Stage 4

Developmental timeline and staging designations for Smed embryogenesis. Timeline: days (d) post egg capsule deposition at 20˚C. Gray bars indicate time windows for RNA-Sequencing samples. Double headed arrows: time windows for Stages (S) S1-S8.

 


 

▻ Overview

▻ Stage Description

▻ Images

▻ Download Supplemental Table

▻ In Situ Hybridization Data

▻ Sequences

 


 

Overview

 

D3-D5. Dispersed blastomere cleavage in the embryonic wall. Yolk ingestion into the gut cavity. Early embryonic gut formation. [ PMID:28072387 ]

 

back to top


 

 

Stage Description

 

Blastomeres continue to divide asynchronously in the embryonic wall. The temporary embryonic pharynx ingests yolk cells into the gut cavity of spherical embryos, ranging in size from ~300-500 µm in diameter. Islands of differentiating gut cells appear within and beneath the parenchyma. It is not known whether the embryonic gut created during stage 4 is a temporary or definitive tissue.

 

back to top


 

Images

Brightfield images of live Stage 4 (S4) embryos harvested for RNA-Sequencing (left), a paraffin embedded S4 embryo sectioned and stained with hematoxylin and eosin (middle), and heat maps for S4 enriched transcripts (right). Yellow arrowhead: temporary embryonic pharynx. Scale bars: 100 µm.

 

Figure 1 – figure supplement 6. Mean centered expression and average RPKM profiles for S4 enriched transcripts. Organized by cluster membership presented shown in the heat map and S4 enriched transcript excel file (Figure 1 – source data 4). S2-S8: Stages 2-8. Y: Yolk.

 

 

 

back to top


 

Download Supplemental Table

 

 

Figure 1 – source data 4. S4 enriched transcripts from pairwise and/or mixed stage reference comparisons
Criteria for flagging differentially expressed transcripts:

1) Pairwise comparison (S3 vs S4): adjusted p-value < 1e-5 S4 vs mixed reference comparison: adjusted p-value <1e-5 2) log2 ratio ≥ 2.322 (5-fold upregulation, both comparisons) or log2 ratio ≤ -2.322 (5 fold downregulation, pairwise comparison only) 3) Average scaled RPKM value ≥ 1.0 for S4 4) Transcript has ≥ 1 ORF 5) Transcripts derived from transposase or retroviruses were omitted, as were S4 enriched transcripts also upregulated in yolk in the mixed reference comparison.

Tabs in this excel file contain 1) pairwise comparison data (if applicable), 2) mixed stage reference comparison data, 3) cluster membership, average RPKM values across embryogenesis (Y-S8), and in C4 and SX adults, as well as best BLASTx hits (E < 0.001) versus the NR, Swiss-Prot, C. elegans, D. melanogaster, D. rerio, X. tropicalis, M. musculus and H. sapiens REF-Seq databases, 4) GO analysis: Manually curated and categorized Biological Process (BP) GO IDs and 5) GO analysis: unabridged results. S2-S8: Stages 2-8. Y: Yolk. C4: C4 asexual adults. SX: Mature sexual adults

 

 

back to top


 

In Situ Hybridization Data

Smed IDGene NameAliasExpression PatternWISH Image
SMED30018602ATP-dependent RNA helicase dbp2DDX5-likeblastomere
SMED30023322Cathepsin LCTSL-likeembryonic gut cell, primitive gut cell, temporary embryonic pharynx
SMED30001900CUGBP Elav-like family member 3bruli-1blastomere
SMED30015313Cysteine-rich secretory protein LCCL domain-containing 2VAL-liketemporary embryonic pharynx
SMED30003202Eukaryotic initiation factor 4A-IeIF4a-likeblastomere
SMED30027428forkhead box A-1foxA1temporary embryonic pharynx
SMED30014940Gelsolingelsolin-likeprimitive ectoderm, temporary embryonic pharynx
SMED30000139Macrophage-expressed gene 1 proteinMPEG1-like-1temporary embryonic pharynx
SMED30015696Macrophage-expressed gene 1 proteinMPEG1-like-3embryonic gut cell, primitive gut cell, temporary embryonic pharynx
SMED30034696Macrophage-expressed gene 1 proteinMPEG1-like-2temporary embryonic pharynx
SMED30025388Myosin heavy chainDj-mhctemporary embryonic pharynx
SMED30023593Netrin-1anetrin-liketemporary embryonic pharynx
SMED30004304Proliferating cell nuclear antigenPCNAblastomere
SMED30010115ribonucleoside diphosphate reductase subunit M2-2RRM2-2blastomere
SMED30007406SMEDWI-1piwi-1blastomere
SMED30014446SMEDWI-2piwi-2blastomere
SMED30001362SMEDWI-3piwi-3blastomere
SMED30019097SOXP-1SOXP-1blastomere
SMED30035063SOXP-2SOXP-2blastomere
SMED30032088Spondin-1spondin1-likeprimitive ectoderm
SMED30022907Synaptotagmin-1Dj-syttemporary embryonic pharynx
SMED30027646Transcription factor BTF3 homologBTF3-likeblastomere
SMED30025427Translationally-controlled tumor protein homologtct-likeblastomere
SMED30013909tud-1tud-1blastomere
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top




Sequences

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30004304 ID=SMED30004304|Name=Proliferating cell nuclear antigen|organism=Schmidtea mediterranea sexual|type=transcript|length=907bp
CTAAAAGGTAATAATTTAAATTTAATTAGAACATTGTTTTAATATTCGGTTATATTCTCCATTATTCTAAATTATGTTTG
AAGCAAAATTAATAAAAGGCGAAGTTTGGAAAAAGGTTATAGAAGCTATAAAAGACTTAGTACAAGAAGCAACATTGGAT
TGCTCAGAAAATGGAATTAGTCTTCAAGCCATGGATACATCTCATGTGTCCTTAGTTAGTATGCTTCTTCGAAGTGATGG
TTTTGAGACTTATCGATGTGATAGAAATGTCAATCTCGGTCTTAATATAACAAGTGTTTCAAAAATTTTAAAGGCGCTTG
GTAGTAATGATTCCCTAACAATGAAAGCCGCTGATTCAAGTGAAACAATTTCGCTTTTGATAGAATCTGCAAATGAAAAT
GAATTATCTGAATACGAAATAAAATTAATGGACTTGGATGGAGATCACTTAGGTATACCAGATACTGAATATAAGTGCAT
TGTGAAAATGCCGAGTTCAAAGTTACAAAGAATATGTCGAGATTTAAGCCAAATTGGAGAAGCAATCACGATTTGTGTTA
CTAAAGATGGTGTAACTTTTGCTGCTGCTGGAGATCTAGGAAAAGGAGCTATAAAACTTAATCAAAATTCTAGTGCTGAC
AAAGAAAATGAAGGAGTAACTATTGAAATGACCGAACCTGTTTCGATGACATATTCATTGAGGTATTTCAATATGTTTAC
AAAGGCTGCACCTCTTTCTTCTCAAGTATCTCTGTCGTTGACTGAAAATGTTCCAGCAGTTATTGAGTTCATAATCGAAG
ATTTGGGATTTATTCGATATTACCTAGCTCCTAAAATCGAAGACGACGAGTGAAAGTTTAACTATTAATGTTGTATGTTT
AATAGATGTTATTTTGTTTAAAAAAAA
>SMED30017940 ID=SMED30017940|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=1165bp
CCTGATTGTGTGCTGTAAACAAATGCAACCTCACCGTATGTCATTATCATAATTGAAAAGATTTACGTATAAATTCAACG
TATTTTTGTCAAATTTATTATAACAATGAAGATCGTTCTACTTGCAGTATTTTGCGTTGTCTCGATTAGTGCTGGAAAAT
TAAAGTTTGAAGTCAACGAGGCCCTGAACGAGGAATGGAACATGTACAAGATCCAGTTCCAGAGAAAATACGAATCCATT
ATCGAATTAACTAGACGACTAATTTGGGAAGAAAATCTCAGATTGATACAGAAACACAATATCGAATACGATCTCGGAAA
ACATTCGTATTACCTCGGTCTGAATGAATTCGCAGACATGACCAACGAAGAATACAGAGTAAAGGTTCTCGGACTGAAAC
CAATAAACAAAAATTACACGAGAACAATTTTCCTGGCTCCGGAAAATACTGTCGATCTCCCTAAATCAGTTGATTGGAGA
ACAAAAGGATACGTAACTCCCGTGAAAAATCAGGCTAATTGTGGATCTTGTTGGTCGTTCTCGACTACTGGCTCACTAGA
GGGTCAACATAAGCGTAAAACTGGTCAGTTAATTTCCTTATCCGAACAGCAACTCGTAGACTGCAGTAAACCATTTGGTA
ATAATGGATGCAATGGTGGCCTCATGGATAACGCATTTCAGTACATTCAAAAAGACGGATTGGAATCGGAAGAAGATTAT
TCCTACACAGCAAAAGAAGGTAACTGTAAGTATGACGCCTCAAAGGTTGTTGCTCATTGCACAGGATTTGTCGATATTAA
AAAAGGAAACGAGAAAGACTTAGCAAAGGCTGTCGCAACAGTCGGTCCGATATCAGTGGCAATCGACGCCAGTAAACCAA
CTTTTCAATTATATAAAGGTGGAATCTATAATGAAAAATCATGCTCCTCCCGCCAATTGGACCATGGGGTCCTTGCAGTT
GGTTATGGGAAAGAGAACAATCAACATTTCTGGATTGTTAAAAACAGTTGGGGACCACAATGGGGACTTTCGGGGTACAT
AAAAATGACAAAGGATCGACACAATCAATGTGGAATAGCTACGATGGCTAGCTATCCTCTTGTTTGAGACTGCAATATTT
ATTTTGTTTTAATTTTATACATTTTATTTTATTTGTGAAAAAAAA
>SMED30026323 ID=SMED30026323|Name=Gelsolin|organism=Schmidtea mediterranea sexual|type=transcript|length=1381bp
ATTTAATTATGCTTATTTTAAACCAATCACATTTGGACTAGCGAACTCATAAGACAGACAAGCTTTCATATATTTATTAA
CATTTATTTCTTATTGTATATGAATACGGTTGAAGTGTTTTATTTAAACTAGATCTTTTTAGTATAGCTAAAACAAAATA
GAAATGGTAAAACCGAAAAAATATTCTTGGAAAGATTCTAATGTTGAATTAATAGGAACAAAGGAAGATCGTAGTATAAA
AAAAATATCTGCCGAAACGGAGAAAGCATGGGCTAAAGTAAAGTCATGCAATCATCCGGAATTATTTATCTGGAGGATAG
AGAAGTTCAAAGTAGTTGAATGGCCTATAAACCAATTTGGGGAATTCTATAATGGAGATTCGTATATCATACTAAATATT
TATACAAGAGGAAATGAGATTCTTTACGATGTACATTTTTGGATTGGAAAATATTCAACTCAAGATGAATACGGAACTGC
CGCCTACAAAACAGTAGAATTGGATAATTTCCTTGATGATAAACCGGTACAACATAGAGAGGTGCAGCATTACGAATCAG
AGTTGTTTAAGAGCTATTTTTCTCAATTAATTTATCTGAACGGTGGAATTGAAAGTGGATTTAGACATGTAATTACGAAA
GAATATTCACCAAGATTGCTTCATGTCCGTGGCGACAAACTAAAAGTCATTGTATCGGAAGTTGCTGCAACGAAAAGAAA
TTTGAACTCGGATGATGTTTTTCTGTATGACACAGGCACCCACATTTTTCAATGGATCGGAAAAGGTGCAAATAAAGATG
AAAGATATCATGGTCAGAGGTTTGCTCAACAATTGAGTTCAGATAGAAATGGAAAAGTAAAAATTGAAGTTGTGGATGAA
GATGACTCTTCATCAAATCTTATTTTTTATAATAAATTATCGGATGAAATTAGTGAGGATTGGGATGATGATAAACACTA
TAAACCTTTATGTGAACATGAAAAATTACTTTTTAGAATTTCCGATGAAACAGGAAAACTAAAATTTGAAAAGATAGGCA
AAGGAAATATTTCCAGAGCCCAAATAAATGAAGATGATGTTTTTATTATAGATAACGGACAGCAGATTTTCGTGTACATC
GGTGAAAAATCAAGTCGGGCTGAACGGCAAAATGCACTTATATATGCTCATAACTACCTAAAGGGAACGGAATATCCTCA
AGCTCCAATATCCGTGGTAAAGAAGGATCTGAAAGGAAATAGTGCTGAGCAATTCAATAAAGTTATTGGGGGCTAATCTT
TGGAATTTTCGTTTCATTTTTTTACTTTGATTAAAACAAACATTTCATACTTTGATTTTCATTATTGTTAGAAATTTACA
AAATCCTTTCTTTAAAAAAAA
>SMED30014981 ID=SMED30014981|Name=Gelsolin|organism=Schmidtea mediterranea sexual|type=transcript|length=1397bp
CTCTTCCGATCTTATCAACTTACTCACATAGATGATAAAATGTTTGGCTGGTTGTTTAAATATTTGAAAAAAAATTGACC
AATAAGAAAAATTTCTGTGCGCCAATTCAATCGATAATTTGCTCACTGACATTTGCATAGTTTTACAGCCGATTTGGACA
GTATAAATACGAATGTCACTTTAGATTAATTTCACTTGTCTTTACATTATCATGAAAAAAGCAGAAAAATACGACTGGAA
GGATTCGAATGTCGAATTAATTGGTTCATCGGAGGATCGCAGTGTTAAAAAATCATCGGCAGACACTGAAAAAGCTTGGA
ATGCTGCAAAAACTTGCAAAACAACCGCTTTGTTTATTTGGAGAATCGAGAAATTTAAGGTTGTTGAATGGCCTAAGCAG
AGATTCGGAGAATTCTTCGAAGGTGATTCCTATATTGTTCTAAATATTTATCAAAAAGAAAAAGAACTACTTTATGATAT
CCATTTTTGGATTGGAAAATATTCGACTCAAGACGAGTACGGCACTGCTGCTTACAAGACTGTGGAGTTGGATACCTTAC
TAGATGACAAACCCATCCAACATCGCGAGGTTCAGGATTATGAGTCTGACATGTTTAAAAGCTATTTTCCAAATATTATA
TATCTAAAAGGAGGTTGCGAAAGTGGATTCCGACACGTCAACACAAGAGAGTACAATCCAAGACTACTCCACGTCAGAGG
CGAAAAGAATAATATAATTATATCTGAAGTTTCGTCGACCAAGAAAAATTTAAATTCTGATGATGTATTCATTTTTGATT
CTGGAAGCTGTATATATCAATGGATCGGAAAAGGTGCTAATAAAGATGAAAGATTCAAAGCTCAACAGTTTGCTCAGCAG
TTGAACTCCGATCGAAATGGGAAACTAAAAATCGAGGTACTTGATGAAGGACAAATGTCCCCAAATCATGAATTCTATAA
TAAATTATCTAACAACGAACCAATTGCTGATGACAAAAACCATAAATCCTTAACAGCTCACGAAAAAAAGCTTTTTCGGA
TTTCCGACGAAACTGGACATTTAAAGTTTGAACAAGTAGCAAGTGGAAATTTCAATAAATCTAATATTCATGAAAATGAC
GTCTTTATTATTGACAATGGGCAAGTTATCTACGTTTATGTCGGAGAAAAGGCAAGTGACAATGAACGGAAAAACGCACT
TATCTATGCACATAACTATCTGAAGGCTACGGATTATCCCCAAGCTCCTATTACCGTTGTCAAGAAGGATATCAAAGGTA
AAAATGCCGAAGAATTCAACAAAGTGTTAAATGGCTGACGACTCAACTTCATATAGAATTTAAATAATTTTACTCTTACA
ATAATTTAATTAAAATTTAGTAATTGTTATTAATAAA
>SMED30023018 ID=SMED30023018|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=1084bp
CCGCTCACATATTCCCGACCATGAAAGGAATGTATAAACTGAACCTTGATACCAAGCATACTATAAAACTCAAAGTAATC
GCATCATATTTCATAACATGAAGGCATTCATAATTTTGTCGTTATTCCTTGTTGCTATTGAGGCTGGGCCAAGGAGATTC
ACGGTCAACAGTGAGTTGAATGAAGAATGGGAATTATTCAAAACCAAATTTCATAAACAGTATGAACCGCTAACGGAGGC
TGCGAGAAGAATCATTTGGGAAGGAAATCTCGAGTTCATTAGACAACACAATCTTGAATACGATCTCGGAAAACATTCTT
ACACTTTGGGATTGAATGGATATTCTGATGTCACTGATGCAGAATTTAAGGCCAAACCTTTAGGAAACAGAATGAATGGA
TCAAACCCAAAAGGATCCGAATTTATAGTGACAGAAAACATTGGAGCTTTGCCTTCATCTGTGGATTGGAGAACTAAAGG
ATACGTAATCCTTGTGAAAGATCAACTTAATTGCGGGTCATGTTGGGCTTTCTCAGCCACCGGAGCTCTTGAAGGTCAGC
ACCTTCGAAAAACAGGAAAATTAATTAGTTTGTCTGAACAGCAACTTGTTGACTGCAATAGACCAAATGGAAACTTCGGA
TGTATCGGTGGTTTACCGTACCAGGCGTTTGACTATGTTGAAATCTCTGAAATGGAATTAGAGAAACATTACCGTTATTA
CGCGGAAGCCAAGAAATGTATTTATAATAAATCAAAGGTTGTCGCAAATTTCACTTCATATACTAATATCAAAAAGGAAA
CAATTCTGACTTGGCAGCCGCCGTGGCCACCTTGGGACCGCTGTCTGTAGCTATTGATGTCAGTAGCCGATGTTTCCGAT
TTTATAAAAATGGTATTTACAGTGACCTCCAACGTTCACAATATAACCGTTTTAGTCGTTGGCTACGGATCACTCTTTGG
GAGTAATTATTGGATTGTGAAGAATAGTTGGGCCCAAGTTGGGGAAACGGGCGATACATTCTCATGTCAAAAGACAACAA
CATCCAAAGTGGAATTGCTAGTCAAGCCGTTTATCCAGTTCTCT
>SMED30019097 ID=SMED30019097|Name=SOXP-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1596bp
GGAATAACAGCCAATTAGGGATCAGCTGCAATTTGGCCTATGATTGGACATTGATTTTTATAGTCTCAGGCGTTCTCAGC
TTACGTGTGCACCTTTTTAGTGGACACGTTAAATTTGATAGGTGCTTAGTGGTGTTGATTCCTGTTTGGAAACTGTATAT
AACCAAGGTTATTTGTTGCTTTGAGACAAATGCAACACAATCAAATAATTAATTATGCTATGTTCAAATTGTTCAAACAA
TCAGGATACTTTGAAATTATGGATGGTCCATTTAGCTTCTTGTCACCCATTACCTCCTGAATGGCTTAGTGAAAAGGCCA
AAGTATTAAATGATGACGAAAATCAGCGCCCCTATACAATTGTCACTGATTCCCGAAAAAGAAGGCGACGTCCAACCACA
CCAAGACCACTAAATACGTTCATGATTTTTTCGAGGCATATCAGACGAAATATTCTCTCAGTGTTTCCGGATGCATCAAA
TTCCCAATTAAGCAAAGAGCTTGGAATTTTATGGAAGAAAGTCACAAATGAAATTAAATCCCTTTATGAAGAAGAGGCAA
AGCGATTGGCTCAATTACATGCTCTTGAATTTCCCGATTATAAATATCAACCAAAGAAACGAGTCCGAAGATTTGGAAGA
GCGATTTATGATCGACAGCCCTGTACAACAGAAAGATCTAACTCAACTAGTGCAACAGACGAAGAAAATGGTAAAGACAA
TAATAGTGTTCAAGACGGTAGAAGATCAAGCGATATTGAGAATCAGTATATAAGATATTCAGTTTTGGGTAAAAATATTG
TAAAACGAGAATGTCAGTCCTTTAATAGTCCTTTAAAAAGCGACAACGTTAAATTGGAAACGCAAGAACAAGATTTTATC
CAAGCGATGCCCAAACCTCTAAACGTCCGAATAACGAATTACAACGAAAACAGTATATTTTTACGACAACAAAGATTACC
ATCAAGTAGCACAATGTATTTACTTCCTTCAGAAAACCTAATAATTAGTAATGGGATTATGGGATCACAGGACTTGGGTG
AGGATTATTGTAGAGAGTTGTATATAATTAATGATTTTTTCCCAGAAAATGTAAACATAGACGATGAAATTGATATAACA
GGAAACATTTTTAGCAATGATTTAGATTTAGAGTGGTCTGAAATTGATGAAAATTACAAACAAGATTTACCAAATCTTAA
TTCATTATTTCAACACTAATATATTTGATTTATAAAATATTTAAATATTTTTTATTAAACAGTCTTTTACATGTACATAT
AGTATTGGAACTCTTCTCTGACTTATAAGATAACAGAGATATTGTAATAAGATTAAATTGGTTATGTGTTTCGGTTTTTG
TAAGATTGGTAATTTTCAGAAGAATTTAGACTTTTTTCATGGAAATTGGAATTGAGAAACAAACTGAATAAAGAAACAAA
TTTTTGAAAAAAACGAAACAGATACTTATTATCAAAAGAAAATTATCTGAAGCATCGAGTCGGTATGAAAAATAAACTAA
TTAGTCAGAAAATTTTTGATGAAATAACGTCTAATGAAATTAAGATCTCCAAGGAATACTTTTTCTAACATTTGAT
>SMED30014446 ID=SMED30014446|Name=SMEDWI-2|organism=Schmidtea mediterranea sexual|type=transcript|length=4773bp
ATTTAATTTTCGAAAAAAAATATGGAGGAAATACCAGTAAAAGTAGCTAAACTTGAAGCGAATGGAAGTGAAACAAGAGG
TAAAATGGGAAATCGTGGTGGCCTGAGAAGAACATTTAGAATTGTTGAACCTAACTTGCAACCTGCTGATATCACTGAAA
AAACAGGAAACATAGGAAGAACAGTTAAATTACAATCAAATTTTACCAAATTCTCTGTTTTGCGTTCAGAAAAGTTCATG
ATGTATGATTCCGTGTTTTCTCAAGTTGGTTTGTCACCCAAAGTAAAATTACAGTTTATTGTTCGAGTCTGCCAAGAAAA
TAAATTGCCAGGGGCTTTTTGTTTTGATGGAAGACGTCTATTTACTAGTGAAAAATGGCATGGAGAATCGGACATTCAAG
AATTTAGTCATGATGAAAAAAAAATGACACTAAGATTGGTATCAACTATCCTTCCTGAAACTGAAGAATATTACCAAATG
ATCAATGTATTACTCAATAATTTACAAGTAATGTTAGGTCAAGAAAGAATTGGTAAAGGTTATTTTTTAAGCCCAAATAT
TACAAAAGATGAAGTTCCCCGTAATTCTGGACCGACATTTTTTGAAACCAATAGTTTTAAAGTTCTTGGGGGCTTTGGTA
CAACTTTACAAAGAGGCACAAAACCAACTGGTGAATTAACCACTCTTTTATATATTGAGCGTATTAACAGAGTATTAAAC
GATAACTCTGTTATGAAGGCATACAACAGAAGAAGTATCGATCAGTTGATAGGCAGAGATATCATAACAAAATATAATAA
CAAAACTTATAGGATAAGTGAAATAAAAGAAATGAACGTAGATGAGAAATTTGAAATGGGTGGTAGAACTTTATCGTATG
CCGAATATTTTAAGGAACGATATAATATTCGATTAACTCAAGGCGATCAACCATTTGTTCTAACGCGAGTGAAGAAACCA
ATGCGTCGAGAAAGAAAGAAAAAAGACGAAGAAGGAGTGGAAAAAGAGAAAGAAAAAGAACGCGAAAAAGAGGCTCCAGA
AGAGAAGGACATGACTCTCAATATTCCTGGAGAGTTGTGTTTCTTATGTGGGTTTTCAGATCAAGAGAAATCGAATATGG
ATCTGCAGAAGAATTTAGGGTGCGTTTTAAAAAGAGAGCCACGTGAAAGATTGGATGATATACCAGCTTATTGTAACTGG
ATTAAAAATAGTGATGCGGCAACTGGAATGTGCAATAAATGGCAGCTGAAAATAGATAACAAACCATTAGAAATCGAAGG
TAGAGAATTACCTCCATGCGATGTAATAAGTGGTGGCAGCAAAATTAATGAAAAAATGGGAGATGATTGGAAATTTGGTC
GAGTTCAATTTGATATTAAGCGTGATCGTAAGCATGAAATCGATGTGGTCATCGTTGATCGAAATGACTTTCAGTATAAA
AATTTTATGAATGATGTGGAACAAGAATTAAGAAACATGAGAATTGATGCTCGAGTTGGAAAGGTTAATACTTGTGGTCC
AAATGATGTTGAAAGATGTTTGAATGATGCCGCTAGAAGTGGAAGTGGGTGTGCTAAAATGGCGCTGGTATTCGTCCCAG
ATGATAGAGTATATGCCAAGGTGAAATCATTTACCATGAGTACTGGTCTTTTAACCCAATGTGTAACAACACGTAATGGT
ACTAATAGAAACGATAAACGAAGAAAGGTGGTTTCAAGTAAAACCGTGATGCAAATATTTGCAAAATTCGGATATGATCC
ATGGACAGTTGAAATTAAATTGAGACCAACTATGATTGTCGGTATGGATACCTATCATAACAAGTCCAGCAAGAAATCAA
TTCAAGCATCTGTATTTTCGATCAACAGCACATTTACACAATATATGAGCTTTGTTAATTCTCCTAAAGGACGTCAGGAA
TTCCACGAAACTTTAGGCAAAAATTTCAATTTAGCGTTAGAAGATTTCAAGAAACGTTATGACATATTGCCCCAGCGAAT
TTTAGTCTTTAGAGATGGTGTTGGAGATAACCAACTTCAATTTACTAAAAATTTTGAAGTTGATGCAATGAAACCGCTTA
TTGAAAATATATACAAAGGCAACGGATTCCCTGTTCCACAAATCATTTATGTCATCGTAAAGAAAAGAGTCGGCACTAAG
CTTTTCAACAGAGGAAATAATCCAAATCCTGGAACTGTTGTGGATAAAGAAATTGTCAAACCGAATTTCTATGAATTTTT
CCTAGTTTCACAAAGAACAACGAAAGGAACTGCAACTCCAACTAATTATAATGTTTTAGAAGATACTCGATTGCTAACGA
AAAAAGGTACTATGGATCCTATGGCACCGAATGAGCTGCAAAAGATTACCTATGCTCTAACTCATTTATATTTCAATTGG
ATGGGAACTATCCGAGTTCCGGTTCCAGTGCATTATGCGCATAGATTGGCTGAATTAGTTGGAAAGGTGCATAAGGGCTC
TAATCCCGTTGCCATTAATGAAAGAATAAGAAATAGGCTCTTCTATTTATAAAAAGATCAAAACTTACATTTTTCTGTGT
TGATTACTATCCCAATTGTGGATTTAATTGTTTCTGAAAGCTGTTCATTCAAATTCTTCTGAAATCCATATTGATTCGTA
AGCAGCCTGTATTTGAATACTAAAATTGATAAAGTAGTTATAAGTATTGTAAAAGTATTAAATATTTGTTTATGTTATTC
GTAATACACTTGGGTTATTGCAATGTTTTAGTTGTTTTTCAATGATAATAAAGCTTAGCTGTATAAATTCTTTTAGGTTT
TTTAGAAGGTTTATTTATATCGTGTAATTGATTGTCGTGTTAATATTAATTAAATAAAAGTTTGATGTAATTGCTTTGTG
TTACGCATAATAAATCTTACGAAATTTCTGAATACAACTGCTGGTGATCGGGATATTGAATGCCGGGTCGTTTGAATTAA
TAATACAAATGCTTTCGATTATTGTCATTAATATTTTCTCCAGTGCGTAATGGGCCAGAGTTCCGGTGCCATGATTAATG
GTTCCTAAATTTTAGAAATAACATTTTGAATGACATGTTAAATGTGTATATAATAAATTTTCTAGTTTTTTTGCTAAGAT
TTTGAGAAATTTTAGTTACCTGTTTTTGTTAATTGCTTTGATAATTTCAATGCTGACACGTGCAGAATTTCACACATCTC
CAGCAGTCGACTGAATTCTTGGATTTTGTTTGATACAATTATGCTTGCAGATGTTATGGCGCATAGATCCAAGAAGGCTG
TGAATCTTGGGTCTTGTTTTGTAAAGGAAGCTTTGTAAAATATGATGGGACAGTTGCACATAAATTCTAGGAATCCAGAT
TTTAGGCAAGATTGAAGTAATGTTGAATGGTTCTATTATAGAATAATCAGTTGCACTTTTAGATAACCAATATACCACAA
AGAGCCATCCGCAAATTTTGAAAGCCCAAAGCATTGAATCGTTGTCTATGTTACTCAGTATAGACAGCAGTAAAATGGCG
CTTTTTTGATATTGTAAACCGAAATGATTACTAGAATTCATTGTTTCGTCAAGAGATTTCGCGAAACTCTGAATATTATC
TGATTGATTTGATACTATTCCTTGGAGTTTACAAATTGATTTCAGTTCCAAATTCATACTATTGTGTTCTGCTGATTTGC
TACTATTGGAGCTCTATAAGGAATTATTAGAATCAATTTTGGTTTGATAGTGGGTTTTGCAATCATTGGCTTATTGTGGG
TTGTGTAACCATGGAAGTAATTGTGAATAGTTATAGTGCTCGCTCTGCATAAAATAATATTTAATCAGTGCTTTAAAGTA
GATTTTTAACGATTATTATGAAAGATTTCTCTTATATATTAATGTTTTTGTATCCTTCAAAAGTTTACTAAAAATAATGC
ACATTTGAAATTTACGCGTTACCATAAAATGTCTGAAGTGGTCCAAAGCAATAAAAGCTTAAAAAGAAAGTTCTTGTTTT
TAAATGTATTGGGATATACTCCCACTAACCTTCCGTACTCCGCTGCCTCCCTTCCCATCACATACAATATTTGCTAGTTC
TACTTACAGAGTTGAAAATCGAAAAATTTTCCCAGTCAATGTCCATGATTATGCTGAATAAATTTTGTCCGAACATAATA
GAGATTGCCTCAGCCAGTATTTCTTTCGTTGTTGAGTTTTGATGAATGACATGTGAGACTAAATTTATGGACAACCATTG
ATTTTGGTTTTGCTGAAGTTGAGACTTCTTACGGTAAAGATAAACACGAAATAATGATAAACTCTAATCAAAAGATATTA
CAAACAAATATTATGATATCAAAACCTTCTGTCGAACCAAGGCACTTGTGTGAGATAATAAATGAAGAATGAATTCGAAA
AAGAAGTCATAATTCGAACATCGCTCCAGAATGCTGTCACTGACTTTGACTTCAATCACATTTTCCAATATTGAAATCAG
ACCGGCGATCACATGGACCCTTGATGATTCAGACTGACCACTGATTACGGGTTGATCGGTTAAATTATCTAGAGATTAAA
ATAATAGTCGGTAAAGGAAATTATCCATATAAACGGGAAACAGAAAAGTTTTAACCATGGTTTCAAAAGCTTTTGGGACT
ACCCCCAGCTTTGCAAAACAATTTTTTAACGCTCTTGTTATGACTTGAATCAACATTGTACAATTGTTACAATAGACTTG
ATGATTTACTTATTTACACCCCATCTAAATTGTTTCTTAACCCTTTGCCACCC
>SMED30028676 ID=SMED30028676|Name=Synaptotagmin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1385bp
AAATCAGAAAAATCAAAAAGAAATTTCACAGAATTACGGAACTTATGAAACAGTGAGCAAAGCGCCGCTGGAAATCACAA
TTACAAAAGCAGAGGATAACGAAGGGGTTTCAAATAAAAAAATAATCCTTCAAGATGACCGTCGATGTACTATGCCATGC
ATTTTACCATCGAGCAACAATTCTTCAGATGGATACTCGGAAAGCAATCTAAGTGTAAATGAAAGTTCTGTATTCTCTCT
TAATTCCAATAATCTTTTGCTTTCCGGTCTGATTTCTCCTGCTCGACGATACAGCGACAATTCAAATACGCAAAATTTCG
TTGAGTTACGAAAGAAAAGTGTCCGACCCGATAGATCAAAACGAACTTTCTTCATATGAGATACTGAATTTATACGGACA
AGGTAAACTATGTTTTTCAATAGTTTACAATGAACATATTTCTCGACTCTACGTGACAATAAACAAAGCAGTTTATTTAA
ACAGTTCCAAAACTAACAATCTGGCCGGATTCTATGTGAAAGTGTATTTATTAAATACAGAAAATGATATGAAATTGCAA
ATGCATAAATCGGAAATTGTAACTGCAAATAAAAATCCAATGTTCGAGCAAACATTTTCGTTTCTTTTAACAAAATCCTC
TTTAGTCAGCATAAAATTACAGTTCAAAGTCAAACAAGCACATATAAAAGTAAAAAAAAATGAATATCTCGGAGGATTCA
TGTTTCATCTTGATAATAATGAAATAATTAACAACCCGGAACTCTTTCAAGAATTATGGCGAGATCTGCGGGGCGACTTG
AGGAAAGACACCAGACGTGGAGAAATCCTCATTTCCCTGATGTACAGCGAACACCAATCTTCAGCTTTTCTATCAGTTAA
TCTGCATCGAGCTAAAAATCTACAAATTCGACAACATGACAATTCTGTTTTTGCCAGATGTACAATGTTGGTTGGAAACA
AACCGATCAAAACAAAGCGATCAATTACAGTAAAACAAGACATCTCTGCGCCCTATGTTGATCTTGAAAGTGTTTTCAAT
GTCGACAAATTGAACATCATGGAAGTCGGCGTTGTTATTCATATATGTAGCCGCAGCAAAATAGGTTTCAGTCACCTGCT
GGGCAAGCTGATCCTGGGATCTGTGATGTATACGGACGATAAGTCAGTCCTAATACACTGGAAGGACATGATCAGTTATC
AGAACAGAACCGTCACTAAGTGGCATACGATTATGTGAACATAAAATAACTTTAGACAATTTGTTGGCATGGATGAATGT
TTACAAATCTCATGAAATTAGCCGTTCATAAAAATGTGTTCACAGACTAATGGTAATTTTTAGGCATAATTCGACCATTC
ATTTAAAATTTCGATTAAATCATAG
>SMED30020209 ID=SMED30020209|Name=Synaptotagmin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1588bp
TGCTTGAACGCTGTTGGGCAATTTCATACTGGTTGAATGACTCTCCCAGCTGTATTCTGACCTATGAAAGTTAAATTAAT
ATAGTTATTTGTATGAGATTGTTATATATGGAATTTCCCAGTGAATTGCGCCCAATAATTGGTATCTTGATGGGCCGATC
TCGGTTTGTGGAATAATTCATTTGATTACAAGCTAAATTACCTTGAAATGACAGAAACAAAAATGAAATTTCATGCCAAT
TTCACTGCTTCAACGACCTCCGGTAAAACCTCAACAAATGCTGCAAAAGAAAAATTCCAGGAAATAATTACATATTTGTC
GAAAAAAATGAAAGTACCCCCATGGGCAGTTTACGCAATTGGAGTAGCAATCATACTTGTTATCCTCATAATTTTCTTTT
GTCTCATAAAGATTTGTTGCTGCAAACGACGCAAAAAATCAAAAGGTGGAGGCAAAAAAGGAAAAAATGCAACAAAGAAT
ATGAAAATCATTGGTGGAGCTGTAGATAATAAGACCCAATCAGATGAAGAAGATTTGGTTCTAGATAAAGATGACGATAA
TGAAAAGAAAGAAGAGGAAAAAGAATATTTGGGAAAATTAGAATACAAATTAGATTACGATTTTACAAAAGGAGAGCTTA
CAGTTGGAATTTTGCAAGCTCAAGAACTACCAGCACTCGATATGAATGGGACGTCAGACCCATACGTCAAAGTCTTTTTA
AAACCAGATAAAAAGAAAAAATTTGAAACAAAAGTTCATCGAAAAACTTTAAATCCGGTCTTTGATGAAGTTTTTCTTTT
TAAAGTACCATTTTCAGAAATAACTTCCAAAACTCTTTGTCTTCATATTTACGATTTTGATAGATTCTCAAAGCATGATC
AAATTGGTCAGTTGGAAATTCCATTGGGTTCAATAGATTTGTGTCAAGTTGTGCAGGAATGGAAGGAACTTGAACCAAGT
AAAGATAGTGCTGAAAAAGAAAATAAACTTGGTGACATTTGTTTTTCGTTGAGATACGTTCCAACAAATGGAAAACTGAC
CGTTGTCGTTTTGGAAGCAAAGAACCTCAAAAAAATGGATGTTGGGGGATTATCTGATCCTTACGTCAAAATTTCGTTAA
TGATGAATGGAAAACGAATAAAAAAGAAGAAAACAACAATCAAAAAATGTACTTTAAATCCATATTACAATGAATCGTTT
TCGTTTGAGGTGCCATTCGAGCAGATACAGAGGATTAATCTAATAGTAACGGTTGTTGATTATGATAGAATCGGAACCTC
GGAGCCGATTGGAAGGGTCGTGTTAGGTTGTAATGCTTCAGGGACTGCTCTTCGTCAATGGTCTGACATGCTTGCTAATC
CTAGAAGACCAATTGCGCAATGGCAAACTTTACAAGAAATGCCAGAAAAATAACTTTTCCTATTTTTCCTATTATATGCT
GATAAAAATTTAAATCTAGTCATTCGTTATGTGATTTCTTATTTTTAGACGACAATTTTAATATTTTCATCGTTTAATGT
AATTTTTTCTTAACTTTAAGGCTAGTTTTGGTTTTTAGCAGTCTGTATCAAGTGAATGTGAAAATCTG
>SMED30020614 ID=SMED30020614|Name=ATP-dependent RNA helicase dbp2|organism=Schmidtea mediterranea sexual|type=transcript|length=2242bp
CTTCCGATCTATTTTGTTTAACTTTTTCTCACTTTTAAATAAATATTATTAATCCAAAATGTCAGATTGGTCTGACAATG
GAAGAGATCGTTCTGGAAAATACAATGGCAATGACAGAAGTGGTCGTCATGATCGAAGCGATCGTAATGATCGAAGTGAT
CGTAATGATCAAAAGGAACGAGGATTTAGAAGCAGTTATAGTGGTCATAATGATAAATATAGCAAAAATAGTAGAACCGA
AAGAAATGGATTTGATAAAAACAGGAAGGATAAATCTGATTGGAACGACAAATCCAGGCGATCTAGATCTCGTTCACCCT
ATAGTAATTATAGATCGAAAGATAACAAAAAGGATGAACAAACTTTAGAAGTTGTTGATTGGAAAACCCACAATTTAATT
CCATTTCAAAAAAATTTCTATAAGGAGAAAGCTGTTGTTTTGTGTAGATCACCAGATGAAGTTGAGAGATATCGTAAAAT
AAAAGAAATGACTGTTGCTGGGGATGATATAGCAAAACCAATATTCTCATTTAATGAAATTGATTTTGCTCCTGAAATAG
TGTCAGTGATTATTAAAAATGGATGGGTTGAACCAACCCCAATTCAAGCGCAAGGTTTGCCTATGGCATTAAGCGGTAAA
AATGTTGTAGGTATAGCGAGAACTGGTTCAGGCAAAACTGCCAGTTTCGTTATTCCAGCAATTGTTCATTTAAAAGCGCA
ACCTAGATTAAGAAAAGGTGATGGTCCCATATGTTTAATCATTGTTCCTACGAGAGAACTAGCTCAACAAGTACAAGGTG
TTGCAAATGATTTCTGCAAATCTTATGGTATTAAATCAGTGTGTTGTTATGGTGGAGCTCATAAAGGTGATCAGATTGGT
GAATTACGCAAAGGTGCGGAAATAGTAGTAGCTACCCCAGGTCGACTTATAGATTTACTAAAATGTGAAATAACAAATCT
TCATAGAACAACTTATGTTGTTCTTGATGAAGCTGATCGTATGTTGGATATGGGGTTTGAGCCTCAAATCAGGAAAATCT
TTAGTCAAATTAGACAAGATAGGCAGACCTTGATGTGGTCAGCTACTTGGCCACGAGAAGTTCAAAAATTGGCTCAAGAC
TTTCTTGGTAAATACATTCAAGTAAATATTGGATCTAGAGATCTGCATGCAAATCCTGATATACAACAGTTTGTTGAAAT
TGTCGATGAATATTCTAAAGATACAAGATTAATTGAAATAGTCAGGAAAAATGCTTGGGATAAAATGATAGTATTTACAG
AGACTAAGAAAAAGGCTGATAAGATTTGTGGATTACTTAGGTCTAGTGGTTTCAATTCCGGATCTATGCATGGTGATAAA
TCACAAAAAGATCGGGAATATATTTTACAAGGATTTAGGAATAAATCGTTGAATATTCTTGTTGCTACAGATGTGGCTAG
TAGAGGATTAGATGTTGACGACATTAAAATGGTCATCAATTATGATTTTCCTAATCAGTTTGAAGATTACATACATCGTA
TTGGAAGAACTGCGAGAAGTGGAAAAAGTGGAATGTCATATACATTTTTTAATAATAAAAGTGCAAAGAGTGCTTCATCA
CTTATTAAGATAATGGAAGAGGCTAAACAAATAGTTCCTGATAGTTTGTACAAAATGGCTTGTATTCCAAGAGATCGTCG
AAGAACAGACTTTCGTTTTCAACAGCCATTTTCTAATGGATTTTCTCAGCAGCAGTCAAATATATCCTCAATTGATTCTG
GTACTATAAAAAATCATTATACCGATTCGTCTAAGGAATATAATTTTGATAAACCTCACGTGACACCAGTTTCCCAGACA
AACGGAACACCACACAGAGTCAGTAGATTTGGTGATCGTATTACCCAGTTGCCAAGTTCTTTTACTTTACCACCTCCGAT
TGATAGTTTTGTTAATGATGTGCATTGTAAACCGGTTATACAACCACATCATCCTACTTCTAATGGAAATGTCAATGGTG
GTGTATATACGGATAATTTATCTGATTCTAATATATTTAACGATCCCAGATTTAATCACATGGCGTTTTACGGAGTACCT
CCTCCAATATTAAATGGATCTATTAAACCTTTGTCGTTTGAACGAGACTAGTGATTTTTCAATTTGTCATATCGTTGATA
TTATGAAATATTCGAGTTTTGTTTGACAGGTTAGTTCTTCAGTAATCATATTGTTTTTACGTAATAAATGTTGAGTTAAA
TG
>SMED30027646 ID=SMED30027646|Name=Transcription factor BTF3 homolog|organism=Schmidtea mediterranea sexual|type=transcript|length=541bp
AAATTAATTTGTTTAAATAAATTTCTTTAGAATCACGCAATGGACGGTTTTAAAATTAACACTGAAAAATTAGAAAAACT
TAGTAAGTTGTCGGAAAATGTCCGAACAGGTGGTAAAGGTACAATGAGACGAAAGAAGAAGGTCATTGTCAAGAGTTCAG
CAGCAGATGATAAGAAATTAGAGGCAACCTTCAAATCATTGTCAATGAGCCCGGTTCCAGTTGAAGAAGTAAACATGTTC
AAGGATGATGGAACTGTTATTAATTTCGTTAATCCAAAAGTCAATGTGTCACTTCCATGCAACACTCTCTCAGTTACTGG
AAAATCCGAAATTAAGCAATTGACCGAAATACTTCCAAAAGTTTGGCAACAACTTGGCCCACTTAAAGGAGATCTTTTCA
AGAAAATTGCACAAAACATGGAAAATCAAGCAACTGTCGAAGATATTGATGATGAAGACGATGACGTTCCAACTCTCGTC
ACAGACTTCGATCAACAAAGCAAATTGGAATAACTTTTTAATATCAATAAATTTTTTGGAC
>SMED30020435 ID=SMED30020435|Name=Myosin heavy chain|organism=Schmidtea mediterranea sexual|type=transcript|length=3615bp
TCTGAATTTAAACAAAGATATTCAATTTTGGCCGCAGATGTAATAGGGCAAGGATTTATTGATGGAAAACAGTGTACTGC
AAAGATAATGGAAGCAATCCAATTAGATAAAAACAACTACAGGCTTGGATCAACTAAAATCTTTTTCAAGGCCGGAGTAC
TTGCTCAGTTAGAAGACATGCGAGATGAGAAATTATCATCCATTTTGTCTGTATTCCAAGCACAGATGAGAGGATATATA
ATGAGAAAAGCATATAAGACATTGCAAGATCAACGAATTGCTCTTTCTCTCATTCAAAGAAACATCAGAAAATATTTATT
ACTAAAAACATGGCCATGGTGGAGACTATACACTAAAGTCAAACCACTCCTCAATATCGCAAGACAAGAAGAGGAGATGA
AGAAAGCTGCTGAAGAGTTGATTAAATTGAAAGAAGAATATGAAAAGATAGAAAAATTTAAAAAGGAATTGGAAGGTCAA
AATGTGGTTTTGCTTGAGCAGAAAAATGATTTATTTTTACAACTGCAAACAGAACAAGACAATCTTAGTGACGCTGAAGA
AAAGATTCAAAAGATGATCAATCAAAGAGTTGAAATGGAGAACCAATTTAAAGAATTAGAAGATAAATTAATGGATTCGG
AAGACATTCAAGATGAATTGGAAATCGAAAAAAAGAAATTGTTGTTGGATATGGATGAATTGAAATCGGACATTGACGAA
CTTGAAGTATCTTTAGAAAAGTCTGAACAAGAAAAACAAGCTCGCGATCAACAAATTAATAATTTGAAAGAAGAAATTCA
AAAACAAGATACTTCTATCGGAAAAGTTCAAAAGGAGAAAAAGACTCTAGAAGATAACTTAAATCAGACCAGAGAAGCTT
TAAATGCTGAAGAAGACAAGGTCAATCAGTTGACTAAAATCAAATCAAAATTGGAATCTGAAATAGATGAAATGGAAGAA
GCTCTAGAACGGGAAAAGAAGATCCGTGGAGATGTTGAAAAACTTAAACGGAAATTAGAAGCTGATCTCAAATCAAGCCT
TGATAACTGTAATGAGTTGGAAAATATAAAGCAGGAGTTAGAAGAAAATATTCAGAGAAAGGACATTGAAATATCAAAAT
TAAATGTCAAATTGGAAGATGAATCTTCAATTGTCACTCAACTTCAACGAAAAATTAAGGAATTACAAACTGTTATACAA
GATCTTGAAGAAGATCTAGAAGGTGAGAGACAAGGTCGATCAAAATCTGAAAAAGCTCGACAGTTGGCTGAACAAGAACT
CGATGAACTAGCTGACAGACTTGAAGAGCAGGGAGGTGCTACTATGGCACAAGTGGAATTGGCCAAGAAACGAGAAACTG
AATTAATGAAACTTAAAAAAGAATTACAAGATACCAATTTACAGAATGAGCAAATACTCAATGGTTTGAAAAAGAAAAAC
CAAGAAATTACCAATGAATTCTCCGAGCAAGTCGATCAAATAAATAAATCTAAATCAAAAATCGAAAAAGAAAAGGCGAC
TCTTAAGCATGATCTGGATGAATTTGTTTCTCAATTAGAATCTGTTTCAAAGCTAAAGGCCAATACAGAAAAACATTCAA
AACATTTAGAAAGTCAAATTATGGAATTGGAAAACAAAATAGACGAACAGAATCATCAAATATCAGAAATGGTTTCACAG
TCTAATAAAGACTCTCAAGCAATAATGTCTTTAGAACAACAACTAGAACAAGCAGAAAATGAAAATCACCAATTGAGCAA
ATCCAAACAACAATTCCTCCAACAAATTAATGACTGTAAATCGACTCTTGAAGACGAAGAAAAAGTAAAGGCCAAACTTT
TCAATGAAATTCGTAATCTGAATGATGAAATGGGCAATTTAAGATCCAGTTTGGAAGAAGAGCAAGAATCCAAAAGTGAA
ATTCAAAGGTCACTAGCAAAATCCCAATCTGAACTTGTACAAATGAAAAATAAATTTGATAGTGAAGGTTCAGGTCGCAT
TGAAGAAGTTGAAGAAGCTAAACGTAAGTTGCAAACGAAACTTCAAGACATGGAACAAGAATTTGACGCTATTAAAAATA
AATGCGCGCAACTTGAAAAAATCAAAATTCGTCTCACTGGAGAAATCGAAGACATGAGTGTTGATGTTGACAGAGCTAAT
GCAGTGGCTAATCAACTAGAAAAGAAACAAAAGAACTTTGACAAAACCGTCAGTGAATGGCAGTCTAAATGCAACTGCCT
TCAAACTGAAGTTGATGTTGCAAATCAAGAATCAAGATTTTTGTCAACCGAAGTATTTAAATGTAAAAGCCAAAACGAAG
AATTGCTTTCACAAATCGAAAATCTTAAACGAGAAAATAAGTCTCTCAGTGATGAAATTCACGATTTAACGGAACAACTA
AGTGATGGCGGAAAATCTGTTCACGATATAGAAAAGGCAAAACGAAAATTGGAAATAGAAAAGGAAGAACTGGAACAAGC
TTTGGAAGAAGCTGAATCAACATTGGAAAATGAAGAAGCCAAATTACAAAGAGCTCAGTTAGAGTTGAGTCAGATGAAAT
CAGATGTAGAAAAACGATTGTGTGAAAAGGAGGAAGATTTTGAAGGAACTCGCCGTAATCATCAAAGAGCAATGGAATCA
ATGCAAGCTTCTTTGGAGGCAGAAATTAAAATTAAACAGGACTCAATTAAAGCCAAGAAGAAGTTAGAACAAGAAATCAG
TGAACTCGAAGCCAATTTAGATCAAATCCAAAGACTGAAATCAGATGCTGATAAGAACAATTCAAGAATGCAACAGCAAA
TTCATGATTTACATTCAGAGATTGAACAAGAACAACACAGTAAAAACGAAGTCCGAGAACATGCTCAGATGGCTGAAAAG
AGATTTTTATCGGCTAATGGAGAACTAGAAGATTTGCGAGCCAAATTTGAACAATCAGATAGAAATCGTAGAAATGCTGA
ATCTGAGCTTCAAGATTTGAGTGATAAATACAATGAAAGCCAAGCACTGATCACTTCACTTCAAAGTTCAAAAAGAAAAA
TGGAAATGGATTACGTAGCTATGCAGTCCGATCTTGATGATATGTCAAACCATGTTCAACAAGCTGAGGAAAGAGCAAAG
AAAGCAGCTGGTGACGCTGCCCATATGTCAGAACAACTTCATCAAGAACAAGACAATAGTTTGCACACGGATAAAATGAG
GAAGCAAATGGAAATTCAAATCAAAGAAATGCAGTGTAAACTAGAAGAAGCCGAAAGTAATGTTTTGTCAGGCGGCAAAA
AGACTTTGGCAAAGTTAGAGTCAAAAATACGAGAATTGGAAACTAATCTTGATAACGAAATGAGAAAACATGCTGAAACT
CAAAAGAATTATCGCAAAGTAGATAGACGAATGAAAGAACTAACATTACAATTGGAAGACGATAGAGCTCAACAAGAAAA
ATCAAATCAAGTTATTGAAAAATTCCAAGGACAAATCAAAACCCTTCGAAAACAATTAGAAGAATCAGAAGAAGTTGCCG
TTTTGAATATTGCCAAATTTAAGAAAGTACAATGTGATTTTGAAGAAGCCGAAGAAAGAGCGAATGAATCGGAACAAGCT
TTACAAAAATTAAGA
>SMED30035063 ID=SMED30035063|Name=SOXP-2|organism=Schmidtea mediterranea sexual|type=transcript|length=2664bp
TGTACATTGAATTCAATATTTAATAGTGATTAACTTATCCAAATTTTCAGCCACTTTTAGTTTAATTTGCGTGTTTTGTT
GAGCAGTTTTTATTGGCGCATTTTATAAAAAATACAAAACCAATCCAAATCAGTTTGAATCATTGTCAGATTTTAGTCGT
GCAAGATACATTATTTCATTTTAATTCTCTAGCATATGACATTTAAACATGGAGCTGAATTACTCGTTGAATGATAATAA
TTTCAATTTACAATTAGAAAGCGAGTCCTTGACTTATTTCGATTTATGCCAAAAATGTTCAGCGTACCAAAATAGTCTTA
GAGACTGGATGAAACATTTAGTTGACAGACATCCTTTACCTATTCAGTGGATGAGTGATTTGGCAAATAATTTAACAGAT
GATAAATTATCTAAGCCATATTCGACCGTTACAGAATCCCGTAAAAAACGCAAGAAGCATATCACTCCAAGGCCATTGAA
TAGTTTCATGATATTTTCCAGACATTTAAGAAGAAATGTTCTTATTTTCTTTAGTGATGCTTCAAATTCAGAAATAAGCA
AACTTCTTGGGAAGTTATGGAATAACATTCCAGCTACCATTAAATCGATGTATGATAATGAAGCTAAAAAGCTTGCAATT
TTACACTCCAAAGAATTTCCTGAATATAAATATCAACCTAAAAAGAAAAAAAAACAATATCTAACGAAATGCCCCATTAA
TTCCACACCTTTGTCGAGTAATTCATATGAAAGTATTCAAGATATTAATTCAGTAACGGATACACTACAGAATTCATCTA
ACAACTTACAAAAGGAAAGTAATCCGACCTCTGTTTCGTCTTATGGAAGCAATCAGGAATGTAATAATTCATTTAAGAAT
CATAGTGTACAGTCCAGCAATTTTCCCAAAGAAATCAACCATAAACCAAGTAGAAAAATTGAAAAGCAATCGTGCAAAAT
AAGTTCCAATCAAATAATGGATGATTCAGAAGGGGCTGAATCCAGTCCATCATCATTTAAAAACACCATTAAAAATGAAA
TTTATTCCTCTTATAGTCCATTTCTAAATGAATCCCATAGCATTCTTTCAGATTTAAGTTACTCTTCGTCTCTCAATAAC
GTTTCAAAACACACTAGCGATTCCATTATAACGAATTCTCCTATCAGAGAAGAAATTGTCTTAGAAAATAATCAGCCCTC
TCAACAGAATAATATAAACAATTACCGACACGTATTTCAGAGAACTTCGACTCTATCCAACAGTTTGTTGACCCCTTTAA
CCATTGTCACAGAAAAAGTTGACGAACAGAAAGATCTTCCACCATCAAGAATCAATATCCGATATGTGAAAATTAACAAA
CTACCGATTCAAACAAAATCCGATTTCCCATTGACTGGATATTTTCAAAATTTCAATAACGACTCAAATCTTCATTTTCA
GAGTTCCATTCACGCCCTGAATACGACATTGACTCCAGATCTGTCGGTAAAACGCGAAGCCACTGTCAACAACAGCATGA
CAGATTATATCAATCGAAAACGTACAAATGTCGATCCACTTATCATCGATGATATATTTGAAAACGAACAATTTGAAGAT
GAGGAAGTGTTGAATTTTGACAATCCTGATAACAATAACAGTTCTCCTTGGTCGTTTAAATCGCCTAACTTTAAAATATC
TACCGGTTCCTCGACACTGTCAGACAATCCGTACAAAGAACAGTTTTGTTCTTCCCCGTTCCATCTATCAGAAACTGATA
CTCAACCGATTCCAGTTCAACGATTGCCAGCAATCGGCTCATGGTTAAAGTCAAACTATTCTGAATTCATGATCTGATCC
AATCTATTATTCTATTCAATTGTCTGTTTTCATACAATTAGGATTACTTGTTATGAATTCTAGCTGATTTTGAGTGTGTT
TATAAAGCTTTTGTAACGCCTTTTCTATACAGATGTTCGATATATATATATAAATAAATAAATATAAATATATAACAATT
TTATTGACATTGTACAGTATTCCATAAGCCCGATCTTGTAACGCATTTATTACTATACTCAATAGACCAATCTATATGTT
CTCATAATTTCTATGTTGTTATTGTACACGGGAATTATTACTATAAATGATGCGAATTTATCACTTTGTAATTGAGGGAA
ATTATCGATCAATTTGCGCTTTCAGACATTTTTCATGTATAAACTTGTTTTTCTCTTTTTTATCATCAAAAATTTAATTT
TTTTGATATCGCTATTCATCATATTATTATTCTCCGTTGCATTTGTTAGATTATGTAAATTTTTATATGAAAATGTTGTT
ATTTATTGTATTTTTATACGATTTTTTGCTTTGGATACACTTTTATCAAATCATATTGCCAGTGTGAGCATTTATTGGAC
TTGTTGTTATTGCTGCTGCTCGAATAATTGCTTCATACGGGGAGTCTCGATATTTTCATGAAGCGATTTTCATGGTTGCC
GCTCTCCGCCGCCGCCATTCGGTGTAAATATCAATTGCATTGCCAGCACGTTTTCTCAAACTCAATTTTTGTACTCAATT
TCAATTGATTTATGTTCATTTTATTTTTCATAGAAATGAGTAAATAAATTTTCATAAATAGTTTTGTTTTCAATATTTTT
AGGAAATTTGAATGTGTCTCTAGA
>SMED30019754 ID=SMED30019754|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=1366bp
ATTTAATTTGCTCTATTTTATTTATCAGTAATTTGTTTATTCAAAATATATAATTAACATTGTTTTGGACATCTGTTATG
AAGTTAGTAATAGTTTGTGTTATTCTCTGTTCAGGCCTTGTTAATTGTAATCCAATAACTAAGCTTTCTGACAATGAAGA
CAATTTAATTTTTGATTCAAACCTTTCTAATTCCAAGTCAAATCATGATCATTTTATTGTCAACTTTGGTCAACTAATTA
CTTATGATTCCAAGTTAGTAAAAGAATTGTCGAATTTATTAAATGAATTTCTACAACTCCCAACAATTGAGTTTATAAAT
CAAATAAAAATAGAATGGACAAATTTTAAAGTTAAATTTAAGAAAATTTACAAAGATGTTAAAGAAGAATCTGAACGGTT
TTTGATATTCTTAAAAAATTATCTCAAAATAAAAAGCCACAATTTAAAATTTAATTCCGGAACAGTTCAATTCAATATGT
CAACTAATCATTTATCTGATCTAACTGATTCTGAATATTCAACATTATTGGGCTTTAAATTTGGAAAGCGTAAAGATGGG
CCTTCGTATTTGTCACCTATGTCTCGCGTAATGTTACCGAACCAAGTTGACTGGAGATTAACTGCAGTTACTCCAGTGAA
AGACCAAGGAAATTGTGGGTCATGTTGGGCTTTTTCTGCAACAGGCTCGTTAGAAGGTCAACATTATAGGAAAACGAAAA
AACTTATCAGTTTATCTGAACAGCAATTGGTGGATTGCAGTCTAGATAATAGCGGTTGCAATGGTGGGTTAATGGATCTG
GCTTTCACATATGTCAATGATAATGGGGGTATTGACAATGAGCAAGCCTATCCATATACCAGTGGGAAAACCGGACGAAG
ATCTGCCAAATGTAATTTTACTATACACAATATTGGCGCAAAGGATTTCGGATATATTGATATTCCTCAAGGAAATGAAG
TTTTGCTTAAAGAGACTGTGGCATTGATTGGTCCAATTAGTGTTGCTATTGATGCTAGTCAATTCAGTTTCAGAAATTAC
CATTCTGGTGTTTATGAAGATCCCAATTGTAGTTCTGTAGAACTTGATCATGGTGTATTGTTAGTAGGCTACGGAATCGA
AAAAGAATCGAACATTCCATATTGGTTAGTTAAAAATAGTTGGAGTACAAATTGGGGAGATTCGGGTTACATAAAAATGA
GACGAAATTCTAATAACATGTGCGGAATCGCTACAGCCGCTTCATTTCCTATAGTGTGAAAGTCTGTCATATTTATTATT
GTTCATTCTCATGATATTCTGTTCATGTTTCAATAGTTGTCCATATCGTACTCTACGTTCTTTTTTATATAATAAAAAGT
TAATAT
>SMED30017650 ID=SMED30017650|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=1091bp
GATGGGTCCTATCTTGATATGTTTATTATTAGCAGTGATTTCAGAAGCCAGAACCACTTATAGCCATCACAAATCAGTTC
CAAGTGATGACATTTCTAGTAAATTTGAACTAGAAAATATGGTATCTCTCTTGTCCCGTTACGATGGAGAATTCCAAACC
TTCAAACAGCGATATAATAAATCTTATAGTTCCATGCATGAAGAGAATTCCAGATTTTTAAATTTTATATCATCTCTACT
TGAGATCAATCATCACAATCAACTTTATGAAAACGGTCAGAAATCATACGAGATTGGAATCAACCATTTGAGTGATTGGA
GTGGCGAAGAACTCGCTCAACTGACTAAATTGAAACAATCAAACCTGACGGGCTCATCATATCTATCATCCAATGTGAAA
ATTGACCTTCCAGATTCATTCGACTGGAGAGAGAAAGGTGCAGTTACTGAAGTAAAAAACCAAGGATTTTGTGGATCATG
TTATGCATTTGCTACTACTGGCACCCTAGAAGCCCAAATCTGGAGGAAGACTGGGAAATTGATCAGTTTATCAGAACAAC
AAATTGTTGATTGCGATACTAATGATGATGGTTGTGATGGCGGATTTGTGCAAGACGCGTTATCATACATCAAGTCAAAT
GGAGGCATTGAAAATGAGGAAAGTTACCCTTACATATCAAGTGAAACATTTAAACCTAATTCTAAATGCAATTTCTTCAA
AAGCAAAGTAGTGGCCACCGACACTGGATTCGTTCAAATGCCAGCAAATGACGAAACAAAAATGAAAGAAGCTCTAGTTA
CAATTGGGCCTATTTCAGTAGCAATATCTGCAACCAAATCGCTCAAAAGATATACAAGTGGCATTTTTCATGAGGATGAA
TGTGACAAACTAAAACTTAATCACGCTGTTCTGATAGTCGGATATGGAACAGATCAAACTTCCGGGACACCATATTGGAT
AATTAAAAATAGTTGGAGCTCATTTTGGGGAGAAAATGGATATTTCCGGTTACCCAGAAATATAAATGCTTGCAAAGTAG
CGATGATGCCAGTTTATCCTTTGGTTTGAATTGATAAAATTTTGTTCACAC
>SMED30022586 ID=SMED30022586|Name=Synaptotagmin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1214bp
TCACCATCTTGTCTTTGATGGGATAGTTTGACTAATTTTTGGTTTTGATTGGTTCTCTTAATTGGGAATGCAAATTTTAC
GGTGCTTGCACTTATGACATGGCATTATTTGCAGAATGAGTTTTCAGAGGCTGTGTGGAGATATTATAATAAAACTTTTG
GAAACTTGTTGTTTTTGTTTTCATTCAGAAACTGAAGAAAAAGGGAAACTATACATCCACGATAGAACATCTCCAATGAT
TTTAAACCAAAAACCTTCAATTATGAATCAGGAAATAGAGATAAAAAATATTTCATTGAATCTGCAGACGGAAAATACAT
TAAATCCAAGAAAACAATCTCTTGGAGGCAATTTTCTTGTTCCAAATGCAGGGTTAAATGAAAAACTTCCTTCAGTAATT
AAAGTAAAACGACATTCGGAATCGGATTTGGGGGACATGAATTACAATTTTCCTGTTGAAATTAACCATAACCACATTTT
GAACGTTTTGTCTATTAAAGTTTTTCCAAACGAAAAAATTCCTGATAAATTTGATATTTCTGTGAAAACTAATGACAAAA
TCACCAAGAAAATAAGCTACTTTTACAAAGTTATTACATTTGACAATATAAGTGAAGATGATTTAAATACATCTTTCCTG
AGCTTGACATTTTATAAGAGAAAAACGCCAGATGATAAAAAAAGTTTCGGAGAAATAAAATTTCCTCTAAAGTTAATATT
GAAGAAAAAAATTCAAAATTCAATTAGATTTTACAATACAGATTTCAATTTATTTCAAAACAATGTGAAATTATCCAACG
GAACGCTTGAAATCGGTTTACGTTTTGATCATAAAAACACTCAATTAACGGTAAATGTTTACGAAGGACAGAATTTTTCA
AACCAAAATCAAACCCCTTTAAATACTTTCTGTGTCGTTGAATTATTTAAAACACATACCCTCTATATGACCTACAAAAC
CAGTGTCAAATTCAATTCGAATTGTCCGATTTGGAATGAAACTTTCATCTTTCCAATTAAGCTTGCCGAATTGGCTAATC
ATATCAAACTGATTATAACAGTCTACAATGAAAATGAAACGGCAAATCTACCAATTGGAAAATTGTTTTTCCCGTCTTCT
GAAATGGCATTGGAAACTCGTCATTGGAATGAAATTCATACAAATTCCAACCTACAAATCAGAATGTTGCATAGCTTAAA
ATGACATTTAAATA
>SMED30023593 ID=SMED30023593|Name=Netrin-1a|organism=Schmidtea mediterranea sexual|type=transcript|length=1962bp
GATCTTGAAATTCTTTTTAAAATTTCTAATCTTATTCATTGGTCTTGTGGCCTTAAATGGAGAACTGCAGACCTGCTACA
GTGCCAATGGAGATCCTAAACCTTGTGAACCATTATTAATAAATTTGGCTCAGCCAATGCATATTGAAGCTAGCTCTACG
TGTGGAGAAAACGGAGCGGAAAGTATTTGTACAGAATGGTTTGACAAACTAGGAAAAGCTCATAAGTCCTGTGAGAAATG
CAATTCTTTAGATCCTAAATTATCAAAATCGTCAAAAATGGTGGTTGATTCACATATACGAGGCAAGGAGACTTGTTGGA
TTTCAGAAGGTGTTCATGAAAGTAGTTATCCAACTAGCGTTAATCTTACATTGGGTTTGAAAAAGAGGTCATTAATATCA
TTTATTACTGTGGAATTATGTGGTCACAACCCGGATGGCATTATTATTTATAAAATGGACAGTGAAACAGATGATTGGTC
TCCTTGGCAATATTTTGCTAAAGACTGTCAACTGACATTTAAGATGCCGGCTTTAACAACGGATACAGTTAATACTTTTT
CCGATATAAATTCATTGAAACCAGTTTGTTTTGATTTGGAAAAAAGTATGGACTATGGAGGAGATGAAAAACTATTCAGA
CTTATCCCATTCAATCCAAGACAAGGCAGAAGTTTTGGAGATGTATTATCTAAAAATGAACAAAACTGGTTGGCAGCTAC
AGAAATACGAATCAGTTATATTCTAACTCCTAAAGAACATTACGGAAATCTGCTGTTGAGAGAAAAGCGAAATGCAGAAA
ATCCTGTTTATCATTTTGGTTCATCTGATATAATGATTGGTGGGCAACCTTTATGTCATGGACATGCTTCGAGAATAATC
AGAACTTCGGATGATACTTATCAGTGTGAATGTCAGCACAGTACTGCTGGAAAGGATTGTGAAAAATGCCATGAAGAATT
CAATGATCAACCGTGGAGTTCAGCAACGATTCGAAACCCAGCGGTTTGTAAAAGATGCGAGTGTAACAATCATTCGATAA
AATGTGTATTCGATTTTAATGTTTTCCTGAAATCTGGTAGAATTCATGGCAGTTCTTGCATAGATTGTGGTGATAACACT
GTCGGCCCTCAGTGTGATCAATGCGCTCCCGGATATTTCCGGCAACATGCTTATCCTATTTACCATAAAAATGCTTGTAA
ACCTTGCTTATGTCATTCAGTTGGATCTCTTTCGGGTACACCCTGCGATCAAGTAAGTGGGAAATGTTTCTGTAAGCCTG
GAGTGACTGGGAAAACATGTACCCATTGTGCACCGGGTTATAAACAAACAAATTCCCTAAAGAATCCTTGCAGAAAGATA
TCAAAATTGCGTCATTTAGTGAAATCAAATTCGAGTTGCGATTTTTGTCAAAGGAAAAGTAAAAGAATTAATTTTAAGAG
ATTTTGCAGCAAGGAAACAAATTTCAAAGTAAATATCAAGAGTAGAGAATCAAGGGGTCAGTGGATTCGGTTCATTTCTG
AAATCGAACAGGTCTGGACAAGAAATCAACAAGATCCCCGAGTATCCCAACTTAATCTAGAATCTAGTGAAGGGACTTCG
ATGTGGGTTCATAAAGATCTCGTGGACTGCGGTTGCGTTGATTTTGAATTCGGTCATTCATATTTAGTCATGGCCAATGT
GAAAACAACGGAATTTATGGGCCAAACTGAACTTATTTTAAACCAAAGTGATGTAATTGAGGATTGGAAGGAGACATGGG
AGGAGCAATTTTCTCAGTTTTATACCCAGGATAAAATGGGAAAATGCAATCGGTTTACTCGACAAAAGCGACACGTCAAG
AGGCGTAATTTTGCCTCAACCTATAACCAATATGCTATCTATTCCTGATCATTTGGACCCGGGATTAATTTAATTAACAT
TTTATCTAGCAGCTGAATGTGATGTCTTATTGTATTTATAAA
>SMED30030773 ID=SMED30030773|Name=ATP-dependent RNA helicase dbp2|organism=Schmidtea mediterranea sexual|type=transcript|length=1968bp
TTTCTTTAAACGCATTATTTTATTTAATATTTTAACTTTCCATTTACAATAACAATAATTTAAAAGATGAATTATAGATA
CAGAAGAGAAAGATCTCGATCTCCTATTAGCAGATTTGGAAGTAAATTTCAAAAGAAACAATTTGACTGTGAAATTACTA
AAATAGATTGGCCTACTATTAGGCTGATGCCATTTAAAAAAAACTTTTATATTGAGCACCCAATTGTGACTGCTAGAAGC
TCATACGAAATAGACAGATTTAGAAATGAAAAAGAAATGACAGTCGTTGGCAAAAATGTCCCACGGCCGATATTTAATTT
TAGTGAAATGAATTTTCCAAATTTTATTTTGACCACAATATTAAAAAATAAATGGGTTAGACCAACACCAATTCAGTGTC
AGGGTTGGCCAATGGCAATGAGTGGTCGAAATGTTGTTGGAATAGCACAAACAGGATCTGGAAAAACTGCAGCTTTTTTG
TTACCTGCTTTAATTCACATTCGAGCACAGCCGCCTCTTGTAGCTGGTGATGGTCCAATTTGCCTAGTTCTTGTGCCTAC
CAGAGAATTGGCACAGCAAGTTGAATCAGTTGTAGAAGAATTTGGCATATCAGGTGGATTCAATATGGTGTGTGTTTACG
GAGGCTCTGATCGGCAGAATCAAATAAAAAATTTACACACTAAACGCCCAGAGATATTAGTTGCTACACCAGGGCGCTTA
TTAGATCTCTTGAAACAAAACGAGACTAATCTAAGACGAACTACCTATTTAGTCTTAGATGAAGCTGATCGAATGCTCGA
TATGGGATTTGAACCACAAATACGCGCAGTTCTAAATCAAGTAAGACCTGATAGGCAAATGTTACTGTGGTCTGCAACCT
GGCCATTAGAAGTCAGGAGGTTGGCTGAAGATTTTTTAAATGAGTATATTCAAGTTAATATTGGGGCTATGTCATTACAC
GCCAATCATAATATCTGTCAGTATGTTGAAGTTATTGACGAATTTGGCAAAGAGCGTCGATTAATTGAGTTACTTAAACA
ATTTAATGGTTTGAAAACATTGGTGTTTGTCGCTCTAAAGAAAAGATGTGATAGAATGTCAGATATGTTGAATTCTAGAA
GCTTTAAAGCCTTAGCCATGCATGGAGATAAGCCTCAAAGAGAAAGAGAACGCGCACTTGAAAATTTCAGAAATGGTAGA
TCAAATATAATGGTTGCAACAGATGTCGCTTCAAGAGGATTAGACATTGATGACATAATGTTGGTAATAAACTATGATTT
TCCAACACAAATCGAAGATTATGTACACAGAATAGGCAGAACTGCCAGACAAGAAAAGAAAGGAACATCTTATACATTTT
TTACAAATAATGAAAAAAAACATGCTCAAAAATTAGTTTCAATTTTGGAAGAAGCTACTCAAAATATTTCGGATAAACTA
TATGATTTGGCGGAAGTTCCGTATTCGAGTCGCAAGAAGTCCACTGCAAATGTACCCAAAGGATTAGTAACAGGTACTCC
TGTAAATAACGATTGGGTAGATTCCGTTACTAATAAAAGAATGCCCAATAAATTTAATGGCGGTATTTCTCGTGATAACT
TTTCAAATGTGGAAAGCGATCATAGAAAGCCAGATTATTTTAAATATAATGGCAGACCGGAAGAAATAGAATCGTTTCCT
CCGAGTAATACTTCTTCATTTAGAGATTCCGGAAATTGGAGAAATAATGAGTCTTTTAATAATTACAACCAACCACAACA
GCAGCAGCAACATCAGCCTCCCTATACTAATAATAGCAATAGCTATAATTCAGCCAAAACTTTCAATTATAATGATGATT
TCAATTCTGTAGGAATCATTGCTAATAGATGGTAAACTTAGCTTATATGTTCTTGTTATATGTTGTAGTTTAAACTTTAA
TTGTAATCAAATTTGTTGTAATTATTTTAATTATTAATATTATTCTTT
>SMED30011059 ID=SMED30011059|Name=Cysteine-rich secretory protein LCCL domain-containing 2|organism=Schmidtea mediterranea sexual|type=transcript|length=824bp
AGTAAATAAAGTCAATATTTTAAATTATTTATGCGGATGAATTTTCAATGCCATTTATGCATTTTCTTTTTACTAATTTT
CGGGAAAAGCTTAACTCTATTGCCAGAGGATCAACAAGCGAGGGTCTTGAGGAAAATAAATGTTCATCGCAACAATTTCA
ATCCAGAAGTAACAAATATGATTAAAGTAAAAACAATGCGCCACCTTGTTGTAATGGCAGAAATTTGGAGTCTAAGATGC
ATAATAGAAAATTATACGGATAAATTCTTTGAATATTCTCAGTACAATGTTCTTGTTTATTATGAAGAAATTCCGCAAAA
CGCAAGATTCGAATTAACGAATGCGTTATTATATTGGATTGGCAAAACGAAACTTCCTTATTGTGCTTTAGATCATTATG
AATTAGAATATTGTGCCGATTTTTTTAAGTATCATGCAGGTGAAAGCGAATATGTCGGATGCGGACAGAATTCCTGCCCT
ACTACAAGACCTGGCTATAAAGGGATATTATTCACATGTTTATATTATCCCAATGCAATGAAACCACGGAAAAAAATAAG
ATATGGTCCAAGATGTTCAGAGTGTCCAAAGAAATATCCATTGTGCGAAAATAGACTTTGTTATAATGAAGCACCCGTTC
TGAATATGACAGAAGAGCCTGACAATAATGAAAGCATGAAAAAACATCTAAATTATTATTTATTATGCTTTATTACTATA
TATTGGATAATTACTAAACTTAAATTTATTTTTAATCGAGTGTGACAGAAATGCTTATTGGGAGGCATAATTTATTATTT
TTAAAATGAAATGTTTTATTATGA
>SMED30012850 ID=SMED30012850|Name=Spondin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=2699bp
GGTGAATGAAAGATTGAAAGTAAACAAATTTATGAGACATTGACATTATTCATTTAACTTACATCACAGGACGACCAATA
TCACATAATACTTCTTCCTGTTTACAAGGTTGAAGTCGTTTATATAAATCGTCAAAGTCTCAGTTAAGATCATTGATATT
ATGAAAATTTACATCTTAATTTGGAATATCCTTTGGATGTTGCTATGTCTTCATTGGATGATCCAGGAAAGTTTTGCCAT
GAATACTAGAACCAATTGTTTTAAAATGCATAAAAAAACCTACCAAAAAGTCATGATGAAAGATGGAGAATTTCGAATAG
TAATTAGAGACATGAAAGGCAAAATGGCAGATAGATTCGAACCTGGTGAAAGCTATAGAATAATTTTGAATAATGCAATG
TATGGAATGGATTTCAGAGATTTTTCAATATTCGCGGCCTACGAGATGGAGGATTCGTTGCAAATGGAAAGTCATAAAAT
GATTCCCGATGAAGGACTTGGTCATTTTATTATAAATAAAAAATTTGGGTTGGTTGATTATAAATGTCCTAACAGAATGC
ATGGAAATGATAATATGTTTCTAACTTATGTAGAGTCGACATGGATAGCTCCGCATAATCCTATAAATTGTATTCGCTTT
GAGGCTCAAGTTGTAAAATTTGATTTTATGGTGTATGAAAGTATCGGACGTTTAGTAAAAGTTATTTGTCCAACAAAAAT
GTATAAAATGATTAGTGAAGAAAATAAAAACATGAAAATATCTAAACCTTTTGATGAGATGACTCCTATGGTTAAAGAAT
GTTGCGCTTGTGGAGTAGCGTCTTATAAAGTAACATTTATGGGGTTATGGTCAAAGAAAACTCATCCCAAAGATTGGCCA
AAACAAAAGAGCATGGTTCATTGGACCAATCTTATAGGGGCCACACATACTGGCGATTACTTTATATATTATAACGGTGG
TCAAGCAAGCCAGGCAGTTCAAAGTATTTGTTCATATGGAGATAGCACGGTTTTGAAACAGCAGTTCGCAGAAGAGACAA
TAAAACCGCATTTGAAGAGTTATTTTAATACTTCAGGCATGTGGAATGAAGACGAAATTGAACAGAGTAGATCGGGATTC
ATATCGGTTAATCGTACTCATCATTTCTTTAGCTTTCTCACAATGATGGGCCCAAGTCCTGATTGGTGTACTGGAGTAGC
AGCTGTAGACATGTGTATGAATGATTGTACATGGAAGGATGATTTCACCATGGATCTATTCCCATTTGATGCTGGAATTA
AAAACGGTTTCACATATTTCCCAGAAAATTCGGACAGGCAAGACATTCCTGATCCAATTAGAACAATCAACACTACATAT
ATGACCCAATTCCCTTTCACAGCAAATGTTCCAGTTGCCCGGGTAATTTATCAAAAGATCAAACCAAAACACAATTGGGA
GTGCACCAAGATGAATGCAAAACAAGTAAAAGAATTTGATGAAATGAATTCAAACAAAAACGGAAATTCTCAATTCGATG
GAAGTAGTTTGACGAAAAAACGCCGACACATTAACAAGAAAAGTCCCCTTGATGATCCGACTTTGGCCAATATGGCTACA
TTTTTGTGTATAACATCTCCATGGAGTGAGTGGACTAAATGTTCAGTTACGTGTGGCATTGGGACAGAGATGAGATCTCG
AGACATGTTGAAAAATGCTAAAACAGAATTATGTCGTCACTTACCTTTGCTTGAAAGTCGGACATGCGAAGGAAGAAAAC
GTTCGTGTGATTTCTCAGCACCATGTAGCCTTCTTTCCTGGTCAAGATGGGGTCCATGCAATGCAACTTGTGAGATGCAC
GGATACCAACAGAGATCTCGAATGTTTGCAAGATTTGAAGAAAAAGAGAAATGTCTCAAAAACAAAGAAAGACGATTTAA
AATTTTTGAAGAAAAACGGTGCAAAAAAGACACAGCCTTGTGTGACCCAGTTATTATATGTAGTGAGGGCCTAATAATGG
GCAGCAGCTGTGGCAAGCCTGTTATGAAATATTTCTATGATGCTGCCAAACACAGTTGTGTGCCTTTTGAATACCTCGGT
TGTAAAGGAAGTCTGAATAACTTTCCTTCTAAAATGTCTTGCGAAAAGACTTGCTTAGCAGCTGTCAATGCGCTGCCTCA
GTGGAGAAAAGACAAAATGGCTCACTTACAGTTTCAGTCTCAGTCGAATTCAGATAAACGAAAGAAAATGCCAACAATGG
CTAACAAATGTCGGCTTGAAGTAAAATACGGCGGAATGAATTGCGATGGAACAATGGGACCGGACATTCGATATTATTAT
GATAACAGAAATGGACGCTGTAGACAATTTAAATACACTGGCTGTGATGGGAATAGTAACAACTTCCGGTCTTATCACAG
CTGCATTAAGGCTTGCATGCCAGATCAAATCGACTTTATGAAAACTGCTCCGATCAAAGCTTGTCAAGTATCTGAGTGGT
CACATTGGGGTCCATGTTCTACGACCTGCGGTGTGGGAGAGAGATTCAAATGGCGATCTGTGCTTCGGCCGGCATTGAAT
GGCGGTCCAGCTTGTCCAGAGTTATTTCTATCGGAACCTTGTTTCGCGACAACTTGTTGAAAAATTTATATAAATTTTGT
ATCCATTTTTGATGACATTTATAATAATTTTATGGGTAAATATATTTTAGTTCTTCCTC
>SMED30018252 ID=SMED30018252|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=1107bp
ATTAACAATCCTACAGTATATAAGTGATGTGAAATCCTTTCAAACTCATTGAGACAATGCAAATCATCATCCTTGTATCT
CTATTCCTTGCCGCAGTAAGTGCCGCTCCACAGCAGTTCACAATCAACAGTGAACTCAACGACGAATGGGAAGCCTACAA
AACCCAATTCGGAAAAAAGTACGTCTCTTTGAATGAAATCTCAAGACGACTTATTTGGGAACAAAATTTGAAATATATTC
AACAACACAATCTTGAGCACGATCTCGGAAAACACACTTACACACTCGGATTGAATCATTTCGCTGACATGACCAACGAG
GAATTCCGGGCGAATTATTTGGGAGTGTCACCAAAACGAATGAACTTCACATCACATTTCATTGCCCCAGAAAATGTGGG
AGCTTTGCCAAGTTCTGTGGATTGGAGAACTAAGGGATTTGTGACCCCAGTGAAAAATCAACAACAATGTGGATCGTGTT
GGTCATTCTCAACGACCGGTTCCTTGGAAGGTCAACATTATCGAAAAACTCAAAATCTTATCAGCTTTTCAGAACAACAG
CTGGTTGATTGCAGTGGCTCTTTTGGAAATAACGGCTGCGATGGGGGGCTAATGGACAGTGCTTTCCAATACATCCAACA
ATACGGAATTGAAGCCGAAAGTACATATCCTTACACCGCACAAGATGGAAATTGTGTATATGACAAATCAAAAGTTGTTG
GAAGCTGCACTGGGTTCTCTGATATCCCCCACGGTAATGAGCAAGCATTGGCTTCAGCTGTTGCTACAGTTGGACCGATT
TCAGTGGCCATTGATGCCAGCAATTATAGTTTCCAATTATACAAGAGTGGTATTTATAACGAACCTCAATGCTCTTCTTC
CCAGTTAGATCACGGCGTCCTCGCCATCGGCTATGGAACCGAAAACGGTAAGAATTTCTGGCTCGTCAAAAATAGTTGGG
GTATCGGATGGGGAATTCAAGGATACATCAAAATGAGCAAAGACCAAGGAAACCAATGTGGAATATCTACAATGGCAAGC
TATCCTTTGGTCTAACTCATTTTGGATAAATGACATTATGCATAATGAAAAAATAAAATGATTTTTT
>SMED30025221 ID=SMED30025221|Name=Eukaryotic initiation factor 4A-I|organism=Schmidtea mediterranea sexual|type=transcript|length=374bp
GGAATGCATGTTGTAGTTGGAACTCCCGGAAGAGTAAAAGATATGCTAAAAAGAGGTCACATCAAATCAGAATACATCAA
AATGTTTGTACTTGATGAAGCTGATGAAATGTTGAGTCGAGGTTTCCAGGAAGATGTCTGTGAGTGTATTACTTATCTTG
AAGCCGACGCTCAAATGTTCATTTTATCTGCCACAATGCCCGATGAAGTTCTTACAGTAACAAAGAGATTCATGAAAGAT
CCGGTAAAGATCTTAGTCAAGACAGAAGAATTGACTTTGGAAGGAATACGACAATTTTATGTCAATGTTAGTCAAGAAGA
ATACAAATTTGACACTTTGACTGATCTCTATGAATCATTAACGATTACACAGGC
>SMED30019471 ID=SMED30019471|Name=Synaptotagmin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1910bp
TTTGGGACTTCTCCAATCTATTAAATATATTTAGAACGAACATCGTTGTGAGAAGCTTTGTCTTGCAAATGCACACCAAC
ACATTCTCTGCCTACTCGAGACCAGCCTGAAGGACGCACCCAGTCATCTCTTATAAAAAAAAAACTCTTCTCTGATTCGG
TATTTTCTGATTAATGGAGATCAAACAATGATTGGGCAACGTCTAGTTTAGAATATTTACAACTAAATCTGCGTATTTCA
ATTTTTTTTCGATTTTGATTGTTGCAAATATTTATGAGTATATCCAATAATATAAGCAGCGCTAGTAATATGACGATAAA
AATGCAACAAAATGTTGAAAAGTCTGTATCACAGCATGTAACAGCGCAAACAAAGGAATCAACATCAAATAAACTTCATA
CAACAACAGCCGGTATCTCGGTTTTGGAGAAAACATTAAAAACATTTCACATGAGTACTGGCACTTTGATTGGAATCGGA
GTTACAGTGTCTATCGTAGTTTTATTACTTCTTTATTGTATTTGCAAACGATGCATTAAGAAACGAAAGAAAAAGAAAGA
TGGCGGCAAAAAAGGTGGAAAAGGCGTAGACATGAAAAGCGTACAACTATTAGGAAATGCTTATAAAGAAAAGGTACAGC
CGGACCTAGAAGAACTGGATGCTAACATGGAAGATAATGAAGGGGCGCAAGATAAAGAAGCAGTCAATCTTGGAAAATTA
CAGTATTCCCTTGATTACGATTTTACAAAAGGCGAGCTAACAGTCGGAGTAATTCAAGCCACAGATCTCCCAGCAATGGA
CATGTCAGGAACTTCTGATCCATATGTGAAAGTTTTTCTATTACCGGATAAAAAGAAAAAATTCGAAACCAAAGTTCATC
GAAAAATATTAAATCCAGTCTTTAATGAGACATTTGTATTCAAGATTCCTTATTCTGAGGTCGGGTCTAAAACTTTGGTA
TTTAATGTTTTCGATTTCGACAGATTTTCAAAGCATGATCAAATTGGGCAAATCCAAATTCCACTGGGTTCAGTAGATTT
ATGCAAAGTTATTGAGGAATGGAAGGAACTCGGCCCACCTGACAGTGATAATGAAAAGGAAAATCGATTAGGAGACATTT
GTTTTTCTTTGAGATATGTTCCAACGTCTGGAAAGTTGAATATCGTCATTCTGGAAGCTAAAAACCTCAAGAAAATGGAT
GTTGGAGGATTGTCGGATCCTTACGTGAAACTATCGTTGATGCTTAACGGCAAACGAGTGAAAAAGAAGAAAACCACAAT
AAAAAAATACACATTAAATCCTTATTATAATGAGTCATTTTCATTCGAAGTTCCATTCGAGCAAATACAAAAAGTTAATT
TAATAGTGACAGTAGTTGATTATGATAGAATTGGAACAAGTGAACCTATTGGAAGAGTAGTTCTTGGATGCAATGCTACA
GGAGCAGAACTTCGGCACTGGTCCGATATGCTTGCTAATCCTAGGAGACCAATTGCCCAGTGGCATACCCTTCAAGATAT
GCCGGAGAAGAGCTGATTTCATTGATTTTAATTTTAAAATCTGTCATATTTTGTGATAAATTTTGCGTATTTATACAATC
ATTCGATTCGATCTTTCCATCAAGTTTCGTAAAATCTGCAGACATTCACGAGGATGCAGAAGAAATAGAAACTTTGTAAT
AAATTAGCATTAGCTGTGATCTCCTATTGACCAAAAAACATAAACTTAATTTTTATAAAGAATTGTGGTGAAATGTTGTT
AGGTTTCAGTCATAGATAACTGTATTTGTGTAATAGTTTGTGTATTTCTCGTCCTGGCCCGATTTTGTGCATTCCACTGG
CAATACTATTTCACTAATAAATTATGTCTGATAATGTATACCAGTATAGGATTTTGTTTGAATTAATGAA
>SMED30015672 ID=SMED30015672|Name=Gelsolin|organism=Schmidtea mediterranea sexual|type=transcript|length=1435bp
TCTTGTCATTTCAGCATGCATATATCATTAGCGTAAAGATAAAAATACTAACAACTCCTAGTCAAATTGCAACCAACCGT
AAATTGCAGACACACACGAACCAATCACATTTGCTGCCATCGGACAGCCTATGAGACAGCAGATTGGATTAATCAATAAA
GATTTATTGTTCGGTTTTCATTGTATAAATACTGAAATCATTTGTCAATCCAATTGTTAAGTCAACCATGCAGAAAACTA
AAAAATATGACTGGAAAGATTCCAATGTGGAATTGATTGGAAGCAGCGAGGACAGAGCTGTCAAGAAATCATCGGCTGAA
AACGAGCCAGCTTGGAAGAAAGCTAAAGCTTGCGGCCATTCTGAATTGTTTATATGGCGAATTGAGAAATTCAAAGTTGT
TGAATGGCCTCAAAAGCAACATGGGGAATTTTATGAAGGAGATTCTTACATTGTCTTAAATATATATCAAAGAGAAAATG
AATTACTGTACGATGTGCATTTTTGGATTGGTAAATATTCTACCCAAGACGAGTATGGGACTGCTGCCTACAAAACTGTG
GAATTGGACAATTTGCTCGATGACAAACCAGTTCAACATAGAGAGGTCCAACATTACGAATCGGAATTGTTCAAAAGTTA
TTTCAAAAATCTAATATATCTGAAAGGTGGTTGCGAAAGTGGATTTAGACATGTTAAAACTGTAGAGTACACTCCGAGAT
TATTACATGTACGAGGGGAAAAACGTAACATCATTGTTTCTGAGGTGACTGCAACTAAACATAATTTAAATTCCAATGAT
GTGTTCATCTATGACACTGGAACTCACATTTTTGAGTGGATTGGAAAAGGTGCGAACAAAGATGAAAAGTTCAAAGGTCA
AGAATTTGCGCAAGCGCTAAATAGTGACCGCAATGGAAAGGCTAAAGTTGAAGTTGTCGACGAGGCAAATATATCAGAAA
ATCACGAATTCTACAAACATTTATCAGATTTACAACCCGACGAAGATGACAAATGGCAAAATAAGTTATCAGTTAAAGAT
AAGAAACTTTTTAGAATATCTGATGCCAGTGGATCTTTGAAATTCGAAAATATTGCTATTGGAAAATTTGCAAAAAAGGA
CATTAACGAAGATGATATTTTCATTGTTGACAACGGTTTAGAAGTATATGTTTATATTGGAGAAAACGCCAGCCCTAACG
AAAGGCAAAATGCCTTGATTTATGCCCATAATTACCTAAAACAAACCGAATATCCCCAAGTTCCGGTGACAGTAATGAAA
AAGGATGTCAAAGGCAAGAATGCTGAAAACTTCAATAAAGTAATTGAAGGATAAACTCTGGCAAATTTGTTTGTTATTTA
ATTCATAATTTATTTTCAATCTAACTAGGTTTTACTTTTCAATAATAAAATATTTATGTTTGTTTTAAAAAAAAA
>SMED30018602 ID=SMED30018602|Name=ATP-dependent RNA helicase dbp2|organism=Schmidtea mediterranea sexual|type=transcript|length=607bp
TATTCAAAAGATAAACGATTGTTAGAAGTTGTTAGCAAAACTCCACGGGACAAAATGATTGTGTTCGCAGAAACGAAAAG
GAAAGCTGATATGATTTGTTCTTTCCTACGTTCAAAACAATTCAGAGTTGGTGCAATGCATGGAGATAAGTCACAGAGCG
ACAGAGAATATATTCTTAATGGGTTTCGAGGTGAAAATTTAAATATTCTCGTGGCAACAGATGTAGCAAGCAGGGGTTTA
GATGTTGATGATATTAAAGTTGTAATCAATTACGACTTCCCTATTCAATTTGAAGATTACATTCATAGAATCGGTAGGAC
AGGCCGACGAGGAAAATCCGGTGTGTCTTATACATTTTTCAATAGAAAGAATTCGAAAAGTGCTCGTCAATTGGTGAAAG
TGATGGAAGAAGCTAATCAATCAGTTTCAGATAGTTTGTATGATCTTGCATATATACCAAGAAGTGAGCGTAGACAAAAT
TTCAATCGTCCGCCAATGCCAGTGCCGCAAGTAAATAATTATCAAGTACCTCCGCCTCAATATAATGGTGGAAATAACAT
GTATCCGCAACCAGATTTATATATGCAAAACGGAGCAGCACATCACA
>SMED30011876 ID=SMED30011876|Name=Macrophage-expressed gene 1 protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1880bp
AACGGAAATACAAATAAATTCTCGATTTGTCAACTCTCTAAAGTTCAAGAGTGCTACAAAGAAAAAAATAGATCACAAAT
GTCCTCTGAGCAATAATCAAACTCAATTCAACACTTTTCCCGGGTTGGGGTGGGACAATTTGGTAAATCAAGAAATGAAG
CCCGTTCTGAAGATCTCATTTTCCAAGTGCGAAGAGTCCAGTGATGGAGTTTATCTCATTCCAGACATGACGACCATTTT
TCCATTAAAAAAATCAAAATTTCATATGAATTCTGATTTATTCTCCAGCTCTTCTGAATATGTTTCTCTCACTTCTCAGT
CCATTAATGAAGATATTAATTTCTCTGATTTCCCTACTTTAATAAATGGCGCATTTTCAAACGAAAAGACCTCTTTGAAA
AGGAAAAAAATAAAGAAAAATTCTATTTTATCTCAAGTTCAATTGAGATACGAAGTTTATAATATTTTGTCTCAACCGGA
CAGTGATCTCTCGAGGGAATTCAAAGACCGAATTGTTGAATTAACGAAATACTTGGACGACGAAAAGAATTTGTTATATT
TGGATTACTTGTCGGATTTGATCATAAGAGATTTCGGAACGCATGTCATCAAGTCCGTGACAGCCGGGGCAATTCTTGCC
AAAATTGACGTTCTCAAACCGGAATATGCGTCAAAATATAATAAAAATCAAGGGGAAATTAAATTAGCAGCCGCCTCAAG
CATGGCTGAAAACGTCGGTACGAATCATGAAAAAGATGAAAGATCAAAAAAATTATTAAAAGAATATAAAGACAATTGTA
TCAGTTCGACAATGAAAGCAATCGGTGGAATGCCAATTGAGTCAAATTTCAATTTGCAAAAATGGACAAATACCATAAAG
TCGAACTTAGCACCCATCGACCGACAAGGTGACCCACTCAATTATGTGGTGACAAAGAAAAGTTTACCGGAATTGAAAGA
TAAAGCAATTTTCGATATAAATAAATTAATTAGTAAAGCAATAAACCGTTACTACAGAGCAAATATGGGATCAGATTGTA
CGAATATTGGTTCTATGAGTAATGAAAATAATGGAAATATTAATAATAAAATGTGCGAGCAGTCAACAGAAATTAAAAGA
TTTGGTGGAATATACCAAACATGCGATGGTGAATCGTGTAGTGAATACAAACAGGATAATCCTGCGACTGGAAATTTAAG
CTGTCCAAAAGGCTACAATTCGTCTATCCTTTATAAAACCATGAACATTAGTAAATGTAAAGAAAATTGTCGAAGCTTAA
CTTTGTACATGTGTTATGCAAACAGCAATGGATTCAATGATCTTGGTTTTTCTTTTGGTAGAATAATACCCAGATTCAAG
CCGAAGTCCGATTGCCCTAAATATCACATCTCGCTACGCTTTGGTGCGCAAAACATTTTATGTGTCACTTCAGGTAGAGA
GCAAGTAGAAGAAAACAGCTTACAATTCGGTGGTTTTTACAGCTGTTTGATAGGAAATCCGTTTACTATAAAAAAACAAT
CAAACGACAGTGCGAATGGCATTTATGAAAAATCATGCCCCCCAGGATTTACAAGTCAACTTAGTCAAGTCGATTCGGAT
TGCCCGGTTTATTATTGTACGAGAATATACAAAACCATCAGCAGAGTCGTTTTATTAAGACCGCCATTTATCAAAATTGA
TTGGAATTTAACTGCTACTAGCGCTGAAACATTCGACAAAATTGACGGTAAAACTGAGATGAAAAAGATCTGGAATAATA
AAGCGTTTCGGTATTGTGTAATTGCATTAGCAATTTTCTTATTTGTTTTCTTACTTCTATTTTTAATATTGTTCCATCTG
AAATTTTGCAAAAAATAAATGTTAACTAATTGGTGAGGCC
>SMED30011264 ID=SMED30011264|Name=Macrophage-expressed gene 1 protein|organism=Schmidtea mediterranea sexual|type=transcript|length=2311bp
AGTCGCGATAGCACGCAACGTCGACATTGCGATGACGTAATCATTGTGAATCTCTACTACAATCGGATCATTCTAATCAC
GTGCATCCTAAAACAATATAAATCTTACAAACGGGAATCCAATTGAACATTTATTTACTCAAGCGTGAAACCAATGATAC
CGTGTAGACTTAATAGTATAATATTGTTTATATTTGTTTATGGAGTTCTATCGGTTTCATGTGAAATTGAACCTAACCGA
GATCAACCATCTTCAAGACGAGTTCATGAGTGTAAACTCACCAGCAACCAATATCCAGTGAATGTTCTTCCCGGATCTGG
GTGGGATAATCTTGAAAACAAAGAACTCGGTCAAGTTTTAGAAATTTCATATAAAGGATGTTTTGGATCGAATGATGGAA
GCTTTCTCATTCCAGACAATGTGGTGATCACCCCAATAAAGAAATCTATTGTCGAGTTAACTTCAGATATATTTGACCAT
TTCTCAAATGTCACCTCTACAACGGCGATGTCTATCAACGCCGATGCCAGTTACTCAACACCAAGCTACAAAATCAGTGG
ATCATTTTCATTTGAAAAAATAAGAATAAAAAACGATCAAATCAAAGAAAAGTCGTCGATTTCGAGATCCCAGTTAAGAC
ATGAATTATATGAAGTAGCGTTCCAACCACACTCAAAACTAGACGCAAAATTCAGAAACAGAATTCTAGATATTGGAGCG
TTATTGAAAGAAGGAAAAGACACAATTTATCCACAATATTTAGCGGATTTAATTGTCCGTGACTTCGGCACTCACGTCAT
TCGGTCGGTGGATGCGGGAGCGACTTTAATAAAGACTGACGTTCTGAAGTCGAAATACGTTAATAAATTCAAAGGAGATA
CAACAACCATAGCAGCCGCCGCATCGTTTAGTATGACAAAAGTTCTTGGGGTAACAATCAAAGGAAACTACTTCAGTGAC
ACTGCTAGCCTCGATGAATACAACAATAACAGCGCAAGCACTAAAGTTGAAACAGTTGGTGGAAGACCATTCGGTTCGAA
CTTCAAATTGGAAGATTGGGAAAAATCTCTGGATTCAAATTTGGTGGCCATTGATCGTCGAGGCAATCCATTATTCTACG
CAATAACACCAAGAAGTCTCCCGGAATTTGATGATAAAACCGTTAATAAAATTGTTACTCTTATCAAAAACGCTGTCAAC
AGATATTATGCAGCCAACACTAGAGTAGGTAAGTTAAACTTTAATAATAAAATACAACGTTGAGACTAGGGTGCATGAAT
ATGGAATCAGAAAATTTCAATGACGATGCAAATATTGATGGTGGAAATTGTGAAACTCCAAAATCATATTACACACTTGG
AGGAACATTTCAAACCTGCAAAGGGCCGGATTACCAATGTGAAAACGTAGCTGGCAAGAACCCCATAACGAATAGCTATG
CGTGTCCTGCAAATTACAAAACCGTTGAATTGGAAAGTGGATTGAGTAAATGCGAAAAGGTTTGCGTTAGGACTTTTTGG
TTTAGTTACAACTGTCATTACGAATGTTCCTATTACGCACTCTATTGGTGTGCTGCAACGAAAGCGACAACAAAATCAGA
AGGATCATTATTCGGTGGATTTTACTCAAATACATATCCGAACCCGATAACAAATGCCTATAATTGTCCGCAATATTATT
ATCCATCTCGATTTGGAATGGTCGGAACGATTTGTTTGGCATTCAATAGAGCAGAGACAATGGAACACCATTTGCCTTTC
GGAGGATTTTACAGCTGCAAGGTCGGAAATCCACTCTCAGACAAATTTGTAGATAATACCACACAGGATCCCAAATATTG
GTCGGAAGGTTGCGCAACTGGATACTCATCTCATGTGGCTATTGTCAACCGAGGCTGTCAAATTTCTTACTGTATCAAGA
ACAACGCGCTTAGCAAAAGGGAGCAACCTCCTCTTTTTAGACCCCCATTTGTTGATTTGGGATTCGGACCGAATGCGACC
ATCACTACTAGTTTAGAAACTCCAACTGGACTCAAACTCTCCGTCGACGAAAACGGGAAGTGGAGTGAAAACAAAAAATC
AAAATCATCCAATTATAATATTATTATATTTTCTGTAACAGCAGTAGCAATAATCACCATAATGATTATAATATTAATTC
TTGGAATTAAAATTCATAGAAAAACTCGAAGAATAACCGTTTTGCCAGAATATAATGGCAGCGATAGGAGCAATTCTACG
AGTTCTTTGAATAATCCAACAACATCGAATCGCGTTCAGCCATTCAAAATACTTATAGATGAGAATCAATA
>SMED30001362 ID=SMED30001362|Name=SMEDWI-3|organism=Schmidtea mediterranea sexual|type=transcript|length=3093bp
AATTAAGAGACAGCCATTTATGTTTATTTTTAAAATAAATAGTATATATTTAAGTTTCGAATTTTCAGCTACAATTTAAT
AGTACATAATTATACGATGTCAGGAAGTAGTGGAATAGGTAGAGGCCGCAGTCGTGGGCTGTTGATGCAAAAGTTTCTGA
ATAAAGATGTTCTTGTTCCTTCTGTTGAATCTTTAGAAGACAAAGCTCTTAATAAGCTAGGAATTCCACTTCCTGGGTCT
ACCGTAGAAAAAAATACAGAGTCAAGTTCTATATCAAGTGGAGATTCAAGAAGTAATCCCAGTGGAGATTCAAGAAATAA
CATAAAACTACAAGATAGTGATATTGAGAATCGCAATATTACCATTGTTACGCGACCATTATCCTGCATAGGCAGGGGTC
GGGGTTTAAGCAATCCCTCAAGTTTAACTACGTCATCGGGTAAATCGGATAAAATTACTGAAAACGAAGAACCTGGTCAA
ATTAAAAAGTTTGTAGGTCGCGGTAGAGGATTGTTGAATTCTCAGAAAGAATGTTCAAACTCTACTCCATCTGAAGTTTC
AAATGAATTGAAACAAATGAAAATTTCAAATGATGATAAAATGACGGTTTCTTCAGAAGCAAAGTCACAATTTGAGAACA
TTGAAAAACCTATTAGTAAATTTCGTCGACGCGAATATCCAACTCAAATAAAAGAACCATGTAATACAAGAAATGATTCA
TCGCCATCTTTAACTTTAAGTGCTAATTACGTTAAAGTTAGGACTACACAACCCCATATATATCAATACCATGTTTCCTT
TGCACCTCCGATAGATTCAAGGTTGATGAGAATTAAAATAGTTCAAGGGTTATCAGAATCAGATTTAGGGGTTGTCAAAG
AAGCAAGAGCTTTTGACGGTATGAATTTATACATTCCTCAACTTTTAAAAAATAAAGAGACAATAATTAAAGTAAACAAA
CCGACTGATAAGACTGTCGTGGATGTTAAAGTAGTTTTTACTAACAATGTTAATTTTAGTGAATGTCCTATGGTTTATAA
TGTTCTTTTTAAAAGAATTGAAAATTCCCTCAGAATGGTTAAAATTGGTAGGGATTATTTCTACCCTGAAAAAAAGATAG
TACTTGACCGTAGAAGGATGGAAATATGGCCGGGATATGTAACAAGTATCCAAAATTTTGACGGTGGTTTACTGTTACAA
TGCGATGTGTCACACAAAGTTATTCGAAATGATAGTGTGTATGACATAATGATGGAAATTAATAAAACTGTTAACAATAA
AGGTCAAATGCAAACTGCTGCGATTAATCAACTATTGGGTCAAATTGTGTTAACTCCTCACAATAACCGAAATTATAGAA
TTACTGATATAGATTGGGCTAAAAATTGTTTAAGTGAATTCGATAAAGGAGGCGAAAAAATTAGCTACCGGGATTATTTT
AAGAACACGTATGGGCTACAAATTCGTGATCTAGAGCAGCCTATGATAGTTAGTAAATCTAATAGCAGATCTGGTAAAAA
CCGAGGTCCCAAAGGATCAAAAGAAGTGGATGGTGGATTGGTCTATTTAATTCCAGAATTGTGTATGCTAACTGGTTTGA
CAGATGACATGATTAAAGATTTTCGTTTGATGAGAGAATTACACGAGCATTGTCGAGTTACTCCCAAGAAAAGACACGAA
GCCTTACTGGAATTCGTGGATAACATATATAGCTGTGAGGAAGCTAAGAAACTTTTAGGGTATTGGGGTATAACGATTGA
AAAGGACACTGTCAACATAAATGCTTGTAAAATGAATCCAGAAATGATATATTTTGGAAATGAAGCTTCTGTTAGTGCTG
GGGAACAAGCTGAATTTAAACAAGCCTTGGCACATAATAAAGTTATAGGTGGTATTCGTATTGAAAATTGGATATTAATT
TCTCCAAAAAGTTTACTGACAAAAGCAAATGGTCTGTTACAGGCTTTAATGAGCAAATCTCCTAGAGTTGGAGTTATGTT
TGGAAAACCCAAAATAGTTGAAATGAACAATGATCGAACAGAAGAGTATTTAAAAGAATTAAAGAGAAATGTGGCTCCTG
GTGTGCAGTTAGTAGTTACAATTTTATCTGCTGTTAGAGAAGATCGATACAATGCAATAAAAAAATTTTGTTATGTGGAT
TGTCCTGTTCCAAGTCAAGTGGTATTAGCCCAAACATTGAAAGAAGGGCCTAAATTAAATAGTGTGGCAGTTAATATAGC
CCTTCAAATAAACGCAAAATTAGGTGGAGAGCTGTGGGCTGTCAAAATACCTATTAAGAAGTTTATGGTTGTTGGACTTG
ATGTTTGGCATGATACTAAAGGGAGAAGTAGATCAGTTGGAGCCGTAGTTGGTTCAACTAATGCGCTATGCACAAGGTGG
TTTTCGAAATCGCATTTGCAAGAACAAGATAAAGAAATTATGTACGTATTACAGTCGTGTATGTTAAGCCTTTTAAAGGC
TTATTTTGAAGAAAATAATTTTTTGCCTGAGACTATCTTTATGTATAGGGATGGTGTTAGTGATGGTCAGTTAGGATATG
TTCAAAAAACTGAAATTGAACAATTCTTTAAAGTTTTTGAATCGTTTAGTGCTGATTATAAACCTAATATGGTATATAAT
GTTGTTCAAAAGAGAATAAATACTAGGCTCTATGTAAGTGATCCGAAAAATAAAGGACAAATAAATAACCCCAATCCTGG
TACAATTGTCGACCATACTGTTACGAGGGCTAACCTTTATGATTTTTTTCTTGTTTCTCAATCGGTTAGGCAGGGAACTG
TAACTCCGACGCATTACGTTGTTTTATGTGACAATTCTAAATACACTCCGCATCAGGTTCAGTTGATGGCTTATAAAACA
TGTCATATATATTACAATTGGCCGGGAACGGTTCGAGTACCAGCACCTTGTATGTATGCTCATAAATTGGCATATATGGT
TGGTCAGAATTTGAAAGCTGAACCTAGTAATCTTTTATGTGACAGACTTTTTTATTTGTAACATATGTGTTTCTATTTGT
ATTATTGTTAAACTGCATTTCGTAAAATAAATTAATTTCGTTATAAAAAAAAA
>SMED30016824 ID=SMED30016824|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=375bp
AAATGTATTTATGATAAATCAAAAGTTGTTGCAAATTTCACTTCGTTTACTGTTATCGAGCCAGGAAACGAATCTGACTT
GGCAGCCGCCGTGGCCACCGTTGGACCTGTGTCCGTATGCATCGATGCCGATCATCCAGGTTTCCAACATTATAAAACTG
GTATTTACAATAACCCCAAATGTTCATTTTTATGCTTAAATCATGCCGTTTTAATCGTTGGTTATGGATCACTCAATGGA
GATAACTTTTGGATTGTGAAGAACAGTTGGGGACCAGATTGGGGAATAGAAGGATACATACTCATGTCAAAGGACAAGGA
CAACCAATGTGGAATTGCTAGTCTAGCCGCTTATCCAGTGGTCTAATATGCATGC
>SMED30002704 ID=SMED30002704|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=1178bp
GAAGATCAAAGGAAGAACCGCTCACATAGGCCCCGCCATGAAAGGAATGTATAAACTGACCCTTGATACCAAGCATACTA
TAAAACTCAAAGTAATCGCATCATATTTCATAACATGAAGGCATTCATAATTTTGTCGTTATTCCTTGTTGCTATTGAGG
CTGGGCCAAGGAGATTCACGGTCAACAGTGAGTTGAATGAAGAATGGGAAATATTCAAAGCCCAATTTCATAAACAGTAT
GAACCGCTAACGGAGGTTATGAGAAGAATCATTTGGGAAGAAAATCTCGACTTCATTAGACAACACAATCTTGAATACGA
TCTCGGAAAACATTCTTACACTTTGGGATTGAATGAATATTCTGATCTCACTAATGCAGAATTTAAAGCCAAACTTTTAG
GAAACAGATTGAATGGATCAAACTCAAAAGGATCAGAATTTATGGTGCCAGAAAACATTGGAGCTTTGCCTTCATCTGTG
GATTGGAGAACTAAAGGATACGTAACCCCTGTGAAAAATCAATATACTTGCGGTTCATGTTGGGCTTTCTCAGCCACGGG
AGCTCTTGAAGGTCAATATTTTCGAAAAACAGGAAAATTAATTAGTTTGTCTGAACAGCAACTTGTTGACTGCAGTAGAC
CATATGGAAACCTTGGATGTGGTGGTGGGTTTCCGTATCAGGCGTTTGACTATGTTAATAAATACGGAATGGAATCCGAG
GATGATTATATATATCGTAACAAAGAAAACAAATGTATTTATGATAAATCAAAAGTTGTTGCAAATTTCACTTCGTATAC
TTTTACCAAGCAAAGAAACGAATCTGACTTGGCAGCCGCCGTGGCCACAGTTGGACCTTTGTCTGTAGGCATCGATGCCC
GTGATTGGCGTCTTCAATATTATAAAAATGGTATTTACAATAACCCCAATTGTTCTTCAGAATACTTAGGTCATTACGTT
TTAGTCGTTGGTTACGGATCACTCAATGGAGATAACTATTGGATTGTGAAGAACAGTTGGGGAACTGACTATGGAATAGG
AGGATACATCCTCATGTCAAAGGACAAGGACAACCAATGTGGAATTGCTACTCGAGCCGTTTATCCAGTGGTCTAATATA
AACAATTCTTGATTGAATTTATGACTTTTATTATTAATAAATAAATAAATTTGCTTTC
>SMED30010115 ID=SMED30010115|Name=ribonucleoside diphosphate reductase subunit M2-2|organism=Schmidtea mediterranea sexual|type=transcript|length=1127bp
GTTTTTAATGAACTGAATCAGGTTTAATGCAAAATAGTCATTTTAATTTCTAGATAAATTAACAGTAATTCTTTCGAGAT
TAGATATTTATTATGGAGATTTTATTAACAGAAGATAAAAGTCGAATAGGATTTCTTAATATACAATATGAAGATATATG
GGAAATGTTTAATAAAGCTCGATCTTCATTTTGGACTGTAAATGAAGTTAATTTATCAAAAGATTTTGCTCACTGGAAAA
AAATGAATGACGATGAACGGTATTTCATTACTCACGTTCTTGCATTTTTTGCTGCCAGTGATGGAATTGTCAATGAAAAT
CTCGTCGAAAGATTCATTCAAGAAGTGAAAATTCCCGAAGCTGAGGCATTTTACAGTTTTCAAATTGCAATTGAAAACAT
TCATTCAGAAATGTATTCTCTATTAATCGATTCTTATGTTACTGATACAGAAACAAAGAATAAATTATTTAATGCCATCG
AAACTATGCCATGCGTTCAGAAAAAAGCTCAATGGGCATTGCGTTGGATTAGCGATAAAAAATCCACTTTTGGAACTAGA
GTTGTTGCATTTGCTGCTGTCGAGGGAATATTTTTCAGTGGTAGTTTTGCATCGATATTTTGGCTTAAAAAGCGTGGATT
AATGCCCGGATTATGTTTCAGCAACGAATTAATTAGCCGAGATGAAGGACTTCATTGCGATTTTGCTTGTTTGATGTTTA
AATATTTAAGTAGCAAACCGTCACCTGAACAAGTTTTGGATTTGATCAAAGAAGCTGTCGGAATCGAGAAGGAATTTCTC
ACCGACGCATTGCCGGTTTCATTGATTGGCATGAACGCTGAATCGATGTGTGAGTATATTGAATTTGTGGCCGACCGGCT
GCTGGTTGAATTGGGCTGTGACAAGTTCTGGAACACAGAGAACCCGTTGGATTTCATGGATAATATTTGCATCGATGGGA
AAACTAACTTCTTTGAGAAACGAGTCGGTGAATATTCCATGTCGAGCGTTGAGGACAAACACAAATTTGATGATGTCAAT
TTCGATATTGATTTTTGAGGGATTCCGTTTTTTGGCGCCAGTGTGCATTTAATGTGTTTTGGTTGTAATTGGCTATTTTT
GTTTGTT
>SMED30035609 ID=SMED30035609|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=1185bp
TGAGATTTAGGCTTGATGTCATATAATTGTGACCCGATCACAAGTTTTATCACAAGCTGATCATGAAATTGAACCTTGGA
AGCAGGCCTACTATAAAAACAAAATTTACACCGACAGAATTATAAAATGAAAGCTTTCGTTTTAATATCCGTTTTCCTTG
TGGCTATTCAAGCTAGACGTCCGACCTTCTCACTCAACAGCGAGTTGAATGAAGATTGGGAACTATACAAGACTCAGTTC
AAAAGACAGTACGAACCCCTCACTGAAATCACGAGAAGAATCATCTGGGAACAAAACCTTGAATACATTCGACAACATAA
CCTCGAGTATGATCTGGGAAAACATACTTACTACTTGGGATTGAATGAATACGCTGATCTAACTAATGAAGAATTTAAAG
CCAAATTTTTGGGAAAAATATTGACTAGATCATCAACAAAAGGATCTCAATTTATGGCTCCAGAAAATATGGGAGCTTTG
CCTACGACTGTGGACTGGAGAACTAAAGGATACGTAACTCCAGTTAAAAATCAACAACAATGCGGATCGTGTTGGGCTTT
CTCGACTACTGGATCTCTTGAAGGTCAACATTTTAGGAAGACTGGAAGTTTAGTTAGTTTCTCAGAACAACAATTAGTTG
ATTGCAGCGGTGCTTATGGAAATGAAGGATGTGGCGGAGGATTAATGGACAATGCATTCAATTATATAATGAAATATGGC
TTGGAATCAGAGAGAGATTACCCATATACTGCAACTGACGGAAAATGTAAGTATGACAGGTCAAAAGTGGTTGGAACATG
CAGTGGATTTACGGATATTAAACATGGAAACGAATCTGATTTGGCAGTTGCGGTAGCAACTGTAGGACCCGTGTCGGTAG
CAATTGATGCCAGTCACTACAGCTTCCAATTATACAAGGGAGGAATTTACAATGAGCCCCAATGTTCTCCTGACCAATTG
GATCACGGAGTTTTGGCAGTCGGTTATGGATCAGAGAATGGAGGCAACTATTGGCTAGTGAAAAATAGCTGGGGTATTTC
TTGGGGCCTTTCTGGATACATCAAAATGTCAAAGGACAGAAACAATCAGTGTGGAATCTCCACCTCTGCAAGCTTTCCAT
TAGTTTAATTTGAACTATTATATTAATTTTTCCAACTTAATTTTTATATTTAATAAACTTTGCTT
>SMED30013843 ID=SMED30013843|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=1112bp
ATTGTTTTAAGATTGAACTCGTCGTTAGACAATAAAGTGGCATATACTATGAAAATAAAATTACTTCCAAATGCAAAGAA
AATGCAATGTTTTGTTTCTAATGAAAATCATTATAAACAAATTATTCAATGTGCTAAATTTGAAGCAATCGGGCATCAAT
CTAGATATTGCAAGGCTAGAAAAGGAAAAGGGATCGATAGTATTCAGGAGTCTCACGCGGTCCCAAATAGGTTTTAAAAG
AAAGACTGCTTCTGATAAATGATAAGTAAAACGATGCTTGATAGATACTGGCAGTTCAACAACAATTATGCGAAGAGATC
CAATAAATTCACCGGATGTTAGAGTATGTTCAGCACATAGATATATATTATTGGTTAGTCGCAGTAAAGCTGAAATAGAA
TTAAAAGGGAAGTATTTTATTATTGATTGTTTTGTTCCCATAAAAATGATATTCAGTTATGATGTGATATTAGGTATTAA
TGGTATTAATGCACTAGGAGGGGAAGTTCTCAACGACGAAGTGAATCATAGTATCCTAATAGTTGCGAGCATACACAATC
TTCAAGATAAGCTGATTGGAAGAAACAATTTCCAGGCAAGATTCGATTATGAATGGAAAGTATTGTGGAATTGGAACATC
AATATTCCTATAGGATGTCAGAAAGATACTCCAAATTAGATCTTAACAAACCAAATACTGGCCTTGTGCCTACAATCATT
GAGTAATGGATAGAAAAGAGTTGGTTAGTTGAATACGATGAAATCCAGTATGGAAAATCAATTGGTTCATTAGTATTATT
CCCAGTCATACAGAAAAACAAGAGTAAATTAAGACCTGTTTTCGATTTGAGGGCATTGAATCACTATGTGAATGTATGTA
GTGGGGAAGCAGTAAGTAAAAGTATGGCTGTTAAAATTTATGGGGATTCAAGACAAAGGATTGTATAAATAAACAGAGTG
CGGTTGAAAAATATTTGATGTTTTCTATACACCGAAGAATTGCGAACTATTATAAGATTTCTGGTAATATACATATAGAG
GTTCGAGAGAGAAAAATGTATAAAACCAGACTTTATGAAAAATCTTTGAAGATTTTCTATAATTAAAAAATC
>SMED30034696 ID=SMED30034696|Name=Macrophage-expressed gene 1 protein|organism=Schmidtea mediterranea sexual|type=transcript|length=2009bp
AGCGAAAATATGACTCGTTTTTCTGTTGCCAGTGCAACATTTATTTGGTTTTTATTTTTCGGTTCCACACTAGCGGATGA
AGCAGTCATTGAGCCGGATAACGTAATTCAGAACTCGAATTTTCCATCCAAACGTGTTGTAAATGATTGCCACCTGACTA
ATGATCAGTATGCATTCAATGTCTTGCCGGGGTCCGGTTGGGATAATCTTGCCAATCAAGAGTTAGGCCAGATTCTGAAA
TTATCCTATAAAAACTGCAAATCTTCCAATGATGCCAGCTTCCTAATTCCCGATGAGGTTTCAATGTCACCAGAAATGTT
GTCTAATGTTCAATTGGATTCCGACCTAGTCTCACATTTTTCAAAATACGATTCAATGACTTCCAAGTCTATTAACATTG
AAGCAAACGCCGCAACGCCAAATTATCAAGTCAGTGGATCGTTTTCTTTTGAAAAGAAAGATGTTAAGAAAAATCAAATG
AAAGAAAAATCCGAAATTTCTCATACGCAACTGAGATACGAACTTCACCACCTTGCCTTTCAGCCAGACAGTGAATTGGA
TCCTACCTTTCTCAATAGGGTCATTGACATGGGAATAGTTTTGGAAAAAGAAAGTAAAAATACTTACTCAGAGTTTTGGC
TGATTTGATCGTAAGAGACTACGGAACTCATGTAATACGGTCTGTTGTCGCTGGAGCTATTCTTTCTAAAACTGATGTTC
TCAAAGGCAATTTTATGTCCAAATCCAGGGGAAATTCTATAAATGTTGCGGCCTCTGCCGCTGTAAGCATGAGAATGGCT
GTGGGAATTAAGATTGGAGGAGGTTATGGCAATTCTGAAACCAATGCCACGGAATATGAAAAGAATTGCGCAAGTTCAAG
AATTAACACCTTTGGTGGAGGACCATATGGTTCTAATTTCAAATTAGAAGATTGGGAAAAGACCCTTCCTACTAACCTTG
TTACTATAGATCGTACTGGTGATCCTTTATATTACGTAATAACAAAAAGAAACGTACCGTATTTCAGTGACAAAACAATA
TTTAACATCAACACTTTGATTAAAAATGCAATCAACAGGTATTACTCAGCTAATTCTCGCCCTGGATGCATGGATATTAA
ATCTGATAATTTTGATGAAAATGCTAACATTGACAATGGCATATGCCAAAATCCAGACGATAATTTCAAATTCGGAGGAG
TTTATCAATTTTGTTATGGGCTGAGTGCTAAATGTAAGGAACTGAACCAACTCAACCCAATCACTGGAACATCCTCATGT
CCAGATGGATTTGACCCTGTTGAGCTATTTTATGTATATAGTAATGAGAATAACGATGGTATGGTCATCAACACGTTTTG
GTGTGCTCCTAATCAAAAATCAACTCATTCAAATGGATATTTATTTGGCGGGATTTTTACCGATGCATATCCGAACCCTG
TTACTGGATCTTCTAGTTGTCCACAATATTTTCTATCTTTGAAATTTGGACGTACCGCAAAGATTTGCGTTTCACAGGAT
ATCGAACTTGGAATGAAAAATAGTCTGCCTTTTGGAGGGTTTTTCAGTTGTTCCATGGGGAATCCCTTGACACAGAAGAA
GACGACTAATTCTCCCGCTGACTATTGGACCCAATCATGCGCACCCGGTTATTCTGCACATTTGGCGGTCATCGAAATTA
ATTGTCAGATTTCATATTGTATCAAGAGTAACGCATTAAAAGGCAAAGAAGAAATTCCTCTTTATCGGCCACCATTCATT
AATTTAGACGATGGAATTAAGTATAATTCTATAAAGAAATTTCAAACTACTTCCGGGATAGAATTGAAACTTTCCAAGGA
CGGAATGTGGAATAAAGTGAAATATGTTCCTTTCGCAAGATCTAAATTTGGTTTAATTATTTTTTCCGAGGTTACCCTAA
TCTTGGTAATTATTGTTGTGGTTTTAATGGTTTGTTGGTTTAAATCCCGTTAAAAGAAAAATTGTTTTAAATAAAGACAG
ATCGGAAGA
>SMED30025388 ID=SMED30025388|Name=Myosin heavy chain|organism=Schmidtea mediterranea sexual|type=transcript|length=6089bp
TTTTTTTTCGAGTTTGTGCTAGAAATTAATTTCAGTTTGAAATTTTTTGCCTATTTCGAGTTCTTTGAAAACAATCTGAA
AACATGAACCCATCTGATCCCGATTTTCAATATCTCGGTGTCGACCGAAAAGCTTTAATGAAGCAGTATGGGGATTCCTT
TGACAGCAAGAAAAACTGTTGGATTCCTGACGAGAAAGAAGCCTTCATTGCGGCGACAATTGAAGATGCGTCTGGAGATG
TCTATACGGTCAAAACCGATAAAAGTGAAACCAAGACTGTTAAAAAGGACGAAATCGAACAAATGAATCCACCGAAATTT
TTGATGATTGAAGACATGGCAAATTTAACCTTTCTAAACGATGCCAGCGTTCTTGATAATTTAAGACAAAGATATTACAA
GAATCTGATTTATACCTACTCTGGACTGTTTTGTGTGACAATAAATCCATACAAAAGATTTCCAATTTACACCCCGCAGG
TGATTTCAAAATACAAAGGTAAACGACGAACTGAAATGCCTCCACATATTTTCTCGATATCCGACAATGCTTACACCAAC
ATGTTGGCGGACCGAGATAATCAATCTGTCTTAATTACTGGTGAAAGTGGAGCTGGGAAAACTGAAAATACAAAAAAAGT
TATCACTTATTTTGCACACGTTGCAGCTGCTACTAAAAAAGAAGAGGATGATACTGGAACTGGTCAAAAGAGAAAGGGAA
CATTGGAAGACCAAATCGTGCAAGCAAATCCTGTTTTAGAAGCATACGGTAACGCAAAAACTGTGCGAAACAACAATTCA
TCCAGATTTGGTAAATTCATTCGTATTCATTTCGGTACAAGTGGAAAAATAGCTGGAGCTGATATTGAATTTTACTTACT
CGAAAAATCGAGAGTAAATTCTCAACAGAAAGGTGAAAGAAACTATCACATTTTCTATCAAATTTTATCGAACGGAGGAA
AACCATTTCATGAAAAATTACTCATCTCTCCTGATCCAGCTTTGTATTCCTTCATTAATCAAGGTGAATTAACAATCGAT
GGAGTCGACGATGAAGAAGAAATGAAAATAACTGATGAAGCTTTCGACATTTTGGGATTTTCTGCCGAAGAAAAAATGAG
CTTGTTCAAGTGTACTTGCTCAATTTTAAACATGGGCGAAATGAAATTTAAACAAAGGCCAAGAGAAGAACAAGCCGAAG
CCGACGGTACTGCTGAAGCTGAGAAAGTGGCTTTTCTGTTGGGTGTCAATGCAAAAGATTTAATGCAATCGATTCTGAAA
CCGAAAGTTAAAGTTGGTAATGAATATGTCACAAAGGGGCAGAATAAAGATCAAGTTCTTTATTCGGTTGGTGCGCTAGC
AAAATCTCTTTACAACAGAATGTTTGCGTGGTTGGTTTTGAGAGTTAACAAAACCCTCGACACTAAAGTCAAGCGACAAT
TTTTCATCGGTGTTTTGGATATTGCCGGTTTCGAAATTTTCAATTTCAATGGATTTGAACAAATTTGTATTAATTACACC
AATGAAAGATTGCAGCAATTTTTTAACCATCACATGTTCGTGTTGGAACAGGAAGAGTACAAGAAGGAAGCGATCGATTG
GGAGTTCATTGATTTTGGAATGGATCTTCAAGCGTGCATTGAGCTCATTGAAAAGCCAATGGGTATTCTGTCAATCTTAG
AAGAAGAGTGCATGTTTCCGAAAGCATCTGATATGACATTTAAAGCAAAATTGTATGATAATCATCTCGGAAAAAGTCCC
AATTTTGGAAAGCCAAAACCTCCAAAACCCGGACAGGCTGAAGCTCACTTCGAATTGCATCACTATGCTGGCAGTGTGCC
ATACAATGTTACTGGTTGGCTGGAAAAGAATAAAGATCCTCTCAACGAAACTGTGATAAATCTACTTGCGGCAAGTAAAG
AGGCATTAGTTTCGAGTTTGTTTGCTCCGGCTGAAGATCCAAATAATACGGGTAAACGGAAAAAGGGTGGGGCCATGCAG
ACCATTTCTTCAACTCATAGGGAATCCTTGAATAAATTGATGAAAAATTTACAAAGTACCAGTCCACATTTTATCCGATG
CATTGTTCCAAACGAATTCAAACAACCTGGTGTAATCGACGCTCATTTGGTATTACATCAATTGCATTGTAACGGTGTCC
TTGAAGGCATCAGAATCTGTCGAAAGGGTTTCCCAAACAGAATGATTTATTCTGAATTTAAACAAAGATATTCTATCTTG
GCTCCAAATGCAATTCCACAGGGATTTGTTGAAGGCAAACAAGTAACGAGCAAAATTCTGGAAGCTGTTCAATTGGACAC
CAATCTTTACCGCCTGGGAAATACTAAGGTATTTTTCAAAGCTGGAACTTTGGCTGATTTAGAAGACATGCGTGATGAAA
AATTATCTTCACTGATTTCATTGTTTCAAGCTCAAATACGCGGATATTTGATGCGAAGACAATATAAAAAATTACAAGAT
CAGAGAGTTGCTCTATCTATCATTCAAAGAAATATTCGTAAATATCTTCTTCTGAGAACATGGCCATGGTGGAAATTGTA
TACCAAAGTTAAGCCACTTTTGAACATTGCTCGTCAAGAGGAAGAAATGAAAAAGGCCGCTGAAGAATTGACAAAATTAA
AGGAAGAATTCGAAAAAGTTGACAAATTCAAAAAAGAACTTGAAGAACAAAACGTCAAATTGTTGGAAGCTAAAAACGAT
TTGTTCTTACAATTACAAACCGAACAAGACAGTTTAGCCGATGCCGAGGAAAAGGTTTCAAAATTGGTTATGCAAAAAGC
CGATATGGAAGGAAGAATTAAAGAATTGGAAGATCACCTTCTAGAAGAAGAAGATAATGCTGCTGGACTGGAAGATATCA
AGAAGAAAATGCAGGGTGAGATTGAAGAGTTGAAAAAAGATGTTGTCGATTTGGAATCTTCATTACAAAAGGCTGAACAA
GAGAAAACCGCGAAAGATCAACAGATAAAATCGTTACAAGATCAAATGGCAAAACAAGAAGAAGAGATGAACAAATTGAA
AAAGGAGAAAAAGGCCGCCGATGAAGTGCAAAAGAAAACCGAAGAATCTCTACTAGCGGAAGAAGAGAAAGTCAAAAATC
TAAACAAAGCTAAAGCCAAATTGGAACAGACCATTGATGAGATGGAAGAAAACCTCTCGCGAGAACAGAAAATCCGAGCT
GACGTAGAAAAAGTTAAACGAAAAATCGAAACTGAACTGAAACAAACTCAAGAGACCGTAGACGATTTGGAAAGAGTAAA
ACGAGAATTAGAGGAACAATTGAAGCGCAAGGAAATGGAATTAGTCAATGCTTCATCGAAAATTGAAGACGAATCGGGAT
TAGTTGCCCAGCTTCAGAGGAAAATCAAAGAACTTCAAGCTCGAATTCAAGAATTGGAAGAAGATCTGGAAGCAGAAAGA
CAAGCCCGTGCAAAAGCAGAGAAAAGCCGACATCAACTCGAAGGCGAGTTGGAAGAATTGAGTGATCGACTGGAAGAACA
AGGAGGCGCAACCTCAGCTCAAATGGATCTCAATAAGAAGCGAGAGGCAGAATTAATGAAATTAAAGAGAGATTTAGAAG
AATCGAATATGCAACACGATCAGGTTATCGCACAAGCTCGAAAGAAGCAACAGGATGTTGTCAATGAATTCTCAGAACAG
CTCGATCAACTGCAGAAAGTCAAAGCTAAAGTTGAAAAAGAAAAGAATGAGATGAAAGAAGATTTAAATGACCTACAAGG
ACAGCTGGAATCATTAAATAAAGCCAAGGCTAACAGCGACAAACGAATCAAAGAAATCGAAGCTCAAAATTCCGAATTAC
AGGGCAAATTGGAAGAGGCAAATAGACATATCAATGATGCCAACAATACATCTGGAAAGAATCAACAAACCAATGCGGAA
CTCCAAGCACGTTTAGAAGAAGCCGAATCGCAAATCAATCAGCTGGGTAAAGTCAAGCAACAAATGCAGACTCAACTCGA
AGAAGCCAGGCAAATCGCTGAGGAAGAGTCGAGAGCAAAGGCTAAATTGAGTTCTGATGTTCGCAATCTCAATGCCGATT
TAGACAATCTCAGGGAGGCACTGGAAGAGGAAAATGAGAACAAAAGTGACATACAGAGACAGCTAGTTAAAGCTCAGGGA
GAAATGCAACAATTGAAGGCTAAATTCGAAGGCTCGGGATCCATTCGTTCAGAAGAGTTGGATGAAGCCAAGCGAAAGTT
TATGACACGAATCCATGAGCTGGAAGAGGAAGCTGAAACCGCCAAATCGAAAGCCGGACAACTAGAAAAAGTTAAAGCTC
GACTCCAAGGAGAAATCGAAGATATGCTGGTCGACGTTGACAGAGCGAATACACTCGCATCTCAGTTGGAAAAGAAGCAG
AAAACATTCGATAAAGTCGTGTCAGAATGGCAGCAGAAATATGCTGAATCTCAGGCGGAATTGGAAGCATCCCAGAGAGA
AAGCAGGACGATTTCAGCTGAGGTGTTTCGAATGAAAGCACAAATCGAAGAAAGTCAAGAGCAGTTGGAAAGCGTTAAAC
GGGAAAACAAAAATCTAGCAGATGAAATCCACGATTTGACAGAGCAAATCGGAGAAGGAGGTCGCAGTGTTCACGAAATC
GACAAAGCAAGGAAACGATTGGAAATGGAAAAGGAAGAATTGCAACATGCGTTAGAAGAAGCCGAACAAGCTTTGGAACA
GGAAGAAGCCAAGTCTCAACGATCACAACTGGAAATGAGCCAGATCAGACAAGAAATCGACAGGCGATTGGCTGAGAAGG
AAGAGGAATTCGAGGCCACTCGAGTCAATCATCAAAGAGCAATGGAGTCAATGGAAGCCTCACTTGAAGCCGAATCCAGA
GGCAGGGCTGAAGCAACGAAGATGAAAAAGAAACTGGAGCACGATATCGGTGAACTGGAAGTTGCAGTGGATACCGCCAA
CAGAATCCGATCGGAGCAAGAAAAGAACGCAAAGAAATTCCAGCAGCAAGTTCAAGAATTGCTATCAATGGTGGAGGATG
AGAAACACCAGAAGGATCAGATACGAGAGCAAACGACGATGACAGAAAGGAAATTGACAATGGTCCTGGCAGAGCTTGAG
GAGGTTCGTGGCTCATTGGAAAATTCCGAGAGAAACAGGAAAAATACCGAGAATGAGAAAATGGAAATAACTGATCGATT
GAATGAGTTGAGTGTCCAGAGCTCCGGTTTCATGGCTACCAAGCGGAAATTGGAAGCTGATTTGGCTGCTATGCAGTCCG
ATTTAGAGGAGGCCGCTACTGAAGCCCGACAAGCCAATGAACAAGCCAAGAAGGCTGTTGCTGACAGTGCGAGATTGTTT
GATGAAATCCGGCAAGAGCAGGAACACGCACAGCAAATCGATAAGATCAAGAAACAACTCGAGGCCCAAAATAAAGAATT
GCAAGCCAAATTAGATGAATCGGAGAATAATGCTTTGAAAGGTGGCAAAAAAGCCTTGAGCAAACTAGAGCAACGCGTTC
GTGAACTTGAAGCCGAATTAGACGGAGAACAAAAAAGACACGTTGAAAGTCAAAAGAACTCCAGAAAAGTTGAAAGACGG
CTTAAGGAGCTTGGATTACAAACCGACGAAGATAAGAAGAACCAAGAAAGATTGCAAGATCTGGTGGAGAAGCTTCAAGG
TAAAATCAAAACCTACAAACGCCAGGTGGAAGAGGCGGAAGAAATTGCTGCTGTAAACTTAGCAAAATACAGAAAGATCC
AACAGGAAATCGAAGATTCCGAAGAAAGAGCTGATCAAGCTGAACAAGCGTTGCAGAAGCTGAGGACCAAAAACCGCAGC
TCCGTTTCGACAGCGAGAGGCGGTAGCATGGCTCCCGGCATGACCACAGTGAAATCGACATCACTCTCTGTTTCGGCTTC
GAGCCGACGACAAGGTTCTAGTGTTTCCAGAGAGAGCTAAGTCAGAAATTCTAGTAACACAACGATAAATTATTAGGATT
TACTTAATTGACATTATTTGCATGTTATCAATTATTGGACACAATTTAGTGATGCTTTTATTTAATAAAATTTACATTTT
GAAAAAAAA
>SMED30022907 ID=SMED30022907|Name=Synaptotagmin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1814bp
ATTTATTGAAAATTATTTTTTCTATTATTAGGAGAAAATTGATTATTTTTTTTTGACAAAATAAGTTTTGGATATATTTC
CCATTTGTTTGTATTCGTAAACCAATGAAGAATTCGACTCACGGATCGGATCATTCGGCCAGCAAGGCCAGTATGAAAAC
GAATGTGGAAAAATTTTGGCATGATCTCGGAAAAAAATTGCACATGGATCCAAAAGCATTAATAGGAGTAACAATCGGTT
TGGGAATATTGTTTTTGTTGTTCCTTTATTGCTTATGTAAAAAATGTGTTTTCAAGCGTCGAAAAAAGAAGGAAACGGCC
AAAAAAGGAGCCAAGGGAGTAGTCGATATGAAAAGTGCCCAATTGTTGGGGAATTCATATAAAGAAAAAATTCAACCCGA
TCTTGAAGAACTTGATGCAAACATGGAAGACAATGAAGGTGTAAAAGAAAAAGAAGATGTTCATTTAGGAAAATTACAAT
ATTCTCTAGATTATGATTTTCAGAAAGGAGAATTAACTGTTGGAGTTATTCAAGCAACTGATCTTCCAGCTATGGATATG
TCAGGAACATCAGATCCATATGTCAAATTATACCTTCTCCCAGACAAGAAAAAGAAATTCGAAACAAAGGTTCATAGGAA
AATTTTAAATCCTGTATTCAATGAAACTTTTGTTTTCAAAGTTCCTTTCAATGAAGTTGCATCGAAGACTTTGATTTTCA
ACGTTTATGACTTTGACAGATTTTCCAAACACGATCAAATCGGTCAAATAAAAGTACCATTGGGAGCTATAGATTTAGGT
CGAGTTATTGAAGAATGGAAGGAACTGGAATCTCCAGAAAACGATGGGGAAAAGGAAAACAGGTTGGGAGACATTTGTTT
CTCTTTAAGATACGTACCGACATCTGGAAAGCTTACAATAGTCATTTTGGAAGCAAAGAATCTTAAAAAAATGGATGTCG
GAGGATTGTCTGATCCATATGTTAAACTTTCCTTGATGCTTAATGGTAAACGAGTGAAGAAGAAGAAAACTACCATCAAA
AAGTATACACTAAATCCTTACTACAATGAATCATTTTCCTTTGAAGTACCATTCGAACAAATACAAAAAGTGAACTTGAT
CGTCACGGTTGTTGATTATGACAGAATCGGAACCAGCGAACCGATAGGTAGAATTGTTCTGGGATGTAACGCAACTGGAG
CAGAATTGCGACATTGGTCGGATATGTTGGCAAATCCCCGGCGACCAATCGCCCAGTGGCATACCCTCCAAGAGATGCCA
GAGAACAATTGATAGTGTTCGTTTGATGCTTTAAAGCGGTTTGCATAATTCGTGAAATAAGTTATCAAAATTTGAGAAAT
GTTTTTTTTTCTGAAACAAAAATGGCATGAGACAATATACCAGAGTTCATTAGTGTGTGGTTTCGTTGAATATTTTGGTG
GTGTTGCATCTTATCGTTTGTCCTCTAATCTAATAATGTTTTATTCTTTATATAGCTGATTTATTCTCGAGCGAAACATT
TTTTATGTGTACCAAAATACTTATGTCATAGCCATTGTGATTAGTCTGTAAACTATTGCGTAATAGCCCCTCTCATTGGC
TTTTTTTAAGAGTAGTGAGTTGGAAAAAAAAATACAAAAATGACTTCAATTGTTAAACATTACTCATATTTTATCAGTAA
GTTAACTTGCATATTTGCAGTTAATTATGGCATTTTATCTCTAAATCTCTGAAGCATGGCCTCAAGTCTTTTGTTTGTTT
TAATGTAATTATGTCTAGATGAGAATATTAAAATACTTCGGTTTATATAAAAGA
>SMED30015313 ID=SMED30015313|Name=Cysteine-rich secretory protein LCCL domain-containing 2|organism=Schmidtea mediterranea sexual|type=transcript|length=614bp
GATTTACTTTACATAAGCGATTGTATCAATAAATTATCGTTTGAGATGAATTCGAAATCAGTAAATTAATCATCGTATTC
ATAGAAAGAAAATGAGAAATTCTCTATTATTTAGTATAATGTTAGGTGTCGTTATCTCAGTTATCCAGTGTTATCTGACT
CCTGACCAACAACAACAAATATTGTATGGAACGATGAAGCTGCACAACGAGCTCAAATGTCGGCTGATCGTTGCGTTTTC
CAATATGATCAATCAAGAGATCGTCGATTTGGAGGTTATAGCTGGGTTGGTCAAAATATTGCATACTGGTCAAGCAATGA
CGTGACAGACGGTATCAAGATGTGGTTCGACGAAGTCAAAGATTACACATTCAATGGAGATAAATGTAGTGGATTTACAT
GCTTGCATTACACAGCTTTAATCTGGGCAAAAACCAAGGAATTTGGATGTGGAATAGCAGATTGTTCTCGAAAGGGTTTA
GGAAATATTTACATCGTCTGTAATTATGGACCCGGTGGAAATTGGAACAACGAAGCACCATATAAAGTTGGACAAGCATG
TTCCAGATGTCCAAATGGAACCAGATGCAGCAATGGACTATGCAGTTAGAAATA
>SMED30035691 ID=SMED30035691|Name=Macrophage-expressed gene 1 protein|organism=Schmidtea mediterranea sexual|type=transcript|length=2718bp
TATATTTTAGAGATTATGATTATAAAAATTTAAAGTGCCGACAGTTAATAAAAACAATTAATGCTTACAACGTAAGGTCA
TCATGATGATGTAATCATTCGGATGTTCTATGACGTTCGGATAACCCTTATCACGTGGATCCTAAACAAAATATATCAAT
CAACTAGGAATTACAATATACATTTGTTTGTTCAACAGTGAAACCAGTGATACTTTGTATGTTTAATAATATAATAATAA
TTATATTTGTCTGTGGAGTTCTATCTTTTAAATGTAAAAGCGAATCAAACAGAGACCTCCCGTCAGAGAGGCAAGTCCAT
AAATGTAAACTTACTAACAAACAATACGCATTCGATATCCTCCCTGGATCTGGATGGGATAATCTTGAAAACAAGGAACT
CGGTCAAGTTTTAGAAATTTCATACAAGGAATGTTTGGCTTCGAATGATGGCAGCTTTCTCATTCCTGACAACTCGGTGA
TTATTCCGATCAAAAGGTCAACTGTCGAATTGGCATCTGACATATTTGATCATTTCTCTAATTTCACATCTGCCACGTCC
AAATCCATAAATGCCGATGCAAGTTACGCCACACCAAGCTATCAGATTAGTGGCTCGTTTTCATGGGAAAAAAAGGATGT
AAAAAATGACCAAATCAAAGAAAAGTCTTTGGTTTCTCGGGTACAATTGAGACACGAATTTTACACCGTTTCATTTCAGC
CAGACTCGAAATTTGATCGTCAATTCAAGAACAGAATTCTAGATATTGGAGCGTTATTGAAAGAAGGAAAAGACACAATT
TATCCACAATATTTAGCGGATTTAATTGTCCGTGACTTCGGCACTCACGTCATTCGGTCGGTGGATGCGGGAGCGACACT
AATAAAGACTGATGTTTTAAAATCGAATTATGTCAAAGGTTTTAAAGGGGATACAACTAAGATTGCAGCTGCGGCATCAT
TCAGTATGACAACAATGCTTTCAGTCAACCTCAAAGGAACCTATGTTGGTGATACCACGAGTCTCAATGAATTCAATAGT
AATAGTGCAAGTACAAAAGTCGAAACTTTTGGTGGTATACCGTTTGGTTCGAATTTTAAGTTGGAAGATTGGGAGAAAAC
CCTTGAAACGAATTTGGTAGCAATTGATCGCAAAGGTGAACCGTTGTCCTATGCTATTACATCAAGAACTCTTCCAGAAT
TTGACGAGAAAATTATTTACAAAATCGCTACTCTCATCAAAGAAGCAGTCAATAGATATTATGCAGCCAACACGAGAGTG
GGATGTATGAATATGGAGTCAGAAAATTTCAATGACGACGCAAATGTTGACGGTGGAAACTGCGAACCTCCTAATACATT
TTACAGTTTTGGAGGAACTTTTCAAACCTGCTCAGGCCCTGATTATCAGTGTATGGATGTCGCGGCAAAAAACCCAGTGA
CCAATAGTTATGCTTGTCCTGATAACTATGATACCATTGAATTACAAAGTGGATTGAATAAATGCATAAATTATTGCACC
AAATACTTATTTTCCACTCAATGTCATTACGAGTGTTCCCAATATGCATTGTATTGGTGTTCTTCTACAAACAAAACGAA
AATATCAGAAGGCGCACTTTTCGGGGGATTCTACACTAATACATTTCCGAATCCACTTACAAATTCCTATAGTTGTCCAC
AATACTATGTAGCGACAAGATTCGGCGTAAACGCCAAGGTTTGCACTGCACTCAATAAGGCAGAGGCTATGGAACACCAT
TTGCCGTTTGGAGGATTTTATAGTTGCAAAGTTGGAAATCCTCTACTAGATGATCCTCTCTACAACATTACACAGGATCC
CAAATATTGGCCTCAAGGTTGTTCAACCGGATATTCATCACATGTAGCTATTGTCGACAGAGCTTGTCAAATTTCCTATT
GCGTTAAAAATAACGCCCTTAGCATGAGAGAGCAACCGCCTCTCTACCGACCACCTTTTATTGATTTGGGATTTGGACCC
AATATGACAGTAATTACCTCTCTGGACACTCCAATGGGGGTCCGATTATCTGTTGATGAAAACGGGAAATGGAGTCATAA
TCACCAATACAAATTATCCAATTACAATATTATAATAATATCAGTCATTATGGCGGCAGGAGCCAGCATTGCAATTATTA
TTATAATTCTTGGAGTTCAAAGATTCAGCAGAAACCGAAAAGGTCAAGTCTCACCGGAATCTCATGAATTTGATAGCAGA
TATGATTCTACTAAAGATGTTGCCAATCTTGCGTTACCCGGCGAGGTTCCACCGTTTCGTGTTATAATTGACGGAGCGAA
ATGATGCTTGGAACCTTTTATTATTTCTGTTGAATCTGATCTGTAAATGTTTTCAGAATATTTTTCTAATAAAATCGTTC
TGAAATTTTAAAGTGATCCTTGATGCTATTAAATGATGGACTTTATTGTACCCCGAATTGGGTCACCCTTGTTCACGCAA
ATTCGTGCTTAGGATATTTGTACGGGCTTATGCAACTTTTTAAATTTTTATTTTTCCTTATTTTTATTAGCAATCCGTTT
TATTTATAACGACAAATGCTTGATGTTTGAATCAAATTTTTATTATGTTTCTTAATGAAACATAGTGAACAATGTGCCAC
TAATTTCATAACCAAGGTCTAATCAAATAGTTTGGGTAGTGAAAGCAATATTACAGAGTTTAGGTTTGTCATTCATAT
>SMED30001900 ID=SMED30001900|Name=CUGBP Elav-like family member 3|organism=Schmidtea mediterranea sexual|type=transcript|length=1713bp
CTTTTGAGGGAAAAATAATTCTTTTATTAATAATGTTTCATCATTGGAATATAAAATAAAATATTAGGAGAAAACATAAG
TTAACCAACAATATTAGCCACATATTTCGTTTAATTATTGGTCTATCACTTTTCATTTTAACCAATTGTCTTGAGATAAT
GGAGAGTTTATCCTTAATTTTTATTATAAATCACTGGTTTTGATAGACTTATTAACAATGGAAAATTATTTCAAACTTTT
CGTTGGTCAGATACCTCGAAATACACCAGATAAAGAAATTAGACTTATTTTTGAAGCTTTTGGACCAATCTTTGAATTTT
TAATTTTAAGGGACAAGAAAACTGGTTTTCATAAAGGATGTGCTTTTGTTACATTTTATCATAAAGACTCTGCAGAAAAT
TGTCAAAAGGCGTTACATGACAAGAAAATCCTAAACGGGATGAATCGACCACTTCAAGTGAAACCAGCTAAAAATAAGTT
AGCAAAAAATTCAAGTTTGAATGGGGAAAATCAGACAGAAGAGCAGGTTTTCAGTGATGAAAGGAAATTGTTTGTTGGAA
TGTTGAGTAAAAATCAAACTGATGAAAATGTACAAAATATGTTCACAAAATTTGGCAAAATCGAAGAGTGCACTGTATTG
AAAGACCAAAATGGAAATAGTAAAGGATGTGCCTTTGTCAAATTCGTGAACCACACCGATGCTTGTGCAGCAATAAACGC
TCTTCATGCCAGTCAAAAAATGGAGGGTGCTTCATCCAGCCTTGTGGTTAAATTTGCTGACACGGATAAACAAAAACAAA
TAAGAAAATTGCAGCAATATATTCCAGATTTAAGCATTTTAAATTCGCGCATTCCTATTAATATTCCATACTATTCACAA
TACGGTACAATAATTAATCCAGAATATAATTCAACAATTCCTTCAAACCAATATATTCGAAATTGTAACGAATATATTCT
TGCTGCTCAAATTCAACAAATAAATTTGTTTTCTAATTTATCATCGGTCTACCCATCTAATTCAATAGTGTCAATGCCAT
CCAGCCATCCGGTACCAATGATTGACTATTCTGTTCCTATTAACAACTTTCCACAAACTGACCAAATAACAATGAAACCA
ATTGTTGATATACAGCCAATACCTCCAGAAGCTGTACACCGAACCATCGTAACTCCAGGATCACTCTTATCATATCCTTT
TCTTAATGTTCAAATTCCTACAGTATATCCAAACGCCTTTTCCAATGGAAATTTAACAAGTACAACACAAAGTTCAACAG
ATGTGAAAACCACTCCTTTGCCAACAGGTCCTGAAGGCTGCAATCTATTTATTTATCATCTGCCACAAGAAATTGGTGAT
TTACAATTATATCAAATTTTTATGCATTTTGGAAACGTTATCAGTTCTAAAGTTTATGTTGACAGAGCAACAAATCAAAG
CAAATGTTTTGGATTTGTCAGCTACGATGATCCGGCATGTGCCAATGCCGCCATCAAATCTATGAATGGATATCATATCG
GAACAAAAAGATTAAAAGTTCAGTTAAAAAAACCAAAAGAAGCAATAAACGAAATGAAAAACTTCAATCAAATGTTATCA
TCAACTCCCGACATAAACCAAGTATTTTGTTCATCCTAATGATTGTGATATTTTACAGGATTTTCTCGACCATATTGAAA
GCCTGATTGGTGATATGTAAAATGACCCACCGT
>SMED30027428 ID=SMED30027428|Name=forkhead box A-1|organism=Schmidtea mediterranea sexual|type=transcript|length=2149bp
ATCACTTGGTGCTGCTTTTTGCCCCGATAAATCTCTCGGTGCTCCAAAATTTGTGTAAGCGAGCAAAAGATGATTGGGCA
ATTTCTAGCACGTCATTCGGCAACGATGTTTACAAGTTTCTCTGATTGGATGATAAAGTAGAAACTTTCCGAAAATGAAA
CTTCTCCGAACATGCGCATACCGACTGAAAATTAACTCTAAGCCAGCCAATGGAATTGAAGCAAAATTCAAGAGAATATT
AATTGACTTCGCGAATGAACTCAAATTTTCTATTGGCGTATTGTGTGTGCCTCATTGTGAGTGGTTGCGATCGCATCTCA
AATTATTTACACACAAAAAAATAACGCACACAGACATTGAATAGATATATTTGATCAAGTCAATATCACAATGTCAATAT
TAGCTTTTTCTGAAGAAAGAAGACGAACTAGAAGAAAAACAACAACGAAATAGATTCGATAAGGCTACTGAGCGATTTTC
ATAATCTAAATATTATTTTATTATTGATACGGACAAAAATTGGTCTTTTACCAAGTACTACTAGATTGTTGATAAAGAGA
GGTTATTTAGATGCTTGGAAAAAATCCTTATGAAACTGCAATGAGCAACGTGTATTCTCTACCTCCGGGAGGTTCTATTT
ACAATATGAACCCGATGAGTATATCATCAGCTGGCTACAACTCTCAACAAGTATCAACACTATCGTTGAACTTGACCGGA
ATCGGACCTCATTCATTAAGCCCAATGAGTGCAAGCATGTCGGGTATAGCTGCAATGGCCGGTGGAATGAGACAAGGTCT
TGAGTTGGGTCTTGGTAGAAGTGATAGTCCAAGAGATAAAAATTCAATTTCCAATAACAACCGACCATATCAAAGAAGTT
ACACTCATGCCAAGCCTCCATACAGTTATATAAGTTTGATAACAATGGCGATTCAAAATTCTCCAGTAAACATGTGCACT
CTATCGGAGATCTATCAATTCATTATGGATCATTTTCCATACTATCGTCAAAATCAACAGCGATGGCAGAATTCGATTCG
ACATTCTTTGTCCTTCAACGATTGCTTTGTTAAGGTTAGTAGAAGCCCAGAAAAACCAGGTAAAGGCTCATATTGGACCT
TGCATCCTCAATCAGGTAACATGTTTGAAAACGGTTGTTATCTCAGAAGACAAAAGCGATTCAAAGATCCACACAGAGAA
ATCGGCAGACAGAGTCAAAGAGCTGCCACTGGTCCTGGATCAAATGTCACAGAAAACAATCACGACAACGCATCGCAAGA
AGCTAGTGATAACGCAGAAAGTGATACGAAACCCAACATCAAGCAACTTGATTTATCAAGCGATCTCTTAACTAATCAAG
GTCATAATATTAAAAATACTAATCCAACTTCTGTTAGTCAGAGTTGTTCGATGTTTCATCGGAAAAAGGAAAACTGCTCA
CCAGTAGAAATGAAATTGAATAACCAAAACCAACAATCAAACCAGCAAGAACATCCACAAATCCATTACAATCCCAATCA
GCAATTCTACTCAAATCAGCAAAACATTTTCCAACAAAGTTCTCTTGATCATTACAGTCTATTAGCATCCGATGATCCTC
TTGGTCAAGGTATGCACTTGCCACCAGGTGCAAATAGTGTTTTCGGACTTTACGGGGCACATAACTTACCAAACGATGAT
CAAATTTCAGTGTCATTACCATCGATATCCTTATCCGGACATCCGTATGACAATTTATCAACAGCAATGGCATATCAATA
TGAAGCATCTCAACACAATTCTTCATTACTAACGACAAGTAATCCGTTCTCAATAGATCGTTTGATGCATCCAAGACTAG
TCGCTGCAGCGATGGGGGTCAGTCCCCATGATACTCTATACGCAGGAGCTACCGGCCCATCAGTTGATCTAGAACACATG
AAATACTACTCAAACTACAACAATGTGCCTCCTTATTCCTCTGCAATGTCTGACTACTACAAATATGTACAAAATCCTCA
GCCGGGCAACAGCGACATGAGTCTTTGAATTGAGTCCATTGAAGTCTACGGCAGTTTCCTCGAAATTTCACATTCAACCA
GATGTTTATCGCCTAATATAAAGCTGTGTTTTTTTATTTATTTACAATTAAATCTTTGTACAAGAGATC
>SMED30033415 ID=SMED30033415|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=703bp
AGAACAAAAGGATACGTAACTCCAGTGAAGTATCAAAAAAAATGTAAGTCCTGTTATTCCTTTTCAACTGCAGGATCTCT
TGAAGGTCAATATTTTCGGAAAACAGGCAAATTGGTTAATTTTTCTGCACAGCAATTAGTTGACTGCAGTAGTTCTTTTG
GAAATGAAGGATGCCGAGGAGGATTTGTAGAAACGTCCTACAGCTATGTGATGGAATACGGCATTCAGTTAGAAAGTGAT
TACCCGTATGAAGGAAAATTTAGACAGTGTAAATACAATAAATCTCAAGTCGTAGGAAAATGCAGTGGATTTGTTCGCAT
AGAAGAAGGGAATGAAACTGATTTGGCCATCGCGGTTTCAACGGTTGGACCTCTGTCCGTTTCAATAAATGTTCAAAAGG
ATTTCATGGATTACAAAAGTGGCATTTACAATAATGCGAATTGTCTGTTTTATTCATTAAATCATGCTCTTCTACTTGTC
GGTTATGGATCAGAAAACGGAGTCAACTATTGGCTTTTGAAAAATCAATGGGGAACTGCTTGGGGTGAAGAAGGATACGC
CAAAATGGTAAAAGACGCGAGAAATCACTGTGGAATCGCTACAGCTGCCAATTATCCCTTAATATAAAATAGACTGATAT
TAATAAAAATGTTTTGTTATAAATTTTAGAATTAAAAAAAGTAATAATAATAATAATAAATTG
>SMED30016085 ID=SMED30016085|Name=Macrophage-expressed gene 1 protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1970bp
TTACAATATAGAAAATGCTTTGCTTTCCTCTGGGAGGGTTGATTCTACTGATATCCATAGCATTTAGCTTAGCTGACATC
AATCTACCTCAATATCAAAGAGGATCAAACACGAATTTCCCATCGAGACGAATGGCCCATGGGTGCCAGTTGACAAATAA
TGAATATCCATTCAATGTGTTGCCAGGATCAGGTTGGGATAACCTCTCTAATCGGGAGCAAGCACAAGTGTTAAAAATAT
CATATGACAAATGTAAAGCCTCAAATGACGGAAGATTTCTAATTCCTGATCAAACGAAATTAGTGCCAAAAATGAAGTCA
ATAGTGCAGTTAGATTCAAATTTGATTTCACATTTTTCAAAATATCCGTCGACTACTTCTAAATCTATTAATGCGGAAGC
AAGTGGAGAAACGAAGAAATATTCAATCAGTGGATCTTTTTCCAATGAAAGGGAAGACGTAAAACGAAATCAGTTAAATT
CTAAATCCTCAATATCCCAATCTCAATTGAGATACGATCTTTACAAAATTTCTCATATCGTAGACGCTGAACTTGATACA
AAGTTTCACCAAAGAATCCTAAACATTGGGGTGTTGATTGAAACAAAAAAGGATTCTTTATATTCAGCATATCTCGCTGA
TTTAATCGTCAGAGAATTTGGAACTCATGTCATTACATCGGTGGATGCTGGAGCCGTTTTGTCGAAAATTGACATCTTGA
AACAAAAATATGTCTTAGATAGTCAAGTACAAAATAGTGACGTATCAGTTGCAGCATCATTCAGTTTGGGACAAATTTGT
GGATTTAAATTCGGTTCAAATTTTAAAAATGATGACACAAAAATTGAGGAATATAACAATAATTGTGCCAGTACGAGAAT
TAAAACAATTGGCGGTGGACCTTTCGGCTCGGATTTCTCTTTAGAAGAATGGGAAAAAACCCTTGACACAAACTTGGTGG
CTATAGATAGAATCGGAGAGCCTTTGTATAACGTAATTACAAAGCATAATATTCCAGAATTTAGTGACAAAACGATTTAC
GAAATAAACTTACTTGTCAAAACTGCTATTGAGAAATATTATTCCACAAACACTCGATTAGGATGCATGGATTTTAATTC
ACATAGCTTTGATGAAAATGCCAATGTCAACTCCGGTTTGTGCAATGAAACGGGAAATACTTATCCCTTTGGTGGGGTTT
ATCAAACCTGCCAGAATTCAGACAAATGTGACACATATAATCAAAAGAATCCCGCCACCGGAGACTATAGCTGTCCAAAG
GCATTTAATCCTATCAAACTGTTTGAACTTGACAATCCAAGTATCACTTTTGTTTGGTGTGCTCCACGAAGCTCTTCAAG
CGCAATAAATGGATATCTATTTGGCGGAATGTATACTGAACAATATCCGAATCTTGTTACTAATAATCACAACTGTCCGC
AATATTACTTTCCTGTCCAGTATGGAATCAGTGGGAAAATATGCATAACTCAAGATAAAGAACTCGGCGGCAAAAATAGT
TTGCCATTCGGAGGATTCTACAGCTGCAAGACTGGAAATCCATTAGCTTTGGCCATTTACAATGGAACTCAGACAAACTT
TCCTCTGACCTGCGGTTCGGGTTATTCTACTCATTTAGCGTCTATTTTTAACAACTGCCATTATTCGTATTGCGTTAAAA
ATAATGCTATAAAAACGAAAGCTGCGACTCCACTTTACAGGCCTCCGTTTGTTGATTTGCAAATGGATTCGAATATTGAA
GTCGTCAGTGAACTCACTACTTCAGCAGGAATGAAGCTGGTTTTAGCCGAAGATGGAATATGGAAGGAAGAAATCCTGAG
AACTTACATGGTCGAGTATATAATGATAGCAGTAACTGTTGCGTTGCTGACTCTAATTGCTATATATATCAAGTTCAAAT
GTTTCGTTGGAAAGAAGTTAAATCCTACTCAAGTTTCAGCAGATCGGAAG
>SMED30022362 ID=SMED30022362|Name=Synaptotagmin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1443bp
CTCTTCCGATCTCAAACATTTCAGTCGCAAAGCAGGTCGCCACGAAATACATAAATCCGAACTCAACTGCTATTTGCATT
AAGCATTTCAATGGCCTTCACGAACATACCAAGCACACACCGACCTTTTGCATAGCAAAATAATTTATTATCATTAAAAC
AACCTTTGTGACTCTATTTTATCGATTTGAACGAAATTCACCACGATGGCACCATAAACAATCAGATCTCACAAATGTCT
GCGACTCTAAGCACAATGTCAACACTGAAGTTCACAAGGCCAACAAATGTAACCTCAAACCTCTACAAAGACATAATCAA
ATATCTTGATCTCCCGGAACCGTTGATTGTAGCAATCTTTGCCGCTGCTGGTTTGTTAATATTCGTTATTTTCATATTGT
TTTGTTCGAGATGCTGCTGCAGAAAATGCTGCAAGCAAACTGCCGATAAAGACAAATACAAAAGACGGAAGCTAGAAACA
AAAGAAATTGACAAAATTTTCAGAGACGAGTTGAATCTTGGATTTAATGAGAGTTTTGGAAAGATATATTTTGCGCTCAA
ATATCTCCTCGTAAAAGAATTGTTAATTGTAAAGGTTATTAAGGTGGAAAACCTACCGACACCAATTGACGACTGTCTTG
ATCCATACGTTGTCGTACAAGTGAAATCAAAAAGTTTGACTGAGGAAAAGAAAACCAAAATTAAATACAAACATATAGAT
CCGGTATTCAATGAAAAGTTTACTTTCAAAATTCTCCATCCAGAACTTAATGATTCGGAAATTTTTTTTAAGGTTTTTGA
CTATGATAAATTTGGAGCCGACTCATTGCTAGGTCAACTTGCACTAAATTTTAAAGACCTCAATCCCAGTAGCATCATAA
ACATGTTGTCAGAGTTTTCCAAAGATTTAAAAGAAGGTGAAGATACATCGGAAGGCATGGGACAGGTATGCATAATTCTG
AATTCAAATGGACAGGCAGGATTACTAGTCACTATACTAGAAGCTAAAAATCTTCGAGTTAAAGAAAACATGAGTTATTC
TCACATTTTTGTCACAGTTAAAATCAAGTCTCGGAAACACGGGAACAAATTTAAAACTCACTCGAAAAAAAGAACCAAAG
ACGCTCATTGTGGACCTTTTCCGTATTTCAATGAAACATTTCTTTTCCCGAAACCTCATGGAACGATATCAGACTGTTTA
GTATCAGTTAAAATTTGGATCAGTAGAATGTTTAAAATGCCAATCTGCATCGGGTACGTCTCATTAGGTTCTGAAATGAA
TATGACTTCCGGCGCCATTCATTGGCAAAGCATGCTTGACAGTCCCCGACACCCGGTTGCAAAATGGCATGTCCTAACCA
ATCCTAATGTGAAAGAATAAAGATTTAATATTTAGTCCTTCAACATATCTTTTTAATAATTAAAATAATAATTATTTGTC
GGT
>SMED30023322 ID=SMED30023322|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=613bp
ACGCATTCTCTACGACAGGCGCGTTAGAAGGTCAACTATTCAGAAAAACTGGAAATTTGATAAGTTTATCTGAACAACAG
ATTGTTGATTGTGATAGTTTTGATTATGCATGTAACGGTGGATTTGTGACTGATACTTTAACTTATATTAAACAAAATGG
AGGAATTGAATCTGAGCAAGATTATCCATATGTGTCAGGAAGGACGAAGAAACCTAATAAAAAATGTTATTTCAAAAAAG
AAAAAATAGTGGGAACAGATACTGGTTTCGTATCTTTACCTCCAGGAGATGAAGAAGCTCTGAGAGAAGCTCTAGTAACA
ATTGGGCCAATTTCAATAGCTTTTTCCGCGTCGCCTTTGTTATCAGGATATAAGAATGGGATATATCATGATTACATGTG
TGCTGATGTTCGCATCAATCATGCAGTTTTACTAGTAGGATATGGAACGGATGAAGAATCAGGAACACCTTATTGGATAA
TAAAAAACAGTTGGGGTCCCGCATGGGGAGAAAATGGATATTTTCGAATGGAAAGAAATAAAAACATGTGCAACATGGCA
TACAATTCATACTATCCATTGGTTTGATTGAACGACTTCTTATGAGTGTGTGT
>SMED30002168 ID=SMED30002168|Name=Spondin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=2693bp
CAATTGCTTAATAAAATTTTCCTTTCAATAATTACCGTAAAAGTTGATGAAATTAATTTTGAATATTTTATCCACTTTTT
TCATATTGAAATTTGATTTTGCTGAATGTTTCGGATTTTGTGACATTCAATTTCCGAAATCATACGTTGCCTTTTCCACT
AGATTCAATCTCTATACGAATCATGAAAAAGAAAAACTGACCAAAATCACCTCGTACATTCCTGATAAAACCTACGACAT
AACTGTGTCATTGAATGATAAAGCTATGCACGAAAAGTTGACAATAAAAGAAATATACGTCTTAGTCTCAAATGTTCACA
CGGAAATGGAAGAATTGTCGGAACATGACTGGAAAAACGCCGGTGAAGTGGTTTTTAATGTAACTCACGCATCCAAAACA
GAATATTGCCCCCAAAGAGCTTACGTTCAGTATTTATATACCCAACCCCAACATGTCACATTCTATTGGATAGCACCTAA
AATACCGAATTTTTGTATTAGAATAACAGTTATTTTGAAAATGAACGATTTGATTTCAGAAAGCAAATTCGAAGAAAGAT
CCCACTGGATATGTGAACAAAAAAGAAACAAAATGGATCAGATGCAAGCAGATCAATATGCATCTACCTCTTGCGCAATG
AAACAAAAAACTGATCCAGTTAAACAATGTAATATTGGATCAACAGCGGTATATAGAATGACAATTGAAAATAAATGGAA
TTTATTAAATCATTGGAAAGATTGGCCGGGCAAAGACGGGTATTCTCCTAAAATAACTCAATATCTCGGAGCTTCTCATT
CAAATGAGTTTAATATTTATCATCTTGGTGGAATGGCCAATGAAGGAGTTTCTCAGGTATGTGGAAACGGGAGCTACACT
GAATTGCAAAAGCAATTCTACAAAGCTGGGAACGGGATCATGACAGTTATATTGGCCAGGTCACTAGATGCGTCATCAAA
AACCAATAAAAGATCAGCACTGATTGTTGTAAATGCAACTCAACATTTGGTTAGTTTTCTTGCAAGACTTCATCCAAGTC
CCGATTGGTGCACAGGTCTAAGTAGATTTGATCTTTGTAACGGCTCATGCAAATGGCAAGAAAAATTTATCGTCCATTTA
TATCCTTGGGATGCCGGTGTTTACAGTGGAGAGACTTATTTAAATAAAAACGAGAAAACTAGACAGACTCCAATATGTCC
AATCACTAGCAGTTGGCCAAAGGATAACCCTTTCACGGTGATGAACGGAAAAATCAAAAATATCGGAGTGGTAACCTTCC
AATTAATACAAGAATATAACAAAAATGATAACCAGTATTGTAATTCTATTAATTCAATCCTTCAAGACGAAGCATACCAA
AATGAACCGAAATCCAGTGCTCTGAAATCAAATCCAGATAAAACCAGGCATTGCTTATTGTCAGAATGGAGTGAATGGAG
CTCTTGTTCAGAATCTTGTGGTAAAGGTGAAAAAACTCGTTACCGAAAACTGCTGAAAGGAAAATCCGAACAATGCATTG
AATCTTCCCTAACTAATACAGAGAGCTGTAGCAGTAAATGTTCGACAGTAATTTCATTCGAAACATGTTCGTTTCGCTTG
TGGGGCCAATGGAGCCCATGCAATGCTACTTGTTCCCAGAAGGGAATTATTCATAGGGAACGTGTTTTTATCAATGAACA
GGAAAAACACGAATGTATGCAATATTCCGAAATGAAAGCCTCTCTTGAATGTGCATTAGCAAGCGAGAGGTGCAAACCCG
ACGTGATCTGCAAGGAATATGTTTATCCTGGAGATTCGTGTTCTTGGTCTAGCCCATCACAAAGATTTTATTACGATTTT
TCTAGTGGAACTTGTAATGCATTTATTTACAAAGGCTGCTATGGGGGTCTGAATAATTTTCACACCTACGAGGAATGTAT
TTTACTCTGTCGACCAAAATTAAAAGAAACAGATCAAAGACGATTTAATACGCCAGAAACTTATCCCAACCGATGCGGAG
TTTCGATGACATGGGGAATCTTTTGTGATAGTCAATCTTCATCAAACCGTTGGTACTATGACAATATTAATAAAGAATGC
TACCGATTTCGTTTCGGGGGCTGTCGAGGGAATGCCAACAATTTCCGAACTAAAACTGAATGTCAAAATGTTTGCTTGAG
AGAAAAGTCTACTTCAACAACAACGACAACGATCAGTCAGCCAGTAACGGTAAGAAAAGTCTGCATCTATTCCAACTGGT
CGGACTGGAGTTCTTGTGATAACAACTGTCAAAATCAACAAACAAGAATAAGATTTTTAATTGAAAAAAATGACGACTGC
ACCGAAAGTATCAGTGAAACAAGAAAATGTCAATCAGAGAAATGCAATTCGCCAAATAACGGGTTTATTTCACTAAGGAA
TTGCAAGTATTCGAGTTGGTCGGAATGGTCGGCTTGTTCATCAAGATGCGGTCCTGGCGTTAGAGAGAGAAAGCGGAAGA
AACTTTCTCGTAATTGTAAACCGGAATTTCCGCAATTTACTGACCGAGAATCATGTTACAATGCTTGTGCTTATGACTGA
ATCCGGTAAAGAAAAAAAAACTGTCAATGTATTTGTGTCATGACATTTTACCTATTGTGCATTTCATTTTGTGAACTTTG
TTTGGTTTTTGATTTATTTTTTCTTGGTGTTTTTCTCTAGAATATGATTTGTT
>SMED30019695 ID=SMED30019695|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=1216bp
TTGAAATTCTGCATTGATGGGAATTGCGTCGTAATAATCACGCGCCGAATATCAAATGTATAAATAAGATATTTGTTCTT
CACTTAATATAATTATAATGTTTGCGATGGGTCCTATCTTGATATGTTTATTATTAGCAGTGATTTCAGAAGCCAGAACC
ACTTATAGCCATCACAAATCAGTTCCAAGTGATGACATTTCTAGTAAATTTGAACTAGAAAATATGGTATCTCTCTTGTC
CCGTTACGACGGAGAATTCCAAACCTTCAAACAGCGATATAATAAATCTTATAGTTCCATGCATGAAGAGAATTCCAGAT
TTTTAAATTTTATATCATCTCTACTTGAGATCAATCATCACAATCAACTTTATGAAAACGGTCAGAAATCATACGAGATT
GGAATCAACCATTTGAGTGATTGGAGTGATGAAGAACTCGCTCAACTGACTAAATTGAAACAATCAAACCTGACGGGCTC
ATCATATTTATCATCCAGTGTGAAAATTGACCTTCCTGATTCATTCGACTGGAGAGAGAAGGGTGCAGTTACTGAAGTTA
AAGATCAAGGAAAGTGTGGATCATGCTATGCATTTGCTGCTACTGGCACTCTAGAAGCCCAAATCTGGAGAAAGACTGGG
AAATTGATCAGTTTATCAGAACAACAAATTGTTGATTGCGATACTAATGATAACAATTGTTACGGTGGATTTGTACAAGA
CGCGTTATCATACATCAAGTCAAATGGAGGCATTGAAAATGAGGAAAATTACCCTTATGTTTCCGGCAAAACAGCAGATA
TGAACCCAAAATGTAATTTCGTAAAAAGCAAAGTAGTGGCGACTGATACTGGATTTGTTAAAATGCCAGCAAATGATGAA
GAAAAATTAAAAGAAGCTCTTGTTACAATTGGCCCTATTTCTGCATTATTATCTGCTCCTAAATCGCTTATAAAATATTC
AAAAGGAATTTTCTACGACAAAGAATGTGAAAAACTAAGAGTTAATCACGCTGTTCTGATAGTCGGATATGGAACAGATC
AAACTTCCGGGACACCATATTGGATAATTAAGAATAGTTGGAACGCATCTTGGGGTGAAAAAGGATATTTCCGGTTACCC
AGAAATATAAATGCTTGCAAAATAGCGTCAGTGCCAGTTTATCCTTTGGTTTGAATTAAAATGTTTATGTAATAAATATA
TTTTTTTGTCTCAAAA
>SMED30003202 ID=SMED30003202|Name=Eukaryotic initiation factor 4A-I|organism=Schmidtea mediterranea sexual|type=transcript|length=1324bp
ATTAATAACAATGGAAAATCCAGGAGAAATAGAAAGTAATTACGACAAAATAGTTGAATCATTTGAAGATTTAAACTTAA
AAGAAGATTTGTTAAGAGGAATCTTTGCTTATGGTTTTGAAAAACCTTCTGCTATTCAGAAGCGTGCTATTTTGCCAGCT
ATTGAAGGTCACGATGTCATTGCCCAAGCACAATCTGGAACCGGAAAAACTGCCACTTTCAGTATTGCTGTTTTGCAGAA
TATTGACACTTCTATCAATTCTACACAAGCTATTATTCTAGCACCTACCAGAGAACTTGCAGTTCAAATCCACAAAGTTA
TAATGACCCTTGGTGACTATATGGGAGCTAAATGTTGCTCATGCATTGGTGGAAGAAATGTCCGTGACGACATTAACAAT
TTGGAAAGTGGAATGCATGTTGTTGTCGGTACTCCAGGACGAGTTAAAGATATGATAAAGAAGGGCCATATTAAATCAGA
TTTCGTGAAAATGTTTGTCCTTGATGAAGCCGATGAAATGTTGAGTCGAGGTTTTCAAAATGACGTTTGTGAATGCGTTC
AATATTTATCTGCCGAAACCCAAAATTTCATTCTTTCTGCAACAATGCCAGATGAAGTTTTAAAAGTCAGTAACGAATTC
ATGAATAATCCAGTGAAAATTCTCGTTAAAAAAGAGGAATTGACTCTGGAAGGTATTCGTCAATTCTACGTTAACGTTAG
CCAAGAAGAATACAAATTTGATACCTTATGTGATTTATATGAATCTCTGACCATCACCCAAGCTGTCATTTTCTGTAACT
TCAAAAACAAAGTTATATTTTTAAATGATAACTTGAAAAGTAAAGGATTTGTTGTTTCATCAGTCCACGGTGACATGGAG
CAACAAGCTAGAGACCAGATTATGAAAGAGTTCCGAAGTGGATCAAGTAGAATTCTCATCACCACAGATTTGCTATGCCG
AGGTATTGACGTCCAACAAGTCTCAATGGTCATTAATTATGATTTGCCTAAAAACAAAGAAAATTATATTCATCGAATTG
GCAGAGGAGGCCGATTCGGAAGGAAAGGAGTTGCACTAAATTTTGTCACAGACAAAGATATTGCTGAAATGCAGGAGCTG
GAAAATTTTTATAACACCAAGATTGAAGAGATGCCCATTAATTTATCTGAATTCTTATAAATGATTTACCGCTATTTTTG
TAAATAAATTTTAATTTACAATTAAATTAGGTTATTCATAACTTCCTTTGTTACGTAATTTTTGCTATCTTATCTATTTT
TGTTAGTAATGTATTTATGCTGCGTCACATTTTTGTTGCAAATT
>SMED30025427 ID=SMED30025427|Name=Translationally-controlled tumor protein homolog|organism=Schmidtea mediterranea sexual|type=transcript|length=570bp
AAGTAATACTTTTATCATTTAATTGAAAAAATGCTCATTTACAAGGATATTGTTGCCGGCGATGAGTTGTGCTCTGATAC
ATTCCCAATGACGATTGTCGACGATGTCGTTTACGAATTCAACGGAAGAAATATTACTATTAAAAACGGTATTTCTGACG
CCCTCTTTGGTGGAAATGCTTCAGAGGAAGCTGCTGGCGATGATGACGTTGCTGATTCGGACGAGACAGCAATTGACATT
GTATACAGCAACCGATTAGTCGAAATGAGCTTTGACAAGAAAGGTTACACGAGTTACATCAAAGGTTACATGAAAAGTAT
TTTGGAAAGATTGAATGCCACTAATAAAGAACGAGCTGAAATCTTCAAATCCAAAGTCGGTGCCTATGTTACAAAAATCA
TCAAAAATTTTGATGAATATCGTTTCTACTGTGGAGAGTCAATGAACCCTGACGGAATGATCATTCCATGCAATTACAGA
GAAGACCAAATTACCCCATACTTTGTTCTCTTCAAAGATGGCCTCGAAGAAGAAAAATGCTAGATTTCTGTTAAATAAAT
TTAGTGGAAC
>SMED30006887 ID=SMED30006887|Name=Gelsolin|organism=Schmidtea mediterranea sexual|type=transcript|length=1378bp
CGATGAGTGGTAAAATGTATGTCATTGTCTCATTGGCGTTAGACCAATCAAAATCATCACGAATTATTTGCTCTCGATAC
AATTCGATTAGAATATAATTGTCATCGTTTGACCTTCGATATCATTTCCATAAATCAAATTTTGTGAGAACATAATGAAG
AGATCAGCGAAATATGATTGGAAAGATTCAAATGTTGAATTGATTGGTTCCAGCGAAGATCGAGCTGTAAAAAAATCGTC
TGCTGAAACTGAAAAAGCATGGGCTGCTGCAAAGGCTTGCAATCATGCTGCATTATTTGTTTGGAGAATTGAAAAATTCA
AAGTTGTTGAATGGCCAAAAGTGCAATATGGAGAGTTTTACGAAGGTGATTCATATATAGTGCTGAAGATATTTGAAAAA
GAAAAACAACTGAATTATGATGTTCATTTCTGGATTGGGAAATATTCAACACAAGATGAATATGGAACGGCTGCGTATAA
AACGGTTGAATTGGATACGCTGCTCGATGACAAGCCGGTCCAACACCGTGAAGTCCAACATTACGAATCGAATTTGTTTA
AAAGTTATTTCCAAAATATTGTATATCTGAAAGGTGGACATGAAAGCGGGTTTAGACACGTTAATACTAGAGAATATATA
CCAAGACTGCTACATTTTAAAGGTGATAAAAGAAATATAATTATTACTGAGATATCGGCGACGAAAAAAAATCTAAAATC
TGACGACGTTTTTATTTATGATACTGGATCCAGTATTTTCCAGTGGATAGGCAAAGGTGCAAATAAAGATGAAAAATACA
AAGCACAACAATTTGCTCAGCAATTGAATGCCGATCGAAATGGAAAGTTAAATATTGAAGTACTTGATGAAGAAGAAACT
CCATCAAATCATGAATTATTCAAACATTTATCGGATTCTGATCCCGAGGAGGAGGACCAGCATCTAAAAGTTTTAAACTT
ACAAGAAACCAAACTTTTCAAAATATCTGATGCAACTGGCTCGTTAAAATTTGAAAAGGTTGCAGCCGGAAAATTGAATA
AATCTCAAATAAATGAAGAGGATGTTTTTATTGTTGACAACGGTCAAATTGTTTATGTCTATGTTGGAGAAGGATCGAGT
CCCAATGAAAGAAAGAATGCCTTGATATATGCTCATAATTATTTGAAGGAAACGGATTATCCTCAAGCACCGGTTACGGT
TATAAATAAGGATGTCAAAGGCGCCAATGCCGAGAATTTTAACAAATTAGTTGAAAATTAATCGGAAATTAAATAGCTGG
AATTTGTGTTAACTTTTTCTTTGGTAATTATGATTAAATATATTTGCGTTTATATTTCTGATTTATGGATTTTAATATTT
AATAAACACAATATTTTG
>SMED30035179 ID=SMED30035179|Name=Spondin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=889bp
AGAAAGGAACATGACCATTTTGAGACTTTTTTTCTTATTTATATTACTTATTAATTTATTCAGTAGTCGCAAATGTGCAA
ATTGTGAAAATCGATTCAAATCCGATAAATATTCAATTCAAAACGGTAACGGAGGATTCTATTTGTATTTCACTGACGAG
CATGGCAACCAAGTTGAAAGATTTCAGCCTGGAAAAATTCACCGAATCCTCGTCAAAAACGACATGATCGGAGTCAAGTT
TCACACATTTCAGTTGAAAGTCTTCCCGACTGAAAAGGTTAAAAGAAACGAATCGTTGGGAACTTTCAAATATCCCAAAT
TCATTACCGAGGATCCTCAATGTCCGGGAGTTTTCTCAAATAACAATAAACATCTCGTGTCCAAGGTCCATATCAACTGG
ATTGCGCCTCAATATCCGGAACAGTGCATCAATTTACAAGCAACCGTTGCCATGGACTCGAATCTTGTTTATCAGAATTC
TCACAACTTGCAAAAAACTGTTTGCTCCAATGAAATGTTTACTTTTATAAATGACAAGCCTATTGTAAACAATGGAATGA
AGACGGCTTACAAACAATGTTGCGCCTGTGGAACTGCAAGTTATCGGGTGACTTTTCATGGGTTATGGAACAAAACCACT
CATCCGCAAAACTGGCCCCAAGAAAAGAATCAGCTTCATTGGAGTGGCCCAGTTGGTCACCCACAATCATAATTACTTTA
TTTATCATTTGGGAAGTCAAGCATCCTATCCATTTAGCAGTGTCTGCACTACCGGAGGATCCACTGCGTTAAAGGAAGAA
TTCATATTACCTGAAAATAGATTAAATGTTAAGAGTCTCTTTACGTCAGGCTGGTTAAATGGGGAAGAACAGCTAAATGA
AGAGCGTTC
>SMED30013909 ID=SMED30013909|Name=tud-1|organism=Schmidtea mediterranea sexual|type=transcript|length=2414bp
ATTTAGAAAATGGAGGCAACTTGCGATGTTTTTTTAACGAATTTACCTAAGTCGATTAATGAAGTAGTTGTGAAGAACTT
ATTTTCTTCTGCTGGGAAAGTGTTAAAAGTGAAAATAATAGATGACAAAAGAAACGAAAATCAGAAGCTATGCTTCGTTG
GATTTCGAACTATGGATGAAGCATTAGAAGCCGTCAGAATTGCAGATAAATCTGATGCGTTTGGTGATCCAATTAGAGCC
AGTATATCAAAGAAGTGTTTAGACGGAATGGAGAATAATCAAAATAGATCAAATAATAACAGAAATGATTCAAGTTATAA
AGGAACTGATTCATTTTCAAGAAAGAGTGATTCTAATTTCAAGGATAGTGAAAAGTATCCAACAAACAATGGTGACTTTG
CACAAGTAAATCGTTTAAACAACGTTGGAAGAGGAAGAGGAATCCAGACTAAAATTATTAGTGGTCCACCTTCATTCAAA
ACTAATGAAATTAAGTTAAACGATATTAAACTTAAAACAAAAGAACTGATTGACATCGAAATCGTCGATTTAAGTAGAGT
TGACATTATACTTATAAGGCCAGTAAAGTCAACGGAAAATTCAAAAATTGAAATAGCAGATTTATTGTCACAAATAAATT
CAAATAAATCGAATCTAATGCCAGTTGACTGTCCTAAAATAGGAGATTTTTGTCTTGCAAAATGGACTGAAGATGATTGC
TATTATCGGGCTGAATTGTTAGATATATTAAAGGATGGATCTTTCAAAGTTACTTTTGTTGATGAAGGAACTTCGGGTGA
TATTGTGACTGATTTGAAACACATTCCGACTGGTGCTTTACAGCAGTATCCTAAACAATTTTTGAAGGTTTCAATCGGTT
GCTCAGACGCAAAAGAATTAATGTCATTTATTTTACAAGAGTCTGAAGGAAAGGTGATTAAAATTTATTGGCTCGGAGAA
TATTGTGATTCCGTGCCTGTTGTAAATTTATTTCTGAATGAAGATGAAATTGTGGAAAAATATACCCAAATAAATAAAGT
AAATATCAGGAAAAAATTCTCACAGACATTTGATGATCTCCCAGTACATAACCTCGAAACTAATTCACATTTTTCAATAG
CACCATCAATGTATAAAAACCGAAATGATTTTATTCTTCAGATGAAAACTTTCTCGGTATCTTTAAAGCAAAAAAAATGT
CCTACGGTTTTACCAATTCCTGGTGATATATGTATATATGAGAAAAGGAATGCTAATGGCGAATCATTTCTTCGTTGTGT
TATATTAAGGCGCCAACTTTTTTCTTTTGACATCGAGTTAATAGATATCGGTGAAAAAATAATGAATGTTAATATTGATC
ACCTGTACACAGTCGAAGATATTCATGTAAAAGACGCTCCCTGTGCTATTACTTGCGATTTAGATAGTTCTATTAATATA
GATGGTATTAAGCTCCCTCAAGATTTGATCGATGGTGTTCTCTTTAATCTTAAAAAGTACAACAAAAATAATAAATACAC
TGTAAATTTCATTTTACCACAAAAGAAAGCTTATGAATATGCAAAAGTATCATATAAAGATTTGATTGGTAAAAGCTTTA
AAGTAATAATGTCGCACGTTGTCTCTCCCATTAATTTCTTTATTCAACTTGATGATGGAGAGCATCAGCTTGCACTTGGA
GATATTCAAGAAAAATTAAATATTAATTATAATGGATCACCATTCAAAAGTGCTAGCGATGTTAAAGAAACTCAGGCAGT
TATTGCTCCTTTTATTGTTTCCGGAAGTGATGCGGAACTTTTTCGGGCTTATGTTTTAGAGAAACGAAAGGAATCTCCAC
AAATTCATGTATTGTTTATTGATTATGGTAATGATGAATGGGTGAATTATGAAACTTTACTGAATACAAATGAAGAATTA
GTTTCTAAACCAGGTTTCGCAATACATTGTAAATTATCTCTAAATATTAAGAAGGAAGCGTGGAGTCACGCTATTGAATT
ATTTAATGATTTAGCTGGTTATACTGAAAATGACCAGGGGACGTTTGTAATGCAGGTTATTAGTGTCGATGGTGATTCGT
TAGTTGTGGACTTGATTTCAGAACTGAAAGGTTCGTTGACGGCCATCTTAGAAAAAAGTGGTACATGTGTAAAGTCCAAT
GAACCAATATGTAATGGAGGAGGACCCCAAGTTAAATTAAATGGCGTTTCAAATGATAAATCTCAATCAGCTATTCTTGA
AAATTTATCTGAAGGAGAATTATATAAAAAATTTATTGAACTAGAACGGAGATTAAGTGCTTTAGAGATATTGATGAAAT
AATGCTACCCGCGCAATTAGTATTATCAAATTATGATAATCTAGTCTTGATGTGTTTAAAATTTTGTATTTTAACATAAA
TTTATTCCGTGTTG
>SMED30001027 ID=SMED30001027|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=1243bp
TAATAATTTGCACATCAAACCGTAATAATAACGGATCCGTACAATTTCATCAATATAAAATATTACACAACAAATGCGAC
TTGCATCGACAATTCATATAAAAATCTCCAACTTTCACTACTATTCATAAATTACAAATGATCTCCTCAGTTGTATTGTT
ATTTTCTATCTCAGTCGCATTCCTAGCAAATGCCGAAATCTGGGAACCAGATCGAAACCTTTCAAACGTCCATCAGAGTC
ACGCTAATACAAAGTTTTCCAGGAAAATTTCATCTTTGATGGTGGATTTCAAGTCAGAATTCGCCAAATTTAAATTACAA
TATGGAAAGGTTTACGAGTCAATTGAGAAAGAAAACGAAAGATTCAACAATTTCATATTATCTCAAGTTGAAATAAACAA
TCACAATCAAATGTTTGAAAAGGGTCACAAGAAATTCCAAATGGAAATTAATCACATGAGTGATTGGACTCCAGAAGAAT
TCAATCAACTTAATAGCCTAAAGATATCTAATCTCACCGGTTCGACATATTTGCCATTGAACATAAAGCCTGGCCTTCCA
GAGTCTTTTGATTGGAGAGACAAAGGTGCAGTTACTGAAGTCAAAAATCAGAAATATTGCGGTTCGTGCTACGCATTCTC
TACGACAGGCGCGTTAGAAGGTCAACTATTCAGAAAAACCGGAAATTTGATAAGTTTATCTGAACAACAAATTGTTGATT
GTGATCATGTTGATTATGGTTGTAGTGGTGGCTTAGTACCAGACGCTTTCAATTACATCAAATACTCCGGAGGAATTGAA
TCCGAACAAGAGTATCCATATGTATCTGGATTGACAAAGAAACCAAATCCAAATTGTAATTTCAAAGAAAAAAAAGCAGT
TGGAACAGATACCGGATTTGTGAAATTGCCTCCTGGAGATGAAGAGGCTTTGAGAGAAGCTTTAGTGACAATAGGCCCGA
TTTCGATAGCGTTTTCCGCCACTGAGCGATTCAAACATTACAAAAATGGAATTTACCATGATGATTGGTGTTCAAATGTC
CGTATCAATCATGCAGTTTTACTCGTCGGATATGGAATGGATGAAGAATCAGGAACGCCTTATTGGATAATAAAAAATAG
TTGGGGACCCAAATGGGGAGAAAACGGATATTTCCGTTTCGAAAGAAATAAAAACATGTGCAACATGGCATACAATTCAT
ACTATCCATTGGTTTGATTGAACGACTTCTTATGAGTGTGTGC
>SMED30035218 ID=SMED30035218|Name=Gelsolin|organism=Schmidtea mediterranea sexual|type=transcript|length=1573bp
TTATAACAGTCGCTTAATAAAATGATTAAAATCCTTAATTTTTAGTGAATTCAAATAACAAATTTTAAAATCTAATTAAT
AATTAAAATCTGTGACTTTGACAATCGATATGATAAAACAAAAAAAATACAACTGGAAAGACTCCAACTTATCTTTATTT
GGATCTGATACGGAAAAATTAGTCAAAAAAACTTCGTCGGAAACAGAAGCAGCATGGAAATTGGTAAAAACTGTAACTAC
ACCGAGTCTTTTTATTTGGAGAATTGAAAAATTTAAAGTTGTCAATTGGCCTAAAGAAGACTATGGGAAATTTTTCAATG
GAGATTCGTATATCATTTTAAAAATAAAAAAGGAAGAAAATAGTCCTGAATTATTTTATGATATTCATTTTTGGATTGGA
AAAAGAAGTACACAAGACGAGTATGGCACAGCTGCGTACAAAACAGTAGAACTAGATACATTTCTTGATGATAAAGCAAT
ACAGCATCGTGAAGTTCACGGTTTTGAATCTGATTTATTTAAGTCCTATTTTCCGGTTATTACAATAATGAAAGGCGGAT
GTGAAAGTGGTTTCAGACAAGTAACTCCAGAAAAATATGAACCAAGACTTTTACATTTTCACTGTGCTGATCAAAAACAT
GTTGAACTTGTAGAAGTGAAATTTTCAAAAAACTCTTTGGATTCAGGCGATGTATTTATTTTAGACAACGGACTAGAGGC
TTTTCAGTGGAATGGAAAACTATCAAATAAAAATGAGAAAGTTAAAGCAGCACAATTTTTACAGCAATTAGAATCAGAAC
GAAACGGTCGGTGCAAAACAGATGTATTAGACGAAGAAGATACTCCTTTGACGCATAAAATTTACAAATTACTACCTGAT
ACAGCTGTTACTAAGAAGGTTCACAAAGACTTGGCAATTTCCAAACGTCTGTATAGATTATCTGATGAGACAGGCAAAAT
AACGTTTTCTCTAATCTCAGAGGGCAAAACTCCAAAATCTATGCTGAAAGACAATGATGTGTTTATGATAGATAATGGGC
GACACATGTTTGTATATATTGGCGCCGGTGCGTCTCCGGATGAAAAGAAAAATGCAATGTCATATGCACATAATTACTTG
AAAGAAACTGACCATCCATTAATTGGAATTACTTGTCTCCAAGCTGGCCAGCATAGCAAAGAATTTGAGCTTCAATTGGA
CTAGAAAATGATTATGAAATTTTAAATTGCATGGCATTTCAATATTTTTAAATATTTGTGTTTTTACTTAATTTTTACAA
AATGCATGAGTTTATGGTAATTCATTTTCTTAGAAGAGTGAAGAAATATTTTTTTGTTTATGTATTTCATAAATTGCTTA
AATATAATTAAACCTAATGTATATATTGCTGTATTATTTGCTGTTACGAATATTATTGGGCTTGATAGAGCTATCAGAAC
TAACTCGCCATGCTCTTGATCATAACAAGAAATCTACGCAATCAATATATTTGTACCAAAAATCATAACCATTACAATTT
TCACCAACACAAATCAATCTAGTTTTTATTTGTTGCCAGAATCAAATTTTGGG
>SMED30022124 ID=SMED30022124|Name=Gelsolin|organism=Schmidtea mediterranea sexual|type=transcript|length=998bp
TGTACATTAGGATGAATATGGAACAGCAGCGTATAAAACCGTTGAGTTGGACACTTTACTCGACGATAAAGCCATTCAGC
ATAGAGAGGTGCAAGGAAATGAAACTGATCTTTTCAAATCTTATTTCCCAATTATGACAATTATGAAAGGCGGTTGCGAA
AGCGGTTTCCATCATGTTACCCCAGACAAATATGAACCGAGACTTTTACATTTCCGATGCACCGATCACAAGCATGTTGA
ATTGGTGGAGGTGAAACTTTCAAAGCAGGCTTTGGATTCGGAAGATGTTTTAATCTTAGACAATGGCTTAGAGGTTTTCC
AATGGAACGGAAAATTATCCAATAAAAATGAGAAATTTAAAGCCGCACAATTTTTGCAACAGTTGAAATCCGAAAGAAGC
GGACGTGTTAAGACCGATGTTTTGGATGAGGAATTCACTGCTGCCAACCATAGAATATTTAAATTGTTGCCAGATGTTCC
ATTTACAAAGAAAACTCAAAACGATTTAAATATGAGTAAAATGCTTTATCGATTGTCTGATGAAAGTGGAAAAATGACTT
TCTCCTGCATTTCTGAAGGATCAATTCCAAGGTCAATGTTAAAGGATGACGATGTCTACATGATTGACAATGGCAGACAT
TTGTTCGTGTATATTGGAGCACGGGCATCGCAGGAGGAAAAGAAGAACGCGATGTCATATGCCCACAACTACCTGAAGAC
GACTGAGCACCCACTTATCGGAATCACATGCCTCCAATCTGGTCAACATAACAAGGAATATGATCTTCAATTAGAATAGG
ATGTTAAATGATAATTTTGGAATATGTAATAAAAATTAACAAAGCAATTTTTTAAAAACAATAATTTCACAAAATAGGAA
TGAAAATCACAAAAGTATTAAAATTCCATCTATGAATTGAATATCACAATTATAAATTCTTCAACACATAAATCTTGAGC
GAAGCAATAACTTAAAGATTTCAAACATTTACCGCCGC
>SMED30030421 ID=SMED30030421|Name=Macrophage-expressed gene 1 protein|organism=Schmidtea mediterranea sexual|type=transcript|length=802bp
ATTGCATGAAGATATTTCAAATTGTTATTTAATGTGCACCCCATGACGCAAATTATAATTGTATAAAATAATTATCTCAT
TCAAGAAGTTTCATTTCAGGAGCAATAATGACCATTTTATGGGTGTTTTTATTTGCATCAATTCATGGACGTTTTGTATA
TGGAATATTAAATACAAAGGAAGTCACGAATTTAAAACTTAATTACCAGAATTGTCAGTTAGATACGACCCAAAAGACGT
TTGATGTGCTACCAGGAACAGGATGGGATAACTTGGCCAACATTGATATGGGAAGAGTTTTGGACCTTAACTTCTCCTTA
TGCTTATTCTCCAATGATAATAAATATCTGATTCCCAATGAATTGGCTCTATATCCGGAAAAAACTTCAAGAGTAGAAAT
TTCTAGTGAAATCTTTAGTCATTTTGTGAATTATACATCTTCAACGTCAAAATCCATCAACTTGGCCGTAGAAGGAAGTG
TTGAGGATTTGAAATTAGGTGGAGCGTTTTCATTTGAAAATACACAAATAAAGAATGATCAAGGTTGATCAACGTTTGAG
TGACAACCTCTCAATGTATTTACCCAATTCTTCGCAGTTGATAACAAGTGGGCCACCCTCTGACCGGGAGACTACAACAG
CTCGTGAAGTTCACTGCTAGTTTTCATTTGACAAAAAGAAATTTTATTCCGCTTCGATATTTAATAATTGAAATCATGAT
ATTTTCCATTTTTCAACGCTCTGGCGCTATTTCAATCAAGCAAAATGACATATTGGACACAAAATCCATTTTCACCAGAG
TT
>SMED30032088 ID=SMED30032088|Name=Spondin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1776bp
TTACCTGAAAATAGATTAAATGTTAAGAGTCTCTTTACGTCAGGCTGGTTAAATGGGGAAGAACAGCTAAATGAAGAGCG
TTCTGGATTCGTTTCTGTTAATAGAACTCATAATTTATTTAGTATGATTTCAATGATGGGACCAAGTCCGGATTGGTGTA
CCGGAGTGTCAGGAATCGATCTTTGTATGGACGGATGCAAATGGAAATCAAATCTAACAATTCCTCTTTATCCTATCGAC
GCTGGAATACAAACTGGAGAGACCTACAAACCAAATAATGTCACAAGACTTGATGAACCCGACACTATTAGAGAAATTAA
TAAAATTTGGATGAAAAGTAATCCTTTTACTCCAGATACTCCAGTAGCAGAAATCACCCTCACCAGAGTAGAGCCACAGA
AAGACACACAATGTGTTAAAACTCCAGTTAAGGGTGTAAATGAATTTCAAAATGCACAAAAAGAGTCTAGATCTAACACG
CTCGGTAGAAATGGTGCCGTGGAAAAATATAATGTTCTAGATGATCCTCAGTTAGCTCAAATGGCAAAAGCCTTTTGTGG
ATTTTCCGAATGGACCAGCTGGTCACCATGTTCCGTAAAATGTGGAGAAGGTGAAACGTCTCGTACTAGAAATTTGATAA
AAAACTTGAAAAATGAATTGTGTATTCAATTGCCAAGAAAGGAGCAAAAAAATTGTGCCGGTGCTCGATTGGAATGTGAT
CTCTCAAAGAAATGTAGTCTATTACCTTGGAGCTCATGGAGTCCGTGTTCTGCATCTTGTACAACTGAAGGGAAAATGAT
CAGAATTAGAAAATTTGCGAGGTCAAAAGAAAAGGACGAATGCATGAAAAACGTCAAACCAGAAATTATTCTTCAACAAG
TGAAAACTTGTAAATTGGATAAAACGGACTTCCGATGTGATCCGATATCAATTTGCAGCGCCGGTAAATTGGCACCTTGC
ATCAATGGTAAACCCAAGACGAGATTTTTCTACCACATCAAAACTGGAAAATGCGAACCGTTTAAATACTATGATTGCAA
AAAAGGAAATCTGAACAATTTCCCAACTATAGATTCATGTGAAAATGTTTGCTCTAAAGTTATTCAGGAATTACCAAAAA
TAAGACGATCTAATTTAGCCTTGCTTCAAGCAAGAACATCTTATTCAGCTGAAGAGAGTCTTTCGCAAAAAGCCAAAAAC
ATTCCGGAATTCTGCTTTCATGAAGTGGATTCCAGTAAGACCTGCATGAAATCCAAACCAAAGACAATCTGGTATTATAG
TCATCGAAATCGAAAATGCCAATCACTGGTGGATTATGATTGTAAAGGAACTTTAAATAAGTTTTCGACTTTCGACGATT
GCATGAAAACCTGCCGACCTGATTCACAACTCGAATCATTGAAACTTGATAAAGTAGATTGTCAGGTCTCTGAATGGAGT
TTATGGAGGCCATGTTCAAAGTCATGCGGTTGGGGAACTCAATACAAGAAAAGAGTCATTCAAAAGGATTCATTGAATGG
GGGCTTACCATGTCCGGTGCTATATGAATCTCGAAAATGCTTTTCCAAACCTTGTTAATCTGTCAATATTTATTTAAAAA
TTGTTTTTTGTGAATTATAATTTCTATTTCTTAATCTATTTGAAAATGTAATAAATATTACTTTGCGTATTTGATTTAGT
TTAAAGTTTTCTCATTGGTCAATCCGCCGTTGCTAACCAATGAGATCGGCTACTACATCAATTGCGATAATTGACAGTGG
TGAGCAAACCTTTAAG
>SMED30022389 ID=SMED30022389|Name=Proliferating cell nuclear antigen|organism=Schmidtea mediterranea sexual|type=transcript|length=915bp
GTTATTAACGTTATTGGACTATAGTTTTATTATCATAAATTTTTGAATAAAATTGAGATCTTCTTTTAATAATGCTATTT
GAAGCAAAATTAAATAAAGTAGATGCATTTAAAAAGCTGATTGATTCGGTTAAAGAATTAATCCAAGAAGCAGTTTTTGA
ATGTTCATCCAAAGGTATTGAATTACAAGCAATGGATAGTTCACATGTTAGTCTAATATTTCTTTTAATTAAAAAGCAAT
CTTTTTCGTCTTATAAATTTACGAGAAATGTATCTTTGGGTGTAAGTCTTGTAAGTCTATGTAAAATACTCAAACTTTCT
CAAATTAATGATTCAATTACAATTAAAGTTGATAATGAATGTGAAACAGTCGAATTTGTTTTCGAATCATCAGATAGTGA
TCGAATGTCTGAATTCAGTTTGAAGTTAATTGACTTGGATATTGACTGTTTAGCTATTCCGGAATCAGACTATGATTGCG
TAGCAACAATCCCGTCTGTAGAATTTAACAAAATATGCCAGCAATTAGCTGTTATTGGAAGCACTGTAACAATTGTAGTA
ACTAAACAGTCAATTCAATTTTCTTGCTCCGGAGACATGGGGAAAGGGAAAATATTATTAAATCAAACTGTAAATAAACC
GAGAATAGAAGATTCTATTAATATTGAAGTTGTTAATCCATTATCAATGGTTTACTCGCTTCGATTTTTTCATATATTCT
CGAAGGCCTATTCGCTTAGCAACAGAGTTTCTTTATCTTTTGCTAATAATTTCCCAGCTTTGGTGGAGTACAGCATGAAT
GAATTGGAAGGTCATCTACGATTTTACTTAGCTCCAAAATTAGATGATGATTGATTTTGCTCTTTTTCTAGTTTTGGGGT
GATATTTTAATTGTAGTGCTTTTTTAGTATGGTTA
>SMED30012543 ID=SMED30012543|Name=Spondin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=2035bp
CTCCAATGAAATGTTTACTTTTATAAATGACAAGCCTATTGTAAACAATGGAATGAAGACGGCTTACAAACAATGTTGCG
CCTGTGGAACTGCAAGTTATCGGGTGACTTTTCATGGGTTATGGAACAAAACAACTCATCCAAAAGAATGGCCAGAAGAA
AAAGGTCAGCTTCATTGGACAGATCCTATTGGAGTCACCCATAATCATAATTACTTTATTTATCATTTGGGAGGACAAGC
TTCATTTGCGGTTGGTAGTGTATGTACAACAGGAAATTCGAGATCTTTGAAAGAGGAATTCACCTTACCTGAAAATAGAT
TAAATGTTAAGAGTCTCTTTACGTCAGGCTGGTTAAATGGGGAAGAACAGCTAAATGAAGAGCGTTCAGGATTCATTTCT
GTTAATAGAACTCATAATTTATTTAGTATGATTTCAATGATGGGACCAAGTCCGGATTGGTGTACCGGAGTGTCAGGAAT
CGATCTTTGTATGGAAGGATGCAAATGGAAATCAAATCTCACTATACCTTTGTTTCCGTTTGATGCTGGAATACAGACTG
GGGAAACCTATAAACCTGAATCTATTACTCGGCTTGATGAACCGGAGCCTATTAAAGAAATCAGTAAAATTTGGATGAAA
AGTAGTCCGTTTACACCGAATGTTCCTGTTGCTGAATTAATTCTGACAAGAATCTCTCCAAAGACCGACGAAAAATGTTC
TAAATCCCCTATGAAAAATGTTGATGAATTTAATAAGTCAAATGAATTAATAAAACAAAATTATCGCGGTAAAAATAAAG
GAATAGCAAAATATAATGTTCTTGATGACCCCCAGCTGGCTCAGATGGCAAAAGCTTTTTGTGGATTTTCTCAATGGGCT
AGCTGGTCTCGGTGTTCAGTGGATTGTGGAGTTGGGGAATCTTCTCGTAAGCGAGAGTTGATCAAGAATTTTAAAAATGA
ATTATGTGTCCAGCTGCCAAGGAAAGAAACCAGATATTGCTATGGTCGACGAAGAAATTGTGATTTTTCTATGAAATGTA
GTCTTCTTCCGTGGACTGAATGGACTAAATGTACTGCTACTTGTAAAGAAGCAGGAAAGATAGCAAGATCGAGAAGATTC
GTGAGGGAGGCGGAACGAGAAGAATGTTTGAGAGAAGTGACACCAACTACTAGACTATATGAGGAAAAGCCATGTAAACT
CGATCAAACTGACAGCCGCTGTGATCCAGTGTCAATTTGCAGTGCTGGAAAATTGCCTCCTTGTACTAGAGGTAAACGTC
AAACAAGATATTTCTATCACGTCAAGACTGGAAAATGTGAACCGTTTTTTTATTTTAATTTTTGCCAGATTGGCCTAAAC
AACTTTCGCACTGAGGTAGACTGTGAGAAAATGTGCGTTAAAGCCATTGGTCAGCTGCCTGGAATTAAAAGATCAAATTT
AGCTCTTTTGCAGTTTCGAACTTCTTATTCAGGAGACCTTTCTCAAAAAGAAACTAAAATACCAGCTCAATGTTTCAACG
AAATAGAATCAGTAAAGACATGTATTCATAAATCTCCAAGAACCGTATGGTACTACAGTCACCGAAACCAGAAATGTCGT
TCTTTGGTGGATTTCGGTTGTCAGGGAAGTTTGAATAAGTTTTCTTCTTTTGAACAATGCATGAAGATTTGTCGACCTAA
TTTACAGAGTCGTTCTTCAACATCTGATAAAGTAGACTGCCAGGTCTCTAATTGGAGTTCCTGGAGGCCTTGCTCTAAAA
GCTGTGGCAAAGGAACACAGATCAGAAAGCGAATAATTTATAAAGATTCTCTTAATGGTGGAGAACCTTGTCCACTTCTT
TACGATTCTAGAGATTGTTACGGTATATCTTGCAATTAGAGATAGCCATAACTATTTTAGTTTATAAAAGCATTCATCCA
GGCCACAGTTGAAAAGCATTTTAATTATTAATAAATTTTAGAATTGTTAATTTTAGTATTTTAGTATATTTTTGCTGTAT
TTAGTGCAAAAAAAAAAGACGGGTATAAAAAGGTG
>SMED30028321 ID=SMED30028321|Name=Synaptotagmin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1303bp
TTTAATTGTGAGTGTATAATTAATTCATTAATAAATGTGCAAAATATGTTCAGACAAGTATAAAGATATATTCATTATTA
ACCATTCAACCATAACAATAGATTCTGTAAGGCCTCTAAATTCTCTGATTGTCATGTATAACAATGTAACAATTCGAAAT
GTAAACCAAACATCAGTTCTTGGAACTTATTTCAATAACCTATTAAAGTTATGGAACATAAGTCCATTACAAGGAATGTT
CATATCCGTCGGACTTTTGCTTGCTGTCGTTCTGACAGTGGCTATCATTATATATTGTGTTAGAAAATCAGTCGAGGGTG
AAGATACCAAAAGGAGTCGACTTTCAAATCTTAAGAAACATCTTCCAGTGAACAGTTCGTCATCAGAGATTGATACTCCA
CATGGGTATATTGAAGCATCAGTCAAGTATAAAAAAAAGCAGAAAGAGATTGAAATTCAAGACATTCAAATTTACAAATT
AGAATTTAACTCAATGAAAAAGCCGGATTGTTATTTAGTAATGTTTGTAAGGCATGGGAAATCTCAGTTGTATCCTTCCC
AAAGAACGAAAACTGCTTTGAATGATTTGTATCCAAATTTCAATGAACACTTTAAGTTTAAAATAAGAAATATGAACAAC
AATATTCTCCAATTTGAACTTTACGACGAAAATCTATCGGGAAATGACATTCTCATTCGTCAGGGAGAAATGATGTTGAA
AGATATCAGCGAAAAGAAATTCCAGGATTATTTTCAGAATTTTGTAATCCACTTGGACAAGCCTTCAGAATTAAAAGGTC
TCGGTGATGTCGCTGTGATTCTGACTGGAAATCCACCAATTTTGAGAATAACAATTCTTGAAGCAAAAGGATTGGCACAA
AAAGAAAATCTTAACTCCAATTCTTTGTACAGTTTTCACGCAGAAGTTAAAGTTTTCGTCAATAAACATTTAGTAAAACA
TTTCAAAACGAAAAAAATTCGTCATATTTCCAATCCGTATTTCCAGGAAACATTTTCATTAAAAGTTTTGTCAAAAATGT
GGGATAAAATTTTAATAAAAATTGAATTATTCCGATCGGGATTTCGTAGAATCGGAAAGGCTTATATCGGTTACAAAGAG
TCCAATTCGAAAGTTAATTATTTGGGGAACTTGCATTGGGAGAATACTTGCAATGACCGTAAAATGTCGAAAGCGATTTG
GCATACGTTGGTCAAATAGGTTGCATATTTCCCTTTGCGGTCTGATTCTTGATGACCCTCACTCTATTCTGACTATAATC
AAAATCTTGTTCAATCTTATTAT
>SMED30022078 ID=SMED30022078|Name=Translationally-controlled tumor protein homolog|organism=Schmidtea mediterranea sexual|type=transcript|length=629bp
GTCAAATATCTTAAATTTGTTTGTTTAAATACTTGTTTACACTAAACACTTTTATTTTGAAAGTTTATTCCACGATGTTA
ATTTACAAAGACATAATTTCGGATGATGAAATAAGCAGTGATTCATATCCAATGAAACTGATTGATGATATTGTGTACGA
ATTTAATGGAAAGAATATTACCATTAAAAATGGCATACCCGATGAAGCAATCGGTGGAAATAAATCTGCTGAAGGTGGAG
ATGATGATTATTCTGAATCATGTGAAACTCAAATAGACATAGTCTATGCTAATCGACTAGTAGAAATGAGTTATTCGAAA
AAAGAGTACACTACTTATATTAAGGATTACATGAAAAGAATACTCGATATTCTTAAAACTAAGAATCCTGCTCGAGTTGA
TGTATTTAAAACGAATGCTCAAAAATATATTACGGAAATTCTTAAAAATTTTAAAGAATACAAATTCTACACGGGTGAAT
CAATGAATCCTGATGCCATGGTAATTTTATGCAATTATCGGGAGGATCAAATTACTCCTTATTTCATCGTCTTTAAAGAT
GGTGTTGTGGAAGAAAAATGCTAGGCCAAATTGCCAATGGAATGTTATATTAATAAAGAATTGATTGAC
>SMED30001973 ID=SMED30001973|Name=Eukaryotic initiation factor 4A-I|organism=Schmidtea mediterranea sexual|type=transcript|length=361bp
ATCGAAACTAATTATGATAAAATTGTGGAGTCTTTTGAAGATCTAAATTTAAAAGAAGATTTGTTGAGAGGAATATTTGC
TTATGGTTTTGAAAAACCATCGGCAATTCAAAAAAGAGCCATTCTCCCAGCAATCGAAGGCCACGATGTCATTGCGCAAG
CACAATCCGGAACTGGTAAAACTGCCACTTTCAGCATCTCAGTTTTGCAAAACATTGACACTTCCATCAACAAAACTCAA
GCTATCATCTTAGCTCCAACTCGTGAATTGGCCCAACAAATTCATAAAGTCATCATGACAATCGGTGATTATTTGTCAGC
AAAATGTTGTGCATGCATCGGCGGAAGAAATGTAAGAGATG
>SMED30014940 ID=SMED30014940|Name=Gelsolin|organism=Schmidtea mediterranea sexual|type=transcript|length=530bp
CAAATAAATTTTCGTTTCGTAATTATTTAAATTTCACATGTTTTTTATTTAACTATAAATTCTGGAAAATAAATTAATTT
TACATTCAATTAATTCAAACAATGAAATTAGATTTTAAAAGTAAATCATTTCTAGAATTTTTTGTTTTTTAAACTTTCTA
AAAAGGAAACAACTACGGAGCAGTCGAAGAAGTTCTTGTCACCGGACACAGAAAGTCTGACAAAACCGGAATGATAAAAC
AAAAAAACTACGATTGGAAAGATTCCAATTTGGCTTTGTTTGGATCAGACACGGAAAAATTAGTAAAAAAAACTTCCGCT
GAAACCGAACCAGCATGGAGAGTTGCTAAGGCAACTACGGTTCCAGGTTTATTTGTTTGGAGAATAGAAAAATTCAAAGT
CATCAGTTTACCAAAGGAAGAATTCGGAAAATTTTACAATGGAGATTCTTACATTATTTTGAAAATCAATAAAGAAGAAG
ACAGTCCGGAGTTGCTATACGATGTGCATTTTTGGATTGGAAAATATTCT
>SMED30031287 ID=SMED30031287|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=505bp
TTGGGCATTTTCAACGACTGAATCATTGAAAGGTCAAAACCAAAGTAAAACTGATAATTTATTCAGTTTTTCTGAGGAAC
AATTGGCTGATTGTAGTCAGGCATACGGTAATTTTTGTTGTGAGGGTGGTCTGATGGACTTTGGTTTCCAATACGTTATG
ATTAATAGAATTGAAGCTGAGGATGATTATCCATATTCCGGCATCTTGAGTTTCATAGGATAATAATTGCCGATGTAATG
GATTCAAAGCAGTCTGGGAATGTATGGAATACAATGACATCGAATCAGGACATGAACAAGATCTTGTAATTGCCATAGCG
ACAGGTGCACCAGTAAAACTATAATTCTGCGCAACTGCAAGTGTACTTGACATATGTTTAGAGACGGAGTTTATGATGAA
CCCGGATGTGCATTGGATAACCTAGACTATGGAGTATTTGCAATACGGTATGGAAATGAGTATGGCAATGACTATTGGCT
TGTCAAGAATAGTTGGAGAACACGT
>SMED30011624 ID=SMED30011624|Name=Cysteine-rich secretory protein LCCL domain-containing 2|organism=Schmidtea mediterranea sexual|type=transcript|length=868bp
AAAATTGATAATTTAAATTAATTGAAGTAATTATATATTATAATTATAAAATATATGGGCCATTCGTAAAAAATGTCAAA
TGCAAAATGGAAGCGAAATTAAAATAATCTCAATTGATAAAATAAATGAAAGTAAACTGTTTTTTATGGAATATGATATT
TGCAATTTATTTTCGGAATGGAAATTTTTTACTTAATAAAAATGAAAGGAAACTTATTTTAAATCTCCATAACAATTATA
GAAATAACGTGAAGCCTCAGTCAAGCAACATGACAAAAATGACATGGAATCAAACCCTTTACAACTTAGCTTTAAATATT
AGCTGGAATTGTTCATTGGATTTTCCTGGTAAAAATAACAGTGAATTTAGTGAATATGGCATAAATATGTATTTTTCCAT
TATGTCTAAATCAACAGTAAAAGATATTCATAAAACCTTTGAGTCTTGGGTCAGCGAAGAGAAAAATTTTATGTATCCAT
TCAAATGCACTGGTAATTGTATGAATTATACTCAAATAGTATGGTCCAGTTCAACGCAACTTGGCTGCAATGATAATATG
TGTTTCATGAAAAACTCTAGTAAAATTAGAAAATGGAATATTTTTTTAACCTGTCTCTATTGGCCAAAAGGAAATATTTT
TGGAATGGTTCCATATGGATCTGGTAAACCTTGCTCAAAGTGTCCGAAGAAAATGGCATATTGTGTCTATAAGTTATGCT
CTAACTGTGCTGTTCCTCATAAATCCGTCGTTTTCAAAATATTAATAGTATTTTACCTGGAGCTTTATTTGGAATTATAA
TAACAAATTCATATTCTCGTGAACTTTACGAAAATAAATTTCTAATATTGTCTCAATATATTATTTTC
>SMED30015696 ID=SMED30015696|Name=Macrophage-expressed gene 1 protein|organism=Schmidtea mediterranea sexual|type=transcript|length=2665bp
AGTCGCGATAGCACGCAACGTCGACATTGCGATGACGTAATCATTGTGAATCTCTACTACAATCGGATCATTCTAATCAC
GTGCATCCTAAAACAATATAAATCTTACAAACGGGAATCCAATTGAACATTTATTTACTCAAGCGTGAAACCAATGATAC
CGTGTAGACTTAATAGTATAATATTGTTTATATTTGTTTATGGAGTTCTATCGGTTTCATGTGAAATTGAACCTAACCGA
GATCAACCATCTTCAAGACGAGTTCATGAGTGTAAACTCACCAGCAACCAATATCCAGTGAATGTTCTTCCCGGATCTGG
GTGGGATAATCTTGAAAACAAAGAACTCGGTCAAGTTTTAGAAATTTCATATAAAGGATGTTTTGGATCGAATGATGGAA
GCTTTCTCATTCCAGACAATGTGGTGATCACCCCAATAAAGAAATCTATTGTCGAGTTAACTTCAGATATATTTGACCAT
TTCTCAAATGTCACCTCTACAACGGCGATGTCTATCAACGCCGATGCCAGTTACTCAACACCAAGCTACAAAATCAGTGG
ATCATTTTCATTTGAAAAAATAAGAATAAAAAACGATCAAATCAAAGAAAAGTCGTCGATTTCGAGATCCCAGTTAAGAC
ATGAATTATATGAAGTAGCGTTCCAACCACACTCAAAACTAGACGCAAAATTCAGAAACAGAATTCTAGATATTGGAGCG
TTATTGAAAGAAGGAAAAGACACAATTTATCCACAATATTTAGCGGATTTAATTGTCCGTGACTTCGGCACTCACGTCAT
TCGGTCGGTGGATGCGGGAGCGACACTAATAAAGACTGATGTTTTAAAATCGAATTATGTCAAAGGTTTTAAAGGGGATA
CAACTAAGATTGCAGCTGCGGCATCATTCAGTATGACAACAATGCTTTCAGTCAACCTCAAAGGAACCTATGTTGGTGAT
ACCACGAGTCTCAATGAATTCAATAGTAATAGTGCAAGTACAAAAGTCGAAACTTTTGGTGGTATACCGTTTGGTTCGAA
TTTTAAGTTGGAAGATTGGGAGAAAACCCTTGAAACGAATTTGGTAGCAATTGATCGCAAAGGTGAACCGTTGTCCTATG
CTATCACACCAAAAAATCTTCCAGAATTCGATGAACAAGCAGTTTTCAAAATAGCTACGCTCATCAAAGAAGCAGTCAAT
AGATATTATGCAGCCAACACGAGAGTGGGATGTATGAATATGGAGTCAGAAAATTTCAATGACGACGCAAATGTTGACGG
TGGAAACTGCGAACCTCCTAATACATTTTACAGTTTTGGAGGAACTTTTCAAACCTGCTCAGGCCCTGATTATCAGTGTA
TGGATGTCGCGGCAAAAAACCCAGTGACCAATAGTTATGCTTGTCCTGATAACTATGATACCATTGAATTACAAAGTGGA
TTGAATAAATGCATAAATTATTGCACCAAATACTTATTTTCCACTCAATGTCATTACGAGTGTTCCCAATATGCATTGTA
TTGGTGTTCTTCTACAAACAAAACGAAAATATCAGAAGGCGCACTTTTCGGGGGATTCTACACTAATACATTTCCGAATC
CACTTACAAATTCCTATAGTTGTCCACAATACTATGTAGCGACAAGATTCGGCGTAAACGCCAAGGTTTGCACTGCACTC
AATAAGGCAGAGGCTATGGAACACCATTTGCCGTTTGGAGGATTTTATAGTTGCAAAGTTGGAAATCCTCTACTAGATGA
TCCTCTCTACAACATTACACAGGATCCCAAATATTGGCCTCAAGGTTGTTCAACCGGATATTCATCACATGTAGCTATTG
TCGACAGAGCTTGTCAAATTTCCTATTGCGTTAAAAATAACGCCCTTAGCATGAGAGAGCAACCGCCTCTCTACCGACCA
CCTTTTATTGATTTGGGATTTGGACCCAATATGACAGTAATTACCTCTCTGGACACTCCAATGGGGGTCCGATTATCTGT
TGATGAAAACGGGAAATGGAGTCATAATCACCAATACAAATTATCCAATTACAATATTATAATAATATCAGTCATTATGG
CGGCAGGAGCCAGCATTGCAATTATTATTATAATTCTTGGAGTTCAAAGATTCAGCAGAAACCGAAAAGGTCAAGTCTCA
CCGGAATCTCATGAATTTGATAGCAGATATGATTCTACTAAAGATGTTGCCAATCTTGCGTTACCCGGCGAGGTTCCACC
GTTTCGTGTTATAATTGACGGAGCGAAATGATGCTTGGAACCTTTTATTATTTCTGTTGAATCTGATCTGTAAATGTTTT
CAGAATATTTTTCTAATAAAATCGTTCTGAAATTTTAAAGTGATCCTTGATGCTATTAAATGATGGACTTTATTGTACCC
CGAATTGGGTCACCCTTGTTCACGCAAATTCGTGCTTAGGATATTTGTACGGGCTTATGCAACTTTTTAAATTTTTATTT
TTCCTTATTTTTATTAGCAATCCGTTTTATTTATAACGACAAATGCTTGATGTTTGAATCAAATTTTTATTATGTTTCTT
AATGAAACATAGTGAACAATGTGCCACTAATTTCATAACCAAGGTCTAATCAAATAGTTTGGGTAGTGAAAGCAATATTA
CAGAGTTTAGGTTTGTCATTCATAT
>SMED30000139 ID=SMED30000139|Name=Macrophage-expressed gene 1 protein|organism=Schmidtea mediterranea sexual|type=transcript|length=2115bp
GTTTGATAAAAGTTATAATTTTATTATTAAATAGTGAAAATGACAATTTTTATGTTGGGTCGAGTAATTTTATTCCTCTC
AATCGGATCCATTTTGGCTGTGCTGGCTGAGGAGAAAGAGCTAAATATTACTCATCCCCACAAAAATATTGCCACTTCGA
ATTTGCCATCAGCCAAATTTGTACATGGATGCCATTTGACCAACAATCAGTATCCATTCAATGTGCTTCCTGGATCTGGC
TGGGATAATTTGTCAAACCGCGAGTTGGGACAAGTTCTAAAAGTAGCCTATTCTCGTTGCAAATCATCCAATGATGGAAC
CTTTCTCATTCCGGACAAAACAAAAATTACGGCGTTTATGAAATCTAGAGTTCAAATGGATTCAGATATTGTAACACACT
TTTCCAAATATTCCTCCTTGACTTCGAAATCAGTAAATCTTGAAGTCAGTTCTGCAACTCCGAATGTTCAGATCAGCGGT
TCATTTTCTTATGAAAAGAAAGACATCAAGGACAATCAAATGAAAGAAAAATCCGCCTTTTCTCAAACTCAGTTAAGATA
TGAATTGTATCGAGTATCCTTCGAACCGGATAGTGAATTGAATGACAGATTTCGTGAAAGGATCCTTGATCTTGGAGTAC
TTATAGAGAATAAAAAGGGTTCAGCTCATGCTCACTATCTCGCTGATTTGATTGTCAGAGATTTCGGAACTCATGTTATT
AAATCTGTTGATGCTGGAGCAATTCTTTCAAAAATTGATGTCCTAAAAGGTGACTATCTTTCAAAACACGAGGGCTCTCA
ACATTCCGTGACATTAGCTGCGTCAGTTAGTATGAGAGAAACACTTGGAATTAAAATAAGTGGTAATTACAAAACCGGTC
ATTCGGAAATGGAAGAGTACAACAAAAATTGCGTAAGCACTCGAATCTCTACAATCGGTGGTGGACCTTTCGGTTCGAAT
TTCACGCTAACAAAATGGGAAAAAACTCTTTCAACAAATCTTGTGGCCATTGACCGTATTGGGGAACCGCTTAATCACAT
TATTACCAAACGTAACGTACCGGAGTTTGACGATAAAATTGTGTATGAAATCGGAAACCATATCAAGGAAGCAATAAGCC
GATATTATTCTGCTAATACTCGAACTGGATGCATGGACATTATGTCAAAGAACTTTGATGAAAATGCAAATGCCGACAGT
GGATTATGTAATAACATTGAAAATGGAAATTTCTTTGGGGGTTTATACCAAAAATGCAGTTTAGACGATGACTCTCTCTG
TGAGAATATAATACAAAAAAATGCCGCTACTGGGGATTACTCGTGTCCAAATGGGTTCACTCCAGTCAAACTATATTCAT
TCAAGTATAAATGTGAAGGTGATAACTGTCCTATTTATGAAACCTTCTGGTGTGTCTCTAACGGTAAATCGTCAAAAGGA
TATGAAATTTTTTTCGGAGGAATCTACACAACAAATATTCAGAATCCGTTTTATAGGGCTGACAGTTGTCCGCAATACTT
CTTTCCTGCTAATGTTGGAATTAACGGTAAAGTCTGCATTTCAATGGATAAAGAACTGGGATTTAAAAATAGTTTACCAT
TTGGAGGATTTTACAGCTGTTCTATGGGAAATCCATTAGCTCAAAAGAAAGGATTTAATTCAACTGTAAATGGAAGTTAT
TTTCCAAAAGCTTGTGGAAGTGGCTATTCTTCTCATTTTGCTCTCCTAGATGGTGTCTGTCAGTTGTCCTATTGTGTTAG
TACTAATGCACTGACAAAGGGATATGACCTACCGTTGTACAGACCCCCATTTATTGATATTAAAACGGAATCAGAAGTTG
TCAACATCAACGCATTGAAAACGTCGGCTGGAATAAAAATGATTCTTTCTGAAAATGGATCTTGGGAAACAATGATTCCT
GAATTCTATTCCACGTACAAATATGCAATAATAACAGTGCTATTTCTCGTGCTATTATCCTTGCTTTTCCTGATGGCAGT
TTTAGCTTGGAAGGGTTTTAGACAATTTCTTGGAAGGATTTTCACTAAAATACCTTTAGTGAATAAAAAACAATCAAACC
ATAAACCGATTCGCGTACAAATAAAGGTGACCAGA
>SMED30007406 ID=SMED30007406|Name=SMEDWI-1|organism=Schmidtea mediterranea sexual|type=transcript|length=2730bp
AATCGAATACATAAAAATTTATTTGACACCAAATACAAAGAGACATTAATCTACAAGTAAAATAAGCGTTCGCGAATTCT
GTCATTTATCGCTGGAGGAGTAACACCACGATGAATCTTGCCAACGAGTTCAGCCAAACGATGGGCATAATGCGTTGGAA
CAGGAACTCGGATTGTTCCCATCCAGTTAAAATACAAATGTGTTAACGAATAAGTTATTTGCTGCAATACACTCGGAGAC
ATAACTGAAACCTCATTTGTTTTCTTGTTTGTAAACTTAGTGTCCATAAGAACATTATAATTCGTAGGAGATGCTGTACC
TTTAGTTGTTTTCTGAGACACCAAGTAAAATTCATAGAAATTGGGTTTCACTATTTTCTCATCAACCACAGTACCAGGAT
TTGGATTAGCCCCATCTTTGAAAAATTTAACACTAATTCTCTTCTTAACCACAACATAAATAATTTGGGGCAAAGTTTGA
TTTTCGTAAATTTTCTCTATCATTTTCATAACAGCATCAGTTTCGAACTTTTTGGTAAATGCTAACTGTGAATCTCCAAC
ACCGTCACGATAAATAATCAAACGAAGAGGCATAGTGTTAAATTTGTTTTGGAATGTTGTAAGGGCCGTTAGGAAGTTTT
TGCCCAAATTTTCGTGAAATTCATTTTTACCTTTAGATGAATTGACAAAACTGATATACTGAGAAAATTTGGCACTAATT
GAAAATACGGATGCTTGAACAGATCTTTTACCGGTTTTGCTATGAAAAGTATCCAATCCTACAATCATAGTCGGTGCCAT
TTTAAGATTAATACCCCATGGGTCGTATCCTAATTTAGAAAACATTTGCATAACTGATTTATCTGCAACCGTTTTACGAC
GTCGATCATCTCTATTACTTCCGTTTCTCTGCGTCACACACTGAGTCAATAGACCTGTAGACATTGTAAAATTCTTTACT
TTTGCGTAAACTTTATCATCAGGAATGAACACTAATGCCATATGTACCTTGCTTACACGAATAAAATCTGTTAAAGCGTC
TTCAACTTCATTGGATCGACATGAAGATATACTGTCCATTGTGTAATTGATTCTTAATCTTCCTATTTCTCTTTTAACAT
CTTCAATAAAATTGTTGAAGTGACTAGGGTTTCGATCAACAACCAGTACACCAAAACGATGAGCTGTGCCTTTAGGAACG
TCAAATTTAATTTCCCCAAACTTCCAATCATCAGGGATTTTAGTATTAATTTTAACTTCGTTTGAAAATATATCAACTGG
AGCCAATTCACGACCACGAATCGTAATCGGTTGTTCTTCAATACACATCCCCCAGCTCTTCATATAATCTTTTGATTTCC
CAGCTCCGGTCCACTTACAAAAATCTCTTATGTCATTTAATCGTTCTCTAGGCTCACGTTTCAATACGGTTCCTAAATTC
TTTTGCAAATTTATATTACTTCTTTCACTATCCGAAAATCCACATAAATAGCATAATTCACCTGGAATTGATAAACTTTG
ATCTGTTTCTGTAGGTCCTTCAGGTTCATTTTCAGTTTTTTTCTTTTGGGCGAACCATCGATCGCTTGACTCGCGATATA
ACAAATGGTTGTTTGTCATTTTTCAAATTAATGTTATACCGTTGCTTGAAATAATTCAAATAGGATATCTTTTTATCGCC
TAGCTGAACCTCGTCATTAACATCCATTTCTTTAATATCTGAAATTCTATACGTCTTGTTATTATACTTGGTAATTATGT
CCCTTCCTATTAATTGATCAATTTGATCTCGTCGATACACTGATACTACATTGTTTTCATTTAGAACACGATTAATTCTT
TCAAGATAAAGTAAAGTCGAAGCAGTTCCATTTTCATTTGTTCCTCTTGTAATTGTAGTAGAATACCCTCCTAATATCTT
GAAATTGTCCATTTTAAAAAAGCTAGGTCCTTCTCGAATACCACCACTTTCACAATTTGATCCCAGAAAAAATTGTCTAC
CAATTTTTTCTTGTCCCATAAATATTTGAATATTATTAAATACAATATTTATCATCTGATAATATTCTTCAGAATTTTTT
AAAAACGTCGTCAGCAATCGTATGGAAATTTCAACATCTTTGATAACTAAGTTTTCTGTATCTTCATCTGAGTGCCACTT
AGAAGTCGTAAATAATCTTCTGCCATCAAAACAAAATGGTTGACCATTATTTTTGCTGTTTGCATAAGCTAATAATAACT
CTAGCTTAGTACGGATACTTTTATTCTCCATAACTACATCATACATGTAAAATGGTCCTTCGACTTTAATATTAAAGTTA
GCGTAGTTAGACTTGAGACTAACTACTCTTCCATCTTTCCCTATTTTGTCTGTAACTGTATCAGGCTGTAAAGCAGGTTC
AATAATTGCGAATCTTCTTTGGAGACCTCCTCTTCTTGGTCTTAAATTGGGATCACTTGTAACATTAGTTGAATCCATTT
CGTAAATTTGAGTAAAAATGTTAAAACAAAGACTTCGGTTTAAATAAACAAAATATACTATGTAAAACGATAAATATAAT
TGCTTTAATGGTTTATGATTTGTATTATATAATAATAATAATTTAATTTCCCTGTGAATATTATATTAAAATATAGTAAA
AATTACTCGTAAATGTGTGTTAAAGTAATAGGATTAAATTAAAATAAACATTTTACGAAATAAGTTCTAGTCAATTATGA
AGTCTTTTCT

 

back to top