonic digestive system, neoblast compartment, primitive ectoderm, temporary embryonic pharynx
SMED30005748AFF18489.1HNF4hnf-4definitive gut, digestive system, embryonic digestive system, gamma neoblast, temporary embryonic pharynx
SMED30028442Lysosomal alpha-glucosidaseStage 2, Stage 3, Stage 5embryonic digestive system, embryonic gut cell, primitive gut cell, temporary embryonic pharynx
SMED30000139Macrophage-expressed gene 1 proteinMPEG1-like-1Stage 2, Stage 3, Stage 4embryonic digestive system, temporary embryonic pharynx
SMED30015696Macrophage-expressed gene 1 proteinMPEG1-like-3Stage 5embryonic digestive system, embryonic gut cell, primitive gut cell, temporary embryonic pharynx
SMED30034696Macrophage-expressed gene 1 proteinMPEG1-like-2Stage 2, Stage 3, Stage 4embryonic digestive system, temporary embryonic pharynx
SMED30025388Myosin heavy chainDj-mhcStage 7, Stage 8embryonic digestive system, muscle cell, musculature of body wall, musculature system, temporary embryonic pharynx
SMED30023593Netrin-1anetrin-likeStage 2, Stage 3, Stage 4, Stage 5embryonic digestive system, temporary embryonic pharynx
SMED30022907Synaptotagmin-1Dj-sytStage 7, Stage 8cephalic ganglia, embryonic digestive system, nervous system, neuron, temporary embryonic pharynx, ventral nerve cord
SMED30010096DAA33932.1TPA_inf: prohormone convertase 2embryonic digestive system, temporary embryonic pharynx
SMED30027646Transcription factor BTF3 homologBTF3-likeStage 2, Stage 3, Stage 4blastomere, blastomere compartment, embryonic digestive system, primitive ectoderm, temporary embryonic pharynx
SMED30025427Translationally-controlled tumor protein homologtct-likeStage 2, Stage 3, Stage 4blastomere, blastomere compartment, embryonic digestive system, primitive ectoderm, temporary embryonic pharynx

 

back to top


Sequences

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30017940 ID=SMED30017940|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=1165bp
CCTGATTGTGTGCTGTAAACAAATGCAACCTCACCGTATGTCATTATCATAATTGAAAAGATTTACGTATAAATTCAACG
TATTTTTGTCAAATTTATTATAACAATGAAGATCGTTCTACTTGCAGTATTTTGCGTTGTCTCGATTAGTGCTGGAAAAT
TAAAGTTTGAAGTCAACGAGGCCCTGAACGAGGAATGGAACATGTACAAGATCCAGTTCCAGAGAAAATACGAATCCATT
ATCGAATTAACTAGACGACTAATTTGGGAAGAAAATCTCAGATTGATACAGAAACACAATATCGAATACGATCTCGGAAA
ACATTCGTATTACCTCGGTCTGAATGAATTCGCAGACATGACCAACGAAGAATACAGAGTAAAGGTTCTCGGACTGAAAC
CAATAAACAAAAATTACACGAGAACAATTTTCCTGGCTCCGGAAAATACTGTCGATCTCCCTAAATCAGTTGATTGGAGA
ACAAAAGGATACGTAACTCCCGTGAAAAATCAGGCTAATTGTGGATCTTGTTGGTCGTTCTCGACTACTGGCTCACTAGA
GGGTCAACATAAGCGTAAAACTGGTCAGTTAATTTCCTTATCCGAACAGCAACTCGTAGACTGCAGTAAACCATTTGGTA
ATAATGGATGCAATGGTGGCCTCATGGATAACGCATTTCAGTACATTCAAAAAGACGGATTGGAATCGGAAGAAGATTAT
TCCTACACAGCAAAAGAAGGTAACTGTAAGTATGACGCCTCAAAGGTTGTTGCTCATTGCACAGGATTTGTCGATATTAA
AAAAGGAAACGAGAAAGACTTAGCAAAGGCTGTCGCAACAGTCGGTCCGATATCAGTGGCAATCGACGCCAGTAAACCAA
CTTTTCAATTATATAAAGGTGGAATCTATAATGAAAAATCATGCTCCTCCCGCCAATTGGACCATGGGGTCCTTGCAGTT
GGTTATGGGAAAGAGAACAATCAACATTTCTGGATTGTTAAAAACAGTTGGGGACCACAATGGGGACTTTCGGGGTACAT
AAAAATGACAAAGGATCGACACAATCAATGTGGAATAGCTACGATGGCTAGCTATCCTCTTGTTTGAGACTGCAATATTT
ATTTTGTTTTAATTTTATACATTTTATTTTATTTGTGAAAAAAAA
>SMED30026323 ID=SMED30026323|Name=Gelsolin|organism=Schmidtea mediterranea sexual|type=transcript|length=1381bp
ATTTAATTATGCTTATTTTAAACCAATCACATTTGGACTAGCGAACTCATAAGACAGACAAGCTTTCATATATTTATTAA
CATTTATTTCTTATTGTATATGAATACGGTTGAAGTGTTTTATTTAAACTAGATCTTTTTAGTATAGCTAAAACAAAATA
GAAATGGTAAAACCGAAAAAATATTCTTGGAAAGATTCTAATGTTGAATTAATAGGAACAAAGGAAGATCGTAGTATAAA
AAAAATATCTGCCGAAACGGAGAAAGCATGGGCTAAAGTAAAGTCATGCAATCATCCGGAATTATTTATCTGGAGGATAG
AGAAGTTCAAAGTAGTTGAATGGCCTATAAACCAATTTGGGGAATTCTATAATGGAGATTCGTATATCATACTAAATATT
TATACAAGAGGAAATGAGATTCTTTACGATGTACATTTTTGGATTGGAAAATATTCAACTCAAGATGAATACGGAACTGC
CGCCTACAAAACAGTAGAATTGGATAATTTCCTTGATGATAAACCGGTACAACATAGAGAGGTGCAGCATTACGAATCAG
AGTTGTTTAAGAGCTATTTTTCTCAATTAATTTATCTGAACGGTGGAATTGAAAGTGGATTTAGACATGTAATTACGAAA
GAATATTCACCAAGATTGCTTCATGTCCGTGGCGACAAACTAAAAGTCATTGTATCGGAAGTTGCTGCAACGAAAAGAAA
TTTGAACTCGGATGATGTTTTTCTGTATGACACAGGCACCCACATTTTTCAATGGATCGGAAAAGGTGCAAATAAAGATG
AAAGATATCATGGTCAGAGGTTTGCTCAACAATTGAGTTCAGATAGAAATGGAAAAGTAAAAATTGAAGTTGTGGATGAA
GATGACTCTTCATCAAATCTTATTTTTTATAATAAATTATCGGATGAAATTAGTGAGGATTGGGATGATGATAAACACTA
TAAACCTTTATGTGAACATGAAAAATTACTTTTTAGAATTTCCGATGAAACAGGAAAACTAAAATTTGAAAAGATAGGCA
AAGGAAATATTTCCAGAGCCCAAATAAATGAAGATGATGTTTTTATTATAGATAACGGACAGCAGATTTTCGTGTACATC
GGTGAAAAATCAAGTCGGGCTGAACGGCAAAATGCACTTATATATGCTCATAACTACCTAAAGGGAACGGAATATCCTCA
AGCTCCAATATCCGTGGTAAAGAAGGATCTGAAAGGAAATAGTGCTGAGCAATTCAATAAAGTTATTGGGGGCTAATCTT
TGGAATTTTCGTTTCATTTTTTTACTTTGATTAAAACAAACATTTCATACTTTGATTTTCATTATTGTTAGAAATTTACA
AAATCCTTTCTTTAAAAAAAA
>SMED30014981 ID=SMED30014981|Name=Gelsolin|organism=Schmidtea mediterranea sexual|type=transcript|length=1397bp
CTCTTCCGATCTTATCAACTTACTCACATAGATGATAAAATGTTTGGCTGGTTGTTTAAATATTTGAAAAAAAATTGACC
AATAAGAAAAATTTCTGTGCGCCAATTCAATCGATAATTTGCTCACTGACATTTGCATAGTTTTACAGCCGATTTGGACA
GTATAAATACGAATGTCACTTTAGATTAATTTCACTTGTCTTTACATTATCATGAAAAAAGCAGAAAAATACGACTGGAA
GGATTCGAATGTCGAATTAATTGGTTCATCGGAGGATCGCAGTGTTAAAAAATCATCGGCAGACACTGAAAAAGCTTGGA
ATGCTGCAAAAACTTGCAAAACAACCGCTTTGTTTATTTGGAGAATCGAGAAATTTAAGGTTGTTGAATGGCCTAAGCAG
AGATTCGGAGAATTCTTCGAAGGTGATTCCTATATTGTTCTAAATATTTATCAAAAAGAAAAAGAACTACTTTATGATAT
CCATTTTTGGATTGGAAAATATTCGACTCAAGACGAGTACGGCACTGCTGCTTACAAGACTGTGGAGTTGGATACCTTAC
TAGATGACAAACCCATCCAACATCGCGAGGTTCAGGATTATGAGTCTGACATGTTTAAAAGCTATTTTCCAAATATTATA
TATCTAAAAGGAGGTTGCGAAAGTGGATTCCGACACGTCAACACAAGAGAGTACAATCCAAGACTACTCCACGTCAGAGG
CGAAAAGAATAATATAATTATATCTGAAGTTTCGTCGACCAAGAAAAATTTAAATTCTGATGATGTATTCATTTTTGATT
CTGGAAGCTGTATATATCAATGGATCGGAAAAGGTGCTAATAAAGATGAAAGATTCAAAGCTCAACAGTTTGCTCAGCAG
TTGAACTCCGATCGAAATGGGAAACTAAAAATCGAGGTACTTGATGAAGGACAAATGTCCCCAAATCATGAATTCTATAA
TAAATTATCTAACAACGAACCAATTGCTGATGACAAAAACCATAAATCCTTAACAGCTCACGAAAAAAAGCTTTTTCGGA
TTTCCGACGAAACTGGACATTTAAAGTTTGAACAAGTAGCAAGTGGAAATTTCAATAAATCTAATATTCATGAAAATGAC
GTCTTTATTATTGACAATGGGCAAGTTATCTACGTTTATGTCGGAGAAAAGGCAAGTGACAATGAACGGAAAAACGCACT
TATCTATGCACATAACTATCTGAAGGCTACGGATTATCCCCAAGCTCCTATTACCGTTGTCAAGAAGGATATCAAAGGTA
AAAATGCCGAAGAATTCAACAAAGTGTTAAATGGCTGACGACTCAACTTCATATAGAATTTAAATAATTTTACTCTTACA
ATAATTTAATTAAAATTTAGTAATTGTTATTAATAAA
>SMED30025482 ID=SMED30025482|Name=Histone H4|organism=Schmidtea mediterranea sexual|type=transcript|length=552bp
TGTCATTATCAAAATATTTTCAATATATAATAAATCAGAAATCACTAAACAGTCATTACTAAACTATTCTAACTCAAAAT
GTCTGGTCGAGGAAAAGGAGGAAAAGGCTTAGGTAAAGGTGGAGCTAAAAGACATAGAAAAGTTTTGCGAGACAACATCC
AAGGAATCACGAAACCAGCTATTAGAAGGTTAGCTCGCAGAGGTGGCGTGAAAAGAATTTCTGGTCTTATCTATGAAGAA
ACTAGAGGTGTTTTAAAGGTTTTCCTTGAAAACGTAATCAGAGATGCTGTTACTTACACTGAACATGCTAAGCGTAAGAC
AGTCACAGCTATGGATGTTGTTTATGCACTTAAACGACAAGGTCGTACTTTATACGGTTTTGGAGGGCCACAAATGTTGA
TTGTAGTGAATTGTTCAAATATTGTTATTCTATCTAGTAATTCTCAGCAATTTTATTAACGTTATTTAGAAATTAATTTT
ACAATTGCTAATTTCGAATGTTATATCTGGTGTCAATGTTCAGTTATATTATTTTACAAATGACTTGAAATG
>SMED30023018 ID=SMED30023018|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=1084bp
CCGCTCACATATTCCCGACCATGAAAGGAATGTATAAACTGAACCTTGATACCAAGCATACTATAAAACTCAAAGTAATC
GCATCATATTTCATAACATGAAGGCATTCATAATTTTGTCGTTATTCCTTGTTGCTATTGAGGCTGGGCCAAGGAGATTC
ACGGTCAACAGTGAGTTGAATGAAGAATGGGAATTATTCAAAACCAAATTTCATAAACAGTATGAACCGCTAACGGAGGC
TGCGAGAAGAATCATTTGGGAAGGAAATCTCGAGTTCATTAGACAACACAATCTTGAATACGATCTCGGAAAACATTCTT
ACACTTTGGGATTGAATGGATATTCTGATGTCACTGATGCAGAATTTAAGGCCAAACCTTTAGGAAACAGAATGAATGGA
TCAAACCCAAAAGGATCCGAATTTATAGTGACAGAAAACATTGGAGCTTTGCCTTCATCTGTGGATTGGAGAACTAAAGG
ATACGTAATCCTTGTGAAAGATCAACTTAATTGCGGGTCATGTTGGGCTTTCTCAGCCACCGGAGCTCTTGAAGGTCAGC
ACCTTCGAAAAACAGGAAAATTAATTAGTTTGTCTGAACAGCAACTTGTTGACTGCAATAGACCAAATGGAAACTTCGGA
TGTATCGGTGGTTTACCGTACCAGGCGTTTGACTATGTTGAAATCTCTGAAATGGAATTAGAGAAACATTACCGTTATTA
CGCGGAAGCCAAGAAATGTATTTATAATAAATCAAAGGTTGTCGCAAATTTCACTTCATATACTAATATCAAAAAGGAAA
CAATTCTGACTTGGCAGCCGCCGTGGCCACCTTGGGACCGCTGTCTGTAGCTATTGATGTCAGTAGCCGATGTTTCCGAT
TTTATAAAAATGGTATTTACAGTGACCTCCAACGTTCACAATATAACCGTTTTAGTCGTTGGCTACGGATCACTCTTTGG
GAGTAATTATTGGATTGTGAAGAATAGTTGGGCCCAAGTTGGGGAAACGGGCGATACATTCTCATGTCAAAAGACAACAA
CATCCAAAGTGGAATTGCTAGTCAAGCCGTTTATCCAGTTCTCT
>SMED30029163 ID=SMED30029163|Name=Histone H4|organism=Schmidtea mediterranea sexual|type=transcript|length=537bp
AGGTTACAGTTTTTCAACTAATACCTCAAAGAAATAATGAAAGATGGACAGTAGAGTTTTGTCACCATCAGGAGACCAAG
TGTCATTTAGGATGATAATAGCCCAGTTAAGGAATCTTGCTGATCTAATCAATGCCAAAAATATTACAAAATTTCGATTT
AAAAGAAGCTAAAGGAGAAAAATTACACGGAAAAGTTCAGAGGTACAACATCCAAGGCATCCCTAGGTCTGCAATTAAAC
GATTAGCACAAAAAAGAGGTGTGAAAAGAATTCATGGGCTTATTTACAAAGAAACAATATATGTTATCAAGTTAGTCCTT
GAAAATGTCATCTTATATGATATTAAATACACATTGCAAGCCAAGCAAGAAACTTTTACTGCCAAGGATGTTTTTAATAT
TCTTGAATGTTTGGAGTTTTCTATTTTGTGATAACATCCTTCCCCAAATGAAAGTTATCAGATCATTTTGCAAAGTTTGT
GAGAAGGGATATATATTTACCAACAAGAAAAATGTTTTGAATTTAAGAATAGGACTC
>SMED30028676 ID=SMED30028676|Name=Synaptotagmin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1385bp
AAATCAGAAAAATCAAAAAGAAATTTCACAGAATTACGGAACTTATGAAACAGTGAGCAAAGCGCCGCTGGAAATCACAA
TTACAAAAGCAGAGGATAACGAAGGGGTTTCAAATAAAAAAATAATCCTTCAAGATGACCGTCGATGTACTATGCCATGC
ATTTTACCATCGAGCAACAATTCTTCAGATGGATACTCGGAAAGCAATCTAAGTGTAAATGAAAGTTCTGTATTCTCTCT
TAATTCCAATAATCTTTTGCTTTCCGGTCTGATTTCTCCTGCTCGACGATACAGCGACAATTCAAATACGCAAAATTTCG
TTGAGTTACGAAAGAAAAGTGTCCGACCCGATAGATCAAAACGAACTTTCTTCATATGAGATACTGAATTTATACGGACA
AGGTAAACTATGTTTTTCAATAGTTTACAATGAACATATTTCTCGACTCTACGTGACAATAAACAAAGCAGTTTATTTAA
ACAGTTCCAAAACTAACAATCTGGCCGGATTCTATGTGAAAGTGTATTTATTAAATACAGAAAATGATATGAAATTGCAA
ATGCATAAATCGGAAATTGTAACTGCAAATAAAAATCCAATGTTCGAGCAAACATTTTCGTTTCTTTTAACAAAATCCTC
TTTAGTCAGCATAAAATTACAGTTCAAAGTCAAACAAGCACATATAAAAGTAAAAAAAAATGAATATCTCGGAGGATTCA
TGTTTCATCTTGATAATAATGAAATAATTAACAACCCGGAACTCTTTCAAGAATTATGGCGAGATCTGCGGGGCGACTTG
AGGAAAGACACCAGACGTGGAGAAATCCTCATTTCCCTGATGTACAGCGAACACCAATCTTCAGCTTTTCTATCAGTTAA
TCTGCATCGAGCTAAAAATCTACAAATTCGACAACATGACAATTCTGTTTTTGCCAGATGTACAATGTTGGTTGGAAACA
AACCGATCAAAACAAAGCGATCAATTACAGTAAAACAAGACATCTCTGCGCCCTATGTTGATCTTGAAAGTGTTTTCAAT
GTCGACAAATTGAACATCATGGAAGTCGGCGTTGTTATTCATATATGTAGCCGCAGCAAAATAGGTTTCAGTCACCTGCT
GGGCAAGCTGATCCTGGGATCTGTGATGTATACGGACGATAAGTCAGTCCTAATACACTGGAAGGACATGATCAGTTATC
AGAACAGAACCGTCACTAAGTGGCATACGATTATGTGAACATAAAATAACTTTAGACAATTTGTTGGCATGGATGAATGT
TTACAAATCTCATGAAATTAGCCGTTCATAAAAATGTGTTCACAGACTAATGGTAATTTTTAGGCATAATTCGACCATTC
ATTTAAAATTTCGATTAAATCATAG
>SMED30020209 ID=SMED30020209|Name=Synaptotagmin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1588bp
TGCTTGAACGCTGTTGGGCAATTTCATACTGGTTGAATGACTCTCCCAGCTGTATTCTGACCTATGAAAGTTAAATTAAT
ATAGTTATTTGTATGAGATTGTTATATATGGAATTTCCCAGTGAATTGCGCCCAATAATTGGTATCTTGATGGGCCGATC
TCGGTTTGTGGAATAATTCATTTGATTACAAGCTAAATTACCTTGAAATGACAGAAACAAAAATGAAATTTCATGCCAAT
TTCACTGCTTCAACGACCTCCGGTAAAACCTCAACAAATGCTGCAAAAGAAAAATTCCAGGAAATAATTACATATTTGTC
GAAAAAAATGAAAGTACCCCCATGGGCAGTTTACGCAATTGGAGTAGCAATCATACTTGTTATCCTCATAATTTTCTTTT
GTCTCATAAAGATTTGTTGCTGCAAACGACGCAAAAAATCAAAAGGTGGAGGCAAAAAAGGAAAAAATGCAACAAAGAAT
ATGAAAATCATTGGTGGAGCTGTAGATAATAAGACCCAATCAGATGAAGAAGATTTGGTTCTAGATAAAGATGACGATAA
TGAAAAGAAAGAAGAGGAAAAAGAATATTTGGGAAAATTAGAATACAAATTAGATTACGATTTTACAAAAGGAGAGCTTA
CAGTTGGAATTTTGCAAGCTCAAGAACTACCAGCACTCGATATGAATGGGACGTCAGACCCATACGTCAAAGTCTTTTTA
AAACCAGATAAAAAGAAAAAATTTGAAACAAAAGTTCATCGAAAAACTTTAAATCCGGTCTTTGATGAAGTTTTTCTTTT
TAAAGTACCATTTTCAGAAATAACTTCCAAAACTCTTTGTCTTCATATTTACGATTTTGATAGATTCTCAAAGCATGATC
AAATTGGTCAGTTGGAAATTCCATTGGGTTCAATAGATTTGTGTCAAGTTGTGCAGGAATGGAAGGAACTTGAACCAAGT
AAAGATAGTGCTGAAAAAGAAAATAAACTTGGTGACATTTGTTTTTCGTTGAGATACGTTCCAACAAATGGAAAACTGAC
CGTTGTCGTTTTGGAAGCAAAGAACCTCAAAAAAATGGATGTTGGGGGATTATCTGATCCTTACGTCAAAATTTCGTTAA
TGATGAATGGAAAACGAATAAAAAAGAAGAAAACAACAATCAAAAAATGTACTTTAAATCCATATTACAATGAATCGTTT
TCGTTTGAGGTGCCATTCGAGCAGATACAGAGGATTAATCTAATAGTAACGGTTGTTGATTATGATAGAATCGGAACCTC
GGAGCCGATTGGAAGGGTCGTGTTAGGTTGTAATGCTTCAGGGACTGCTCTTCGTCAATGGTCTGACATGCTTGCTAATC
CTAGAAGACCAATTGCGCAATGGCAAACTTTACAAGAAATGCCAGAAAAATAACTTTTCCTATTTTTCCTATTATATGCT
GATAAAAATTTAAATCTAGTCATTCGTTATGTGATTTCTTATTTTTAGACGACAATTTTAATATTTTCATCGTTTAATGT
AATTTTTTCTTAACTTTAAGGCTAGTTTTGGTTTTTAGCAGTCTGTATCAAGTGAATGTGAAAATCTG
>SMED30020956 ID=SMED30020956|Name=Lysosomal alpha-glucosidase|organism=Schmidtea mediterranea sexual|type=transcript|length=2869bp
GTAAAGTGCTAAATTTCAAGATGATGTATAGAGAAAATGAATGACCAAAGTACAAAATATAAAGATATTTAAGTAATAAA
ATTGAATTCCGAACTTAAATTGAAATGTTGAAGTTATTGTTGATAATCTCCTTGAACTTTATAATCGTGTCCAATGCTCT
CCAATGTTCAGTACCGAATAACAATTATAGGCTAGACTGCTTTCCTGGGTCCAATGCAAATCAGAACGATTGTTTGGCTA
GAGGATGTTGTTGGTCACCACCGGAAACCCGGGAATATAGTCAGAATAATCCGACTATTCCATACTGCTACTTTCCAATA
GAATATCCAAACTACCAAATTAATTCATTCACTCCTACCGATCGAGGATTCAAAGCTCGTCTAACAAAACAACAAAAATC
ATTTTTACCGAAGGAAATATTAAATTTGAACTTTGAAGTGATCTTTGAGACAAATACTCGATTGAGAATAAGAATCACCG
ATCCGAATGTGCAAAGATTTGAAGTTCCGATTCAGCTTGGATCTCCTGATCCGACTCCACCTTCAAATGTTCAATATAAA
TTCACAATGCCCACAAATGGTTCTTTTGGATTCGAAGTCAAAAGAAATTCCGACGGATTGAGCTTGTTCAAAACATTTGG
TCCTCTATTGTATTCTGATCAGTTCATACAAATATCTTCTTTGATGTCAATCCAACACGTTTATGGAATCGGAGAACAGA
ATCGTCCATTTCTACATGATTTGTCTACTCAATGGGAAAGAATAGGACTGTGGGCACGCGATAATGGAATAGATACATAT
AATAATTTATATGGTACTCACCCGTTTTATATGTCACTGCCTGATTCTGGAGAAGCGTTTGGAGTTTATTATTTCAATAG
CAATGCACAAGAATTTGTTTTACAACCGGCTCCAGCGATTACTTACCGAACAATCGGAGGAATACTCGATATTTTCATTT
TTTCAGGTGGAACACCGGAAACAACCGTTAGTCAATACACTGAATTAATAGGAAGACCAATGCTTCCTCCGTTTTGGTCT
CTTGGATTCCATCTATCAAAATACGGTTATAAAAGTATTGCTGATGTTTCTAACACTCTGTATAGAAATATTAATATAAG
CATACCAATAGAGGTCCAGTGGTCTGACATTGATTACATGGACAAATATAAAGACTTCACATCCGATCCGATCAAATATG
CAAATTTTGGTTCATTTGTTGCATATCTTAATATAACTTTAGGAATAAGGTATATTGTTATAATAGATCCCGGAATCAGT
ATACAAAGTCCCGGTGCATATTCCCCATATGATGAAGGACTTGAAATGAACTTATATATTAAAGATGCGAATACTAAGAA
ACCTTTAATTGGACAGGTTTGGCCAGGGGAAACATGTTATCCTGATTTTACTCATCCTAATGCTTCAAAGTATTGGTCAA
ATCAAATTCAAAGATTTCATTCTCAAGTACCAATAGATGGTTTGTGGATTGATATGAATGAACCATCAAATTTCTACGAT
GGATCTAGAACCGGATGCGCTCTAAATAATCCGTATGACTATCCATTCTTTGTACCGACAATCAGAGATGGTTCGTTAAT
TAAAAAAACAATATGTTCATCTTCTCTTCATTATAACAATGTCATGCATTACAACTTGCATAATTTATATGGTTACACCG
AGGCAGTAGCGACTCATAGTGCTTTATTGAATACCATTCCAAACAAAAGACCATTTATTTTATCTCGTTCCACATTCAGT
GGATCTGGTAAGTACACCTTTCATTGGACCGGTGATAATTCGGCAAATTGGGATCAGTTAGCCAATTCAATCAGGCAAGT
CCTCAATTTCAACATGTTTGGTATTCCAATGACGGGTGCGGATATTTGTGGATTCAATGGAGATAGTAATGAAGAACTGT
GTATAAGATGGATGCAATTAGGTGCTTTCTATCCATTCATGCGGAATCATAATACCTATGGTGTAAGAGATCAAGACCCA
GCATCTTGGAGTAAAGAAGCTCAGAACATTATGAGAAAAAGTATCAATTTAAGATATGTTTGGTTACCTAACTTTTATAC
ATTATTGGTTAAATCATATTTGTACGGTGGCACTGTGATGCGACCATTGAGTTTCCAGTTTTACAGTGATGCTGAGACGC
ATGAAATTGAGAGGCAATTTATGATTGGTTCCTCGATGCTCGTCAATCCAGTTGTTGTCCAAGGAGCTAGAAATGTTGTA
GCATATTTTCCAACTGGAGTCTGGTATGATGGATACACAAATCAAGTCGTCCATTCAGGACCAATTGGAAAATGGATCAG
TTTAGATGCGCCGATAGATAAATTGAATTATGCAATTAGAGGGGGCTCTATTTTGACAGGATTGTTTCCAGCTATGACCA
CTACGTCATCTCGCAATGGTCCTTGCTTTTTATATTGTGCTCTTTCTCTTAACAGAACTGCTTCTGGCGAATTGTATTGG
GACGATGGAGAAAGCTTCGACAGTTATTCAGGAAATAAATATAGTTATATTACCTTTACGGCAGACTCGAGGGGATTAAA
GGTGACACCTCAATTCGTTGGATTCCGTTCTATTCCTTTACTGGCAAGTATTTCTGTTGTTGGACTTGAAAATTTGTCAA
TCACAAAAGTGTCATTAAATGGAAAAGAAGTTCCATTTATTGTTTTGAACAATTGCTTAATAATTACGACTGGGAAGGTT
TCAATGTCAACTGATATTCATGTAACTTGGCTATAAAATTCGGGAATTTTATTTTTGATTTAATTATTCATTTGTTTAAA
AGAGTCATTATTATGGTTTCATTTTATTCAAATTAAATTGAGTTACTTTCACAGATAAAAATCTCACCT
>SMED30020614 ID=SMED30020614|Name=ATP-dependent RNA helicase dbp2|organism=Schmidtea mediterranea sexual|type=transcript|length=2242bp
CTTCCGATCTATTTTGTTTAACTTTTTCTCACTTTTAAATAAATATTATTAATCCAAAATGTCAGATTGGTCTGACAATG
GAAGAGATCGTTCTGGAAAATACAATGGCAATGACAGAAGTGGTCGTCATGATCGAAGCGATCGTAATGATCGAAGTGAT
CGTAATGATCAAAAGGAACGAGGATTTAGAAGCAGTTATAGTGGTCATAATGATAAATATAGCAAAAATAGTAGAACCGA
AAGAAATGGATTTGATAAAAACAGGAAGGATAAATCTGATTGGAACGACAAATCCAGGCGATCTAGATCTCGTTCACCCT
ATAGTAATTATAGATCGAAAGATAACAAAAAGGATGAACAAACTTTAGAAGTTGTTGATTGGAAAACCCACAATTTAATT
CCATTTCAAAAAAATTTCTATAAGGAGAAAGCTGTTGTTTTGTGTAGATCACCAGATGAAGTTGAGAGATATCGTAAAAT
AAAAGAAATGACTGTTGCTGGGGATGATATAGCAAAACCAATATTCTCATTTAATGAAATTGATTTTGCTCCTGAAATAG
TGTCAGTGATTATTAAAAATGGATGGGTTGAACCAACCCCAATTCAAGCGCAAGGTTTGCCTATGGCATTAAGCGGTAAA
AATGTTGTAGGTATAGCGAGAACTGGTTCAGGCAAAACTGCCAGTTTCGTTATTCCAGCAATTGTTCATTTAAAAGCGCA
ACCTAGATTAAGAAAAGGTGATGGTCCCATATGTTTAATCATTGTTCCTACGAGAGAACTAGCTCAACAAGTACAAGGTG
TTGCAAATGATTTCTGCAAATCTTATGGTATTAAATCAGTGTGTTGTTATGGTGGAGCTCATAAAGGTGATCAGATTGGT
GAATTACGCAAAGGTGCGGAAATAGTAGTAGCTACCCCAGGTCGACTTATAGATTTACTAAAATGTGAAATAACAAATCT
TCATAGAACAACTTATGTTGTTCTTGATGAAGCTGATCGTATGTTGGATATGGGGTTTGAGCCTCAAATCAGGAAAATCT
TTAGTCAAATTAGACAAGATAGGCAGACCTTGATGTGGTCAGCTACTTGGCCACGAGAAGTTCAAAAATTGGCTCAAGAC
TTTCTTGGTAAATACATTCAAGTAAATATTGGATCTAGAGATCTGCATGCAAATCCTGATATACAACAGTTTGTTGAAAT
TGTCGATGAATATTCTAAAGATACAAGATTAATTGAAATAGTCAGGAAAAATGCTTGGGATAAAATGATAGTATTTACAG
AGACTAAGAAAAAGGCTGATAAGATTTGTGGATTACTTAGGTCTAGTGGTTTCAATTCCGGATCTATGCATGGTGATAAA
TCACAAAAAGATCGGGAATATATTTTACAAGGATTTAGGAATAAATCGTTGAATATTCTTGTTGCTACAGATGTGGCTAG
TAGAGGATTAGATGTTGACGACATTAAAATGGTCATCAATTATGATTTTCCTAATCAGTTTGAAGATTACATACATCGTA
TTGGAAGAACTGCGAGAAGTGGAAAAAGTGGAATGTCATATACATTTTTTAATAATAAAAGTGCAAAGAGTGCTTCATCA
CTTATTAAGATAATGGAAGAGGCTAAACAAATAGTTCCTGATAGTTTGTACAAAATGGCTTGTATTCCAAGAGATCGTCG
AAGAACAGACTTTCGTTTTCAACAGCCATTTTCTAATGGATTTTCTCAGCAGCAGTCAAATATATCCTCAATTGATTCTG
GTACTATAAAAAATCATTATACCGATTCGTCTAAGGAATATAATTTTGATAAACCTCACGTGACACCAGTTTCCCAGACA
AACGGAACACCACACAGAGTCAGTAGATTTGGTGATCGTATTACCCAGTTGCCAAGTTCTTTTACTTTACCACCTCCGAT
TGATAGTTTTGTTAATGATGTGCATTGTAAACCGGTTATACAACCACATCATCCTACTTCTAATGGAAATGTCAATGGTG
GTGTATATACGGATAATTTATCTGATTCTAATATATTTAACGATCCCAGATTTAATCACATGGCGTTTTACGGAGTACCT
CCTCCAATATTAAATGGATCTATTAAACCTTTGTCGTTTGAACGAGACTAGTGATTTTTCAATTTGTCATATCGTTGATA
TTATGAAATATTCGAGTTTTGTTTGACAGGTTAGTTCTTCAGTAATCATATTGTTTTTACGTAATAAATGTTGAGTTAAA
TG
>SMED30027646 ID=SMED30027646|Name=Transcription factor BTF3 homolog|organism=Schmidtea mediterranea sexual|type=transcript|length=541bp
AAATTAATTTGTTTAAATAAATTTCTTTAGAATCACGCAATGGACGGTTTTAAAATTAACACTGAAAAATTAGAAAAACT
TAGTAAGTTGTCGGAAAATGTCCGAACAGGTGGTAAAGGTACAATGAGACGAAAGAAGAAGGTCATTGTCAAGAGTTCAG
CAGCAGATGATAAGAAATTAGAGGCAACCTTCAAATCATTGTCAATGAGCCCGGTTCCAGTTGAAGAAGTAAACATGTTC
AAGGATGATGGAACTGTTATTAATTTCGTTAATCCAAAAGTCAATGTGTCACTTCCATGCAACACTCTCTCAGTTACTGG
AAAATCCGAAATTAAGCAATTGACCGAAATACTTCCAAAAGTTTGGCAACAACTTGGCCCACTTAAAGGAGATCTTTTCA
AGAAAATTGCACAAAACATGGAAAATCAAGCAACTGTCGAAGATATTGATGATGAAGACGATGACGTTCCAACTCTCGTC
ACAGACTTCGATCAACAAAGCAAATTGGAATAACTTTTTAATATCAATAAATTTTTTGGAC
>SMED30020435 ID=SMED30020435|Name=Myosin heavy chain|organism=Schmidtea mediterranea sexual|type=transcript|length=3615bp
TCTGAATTTAAACAAAGATATTCAATTTTGGCCGCAGATGTAATAGGGCAAGGATTTATTGATGGAAAACAGTGTACTGC
AAAGATAATGGAAGCAATCCAATTAGATAAAAACAACTACAGGCTTGGATCAACTAAAATCTTTTTCAAGGCCGGAGTAC
TTGCTCAGTTAGAAGACATGCGAGATGAGAAATTATCATCCATTTTGTCTGTATTCCAAGCACAGATGAGAGGATATATA
ATGAGAAAAGCATATAAGACATTGCAAGATCAACGAATTGCTCTTTCTCTCATTCAAAGAAACATCAGAAAATATTTATT
ACTAAAAACATGGCCATGGTGGAGACTATACACTAAAGTCAAACCACTCCTCAATATCGCAAGACAAGAAGAGGAGATGA
AGAAAGCTGCTGAAGAGTTGATTAAATTGAAAGAAGAATATGAAAAGATAGAAAAATTTAAAAAGGAATTGGAAGGTCAA
AATGTGGTTTTGCTTGAGCAGAAAAATGATTTATTTTTACAACTGCAAACAGAACAAGACAATCTTAGTGACGCTGAAGA
AAAGATTCAAAAGATGATCAATCAAAGAGTTGAAATGGAGAACCAATTTAAAGAATTAGAAGATAAATTAATGGATTCGG
AAGACATTCAAGATGAATTGGAAATCGAAAAAAAGAAATTGTTGTTGGATATGGATGAATTGAAATCGGACATTGACGAA
CTTGAAGTATCTTTAGAAAAGTCTGAACAAGAAAAACAAGCTCGCGATCAACAAATTAATAATTTGAAAGAAGAAATTCA
AAAACAAGATACTTCTATCGGAAAAGTTCAAAAGGAGAAAAAGACTCTAGAAGATAACTTAAATCAGACCAGAGAAGCTT
TAAATGCTGAAGAAGACAAGGTCAATCAGTTGACTAAAATCAAATCAAAATTGGAATCTGAAATAGATGAAATGGAAGAA
GCTCTAGAACGGGAAAAGAAGATCCGTGGAGATGTTGAAAAACTTAAACGGAAATTAGAAGCTGATCTCAAATCAAGCCT
TGATAACTGTAATGAGTTGGAAAATATAAAGCAGGAGTTAGAAGAAAATATTCAGAGAAAGGACATTGAAATATCAAAAT
TAAATGTCAAATTGGAAGATGAATCTTCAATTGTCACTCAACTTCAACGAAAAATTAAGGAATTACAAACTGTTATACAA
GATCTTGAAGAAGATCTAGAAGGTGAGAGACAAGGTCGATCAAAATCTGAAAAAGCTCGACAGTTGGCTGAACAAGAACT
CGATGAACTAGCTGACAGACTTGAAGAGCAGGGAGGTGCTACTATGGCACAAGTGGAATTGGCCAAGAAACGAGAAACTG
AATTAATGAAACTTAAAAAAGAATTACAAGATACCAATTTACAGAATGAGCAAATACTCAATGGTTTGAAAAAGAAAAAC
CAAGAAATTACCAATGAATTCTCCGAGCAAGTCGATCAAATAAATAAATCTAAATCAAAAATCGAAAAAGAAAAGGCGAC
TCTTAAGCATGATCTGGATGAATTTGTTTCTCAATTAGAATCTGTTTCAAAGCTAAAGGCCAATACAGAAAAACATTCAA
AACATTTAGAAAGTCAAATTATGGAATTGGAAAACAAAATAGACGAACAGAATCATCAAATATCAGAAATGGTTTCACAG
TCTAATAAAGACTCTCAAGCAATAATGTCTTTAGAACAACAACTAGAACAAGCAGAAAATGAAAATCACCAATTGAGCAA
ATCCAAACAACAATTCCTCCAACAAATTAATGACTGTAAATCGACTCTTGAAGACGAAGAAAAAGTAAAGGCCAAACTTT
TCAATGAAATTCGTAATCTGAATGATGAAATGGGCAATTTAAGATCCAGTTTGGAAGAAGAGCAAGAATCCAAAAGTGAA
ATTCAAAGGTCACTAGCAAAATCCCAATCTGAACTTGTACAAATGAAAAATAAATTTGATAGTGAAGGTTCAGGTCGCAT
TGAAGAAGTTGAAGAAGCTAAACGTAAGTTGCAAACGAAACTTCAAGACATGGAACAAGAATTTGACGCTATTAAAAATA
AATGCGCGCAACTTGAAAAAATCAAAATTCGTCTCACTGGAGAAATCGAAGACATGAGTGTTGATGTTGACAGAGCTAAT
GCAGTGGCTAATCAACTAGAAAAGAAACAAAAGAACTTTGACAAAACCGTCAGTGAATGGCAGTCTAAATGCAACTGCCT
TCAAACTGAAGTTGATGTTGCAAATCAAGAATCAAGATTTTTGTCAACCGAAGTATTTAAATGTAAAAGCCAAAACGAAG
AATTGCTTTCACAAATCGAAAATCTTAAACGAGAAAATAAGTCTCTCAGTGATGAAATTCACGATTTAACGGAACAACTA
AGTGATGGCGGAAAATCTGTTCACGATATAGAAAAGGCAAAACGAAAATTGGAAATAGAAAAGGAAGAACTGGAACAAGC
TTTGGAAGAAGCTGAATCAACATTGGAAAATGAAGAAGCCAAATTACAAAGAGCTCAGTTAGAGTTGAGTCAGATGAAAT
CAGATGTAGAAAAACGATTGTGTGAAAAGGAGGAAGATTTTGAAGGAACTCGCCGTAATCATCAAAGAGCAATGGAATCA
ATGCAAGCTTCTTTGGAGGCAGAAATTAAAATTAAACAGGACTCAATTAAAGCCAAGAAGAAGTTAGAACAAGAAATCAG
TGAACTCGAAGCCAATTTAGATCAAATCCAAAGACTGAAATCAGATGCTGATAAGAACAATTCAAGAATGCAACAGCAAA
TTCATGATTTACATTCAGAGATTGAACAAGAACAACACAGTAAAAACGAAGTCCGAGAACATGCTCAGATGGCTGAAAAG
AGATTTTTATCGGCTAATGGAGAACTAGAAGATTTGCGAGCCAAATTTGAACAATCAGATAGAAATCGTAGAAATGCTGA
ATCTGAGCTTCAAGATTTGAGTGATAAATACAATGAAAGCCAAGCACTGATCACTTCACTTCAAAGTTCAAAAAGAAAAA
TGGAAATGGATTACGTAGCTATGCAGTCCGATCTTGATGATATGTCAAACCATGTTCAACAAGCTGAGGAAAGAGCAAAG
AAAGCAGCTGGTGACGCTGCCCATATGTCAGAACAACTTCATCAAGAACAAGACAATAGTTTGCACACGGATAAAATGAG
GAAGCAAATGGAAATTCAAATCAAAGAAATGCAGTGTAAACTAGAAGAAGCCGAAAGTAATGTTTTGTCAGGCGGCAAAA
AGACTTTGGCAAAGTTAGAGTCAAAAATACGAGAATTGGAAACTAATCTTGATAACGAAATGAGAAAACATGCTGAAACT
CAAAAGAATTATCGCAAAGTAGATAGACGAATGAAAGAACTAACATTACAATTGGAAGACGATAGAGCTCAACAAGAAAA
ATCAAATCAAGTTATTGAAAAATTCCAAGGACAAATCAAAACCCTTCGAAAACAATTAGAAGAATCAGAAGAAGTTGCCG
TTTTGAATATTGCCAAATTTAAGAAAGTACAATGTGATTTTGAAGAAGCCGAAGAAAGAGCGAATGAATCGGAACAAGCT
TTACAAAAATTAAGA
>SMED30019754 ID=SMED30019754|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=1366bp
ATTTAATTTGCTCTATTTTATTTATCAGTAATTTGTTTATTCAAAATATATAATTAACATTGTTTTGGACATCTGTTATG
AAGTTAGTAATAGTTTGTGTTATTCTCTGTTCAGGCCTTGTTAATTGTAATCCAATAACTAAGCTTTCTGACAATGAAGA
CAATTTAATTTTTGATTCAAACCTTTCTAATTCCAAGTCAAATCATGATCATTTTATTGTCAACTTTGGTCAACTAATTA
CTTATGATTCCAAGTTAGTAAAAGAATTGTCGAATTTATTAAATGAATTTCTACAACTCCCAACAATTGAGTTTATAAAT
CAAATAAAAATAGAATGGACAAATTTTAAAGTTAAATTTAAGAAAATTTACAAAGATGTTAAAGAAGAATCTGAACGGTT
TTTGATATTCTTAAAAAATTATCTCAAAATAAAAAGCCACAATTTAAAATTTAATTCCGGAACAGTTCAATTCAATATGT
CAACTAATCATTTATCTGATCTAACTGATTCTGAATATTCAACATTATTGGGCTTTAAATTTGGAAAGCGTAAAGATGGG
CCTTCGTATTTGTCACCTATGTCTCGCGTAATGTTACCGAACCAAGTTGACTGGAGATTAACTGCAGTTACTCCAGTGAA
AGACCAAGGAAATTGTGGGTCATGTTGGGCTTTTTCTGCAACAGGCTCGTTAGAAGGTCAACATTATAGGAAAACGAAAA
AACTTATCAGTTTATCTGAACAGCAATTGGTGGATTGCAGTCTAGATAATAGCGGTTGCAATGGTGGGTTAATGGATCTG
GCTTTCACATATGTCAATGATAATGGGGGTATTGACAATGAGCAAGCCTATCCATATACCAGTGGGAAAACCGGACGAAG
ATCTGCCAAATGTAATTTTACTATACACAATATTGGCGCAAAGGATTTCGGATATATTGATATTCCTCAAGGAAATGAAG
TTTTGCTTAAAGAGACTGTGGCATTGATTGGTCCAATTAGTGTTGCTATTGATGCTAGTCAATTCAGTTTCAGAAATTAC
CATTCTGGTGTTTATGAAGATCCCAATTGTAGTTCTGTAGAACTTGATCATGGTGTATTGTTAGTAGGCTACGGAATCGA
AAAAGAATCGAACATTCCATATTGGTTAGTTAAAAATAGTTGGAGTACAAATTGGGGAGATTCGGGTTACATAAAAATGA
GACGAAATTCTAATAACATGTGCGGAATCGCTACAGCCGCTTCATTTCCTATAGTGTGAAAGTCTGTCATATTTATTATT
GTTCATTCTCATGATATTCTGTTCATGTTTCAATAGTTGTCCATATCGTACTCTACGTTCTTTTTTATATAATAAAAAGT
TAATAT
>SMED30017650 ID=SMED30017650|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=1091bp
GATGGGTCCTATCTTGATATGTTTATTATTAGCAGTGATTTCAGAAGCCAGAACCACTTATAGCCATCACAAATCAGTTC
CAAGTGATGACATTTCTAGTAAATTTGAACTAGAAAATATGGTATCTCTCTTGTCCCGTTACGATGGAGAATTCCAAACC
TTCAAACAGCGATATAATAAATCTTATAGTTCCATGCATGAAGAGAATTCCAGATTTTTAAATTTTATATCATCTCTACT
TGAGATCAATCATCACAATCAACTTTATGAAAACGGTCAGAAATCATACGAGATTGGAATCAACCATTTGAGTGATTGGA
GTGGCGAAGAACTCGCTCAACTGACTAAATTGAAACAATCAAACCTGACGGGCTCATCATATCTATCATCCAATGTGAAA
ATTGACCTTCCAGATTCATTCGACTGGAGAGAGAAAGGTGCAGTTACTGAAGTAAAAAACCAAGGATTTTGTGGATCATG
TTATGCATTTGCTACTACTGGCACCCTAGAAGCCCAAATCTGGAGGAAGACTGGGAAATTGATCAGTTTATCAGAACAAC
AAATTGTTGATTGCGATACTAATGATGATGGTTGTGATGGCGGATTTGTGCAAGACGCGTTATCATACATCAAGTCAAAT
GGAGGCATTGAAAATGAGGAAAGTTACCCTTACATATCAAGTGAAACATTTAAACCTAATTCTAAATGCAATTTCTTCAA
AAGCAAAGTAGTGGCCACCGACACTGGATTCGTTCAAATGCCAGCAAATGACGAAACAAAAATGAAAGAAGCTCTAGTTA
CAATTGGGCCTATTTCAGTAGCAATATCTGCAACCAAATCGCTCAAAAGATATACAAGTGGCATTTTTCATGAGGATGAA
TGTGACAAACTAAAACTTAATCACGCTGTTCTGATAGTCGGATATGGAACAGATCAAACTTCCGGGACACCATATTGGAT
AATTAAAAATAGTTGGAGCTCATTTTGGGGAGAAAATGGATATTTCCGGTTACCCAGAAATATAAATGCTTGCAAAGTAG
CGATGATGCCAGTTTATCCTTTGGTTTGAATTGATAAAATTTTGTTCACAC
>SMED30022586 ID=SMED30022586|Name=Synaptotagmin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1214bp
TCACCATCTTGTCTTTGATGGGATAGTTTGACTAATTTTTGGTTTTGATTGGTTCTCTTAATTGGGAATGCAAATTTTAC
GGTGCTTGCACTTATGACATGGCATTATTTGCAGAATGAGTTTTCAGAGGCTGTGTGGAGATATTATAATAAAACTTTTG
GAAACTTGTTGTTTTTGTTTTCATTCAGAAACTGAAGAAAAAGGGAAACTATACATCCACGATAGAACATCTCCAATGAT
TTTAAACCAAAAACCTTCAATTATGAATCAGGAAATAGAGATAAAAAATATTTCATTGAATCTGCAGACGGAAAATACAT
TAAATCCAAGAAAACAATCTCTTGGAGGCAATTTTCTTGTTCCAAATGCAGGGTTAAATGAAAAACTTCCTTCAGTAATT
AAAGTAAAACGACATTCGGAATCGGATTTGGGGGACATGAATTACAATTTTCCTGTTGAAATTAACCATAACCACATTTT
GAACGTTTTGTCTATTAAAGTTTTTCCAAACGAAAAAATTCCTGATAAATTTGATATTTCTGTGAAAACTAATGACAAAA
TCACCAAGAAAATAAGCTACTTTTACAAAGTTATTACATTTGACAATATAAGTGAAGATGATTTAAATACATCTTTCCTG
AGCTTGACATTTTATAAGAGAAAAACGCCAGATGATAAAAAAAGTTTCGGAGAAATAAAATTTCCTCTAAAGTTAATATT
GAAGAAAAAAATTCAAAATTCAATTAGATTTTACAATACAGATTTCAATTTATTTCAAAACAATGTGAAATTATCCAACG
GAACGCTTGAAATCGGTTTACGTTTTGATCATAAAAACACTCAATTAACGGTAAATGTTTACGAAGGACAGAATTTTTCA
AACCAAAATCAAACCCCTTTAAATACTTTCTGTGTCGTTGAATTATTTAAAACACATACCCTCTATATGACCTACAAAAC
CAGTGTCAAATTCAATTCGAATTGTCCGATTTGGAATGAAACTTTCATCTTTCCAATTAAGCTTGCCGAATTGGCTAATC
ATATCAAACTGATTATAACAGTCTACAATGAAAATGAAACGGCAAATCTACCAATTGGAAAATTGTTTTTCCCGTCTTCT
GAAATGGCATTGGAAACTCGTCATTGGAATGAAATTCATACAAATTCCAACCTACAAATCAGAATGTTGCATAGCTTAAA
ATGACATTTAAATA
>SMED30010096 ID=SMED30010096|Name=TPA_inf: prohormone convertase 2|organism=Schmidtea mediterranea sexual|type=transcript|length=2542bp
CTTTGTTTGTAACCAGACTGAAACTGGATATTGTTGTCATAAAAAAATGAAAATTTTGAACCAATTAAATTCCATTGAGT
AACTGAAAACAAGATAAAAACTAGGAAAATCGTTTTTATCGTGAACGAACAAACAAAACAGATCATTCATTGTGCCCCTT
TACAATTCATTCTCACTTTGCCCTTGTGTCTGTGCGTGTGTGTACGCGCGCGCGTGATGACGTCAGCACAAATAATTGAT
GCTCCTGAAGAAATAATATCGATCGATTCTCTCACCGAGTCCAGAGCATGCATATTATTTCTGCAAACATAAAGAATTAT
GTGTAGGTGGGATGCAGATAAAATACAAACAACGACTTTCTATAAAATTTCTGGAAAATTTCTATCGAATCTACTTTTTC
ATTAGATTTGCTATTTTTAGATGAAGATTACATGGATCCTTTTGTTTCTATGCGAATATGTAGTTTGTGGAAAAATTGTC
ACCAATCAATGGCATGTCCACCTTCATGATCCTGCAACTCAAGAATCGGCAAATAAAGTAGCTCAGGAAACTGGTTTCTC
GGTCTTACGAAACCATCTGAATTCTCCAAATGAATTTGTTTTCCATCACAAAACCGTTCCTCACGTTAGTTCAGTTCCAA
GTTGGAGTCAACACAAAGTTCTATTGGCTCACCATCTTGTTAAAAACGCAAAACAAGTTGAAGGGTTTTTGAGACGAAAG
AGAGGCTATAAGCCAATTAAAAAACAAGGTCGTGTCCCACTGCCAACGATTAATAAAAAAGGAATTCCCGGCCTGGGAGA
GTCTGACAACATTAAAGTGGATTTGAAATTACCTACTGATCCTCTATTTTCTAAAGAATGGTACATCAGAAATACCGGTC
AAGCTGATGGAGTGAAAGATCTTGATCTTAATGTATTATCAGCGTGGGCTCAAGGTATAACCGGCAAAGGGGTCACGACT
GCAATCATGGATGATGGAATAGACTATCTTCACCCGGATTTATCAAAAAATTATAACGCAGAAAGCAGTTATGATTTCAG
TAGCAATGACCCTTACCCGTTCCCTCGATATACTGACGATTGGTTTAACAGTCACGGAACAAGATGTGCCGGTGAGATTT
CCGCCGAACGTGATAATGGCATTTGTGGTGTTGGAGTGGCATACGATTCCAAAATCGCTGGGTTGCGCATGCTAGATCAA
CCATATATGACAGATCTCATTGAGGCAGCAGCTATGAGTTATGATCGAGACAATATTGACATTTACTCTGCTAGCTGGGG
ACCCACGGATGATGGAAGAACTGTAGATGGGCCGAGAAATGAAACGATGCGCGCTATTGTTGAAGGTGTAAATAAGGGAC
GCAAAGGCAAAGGAAGCATTTACGTTTGGGCATCTGGTGACGGTGGAGCAGCTGACGATTGTAATTGCGATGGATATGCT
GCCAGCATGTGGACAATAAGTATTAATTCAGCAACCAATGATGGAGAAACCGCAAGCTATGATGAATCCTGTTCTTCAAC
ACTTGCGTCGACATTTTCTAATGGTAAGGCATGGTTTAGCCTTGACGCCGGTGTCGGAACTGTGGATTTATATGGCCAAT
GTACTCTACATCATTCGGGAACTTCTGCTGCTGCTCCAGAAGCAGCTGGAGTGTTTGCTCTTGCTCTTGAAGCCAATTCG
AATATTGGCTGGAGAGATATGCAGCATTTGACAGTGCTTACGAGTAAACGAAATCATTTGCATGACAGAGATCGACGCCA
TAATTGGACCATTAATGGAGCGGGTTTGGAATTCAATCATCTTTTTGGATACGGAGTACTCGATGCTGGTGACATGGTCC
GAGTTGCTAAAAAGTGGGTGAATGTACCAGAACGATTTCACTGCATTGCCGGACAAATCGATAAGCGTTATCGATTCAAT
GTAACAAAAGCTTTAATATTGGAAATTGATACTGACGCGTGCAAATCAGATATAGGTCATCGAGTGAATTATCTTGAGCA
TGTCCAGGCTTTTGTTTCAGTTAAATCTAGTCGACGAGGAGACATAACAATGTTTTTAACGAGCCCCATGGGTACGACTT
CTATGATTCTCAGCCATCGACCAAAGGATGACGATTCCACAAGAGGATTCACCAAATGGCCATTTATGACCACTCATACA
TGGGGAGAAAACCCTCGCGGAAAATGGAAACTGACAGTAATGTTCGACACGAAAGATCCATTAAGTCAAGGAATATTTTC
TGAATGGGTGCTCGTGCTTCATGGAACACAGAGTCGACCCTATGACAAATTGTCTAGTTCACTAGAGAAAATCATTCCTA
AACTCGGTGTAGTAAAGAGACAACATGCCTCTAACAGATTTTCACAATAGTTGTTGAACTTGATCTTTATTTAGTATTGA
TAATATTTTTTGTCTTTGACCGCGACTAAGCAGTGCTACTGCAGATTTTGTGATCGTATTTTTGTAAACTTTTGTCCAGT
AAGATTGTCGTATCTTATTGTTATTATTAATTTCACTATCATTTCATCAACAGGATTAATAA
>SMED30023593 ID=SMED30023593|Name=Netrin-1a|organism=Schmidtea mediterranea sexual|type=transcript|length=1962bp
GATCTTGAAATTCTTTTTAAAATTTCTAATCTTATTCATTGGTCTTGTGGCCTTAAATGGAGAACTGCAGACCTGCTACA
GTGCCAATGGAGATCCTAAACCTTGTGAACCATTATTAATAAATTTGGCTCAGCCAATGCATATTGAAGCTAGCTCTACG
TGTGGAGAAAACGGAGCGGAAAGTATTTGTACAGAATGGTTTGACAAACTAGGAAAAGCTCATAAGTCCTGTGAGAAATG
CAATTCTTTAGATCCTAAATTATCAAAATCGTCAAAAATGGTGGTTGATTCACATATACGAGGCAAGGAGACTTGTTGGA
TTTCAGAAGGTGTTCATGAAAGTAGTTATCCAACTAGCGTTAATCTTACATTGGGTTTGAAAAAGAGGTCATTAATATCA
TTTATTACTGTGGAATTATGTGGTCACAACCCGGATGGCATTATTATTTATAAAATGGACAGTGAAACAGATGATTGGTC
TCCTTGGCAATATTTTGCTAAAGACTGTCAACTGACATTTAAGATGCCGGCTTTAACAACGGATACAGTTAATACTTTTT
CCGATATAAATTCATTGAAACCAGTTTGTTTTGATTTGGAAAAAAGTATGGACTATGGAGGAGATGAAAAACTATTCAGA
CTTATCCCATTCAATCCAAGACAAGGCAGAAGTTTTGGAGATGTATTATCTAAAAATGAACAAAACTGGTTGGCAGCTAC
AGAAATACGAATCAGTTATATTCTAACTCCTAAAGAACATTACGGAAATCTGCTGTTGAGAGAAAAGCGAAATGCAGAAA
ATCCTGTTTATCATTTTGGTTCATCTGATATAATGATTGGTGGGCAACCTTTATGTCATGGACATGCTTCGAGAATAATC
AGAACTTCGGATGATACTTATCAGTGTGAATGTCAGCACAGTACTGCTGGAAAGGATTGTGAAAAATGCCATGAAGAATT
CAATGATCAACCGTGGAGTTCAGCAACGATTCGAAACCCAGCGGTTTGTAAAAGATGCGAGTGTAACAATCATTCGATAA
AATGTGTATTCGATTTTAATGTTTTCCTGAAATCTGGTAGAATTCATGGCAGTTCTTGCATAGATTGTGGTGATAACACT
GTCGGCCCTCAGTGTGATCAATGCGCTCCCGGATATTTCCGGCAACATGCTTATCCTATTTACCATAAAAATGCTTGTAA
ACCTTGCTTATGTCATTCAGTTGGATCTCTTTCGGGTACACCCTGCGATCAAGTAAGTGGGAAATGTTTCTGTAAGCCTG
GAGTGACTGGGAAAACATGTACCCATTGTGCACCGGGTTATAAACAAACAAATTCCCTAAAGAATCCTTGCAGAAAGATA
TCAAAATTGCGTCATTTAGTGAAATCAAATTCGAGTTGCGATTTTTGTCAAAGGAAAAGTAAAAGAATTAATTTTAAGAG
ATTTTGCAGCAAGGAAACAAATTTCAAAGTAAATATCAAGAGTAGAGAATCAAGGGGTCAGTGGATTCGGTTCATTTCTG
AAATCGAACAGGTCTGGACAAGAAATCAACAAGATCCCCGAGTATCCCAACTTAATCTAGAATCTAGTGAAGGGACTTCG
ATGTGGGTTCATAAAGATCTCGTGGACTGCGGTTGCGTTGATTTTGAATTCGGTCATTCATATTTAGTCATGGCCAATGT
GAAAACAACGGAATTTATGGGCCAAACTGAACTTATTTTAAACCAAAGTGATGTAATTGAGGATTGGAAGGAGACATGGG
AGGAGCAATTTTCTCAGTTTTATACCCAGGATAAAATGGGAAAATGCAATCGGTTTACTCGACAAAAGCGACACGTCAAG
AGGCGTAATTTTGCCTCAACCTATAACCAATATGCTATCTATTCCTGATCATTTGGACCCGGGATTAATTTAATTAACAT
TTTATCTAGCAGCTGAATGTGATGTCTTATTGTATTTATAAA
>SMED30030773 ID=SMED30030773|Name=ATP-dependent RNA helicase dbp2|organism=Schmidtea mediterranea sexual|type=transcript|length=1968bp
TTTCTTTAAACGCATTATTTTATTTAATATTTTAACTTTCCATTTACAATAACAATAATTTAAAAGATGAATTATAGATA
CAGAAGAGAAAGATCTCGATCTCCTATTAGCAGATTTGGAAGTAAATTTCAAAAGAAACAATTTGACTGTGAAATTACTA
AAATAGATTGGCCTACTATTAGGCTGATGCCATTTAAAAAAAACTTTTATATTGAGCACCCAATTGTGACTGCTAGAAGC
TCATACGAAATAGACAGATTTAGAAATGAAAAAGAAATGACAGTCGTTGGCAAAAATGTCCCACGGCCGATATTTAATTT
TAGTGAAATGAATTTTCCAAATTTTATTTTGACCACAATATTAAAAAATAAATGGGTTAGACCAACACCAATTCAGTGTC
AGGGTTGGCCAATGGCAATGAGTGGTCGAAATGTTGTTGGAATAGCACAAACAGGATCTGGAAAAACTGCAGCTTTTTTG
TTACCTGCTTTAATTCACATTCGAGCACAGCCGCCTCTTGTAGCTGGTGATGGTCCAATTTGCCTAGTTCTTGTGCCTAC
CAGAGAATTGGCACAGCAAGTTGAATCAGTTGTAGAAGAATTTGGCATATCAGGTGGATTCAATATGGTGTGTGTTTACG
GAGGCTCTGATCGGCAGAATCAAATAAAAAATTTACACACTAAACGCCCAGAGATATTAGTTGCTACACCAGGGCGCTTA
TTAGATCTCTTGAAACAAAACGAGACTAATCTAAGACGAACTACCTATTTAGTCTTAGATGAAGCTGATCGAATGCTCGA
TATGGGATTTGAACCACAAATACGCGCAGTTCTAAATCAAGTAAGACCTGATAGGCAAATGTTACTGTGGTCTGCAACCT
GGCCATTAGAAGTCAGGAGGTTGGCTGAAGATTTTTTAAATGAGTATATTCAAGTTAATATTGGGGCTATGTCATTACAC
GCCAATCATAATATCTGTCAGTATGTTGAAGTTATTGACGAATTTGGCAAAGAGCGTCGATTAATTGAGTTACTTAAACA
ATTTAATGGTTTGAAAACATTGGTGTTTGTCGCTCTAAAGAAAAGATGTGATAGAATGTCAGATATGTTGAATTCTAGAA
GCTTTAAAGCCTTAGCCATGCATGGAGATAAGCCTCAAAGAGAAAGAGAACGCGCACTTGAAAATTTCAGAAATGGTAGA
TCAAATATAATGGTTGCAACAGATGTCGCTTCAAGAGGATTAGACATTGATGACATAATGTTGGTAATAAACTATGATTT
TCCAACACAAATCGAAGATTATGTACACAGAATAGGCAGAACTGCCAGACAAGAAAAGAAAGGAACATCTTATACATTTT
TTACAAATAATGAAAAAAAACATGCTCAAAAATTAGTTTCAATTTTGGAAGAAGCTACTCAAAATATTTCGGATAAACTA
TATGATTTGGCGGAAGTTCCGTATTCGAGTCGCAAGAAGTCCACTGCAAATGTACCCAAAGGATTAGTAACAGGTACTCC
TGTAAATAACGATTGGGTAGATTCCGTTACTAATAAAAGAATGCCCAATAAATTTAATGGCGGTATTTCTCGTGATAACT
TTTCAAATGTGGAAAGCGATCATAGAAAGCCAGATTATTTTAAATATAATGGCAGACCGGAAGAAATAGAATCGTTTCCT
CCGAGTAATACTTCTTCATTTAGAGATTCCGGAAATTGGAGAAATAATGAGTCTTTTAATAATTACAACCAACCACAACA
GCAGCAGCAACATCAGCCTCCCTATACTAATAATAGCAATAGCTATAATTCAGCCAAAACTTTCAATTATAATGATGATT
TCAATTCTGTAGGAATCATTGCTAATAGATGGTAAACTTAGCTTATATGTTCTTGTTATATGTTGTAGTTTAAACTTTAA
TTGTAATCAAATTTGTTGTAATTATTTTAATTATTAATATTATTCTTT
>SMED30007290 ID=SMED30007290|Name=GATA456|organism=Schmidtea mediterranea sexual|type=transcript|length=2033bp
AGGTAAGTGTCGTCATCACAAGTGGCTTTATTATTATCATTTAAATTTTTTATCATATTATCATTGATTGCTTGTTTTCC
TCATTCAAAATTTAACTGATTGTTATCAAGCTCATTTGATAACTCCAAATCTAATTGACACTCATGTAAATATCCCATTC
GAATTTCCGTTCCCGTCCGTAAGATCCACGATCCGACAATGTTTCTCCCATCGGTATTGTCGAATTCTCACCAGAGAAAC
TCACCAATAATGGACATTGTATCACCAAAATCCAACACCAGCAATCTGAATGCGTTGATCACGTATTCGAATTGTCCCAA
CATAGATCTACAGTCGAATGATCTGTCAGTGAACTTGACGAATTCTCAAAACTTCCACGAATTGGATCACAAAACCAATT
ACGGATACAAAGTTTCAAACAACGAGACAAAACTGAATGCTTTTCCATATTTAGCTCAATCGAACTTAACAGATTGCACA
ACAGACATCAGTGGAGATCTGAAAAATCCAAATTCACATCTCAACTATGGAAACGGAATTTCGTTCTCGGAATTTTCGAA
AATGTCCGAAACCAACATCCACGGATATCCGCCATATTGTTTCTCCACTAAACTGTTTCCCATTCCAAATCTACAAGAGA
AATCAATTATCAACGACAACTATTCCGTGAAATCCACCGCCGGAGGCTTTATCACCGAATCGAATGAGCATCAAAACTCT
GTAAATACTGGAAATTCCTACAATTCCAATTTAAGCTCATACAGAACGGTAATTCCCGCTCATTTTCATCTCTTCAATCA
GAATTCACCAGAATCGAACTCGTTTTACAATACGGCTTGGAACAACTATCCGTTTCAAATATCCCCAACTTATCCCATAC
AAAATCTACCGGATTCAACAATCAACTGGACAACAAACAATCAAATTCCAAGCAGCAATTTAGTTTTTGATCCCTGGAGC
TGTAAATCAAATCTTAATCTTCCTCCGATTAATGAATTCGGTTCCAATTGCGATGTCAGCAGAGAGTGTGTGAACTGTGG
AGCTAGCAATACTCAGTTGTGGTCCCGGGATAATTCTGGCTATTATTTGTGTGATGAATGCGACAGGTTCTCTCAAAACA
ACAGTAGAAACCTCGAAAAACTACCAACGAATCAAGTCTCATCAAGTACCGAAAATGAGTTCATGAAAAAATCCAATGCC
AACTTTCAACAATATGGAAAAAGATCCGACCTCGAATGCAGCAATTGTAAAATTACCAAGACTTCTTTATGGAGAAGAAA
CAACGAAGGAGAACCTGTCTGCAATGCTTGCGGCTTGTATTATAAATTACATAAGTCTCTAAGACCTCTTTCAATGAGGA
AAGAAGGAATACAAACAAGGAAAAGAAAACGGAAAACACAAATGAAACCGGTTTCCACTCATATTGCCAATAATCAAAAG
GTGCCGTCTTCAGAATCGTCATCAGAACAAAATCAGTTTATAAACACTGTGAAATCAAGTGAAAATTGCTATAACATGAT
TTCTGAAAATTCTCCAACATATATGCCAAATATATCAGTCCAGCCCTTCAATCACATTCTGAACTCCAGCCAATATCAAT
TCCAATCTACAGAAAATCCCATTAATCAATCATATTTAAATTCCTCAATCAAAAACAGCAATCCCTTTTACGATTCCGAA
AGTATACTTTATTCCTACAACAATTCAAACAAAATCAAAGATGAGCCCCTATTATCCATGGACAACGAACCGAAGCCCTA
TTCCTCAATCAACGAGAAAATTGACGTCAACTCCATAGTGAGAATTAATGAAATCTCAAACAATTCGAATTCGAGTTAAT
TATTCTGATCTACTTTTTAATTATATATTTAAGAACCGTATATACTTCGAAATATAATTTTAATGATAAAATTTTATATC
TAAAAAATGTAATTTTTAAGTGCGAATTATTAAGTATGCATTTAAATAGTGCAATTATTGTGGTAGTTATTTTTATTACT
AAATAAATGTTGTTTGTAAATTCGAGAATTTGT
>SMED30011059 ID=SMED30011059|Name=Cysteine-rich secretory protein LCCL domain-containing 2|organism=Schmidtea mediterranea sexual|type=transcript|length=824bp
AGTAAATAAAGTCAATATTTTAAATTATTTATGCGGATGAATTTTCAATGCCATTTATGCATTTTCTTTTTACTAATTTT
CGGGAAAAGCTTAACTCTATTGCCAGAGGATCAACAAGCGAGGGTCTTGAGGAAAATAAATGTTCATCGCAACAATTTCA
ATCCAGAAGTAACAAATATGATTAAAGTAAAAACAATGCGCCACCTTGTTGTAATGGCAGAAATTTGGAGTCTAAGATGC
ATAATAGAAAATTATACGGATAAATTCTTTGAATATTCTCAGTACAATGTTCTTGTTTATTATGAAGAAATTCCGCAAAA
CGCAAGATTCGAATTAACGAATGCGTTATTATATTGGATTGGCAAAACGAAACTTCCTTATTGTGCTTTAGATCATTATG
AATTAGAATATTGTGCCGATTTTTTTAAGTATCATGCAGGTGAAAGCGAATATGTCGGATGCGGACAGAATTCCTGCCCT
ACTACAAGACCTGGCTATAAAGGGATATTATTCACATGTTTATATTATCCCAATGCAATGAAACCACGGAAAAAAATAAG
ATATGGTCCAAGATGTTCAGAGTGTCCAAAGAAATATCCATTGTGCGAAAATAGACTTTGTTATAATGAAGCACCCGTTC
TGAATATGACAGAAGAGCCTGACAATAATGAAAGCATGAAAAAACATCTAAATTATTATTTATTATGCTTTATTACTATA
TATTGGATAATTACTAAACTTAAATTTATTTTTAATCGAGTGTGACAGAAATGCTTATTGGGAGGCATAATTTATTATTT
TTAAAATGAAATGTTTTATTATGA
>SMED30008458 ID=SMED30008458|Name=Lysosomal alpha-glucosidase|organism=Schmidtea mediterranea sexual|type=transcript|length=3017bp
ATTGTTATGCAAAATTATTTTAGCAAAAATTCCGATAGGTTTTATCTAATTAGTAATTAAGTAGATACTTCATGCTCTTG
AACTTGATTTTATTTTAAAATGGAGGTGTGTCGCTGATCTGGAAAAGTTTAATTTCAAATTATCTTTAATTAGATCATCA
CACCTATTTTAGTTGTTGTAGAGAGTCAAAGTTCAGCTTTTAATTAATATATATTCAATTAAAAATTTGCAAAAAATTAT
TTCCATTTCAAATGAAATTAATAATATTAATAAGTTTTATTAATTTGATTTCGTTATTCAACTTTTCCAACGCGACAGCA
CAATGTCAAATAGCCAATAACAATGAGAGACTTGATTGCTACCCAGAATCCGGAGCCAATCAAGATTCATGTATAGCAAG
GGGGTGTTGCTGGTCCGAACCAATGAGATTGTCCAATAAATTGCAAGGTGTTCCACTATCAATCCCATATTGCTATTATC
CAACTGATTATTCCAACTATATGATTAAATCCTTAAGAAAATCTTCAAGAGGGATCAAAGCAAAATTAGTCAGGGAATCA
CCAAGTTATTTACCCTATGAAGTTGCAATGTTAGATCTTGAGGTAATTTATGAAACAAAATCTAGAACTCGAGTCAGAAT
AACAGATCCTAAACAAAAAAGATATGAAGTTCCAATGAAACTCAGTCCTCCAGATTTGAAGCCACCGACTGATCGAGAAT
ATGAAGTCATAATCCCATCTGATGGTTCATTTTCTATTGAAATTAAACGAAAATCAGATGATCGTTCACTTTTCAAATCA
TTTGGGCCACTTTTATATTCTGATCAATTTTTACAAATATCTTCAATAATGTCAACTGATCAAATCTATGGAATAGGAGA
ACAAAATAGACCCTTTCTTCATCAATTATCCAATGGCTGGGAAAGAATTGGATTGTGGGCAAGAGACAATCCGATTGAAA
CATTTATGAATCTTTATGGAGCTCATCCATTTTATATCGGTATGCCAGACGATGGAAAAGCTTTCGGTGTTTTTCACTTT
AATAGTAATGGTCAAGAATTCGCTTTACAACCGGCACCAGCAGTAACTTATAGAACAATCGGTGGAATTTTAGATTTCTT
TATTTTTACCGGAGGCAGCCCTGAAGAAACAGTAAAACAATACCTAGAATTGGTAGGAAAGCCAATGCTTCCTCCATATT
GGTCTCTTGGATTCCATCTGTCAAAATGGGGTTACAAAAATATTGAGCAATTGTCTGAAATATTTCAAAGAAATATTAAT
GCCGGTTTCCCAATCGGTACTCAGTGGAGTGATATAGATTATATGGAAAATTATAAAGATTTTACTGTCGACAAAGAGAA
ATTTAATGGATTGGGAAGATTTGTCAGAGAGATTAAACAAAAATATAACTCTAGATTTGTTGCAATTGTTGATCCAGGAA
TAAGCTGCACAAGTGGTAACGAATATCCACCTTATTATGAAGGAGTATTTATGGATATTTTCATCAAAGATTCACAGACC
AATCAACCAATTGTTGGCAAGGTTTGGCCCGGAGAAACAGTTTATCCAGACTTCACTCATCCGAACATTTCTATGTATTG
GTATAAACAAATTCAACGCTTTTATAATGATGTTCCAATTGATGGGCTTTGGATTGATATGAATGAGCCATCTAATTTCT
ACGATGGTTCCAAAAGAGGCTGTCAAGGAAATAGTAAATATGACAATCCATTTTTTGTACCGGATATTCGAGATCAGTCA
TTAATATCTAAAACTATTTGTTCTTCAGCACTCCATTACAATAACGAAAAGCATTATAATTTGCACAATCTCTACGGCTA
TACGGAATCAGTAACAACAAATAAAGCATTATTAAAAACGATACACGGAAAAAGACCTTTTATTTTATCCCGGTCAACTT
TCAGTGGATCTGGTAAATATACCTTCCATTGGACCGGGGATAATCAAGCAAGTTGGGATCAGTTAAGAAATTCCATTAGA
CAAGTGCTTAATTTCAACATGTTTGGTATTCCGATGACTGGTGCTGACATTTGTGGATTTAACGGTAACAGTGATGAAGA
ACTCTGTATTAGATGGATGCAATTGGGCGCTTTTTATCCATTCATGAGGAACCACAATGCAATCAACCAGAGAGATCAAG
ATCCAGCTTCATGGAGTATTGAAGCTCAGAAAATCATGAAAATTGCAATAAACATTAGATATGCATTATTCCCTCATTTT
TATACTTCTCTTGTTAAATCTCATTTATACGGTGGAACCGTGATGAAACCAATGAGCTTTGAGTTTTACTCTGATAGAAA
TACCCACGGATTGGACCTACAATTCATGATTGGATCATCTATAATGGTTGTTCCTGTAGTTGATCAGGGTGCCAGAAAAG
TCAATGCTTATTTCCCAGCTGGTATTTGGTATGATTTCCAAAGTGGTAGTATTTTGTATTCTGATTCCAAAGGTGCCCAG
GTAACCCTAGATGCTCCATTAGATAAAATAAATGTTGCACTAAGAGGAGGCCATATAGTTTCATTGATATCAGATTCTAT
GACAAATCCTCAGATGTCAACAAATAAAATGATTTTATATTGTGCTTTATCGGAAGATTCACAGGCATCTGGAGATGCAT
ATTGGGATGATGGGGAAAATGTTGATTCTTATTCTGGAAATAAGTACAATTATTTGAAATTTATTGCCAACGGAAATAGG
CTGGAAATTTCAGTAGAATTCAAGGGATATGAACTTGTCCCGGTGTTGTCAAAAGTAGTAATTTTGGGGGTAAAACAAAC
TGGTGTACAAAATGTCTCTATAAATGACAGACCAGTAGACTATCAATTCGACGCAGAAAAATCAATTTTACTGATCAGCA
ATATTGATCTTAGTATTGATTCGCACATTTTGCTTTCATGGAATTGACTGAAGCAATCTCACAAAAAATATTTTTATTAA
TAAAACACTATTGTTTTTTAATGCTTGATTAAATTATATTTTTAAAGTTTTTAAAAA
>SMED30018252 ID=SMED30018252|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=1107bp
ATTAACAATCCTACAGTATATAAGTGATGTGAAATCCTTTCAAACTCATTGAGACAATGCAAATCATCATCCTTGTATCT
CTATTCCTTGCCGCAGTAAGTGCCGCTCCACAGCAGTTCACAATCAACAGTGAACTCAACGACGAATGGGAAGCCTACAA
AACCCAATTCGGAAAAAAGTACGTCTCTTTGAATGAAATCTCAAGACGACTTATTTGGGAACAAAATTTGAAATATATTC
AACAACACAATCTTGAGCACGATCTCGGAAAACACACTTACACACTCGGATTGAATCATTTCGCTGACATGACCAACGAG
GAATTCCGGGCGAATTATTTGGGAGTGTCACCAAAACGAATGAACTTCACATCACATTTCATTGCCCCAGAAAATGTGGG
AGCTTTGCCAAGTTCTGTGGATTGGAGAACTAAGGGATTTGTGACCCCAGTGAAAAATCAACAACAATGTGGATCGTGTT
GGTCATTCTCAACGACCGGTTCCTTGGAAGGTCAACATTATCGAAAAACTCAAAATCTTATCAGCTTTTCAGAACAACAG
CTGGTTGATTGCAGTGGCTCTTTTGGAAATAACGGCTGCGATGGGGGGCTAATGGACAGTGCTTTCCAATACATCCAACA
ATACGGAATTGAAGCCGAAAGTACATATCCTTACACCGCACAAGATGGAAATTGTGTATATGACAAATCAAAAGTTGTTG
GAAGCTGCACTGGGTTCTCTGATATCCCCCACGGTAATGAGCAAGCATTGGCTTCAGCTGTTGCTACAGTTGGACCGATT
TCAGTGGCCATTGATGCCAGCAATTATAGTTTCCAATTATACAAGAGTGGTATTTATAACGAACCTCAATGCTCTTCTTC
CCAGTTAGATCACGGCGTCCTCGCCATCGGCTATGGAACCGAAAACGGTAAGAATTTCTGGCTCGTCAAAAATAGTTGGG
GTATCGGATGGGGAATTCAAGGATACATCAAAATGAGCAAAGACCAAGGAAACCAATGTGGAATATCTACAATGGCAAGC
TATCCTTTGGTCTAACTCATTTTGGATAAATGACATTATGCATAATGAAAAAATAAAATGATTTTTT
>SMED30025221 ID=SMED30025221|Name=Eukaryotic initiation factor 4A-I|organism=Schmidtea mediterranea sexual|type=transcript|length=374bp
GGAATGCATGTTGTAGTTGGAACTCCCGGAAGAGTAAAAGATATGCTAAAAAGAGGTCACATCAAATCAGAATACATCAA
AATGTTTGTACTTGATGAAGCTGATGAAATGTTGAGTCGAGGTTTCCAGGAAGATGTCTGTGAGTGTATTACTTATCTTG
AAGCCGACGCTCAAATGTTCATTTTATCTGCCACAATGCCCGATGAAGTTCTTACAGTAACAAAGAGATTCATGAAAGAT
CCGGTAAAGATCTTAGTCAAGACAGAAGAATTGACTTTGGAAGGAATACGACAATTTTATGTCAATGTTAGTCAAGAAGA
ATACAAATTTGACACTTTGACTGATCTCTATGAATCATTAACGATTACACAGGC
>SMED30028442 ID=SMED30028442|Name=Lysosomal alpha-glucosidase|organism=Schmidtea mediterranea sexual|type=transcript|length=2946bp
ATTGTTATGCAAAATTATTTTAGCAAAAATTCCGATAGGTTTTATCTAATTAGTAATTAAGTAGATACTTCATGCTCTTG
AACTTGATTTTATTTTAAAATGGAGGTGTGTCGCTGATCTGGAAAAGTTTAATTTCAAATTATCTTTAATTAGATCATCA
CACCTATTTTAGTTGTTGTAGAGAGTCAAAGTTCAGCTTTTAATTAATATATATTCAATTAAAAATTTGCAAAAAATTAT
TTCCATTTCAAATGAAATTAATAATATTAATAAGTTTTATTAATTTGATTTCGTTATTCAACTTTTCCAACGCGACAGCA
CAATGTCAAATAGCCAATAACAATGAGAGACTTGATTGCTACCCAGAATCCGGAGCCAATCAAGATTCATGTATAGCAAG
GGGGTGTTGCTGGTCCGAACCAATGAGATTGTCCAATAAATTGCAAGGTGTTCCACTATCAATCCCATATTGCTATTATC
CAACTGATTATTCCAACTATATGATTAAATCCTTAAGAAAATCTTCAAGAGGGATCAAAGCAAAATTAGTCAGGGAATCA
CCAAGTTATTTACCCTATGAAGTTGCAATGTTAGATCTTGAGGTAATTTATGAAACAAAATCTAGAACTCGAGTCAGAAT
AACAGATCCTAAACAAAAAAGATATGAAGTTCCAATGAAACTCAGTCCTCCAGATTTGAAGCCACCGACTGATCGAGAAT
ATGAAGTCATAATCCCATCTGATGGTTCATTTTCTATTGAAATTAAACGAAAATCAGATGATCGTTCACTTTTCAAATCA
TTTGGGCCACTTTTATATTCTGATCAATTTTTACAAATATCTTCAATAATGTCAACTGATCAAATCTATGGAATAGGAGA
ACAAAATAGACCCTTTCTTCATCAATTATCCAATGGCTGGGAAAGAATTGGATTGTGGGCAAGAGACAATCCGATTGAAA
CATTTATGAATCTTTATGGAGCTCATCCATTTTATATCGGTATGCCAGACGATGGAAAAGCTTTCGGTGTTTTTCACTTT
AATAGTAATGGTCAAGAATTCGCTTTACAACCGGCACCAGCAGTAACTTATAGAACAATCGGTGGAATTTTAGATTTCTT
TATTTTTACCGGAGGCAGCCCTGAAGAAACAGTAAAACAATACCTAGAATTGGTAGGAAAGCCAATGCTTCCTCCATATT
GGTCTCTTGGATTCCATCTGTCAAAATGGGGTTACAAAAATATTGAGCAATTGTCTGAAATATTTCAAAGAAATATTAAT
GCCGGTTTCCCAATCGGTACTCAGTGGAGTGATATAGATTATATGGAAAATTATAAAGATTTTACTGTCGACAAAGAGAA
ATTTAATGGATTGGGAAGATTTGTCAGAGAGATTAAACAAAAATATAACTCTAGATTTGTTGCAATTGTTGATCCAGGAA
TAAGCTGCACAAGTGGTAACGAATATCCACCTTATTATGAAGGAGTATTTATGGATATTTTCATCAAAGATTCACAGACC
AATCAACCAATTGTTGGCAAGGTTTGGCCCGGAGAAACAGTTTATCCAGACTTCACTCATCCGAACATTTCTATGTATTG
GTATAAACAAATTCAACGCTTTTATAATGATGTTCCAATTGATGGGCTTTGGATTGATATGAATGAGCCATCTAATTTCT
ACGATGGTTCCAAAAGAGGCTGTCAAGGAAATAGTAAATATGACAATCCATTTTTTGTACCGGATATTCGAGATCAGTCA
TTAATATCTAAAACTATTTGTTCTTCAGCACTCCATTACAATAACGAAAAGCATTATAATTTGCACAATCTCTACGGCTA
TACGGAATCAGTAACAACAAATAAAGCATTATTAAAAACGATACACGGAAAAAGACCTTTTATTTTATCCCGGTCAACTT
TCAGTGGATCTGGTAAATATACCTTCCATTGGACCGGGGATAATCAAGCAAGTTGGGATCAGTTAAGAAATTCCATTAGA
CAAGTGCTTAATTTCAACATGTTTGGTATTCCGATGACTGGTGCTGACATTTGTGGATTTAACGGTAACAGTGATGAAGA
ACTCTGTATTAGATGGATGCAATTGGGCGCTTTTTATCCATTCATGAGGAACCACAATGCAATCAACCAGAGAGATCAAG
ATCCAGCTTCATGGAATACGGAAGCCCAGAAAATAATGAAAACAGCTATTTCTAATCGTTATGCAATGTTGCCTTTATTT
TATACATTATTAGTCAAATCCCATATGAATGGTGGCACCGTAATGAGACCAATGAGCTTTGAATTCTTTTCAGATAAAGT
AACGCATTCTATAGAATTACAGTTTATGATTGGATCCTCGATTATGGCAACTCCAGTTGTTTATCCTGGGGCCAGATCTG
TAGATGCATATTTTCCAGCTGGAGTCTGGTACGATTTTCACAGTGGAAAATTGTTACATTCAGATGCTGAAGGAGCTTGG
TTGACTTTGGATGCTCCTTTGGACAAAATTAATATTGCATTACGCGGCGGTCATATAGTTCCTCTATTGGATTCCAATAG
AAATTCTAAATCAAACATACCAAATAAAATGACATTGTATTGCGGAATGGCACAAGATATGAGTGCTTCTGGAGATTTAT
ATTGGGACGATGGCGAGAGCATTGACTCCTACTCACGCAATAGATATAGCTATGTATCATTCAATGCTAGCCCTGAGCAA
CTGTTAATAACACCGGTTTACTTTGGCTACGACTTGTTGCCGGTCTTAAACAAAATCGTAATCCTTGGGTTTGAGAATAA
GTCAATTACTAAATTTCTATTAAATGACAATGATATTCCTTTCCATTATAATCCGGAGACTTCATCTGTGGTGCTCAGCA
GTTTAAATGCCAATTTAAATTCCGAAATAAAAATTCAATGGATGTGAATAATTTTTTGTATTTTAT
>SMED30019471 ID=SMED30019471|Name=Synaptotagmin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1910bp
TTTGGGACTTCTCCAATCTATTAAATATATTTAGAACGAACATCGTTGTGAGAAGCTTTGTCTTGCAAATGCACACCAAC
ACATTCTCTGCCTACTCGAGACCAGCCTGAAGGACGCACCCAGTCATCTCTTATAAAAAAAAAACTCTTCTCTGATTCGG
TATTTTCTGATTAATGGAGATCAAACAATGATTGGGCAACGTCTAGTTTAGAATATTTACAACTAAATCTGCGTATTTCA
ATTTTTTTTCGATTTTGATTGTTGCAAATATTTATGAGTATATCCAATAATATAAGCAGCGCTAGTAATATGACGATAAA
AATGCAACAAAATGTTGAAAAGTCTGTATCACAGCATGTAACAGCGCAAACAAAGGAATCAACATCAAATAAACTTCATA
CAACAACAGCCGGTATCTCGGTTTTGGAGAAAACATTAAAAACATTTCACATGAGTACTGGCACTTTGATTGGAATCGGA
GTTACAGTGTCTATCGTAGTTTTATTACTTCTTTATTGTATTTGCAAACGATGCATTAAGAAACGAAAGAAAAAGAAAGA
TGGCGGCAAAAAAGGTGGAAAAGGCGTAGACATGAAAAGCGTACAACTATTAGGAAATGCTTATAAAGAAAAGGTACAGC
CGGACCTAGAAGAACTGGATGCTAACATGGAAGATAATGAAGGGGCGCAAGATAAAGAAGCAGTCAATCTTGGAAAATTA
CAGTATTCCCTTGATTACGATTTTACAAAAGGCGAGCTAACAGTCGGAGTAATTCAAGCCACAGATCTCCCAGCAATGGA
CATGTCAGGAACTTCTGATCCATATGTGAAAGTTTTTCTATTACCGGATAAAAAGAAAAAATTCGAAACCAAAGTTCATC
GAAAAATATTAAATCCAGTCTTTAATGAGACATTTGTATTCAAGATTCCTTATTCTGAGGTCGGGTCTAAAACTTTGGTA
TTTAATGTTTTCGATTTCGACAGATTTTCAAAGCATGATCAAATTGGGCAAATCCAAATTCCACTGGGTTCAGTAGATTT
ATGCAAAGTTATTGAGGAATGGAAGGAACTCGGCCCACCTGACAGTGATAATGAAAAGGAAAATCGATTAGGAGACATTT
GTTTTTCTTTGAGATATGTTCCAACGTCTGGAAAGTTGAATATCGTCATTCTGGAAGCTAAAAACCTCAAGAAAATGGAT
GTTGGAGGATTGTCGGATCCTTACGTGAAACTATCGTTGATGCTTAACGGCAAACGAGTGAAAAAGAAGAAAACCACAAT
AAAAAAATACACATTAAATCCTTATTATAATGAGTCATTTTCATTCGAAGTTCCATTCGAGCAAATACAAAAAGTTAATT
TAATAGTGACAGTAGTTGATTATGATAGAATTGGAACAAGTGAACCTATTGGAAGAGTAGTTCTTGGATGCAATGCTACA
GGAGCAGAACTTCGGCACTGGTCCGATATGCTTGCTAATCCTAGGAGACCAATTGCCCAGTGGCATACCCTTCAAGATAT
GCCGGAGAAGAGCTGATTTCATTGATTTTAATTTTAAAATCTGTCATATTTTGTGATAAATTTTGCGTATTTATACAATC
ATTCGATTCGATCTTTCCATCAAGTTTCGTAAAATCTGCAGACATTCACGAGGATGCAGAAGAAATAGAAACTTTGTAAT
AAATTAGCATTAGCTGTGATCTCCTATTGACCAAAAAACATAAACTTAATTTTTATAAAGAATTGTGGTGAAATGTTGTT
AGGTTTCAGTCATAGATAACTGTATTTGTGTAATAGTTTGTGTATTTCTCGTCCTGGCCCGATTTTGTGCATTCCACTGG
CAATACTATTTCACTAATAAATTATGTCTGATAATGTATACCAGTATAGGATTTTGTTTGAATTAATGAA
>SMED30015672 ID=SMED30015672|Name=Gelsolin|organism=Schmidtea mediterranea sexual|type=transcript|length=1435bp
TCTTGTCATTTCAGCATGCATATATCATTAGCGTAAAGATAAAAATACTAACAACTCCTAGTCAAATTGCAACCAACCGT
AAATTGCAGACACACACGAACCAATCACATTTGCTGCCATCGGACAGCCTATGAGACAGCAGATTGGATTAATCAATAAA
GATTTATTGTTCGGTTTTCATTGTATAAATACTGAAATCATTTGTCAATCCAATTGTTAAGTCAACCATGCAGAAAACTA
AAAAATATGACTGGAAAGATTCCAATGTGGAATTGATTGGAAGCAGCGAGGACAGAGCTGTCAAGAAATCATCGGCTGAA
AACGAGCCAGCTTGGAAGAAAGCTAAAGCTTGCGGCCATTCTGAATTGTTTATATGGCGAATTGAGAAATTCAAAGTTGT
TGAATGGCCTCAAAAGCAACATGGGGAATTTTATGAAGGAGATTCTTACATTGTCTTAAATATATATCAAAGAGAAAATG
AATTACTGTACGATGTGCATTTTTGGATTGGTAAATATTCTACCCAAGACGAGTATGGGACTGCTGCCTACAAAACTGTG
GAATTGGACAATTTGCTCGATGACAAACCAGTTCAACATAGAGAGGTCCAACATTACGAATCGGAATTGTTCAAAAGTTA
TTTCAAAAATCTAATATATCTGAAAGGTGGTTGCGAAAGTGGATTTAGACATGTTAAAACTGTAGAGTACACTCCGAGAT
TATTACATGTACGAGGGGAAAAACGTAACATCATTGTTTCTGAGGTGACTGCAACTAAACATAATTTAAATTCCAATGAT
GTGTTCATCTATGACACTGGAACTCACATTTTTGAGTGGATTGGAAAAGGTGCGAACAAAGATGAAAAGTTCAAAGGTCA
AGAATTTGCGCAAGCGCTAAATAGTGACCGCAATGGAAAGGCTAAAGTTGAAGTTGTCGACGAGGCAAATATATCAGAAA
ATCACGAATTCTACAAACATTTATCAGATTTACAACCCGACGAAGATGACAAATGGCAAAATAAGTTATCAGTTAAAGAT
AAGAAACTTTTTAGAATATCTGATGCCAGTGGATCTTTGAAATTCGAAAATATTGCTATTGGAAAATTTGCAAAAAAGGA
CATTAACGAAGATGATATTTTCATTGTTGACAACGGTTTAGAAGTATATGTTTATATTGGAGAAAACGCCAGCCCTAACG
AAAGGCAAAATGCCTTGATTTATGCCCATAATTACCTAAAACAAACCGAATATCCCCAAGTTCCGGTGACAGTAATGAAA
AAGGATGTCAAAGGCAAGAATGCTGAAAACTTCAATAAAGTAATTGAAGGATAAACTCTGGCAAATTTGTTTGTTATTTA
ATTCATAATTTATTTTCAATCTAACTAGGTTTTACTTTTCAATAATAAAATATTTATGTTTGTTTTAAAAAAAAA
>SMED30018602 ID=SMED30018602|Name=ATP-dependent RNA helicase dbp2|organism=Schmidtea mediterranea sexual|type=transcript|length=607bp
TATTCAAAAGATAAACGATTGTTAGAAGTTGTTAGCAAAACTCCACGGGACAAAATGATTGTGTTCGCAGAAACGAAAAG
GAAAGCTGATATGATTTGTTCTTTCCTACGTTCAAAACAATTCAGAGTTGGTGCAATGCATGGAGATAAGTCACAGAGCG
ACAGAGAATATATTCTTAATGGGTTTCGAGGTGAAAATTTAAATATTCTCGTGGCAACAGATGTAGCAAGCAGGGGTTTA
GATGTTGATGATATTAAAGTTGTAATCAATTACGACTTCCCTATTCAATTTGAAGATTACATTCATAGAATCGGTAGGAC
AGGCCGACGAGGAAAATCCGGTGTGTCTTATACATTTTTCAATAGAAAGAATTCGAAAAGTGCTCGTCAATTGGTGAAAG
TGATGGAAGAAGCTAATCAATCAGTTTCAGATAGTTTGTATGATCTTGCATATATACCAAGAAGTGAGCGTAGACAAAAT
TTCAATCGTCCGCCAATGCCAGTGCCGCAAGTAAATAATTATCAAGTACCTCCGCCTCAATATAATGGTGGAAATAACAT
GTATCCGCAACCAGATTTATATATGCAAAACGGAGCAGCACATCACA
>SMED30033466 ID=SMED30033466|Name=Histone H4|organism=Schmidtea mediterranea sexual|type=transcript|length=421bp
GATCTCACTATATAAATAAGTATTTGTCCCTATTAATTCATAACAATTATTCAACATGTCTGGTCGAGGTAAAGGAGGAA
AAGGACTAGGAAAAGGTGGAGCAAAGCGTCACAGAAAAGTCCTTCGTGATAACATTCAAGGTATCACAAAGCCAGCAATC
AGAAGATTAGCTCGTCGAGGTGGTGTTAAGAGAATTTCTGGATTGATATATGAAGAAACCCGAGGTGTTCTTAAAGTATT
CTTGGAAAATGTTATTAGAGACGCTGTGACATACACTGAGCACGCTAAGCGCAAGACAGTAACTGCCATGGATGTCGTCT
ATGCTTTGAAACGACAAGGAAGAACTTTGTACGGTTTTGGAGGTTAAATAACACTTTCATATTTGTGAATGTTTTAGCGG
CCCTCTTTAGGGCCACAAATG
>SMED30000837 ID=SMED30000837|Name=Histone H4|organism=Schmidtea mediterranea sexual|type=transcript|length=1387bp
ATTAACACTAAATTTTGTTTATATAATGATTAAATATTTCAATAATCAATTAATTGAAAAATGTCTGGTCGTGGTAAAGG
AGGAAAAGGGTTAGGAAAAGGTGGAGCCAAGCGTCATCGTAAGGTTTTACGTGATAACATTCAAGGAATAACTAAGCCGG
CAATTAGAAGATTAGCTCGTAGAGGCGGAGTAAAAAGAATATCTGGTTTAATTTACGAAGAAACTCGTGGTGTTCTCAAA
GTTTTCCTGGAAAATGTTATAAGAGACGCTGTTACTTATACTGAACATGCTAAGCGTAAGACAGTAACTGCAATGGATGT
TGTTTACGCTCTTAAACGCCAAGGAAGAACTTTATACGGATTCGGAGGTTAAATGTGAAACCAATGATATTTTAAGCTAA
CATTTATTTGTTGAGAATGTTTATGGTCCTCCTTAGGGCCACAATTTTTGATTGTTTACTTTATTTTGTTAGCATTACGT
AATTTTACAGTGATTGGTTATCTTGCTGGTTGTCTGAAATATTAAATAATAATATGCTATAATTAAATGATATTAGTATA
GAAAACAAAAATCGGTTTTATTGTTTGATCAACACAATGAATATGTTTATCAATTATCATCATTTCCAGTTTTTCGATTT
CAGTTGATAATAATTATTTGCGAATTTGTGATTATATTTTCTAATGGGTTGCGAGACATAAATGAGCGTGCAGATATCAC
ATGCGAACCTGGTTCATGTAGTGTTTTGAGCTACACACTGCAGATAGACGATCAAATCTATAAAGTGAAAAAAGGGTTCA
AATCAGCTTGCAGCACCAGACTATGTGAAAATTGTGCTCACAAAGGTGATTGGTCAATGAGACTGATTGACGGAAACAAA
TATATGGTACGACAAGTCAATAAATGTTTAACTAATAATATTTTGGCAGTTGAGCAACTTTTCACAAATTTATATACTCC
TGTCTCAGATTTTACATGCTCCTTGCATAAGTGCTCTAAATATAATTATTCTTATAATGGAAATATGATTAGCTTTAGCT
ATATAGGAGTTTGTGACCATTCTTACTGTGACTCATGCCGCTATTCCGACAATTGGAGTCTATTAACCGGATATTTGCAG
CGGACGACCATTTCATGTTATGTTGTCGATAAAATTAGACTTGAAGATTATTTTCTCATTCCAGAGTTTACCGAAACCTT
CTATACACTAATTCGGAAATTAGCAATAACTATAAGCTGCGCTTCATTTTTGTGTTTGGTGATCATTCTTTTGGTTTGTT
TTGCTAAAAAATGAGATCTTACAGAAGCTTTAAGGAACTTAATTTTATTTAACAATATATTTATACTTAGATCTAATGCT
TTGAATGATCCTTTCGCAAGTCCATCC
>SMED30011876 ID=SMED30011876|Name=Macrophage-expressed gene 1 protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1880bp
AACGGAAATACAAATAAATTCTCGATTTGTCAACTCTCTAAAGTTCAAGAGTGCTACAAAGAAAAAAATAGATCACAAAT
GTCCTCTGAGCAATAATCAAACTCAATTCAACACTTTTCCCGGGTTGGGGTGGGACAATTTGGTAAATCAAGAAATGAAG
CCCGTTCTGAAGATCTCATTTTCCAAGTGCGAAGAGTCCAGTGATGGAGTTTATCTCATTCCAGACATGACGACCATTTT
TCCATTAAAAAAATCAAAATTTCATATGAATTCTGATTTATTCTCCAGCTCTTCTGAATATGTTTCTCTCACTTCTCAGT
CCATTAATGAAGATATTAATTTCTCTGATTTCCCTACTTTAATAAATGGCGCATTTTCAAACGAAAAGACCTCTTTGAAA
AGGAAAAAAATAAAGAAAAATTCTATTTTATCTCAAGTTCAATTGAGATACGAAGTTTATAATATTTTGTCTCAACCGGA
CAGTGATCTCTCGAGGGAATTCAAAGACCGAATTGTTGAATTAACGAAATACTTGGACGACGAAAAGAATTTGTTATATT
TGGATTACTTGTCGGATTTGATCATAAGAGATTTCGGAACGCATGTCATCAAGTCCGTGACAGCCGGGGCAATTCTTGCC
AAAATTGACGTTCTCAAACCGGAATATGCGTCAAAATATAATAAAAATCAAGGGGAAATTAAATTAGCAGCCGCCTCAAG
CATGGCTGAAAACGTCGGTACGAATCATGAAAAAGATGAAAGATCAAAAAAATTATTAAAAGAATATAAAGACAATTGTA
TCAGTTCGACAATGAAAGCAATCGGTGGAATGCCAATTGAGTCAAATTTCAATTTGCAAAAATGGACAAATACCATAAAG
TCGAACTTAGCACCCATCGACCGACAAGGTGACCCACTCAATTATGTGGTGACAAAGAAAAGTTTACCGGAATTGAAAGA
TAAAGCAATTTTCGATATAAATAAATTAATTAGTAAAGCAATAAACCGTTACTACAGAGCAAATATGGGATCAGATTGTA
CGAATATTGGTTCTATGAGTAATGAAAATAATGGAAATATTAATAATAAAATGTGCGAGCAGTCAACAGAAATTAAAAGA
TTTGGTGGAATATACCAAACATGCGATGGTGAATCGTGTAGTGAATACAAACAGGATAATCCTGCGACTGGAAATTTAAG
CTGTCCAAAAGGCTACAATTCGTCTATCCTTTATAAAACCATGAACATTAGTAAATGTAAAGAAAATTGTCGAAGCTTAA
CTTTGTACATGTGTTATGCAAACAGCAATGGATTCAATGATCTTGGTTTTTCTTTTGGTAGAATAATACCCAGATTCAAG
CCGAAGTCCGATTGCCCTAAATATCACATCTCGCTACGCTTTGGTGCGCAAAACATTTTATGTGTCACTTCAGGTAGAGA
GCAAGTAGAAGAAAACAGCTTACAATTCGGTGGTTTTTACAGCTGTTTGATAGGAAATCCGTTTACTATAAAAAAACAAT
CAAACGACAGTGCGAATGGCATTTATGAAAAATCATGCCCCCCAGGATTTACAAGTCAACTTAGTCAAGTCGATTCGGAT
TGCCCGGTTTATTATTGTACGAGAATATACAAAACCATCAGCAGAGTCGTTTTATTAAGACCGCCATTTATCAAAATTGA
TTGGAATTTAACTGCTACTAGCGCTGAAACATTCGACAAAATTGACGGTAAAACTGAGATGAAAAAGATCTGGAATAATA
AAGCGTTTCGGTATTGTGTAATTGCATTAGCAATTTTCTTATTTGTTTTCTTACTTCTATTTTTAATATTGTTCCATCTG
AAATTTTGCAAAAAATAAATGTTAACTAATTGGTGAGGCC
>SMED30011264 ID=SMED30011264|Name=Macrophage-expressed gene 1 protein|organism=Schmidtea mediterranea sexual|type=transcript|length=2311bp
AGTCGCGATAGCACGCAACGTCGACATTGCGATGACGTAATCATTGTGAATCTCTACTACAATCGGATCATTCTAATCAC
GTGCATCCTAAAACAATATAAATCTTACAAACGGGAATCCAATTGAACATTTATTTACTCAAGCGTGAAACCAATGATAC
CGTGTAGACTTAATAGTATAATATTGTTTATATTTGTTTATGGAGTTCTATCGGTTTCATGTGAAATTGAACCTAACCGA
GATCAACCATCTTCAAGACGAGTTCATGAGTGTAAACTCACCAGCAACCAATATCCAGTGAATGTTCTTCCCGGATCTGG
GTGGGATAATCTTGAAAACAAAGAACTCGGTCAAGTTTTAGAAATTTCATATAAAGGATGTTTTGGATCGAATGATGGAA
GCTTTCTCATTCCAGACAATGTGGTGATCACCCCAATAAAGAAATCTATTGTCGAGTTAACTTCAGATATATTTGACCAT
TTCTCAAATGTCACCTCTACAACGGCGATGTCTATCAACGCCGATGCCAGTTACTCAACACCAAGCTACAAAATCAGTGG
ATCATTTTCATTTGAAAAAATAAGAATAAAAAACGATCAAATCAAAGAAAAGTCGTCGATTTCGAGATCCCAGTTAAGAC
ATGAATTATATGAAGTAGCGTTCCAACCACACTCAAAACTAGACGCAAAATTCAGAAACAGAATTCTAGATATTGGAGCG
TTATTGAAAGAAGGAAAAGACACAATTTATCCACAATATTTAGCGGATTTAATTGTCCGTGACTTCGGCACTCACGTCAT
TCGGTCGGTGGATGCGGGAGCGACTTTAATAAAGACTGACGTTCTGAAGTCGAAATACGTTAATAAATTCAAAGGAGATA
CAACAACCATAGCAGCCGCCGCATCGTTTAGTATGACAAAAGTTCTTGGGGTAACAATCAAAGGAAACTACTTCAGTGAC
ACTGCTAGCCTCGATGAATACAACAATAACAGCGCAAGCACTAAAGTTGAAACAGTTGGTGGAAGACCATTCGGTTCGAA
CTTCAAATTGGAAGATTGGGAAAAATCTCTGGATTCAAATTTGGTGGCCATTGATCGTCGAGGCAATCCATTATTCTACG
CAATAACACCAAGAAGTCTCCCGGAATTTGATGATAAAACCGTTAATAAAATTGTTACTCTTATCAAAAACGCTGTCAAC
AGATATTATGCAGCCAACACTAGAGTAGGTAAGTTAAACTTTAATAATAAAATACAACGTTGAGACTAGGGTGCATGAAT
ATGGAATCAGAAAATTTCAATGACGATGCAAATATTGATGGTGGAAATTGTGAAACTCCAAAATCATATTACACACTTGG
AGGAACATTTCAAACCTGCAAAGGGCCGGATTACCAATGTGAAAACGTAGCTGGCAAGAACCCCATAACGAATAGCTATG
CGTGTCCTGCAAATTACAAAACCGTTGAATTGGAAAGTGGATTGAGTAAATGCGAAAAGGTTTGCGTTAGGACTTTTTGG
TTTAGTTACAACTGTCATTACGAATGTTCCTATTACGCACTCTATTGGTGTGCTGCAACGAAAGCGACAACAAAATCAGA
AGGATCATTATTCGGTGGATTTTACTCAAATACATATCCGAACCCGATAACAAATGCCTATAATTGTCCGCAATATTATT
ATCCATCTCGATTTGGAATGGTCGGAACGATTTGTTTGGCATTCAATAGAGCAGAGACAATGGAACACCATTTGCCTTTC
GGAGGATTTTACAGCTGCAAGGTCGGAAATCCACTCTCAGACAAATTTGTAGATAATACCACACAGGATCCCAAATATTG
GTCGGAAGGTTGCGCAACTGGATACTCATCTCATGTGGCTATTGTCAACCGAGGCTGTCAAATTTCTTACTGTATCAAGA
ACAACGCGCTTAGCAAAAGGGAGCAACCTCCTCTTTTTAGACCCCCATTTGTTGATTTGGGATTCGGACCGAATGCGACC
ATCACTACTAGTTTAGAAACTCCAACTGGACTCAAACTCTCCGTCGACGAAAACGGGAAGTGGAGTGAAAACAAAAAATC
AAAATCATCCAATTATAATATTATTATATTTTCTGTAACAGCAGTAGCAATAATCACCATAATGATTATAATATTAATTC
TTGGAATTAAAATTCATAGAAAAACTCGAAGAATAACCGTTTTGCCAGAATATAATGGCAGCGATAGGAGCAATTCTACG
AGTTCTTTGAATAATCCAACAACATCGAATCGCGTTCAGCCATTCAAAATACTTATAGATGAGAATCAATA
>SMED30016824 ID=SMED30016824|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=375bp
AAATGTATTTATGATAAATCAAAAGTTGTTGCAAATTTCACTTCGTTTACTGTTATCGAGCCAGGAAACGAATCTGACTT
GGCAGCCGCCGTGGCCACCGTTGGACCTGTGTCCGTATGCATCGATGCCGATCATCCAGGTTTCCAACATTATAAAACTG
GTATTTACAATAACCCCAAATGTTCATTTTTATGCTTAAATCATGCCGTTTTAATCGTTGGTTATGGATCACTCAATGGA
GATAACTTTTGGATTGTGAAGAACAGTTGGGGACCAGATTGGGGAATAGAAGGATACATACTCATGTCAAAGGACAAGGA
CAACCAATGTGGAATTGCTAGTCTAGCCGCTTATCCAGTGGTCTAATATGCATGC
>SMED30002704 ID=SMED30002704|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=1178bp
GAAGATCAAAGGAAGAACCGCTCACATAGGCCCCGCCATGAAAGGAATGTATAAACTGACCCTTGATACCAAGCATACTA
TAAAACTCAAAGTAATCGCATCATATTTCATAACATGAAGGCATTCATAATTTTGTCGTTATTCCTTGTTGCTATTGAGG
CTGGGCCAAGGAGATTCACGGTCAACAGTGAGTTGAATGAAGAATGGGAAATATTCAAAGCCCAATTTCATAAACAGTAT
GAACCGCTAACGGAGGTTATGAGAAGAATCATTTGGGAAGAAAATCTCGACTTCATTAGACAACACAATCTTGAATACGA
TCTCGGAAAACATTCTTACACTTTGGGATTGAATGAATATTCTGATCTCACTAATGCAGAATTTAAAGCCAAACTTTTAG
GAAACAGATTGAATGGATCAAACTCAAAAGGATCAGAATTTATGGTGCCAGAAAACATTGGAGCTTTGCCTTCATCTGTG
GATTGGAGAACTAAAGGATACGTAACCCCTGTGAAAAATCAATATACTTGCGGTTCATGTTGGGCTTTCTCAGCCACGGG
AGCTCTTGAAGGTCAATATTTTCGAAAAACAGGAAAATTAATTAGTTTGTCTGAACAGCAACTTGTTGACTGCAGTAGAC
CATATGGAAACCTTGGATGTGGTGGTGGGTTTCCGTATCAGGCGTTTGACTATGTTAATAAATACGGAATGGAATCCGAG
GATGATTATATATATCGTAACAAAGAAAACAAATGTATTTATGATAAATCAAAAGTTGTTGCAAATTTCACTTCGTATAC
TTTTACCAAGCAAAGAAACGAATCTGACTTGGCAGCCGCCGTGGCCACAGTTGGACCTTTGTCTGTAGGCATCGATGCCC
GTGATTGGCGTCTTCAATATTATAAAAATGGTATTTACAATAACCCCAATTGTTCTTCAGAATACTTAGGTCATTACGTT
TTAGTCGTTGGTTACGGATCACTCAATGGAGATAACTATTGGATTGTGAAGAACAGTTGGGGAACTGACTATGGAATAGG
AGGATACATCCTCATGTCAAAGGACAAGGACAACCAATGTGGAATTGCTACTCGAGCCGTTTATCCAGTGGTCTAATATA
AACAATTCTTGATTGAATTTATGACTTTTATTATTAATAAATAAATAAATTTGCTTTC
>SMED30028453 ID=SMED30028453|Name=Lysosomal alpha-glucosidase|organism=Schmidtea mediterranea sexual|type=transcript|length=2906bp
AGAATTAGGTAAAGTGCTAAATTTCAAGATGATGGATAGAGAAAATGAATGACCAAAGTACAAAATATAAAGATATTTAA
GTAATAAAATTGAATTCCGAACTTAAATTGAAATGTTGAAGTTATTGTTGATAATCTCCTTGAACTTTATAATTGTGTCC
AATGCTCTCCAATGTTCAGTACCGAATAACAATTATAGGCTAGACTGCTTTCCTGGGTCCAATGCAAATCAGAACGATTG
TTTGGCTAGAGGATGTTGTTGGTCACCACCGGAAACCCGGGAATATAGTCAGAATAATCCGACTATTCCATACTGCTTCT
TTCCAATAGAATATCCAAACTACCAAATTAATTCATTCACTCCTACCGATCGAGGATTCAAAGCTCGTCTAACAAAACAA
CAAAAATCATTTTTACGGAAGGAAATATTAAATTTGAACTTTGAAGTGATCTTTGAGACAAATACTCGATTGAGAATAAG
AATCACCGATCCGAATGTGCAAAGATTTGAAGTTCCGATTCAGCTTGGATCTCCTGATCCGACTCCACCTTCAAATATTC
AATATAAATTCACAATGCCCACAAATGGTTCTTTTGGATTCGAAGTCAAAAGAAATTCCGACGGATTGAGCTTGTTCAAA
ACATTTGGTCCTCTATTGTATTCTGATCAGTTCATACAAATATCTTCTTTGATGTCAATCCAACACGTTTATGGAATCGG
AGAACAGAATCGTCCATTTCTACATGATTTGTCTACTCAATGGGAAAGAATAGGACTGTGGGCACGCGATAATGGAATAG
ATACATATAATAATTTATATGGTACTCACCCATTCTATATGTCACTGCCTGATTCTGGAGAAGCGTTTGGAGTTTATTAT
TTCAATAGCAATGCACAAGAATTTGTTTTACAACCGGCTCCAGCGATTACTTACCGAACAATCGGAGGAATACTCGATAT
TTTCATTTTTTCAGGAGGAACACCGGAAACCACCGTTAGTCAATACACTGAATTAATAGGAAGACCAATGCTTCCTCCGT
TTTGGTCTCTTGGATTCCATCTATCAAAATACGGTTATAAAAGTATTGCAGATGTTTCTAACACTCTGTATAGAAATATT
AATATAAGCATACCAATAGAGGTCCAGTGGTCTGACATTGATTACATGGACAAATACAAAGACTTCACATCGGATCCGAT
AAGATACCCTAACTTTGGTTCTTTTGTCGCCCATTTGAATCAATCTTTAGGAATAAAGTATATTGTTATAATTGATCCTG
GAATCAGTATACAAAGTCCCGGTGTATATTCTGCTTACGATGAAGGACTTGAATTGAATATATTCATTAAAGATGCGAAT
ACTAAGAAAGATTTGATTTCAAATGTTTGGCCAGGAGAAACATGTTTTCCTGACTTTACTCATCCTAATGCTTCAAAGTA
TTGGTCACATCAAATTCAACGATTTCATTCTCAAGTACCAATAGATGGTTTGTGGATTGATATGAATGAACCATCAAATT
TCTACGATGGATCTAGAACCGGATGCGCTCTAAATAATCCGTACGACTATCCATTCTTTGTACCGACAATCAGAGATGGT
TCATTAATTAAGAAAACAATATGTTCATCCTCTCTTCATTATAACAATGTCATGCATTACAACTTGCATAATTTATATGG
TTACACCGAGGCAGTAGCCACTCATAGTGCTTTATTGAATACCATTCCAAACAAAAGACCATTTATTTTATCTCGTTCCA
CATTCAGCGGATCTGGTAAGTACACCTTTCATTGGACCGGTGATAATTCGGCAAATTGGGATCAGTTAGCCAATTCAATC
AGGCAAGTCCTCAATTTTAACATGTTTGGTATTCCAATGACGGGTGCGGATATTTGTGGATTCAATGGAGATAGTAATGA
AGAACTGTGTATAAGATGGATGCAATTAGGTGCTTTCTATCCATTCATGCGAAATCATAATAGTATTGGCGCTAAAGCCC
AAGATCCAGCTTCATGGAGTCAAGAAGCTCAAATTATTATGAAAAAAAGTATTATAATAAGATATGTTTGGTTACCTAAC
TTTTATACATTATTGGTTAAATCATATTTGTACGGTGGCACTGTGATGCGACCATTGAGTTTCCAGTTTTACAGTGATGC
TGAGACGCATGAAATTGAGAGGCAATTTATGATTGGTTCCTCGATGCTCGTCAATCCAGTTGTTGTCCAAGGAGCTAGAA
ATGTTGTAGCATATTTCCCAGCTGGGATTTGGTATGATGCAACAGATTTGAGTGTTATTTATTCGGGGAAAACTGGAAAA
TGGATTTCTTTGAATGCACCTCTTGAAAGAACTAATGTTGCATTACGTGGAGGACATGCTTTGATTTTATCAAGTTTGGT
AAACAGTACCGAGTATTCAAGAAAGGTCATTAATTTGGTTTGTATATTATCAATGAATCAAACAGCTGCGGGAGATTTGT
ATTGGGATGATGGAGAGAGTATGGACAGTTATTCTGGTAAGAAATTCAGTTATTTTAAATTTACTGCAACTTCCAGCAGT
GTTCTTATCAATCCTGAAATATTAGGATATAGTGTTCTTCCGTCTTTGAATAGTATTATAATACTCGGAATTAATACCTC
CTCAATCACTACTGTAACTATAAATGATAAACCAATACAGTTTTATAAAAAATCTAATTTGTTAGACGCCCTCCTTGGCG
GCTTGTTTCCTATTGGTCAGAAATTAATTTTAAAATGGAAATGACGAGATTCATTATTTAGTGCATAATTATGATTTTAT
ATTTTTTATTTTTTTATTTTTTTAATGAAGATTGATTGATTGATTGACTAATCATTAAATTGTGATTTATTGAAATTAAA
AATTTGTTCGATTTTTATAAAAAAAA
>SMED30035609 ID=SMED30035609|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=1185bp
TGAGATTTAGGCTTGATGTCATATAATTGTGACCCGATCACAAGTTTTATCACAAGCTGATCATGAAATTGAACCTTGGA
AGCAGGCCTACTATAAAAACAAAATTTACACCGACAGAATTATAAAATGAAAGCTTTCGTTTTAATATCCGTTTTCCTTG
TGGCTATTCAAGCTAGACGTCCGACCTTCTCACTCAACAGCGAGTTGAATGAAGATTGGGAACTATACAAGACTCAGTTC
AAAAGACAGTACGAACCCCTCACTGAAATCACGAGAAGAATCATCTGGGAACAAAACCTTGAATACATTCGACAACATAA
CCTCGAGTATGATCTGGGAAAACATACTTACTACTTGGGATTGAATGAATACGCTGATCTAACTAATGAAGAATTTAAAG
CCAAATTTTTGGGAAAAATATTGACTAGATCATCAACAAAAGGATCTCAATTTATGGCTCCAGAAAATATGGGAGCTTTG
CCTACGACTGTGGACTGGAGAACTAAAGGATACGTAACTCCAGTTAAAAATCAACAACAATGCGGATCGTGTTGGGCTTT
CTCGACTACTGGATCTCTTGAAGGTCAACATTTTAGGAAGACTGGAAGTTTAGTTAGTTTCTCAGAACAACAATTAGTTG
ATTGCAGCGGTGCTTATGGAAATGAAGGATGTGGCGGAGGATTAATGGACAATGCATTCAATTATATAATGAAATATGGC
TTGGAATCAGAGAGAGATTACCCATATACTGCAACTGACGGAAAATGTAAGTATGACAGGTCAAAAGTGGTTGGAACATG
CAGTGGATTTACGGATATTAAACATGGAAACGAATCTGATTTGGCAGTTGCGGTAGCAACTGTAGGACCCGTGTCGGTAG
CAATTGATGCCAGTCACTACAGCTTCCAATTATACAAGGGAGGAATTTACAATGAGCCCCAATGTTCTCCTGACCAATTG
GATCACGGAGTTTTGGCAGTCGGTTATGGATCAGAGAATGGAGGCAACTATTGGCTAGTGAAAAATAGCTGGGGTATTTC
TTGGGGCCTTTCTGGATACATCAAAATGTCAAAGGACAGAAACAATCAGTGTGGAATCTCCACCTCTGCAAGCTTTCCAT
TAGTTTAATTTGAACTATTATATTAATTTTTCCAACTTAATTTTTATATTTAATAAACTTTGCTT
>SMED30013843 ID=SMED30013843|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=1112bp
ATTGTTTTAAGATTGAACTCGTCGTTAGACAATAAAGTGGCATATACTATGAAAATAAAATTACTTCCAAATGCAAAGAA
AATGCAATGTTTTGTTTCTAATGAAAATCATTATAAACAAATTATTCAATGTGCTAAATTTGAAGCAATCGGGCATCAAT
CTAGATATTGCAAGGCTAGAAAAGGAAAAGGGATCGATAGTATTCAGGAGTCTCACGCGGTCCCAAATAGGTTTTAAAAG
AAAGACTGCTTCTGATAAATGATAAGTAAAACGATGCTTGATAGATACTGGCAGTTCAACAACAATTATGCGAAGAGATC
CAATAAATTCACCGGATGTTAGAGTATGTTCAGCACATAGATATATATTATTGGTTAGTCGCAGTAAAGCTGAAATAGAA
TTAAAAGGGAAGTATTTTATTATTGATTGTTTTGTTCCCATAAAAATGATATTCAGTTATGATGTGATATTAGGTATTAA
TGGTATTAATGCACTAGGAGGGGAAGTTCTCAACGACGAAGTGAATCATAGTATCCTAATAGTTGCGAGCATACACAATC
TTCAAGATAAGCTGATTGGAAGAAACAATTTCCAGGCAAGATTCGATTATGAATGGAAAGTATTGTGGAATTGGAACATC
AATATTCCTATAGGATGTCAGAAAGATACTCCAAATTAGATCTTAACAAACCAAATACTGGCCTTGTGCCTACAATCATT
GAGTAATGGATAGAAAAGAGTTGGTTAGTTGAATACGATGAAATCCAGTATGGAAAATCAATTGGTTCATTAGTATTATT
CCCAGTCATACAGAAAAACAAGAGTAAATTAAGACCTGTTTTCGATTTGAGGGCATTGAATCACTATGTGAATGTATGTA
GTGGGGAAGCAGTAAGTAAAAGTATGGCTGTTAAAATTTATGGGGATTCAAGACAAAGGATTGTATAAATAAACAGAGTG
CGGTTGAAAAATATTTGATGTTTTCTATACACCGAAGAATTGCGAACTATTATAAGATTTCTGGTAATATACATATAGAG
GTTCGAGAGAGAAAAATGTATAAAACCAGACTTTATGAAAAATCTTTGAAGATTTTCTATAATTAAAAAATC
>SMED30034696 ID=SMED30034696|Name=Macrophage-expressed gene 1 protein|organism=Schmidtea mediterranea sexual|type=transcript|length=2009bp
AGCGAAAATATGACTCGTTTTTCTGTTGCCAGTGCAACATTTATTTGGTTTTTATTTTTCGGTTCCACACTAGCGGATGA
AGCAGTCATTGAGCCGGATAACGTAATTCAGAACTCGAATTTTCCATCCAAACGTGTTGTAAATGATTGCCACCTGACTA
ATGATCAGTATGCATTCAATGTCTTGCCGGGGTCCGGTTGGGATAATCTTGCCAATCAAGAGTTAGGCCAGATTCTGAAA
TTATCCTATAAAAACTGCAAATCTTCCAATGATGCCAGCTTCCTAATTCCCGATGAGGTTTCAATGTCACCAGAAATGTT
GTCTAATGTTCAATTGGATTCCGACCTAGTCTCACATTTTTCAAAATACGATTCAATGACTTCCAAGTCTATTAACATTG
AAGCAAACGCCGCAACGCCAAATTATCAAGTCAGTGGATCGTTTTCTTTTGAAAAGAAAGATGTTAAGAAAAATCAAATG
AAAGAAAAATCCGAAATTTCTCATACGCAACTGAGATACGAACTTCACCACCTTGCCTTTCAGCCAGACAGTGAATTGGA
TCCTACCTTTCTCAATAGGGTCATTGACATGGGAATAGTTTTGGAAAAAGAAAGTAAAAATACTTACTCAGAGTTTTGGC
TGATTTGATCGTAAGAGACTACGGAACTCATGTAATACGGTCTGTTGTCGCTGGAGCTATTCTTTCTAAAACTGATGTTC
TCAAAGGCAATTTTATGTCCAAATCCAGGGGAAATTCTATAAATGTTGCGGCCTCTGCCGCTGTAAGCATGAGAATGGCT
GTGGGAATTAAGATTGGAGGAGGTTATGGCAATTCTGAAACCAATGCCACGGAATATGAAAAGAATTGCGCAAGTTCAAG
AATTAACACCTTTGGTGGAGGACCATATGGTTCTAATTTCAAATTAGAAGATTGGGAAAAGACCCTTCCTACTAACCTTG
TTACTATAGATCGTACTGGTGATCCTTTATATTACGTAATAACAAAAAGAAACGTACCGTATTTCAGTGACAAAACAATA
TTTAACATCAACACTTTGATTAAAAATGCAATCAACAGGTATTACTCAGCTAATTCTCGCCCTGGATGCATGGATATTAA
ATCTGATAATTTTGATGAAAATGCTAACATTGACAATGGCATATGCCAAAATCCAGACGATAATTTCAAATTCGGAGGAG
TTTATCAATTTTGTTATGGGCTGAGTGCTAAATGTAAGGAACTGAACCAACTCAACCCAATCACTGGAACATCCTCATGT
CCAGATGGATTTGACCCTGTTGAGCTATTTTATGTATATAGTAATGAGAATAACGATGGTATGGTCATCAACACGTTTTG
GTGTGCTCCTAATCAAAAATCAACTCATTCAAATGGATATTTATTTGGCGGGATTTTTACCGATGCATATCCGAACCCTG
TTACTGGATCTTCTAGTTGTCCACAATATTTTCTATCTTTGAAATTTGGACGTACCGCAAAGATTTGCGTTTCACAGGAT
ATCGAACTTGGAATGAAAAATAGTCTGCCTTTTGGAGGGTTTTTCAGTTGTTCCATGGGGAATCCCTTGACACAGAAGAA
GACGACTAATTCTCCCGCTGACTATTGGACCCAATCATGCGCACCCGGTTATTCTGCACATTTGGCGGTCATCGAAATTA
ATTGTCAGATTTCATATTGTATCAAGAGTAACGCATTAAAAGGCAAAGAAGAAATTCCTCTTTATCGGCCACCATTCATT
AATTTAGACGATGGAATTAAGTATAATTCTATAAAGAAATTTCAAACTACTTCCGGGATAGAATTGAAACTTTCCAAGGA
CGGAATGTGGAATAAAGTGAAATATGTTCCTTTCGCAAGATCTAAATTTGGTTTAATTATTTTTTCCGAGGTTACCCTAA
TCTTGGTAATTATTGTTGTGGTTTTAATGGTTTGTTGGTTTAAATCCCGTTAAAAGAAAAATTGTTTTAAATAAAGACAG
ATCGGAAGA
>SMED30025555 ID=SMED30025555|Name=Lysosomal alpha-glucosidase|organism=Schmidtea mediterranea sexual|type=transcript|length=769bp
TGTCAAATGTCGCACGGAAGATTATTGTCTGCTTTGCCAGAATTTATAGTTCCAAGAAACAATGACAGACTTGATTGTTT
TCCTCAGTCAAATTCTAATAGAAATGATTACATTGCAAGAGGTTGTTGCTGGTCACCCGCACTTTCGCTTAATAAAATAT
ACGGATATAGTGAGATATCTGTTCCTTATTGTTATTTTCCAAATGATTTTCCAAATTATGAAATAAAAAATATCCAGGAA
ACGAAAAATGGAATAAAAGATGAGTTGATAAAAAAAGCGAAAAGTCATTTATCCGATGAAATATTGAATCTATTCTTTGA
AATAAGCTATGAAACCGATACGATAGCTAGAATTAGGATAACTGATCAAAAAGAAAAAAGATTTGAAGTTCCGATTACTT
ATAATTTAGGTCGTTCACTGGTAAATCAAAAAAAGTATGATGTCATCATTTCATCCAGTGGATCGTTTTCTGTTGAAATT
ACCAGAAATTCAGACAAACGCTCACTTTTCAAATCATTTGGTCCACTTTTATATTCTGATCAATTTTTACAAATATCAAC
ATTGATGTCAACAGATCAAATTTATGGAATTAGAGAACAAAATGGACCCTTTCTTCATCAATTATCCAATGGCTGGGAAA
TAATTGGATTGTGGGCAAGAGACAATGATTTTGATTGTTATCCACATACATGTTAATTCTATATTTATTGCGTCCTATTG
TATATTATTTTAATCCCGTTTTCATTATTTTCCCATCTTCCAATATGAG
>SMED30025388 ID=SMED30025388|Name=Myosin heavy chain|organism=Schmidtea mediterranea sexual|type=transcript|length=6089bp
TTTTTTTTCGAGTTTGTGCTAGAAATTAATTTCAGTTTGAAATTTTTTGCCTATTTCGAGTTCTTTGAAAACAATCTGAA
AACATGAACCCATCTGATCCCGATTTTCAATATCTCGGTGTCGACCGAAAAGCTTTAATGAAGCAGTATGGGGATTCCTT
TGACAGCAAGAAAAACTGTTGGATTCCTGACGAGAAAGAAGCCTTCATTGCGGCGACAATTGAAGATGCGTCTGGAGATG
TCTATACGGTCAAAACCGATAAAAGTGAAACCAAGACTGTTAAAAAGGACGAAATCGAACAAATGAATCCACCGAAATTT
TTGATGATTGAAGACATGGCAAATTTAACCTTTCTAAACGATGCCAGCGTTCTTGATAATTTAAGACAAAGATATTACAA
GAATCTGATTTATACCTACTCTGGACTGTTTTGTGTGACAATAAATCCATACAAAAGATTTCCAATTTACACCCCGCAGG
TGATTTCAAAATACAAAGGTAAACGACGAACTGAAATGCCTCCACATATTTTCTCGATATCCGACAATGCTTACACCAAC
ATGTTGGCGGACCGAGATAATCAATCTGTCTTAATTACTGGTGAAAGTGGAGCTGGGAAAACTGAAAATACAAAAAAAGT
TATCACTTATTTTGCACACGTTGCAGCTGCTACTAAAAAAGAAGAGGATGATACTGGAACTGGTCAAAAGAGAAAGGGAA
CATTGGAAGACCAAATCGTGCAAGCAAATCCTGTTTTAGAAGCATACGGTAACGCAAAAACTGTGCGAAACAACAATTCA
TCCAGATTTGGTAAATTCATTCGTATTCATTTCGGTACAAGTGGAAAAATAGCTGGAGCTGATATTGAATTTTACTTACT
CGAAAAATCGAGAGTAAATTCTCAACAGAAAGGTGAAAGAAACTATCACATTTTCTATCAAATTTTATCGAACGGAGGAA
AACCATTTCATGAAAAATTACTCATCTCTCCTGATCCAGCTTTGTATTCCTTCATTAATCAAGGTGAATTAACAATCGAT
GGAGTCGACGATGAAGAAGAAATGAAAATAACTGATGAAGCTTTCGACATTTTGGGATTTTCTGCCGAAGAAAAAATGAG
CTTGTTCAAGTGTACTTGCTCAATTTTAAACATGGGCGAAATGAAATTTAAACAAAGGCCAAGAGAAGAACAAGCCGAAG
CCGACGGTACTGCTGAAGCTGAGAAAGTGGCTTTTCTGTTGGGTGTCAATGCAAAAGATTTAATGCAATCGATTCTGAAA
CCGAAAGTTAAAGTTGGTAATGAATATGTCACAAAGGGGCAGAATAAAGATCAAGTTCTTTATTCGGTTGGTGCGCTAGC
AAAATCTCTTTACAACAGAATGTTTGCGTGGTTGGTTTTGAGAGTTAACAAAACCCTCGACACTAAAGTCAAGCGACAAT
TTTTCATCGGTGTTTTGGATATTGCCGGTTTCGAAATTTTCAATTTCAATGGATTTGAACAAATTTGTATTAATTACACC
AATGAAAGATTGCAGCAATTTTTTAACCATCACATGTTCGTGTTGGAACAGGAAGAGTACAAGAAGGAAGCGATCGATTG
GGAGTTCATTGATTTTGGAATGGATCTTCAAGCGTGCATTGAGCTCATTGAAAAGCCAATGGGTATTCTGTCAATCTTAG
AAGAAGAGTGCATGTTTCCGAAAGCATCTGATATGACATTTAAAGCAAAATTGTATGATAATCATCTCGGAAAAAGTCCC
AATTTTGGAAAGCCAAAACCTCCAAAACCCGGACAGGCTGAAGCTCACTTCGAATTGCATCACTATGCTGGCAGTGTGCC
ATACAATGTTACTGGTTGGCTGGAAAAGAATAAAGATCCTCTCAACGAAACTGTGATAAATCTACTTGCGGCAAGTAAAG
AGGCATTAGTTTCGAGTTTGTTTGCTCCGGCTGAAGATCCAAATAATACGGGTAAACGGAAAAAGGGTGGGGCCATGCAG
ACCATTTCTTCAACTCATAGGGAATCCTTGAATAAATTGATGAAAAATTTACAAAGTACCAGTCCACATTTTATCCGATG
CATTGTTCCAAACGAATTCAAACAACCTGGTGTAATCGACGCTCATTTGGTATTACATCAATTGCATTGTAACGGTGTCC
TTGAAGGCATCAGAATCTGTCGAAAGGGTTTCCCAAACAGAATGATTTATTCTGAATTTAAACAAAGATATTCTATCTTG
GCTCCAAATGCAATTCCACAGGGATTTGTTGAAGGCAAACAAGTAACGAGCAAAATTCTGGAAGCTGTTCAATTGGACAC
CAATCTTTACCGCCTGGGAAATACTAAGGTATTTTTCAAAGCTGGAACTTTGGCTGATTTAGAAGACATGCGTGATGAAA
AATTATCTTCACTGATTTCATTGTTTCAAGCTCAAATACGCGGATATTTGATGCGAAGACAATATAAAAAATTACAAGAT
CAGAGAGTTGCTCTATCTATCATTCAAAGAAATATTCGTAAATATCTTCTTCTGAGAACATGGCCATGGTGGAAATTGTA
TACCAAAGTTAAGCCACTTTTGAACATTGCTCGTCAAGAGGAAGAAATGAAAAAGGCCGCTGAAGAATTGACAAAATTAA
AGGAAGAATTCGAAAAAGTTGACAAATTCAAAAAAGAACTTGAAGAACAAAACGTCAAATTGTTGGAAGCTAAAAACGAT
TTGTTCTTACAATTACAAACCGAACAAGACAGTTTAGCCGATGCCGAGGAAAAGGTTTCAAAATTGGTTATGCAAAAAGC
CGATATGGAAGGAAGAATTAAAGAATTGGAAGATCACCTTCTAGAAGAAGAAGATAATGCTGCTGGACTGGAAGATATCA
AGAAGAAAATGCAGGGTGAGATTGAAGAGTTGAAAAAAGATGTTGTCGATTTGGAATCTTCATTACAAAAGGCTGAACAA
GAGAAAACCGCGAAAGATCAACAGATAAAATCGTTACAAGATCAAATGGCAAAACAAGAAGAAGAGATGAACAAATTGAA
AAAGGAGAAAAAGGCCGCCGATGAAGTGCAAAAGAAAACCGAAGAATCTCTACTAGCGGAAGAAGAGAAAGTCAAAAATC
TAAACAAAGCTAAAGCCAAATTGGAACAGACCATTGATGAGATGGAAGAAAACCTCTCGCGAGAACAGAAAATCCGAGCT
GACGTAGAAAAAGTTAAACGAAAAATCGAAACTGAACTGAAACAAACTCAAGAGACCGTAGACGATTTGGAAAGAGTAAA
ACGAGAATTAGAGGAACAATTGAAGCGCAAGGAAATGGAATTAGTCAATGCTTCATCGAAAATTGAAGACGAATCGGGAT
TAGTTGCCCAGCTTCAGAGGAAAATCAAAGAACTTCAAGCTCGAATTCAAGAATTGGAAGAAGATCTGGAAGCAGAAAGA
CAAGCCCGTGCAAAAGCAGAGAAAAGCCGACATCAACTCGAAGGCGAGTTGGAAGAATTGAGTGATCGACTGGAAGAACA
AGGAGGCGCAACCTCAGCTCAAATGGATCTCAATAAGAAGCGAGAGGCAGAATTAATGAAATTAAAGAGAGATTTAGAAG
AATCGAATATGCAACACGATCAGGTTATCGCACAAGCTCGAAAGAAGCAACAGGATGTTGTCAATGAATTCTCAGAACAG
CTCGATCAACTGCAGAAAGTCAAAGCTAAAGTTGAAAAAGAAAAGAATGAGATGAAAGAAGATTTAAATGACCTACAAGG
ACAGCTGGAATCATTAAATAAAGCCAAGGCTAACAGCGACAAACGAATCAAAGAAATCGAAGCTCAAAATTCCGAATTAC
AGGGCAAATTGGAAGAGGCAAATAGACATATCAATGATGCCAACAATACATCTGGAAAGAATCAACAAACCAATGCGGAA
CTCCAAGCACGTTTAGAAGAAGCCGAATCGCAAATCAATCAGCTGGGTAAAGTCAAGCAACAAATGCAGACTCAACTCGA
AGAAGCCAGGCAAATCGCTGAGGAAGAGTCGAGAGCAAAGGCTAAATTGAGTTCTGATGTTCGCAATCTCAATGCCGATT
TAGACAATCTCAGGGAGGCACTGGAAGAGGAAAATGAGAACAAAAGTGACATACAGAGACAGCTAGTTAAAGCTCAGGGA
GAAATGCAACAATTGAAGGCTAAATTCGAAGGCTCGGGATCCATTCGTTCAGAAGAGTTGGATGAAGCCAAGCGAAAGTT
TATGACACGAATCCATGAGCTGGAAGAGGAAGCTGAAACCGCCAAATCGAAAGCCGGACAACTAGAAAAAGTTAAAGCTC
GACTCCAAGGAGAAATCGAAGATATGCTGGTCGACGTTGACAGAGCGAATACACTCGCATCTCAGTTGGAAAAGAAGCAG
AAAACATTCGATAAAGTCGTGTCAGAATGGCAGCAGAAATATGCTGAATCTCAGGCGGAATTGGAAGCATCCCAGAGAGA
AAGCAGGACGATTTCAGCTGAGGTGTTTCGAATGAAAGCACAAATCGAAGAAAGTCAAGAGCAGTTGGAAAGCGTTAAAC
GGGAAAACAAAAATCTAGCAGATGAAATCCACGATTTGACAGAGCAAATCGGAGAAGGAGGTCGCAGTGTTCACGAAATC
GACAAAGCAAGGAAACGATTGGAAATGGAAAAGGAAGAATTGCAACATGCGTTAGAAGAAGCCGAACAAGCTTTGGAACA
GGAAGAAGCCAAGTCTCAACGATCACAACTGGAAATGAGCCAGATCAGACAAGAAATCGACAGGCGATTGGCTGAGAAGG
AAGAGGAATTCGAGGCCACTCGAGTCAATCATCAAAGAGCAATGGAGTCAATGGAAGCCTCACTTGAAGCCGAATCCAGA
GGCAGGGCTGAAGCAACGAAGATGAAAAAGAAACTGGAGCACGATATCGGTGAACTGGAAGTTGCAGTGGATACCGCCAA
CAGAATCCGATCGGAGCAAGAAAAGAACGCAAAGAAATTCCAGCAGCAAGTTCAAGAATTGCTATCAATGGTGGAGGATG
AGAAACACCAGAAGGATCAGATACGAGAGCAAACGACGATGACAGAAAGGAAATTGACAATGGTCCTGGCAGAGCTTGAG
GAGGTTCGTGGCTCATTGGAAAATTCCGAGAGAAACAGGAAAAATACCGAGAATGAGAAAATGGAAATAACTGATCGATT
GAATGAGTTGAGTGTCCAGAGCTCCGGTTTCATGGCTACCAAGCGGAAATTGGAAGCTGATTTGGCTGCTATGCAGTCCG
ATTTAGAGGAGGCCGCTACTGAAGCCCGACAAGCCAATGAACAAGCCAAGAAGGCTGTTGCTGACAGTGCGAGATTGTTT
GATGAAATCCGGCAAGAGCAGGAACACGCACAGCAAATCGATAAGATCAAGAAACAACTCGAGGCCCAAAATAAAGAATT
GCAAGCCAAATTAGATGAATCGGAGAATAATGCTTTGAAAGGTGGCAAAAAAGCCTTGAGCAAACTAGAGCAACGCGTTC
GTGAACTTGAAGCCGAATTAGACGGAGAACAAAAAAGACACGTTGAAAGTCAAAAGAACTCCAGAAAAGTTGAAAGACGG
CTTAAGGAGCTTGGATTACAAACCGACGAAGATAAGAAGAACCAAGAAAGATTGCAAGATCTGGTGGAGAAGCTTCAAGG
TAAAATCAAAACCTACAAACGCCAGGTGGAAGAGGCGGAAGAAATTGCTGCTGTAAACTTAGCAAAATACAGAAAGATCC
AACAGGAAATCGAAGATTCCGAAGAAAGAGCTGATCAAGCTGAACAAGCGTTGCAGAAGCTGAGGACCAAAAACCGCAGC
TCCGTTTCGACAGCGAGAGGCGGTAGCATGGCTCCCGGCATGACCACAGTGAAATCGACATCACTCTCTGTTTCGGCTTC
GAGCCGACGACAAGGTTCTAGTGTTTCCAGAGAGAGCTAAGTCAGAAATTCTAGTAACACAACGATAAATTATTAGGATT
TACTTAATTGACATTATTTGCATGTTATCAATTATTGGACACAATTTAGTGATGCTTTTATTTAATAAAATTTACATTTT
GAAAAAAAA
>SMED30022907 ID=SMED30022907|Name=Synaptotagmin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1814bp
ATTTATTGAAAATTATTTTTTCTATTATTAGGAGAAAATTGATTATTTTTTTTTGACAAAATAAGTTTTGGATATATTTC
CCATTTGTTTGTATTCGTAAACCAATGAAGAATTCGACTCACGGATCGGATCATTCGGCCAGCAAGGCCAGTATGAAAAC
GAATGTGGAAAAATTTTGGCATGATCTCGGAAAAAAATTGCACATGGATCCAAAAGCATTAATAGGAGTAACAATCGGTT
TGGGAATATTGTTTTTGTTGTTCCTTTATTGCTTATGTAAAAAATGTGTTTTCAAGCGTCGAAAAAAGAAGGAAACGGCC
AAAAAAGGAGCCAAGGGAGTAGTCGATATGAAAAGTGCCCAATTGTTGGGGAATTCATATAAAGAAAAAATTCAACCCGA
TCTTGAAGAACTTGATGCAAACATGGAAGACAATGAAGGTGTAAAAGAAAAAGAAGATGTTCATTTAGGAAAATTACAAT
ATTCTCTAGATTATGATTTTCAGAAAGGAGAATTAACTGTTGGAGTTATTCAAGCAACTGATCTTCCAGCTATGGATATG
TCAGGAACATCAGATCCATATGTCAAATTATACCTTCTCCCAGACAAGAAAAAGAAATTCGAAACAAAGGTTCATAGGAA
AATTTTAAATCCTGTATTCAATGAAACTTTTGTTTTCAAAGTTCCTTTCAATGAAGTTGCATCGAAGACTTTGATTTTCA
ACGTTTATGACTTTGACAGATTTTCCAAACACGATCAAATCGGTCAAATAAAAGTACCATTGGGAGCTATAGATTTAGGT
CGAGTTATTGAAGAATGGAAGGAACTGGAATCTCCAGAAAACGATGGGGAAAAGGAAAACAGGTTGGGAGACATTTGTTT
CTCTTTAAGATACGTACCGACATCTGGAAAGCTTACAATAGTCATTTTGGAAGCAAAGAATCTTAAAAAAATGGATGTCG
GAGGATTGTCTGATCCATATGTTAAACTTTCCTTGATGCTTAATGGTAAACGAGTGAAGAAGAAGAAAACTACCATCAAA
AAGTATACACTAAATCCTTACTACAATGAATCATTTTCCTTTGAAGTACCATTCGAACAAATACAAAAAGTGAACTTGAT
CGTCACGGTTGTTGATTATGACAGAATCGGAACCAGCGAACCGATAGGTAGAATTGTTCTGGGATGTAACGCAACTGGAG
CAGAATTGCGACATTGGTCGGATATGTTGGCAAATCCCCGGCGACCAATCGCCCAGTGGCATACCCTCCAAGAGATGCCA
GAGAACAATTGATAGTGTTCGTTTGATGCTTTAAAGCGGTTTGCATAATTCGTGAAATAAGTTATCAAAATTTGAGAAAT
GTTTTTTTTTCTGAAACAAAAATGGCATGAGACAATATACCAGAGTTCATTAGTGTGTGGTTTCGTTGAATATTTTGGTG
GTGTTGCATCTTATCGTTTGTCCTCTAATCTAATAATGTTTTATTCTTTATATAGCTGATTTATTCTCGAGCGAAACATT
TTTTATGTGTACCAAAATACTTATGTCATAGCCATTGTGATTAGTCTGTAAACTATTGCGTAATAGCCCCTCTCATTGGC
TTTTTTTAAGAGTAGTGAGTTGGAAAAAAAAATACAAAAATGACTTCAATTGTTAAACATTACTCATATTTTATCAGTAA
GTTAACTTGCATATTTGCAGTTAATTATGGCATTTTATCTCTAAATCTCTGAAGCATGGCCTCAAGTCTTTTGTTTGTTT
TAATGTAATTATGTCTAGATGAGAATATTAAAATACTTCGGTTTATATAAAAGA
>SMED30015313 ID=SMED30015313|Name=Cysteine-rich secretory protein LCCL domain-containing 2|organism=Schmidtea mediterranea sexual|type=transcript|length=614bp
GATTTACTTTACATAAGCGATTGTATCAATAAATTATCGTTTGAGATGAATTCGAAATCAGTAAATTAATCATCGTATTC
ATAGAAAGAAAATGAGAAATTCTCTATTATTTAGTATAATGTTAGGTGTCGTTATCTCAGTTATCCAGTGTTATCTGACT
CCTGACCAACAACAACAAATATTGTATGGAACGATGAAGCTGCACAACGAGCTCAAATGTCGGCTGATCGTTGCGTTTTC
CAATATGATCAATCAAGAGATCGTCGATTTGGAGGTTATAGCTGGGTTGGTCAAAATATTGCATACTGGTCAAGCAATGA
CGTGACAGACGGTATCAAGATGTGGTTCGACGAAGTCAAAGATTACACATTCAATGGAGATAAATGTAGTGGATTTACAT
GCTTGCATTACACAGCTTTAATCTGGGCAAAAACCAAGGAATTTGGATGTGGAATAGCAGATTGTTCTCGAAAGGGTTTA
GGAAATATTTACATCGTCTGTAATTATGGACCCGGTGGAAATTGGAACAACGAAGCACCATATAAAGTTGGACAAGCATG
TTCCAGATGTCCAAATGGAACCAGATGCAGCAATGGACTATGCAGTTAGAAATA
>SMED30035691 ID=SMED30035691|Name=Macrophage-expressed gene 1 protein|organism=Schmidtea mediterranea sexual|type=transcript|length=2718bp
TATATTTTAGAGATTATGATTATAAAAATTTAAAGTGCCGACAGTTAATAAAAACAATTAATGCTTACAACGTAAGGTCA
TCATGATGATGTAATCATTCGGATGTTCTATGACGTTCGGATAACCCTTATCACGTGGATCCTAAACAAAATATATCAAT
CAACTAGGAATTACAATATACATTTGTTTGTTCAACAGTGAAACCAGTGATACTTTGTATGTTTAATAATATAATAATAA
TTATATTTGTCTGTGGAGTTCTATCTTTTAAATGTAAAAGCGAATCAAACAGAGACCTCCCGTCAGAGAGGCAAGTCCAT
AAATGTAAACTTACTAACAAACAATACGCATTCGATATCCTCCCTGGATCTGGATGGGATAATCTTGAAAACAAGGAACT
CGGTCAAGTTTTAGAAATTTCATACAAGGAATGTTTGGCTTCGAATGATGGCAGCTTTCTCATTCCTGACAACTCGGTGA
TTATTCCGATCAAAAGGTCAACTGTCGAATTGGCATCTGACATATTTGATCATTTCTCTAATTTCACATCTGCCACGTCC
AAATCCATAAATGCCGATGCAAGTTACGCCACACCAAGCTATCAGATTAGTGGCTCGTTTTCATGGGAAAAAAAGGATGT
AAAAAATGACCAAATCAAAGAAAAGTCTTTGGTTTCTCGGGTACAATTGAGACACGAATTTTACACCGTTTCATTTCAGC
CAGACTCGAAATTTGATCGTCAATTCAAGAACAGAATTCTAGATATTGGAGCGTTATTGAAAGAAGGAAAAGACACAATT
TATCCACAATATTTAGCGGATTTAATTGTCCGTGACTTCGGCACTCACGTCATTCGGTCGGTGGATGCGGGAGCGACACT
AATAAAGACTGATGTTTTAAAATCGAATTATGTCAAAGGTTTTAAAGGGGATACAACTAAGATTGCAGCTGCGGCATCAT
TCAGTATGACAACAATGCTTTCAGTCAACCTCAAAGGAACCTATGTTGGTGATACCACGAGTCTCAATGAATTCAATAGT
AATAGTGCAAGTACAAAAGTCGAAACTTTTGGTGGTATACCGTTTGGTTCGAATTTTAAGTTGGAAGATTGGGAGAAAAC
CCTTGAAACGAATTTGGTAGCAATTGATCGCAAAGGTGAACCGTTGTCCTATGCTATTACATCAAGAACTCTTCCAGAAT
TTGACGAGAAAATTATTTACAAAATCGCTACTCTCATCAAAGAAGCAGTCAATAGATATTATGCAGCCAACACGAGAGTG
GGATGTATGAATATGGAGTCAGAAAATTTCAATGACGACGCAAATGTTGACGGTGGAAACTGCGAACCTCCTAATACATT
TTACAGTTTTGGAGGAACTTTTCAAACCTGCTCAGGCCCTGATTATCAGTGTATGGATGTCGCGGCAAAAAACCCAGTGA
CCAATAGTTATGCTTGTCCTGATAACTATGATACCATTGAATTACAAAGTGGATTGAATAAATGCATAAATTATTGCACC
AAATACTTATTTTCCACTCAATGTCATTACGAGTGTTCCCAATATGCATTGTATTGGTGTTCTTCTACAAACAAAACGAA
AATATCAGAAGGCGCACTTTTCGGGGGATTCTACACTAATACATTTCCGAATCCACTTACAAATTCCTATAGTTGTCCAC
AATACTATGTAGCGACAAGATTCGGCGTAAACGCCAAGGTTTGCACTGCACTCAATAAGGCAGAGGCTATGGAACACCAT
TTGCCGTTTGGAGGATTTTATAGTTGCAAAGTTGGAAATCCTCTACTAGATGATCCTCTCTACAACATTACACAGGATCC
CAAATATTGGCCTCAAGGTTGTTCAACCGGATATTCATCACATGTAGCTATTGTCGACAGAGCTTGTCAAATTTCCTATT
GCGTTAAAAATAACGCCCTTAGCATGAGAGAGCAACCGCCTCTCTACCGACCACCTTTTATTGATTTGGGATTTGGACCC
AATATGACAGTAATTACCTCTCTGGACACTCCAATGGGGGTCCGATTATCTGTTGATGAAAACGGGAAATGGAGTCATAA
TCACCAATACAAATTATCCAATTACAATATTATAATAATATCAGTCATTATGGCGGCAGGAGCCAGCATTGCAATTATTA
TTATAATTCTTGGAGTTCAAAGATTCAGCAGAAACCGAAAAGGTCAAGTCTCACCGGAATCTCATGAATTTGATAGCAGA
TATGATTCTACTAAAGATGTTGCCAATCTTGCGTTACCCGGCGAGGTTCCACCGTTTCGTGTTATAATTGACGGAGCGAA
ATGATGCTTGGAACCTTTTATTATTTCTGTTGAATCTGATCTGTAAATGTTTTCAGAATATTTTTCTAATAAAATCGTTC
TGAAATTTTAAAGTGATCCTTGATGCTATTAAATGATGGACTTTATTGTACCCCGAATTGGGTCACCCTTGTTCACGCAA
ATTCGTGCTTAGGATATTTGTACGGGCTTATGCAACTTTTTAAATTTTTATTTTTCCTTATTTTTATTAGCAATCCGTTT
TATTTATAACGACAAATGCTTGATGTTTGAATCAAATTTTTATTATGTTTCTTAATGAAACATAGTGAACAATGTGCCAC
TAATTTCATAACCAAGGTCTAATCAAATAGTTTGGGTAGTGAAAGCAATATTACAGAGTTTAGGTTTGTCATTCATAT
>SMED30027428 ID=SMED30027428|Name=forkhead box A-1|organism=Schmidtea mediterranea sexual|type=transcript|length=2149bp
ATCACTTGGTGCTGCTTTTTGCCCCGATAAATCTCTCGGTGCTCCAAAATTTGTGTAAGCGAGCAAAAGATGATTGGGCA
ATTTCTAGCACGTCATTCGGCAACGATGTTTACAAGTTTCTCTGATTGGATGATAAAGTAGAAACTTTCCGAAAATGAAA
CTTCTCCGAACATGCGCATACCGACTGAAAATTAACTCTAAGCCAGCCAATGGAATTGAAGCAAAATTCAAGAGAATATT
AATTGACTTCGCGAATGAACTCAAATTTTCTATTGGCGTATTGTGTGTGCCTCATTGTGAGTGGTTGCGATCGCATCTCA
AATTATTTACACACAAAAAAATAACGCACACAGACATTGAATAGATATATTTGATCAAGTCAATATCACAATGTCAATAT
TAGCTTTTTCTGAAGAAAGAAGACGAACTAGAAGAAAAACAACAACGAAATAGATTCGATAAGGCTACTGAGCGATTTTC
ATAATCTAAATATTATTTTATTATTGATACGGACAAAAATTGGTCTTTTACCAAGTACTACTAGATTGTTGATAAAGAGA
GGTTATTTAGATGCTTGGAAAAAATCCTTATGAAACTGCAATGAGCAACGTGTATTCTCTACCTCCGGGAGGTTCTATTT
ACAATATGAACCCGATGAGTATATCATCAGCTGGCTACAACTCTCAACAAGTATCAACACTATCGTTGAACTTGACCGGA
ATCGGACCTCATTCATTAAGCCCAATGAGTGCAAGCATGTCGGGTATAGCTGCAATGGCCGGTGGAATGAGACAAGGTCT
TGAGTTGGGTCTTGGTAGAAGTGATAGTCCAAGAGATAAAAATTCAATTTCCAATAACAACCGACCATATCAAAGAAGTT
ACACTCATGCCAAGCCTCCATACAGTTATATAAGTTTGATAACAATGGCGATTCAAAATTCTCCAGTAAACATGTGCACT
CTATCGGAGATCTATCAATTCATTATGGATCATTTTCCATACTATCGTCAAAATCAACAGCGATGGCAGAATTCGATTCG
ACATTCTTTGTCCTTCAACGATTGCTTTGTTAAGGTTAGTAGAAGCCCAGAAAAACCAGGTAAAGGCTCATATTGGACCT
TGCATCCTCAATCAGGTAACATGTTTGAAAACGGTTGTTATCTCAGAAGACAAAAGCGATTCAAAGATCCACACAGAGAA
ATCGGCAGACAGAGTCAAAGAGCTGCCACTGGTCCTGGATCAAATGTCACAGAAAACAATCACGACAACGCATCGCAAGA
AGCTAGTGATAACGCAGAAAGTGATACGAAACCCAACATCAAGCAACTTGATTTATCAAGCGATCTCTTAACTAATCAAG
GTCATAATATTAAAAATACTAATCCAACTTCTGTTAGTCAGAGTTGTTCGATGTTTCATCGGAAAAAGGAAAACTGCTCA
CCAGTAGAAATGAAATTGAATAACCAAAACCAACAATCAAACCAGCAAGAACATCCACAAATCCATTACAATCCCAATCA
GCAATTCTACTCAAATCAGCAAAACATTTTCCAACAAAGTTCTCTTGATCATTACAGTCTATTAGCATCCGATGATCCTC
TTGGTCAAGGTATGCACTTGCCACCAGGTGCAAATAGTGTTTTCGGACTTTACGGGGCACATAACTTACCAAACGATGAT
CAAATTTCAGTGTCATTACCATCGATATCCTTATCCGGACATCCGTATGACAATTTATCAACAGCAATGGCATATCAATA
TGAAGCATCTCAACACAATTCTTCATTACTAACGACAAGTAATCCGTTCTCAATAGATCGTTTGATGCATCCAAGACTAG
TCGCTGCAGCGATGGGGGTCAGTCCCCATGATACTCTATACGCAGGAGCTACCGGCCCATCAGTTGATCTAGAACACATG
AAATACTACTCAAACTACAACAATGTGCCTCCTTATTCCTCTGCAATGTCTGACTACTACAAATATGTACAAAATCCTCA
GCCGGGCAACAGCGACATGAGTCTTTGAATTGAGTCCATTGAAGTCTACGGCAGTTTCCTCGAAATTTCACATTCAACCA
GATGTTTATCGCCTAATATAAAGCTGTGTTTTTTTATTTATTTACAATTAAATCTTTGTACAAGAGATC
>SMED30033415 ID=SMED30033415|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=703bp
AGAACAAAAGGATACGTAACTCCAGTGAAGTATCAAAAAAAATGTAAGTCCTGTTATTCCTTTTCAACTGCAGGATCTCT
TGAAGGTCAATATTTTCGGAAAACAGGCAAATTGGTTAATTTTTCTGCACAGCAATTAGTTGACTGCAGTAGTTCTTTTG
GAAATGAAGGATGCCGAGGAGGATTTGTAGAAACGTCCTACAGCTATGTGATGGAATACGGCATTCAGTTAGAAAGTGAT
TACCCGTATGAAGGAAAATTTAGACAGTGTAAATACAATAAATCTCAAGTCGTAGGAAAATGCAGTGGATTTGTTCGCAT
AGAAGAAGGGAATGAAACTGATTTGGCCATCGCGGTTTCAACGGTTGGACCTCTGTCCGTTTCAATAAATGTTCAAAAGG
ATTTCATGGATTACAAAAGTGGCATTTACAATAATGCGAATTGTCTGTTTTATTCATTAAATCATGCTCTTCTACTTGTC
GGTTATGGATCAGAAAACGGAGTCAACTATTGGCTTTTGAAAAATCAATGGGGAACTGCTTGGGGTGAAGAAGGATACGC
CAAAATGGTAAAAGACGCGAGAAATCACTGTGGAATCGCTACAGCTGCCAATTATCCCTTAATATAAAATAGACTGATAT
TAATAAAAATGTTTTGTTATAAATTTTAGAATTAAAAAAAGTAATAATAATAATAATAAATTG
>SMED30036022 ID=SMED30036022|Name=Lysosomal alpha-glucosidase|organism=Schmidtea mediterranea sexual|type=transcript|length=2871bp
TTCTAGTACTTCGATCAAAGTCCAAACTACGATTTCCTATTTATGATGAAAATTATTGAATTAGCAAAACGCATTATAAT
GAAAAGTTTCATTATTTTTCAGATCTTTTTTTATTTTTATGTTGCCCATAATTCGGCCGCGAATTCTCCTCAGTGCTTGA
TCCAAAATAACAATGAACGTCTTGATTGCCACCCAGAACCTAATGCTAATGAACAATCGTGTAGAAGCAAAGGATGCTGT
TGGTCTGAACCCATGCGATCATCAAATAAATTACAAGCCTTGCCAGGATCAATTCCTTATTGCTATTTTCCCACAAATTA
TCCCAATTATGCTGTCAAAGATATAGAAGTTTCTAACAGAGGAATCAAAGCGAAACTGATCAAGCAGAAATTTAATCATC
TACCAGAGGAAATTTTATCGTTAAATCTAGATGTCATTTATGAAACGAAATCCAGAGTTCGTATCAGAATATCTGACACT
GAAAACAAGCGATTTGAAGTTCCAATAAAACTAAATCCTGCGGATCCTACTCCGCCAACTGATACAGATTATGATGTCTT
CATTCCATCTGAAGGGTCGTTCTCTATTGAAATTAAAAGAAAGTCAGATGGTCGATCGCTTTTTAAAACCTTTGGTCCAC
TTTTGTATTCCGATCAGTTTTTGCAAATATCAACATTGATGTCAACTGATCAAGTTTATGGGATTGGAGAACAAAATAGA
CCTTTCCTTCATCAACTATCTAATGGGTGGACACGAATTGGATTATGGGCGAGAGATTATGGAATTGAAACATTCAACAA
TTTGTACGGAACTCATCCTTTTTATATGGGAATTCCAGACGATGGAAAAGCTTTTGGTGTTTTTCATTTCAATAGTAATG
CCCAAGAATTCTCGTTGCAGCCTGCACCCGCAATTACGTATCGTTCAATTGGAGGAATACTAGATATTTTCATATTTACC
GGAGACACTCCTGAAGAAACCGTTAAGCAGTACGTAACTCTCATTGGTAAGCCAATGCTTCCTCCATATTGGTCTCTTGG
ATTCCATCTGTCAAAATGGGGTTACAAAAATATTGAGCAATTGTCTGAAATATTTCAAAGAAATATTAATGCCGGTTTCC
CAATCGGTACTCAGTGGAGTGATATAGATTATATGGAAAATTATAAAGATTTTACTGTCGACAAAGAGAAATTTAATGGA
TTGGGAAGATTTGTCAGAGAGATTAAACAAAAATATAACTCTAGATTTGTTGCAATTGTTGATCCAGGAATAAGCTGCAC
AAGTGGTAACGAATATCCACCTTATTATGAAGGAGTATTTATGGATATTTTCATCAAAGATTCACAGACCAATCAACCAA
TTGTTGGCAAGGTTTGGCCCGGAGAAACAGTTTATCCAGACTTCACTCATCCGAACATTTCTATGTATTGGTATAAACAA
ATTCAACGCTTTTATAATGATGTTCCAATTGATGGGCTTTGGATTGATATGAATGAGCCATCTAATTTCTACGATGGTTC
CAAAAGAGGCTGTCAAGGAAATAGTAAATATGACAATCCATTTTTTGTACCGGATATTCGAGATCAGTCATTAATATCTA
AAACTATTTGTTCTTCAGCACTCCATTACAATAACGAAAAGCATTATAATTTGCACAATCTCTACGGCTATACGGAATCA
GTAACAACAAATAAAGCATTATTAAAAACGATACACGGAAAAAGACCTTTTATTTTATCCCGGTCAACTTTCAGTGGATC
TGGTAAATATACCTTCCATTGGACCGGGGATAATCAAGCAAGTTGGGATCAGTTAAGAAATTCCATTAGACAAGTGCTTA
ATTTCAACATGTTTGGTATTCCGATGACTGGTGCTGACATTTGTGGATTTAACGGTAACAGTAATGAAGAACTCTGTATT
AGATGGATGCAATTGGGCGCTTTTTATCCATTCATGAGGAACCACAATGCAATCAACCAGAGAGATCAAGATCCAGCTTC
ATGGAGTATTGAAGCTCAGAAAATCATGAAAATTGCAATAAACATTAGATATGCATTATTCCCTCATTTTTATACTTCTC
TTGTTAAATCTCATTTATACGGTGGAACCGTGATGAAACCAATGAGCTTTGAGTTTTACTCTGATAGAAATACCCACGGA
TTGGACCTACAATTCATGATTGGATCATCTATAATGGTTGTTCCTGTAGTTGATCAGGGTGCCAGAAAAGTCAATGCTTA
TTTCCCAGCTGGTATTTGGTATGATTTCCAAAGTGGTAGTATTTTGTATTCTGATTCCAAAGGTGCCCAGGTAACCCTAG
ATGCTCCATTAGATAAAATAAATGTTGCACTAAGAGGAGGCCATATAGTTTCATTGATATCAGATTCTATGACAAATCCT
CAGATGTCAACAAATAAAATGATTTTATATTGTGCTTTATCGGAAGATTCACAGGCATCTGGAGATGCATATTGGGATGA
TGGGGAAAATGTTGATTCTTATTCTGGAAATAAGTACAATTATTTGAAATTTATTGCCAACGGAAATAGGCTGGAAATTT
CAGTAGAATTCAAGGGATATGAACTTGTCCCGGTGTTGTCAAAAGTAGTAATTTTGGGGGTAAAACAAACTGGTGTACAA
AATGTCTCTATAAATGACAGACCAGTAGACTATCAATTCGACGCAGAAAAATCAATTTTACTGATCAGCAATATTGATCT
TAGTATTGATTCGCACATTTTGCTTTCATGGAATTGACTGAAGCAATCTCACAAAAAATATTTTTATTAATAAAACACTA
TTGTTTTTTAATGCTTGATTAAATTATATTTTTAAAGTTTTTAAAGGATTTATTAATAAAAGAAATGTTTG
>SMED30016085 ID=SMED30016085|Name=Macrophage-expressed gene 1 protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1970bp
TTACAATATAGAAAATGCTTTGCTTTCCTCTGGGAGGGTTGATTCTACTGATATCCATAGCATTTAGCTTAGCTGACATC
AATCTACCTCAATATCAAAGAGGATCAAACACGAATTTCCCATCGAGACGAATGGCCCATGGGTGCCAGTTGACAAATAA
TGAATATCCATTCAATGTGTTGCCAGGATCAGGTTGGGATAACCTCTCTAATCGGGAGCAAGCACAAGTGTTAAAAATAT
CATATGACAAATGTAAAGCCTCAAATGACGGAAGATTTCTAATTCCTGATCAAACGAAATTAGTGCCAAAAATGAAGTCA
ATAGTGCAGTTAGATTCAAATTTGATTTCACATTTTTCAAAATATCCGTCGACTACTTCTAAATCTATTAATGCGGAAGC
AAGTGGAGAAACGAAGAAATATTCAATCAGTGGATCTTTTTCCAATGAAAGGGAAGACGTAAAACGAAATCAGTTAAATT
CTAAATCCTCAATATCCCAATCTCAATTGAGATACGATCTTTACAAAATTTCTCATATCGTAGACGCTGAACTTGATACA
AAGTTTCACCAAAGAATCCTAAACATTGGGGTGTTGATTGAAACAAAAAAGGATTCTTTATATTCAGCATATCTCGCTGA
TTTAATCGTCAGAGAATTTGGAACTCATGTCATTACATCGGTGGATGCTGGAGCCGTTTTGTCGAAAATTGACATCTTGA
AACAAAAATATGTCTTAGATAGTCAAGTACAAAATAGTGACGTATCAGTTGCAGCATCATTCAGTTTGGGACAAATTTGT
GGATTTAAATTCGGTTCAAATTTTAAAAATGATGACACAAAAATTGAGGAATATAACAATAATTGTGCCAGTACGAGAAT
TAAAACAATTGGCGGTGGACCTTTCGGCTCGGATTTCTCTTTAGAAGAATGGGAAAAAACCCTTGACACAAACTTGGTGG
CTATAGATAGAATCGGAGAGCCTTTGTATAACGTAATTACAAAGCATAATATTCCAGAATTTAGTGACAAAACGATTTAC
GAAATAAACTTACTTGTCAAAACTGCTATTGAGAAATATTATTCCACAAACACTCGATTAGGATGCATGGATTTTAATTC
ACATAGCTTTGATGAAAATGCCAATGTCAACTCCGGTTTGTGCAATGAAACGGGAAATACTTATCCCTTTGGTGGGGTTT
ATCAAACCTGCCAGAATTCAGACAAATGTGACACATATAATCAAAAGAATCCCGCCACCGGAGACTATAGCTGTCCAAAG
GCATTTAATCCTATCAAACTGTTTGAACTTGACAATCCAAGTATCACTTTTGTTTGGTGTGCTCCACGAAGCTCTTCAAG
CGCAATAAATGGATATCTATTTGGCGGAATGTATACTGAACAATATCCGAATCTTGTTACTAATAATCACAACTGTCCGC
AATATTACTTTCCTGTCCAGTATGGAATCAGTGGGAAAATATGCATAACTCAAGATAAAGAACTCGGCGGCAAAAATAGT
TTGCCATTCGGAGGATTCTACAGCTGCAAGACTGGAAATCCATTAGCTTTGGCCATTTACAATGGAACTCAGACAAACTT
TCCTCTGACCTGCGGTTCGGGTTATTCTACTCATTTAGCGTCTATTTTTAACAACTGCCATTATTCGTATTGCGTTAAAA
ATAATGCTATAAAAACGAAAGCTGCGACTCCACTTTACAGGCCTCCGTTTGTTGATTTGCAAATGGATTCGAATATTGAA
GTCGTCAGTGAACTCACTACTTCAGCAGGAATGAAGCTGGTTTTAGCCGAAGATGGAATATGGAAGGAAGAAATCCTGAG
AACTTACATGGTCGAGTATATAATGATAGCAGTAACTGTTGCGTTGCTGACTCTAATTGCTATATATATCAAGTTCAAAT
GTTTCGTTGGAAAGAAGTTAAATCCTACTCAAGTTTCAGCAGATCGGAAG
>SMED30022362 ID=SMED30022362|Name=Synaptotagmin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1443bp
CTCTTCCGATCTCAAACATTTCAGTCGCAAAGCAGGTCGCCACGAAATACATAAATCCGAACTCAACTGCTATTTGCATT
AAGCATTTCAATGGCCTTCACGAACATACCAAGCACACACCGACCTTTTGCATAGCAAAATAATTTATTATCATTAAAAC
AACCTTTGTGACTCTATTTTATCGATTTGAACGAAATTCACCACGATGGCACCATAAACAATCAGATCTCACAAATGTCT
GCGACTCTAAGCACAATGTCAACACTGAAGTTCACAAGGCCAACAAATGTAACCTCAAACCTCTACAAAGACATAATCAA
ATATCTTGATCTCCCGGAACCGTTGATTGTAGCAATCTTTGCCGCTGCTGGTTTGTTAATATTCGTTATTTTCATATTGT
TTTGTTCGAGATGCTGCTGCAGAAAATGCTGCAAGCAAACTGCCGATAAAGACAAATACAAAAGACGGAAGCTAGAAACA
AAAGAAATTGACAAAATTTTCAGAGACGAGTTGAATCTTGGATTTAATGAGAGTTTTGGAAAGATATATTTTGCGCTCAA
ATATCTCCTCGTAAAAGAATTGTTAATTGTAAAGGTTATTAAGGTGGAAAACCTACCGACACCAATTGACGACTGTCTTG
ATCCATACGTTGTCGTACAAGTGAAATCAAAAAGTTTGACTGAGGAAAAGAAAACCAAAATTAAATACAAACATATAGAT
CCGGTATTCAATGAAAAGTTTACTTTCAAAATTCTCCATCCAGAACTTAATGATTCGGAAATTTTTTTTAAGGTTTTTGA
CTATGATAAATTTGGAGCCGACTCATTGCTAGGTCAACTTGCACTAAATTTTAAAGACCTCAATCCCAGTAGCATCATAA
ACATGTTGTCAGAGTTTTCCAAAGATTTAAAAGAAGGTGAAGATACATCGGAAGGCATGGGACAGGTATGCATAATTCTG
AATTCAAATGGACAGGCAGGATTACTAGTCACTATACTAGAAGCTAAAAATCTTCGAGTTAAAGAAAACATGAGTTATTC
TCACATTTTTGTCACAGTTAAAATCAAGTCTCGGAAACACGGGAACAAATTTAAAACTCACTCGAAAAAAAGAACCAAAG
ACGCTCATTGTGGACCTTTTCCGTATTTCAATGAAACATTTCTTTTCCCGAAACCTCATGGAACGATATCAGACTGTTTA
GTATCAGTTAAAATTTGGATCAGTAGAATGTTTAAAATGCCAATCTGCATCGGGTACGTCTCATTAGGTTCTGAAATGAA
TATGACTTCCGGCGCCATTCATTGGCAAAGCATGCTTGACAGTCCCCGACACCCGGTTGCAAAATGGCATGTCCTAACCA
ATCCTAATGTGAAAGAATAAAGATTTAATATTTAGTCCTTCAACATATCTTTTTAATAATTAAAATAATAATTATTTGTC
GGT
>SMED30023322 ID=SMED30023322|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=613bp
ACGCATTCTCTACGACAGGCGCGTTAGAAGGTCAACTATTCAGAAAAACTGGAAATTTGATAAGTTTATCTGAACAACAG
ATTGTTGATTGTGATAGTTTTGATTATGCATGTAACGGTGGATTTGTGACTGATACTTTAACTTATATTAAACAAAATGG
AGGAATTGAATCTGAGCAAGATTATCCATATGTGTCAGGAAGGACGAAGAAACCTAATAAAAAATGTTATTTCAAAAAAG
AAAAAATAGTGGGAACAGATACTGGTTTCGTATCTTTACCTCCAGGAGATGAAGAAGCTCTGAGAGAAGCTCTAGTAACA
ATTGGGCCAATTTCAATAGCTTTTTCCGCGTCGCCTTTGTTATCAGGATATAAGAATGGGATATATCATGATTACATGTG
TGCTGATGTTCGCATCAATCATGCAGTTTTACTAGTAGGATATGGAACGGATGAAGAATCAGGAACACCTTATTGGATAA
TAAAAAACAGTTGGGGTCCCGCATGGGGAGAAAATGGATATTTTCGAATGGAAAGAAATAAAAACATGTGCAACATGGCA
TACAATTCATACTATCCATTGGTTTGATTGAACGACTTCTTATGAGTGTGTGT
>SMED30005748 ID=SMED30005748|Name=HNF4|organism=Schmidtea mediterranea sexual|type=transcript|length=3066bp
GAAGAATAACAAAGAAATTTATTGCCAAACTAAAATACCCGGCCTATTTCATCAAAAAAAAAACAATCAAAAACACAAAT
CGCTACGAAAACTTGTATAAAAGATTCACATTAAAAGTCATCAATATTCCTCTTTTTTAAAGACTGATGATTCAGATTCT
TGGATCCGAATGGGGTGATCTGTTAGGAAGTGAGCTGTTGACGAGATAGCTGAATAGTTTGATCTGGAATTGTGCTGTTG
GTTCGCTTCCGATGATCTGTTGGCGATTGATTGAATTTGGCAGTTTTCTATCGGCGAGTTTGGAAGCGACTTGGTATAGG
CCACAAGAAGCGACGGATCAACGACATTTTGAGTGGAATTCACAGAAAGAGCTGGGTGGATTAGGTCATCTGAATTGGAA
GAATTTGAGCAGTTATGATTTGCGTCACTGTTATAGGCGTATTTTGACTGGTTGATCATGGGGAACCCTTGATCAAGGTT
GACCAAGAAATGGCTGGTATCCTGTGATAAATTGGAATGCTGATAAAGATTGATGGAATCATTGACGCATGAAAACAGAG
AAGGAACGCCGACTCTTTCATTTTTCAGCATCATCCCATCGCTGTTGATTATCATACCGAAGTTGCTATTGTCCTGGGAA
TTTTGCTGCATTATTTCAGTTCCTTGATTAACAAAAGCTCGATATATATTTCCTGAAGGCATCGACGTAGAACTTGGCAA
ATATGCACTCCATATTTTTGAGGCCGCTTCAGGTGATATGTTTTGGTTGTTGATATTGAGTAGGACACTGTCTGGCATGA
AAGGGGGAATTCCGTAGCAGTCCTGGTAAGTATATTTCGGTGAGGAAATCCTGTGGGAGTTAATTATATCCATGGAATCG
TTTTGATTATTGTTATTGTTCCCATCTGTTTCTGGATCTATGCTGAATACCCCTGGTGGATTGTCACCCAATAATGTTTC
AGATAACAAGCTATCAATCTCGGCTAATCCTGTCATTTTCATGAACTCGACCTTCTTTACCATCAGCTGGGTGACCAATC
TCAGATCAGGAATTGTCAGCAGCAATTCCCCGAATCTACCCGGCTTGTGGTATTGCTTGTCATTCATGTGGTTCATCAGG
TCCATTTGTATTTGGTATCGGCATCGTCTCACGAACTCCTTGCCAGACTCGCTGACTCTCGGATCAAAAAATACGATCGC
TTTCAAACAAGCGAATTCTGCGTCATCCAATTGCAATTCTCGCAGCGGAATGAACAGGTCGTCAAGGATGTGACTGGCTA
TTTCAGCGAAATGTTTGTCACTGGAGTTCCTACTGATGATAAGATTGTTTCCCAATAATAGCACATCGTCTTCGTCCAAT
TGAAACGACCGCCTTATTACTCCAAGAATTAGAATTTCTCCCGCGTGTGCTTTTAAAAGGGAAATTTGATCGCTCAAGTT
TAACTGTGAAAAACAAGGCAAAGACTTTGCCCAATTCACTAGAAGAAATAACTGATTTTTCATGGACTCGCAAACATCAG
GCACATCGGCATATCTGTTCATGTATTCCTGAGGATTCGGGGGCTTTTGTATTGCAACCCTTTGCTCGGCCTGCATCAAC
TGAGAAATGGAGAGAATGACATTCGGAGGAATATCATCAAACGACGATCTTCGAGTACTGATCCTATCTCGTTCATTTTG
AACCGCTGCTCGCTTCATTCCTACAAGAATGCATTTCTTTAGCCGACAATAACGGCATTGGTTTCGTTTATCCTTGTCCA
TTTTACAATTCCGATTGTACTGGCAAGTGTAGTTATTCTTCTTCCTCACTGACCTCCGAAAAAATCCTTTACAACCGTCA
CACGAGAAAGCCCCATAATGTTTTCCTGTAGCTTTGTCACTGCAAATGAGACAGAGTTGATTGTTTTCCATTCCTTCTGG
TCCCGACGCGTTAGACGCATAGACTTCATGTTGTTGCGAGGACACTGAAACGAAAACTATTTGATAATATTTGTACAAAA
CAACTGACAGATGGTTTCGGAAAAGGTTCAATGTTCAGCCATAGTTCAGCGAAAGGTCAAATTCCTGAACTACTATTTCA
AGGTATAAATTTGAATATATTGGTTTTGCCTCGTGCTAACAAAGTCCAGAAATATAATAAGCAAAGTCTGAATCGTGTAC
TTTGGATTTCTAGCCAGGGGCACACAATAACCTATATTTAATAGCAGTTCATTGCGTTCACTCGTTATTTCTCCGACTGA
ACTGCATTGCAGGAGGATCCGCAACCATGGAGATTTCATAATTATTATCAAAATGATAATAATAATAATTATTATGAGGT
ATTGTAAAAGAAAACGTAACTCACTTTCACTTTCCAATGGATATTGCATCGAGGAAGCGTTGCTGGAAATGGAAATCGGA
GCTGAATTGCTAGTCAATAGTTGATAGGAGAATGCTGGATTGAGGTTCGGATGCTGGGTAGACGTCATATAGAATTGGCT
CGACGGATTCGGTAAAATTATGGTGAAGTTTACAATCGAAGCTCAGATATAACGTATTATAATGAAGTATTATTAATAAA
CTGCAAGTAACGTGCGCGCATTCTGAAGTGGTTGATTGAGAATAATCAGTTCTTATTCGACAAATTCAGATAAAAAAGGC
ACCACTCGAATTGTTCAGCTGCGTCATGTGAATGCCGGAACGTTGTGCGTTGGCTGTTGGCAGATCAGCGCTCCGTGTTC
ACTGCAATCCGGATACACCAGACCACTTGAAATCGTTGCGAATTCAGCGTGTCGAGTGCATTGTGCGAGATCAGTATCGG
TGTGTATGTGTGTCTGCCTGTGTGCGTGTGGATGTGTGTGCTTGTCGAGTCGGTTGTGTGTTTATGAGTGTAACTGTGTC
GATTTGGTCGAATGCAGTAGCAGATAGCTGAAATGCGATTGTTCCTATTTTTCATTTAATATTGTTTTATGTTTTGTTTC
TATTTTTATAATTTAATTTATCAGTTTTTGTTTAGATTATGCAATCATTGTTTAATTTATTTTTGTCAATTTAAAATTTA
TTATTAATTAAATTATTATAATTATT
>SMED30019695 ID=SMED30019695|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=1216bp
TTGAAATTCTGCATTGATGGGAATTGCGTCGTAATAATCACGCGCCGAATATCAAATGTATAAATAAGATATTTGTTCTT
CACTTAATATAATTATAATGTTTGCGATGGGTCCTATCTTGATATGTTTATTATTAGCAGTGATTTCAGAAGCCAGAACC
ACTTATAGCCATCACAAATCAGTTCCAAGTGATGACATTTCTAGTAAATTTGAACTAGAAAATATGGTATCTCTCTTGTC
CCGTTACGACGGAGAATTCCAAACCTTCAAACAGCGATATAATAAATCTTATAGTTCCATGCATGAAGAGAATTCCAGAT
TTTTAAATTTTATATCATCTCTACTTGAGATCAATCATCACAATCAACTTTATGAAAACGGTCAGAAATCATACGAGATT
GGAATCAACCATTTGAGTGATTGGAGTGATGAAGAACTCGCTCAACTGACTAAATTGAAACAATCAAACCTGACGGGCTC
ATCATATTTATCATCCAGTGTGAAAATTGACCTTCCTGATTCATTCGACTGGAGAGAGAAGGGTGCAGTTACTGAAGTTA
AAGATCAAGGAAAGTGTGGATCATGCTATGCATTTGCTGCTACTGGCACTCTAGAAGCCCAAATCTGGAGAAAGACTGGG
AAATTGATCAGTTTATCAGAACAACAAATTGTTGATTGCGATACTAATGATAACAATTGTTACGGTGGATTTGTACAAGA
CGCGTTATCATACATCAAGTCAAATGGAGGCATTGAAAATGAGGAAAATTACCCTTATGTTTCCGGCAAAACAGCAGATA
TGAACCCAAAATGTAATTTCGTAAAAAGCAAAGTAGTGGCGACTGATACTGGATTTGTTAAAATGCCAGCAAATGATGAA
GAAAAATTAAAAGAAGCTCTTGTTACAATTGGCCCTATTTCTGCATTATTATCTGCTCCTAAATCGCTTATAAAATATTC
AAAAGGAATTTTCTACGACAAAGAATGTGAAAAACTAAGAGTTAATCACGCTGTTCTGATAGTCGGATATGGAACAGATC
AAACTTCCGGGACACCATATTGGATAATTAAGAATAGTTGGAACGCATCTTGGGGTGAAAAAGGATATTTCCGGTTACCC
AGAAATATAAATGCTTGCAAAATAGCGTCAGTGCCAGTTTATCCTTTGGTTTGAATTAAAATGTTTATGTAATAAATATA
TTTTTTTGTCTCAAAA
>SMED30003202 ID=SMED30003202|Name=Eukaryotic initiation factor 4A-I|organism=Schmidtea mediterranea sexual|type=transcript|length=1324bp
ATTAATAACAATGGAAAATCCAGGAGAAATAGAAAGTAATTACGACAAAATAGTTGAATCATTTGAAGATTTAAACTTAA
AAGAAGATTTGTTAAGAGGAATCTTTGCTTATGGTTTTGAAAAACCTTCTGCTATTCAGAAGCGTGCTATTTTGCCAGCT
ATTGAAGGTCACGATGTCATTGCCCAAGCACAATCTGGAACCGGAAAAACTGCCACTTTCAGTATTGCTGTTTTGCAGAA
TATTGACACTTCTATCAATTCTACACAAGCTATTATTCTAGCACCTACCAGAGAACTTGCAGTTCAAATCCACAAAGTTA
TAATGACCCTTGGTGACTATATGGGAGCTAAATGTTGCTCATGCATTGGTGGAAGAAATGTCCGTGACGACATTAACAAT
TTGGAAAGTGGAATGCATGTTGTTGTCGGTACTCCAGGACGAGTTAAAGATATGATAAAGAAGGGCCATATTAAATCAGA
TTTCGTGAAAATGTTTGTCCTTGATGAAGCCGATGAAATGTTGAGTCGAGGTTTTCAAAATGACGTTTGTGAATGCGTTC
AATATTTATCTGCCGAAACCCAAAATTTCATTCTTTCTGCAACAATGCCAGATGAAGTTTTAAAAGTCAGTAACGAATTC
ATGAATAATCCAGTGAAAATTCTCGTTAAAAAAGAGGAATTGACTCTGGAAGGTATTCGTCAATTCTACGTTAACGTTAG
CCAAGAAGAATACAAATTTGATACCTTATGTGATTTATATGAATCTCTGACCATCACCCAAGCTGTCATTTTCTGTAACT
TCAAAAACAAAGTTATATTTTTAAATGATAACTTGAAAAGTAAAGGATTTGTTGTTTCATCAGTCCACGGTGACATGGAG
CAACAAGCTAGAGACCAGATTATGAAAGAGTTCCGAAGTGGATCAAGTAGAATTCTCATCACCACAGATTTGCTATGCCG
AGGTATTGACGTCCAACAAGTCTCAATGGTCATTAATTATGATTTGCCTAAAAACAAAGAAAATTATATTCATCGAATTG
GCAGAGGAGGCCGATTCGGAAGGAAAGGAGTTGCACTAAATTTTGTCACAGACAAAGATATTGCTGAAATGCAGGAGCTG
GAAAATTTTTATAACACCAAGATTGAAGAGATGCCCATTAATTTATCTGAATTCTTATAAATGATTTACCGCTATTTTTG
TAAATAAATTTTAATTTACAATTAAATTAGGTTATTCATAACTTCCTTTGTTACGTAATTTTTGCTATCTTATCTATTTT
TGTTAGTAATGTATTTATGCTGCGTCACATTTTTGTTGCAAATT
>SMED30025427 ID=SMED30025427|Name=Translationally-controlled tumor protein homolog|organism=Schmidtea mediterranea sexual|type=transcript|length=570bp
AAGTAATACTTTTATCATTTAATTGAAAAAATGCTCATTTACAAGGATATTGTTGCCGGCGATGAGTTGTGCTCTGATAC
ATTCCCAATGACGATTGTCGACGATGTCGTTTACGAATTCAACGGAAGAAATATTACTATTAAAAACGGTATTTCTGACG
CCCTCTTTGGTGGAAATGCTTCAGAGGAAGCTGCTGGCGATGATGACGTTGCTGATTCGGACGAGACAGCAATTGACATT
GTATACAGCAACCGATTAGTCGAAATGAGCTTTGACAAGAAAGGTTACACGAGTTACATCAAAGGTTACATGAAAAGTAT
TTTGGAAAGATTGAATGCCACTAATAAAGAACGAGCTGAAATCTTCAAATCCAAAGTCGGTGCCTATGTTACAAAAATCA
TCAAAAATTTTGATGAATATCGTTTCTACTGTGGAGAGTCAATGAACCCTGACGGAATGATCATTCCATGCAATTACAGA
GAAGACCAAATTACCCCATACTTTGTTCTCTTCAAAGATGGCCTCGAAGAAGAAAAATGCTAGATTTCTGTTAAATAAAT
TTAGTGGAAC
>SMED30006887 ID=SMED30006887|Name=Gelsolin|organism=Schmidtea mediterranea sexual|type=transcript|length=1378bp
CGATGAGTGGTAAAATGTATGTCATTGTCTCATTGGCGTTAGACCAATCAAAATCATCACGAATTATTTGCTCTCGATAC
AATTCGATTAGAATATAATTGTCATCGTTTGACCTTCGATATCATTTCCATAAATCAAATTTTGTGAGAACATAATGAAG
AGATCAGCGAAATATGATTGGAAAGATTCAAATGTTGAATTGATTGGTTCCAGCGAAGATCGAGCTGTAAAAAAATCGTC
TGCTGAAACTGAAAAAGCATGGGCTGCTGCAAAGGCTTGCAATCATGCTGCATTATTTGTTTGGAGAATTGAAAAATTCA
AAGTTGTTGAATGGCCAAAAGTGCAATATGGAGAGTTTTACGAAGGTGATTCATATATAGTGCTGAAGATATTTGAAAAA
GAAAAACAACTGAATTATGATGTTCATTTCTGGATTGGGAAATATTCAACACAAGATGAATATGGAACGGCTGCGTATAA
AACGGTTGAATTGGATACGCTGCTCGATGACAAGCCGGTCCAACACCGTGAAGTCCAACATTACGAATCGAATTTGTTTA
AAAGTTATTTCCAAAATATTGTATATCTGAAAGGTGGACATGAAAGCGGGTTTAGACACGTTAATACTAGAGAATATATA
CCAAGACTGCTACATTTTAAAGGTGATAAAAGAAATATAATTATTACTGAGATATCGGCGACGAAAAAAAATCTAAAATC
TGACGACGTTTTTATTTATGATACTGGATCCAGTATTTTCCAGTGGATAGGCAAAGGTGCAAATAAAGATGAAAAATACA
AAGCACAACAATTTGCTCAGCAATTGAATGCCGATCGAAATGGAAAGTTAAATATTGAAGTACTTGATGAAGAAGAAACT
CCATCAAATCATGAATTATTCAAACATTTATCGGATTCTGATCCCGAGGAGGAGGACCAGCATCTAAAAGTTTTAAACTT
ACAAGAAACCAAACTTTTCAAAATATCTGATGCAACTGGCTCGTTAAAATTTGAAAAGGTTGCAGCCGGAAAATTGAATA
AATCTCAAATAAATGAAGAGGATGTTTTTATTGTTGACAACGGTCAAATTGTTTATGTCTATGTTGGAGAAGGATCGAGT
CCCAATGAAAGAAAGAATGCCTTGATATATGCTCATAATTATTTGAAGGAAACGGATTATCCTCAAGCACCGGTTACGGT
TATAAATAAGGATGTCAAAGGCGCCAATGCCGAGAATTTTAACAAATTAGTTGAAAATTAATCGGAAATTAAATAGCTGG
AATTTGTGTTAACTTTTTCTTTGGTAATTATGATTAAATATATTTGCGTTTATATTTCTGATTTATGGATTTTAATATTT
AATAAACACAATATTTTG
>SMED30001027 ID=SMED30001027|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=1243bp
TAATAATTTGCACATCAAACCGTAATAATAACGGATCCGTACAATTTCATCAATATAAAATATTACACAACAAATGCGAC
TTGCATCGACAATTCATATAAAAATCTCCAACTTTCACTACTATTCATAAATTACAAATGATCTCCTCAGTTGTATTGTT
ATTTTCTATCTCAGTCGCATTCCTAGCAAATGCCGAAATCTGGGAACCAGATCGAAACCTTTCAAACGTCCATCAGAGTC
ACGCTAATACAAAGTTTTCCAGGAAAATTTCATCTTTGATGGTGGATTTCAAGTCAGAATTCGCCAAATTTAAATTACAA
TATGGAAAGGTTTACGAGTCAATTGAGAAAGAAAACGAAAGATTCAACAATTTCATATTATCTCAAGTTGAAATAAACAA
TCACAATCAAATGTTTGAAAAGGGTCACAAGAAATTCCAAATGGAAATTAATCACATGAGTGATTGGACTCCAGAAGAAT
TCAATCAACTTAATAGCCTAAAGATATCTAATCTCACCGGTTCGACATATTTGCCATTGAACATAAAGCCTGGCCTTCCA
GAGTCTTTTGATTGGAGAGACAAAGGTGCAGTTACTGAAGTCAAAAATCAGAAATATTGCGGTTCGTGCTACGCATTCTC
TACGACAGGCGCGTTAGAAGGTCAACTATTCAGAAAAACCGGAAATTTGATAAGTTTATCTGAACAACAAATTGTTGATT
GTGATCATGTTGATTATGGTTGTAGTGGTGGCTTAGTACCAGACGCTTTCAATTACATCAAATACTCCGGAGGAATTGAA
TCCGAACAAGAGTATCCATATGTATCTGGATTGACAAAGAAACCAAATCCAAATTGTAATTTCAAAGAAAAAAAAGCAGT
TGGAACAGATACCGGATTTGTGAAATTGCCTCCTGGAGATGAAGAGGCTTTGAGAGAAGCTTTAGTGACAATAGGCCCGA
TTTCGATAGCGTTTTCCGCCACTGAGCGATTCAAACATTACAAAAATGGAATTTACCATGATGATTGGTGTTCAAATGTC
CGTATCAATCATGCAGTTTTACTCGTCGGATATGGAATGGATGAAGAATCAGGAACGCCTTATTGGATAATAAAAAATAG
TTGGGGACCCAAATGGGGAGAAAACGGATATTTCCGTTTCGAAAGAAATAAAAACATGTGCAACATGGCATACAATTCAT
ACTATCCATTGGTTTGATTGAACGACTTCTTATGAGTGTGTGC
>SMED30035218 ID=SMED30035218|Name=Gelsolin|organism=Schmidtea mediterranea sexual|type=transcript|length=1573bp
TTATAACAGTCGCTTAATAAAATGATTAAAATCCTTAATTTTTAGTGAATTCAAATAACAAATTTTAAAATCTAATTAAT
AATTAAAATCTGTGACTTTGACAATCGATATGATAAAACAAAAAAAATACAACTGGAAAGACTCCAACTTATCTTTATTT
GGATCTGATACGGAAAAATTAGTCAAAAAAACTTCGTCGGAAACAGAAGCAGCATGGAAATTGGTAAAAACTGTAACTAC
ACCGAGTCTTTTTATTTGGAGAATTGAAAAATTTAAAGTTGTCAATTGGCCTAAAGAAGACTATGGGAAATTTTTCAATG
GAGATTCGTATATCATTTTAAAAATAAAAAAGGAAGAAAATAGTCCTGAATTATTTTATGATATTCATTTTTGGATTGGA
AAAAGAAGTACACAAGACGAGTATGGCACAGCTGCGTACAAAACAGTAGAACTAGATACATTTCTTGATGATAAAGCAAT
ACAGCATCGTGAAGTTCACGGTTTTGAATCTGATTTATTTAAGTCCTATTTTCCGGTTATTACAATAATGAAAGGCGGAT
GTGAAAGTGGTTTCAGACAAGTAACTCCAGAAAAATATGAACCAAGACTTTTACATTTTCACTGTGCTGATCAAAAACAT
GTTGAACTTGTAGAAGTGAAATTTTCAAAAAACTCTTTGGATTCAGGCGATGTATTTATTTTAGACAACGGACTAGAGGC
TTTTCAGTGGAATGGAAAACTATCAAATAAAAATGAGAAAGTTAAAGCAGCACAATTTTTACAGCAATTAGAATCAGAAC
GAAACGGTCGGTGCAAAACAGATGTATTAGACGAAGAAGATACTCCTTTGACGCATAAAATTTACAAATTACTACCTGAT
ACAGCTGTTACTAAGAAGGTTCACAAAGACTTGGCAATTTCCAAACGTCTGTATAGATTATCTGATGAGACAGGCAAAAT
AACGTTTTCTCTAATCTCAGAGGGCAAAACTCCAAAATCTATGCTGAAAGACAATGATGTGTTTATGATAGATAATGGGC
GACACATGTTTGTATATATTGGCGCCGGTGCGTCTCCGGATGAAAAGAAAAATGCAATGTCATATGCACATAATTACTTG
AAAGAAACTGACCATCCATTAATTGGAATTACTTGTCTCCAAGCTGGCCAGCATAGCAAAGAATTTGAGCTTCAATTGGA
CTAGAAAATGATTATGAAATTTTAAATTGCATGGCATTTCAATATTTTTAAATATTTGTGTTTTTACTTAATTTTTACAA
AATGCATGAGTTTATGGTAATTCATTTTCTTAGAAGAGTGAAGAAATATTTTTTTGTTTATGTATTTCATAAATTGCTTA
AATATAATTAAACCTAATGTATATATTGCTGTATTATTTGCTGTTACGAATATTATTGGGCTTGATAGAGCTATCAGAAC
TAACTCGCCATGCTCTTGATCATAACAAGAAATCTACGCAATCAATATATTTGTACCAAAAATCATAACCATTACAATTT
TCACCAACACAAATCAATCTAGTTTTTATTTGTTGCCAGAATCAAATTTTGGG
>SMED30022124 ID=SMED30022124|Name=Gelsolin|organism=Schmidtea mediterranea sexual|type=transcript|length=998bp
TGTACATTAGGATGAATATGGAACAGCAGCGTATAAAACCGTTGAGTTGGACACTTTACTCGACGATAAAGCCATTCAGC
ATAGAGAGGTGCAAGGAAATGAAACTGATCTTTTCAAATCTTATTTCCCAATTATGACAATTATGAAAGGCGGTTGCGAA
AGCGGTTTCCATCATGTTACCCCAGACAAATATGAACCGAGACTTTTACATTTCCGATGCACCGATCACAAGCATGTTGA
ATTGGTGGAGGTGAAACTTTCAAAGCAGGCTTTGGATTCGGAAGATGTTTTAATCTTAGACAATGGCTTAGAGGTTTTCC
AATGGAACGGAAAATTATCCAATAAAAATGAGAAATTTAAAGCCGCACAATTTTTGCAACAGTTGAAATCCGAAAGAAGC
GGACGTGTTAAGACCGATGTTTTGGATGAGGAATTCACTGCTGCCAACCATAGAATATTTAAATTGTTGCCAGATGTTCC
ATTTACAAAGAAAACTCAAAACGATTTAAATATGAGTAAAATGCTTTATCGATTGTCTGATGAAAGTGGAAAAATGACTT
TCTCCTGCATTTCTGAAGGATCAATTCCAAGGTCAATGTTAAAGGATGACGATGTCTACATGATTGACAATGGCAGACAT
TTGTTCGTGTATATTGGAGCACGGGCATCGCAGGAGGAAAAGAAGAACGCGATGTCATATGCCCACAACTACCTGAAGAC
GACTGAGCACCCACTTATCGGAATCACATGCCTCCAATCTGGTCAACATAACAAGGAATATGATCTTCAATTAGAATAGG
ATGTTAAATGATAATTTTGGAATATGTAATAAAAATTAACAAAGCAATTTTTTAAAAACAATAATTTCACAAAATAGGAA
TGAAAATCACAAAAGTATTAAAATTCCATCTATGAATTGAATATCACAATTATAAATTCTTCAACACATAAATCTTGAGC
GAAGCAATAACTTAAAGATTTCAAACATTTACCGCCGC
>SMED30030421 ID=SMED30030421|Name=Macrophage-expressed gene 1 protein|organism=Schmidtea mediterranea sexual|type=transcript|length=802bp
ATTGCATGAAGATATTTCAAATTGTTATTTAATGTGCACCCCATGACGCAAATTATAATTGTATAAAATAATTATCTCAT
TCAAGAAGTTTCATTTCAGGAGCAATAATGACCATTTTATGGGTGTTTTTATTTGCATCAATTCATGGACGTTTTGTATA
TGGAATATTAAATACAAAGGAAGTCACGAATTTAAAACTTAATTACCAGAATTGTCAGTTAGATACGACCCAAAAGACGT
TTGATGTGCTACCAGGAACAGGATGGGATAACTTGGCCAACATTGATATGGGAAGAGTTTTGGACCTTAACTTCTCCTTA
TGCTTATTCTCCAATGATAATAAATATCTGATTCCCAATGAATTGGCTCTATATCCGGAAAAAACTTCAAGAGTAGAAAT
TTCTAGTGAAATCTTTAGTCATTTTGTGAATTATACATCTTCAACGTCAAAATCCATCAACTTGGCCGTAGAAGGAAGTG
TTGAGGATTTGAAATTAGGTGGAGCGTTTTCATTTGAAAATACACAAATAAAGAATGATCAAGGTTGATCAACGTTTGAG
TGACAACCTCTCAATGTATTTACCCAATTCTTCGCAGTTGATAACAAGTGGGCCACCCTCTGACCGGGAGACTACAACAG
CTCGTGAAGTTCACTGCTAGTTTTCATTTGACAAAAAGAAATTTTATTCCGCTTCGATATTTAATAATTGAAATCATGAT
ATTTTCCATTTTTCAACGCTCTGGCGCTATTTCAATCAAGCAAAATGACATATTGGACACAAAATCCATTTTCACCAGAG
TT
>SMED30008977 ID=SMED30008977|Name=Lysosomal alpha-glucosidase|organism=Schmidtea mediterranea sexual|type=transcript|length=2946bp
ATTGTTATGCAAAATTATTTTAGCAAAAATTCCGATAGGTTTTATCTAATTAGTAATTAAGTAGATACTTCATGCTCTTG
AACTTGATTTTATTTTAAAATGGAGGTGTGTCGCTGATCTGGAAAAGTTTAATTTCAAATTATCTTTAATTAGATCATCA
CACCTATTTTAGTTGTTGTAGAGAGTCAAAGTTCAGCTTTTAATTAATATATATTCAATTAAAAATTTGCAAAAAATTAT
TTCCATTTCAAATGAAATTAATAATATTAATAAGTTTTATTAATTTGATTTCGTTATTCAACTTTTCCAACGCGACAGCA
CAATGTCAAATAGCCAATAACAATGAGAGACTTGATTGCTACCCAGAATCCGGAGCCAATCAAGATTCATGTATAGCAAG
GGGGTGTTGCTGGTCCGAACCAATGAGATTGTCCAATAAATTGCAAGGTGTTCCACTATCAATCCCATATTGCTATTATC
CAACTGATTATTCCAACTATATGATTAAATCCTTAAGAAAATCTTCAAGAGGGATCAAAGCAAAATTAGTCAGGGAATCA
CCAAGTTATTTACCCTATGAAGTTGCAATGTTAGATCTTGAGGTAATTTATGAAACAAAATCTAGAACTCGAGTCAGAAT
AACAGATCCTAAACAAAAAAGATATGAAGTTCCAATGAAACTCAGTCCTCCAGATTTGAAGCCACCGACTGATCGAGAAT
ATGAAGTCATAATCCCATCTGATGGTTCATTTTCTATTGAAATTAAACGAAAATCAGATGATCGTTCACTTTTCAAATCA
TTTGGGCCACTTTTATATTCTGATCAATTTTTACAAATATCTTCAATAATGTCAACTGATCAAATCTATGGAATAGGAGA
ACAAAATAGACCCTTTCTTCATCAATTATCCAATGGCTGGGAAAGAATTGGATTGTGGGCAAGAGACAATCCGATTGAAA
CATTTATGAATCTTTATGGAGCTCATCCATTTTATATCGGTATGCCAGACGATGGAAAAGCTTTCGGTGTTTTTCACTTT
AATAGTAATGGTCAAGAATTCGCTTTACAACCGGCACCAGCAGTAACTTATAGAACAATCGGTGGAATTTTAGATTTCTT
TATTTTTACCGGAGGCAGCCCTGAAGAAACAGTAAAACAATACCTAGAATTGGTAGGAAAGCCAATGCTTCCTCCATATT
GGTCTCTCGGATTTCATTTATCTAAATACGGCTATAAAGATATCAAAGAAATCCATGAGACCCTACAAAGAAATGTCAAC
TCCGGTATATCAGTGGATGTCCAATGGTCTGACATAGATTATATGGATGGTTACAAAGATTTTTCGGTTGATAATCAAAA
TTATCAAAACTTTGGAGAATTTGTTAAACAGATCAGAGATGCTTACAATACGCGGTACATTAGTATAATTGATCCCGCCA
TCAGTAATCAGAACACTGACAATTACTCTCCTTATACAGATGGATTGGAAATGGATATTTTCATCAAGAACCCTGACACA
AATGAACCAATAATCGGAGAAGTGTGGCCAGGAAAAACAGTTTTCCCTGATTTTACTCATCCTGATATAACAAAATATTG
GTCAAAACAGATTCGCGCCTTTCATGACATGGTACCAGTGGATGGCTTATGGATTGATATGAATGACCCTTCCAGTTTTG
TTGATGGATCAACCACTGGATGCTCCAATAATAATCGGTATGACAGACCGTTTTTTGTGCCGGAAATTCGAGACCAGTCA
TTAATAGCAAAGACAATTTGTTCATCATCCCTTCATTACAATAAAGAAAAACATTATAATTTACACAATATTTATGGCTT
TAAAGAATCTGTGGTCACTAATGATGTATTACTTCAAATTTTTCCGAAGAAAAGACCTTTTCTTTTATCCCGGTCAACTT
TCAGCGGATCTGGTAAATACGCTTTTCATTGGACGGGGGATAATCAAGCTAGTTGGGATCATTTAAGGAACTCCATTAGA
CAAGTGCTTAATTTCAACATGTTTGGTATTCCGATGACTGGTGCTGACATTTGTGGATTTAACGGTAACAGTGATGAAGA
ACTCTGTATTAGATGGATGCAATTAGGCGCTTTTTATCCATTCATGCGGAATCACAATGCAATCAACCAGAGAGATCAAG
ATCCAGCTTCATGGAATACGGAAGCCCAGAAAATAATGAAAACAGCTATTTCTAATCGTTATGCAATGTTGCCTTTATTT
TATACATTATTAGTCAAATCCCATATGAATGGTGGCACCGTAATGAGACCAATGAGCTTTGAATTCTTTTCAGATAAAGT
AACGCATTCTATAGAATTACAGTTTATGATTGGATCCTCGATTATGGCAACTCCAGTTGTTTATCCTGGGGCCAGATCTG
TAGATGCATATTTTCCAGCTGGAGTCTGGTACGATTTTCACAGTGGAAAATTGTTACATTCAGATGCTGAAGGAGCTTGG
TTGACTTTGGATGCTCCTTTGGACAAAATTAATATTGCATTACGCGGCGGTCATATAGTTCCTCTATTGGATTCCAATAG
AAATTCTAAATCAAACATACCAAATAAAATGACATTGTATTGCGGAATGGCACAAGATATGAGTGCTTCTGGAGATTTAT
ATTGGGACGATGGCGAGAGCATTGACTCCTACTCACGCAATAGATATAGCTATGTATCATTCAATGCTAGCCCTGAGCAA
CTGTTAATAACACCGGTTTACTTTGGCTACGACTTGTTGCCGGTCTTAAACAAAATCGTAATCCTTGGGTTTGAGAATAA
GTCAATTACTAAATTTCTATTAAATGACAATGATATTCCTTTCCATTATAATCCGGAGACTTCATCTGTGGTGCTCAGCA
GTTTAAATGCCAATTTAAATTCCGAAATAAAAATTCAATGGATGTGAATAATTTTTTGTATTTTAT
>SMED30028321 ID=SMED30028321|Name=Synaptotagmin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1303bp
TTTAATTGTGAGTGTATAATTAATTCATTAATAAATGTGCAAAATATGTTCAGACAAGTATAAAGATATATTCATTATTA
ACCATTCAACCATAACAATAGATTCTGTAAGGCCTCTAAATTCTCTGATTGTCATGTATAACAATGTAACAATTCGAAAT
GTAAACCAAACATCAGTTCTTGGAACTTATTTCAATAACCTATTAAAGTTATGGAACATAAGTCCATTACAAGGAATGTT
CATATCCGTCGGACTTTTGCTTGCTGTCGTTCTGACAGTGGCTATCATTATATATTGTGTTAGAAAATCAGTCGAGGGTG
AAGATACCAAAAGGAGTCGACTTTCAAATCTTAAGAAACATCTTCCAGTGAACAGTTCGTCATCAGAGATTGATACTCCA
CATGGGTATATTGAAGCATCAGTCAAGTATAAAAAAAAGCAGAAAGAGATTGAAATTCAAGACATTCAAATTTACAAATT
AGAATTTAACTCAATGAAAAAGCCGGATTGTTATTTAGTAATGTTTGTAAGGCATGGGAAATCTCAGTTGTATCCTTCCC
AAAGAACGAAAACTGCTTTGAATGATTTGTATCCAAATTTCAATGAACACTTTAAGTTTAAAATAAGAAATATGAACAAC
AATATTCTCCAATTTGAACTTTACGACGAAAATCTATCGGGAAATGACATTCTCATTCGTCAGGGAGAAATGATGTTGAA
AGATATCAGCGAAAAGAAATTCCAGGATTATTTTCAGAATTTTGTAATCCACTTGGACAAGCCTTCAGAATTAAAAGGTC
TCGGTGATGTCGCTGTGATTCTGACTGGAAATCCACCAATTTTGAGAATAACAATTCTTGAAGCAAAAGGATTGGCACAA
AAAGAAAATCTTAACTCCAATTCTTTGTACAGTTTTCACGCAGAAGTTAAAGTTTTCGTCAATAAACATTTAGTAAAACA
TTTCAAAACGAAAAAAATTCGTCATATTTCCAATCCGTATTTCCAGGAAACATTTTCATTAAAAGTTTTGTCAAAAATGT
GGGATAAAATTTTAATAAAAATTGAATTATTCCGATCGGGATTTCGTAGAATCGGAAAGGCTTATATCGGTTACAAAGAG
TCCAATTCGAAAGTTAATTATTTGGGGAACTTGCATTGGGAGAATACTTGCAATGACCGTAAAATGTCGAAAGCGATTTG
GCATACGTTGGTCAAATAGGTTGCATATTTCCCTTTGCGGTCTGATTCTTGATGACCCTCACTCTATTCTGACTATAATC
AAAATCTTGTTCAATCTTATTAT
>SMED30022078 ID=SMED30022078|Name=Translationally-controlled tumor protein homolog|organism=Schmidtea mediterranea sexual|type=transcript|length=629bp
GTCAAATATCTTAAATTTGTTTGTTTAAATACTTGTTTACACTAAACACTTTTATTTTGAAAGTTTATTCCACGATGTTA
ATTTACAAAGACATAATTTCGGATGATGAAATAAGCAGTGATTCATATCCAATGAAACTGATTGATGATATTGTGTACGA
ATTTAATGGAAAGAATATTACCATTAAAAATGGCATACCCGATGAAGCAATCGGTGGAAATAAATCTGCTGAAGGTGGAG
ATGATGATTATTCTGAATCATGTGAAACTCAAATAGACATAGTCTATGCTAATCGACTAGTAGAAATGAGTTATTCGAAA
AAAGAGTACACTACTTATATTAAGGATTACATGAAAAGAATACTCGATATTCTTAAAACTAAGAATCCTGCTCGAGTTGA
TGTATTTAAAACGAATGCTCAAAAATATATTACGGAAATTCTTAAAAATTTTAAAGAATACAAATTCTACACGGGTGAAT
CAATGAATCCTGATGCCATGGTAATTTTATGCAATTATCGGGAGGATCAAATTACTCCTTATTTCATCGTCTTTAAAGAT
GGTGTTGTGGAAGAAAAATGCTAGGCCAAATTGCCAATGGAATGTTATATTAATAAAGAATTGATTGAC
>SMED30001973 ID=SMED30001973|Name=Eukaryotic initiation factor 4A-I|organism=Schmidtea mediterranea sexual|type=transcript|length=361bp
ATCGAAACTAATTATGATAAAATTGTGGAGTCTTTTGAAGATCTAAATTTAAAAGAAGATTTGTTGAGAGGAATATTTGC
TTATGGTTTTGAAAAACCATCGGCAATTCAAAAAAGAGCCATTCTCCCAGCAATCGAAGGCCACGATGTCATTGCGCAAG
CACAATCCGGAACTGGTAAAACTGCCACTTTCAGCATCTCAGTTTTGCAAAACATTGACACTTCCATCAACAAAACTCAA
GCTATCATCTTAGCTCCAACTCGTGAATTGGCCCAACAAATTCATAAAGTCATCATGACAATCGGTGATTATTTGTCAGC
AAAATGTTGTGCATGCATCGGCGGAAGAAATGTAAGAGATG
>SMED30014940 ID=SMED30014940|Name=Gelsolin|organism=Schmidtea mediterranea sexual|type=transcript|length=530bp
CAAATAAATTTTCGTTTCGTAATTATTTAAATTTCACATGTTTTTTATTTAACTATAAATTCTGGAAAATAAATTAATTT
TACATTCAATTAATTCAAACAATGAAATTAGATTTTAAAAGTAAATCATTTCTAGAATTTTTTGTTTTTTAAACTTTCTA
AAAAGGAAACAACTACGGAGCAGTCGAAGAAGTTCTTGTCACCGGACACAGAAAGTCTGACAAAACCGGAATGATAAAAC
AAAAAAACTACGATTGGAAAGATTCCAATTTGGCTTTGTTTGGATCAGACACGGAAAAATTAGTAAAAAAAACTTCCGCT
GAAACCGAACCAGCATGGAGAGTTGCTAAGGCAACTACGGTTCCAGGTTTATTTGTTTGGAGAATAGAAAAATTCAAAGT
CATCAGTTTACCAAAGGAAGAATTCGGAAAATTTTACAATGGAGATTCTTACATTATTTTGAAAATCAATAAAGAAGAAG
ACAGTCCGGAGTTGCTATACGATGTGCATTTTTGGATTGGAAAATATTCT
>SMED30031287 ID=SMED30031287|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=505bp
TTGGGCATTTTCAACGACTGAATCATTGAAAGGTCAAAACCAAAGTAAAACTGATAATTTATTCAGTTTTTCTGAGGAAC
AATTGGCTGATTGTAGTCAGGCATACGGTAATTTTTGTTGTGAGGGTGGTCTGATGGACTTTGGTTTCCAATACGTTATG
ATTAATAGAATTGAAGCTGAGGATGATTATCCATATTCCGGCATCTTGAGTTTCATAGGATAATAATTGCCGATGTAATG
GATTCAAAGCAGTCTGGGAATGTATGGAATACAATGACATCGAATCAGGACATGAACAAGATCTTGTAATTGCCATAGCG
ACAGGTGCACCAGTAAAACTATAATTCTGCGCAACTGCAAGTGTACTTGACATATGTTTAGAGACGGAGTTTATGATGAA
CCCGGATGTGCATTGGATAACCTAGACTATGGAGTATTTGCAATACGGTATGGAAATGAGTATGGCAATGACTATTGGCT
TGTCAAGAATAGTTGGAGAACACGT
>SMED30011624 ID=SMED30011624|Name=Cysteine-rich secretory protein LCCL domain-containing 2|organism=Schmidtea mediterranea sexual|type=transcript|length=868bp
AAAATTGATAATTTAAATTAATTGAAGTAATTATATATTATAATTATAAAATATATGGGCCATTCGTAAAAAATGTCAAA
TGCAAAATGGAAGCGAAATTAAAATAATCTCAATTGATAAAATAAATGAAAGTAAACTGTTTTTTATGGAATATGATATT
TGCAATTTATTTTCGGAATGGAAATTTTTTACTTAATAAAAATGAAAGGAAACTTATTTTAAATCTCCATAACAATTATA
GAAATAACGTGAAGCCTCAGTCAAGCAACATGACAAAAATGACATGGAATCAAACCCTTTACAACTTAGCTTTAAATATT
AGCTGGAATTGTTCATTGGATTTTCCTGGTAAAAATAACAGTGAATTTAGTGAATATGGCATAAATATGTATTTTTCCAT
TATGTCTAAATCAACAGTAAAAGATATTCATAAAACCTTTGAGTCTTGGGTCAGCGAAGAGAAAAATTTTATGTATCCAT
TCAAATGCACTGGTAATTGTATGAATTATACTCAAATAGTATGGTCCAGTTCAACGCAACTTGGCTGCAATGATAATATG
TGTTTCATGAAAAACTCTAGTAAAATTAGAAAATGGAATATTTTTTTAACCTGTCTCTATTGGCCAAAAGGAAATATTTT
TGGAATGGTTCCATATGGATCTGGTAAACCTTGCTCAAAGTGTCCGAAGAAAATGGCATATTGTGTCTATAAGTTATGCT
CTAACTGTGCTGTTCCTCATAAATCCGTCGTTTTCAAAATATTAATAGTATTTTACCTGGAGCTTTATTTGGAATTATAA
TAACAAATTCATATTCTCGTGAACTTTACGAAAATAAATTTCTAATATTGTCTCAATATATTATTTTC
>SMED30014692 ID=SMED30014692|Name=Histone H4|organism=Schmidtea mediterranea sexual|type=transcript|length=464bp
AAATCTATATAAATCTTATATGAGATAAATGTCAGGTCGAGGAAAAGGTGGAAAAGGTCTTGGTAAAGGAGGTGCTAAGA
GGCACAGAAAAGTATTGCGTGATAATATTCAAGGAATCACTAAACCTGCAATTAGACGTTTAGCAAGAAGAGGTGGCGTT
AAACGAATATCTGGGCTGATTTATGAAGAAACACGAGGTGTGCTGAAGGTTTTTCTGGAAAATATCATCCGCGATGCTGT
CACATATACGGAACACGCGAAGCGAAAAACCGTGACTGCAATGGATGTTGTTTATGCTTTGAAACGTCAAGGTCGAACTC
TTTATGGGTTCGGTGGATAATCATTTTGTATTTTATTATTTAATGTTGTAATTGCTATAATTGTTGCTAGTATTAATCTT
ATTTTAATAAATTATTTAACTGGATTTTAATTTAAATATGTCGGTTTTGTAAATCCAATTTGTA
>SMED30000139 ID=SMED30000139|Name=Macrophage-expressed gene 1 protein|organism=Schmidtea mediterranea sexual|type=transcript|length=2115bp
GTTTGATAAAAGTTATAATTTTATTATTAAATAGTGAAAATGACAATTTTTATGTTGGGTCGAGTAATTTTATTCCTCTC
AATCGGATCCATTTTGGCTGTGCTGGCTGAGGAGAAAGAGCTAAATATTACTCATCCCCACAAAAATATTGCCACTTCGA
ATTTGCCATCAGCCAAATTTGTACATGGATGCCATTTGACCAACAATCAGTATCCATTCAATGTGCTTCCTGGATCTGGC
TGGGATAATTTGTCAAACCGCGAGTTGGGACAAGTTCTAAAAGTAGCCTATTCTCGTTGCAAATCATCCAATGATGGAAC
CTTTCTCATTCCGGACAAAACAAAAATTACGGCGTTTATGAAATCTAGAGTTCAAATGGATTCAGATATTGTAACACACT
TTTCCAAATATTCCTCCTTGACTTCGAAATCAGTAAATCTTGAAGTCAGTTCTGCAACTCCGAATGTTCAGATCAGCGGT
TCATTTTCTTATGAAAAGAAAGACATCAAGGACAATCAAATGAAAGAAAAATCCGCCTTTTCTCAAACTCAGTTAAGATA
TGAATTGTATCGAGTATCCTTCGAACCGGATAGTGAATTGAATGACAGATTTCGTGAAAGGATCCTTGATCTTGGAGTAC
TTATAGAGAATAAAAAGGGTTCAGCTCATGCTCACTATCTCGCTGATTTGATTGTCAGAGATTTCGGAACTCATGTTATT
AAATCTGTTGATGCTGGAGCAATTCTTTCAAAAATTGATGTCCTAAAAGGTGACTATCTTTCAAAACACGAGGGCTCTCA
ACATTCCGTGACATTAGCTGCGTCAGTTAGTATGAGAGAAACACTTGGAATTAAAATAAGTGGTAATTACAAAACCGGTC
ATTCGGAAATGGAAGAGTACAACAAAAATTGCGTAAGCACTCGAATCTCTACAATCGGTGGTGGACCTTTCGGTTCGAAT
TTCACGCTAACAAAATGGGAAAAAACTCTTTCAACAAATCTTGTGGCCATTGACCGTATTGGGGAACCGCTTAATCACAT
TATTACCAAACGTAACGTACCGGAGTTTGACGATAAAATTGTGTATGAAATCGGAAACCATATCAAGGAAGCAATAAGCC
GATATTATTCTGCTAATACTCGAACTGGATGCATGGACATTATGTCAAAGAACTTTGATGAAAATGCAAATGCCGACAGT
GGATTATGTAATAACATTGAAAATGGAAATTTCTTTGGGGGTTTATACCAAAAATGCAGTTTAGACGATGACTCTCTCTG
TGAGAATATAATACAAAAAAATGCCGCTACTGGGGATTACTCGTGTCCAAATGGGTTCACTCCAGTCAAACTATATTCAT
TCAAGTATAAATGTGAAGGTGATAACTGTCCTATTTATGAAACCTTCTGGTGTGTCTCTAACGGTAAATCGTCAAAAGGA
TATGAAATTTTTTTCGGAGGAATCTACACAACAAATATTCAGAATCCGTTTTATAGGGCTGACAGTTGTCCGCAATACTT
CTTTCCTGCTAATGTTGGAATTAACGGTAAAGTCTGCATTTCAATGGATAAAGAACTGGGATTTAAAAATAGTTTACCAT
TTGGAGGATTTTACAGCTGTTCTATGGGAAATCCATTAGCTCAAAAGAAAGGATTTAATTCAACTGTAAATGGAAGTTAT
TTTCCAAAAGCTTGTGGAAGTGGCTATTCTTCTCATTTTGCTCTCCTAGATGGTGTCTGTCAGTTGTCCTATTGTGTTAG
TACTAATGCACTGACAAAGGGATATGACCTACCGTTGTACAGACCCCCATTTATTGATATTAAAACGGAATCAGAAGTTG
TCAACATCAACGCATTGAAAACGTCGGCTGGAATAAAAATGATTCTTTCTGAAAATGGATCTTGGGAAACAATGATTCCT
GAATTCTATTCCACGTACAAATATGCAATAATAACAGTGCTATTTCTCGTGCTATTATCCTTGCTTTTCCTGATGGCAGT
TTTAGCTTGGAAGGGTTTTAGACAATTTCTTGGAAGGATTTTCACTAAAATACCTTTAGTGAATAAAAAACAATCAAACC
ATAAACCGATTCGCGTACAAATAAAGGTGACCAGA
>SMED30015696 ID=SMED30015696|Name=Macrophage-expressed gene 1 protein|organism=Schmidtea mediterranea sexual|type=transcript|length=2665bp
AGTCGCGATAGCACGCAACGTCGACATTGCGATGACGTAATCATTGTGAATCTCTACTACAATCGGATCATTCTAATCAC
GTGCATCCTAAAACAATATAAATCTTACAAACGGGAATCCAATTGAACATTTATTTACTCAAGCGTGAAACCAATGATAC
CGTGTAGACTTAATAGTATAATATTGTTTATATTTGTTTATGGAGTTCTATCGGTTTCATGTGAAATTGAACCTAACCGA
GATCAACCATCTTCAAGACGAGTTCATGAGTGTAAACTCACCAGCAACCAATATCCAGTGAATGTTCTTCCCGGATCTGG
GTGGGATAATCTTGAAAACAAAGAACTCGGTCAAGTTTTAGAAATTTCATATAAAGGATGTTTTGGATCGAATGATGGAA
GCTTTCTCATTCCAGACAATGTGGTGATCACCCCAATAAAGAAATCTATTGTCGAGTTAACTTCAGATATATTTGACCAT
TTCTCAAATGTCACCTCTACAACGGCGATGTCTATCAACGCCGATGCCAGTTACTCAACACCAAGCTACAAAATCAGTGG
ATCATTTTCATTTGAAAAAATAAGAATAAAAAACGATCAAATCAAAGAAAAGTCGTCGATTTCGAGATCCCAGTTAAGAC
ATGAATTATATGAAGTAGCGTTCCAACCACACTCAAAACTAGACGCAAAATTCAGAAACAGAATTCTAGATATTGGAGCG
TTATTGAAAGAAGGAAAAGACACAATTTATCCACAATATTTAGCGGATTTAATTGTCCGTGACTTCGGCACTCACGTCAT
TCGGTCGGTGGATGCGGGAGCGACACTAATAAAGACTGATGTTTTAAAATCGAATTATGTCAAAGGTTTTAAAGGGGATA
CAACTAAGATTGCAGCTGCGGCATCATTCAGTATGACAACAATGCTTTCAGTCAACCTCAAAGGAACCTATGTTGGTGAT
ACCACGAGTCTCAATGAATTCAATAGTAATAGTGCAAGTACAAAAGTCGAAACTTTTGGTGGTATACCGTTTGGTTCGAA
TTTTAAGTTGGAAGATTGGGAGAAAACCCTTGAAACGAATTTGGTAGCAATTGATCGCAAAGGTGAACCGTTGTCCTATG
CTATCACACCAAAAAATCTTCCAGAATTCGATGAACAAGCAGTTTTCAAAATAGCTACGCTCATCAAAGAAGCAGTCAAT
AGATATTATGCAGCCAACACGAGAGTGGGATGTATGAATATGGAGTCAGAAAATTTCAATGACGACGCAAATGTTGACGG
TGGAAACTGCGAACCTCCTAATACATTTTACAGTTTTGGAGGAACTTTTCAAACCTGCTCAGGCCCTGATTATCAGTGTA
TGGATGTCGCGGCAAAAAACCCAGTGACCAATAGTTATGCTTGTCCTGATAACTATGATACCATTGAATTACAAAGTGGA
TTGAATAAATGCATAAATTATTGCACCAAATACTTATTTTCCACTCAATGTCATTACGAGTGTTCCCAATATGCATTGTA
TTGGTGTTCTTCTACAAACAAAACGAAAATATCAGAAGGCGCACTTTTCGGGGGATTCTACACTAATACATTTCCGAATC
CACTTACAAATTCCTATAGTTGTCCACAATACTATGTAGCGACAAGATTCGGCGTAAACGCCAAGGTTTGCACTGCACTC
AATAAGGCAGAGGCTATGGAACACCATTTGCCGTTTGGAGGATTTTATAGTTGCAAAGTTGGAAATCCTCTACTAGATGA
TCCTCTCTACAACATTACACAGGATCCCAAATATTGGCCTCAAGGTTGTTCAACCGGATATTCATCACATGTAGCTATTG
TCGACAGAGCTTGTCAAATTTCCTATTGCGTTAAAAATAACGCCCTTAGCATGAGAGAGCAACCGCCTCTCTACCGACCA
CCTTTTATTGATTTGGGATTTGGACCCAATATGACAGTAATTACCTCTCTGGACACTCCAATGGGGGTCCGATTATCTGT
TGATGAAAACGGGAAATGGAGTCATAATCACCAATACAAATTATCCAATTACAATATTATAATAATATCAGTCATTATGG
CGGCAGGAGCCAGCATTGCAATTATTATTATAATTCTTGGAGTTCAAAGATTCAGCAGAAACCGAAAAGGTCAAGTCTCA
CCGGAATCTCATGAATTTGATAGCAGATATGATTCTACTAAAGATGTTGCCAATCTTGCGTTACCCGGCGAGGTTCCACC
GTTTCGTGTTATAATTGACGGAGCGAAATGATGCTTGGAACCTTTTATTATTTCTGTTGAATCTGATCTGTAAATGTTTT
CAGAATATTTTTCTAATAAAATCGTTCTGAAATTTTAAAGTGATCCTTGATGCTATTAAATGATGGACTTTATTGTACCC
CGAATTGGGTCACCCTTGTTCACGCAAATTCGTGCTTAGGATATTTGTACGGGCTTATGCAACTTTTTAAATTTTTATTT
TTCCTTATTTTTATTAGCAATCCGTTTTATTTATAACGACAAATGCTTGATGTTTGAATCAAATTTTTATTATGTTTCTT
AATGAAACATAGTGAACAATGTGCCACTAATTTCATAACCAAGGTCTAATCAAATAGTTTGGGTAGTGAAAGCAATATTA
CAGAGTTTAGGTTTGTCATTCATAT

 

back to top


 

References

Adler, C.E., Seidel, C.W., McKinney, S.A., and Sánchez Alvarado, A. (2014). Selective amputation of the pharynx identifies a FoxA-dependent regeneration program in planaria. Elife 3, e02238.

Martín-Durán, J.M., and Romero, R. (2011). Evolutionary implications of morphogenesis and molecular patterning of the blind gut in the planarian Schmidtea polychroa. Dev Biol 352, 164-176.

Scimone, M.L., Kravarik, K.M., Lapan, S.W., and Reddien, P.W. (2014). Neoblast specialization in regeneration of the planarian Schmidtea mediterranea. Stem Cell Reports 3, 339-352.

 

back to top