primitive ectoderm



Overview

A single cell layer of extraembryonic, post-mitotic ectodermal cells bounding the embryo. The primitive ectoderm forms during Stage 2 and is thought to degenerate as the definitive epidermis forms during Stages 5-7.

 

primitive ectoderm

 

"PRIMITIVE ECTODERM" TERM REFERENCES

OCLC:20423827 , OCLC:464776945 , OCLC:82522822 , PLANA_REF:0000001

 

back to top


 

Tissue Description

 

Sphere formation begins during S2 when some of the blastomeres exit the cell cycle and commit to primitive ectoderm fate (Hallez, 1887; Ijima, 1884; Le Moigne, 1963; Metschnikoff, 1883). These cells flatten, elaborate numerous processes, and ultimately generate a single cell layer bounding the sphere. The number of primitive ectoderm cells varied, with a mean of 21.5 +/- 2.9 per S3 embryo (Figure 1 – figure supplement 11 B). This observation is consistent with primitive ectoderm cell number estimations in Polycelis nigra embryos (Le Moigne, 1963). Moreover, the primitive ectoderm cell number remained constant during S4 as the embryo ingested yolk and increased in volume (Figure 1 – figure supplement 11 B-C). Consistent with this finding, cycling cells were not observed in the primitive ectoderm (Figure 3 A-E). Pan-embryonic cell markers, including EF1a-like-1 (SMED30004295), EF1a-like-2 (SMED30012165), and eIF4a-like (SMED30003202) were expressed in primitive ectoderm cells of S2-S3 embryos, (Figure 2A-B, Figure 5 E, Figure 5 – source data 3). gelsolin-like (SMED30014940) was expressed in blastomeres during S2, and primitive ectoderm cells and the temporary embryonic pharynx in S3-S4 embryos (Figure 1 – figure supplement 11 D). gelsolin-like mRNA was detected throughout the primitive ectoderm cell layer, with concentrated perinuclear staining. spondin-1-like (SMED30032088) was frequently detected in blastomeres during S2, and was expressed in primitive ectoderm cells with star-like morphology, as well as parenchymal cells, in S3-S4 embryos (Figure 1 – figure supplement 11 E).  Early embryo enriched (EEE) transcripts were not detected in the primitive ectoderm beyond S4 (Figure 5 – source data 3).

 

back to top


 

Figures

Figure 1 – figure supplement 11: Molecular markers for the primitive ectoderm

A: Average RPKM values per embryo for primitive ectoderm markers gelsolin-like (SMED30014940, blue) and spondin1-like (SMED30032088, red) during embryogenesis, Y (yolk), S2-S8.  

B-C: The number of primitive ectoderm cells remained constant while embryo volume increased during S3-S4. Primitive ectoderm cell nuclei were scored in SPIM reconstructed S3 and S4 embryos. B) S3: Average number of primitive ectoderm nuclei per embryo: 21.5 +/- 2.9. S4: Average number of primitive ectoderm nuclei per embryo: 22 +/- 1.4. n=5 embryos. Unpaired t-test, two tailed p value = 0.72.  C) Average S3 embryo volume: 7.4 x 107 µm3. Average S4 embryo volume: 1.5 x 108 µm3. Unpaired t-test, two tailed p value = 0.01. Embryo volumes were calculated by generating a masked surface in Imaris. Embryos scored, S3: n= 22. S4: n=5. Error bars: Standard deviation of the mean.

 D-E: gelsolin-like (D) and spondin1-like (E) expression (blue) during embryogenesis, S2-S8. Black arrowheads: temporary embryonic pharynx. Red arrowheads: definitive pharynx. Yellow arrows: primitive ectoderm cells. O: oral hemisphere. A: aboral hemisphere. V: ventral. Scale bars: 100 µm.

 

 

back to top


 

In Situ Hybridization Data

Smed IDAccessionNameAliasEnriched during stage(s)Tissue/PatternImages
SMED30018602ATP-dependent RNA helicase dbp2DDX5-likeStage 2, Stage 3, Stage 4blastomere, primitive ectoderm, temporary embryonic pharynx
SMED30003202Eukaryotic initiation factor 4A-IeIF4a-likeStage 2, Stage 3, Stage 4blastomere, primitive ectoderm, temporary embryonic pharynx
SMED30014940Gelsolingelsolin-likeStage 2, Stage 3, Stage 4, Stage 5primitive ectoderm, temporary embryonic pharynx
SMED30033466Histone H4Stage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8blastomere, neoblast, primitive ectoderm, temporary embryonic pharynx
SMED30032088Spondin-1spondin1-likeStage 2, Stage 3, Stage 4blastomere, primitive ectoderm
SMED30027646Transcription factor BTF3 homologBTF3-likeStage 2, Stage 3, Stage 4blastomere, primitive ectoderm, temporary embryonic pharynx
SMED30025427Translationally-controlled tumor protein homologtct-likeStage 2, Stage 3, Stage 4blastomere, primitive ectoderm, temporary embryonic pharynx

 

back to top


Sequences

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30026323 ID=SMED30026323|Name=Gelsolin|organism=Schmidtea mediterranea sexual|type=transcript|length=1381bp
ATTTAATTATGCTTATTTTAAACCAATCACATTTGGACTAGCGAACTCATAAGACAGACAAGCTTTCATATATTTATTAA
CATTTATTTCTTATTGTATATGAATACGGTTGAAGTGTTTTATTTAAACTAGATCTTTTTAGTATAGCTAAAACAAAATA
GAAATGGTAAAACCGAAAAAATATTCTTGGAAAGATTCTAATGTTGAATTAATAGGAACAAAGGAAGATCGTAGTATAAA
AAAAATATCTGCCGAAACGGAGAAAGCATGGGCTAAAGTAAAGTCATGCAATCATCCGGAATTATTTATCTGGAGGATAG
AGAAGTTCAAAGTAGTTGAATGGCCTATAAACCAATTTGGGGAATTCTATAATGGAGATTCGTATATCATACTAAATATT
TATACAAGAGGAAATGAGATTCTTTACGATGTACATTTTTGGATTGGAAAATATTCAACTCAAGATGAATACGGAACTGC
CGCCTACAAAACAGTAGAATTGGATAATTTCCTTGATGATAAACCGGTACAACATAGAGAGGTGCAGCATTACGAATCAG
AGTTGTTTAAGAGCTATTTTTCTCAATTAATTTATCTGAACGGTGGAATTGAAAGTGGATTTAGACATGTAATTACGAAA
GAATATTCACCAAGATTGCTTCATGTCCGTGGCGACAAACTAAAAGTCATTGTATCGGAAGTTGCTGCAACGAAAAGAAA
TTTGAACTCGGATGATGTTTTTCTGTATGACACAGGCACCCACATTTTTCAATGGATCGGAAAAGGTGCAAATAAAGATG
AAAGATATCATGGTCAGAGGTTTGCTCAACAATTGAGTTCAGATAGAAATGGAAAAGTAAAAATTGAAGTTGTGGATGAA
GATGACTCTTCATCAAATCTTATTTTTTATAATAAATTATCGGATGAAATTAGTGAGGATTGGGATGATGATAAACACTA
TAAACCTTTATGTGAACATGAAAAATTACTTTTTAGAATTTCCGATGAAACAGGAAAACTAAAATTTGAAAAGATAGGCA
AAGGAAATATTTCCAGAGCCCAAATAAATGAAGATGATGTTTTTATTATAGATAACGGACAGCAGATTTTCGTGTACATC
GGTGAAAAATCAAGTCGGGCTGAACGGCAAAATGCACTTATATATGCTCATAACTACCTAAAGGGAACGGAATATCCTCA
AGCTCCAATATCCGTGGTAAAGAAGGATCTGAAAGGAAATAGTGCTGAGCAATTCAATAAAGTTATTGGGGGCTAATCTT
TGGAATTTTCGTTTCATTTTTTTACTTTGATTAAAACAAACATTTCATACTTTGATTTTCATTATTGTTAGAAATTTACA
AAATCCTTTCTTTAAAAAAAA
>SMED30014981 ID=SMED30014981|Name=Gelsolin|organism=Schmidtea mediterranea sexual|type=transcript|length=1397bp
CTCTTCCGATCTTATCAACTTACTCACATAGATGATAAAATGTTTGGCTGGTTGTTTAAATATTTGAAAAAAAATTGACC
AATAAGAAAAATTTCTGTGCGCCAATTCAATCGATAATTTGCTCACTGACATTTGCATAGTTTTACAGCCGATTTGGACA
GTATAAATACGAATGTCACTTTAGATTAATTTCACTTGTCTTTACATTATCATGAAAAAAGCAGAAAAATACGACTGGAA
GGATTCGAATGTCGAATTAATTGGTTCATCGGAGGATCGCAGTGTTAAAAAATCATCGGCAGACACTGAAAAAGCTTGGA
ATGCTGCAAAAACTTGCAAAACAACCGCTTTGTTTATTTGGAGAATCGAGAAATTTAAGGTTGTTGAATGGCCTAAGCAG
AGATTCGGAGAATTCTTCGAAGGTGATTCCTATATTGTTCTAAATATTTATCAAAAAGAAAAAGAACTACTTTATGATAT
CCATTTTTGGATTGGAAAATATTCGACTCAAGACGAGTACGGCACTGCTGCTTACAAGACTGTGGAGTTGGATACCTTAC
TAGATGACAAACCCATCCAACATCGCGAGGTTCAGGATTATGAGTCTGACATGTTTAAAAGCTATTTTCCAAATATTATA
TATCTAAAAGGAGGTTGCGAAAGTGGATTCCGACACGTCAACACAAGAGAGTACAATCCAAGACTACTCCACGTCAGAGG
CGAAAAGAATAATATAATTATATCTGAAGTTTCGTCGACCAAGAAAAATTTAAATTCTGATGATGTATTCATTTTTGATT
CTGGAAGCTGTATATATCAATGGATCGGAAAAGGTGCTAATAAAGATGAAAGATTCAAAGCTCAACAGTTTGCTCAGCAG
TTGAACTCCGATCGAAATGGGAAACTAAAAATCGAGGTACTTGATGAAGGACAAATGTCCCCAAATCATGAATTCTATAA
TAAATTATCTAACAACGAACCAATTGCTGATGACAAAAACCATAAATCCTTAACAGCTCACGAAAAAAAGCTTTTTCGGA
TTTCCGACGAAACTGGACATTTAAAGTTTGAACAAGTAGCAAGTGGAAATTTCAATAAATCTAATATTCATGAAAATGAC
GTCTTTATTATTGACAATGGGCAAGTTATCTACGTTTATGTCGGAGAAAAGGCAAGTGACAATGAACGGAAAAACGCACT
TATCTATGCACATAACTATCTGAAGGCTACGGATTATCCCCAAGCTCCTATTACCGTTGTCAAGAAGGATATCAAAGGTA
AAAATGCCGAAGAATTCAACAAAGTGTTAAATGGCTGACGACTCAACTTCATATAGAATTTAAATAATTTTACTCTTACA
ATAATTTAATTAAAATTTAGTAATTGTTATTAATAAA
>SMED30025482 ID=SMED30025482|Name=Histone H4|organism=Schmidtea mediterranea sexual|type=transcript|length=552bp
TGTCATTATCAAAATATTTTCAATATATAATAAATCAGAAATCACTAAACAGTCATTACTAAACTATTCTAACTCAAAAT
GTCTGGTCGAGGAAAAGGAGGAAAAGGCTTAGGTAAAGGTGGAGCTAAAAGACATAGAAAAGTTTTGCGAGACAACATCC
AAGGAATCACGAAACCAGCTATTAGAAGGTTAGCTCGCAGAGGTGGCGTGAAAAGAATTTCTGGTCTTATCTATGAAGAA
ACTAGAGGTGTTTTAAAGGTTTTCCTTGAAAACGTAATCAGAGATGCTGTTACTTACACTGAACATGCTAAGCGTAAGAC
AGTCACAGCTATGGATGTTGTTTATGCACTTAAACGACAAGGTCGTACTTTATACGGTTTTGGAGGGCCACAAATGTTGA
TTGTAGTGAATTGTTCAAATATTGTTATTCTATCTAGTAATTCTCAGCAATTTTATTAACGTTATTTAGAAATTAATTTT
ACAATTGCTAATTTCGAATGTTATATCTGGTGTCAATGTTCAGTTATATTATTTTACAAATGACTTGAAATG
>SMED30029163 ID=SMED30029163|Name=Histone H4|organism=Schmidtea mediterranea sexual|type=transcript|length=537bp
AGGTTACAGTTTTTCAACTAATACCTCAAAGAAATAATGAAAGATGGACAGTAGAGTTTTGTCACCATCAGGAGACCAAG
TGTCATTTAGGATGATAATAGCCCAGTTAAGGAATCTTGCTGATCTAATCAATGCCAAAAATATTACAAAATTTCGATTT
AAAAGAAGCTAAAGGAGAAAAATTACACGGAAAAGTTCAGAGGTACAACATCCAAGGCATCCCTAGGTCTGCAATTAAAC
GATTAGCACAAAAAAGAGGTGTGAAAAGAATTCATGGGCTTATTTACAAAGAAACAATATATGTTATCAAGTTAGTCCTT
GAAAATGTCATCTTATATGATATTAAATACACATTGCAAGCCAAGCAAGAAACTTTTACTGCCAAGGATGTTTTTAATAT
TCTTGAATGTTTGGAGTTTTCTATTTTGTGATAACATCCTTCCCCAAATGAAAGTTATCAGATCATTTTGCAAAGTTTGT
GAGAAGGGATATATATTTACCAACAAGAAAAATGTTTTGAATTTAAGAATAGGACTC
>SMED30018602 ID=SMED30018602|Name=ATP-dependent RNA helicase dbp2|organism=Schmidtea mediterranea sexual|type=transcript|length=607bp
TATTCAAAAGATAAACGATTGTTAGAAGTTGTTAGCAAAACTCCACGGGACAAAATGATTGTGTTCGCAGAAACGAAAAG
GAAAGCTGATATGATTTGTTCTTTCCTACGTTCAAAACAATTCAGAGTTGGTGCAATGCATGGAGATAAGTCACAGAGCG
ACAGAGAATATATTCTTAATGGGTTTCGAGGTGAAAATTTAAATATTCTCGTGGCAACAGATGTAGCAAGCAGGGGTTTA
GATGTTGATGATATTAAAGTTGTAATCAATTACGACTTCCCTATTCAATTTGAAGATTACATTCATAGAATCGGTAGGAC
AGGCCGACGAGGAAAATCCGGTGTGTCTTATACATTTTTCAATAGAAAGAATTCGAAAAGTGCTCGTCAATTGGTGAAAG
TGATGGAAGAAGCTAATCAATCAGTTTCAGATAGTTTGTATGATCTTGCATATATACCAAGAAGTGAGCGTAGACAAAAT
TTCAATCGTCCGCCAATGCCAGTGCCGCAAGTAAATAATTATCAAGTACCTCCGCCTCAATATAATGGTGGAAATAACAT
GTATCCGCAACCAGATTTATATATGCAAAACGGAGCAGCACATCACA
>SMED30022078 ID=SMED30022078|Name=Translationally-controlled tumor protein homolog|organism=Schmidtea mediterranea sexual|type=transcript|length=629bp
GTCAAATATCTTAAATTTGTTTGTTTAAATACTTGTTTACACTAAACACTTTTATTTTGAAAGTTTATTCCACGATGTTA
ATTTACAAAGACATAATTTCGGATGATGAAATAAGCAGTGATTCATATCCAATGAAACTGATTGATGATATTGTGTACGA
ATTTAATGGAAAGAATATTACCATTAAAAATGGCATACCCGATGAAGCAATCGGTGGAAATAAATCTGCTGAAGGTGGAG
ATGATGATTATTCTGAATCATGTGAAACTCAAATAGACATAGTCTATGCTAATCGACTAGTAGAAATGAGTTATTCGAAA
AAAGAGTACACTACTTATATTAAGGATTACATGAAAAGAATACTCGATATTCTTAAAACTAAGAATCCTGCTCGAGTTGA
TGTATTTAAAACGAATGCTCAAAAATATATTACGGAAATTCTTAAAAATTTTAAAGAATACAAATTCTACACGGGTGAAT
CAATGAATCCTGATGCCATGGTAATTTTATGCAATTATCGGGAGGATCAAATTACTCCTTATTTCATCGTCTTTAAAGAT
GGTGTTGTGGAAGAAAAATGCTAGGCCAAATTGCCAATGGAATGTTATATTAATAAAGAATTGATTGAC
>SMED30001973 ID=SMED30001973|Name=Eukaryotic initiation factor 4A-I|organism=Schmidtea mediterranea sexual|type=transcript|length=361bp
ATCGAAACTAATTATGATAAAATTGTGGAGTCTTTTGAAGATCTAAATTTAAAAGAAGATTTGTTGAGAGGAATATTTGC
TTATGGTTTTGAAAAACCATCGGCAATTCAAAAAAGAGCCATTCTCCCAGCAATCGAAGGCCACGATGTCATTGCGCAAG
CACAATCCGGAACTGGTAAAACTGCCACTTTCAGCATCTCAGTTTTGCAAAACATTGACACTTCCATCAACAAAACTCAA
GCTATCATCTTAGCTCCAACTCGTGAATTGGCCCAACAAATTCATAAAGTCATCATGACAATCGGTGATTATTTGTCAGC
AAAATGTTGTGCATGCATCGGCGGAAGAAATGTAAGAGATG
>SMED30014940 ID=SMED30014940|Name=Gelsolin|organism=Schmidtea mediterranea sexual|type=transcript|length=530bp
CAAATAAATTTTCGTTTCGTAATTATTTAAATTTCACATGTTTTTTATTTAACTATAAATTCTGGAAAATAAATTAATTT
TACATTCAATTAATTCAAACAATGAAATTAGATTTTAAAAGTAAATCATTTCTAGAATTTTTTGTTTTTTAAACTTTCTA
AAAAGGAAACAACTACGGAGCAGTCGAAGAAGTTCTTGTCACCGGACACAGAAAGTCTGACAAAACCGGAATGATAAAAC
AAAAAAACTACGATTGGAAAGATTCCAATTTGGCTTTGTTTGGATCAGACACGGAAAAATTAGTAAAAAAAACTTCCGCT
GAAACCGAACCAGCATGGAGAGTTGCTAAGGCAACTACGGTTCCAGGTTTATTTGTTTGGAGAATAGAAAAATTCAAAGT
CATCAGTTTACCAAAGGAAGAATTCGGAAAATTTTACAATGGAGATTCTTACATTATTTTGAAAATCAATAAAGAAGAAG
ACAGTCCGGAGTTGCTATACGATGTGCATTTTTGGATTGGAAAATATTCT
>SMED30033466 ID=SMED30033466|Name=Histone H4|organism=Schmidtea mediterranea sexual|type=transcript|length=421bp
GATCTCACTATATAAATAAGTATTTGTCCCTATTAATTCATAACAATTATTCAACATGTCTGGTCGAGGTAAAGGAGGAA
AAGGACTAGGAAAAGGTGGAGCAAAGCGTCACAGAAAAGTCCTTCGTGATAACATTCAAGGTATCACAAAGCCAGCAATC
AGAAGATTAGCTCGTCGAGGTGGTGTTAAGAGAATTTCTGGATTGATATATGAAGAAACCCGAGGTGTTCTTAAAGTATT
CTTGGAAAATGTTATTAGAGACGCTGTGACATACACTGAGCACGCTAAGCGCAAGACAGTAACTGCCATGGATGTCGTCT
ATGCTTTGAAACGACAAGGAAGAACTTTGTACGGTTTTGGAGGTTAAATAACACTTTCATATTTGTGAATGTTTTAGCGG
CCCTCTTTAGGGCCACAAATG
>SMED30000837 ID=SMED30000837|Name=Histone H4|organism=Schmidtea mediterranea sexual|type=transcript|length=1387bp
ATTAACACTAAATTTTGTTTATATAATGATTAAATATTTCAATAATCAATTAATTGAAAAATGTCTGGTCGTGGTAAAGG
AGGAAAAGGGTTAGGAAAAGGTGGAGCCAAGCGTCATCGTAAGGTTTTACGTGATAACATTCAAGGAATAACTAAGCCGG
CAATTAGAAGATTAGCTCGTAGAGGCGGAGTAAAAAGAATATCTGGTTTAATTTACGAAGAAACTCGTGGTGTTCTCAAA
GTTTTCCTGGAAAATGTTATAAGAGACGCTGTTACTTATACTGAACATGCTAAGCGTAAGACAGTAACTGCAATGGATGT
TGTTTACGCTCTTAAACGCCAAGGAAGAACTTTATACGGATTCGGAGGTTAAATGTGAAACCAATGATATTTTAAGCTAA
CATTTATTTGTTGAGAATGTTTATGGTCCTCCTTAGGGCCACAATTTTTGATTGTTTACTTTATTTTGTTAGCATTACGT
AATTTTACAGTGATTGGTTATCTTGCTGGTTGTCTGAAATATTAAATAATAATATGCTATAATTAAATGATATTAGTATA
GAAAACAAAAATCGGTTTTATTGTTTGATCAACACAATGAATATGTTTATCAATTATCATCATTTCCAGTTTTTCGATTT
CAGTTGATAATAATTATTTGCGAATTTGTGATTATATTTTCTAATGGGTTGCGAGACATAAATGAGCGTGCAGATATCAC
ATGCGAACCTGGTTCATGTAGTGTTTTGAGCTACACACTGCAGATAGACGATCAAATCTATAAAGTGAAAAAAGGGTTCA
AATCAGCTTGCAGCACCAGACTATGTGAAAATTGTGCTCACAAAGGTGATTGGTCAATGAGACTGATTGACGGAAACAAA
TATATGGTACGACAAGTCAATAAATGTTTAACTAATAATATTTTGGCAGTTGAGCAACTTTTCACAAATTTATATACTCC
TGTCTCAGATTTTACATGCTCCTTGCATAAGTGCTCTAAATATAATTATTCTTATAATGGAAATATGATTAGCTTTAGCT
ATATAGGAGTTTGTGACCATTCTTACTGTGACTCATGCCGCTATTCCGACAATTGGAGTCTATTAACCGGATATTTGCAG
CGGACGACCATTTCATGTTATGTTGTCGATAAAATTAGACTTGAAGATTATTTTCTCATTCCAGAGTTTACCGAAACCTT
CTATACACTAATTCGGAAATTAGCAATAACTATAAGCTGCGCTTCATTTTTGTGTTTGGTGATCATTCTTTTGGTTTGTT
TTGCTAAAAAATGAGATCTTACAGAAGCTTTAAGGAACTTAATTTTATTTAACAATATATTTATACTTAGATCTAATGCT
TTGAATGATCCTTTCGCAAGTCCATCC
>SMED30002168 ID=SMED30002168|Name=Spondin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=2693bp
CAATTGCTTAATAAAATTTTCCTTTCAATAATTACCGTAAAAGTTGATGAAATTAATTTTGAATATTTTATCCACTTTTT
TCATATTGAAATTTGATTTTGCTGAATGTTTCGGATTTTGTGACATTCAATTTCCGAAATCATACGTTGCCTTTTCCACT
AGATTCAATCTCTATACGAATCATGAAAAAGAAAAACTGACCAAAATCACCTCGTACATTCCTGATAAAACCTACGACAT
AACTGTGTCATTGAATGATAAAGCTATGCACGAAAAGTTGACAATAAAAGAAATATACGTCTTAGTCTCAAATGTTCACA
CGGAAATGGAAGAATTGTCGGAACATGACTGGAAAAACGCCGGTGAAGTGGTTTTTAATGTAACTCACGCATCCAAAACA
GAATATTGCCCCCAAAGAGCTTACGTTCAGTATTTATATACCCAACCCCAACATGTCACATTCTATTGGATAGCACCTAA
AATACCGAATTTTTGTATTAGAATAACAGTTATTTTGAAAATGAACGATTTGATTTCAGAAAGCAAATTCGAAGAAAGAT
CCCACTGGATATGTGAACAAAAAAGAAACAAAATGGATCAGATGCAAGCAGATCAATATGCATCTACCTCTTGCGCAATG
AAACAAAAAACTGATCCAGTTAAACAATGTAATATTGGATCAACAGCGGTATATAGAATGACAATTGAAAATAAATGGAA
TTTATTAAATCATTGGAAAGATTGGCCGGGCAAAGACGGGTATTCTCCTAAAATAACTCAATATCTCGGAGCTTCTCATT
CAAATGAGTTTAATATTTATCATCTTGGTGGAATGGCCAATGAAGGAGTTTCTCAGGTATGTGGAAACGGGAGCTACACT
GAATTGCAAAAGCAATTCTACAAAGCTGGGAACGGGATCATGACAGTTATATTGGCCAGGTCACTAGATGCGTCATCAAA
AACCAATAAAAGATCAGCACTGATTGTTGTAAATGCAACTCAACATTTGGTTAGTTTTCTTGCAAGACTTCATCCAAGTC
CCGATTGGTGCACAGGTCTAAGTAGATTTGATCTTTGTAACGGCTCATGCAAATGGCAAGAAAAATTTATCGTCCATTTA
TATCCTTGGGATGCCGGTGTTTACAGTGGAGAGACTTATTTAAATAAAAACGAGAAAACTAGACAGACTCCAATATGTCC
AATCACTAGCAGTTGGCCAAAGGATAACCCTTTCACGGTGATGAACGGAAAAATCAAAAATATCGGAGTGGTAACCTTCC
AATTAATACAAGAATATAACAAAAATGATAACCAGTATTGTAATTCTATTAATTCAATCCTTCAAGACGAAGCATACCAA
AATGAACCGAAATCCAGTGCTCTGAAATCAAATCCAGATAAAACCAGGCATTGCTTATTGTCAGAATGGAGTGAATGGAG
CTCTTGTTCAGAATCTTGTGGTAAAGGTGAAAAAACTCGTTACCGAAAACTGCTGAAAGGAAAATCCGAACAATGCATTG
AATCTTCCCTAACTAATACAGAGAGCTGTAGCAGTAAATGTTCGACAGTAATTTCATTCGAAACATGTTCGTTTCGCTTG
TGGGGCCAATGGAGCCCATGCAATGCTACTTGTTCCCAGAAGGGAATTATTCATAGGGAACGTGTTTTTATCAATGAACA
GGAAAAACACGAATGTATGCAATATTCCGAAATGAAAGCCTCTCTTGAATGTGCATTAGCAAGCGAGAGGTGCAAACCCG
ACGTGATCTGCAAGGAATATGTTTATCCTGGAGATTCGTGTTCTTGGTCTAGCCCATCACAAAGATTTTATTACGATTTT
TCTAGTGGAACTTGTAATGCATTTATTTACAAAGGCTGCTATGGGGGTCTGAATAATTTTCACACCTACGAGGAATGTAT
TTTACTCTGTCGACCAAAATTAAAAGAAACAGATCAAAGACGATTTAATACGCCAGAAACTTATCCCAACCGATGCGGAG
TTTCGATGACATGGGGAATCTTTTGTGATAGTCAATCTTCATCAAACCGTTGGTACTATGACAATATTAATAAAGAATGC
TACCGATTTCGTTTCGGGGGCTGTCGAGGGAATGCCAACAATTTCCGAACTAAAACTGAATGTCAAAATGTTTGCTTGAG
AGAAAAGTCTACTTCAACAACAACGACAACGATCAGTCAGCCAGTAACGGTAAGAAAAGTCTGCATCTATTCCAACTGGT
CGGACTGGAGTTCTTGTGATAACAACTGTCAAAATCAACAAACAAGAATAAGATTTTTAATTGAAAAAAATGACGACTGC
ACCGAAAGTATCAGTGAAACAAGAAAATGTCAATCAGAGAAATGCAATTCGCCAAATAACGGGTTTATTTCACTAAGGAA
TTGCAAGTATTCGAGTTGGTCGGAATGGTCGGCTTGTTCATCAAGATGCGGTCCTGGCGTTAGAGAGAGAAAGCGGAAGA
AACTTTCTCGTAATTGTAAACCGGAATTTCCGCAATTTACTGACCGAGAATCATGTTACAATGCTTGTGCTTATGACTGA
ATCCGGTAAAGAAAAAAAAACTGTCAATGTATTTGTGTCATGACATTTTACCTATTGTGCATTTCATTTTGTGAACTTTG
TTTGGTTTTTGATTTATTTTTTCTTGGTGTTTTTCTCTAGAATATGATTTGTT
>SMED30003202 ID=SMED30003202|Name=Eukaryotic initiation factor 4A-I|organism=Schmidtea mediterranea sexual|type=transcript|length=1324bp
ATTAATAACAATGGAAAATCCAGGAGAAATAGAAAGTAATTACGACAAAATAGTTGAATCATTTGAAGATTTAAACTTAA
AAGAAGATTTGTTAAGAGGAATCTTTGCTTATGGTTTTGAAAAACCTTCTGCTATTCAGAAGCGTGCTATTTTGCCAGCT
ATTGAAGGTCACGATGTCATTGCCCAAGCACAATCTGGAACCGGAAAAACTGCCACTTTCAGTATTGCTGTTTTGCAGAA
TATTGACACTTCTATCAATTCTACACAAGCTATTATTCTAGCACCTACCAGAGAACTTGCAGTTCAAATCCACAAAGTTA
TAATGACCCTTGGTGACTATATGGGAGCTAAATGTTGCTCATGCATTGGTGGAAGAAATGTCCGTGACGACATTAACAAT
TTGGAAAGTGGAATGCATGTTGTTGTCGGTACTCCAGGACGAGTTAAAGATATGATAAAGAAGGGCCATATTAAATCAGA
TTTCGTGAAAATGTTTGTCCTTGATGAAGCCGATGAAATGTTGAGTCGAGGTTTTCAAAATGACGTTTGTGAATGCGTTC
AATATTTATCTGCCGAAACCCAAAATTTCATTCTTTCTGCAACAATGCCAGATGAAGTTTTAAAAGTCAGTAACGAATTC
ATGAATAATCCAGTGAAAATTCTCGTTAAAAAAGAGGAATTGACTCTGGAAGGTATTCGTCAATTCTACGTTAACGTTAG
CCAAGAAGAATACAAATTTGATACCTTATGTGATTTATATGAATCTCTGACCATCACCCAAGCTGTCATTTTCTGTAACT
TCAAAAACAAAGTTATATTTTTAAATGATAACTTGAAAAGTAAAGGATTTGTTGTTTCATCAGTCCACGGTGACATGGAG
CAACAAGCTAGAGACCAGATTATGAAAGAGTTCCGAAGTGGATCAAGTAGAATTCTCATCACCACAGATTTGCTATGCCG
AGGTATTGACGTCCAACAAGTCTCAATGGTCATTAATTATGATTTGCCTAAAAACAAAGAAAATTATATTCATCGAATTG
GCAGAGGAGGCCGATTCGGAAGGAAAGGAGTTGCACTAAATTTTGTCACAGACAAAGATATTGCTGAAATGCAGGAGCTG
GAAAATTTTTATAACACCAAGATTGAAGAGATGCCCATTAATTTATCTGAATTCTTATAAATGATTTACCGCTATTTTTG
TAAATAAATTTTAATTTACAATTAAATTAGGTTATTCATAACTTCCTTTGTTACGTAATTTTTGCTATCTTATCTATTTT
TGTTAGTAATGTATTTATGCTGCGTCACATTTTTGTTGCAAATT
>SMED30020614 ID=SMED30020614|Name=ATP-dependent RNA helicase dbp2|organism=Schmidtea mediterranea sexual|type=transcript|length=2242bp
CTTCCGATCTATTTTGTTTAACTTTTTCTCACTTTTAAATAAATATTATTAATCCAAAATGTCAGATTGGTCTGACAATG
GAAGAGATCGTTCTGGAAAATACAATGGCAATGACAGAAGTGGTCGTCATGATCGAAGCGATCGTAATGATCGAAGTGAT
CGTAATGATCAAAAGGAACGAGGATTTAGAAGCAGTTATAGTGGTCATAATGATAAATATAGCAAAAATAGTAGAACCGA
AAGAAATGGATTTGATAAAAACAGGAAGGATAAATCTGATTGGAACGACAAATCCAGGCGATCTAGATCTCGTTCACCCT
ATAGTAATTATAGATCGAAAGATAACAAAAAGGATGAACAAACTTTAGAAGTTGTTGATTGGAAAACCCACAATTTAATT
CCATTTCAAAAAAATTTCTATAAGGAGAAAGCTGTTGTTTTGTGTAGATCACCAGATGAAGTTGAGAGATATCGTAAAAT
AAAAGAAATGACTGTTGCTGGGGATGATATAGCAAAACCAATATTCTCATTTAATGAAATTGATTTTGCTCCTGAAATAG
TGTCAGTGATTATTAAAAATGGATGGGTTGAACCAACCCCAATTCAAGCGCAAGGTTTGCCTATGGCATTAAGCGGTAAA
AATGTTGTAGGTATAGCGAGAACTGGTTCAGGCAAAACTGCCAGTTTCGTTATTCCAGCAATTGTTCATTTAAAAGCGCA
ACCTAGATTAAGAAAAGGTGATGGTCCCATATGTTTAATCATTGTTCCTACGAGAGAACTAGCTCAACAAGTACAAGGTG
TTGCAAATGATTTCTGCAAATCTTATGGTATTAAATCAGTGTGTTGTTATGGTGGAGCTCATAAAGGTGATCAGATTGGT
GAATTACGCAAAGGTGCGGAAATAGTAGTAGCTACCCCAGGTCGACTTATAGATTTACTAAAATGTGAAATAACAAATCT
TCATAGAACAACTTATGTTGTTCTTGATGAAGCTGATCGTATGTTGGATATGGGGTTTGAGCCTCAAATCAGGAAAATCT
TTAGTCAAATTAGACAAGATAGGCAGACCTTGATGTGGTCAGCTACTTGGCCACGAGAAGTTCAAAAATTGGCTCAAGAC
TTTCTTGGTAAATACATTCAAGTAAATATTGGATCTAGAGATCTGCATGCAAATCCTGATATACAACAGTTTGTTGAAAT
TGTCGATGAATATTCTAAAGATACAAGATTAATTGAAATAGTCAGGAAAAATGCTTGGGATAAAATGATAGTATTTACAG
AGACTAAGAAAAAGGCTGATAAGATTTGTGGATTACTTAGGTCTAGTGGTTTCAATTCCGGATCTATGCATGGTGATAAA
TCACAAAAAGATCGGGAATATATTTTACAAGGATTTAGGAATAAATCGTTGAATATTCTTGTTGCTACAGATGTGGCTAG
TAGAGGATTAGATGTTGACGACATTAAAATGGTCATCAATTATGATTTTCCTAATCAGTTTGAAGATTACATACATCGTA
TTGGAAGAACTGCGAGAAGTGGAAAAAGTGGAATGTCATATACATTTTTTAATAATAAAAGTGCAAAGAGTGCTTCATCA
CTTATTAAGATAATGGAAGAGGCTAAACAAATAGTTCCTGATAGTTTGTACAAAATGGCTTGTATTCCAAGAGATCGTCG
AAGAACAGACTTTCGTTTTCAACAGCCATTTTCTAATGGATTTTCTCAGCAGCAGTCAAATATATCCTCAATTGATTCTG
GTACTATAAAAAATCATTATACCGATTCGTCTAAGGAATATAATTTTGATAAACCTCACGTGACACCAGTTTCCCAGACA
AACGGAACACCACACAGAGTCAGTAGATTTGGTGATCGTATTACCCAGTTGCCAAGTTCTTTTACTTTACCACCTCCGAT
TGATAGTTTTGTTAATGATGTGCATTGTAAACCGGTTATACAACCACATCATCCTACTTCTAATGGAAATGTCAATGGTG
GTGTATATACGGATAATTTATCTGATTCTAATATATTTAACGATCCCAGATTTAATCACATGGCGTTTTACGGAGTACCT
CCTCCAATATTAAATGGATCTATTAAACCTTTGTCGTTTGAACGAGACTAGTGATTTTTCAATTTGTCATATCGTTGATA
TTATGAAATATTCGAGTTTTGTTTGACAGGTTAGTTCTTCAGTAATCATATTGTTTTTACGTAATAAATGTTGAGTTAAA
TG
>SMED30014692 ID=SMED30014692|Name=Histone H4|organism=Schmidtea mediterranea sexual|type=transcript|length=464bp
AAATCTATATAAATCTTATATGAGATAAATGTCAGGTCGAGGAAAAGGTGGAAAAGGTCTTGGTAAAGGAGGTGCTAAGA
GGCACAGAAAAGTATTGCGTGATAATATTCAAGGAATCACTAAACCTGCAATTAGACGTTTAGCAAGAAGAGGTGGCGTT
AAACGAATATCTGGGCTGATTTATGAAGAAACACGAGGTGTGCTGAAGGTTTTTCTGGAAAATATCATCCGCGATGCTGT
CACATATACGGAACACGCGAAGCGAAAAACCGTGACTGCAATGGATGTTGTTTATGCTTTGAAACGTCAAGGTCGAACTC
TTTATGGGTTCGGTGGATAATCATTTTGTATTTTATTATTTAATGTTGTAATTGCTATAATTGTTGCTAGTATTAATCTT
ATTTTAATAAATTATTTAACTGGATTTTAATTTAAATATGTCGGTTTTGTAAATCCAATTTGTA
>SMED30027646 ID=SMED30027646|Name=Transcription factor BTF3 homolog|organism=Schmidtea mediterranea sexual|type=transcript|length=541bp
AAATTAATTTGTTTAAATAAATTTCTTTAGAATCACGCAATGGACGGTTTTAAAATTAACACTGAAAAATTAGAAAAACT
TAGTAAGTTGTCGGAAAATGTCCGAACAGGTGGTAAAGGTACAATGAGACGAAAGAAGAAGGTCATTGTCAAGAGTTCAG
CAGCAGATGATAAGAAATTAGAGGCAACCTTCAAATCATTGTCAATGAGCCCGGTTCCAGTTGAAGAAGTAAACATGTTC
AAGGATGATGGAACTGTTATTAATTTCGTTAATCCAAAAGTCAATGTGTCACTTCCATGCAACACTCTCTCAGTTACTGG
AAAATCCGAAATTAAGCAATTGACCGAAATACTTCCAAAAGTTTGGCAACAACTTGGCCCACTTAAAGGAGATCTTTTCA
AGAAAATTGCACAAAACATGGAAAATCAAGCAACTGTCGAAGATATTGATGATGAAGACGATGACGTTCCAACTCTCGTC
ACAGACTTCGATCAACAAAGCAAATTGGAATAACTTTTTAATATCAATAAATTTTTTGGAC
>SMED30025427 ID=SMED30025427|Name=Translationally-controlled tumor protein homolog|organism=Schmidtea mediterranea sexual|type=transcript|length=570bp
AAGTAATACTTTTATCATTTAATTGAAAAAATGCTCATTTACAAGGATATTGTTGCCGGCGATGAGTTGTGCTCTGATAC
ATTCCCAATGACGATTGTCGACGATGTCGTTTACGAATTCAACGGAAGAAATATTACTATTAAAAACGGTATTTCTGACG
CCCTCTTTGGTGGAAATGCTTCAGAGGAAGCTGCTGGCGATGATGACGTTGCTGATTCGGACGAGACAGCAATTGACATT
GTATACAGCAACCGATTAGTCGAAATGAGCTTTGACAAGAAAGGTTACACGAGTTACATCAAAGGTTACATGAAAAGTAT
TTTGGAAAGATTGAATGCCACTAATAAAGAACGAGCTGAAATCTTCAAATCCAAAGTCGGTGCCTATGTTACAAAAATCA
TCAAAAATTTTGATGAATATCGTTTCTACTGTGGAGAGTCAATGAACCCTGACGGAATGATCATTCCATGCAATTACAGA
GAAGACCAAATTACCCCATACTTTGTTCTCTTCAAAGATGGCCTCGAAGAAGAAAAATGCTAGATTTCTGTTAAATAAAT
TTAGTGGAAC
>SMED30006887 ID=SMED30006887|Name=Gelsolin|organism=Schmidtea mediterranea sexual|type=transcript|length=1378bp
CGATGAGTGGTAAAATGTATGTCATTGTCTCATTGGCGTTAGACCAATCAAAATCATCACGAATTATTTGCTCTCGATAC
AATTCGATTAGAATATAATTGTCATCGTTTGACCTTCGATATCATTTCCATAAATCAAATTTTGTGAGAACATAATGAAG
AGATCAGCGAAATATGATTGGAAAGATTCAAATGTTGAATTGATTGGTTCCAGCGAAGATCGAGCTGTAAAAAAATCGTC
TGCTGAAACTGAAAAAGCATGGGCTGCTGCAAAGGCTTGCAATCATGCTGCATTATTTGTTTGGAGAATTGAAAAATTCA
AAGTTGTTGAATGGCCAAAAGTGCAATATGGAGAGTTTTACGAAGGTGATTCATATATAGTGCTGAAGATATTTGAAAAA
GAAAAACAACTGAATTATGATGTTCATTTCTGGATTGGGAAATATTCAACACAAGATGAATATGGAACGGCTGCGTATAA
AACGGTTGAATTGGATACGCTGCTCGATGACAAGCCGGTCCAACACCGTGAAGTCCAACATTACGAATCGAATTTGTTTA
AAAGTTATTTCCAAAATATTGTATATCTGAAAGGTGGACATGAAAGCGGGTTTAGACACGTTAATACTAGAGAATATATA
CCAAGACTGCTACATTTTAAAGGTGATAAAAGAAATATAATTATTACTGAGATATCGGCGACGAAAAAAAATCTAAAATC
TGACGACGTTTTTATTTATGATACTGGATCCAGTATTTTCCAGTGGATAGGCAAAGGTGCAAATAAAGATGAAAAATACA
AAGCACAACAATTTGCTCAGCAATTGAATGCCGATCGAAATGGAAAGTTAAATATTGAAGTACTTGATGAAGAAGAAACT
CCATCAAATCATGAATTATTCAAACATTTATCGGATTCTGATCCCGAGGAGGAGGACCAGCATCTAAAAGTTTTAAACTT
ACAAGAAACCAAACTTTTCAAAATATCTGATGCAACTGGCTCGTTAAAATTTGAAAAGGTTGCAGCCGGAAAATTGAATA
AATCTCAAATAAATGAAGAGGATGTTTTTATTGTTGACAACGGTCAAATTGTTTATGTCTATGTTGGAGAAGGATCGAGT
CCCAATGAAAGAAAGAATGCCTTGATATATGCTCATAATTATTTGAAGGAAACGGATTATCCTCAAGCACCGGTTACGGT
TATAAATAAGGATGTCAAAGGCGCCAATGCCGAGAATTTTAACAAATTAGTTGAAAATTAATCGGAAATTAAATAGCTGG
AATTTGTGTTAACTTTTTCTTTGGTAATTATGATTAAATATATTTGCGTTTATATTTCTGATTTATGGATTTTAATATTT
AATAAACACAATATTTTG
>SMED30035179 ID=SMED30035179|Name=Spondin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=889bp
AGAAAGGAACATGACCATTTTGAGACTTTTTTTCTTATTTATATTACTTATTAATTTATTCAGTAGTCGCAAATGTGCAA
ATTGTGAAAATCGATTCAAATCCGATAAATATTCAATTCAAAACGGTAACGGAGGATTCTATTTGTATTTCACTGACGAG
CATGGCAACCAAGTTGAAAGATTTCAGCCTGGAAAAATTCACCGAATCCTCGTCAAAAACGACATGATCGGAGTCAAGTT
TCACACATTTCAGTTGAAAGTCTTCCCGACTGAAAAGGTTAAAAGAAACGAATCGTTGGGAACTTTCAAATATCCCAAAT
TCATTACCGAGGATCCTCAATGTCCGGGAGTTTTCTCAAATAACAATAAACATCTCGTGTCCAAGGTCCATATCAACTGG
ATTGCGCCTCAATATCCGGAACAGTGCATCAATTTACAAGCAACCGTTGCCATGGACTCGAATCTTGTTTATCAGAATTC
TCACAACTTGCAAAAAACTGTTTGCTCCAATGAAATGTTTACTTTTATAAATGACAAGCCTATTGTAAACAATGGAATGA
AGACGGCTTACAAACAATGTTGCGCCTGTGGAACTGCAAGTTATCGGGTGACTTTTCATGGGTTATGGAACAAAACCACT
CATCCGCAAAACTGGCCCCAAGAAAAGAATCAGCTTCATTGGAGTGGCCCAGTTGGTCACCCACAATCATAATTACTTTA
TTTATCATTTGGGAAGTCAAGCATCCTATCCATTTAGCAGTGTCTGCACTACCGGAGGATCCACTGCGTTAAAGGAAGAA
TTCATATTACCTGAAAATAGATTAAATGTTAAGAGTCTCTTTACGTCAGGCTGGTTAAATGGGGAAGAACAGCTAAATGA
AGAGCGTTC
>SMED30030773 ID=SMED30030773|Name=ATP-dependent RNA helicase dbp2|organism=Schmidtea mediterranea sexual|type=transcript|length=1968bp
TTTCTTTAAACGCATTATTTTATTTAATATTTTAACTTTCCATTTACAATAACAATAATTTAAAAGATGAATTATAGATA
CAGAAGAGAAAGATCTCGATCTCCTATTAGCAGATTTGGAAGTAAATTTCAAAAGAAACAATTTGACTGTGAAATTACTA
AAATAGATTGGCCTACTATTAGGCTGATGCCATTTAAAAAAAACTTTTATATTGAGCACCCAATTGTGACTGCTAGAAGC
TCATACGAAATAGACAGATTTAGAAATGAAAAAGAAATGACAGTCGTTGGCAAAAATGTCCCACGGCCGATATTTAATTT
TAGTGAAATGAATTTTCCAAATTTTATTTTGACCACAATATTAAAAAATAAATGGGTTAGACCAACACCAATTCAGTGTC
AGGGTTGGCCAATGGCAATGAGTGGTCGAAATGTTGTTGGAATAGCACAAACAGGATCTGGAAAAACTGCAGCTTTTTTG
TTACCTGCTTTAATTCACATTCGAGCACAGCCGCCTCTTGTAGCTGGTGATGGTCCAATTTGCCTAGTTCTTGTGCCTAC
CAGAGAATTGGCACAGCAAGTTGAATCAGTTGTAGAAGAATTTGGCATATCAGGTGGATTCAATATGGTGTGTGTTTACG
GAGGCTCTGATCGGCAGAATCAAATAAAAAATTTACACACTAAACGCCCAGAGATATTAGTTGCTACACCAGGGCGCTTA
TTAGATCTCTTGAAACAAAACGAGACTAATCTAAGACGAACTACCTATTTAGTCTTAGATGAAGCTGATCGAATGCTCGA
TATGGGATTTGAACCACAAATACGCGCAGTTCTAAATCAAGTAAGACCTGATAGGCAAATGTTACTGTGGTCTGCAACCT
GGCCATTAGAAGTCAGGAGGTTGGCTGAAGATTTTTTAAATGAGTATATTCAAGTTAATATTGGGGCTATGTCATTACAC
GCCAATCATAATATCTGTCAGTATGTTGAAGTTATTGACGAATTTGGCAAAGAGCGTCGATTAATTGAGTTACTTAAACA
ATTTAATGGTTTGAAAACATTGGTGTTTGTCGCTCTAAAGAAAAGATGTGATAGAATGTCAGATATGTTGAATTCTAGAA
GCTTTAAAGCCTTAGCCATGCATGGAGATAAGCCTCAAAGAGAAAGAGAACGCGCACTTGAAAATTTCAGAAATGGTAGA
TCAAATATAATGGTTGCAACAGATGTCGCTTCAAGAGGATTAGACATTGATGACATAATGTTGGTAATAAACTATGATTT
TCCAACACAAATCGAAGATTATGTACACAGAATAGGCAGAACTGCCAGACAAGAAAAGAAAGGAACATCTTATACATTTT
TTACAAATAATGAAAAAAAACATGCTCAAAAATTAGTTTCAATTTTGGAAGAAGCTACTCAAAATATTTCGGATAAACTA
TATGATTTGGCGGAAGTTCCGTATTCGAGTCGCAAGAAGTCCACTGCAAATGTACCCAAAGGATTAGTAACAGGTACTCC
TGTAAATAACGATTGGGTAGATTCCGTTACTAATAAAAGAATGCCCAATAAATTTAATGGCGGTATTTCTCGTGATAACT
TTTCAAATGTGGAAAGCGATCATAGAAAGCCAGATTATTTTAAATATAATGGCAGACCGGAAGAAATAGAATCGTTTCCT
CCGAGTAATACTTCTTCATTTAGAGATTCCGGAAATTGGAGAAATAATGAGTCTTTTAATAATTACAACCAACCACAACA
GCAGCAGCAACATCAGCCTCCCTATACTAATAATAGCAATAGCTATAATTCAGCCAAAACTTTCAATTATAATGATGATT
TCAATTCTGTAGGAATCATTGCTAATAGATGGTAAACTTAGCTTATATGTTCTTGTTATATGTTGTAGTTTAAACTTTAA
TTGTAATCAAATTTGTTGTAATTATTTTAATTATTAATATTATTCTTT
>SMED30035218 ID=SMED30035218|Name=Gelsolin|organism=Schmidtea mediterranea sexual|type=transcript|length=1573bp
TTATAACAGTCGCTTAATAAAATGATTAAAATCCTTAATTTTTAGTGAATTCAAATAACAAATTTTAAAATCTAATTAAT
AATTAAAATCTGTGACTTTGACAATCGATATGATAAAACAAAAAAAATACAACTGGAAAGACTCCAACTTATCTTTATTT
GGATCTGATACGGAAAAATTAGTCAAAAAAACTTCGTCGGAAACAGAAGCAGCATGGAAATTGGTAAAAACTGTAACTAC
ACCGAGTCTTTTTATTTGGAGAATTGAAAAATTTAAAGTTGTCAATTGGCCTAAAGAAGACTATGGGAAATTTTTCAATG
GAGATTCGTATATCATTTTAAAAATAAAAAAGGAAGAAAATAGTCCTGAATTATTTTATGATATTCATTTTTGGATTGGA
AAAAGAAGTACACAAGACGAGTATGGCACAGCTGCGTACAAAACAGTAGAACTAGATACATTTCTTGATGATAAAGCAAT
ACAGCATCGTGAAGTTCACGGTTTTGAATCTGATTTATTTAAGTCCTATTTTCCGGTTATTACAATAATGAAAGGCGGAT
GTGAAAGTGGTTTCAGACAAGTAACTCCAGAAAAATATGAACCAAGACTTTTACATTTTCACTGTGCTGATCAAAAACAT
GTTGAACTTGTAGAAGTGAAATTTTCAAAAAACTCTTTGGATTCAGGCGATGTATTTATTTTAGACAACGGACTAGAGGC
TTTTCAGTGGAATGGAAAACTATCAAATAAAAATGAGAAAGTTAAAGCAGCACAATTTTTACAGCAATTAGAATCAGAAC
GAAACGGTCGGTGCAAAACAGATGTATTAGACGAAGAAGATACTCCTTTGACGCATAAAATTTACAAATTACTACCTGAT
ACAGCTGTTACTAAGAAGGTTCACAAAGACTTGGCAATTTCCAAACGTCTGTATAGATTATCTGATGAGACAGGCAAAAT
AACGTTTTCTCTAATCTCAGAGGGCAAAACTCCAAAATCTATGCTGAAAGACAATGATGTGTTTATGATAGATAATGGGC
GACACATGTTTGTATATATTGGCGCCGGTGCGTCTCCGGATGAAAAGAAAAATGCAATGTCATATGCACATAATTACTTG
AAAGAAACTGACCATCCATTAATTGGAATTACTTGTCTCCAAGCTGGCCAGCATAGCAAAGAATTTGAGCTTCAATTGGA
CTAGAAAATGATTATGAAATTTTAAATTGCATGGCATTTCAATATTTTTAAATATTTGTGTTTTTACTTAATTTTTACAA
AATGCATGAGTTTATGGTAATTCATTTTCTTAGAAGAGTGAAGAAATATTTTTTTGTTTATGTATTTCATAAATTGCTTA
AATATAATTAAACCTAATGTATATATTGCTGTATTATTTGCTGTTACGAATATTATTGGGCTTGATAGAGCTATCAGAAC
TAACTCGCCATGCTCTTGATCATAACAAGAAATCTACGCAATCAATATATTTGTACCAAAAATCATAACCATTACAATTT
TCACCAACACAAATCAATCTAGTTTTTATTTGTTGCCAGAATCAAATTTTGGG
>SMED30012850 ID=SMED30012850|Name=Spondin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=2699bp
GGTGAATGAAAGATTGAAAGTAAACAAATTTATGAGACATTGACATTATTCATTTAACTTACATCACAGGACGACCAATA
TCACATAATACTTCTTCCTGTTTACAAGGTTGAAGTCGTTTATATAAATCGTCAAAGTCTCAGTTAAGATCATTGATATT
ATGAAAATTTACATCTTAATTTGGAATATCCTTTGGATGTTGCTATGTCTTCATTGGATGATCCAGGAAAGTTTTGCCAT
GAATACTAGAACCAATTGTTTTAAAATGCATAAAAAAACCTACCAAAAAGTCATGATGAAAGATGGAGAATTTCGAATAG
TAATTAGAGACATGAAAGGCAAAATGGCAGATAGATTCGAACCTGGTGAAAGCTATAGAATAATTTTGAATAATGCAATG
TATGGAATGGATTTCAGAGATTTTTCAATATTCGCGGCCTACGAGATGGAGGATTCGTTGCAAATGGAAAGTCATAAAAT
GATTCCCGATGAAGGACTTGGTCATTTTATTATAAATAAAAAATTTGGGTTGGTTGATTATAAATGTCCTAACAGAATGC
ATGGAAATGATAATATGTTTCTAACTTATGTAGAGTCGACATGGATAGCTCCGCATAATCCTATAAATTGTATTCGCTTT
GAGGCTCAAGTTGTAAAATTTGATTTTATGGTGTATGAAAGTATCGGACGTTTAGTAAAAGTTATTTGTCCAACAAAAAT
GTATAAAATGATTAGTGAAGAAAATAAAAACATGAAAATATCTAAACCTTTTGATGAGATGACTCCTATGGTTAAAGAAT
GTTGCGCTTGTGGAGTAGCGTCTTATAAAGTAACATTTATGGGGTTATGGTCAAAGAAAACTCATCCCAAAGATTGGCCA
AAACAAAAGAGCATGGTTCATTGGACCAATCTTATAGGGGCCACACATACTGGCGATTACTTTATATATTATAACGGTGG
TCAAGCAAGCCAGGCAGTTCAAAGTATTTGTTCATATGGAGATAGCACGGTTTTGAAACAGCAGTTCGCAGAAGAGACAA
TAAAACCGCATTTGAAGAGTTATTTTAATACTTCAGGCATGTGGAATGAAGACGAAATTGAACAGAGTAGATCGGGATTC
ATATCGGTTAATCGTACTCATCATTTCTTTAGCTTTCTCACAATGATGGGCCCAAGTCCTGATTGGTGTACTGGAGTAGC
AGCTGTAGACATGTGTATGAATGATTGTACATGGAAGGATGATTTCACCATGGATCTATTCCCATTTGATGCTGGAATTA
AAAACGGTTTCACATATTTCCCAGAAAATTCGGACAGGCAAGACATTCCTGATCCAATTAGAACAATCAACACTACATAT
ATGACCCAATTCCCTTTCACAGCAAATGTTCCAGTTGCCCGGGTAATTTATCAAAAGATCAAACCAAAACACAATTGGGA
GTGCACCAAGATGAATGCAAAACAAGTAAAAGAATTTGATGAAATGAATTCAAACAAAAACGGAAATTCTCAATTCGATG
GAAGTAGTTTGACGAAAAAACGCCGACACATTAACAAGAAAAGTCCCCTTGATGATCCGACTTTGGCCAATATGGCTACA
TTTTTGTGTATAACATCTCCATGGAGTGAGTGGACTAAATGTTCAGTTACGTGTGGCATTGGGACAGAGATGAGATCTCG
AGACATGTTGAAAAATGCTAAAACAGAATTATGTCGTCACTTACCTTTGCTTGAAAGTCGGACATGCGAAGGAAGAAAAC
GTTCGTGTGATTTCTCAGCACCATGTAGCCTTCTTTCCTGGTCAAGATGGGGTCCATGCAATGCAACTTGTGAGATGCAC
GGATACCAACAGAGATCTCGAATGTTTGCAAGATTTGAAGAAAAAGAGAAATGTCTCAAAAACAAAGAAAGACGATTTAA
AATTTTTGAAGAAAAACGGTGCAAAAAAGACACAGCCTTGTGTGACCCAGTTATTATATGTAGTGAGGGCCTAATAATGG
GCAGCAGCTGTGGCAAGCCTGTTATGAAATATTTCTATGATGCTGCCAAACACAGTTGTGTGCCTTTTGAATACCTCGGT
TGTAAAGGAAGTCTGAATAACTTTCCTTCTAAAATGTCTTGCGAAAAGACTTGCTTAGCAGCTGTCAATGCGCTGCCTCA
GTGGAGAAAAGACAAAATGGCTCACTTACAGTTTCAGTCTCAGTCGAATTCAGATAAACGAAAGAAAATGCCAACAATGG
CTAACAAATGTCGGCTTGAAGTAAAATACGGCGGAATGAATTGCGATGGAACAATGGGACCGGACATTCGATATTATTAT
GATAACAGAAATGGACGCTGTAGACAATTTAAATACACTGGCTGTGATGGGAATAGTAACAACTTCCGGTCTTATCACAG
CTGCATTAAGGCTTGCATGCCAGATCAAATCGACTTTATGAAAACTGCTCCGATCAAAGCTTGTCAAGTATCTGAGTGGT
CACATTGGGGTCCATGTTCTACGACCTGCGGTGTGGGAGAGAGATTCAAATGGCGATCTGTGCTTCGGCCGGCATTGAAT
GGCGGTCCAGCTTGTCCAGAGTTATTTCTATCGGAACCTTGTTTCGCGACAACTTGTTGAAAAATTTATATAAATTTTGT
ATCCATTTTTGATGACATTTATAATAATTTTATGGGTAAATATATTTTAGTTCTTCCTC
>SMED30022124 ID=SMED30022124|Name=Gelsolin|organism=Schmidtea mediterranea sexual|type=transcript|length=998bp
TGTACATTAGGATGAATATGGAACAGCAGCGTATAAAACCGTTGAGTTGGACACTTTACTCGACGATAAAGCCATTCAGC
ATAGAGAGGTGCAAGGAAATGAAACTGATCTTTTCAAATCTTATTTCCCAATTATGACAATTATGAAAGGCGGTTGCGAA
AGCGGTTTCCATCATGTTACCCCAGACAAATATGAACCGAGACTTTTACATTTCCGATGCACCGATCACAAGCATGTTGA
ATTGGTGGAGGTGAAACTTTCAAAGCAGGCTTTGGATTCGGAAGATGTTTTAATCTTAGACAATGGCTTAGAGGTTTTCC
AATGGAACGGAAAATTATCCAATAAAAATGAGAAATTTAAAGCCGCACAATTTTTGCAACAGTTGAAATCCGAAAGAAGC
GGACGTGTTAAGACCGATGTTTTGGATGAGGAATTCACTGCTGCCAACCATAGAATATTTAAATTGTTGCCAGATGTTCC
ATTTACAAAGAAAACTCAAAACGATTTAAATATGAGTAAAATGCTTTATCGATTGTCTGATGAAAGTGGAAAAATGACTT
TCTCCTGCATTTCTGAAGGATCAATTCCAAGGTCAATGTTAAAGGATGACGATGTCTACATGATTGACAATGGCAGACAT
TTGTTCGTGTATATTGGAGCACGGGCATCGCAGGAGGAAAAGAAGAACGCGATGTCATATGCCCACAACTACCTGAAGAC
GACTGAGCACCCACTTATCGGAATCACATGCCTCCAATCTGGTCAACATAACAAGGAATATGATCTTCAATTAGAATAGG
ATGTTAAATGATAATTTTGGAATATGTAATAAAAATTAACAAAGCAATTTTTTAAAAACAATAATTTCACAAAATAGGAA
TGAAAATCACAAAAGTATTAAAATTCCATCTATGAATTGAATATCACAATTATAAATTCTTCAACACATAAATCTTGAGC
GAAGCAATAACTTAAAGATTTCAAACATTTACCGCCGC
>SMED30025221 ID=SMED30025221|Name=Eukaryotic initiation factor 4A-I|organism=Schmidtea mediterranea sexual|type=transcript|length=374bp
GGAATGCATGTTGTAGTTGGAACTCCCGGAAGAGTAAAAGATATGCTAAAAAGAGGTCACATCAAATCAGAATACATCAA
AATGTTTGTACTTGATGAAGCTGATGAAATGTTGAGTCGAGGTTTCCAGGAAGATGTCTGTGAGTGTATTACTTATCTTG
AAGCCGACGCTCAAATGTTCATTTTATCTGCCACAATGCCCGATGAAGTTCTTACAGTAACAAAGAGATTCATGAAAGAT
CCGGTAAAGATCTTAGTCAAGACAGAAGAATTGACTTTGGAAGGAATACGACAATTTTATGTCAATGTTAGTCAAGAAGA
ATACAAATTTGACACTTTGACTGATCTCTATGAATCATTAACGATTACACAGGC
>SMED30032088 ID=SMED30032088|Name=Spondin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1776bp
TTACCTGAAAATAGATTAAATGTTAAGAGTCTCTTTACGTCAGGCTGGTTAAATGGGGAAGAACAGCTAAATGAAGAGCG
TTCTGGATTCGTTTCTGTTAATAGAACTCATAATTTATTTAGTATGATTTCAATGATGGGACCAAGTCCGGATTGGTGTA
CCGGAGTGTCAGGAATCGATCTTTGTATGGACGGATGCAAATGGAAATCAAATCTAACAATTCCTCTTTATCCTATCGAC
GCTGGAATACAAACTGGAGAGACCTACAAACCAAATAATGTCACAAGACTTGATGAACCCGACACTATTAGAGAAATTAA
TAAAATTTGGATGAAAAGTAATCCTTTTACTCCAGATACTCCAGTAGCAGAAATCACCCTCACCAGAGTAGAGCCACAGA
AAGACACACAATGTGTTAAAACTCCAGTTAAGGGTGTAAATGAATTTCAAAATGCACAAAAAGAGTCTAGATCTAACACG
CTCGGTAGAAATGGTGCCGTGGAAAAATATAATGTTCTAGATGATCCTCAGTTAGCTCAAATGGCAAAAGCCTTTTGTGG
ATTTTCCGAATGGACCAGCTGGTCACCATGTTCCGTAAAATGTGGAGAAGGTGAAACGTCTCGTACTAGAAATTTGATAA
AAAACTTGAAAAATGAATTGTGTATTCAATTGCCAAGAAAGGAGCAAAAAAATTGTGCCGGTGCTCGATTGGAATGTGAT
CTCTCAAAGAAATGTAGTCTATTACCTTGGAGCTCATGGAGTCCGTGTTCTGCATCTTGTACAACTGAAGGGAAAATGAT
CAGAATTAGAAAATTTGCGAGGTCAAAAGAAAAGGACGAATGCATGAAAAACGTCAAACCAGAAATTATTCTTCAACAAG
TGAAAACTTGTAAATTGGATAAAACGGACTTCCGATGTGATCCGATATCAATTTGCAGCGCCGGTAAATTGGCACCTTGC
ATCAATGGTAAACCCAAGACGAGATTTTTCTACCACATCAAAACTGGAAAATGCGAACCGTTTAAATACTATGATTGCAA
AAAAGGAAATCTGAACAATTTCCCAACTATAGATTCATGTGAAAATGTTTGCTCTAAAGTTATTCAGGAATTACCAAAAA
TAAGACGATCTAATTTAGCCTTGCTTCAAGCAAGAACATCTTATTCAGCTGAAGAGAGTCTTTCGCAAAAAGCCAAAAAC
ATTCCGGAATTCTGCTTTCATGAAGTGGATTCCAGTAAGACCTGCATGAAATCCAAACCAAAGACAATCTGGTATTATAG
TCATCGAAATCGAAAATGCCAATCACTGGTGGATTATGATTGTAAAGGAACTTTAAATAAGTTTTCGACTTTCGACGATT
GCATGAAAACCTGCCGACCTGATTCACAACTCGAATCATTGAAACTTGATAAAGTAGATTGTCAGGTCTCTGAATGGAGT
TTATGGAGGCCATGTTCAAAGTCATGCGGTTGGGGAACTCAATACAAGAAAAGAGTCATTCAAAAGGATTCATTGAATGG
GGGCTTACCATGTCCGGTGCTATATGAATCTCGAAAATGCTTTTCCAAACCTTGTTAATCTGTCAATATTTATTTAAAAA
TTGTTTTTTGTGAATTATAATTTCTATTTCTTAATCTATTTGAAAATGTAATAAATATTACTTTGCGTATTTGATTTAGT
TTAAAGTTTTCTCATTGGTCAATCCGCCGTTGCTAACCAATGAGATCGGCTACTACATCAATTGCGATAATTGACAGTGG
TGAGCAAACCTTTAAG
>SMED30015672 ID=SMED30015672|Name=Gelsolin|organism=Schmidtea mediterranea sexual|type=transcript|length=1435bp
TCTTGTCATTTCAGCATGCATATATCATTAGCGTAAAGATAAAAATACTAACAACTCCTAGTCAAATTGCAACCAACCGT
AAATTGCAGACACACACGAACCAATCACATTTGCTGCCATCGGACAGCCTATGAGACAGCAGATTGGATTAATCAATAAA
GATTTATTGTTCGGTTTTCATTGTATAAATACTGAAATCATTTGTCAATCCAATTGTTAAGTCAACCATGCAGAAAACTA
AAAAATATGACTGGAAAGATTCCAATGTGGAATTGATTGGAAGCAGCGAGGACAGAGCTGTCAAGAAATCATCGGCTGAA
AACGAGCCAGCTTGGAAGAAAGCTAAAGCTTGCGGCCATTCTGAATTGTTTATATGGCGAATTGAGAAATTCAAAGTTGT
TGAATGGCCTCAAAAGCAACATGGGGAATTTTATGAAGGAGATTCTTACATTGTCTTAAATATATATCAAAGAGAAAATG
AATTACTGTACGATGTGCATTTTTGGATTGGTAAATATTCTACCCAAGACGAGTATGGGACTGCTGCCTACAAAACTGTG
GAATTGGACAATTTGCTCGATGACAAACCAGTTCAACATAGAGAGGTCCAACATTACGAATCGGAATTGTTCAAAAGTTA
TTTCAAAAATCTAATATATCTGAAAGGTGGTTGCGAAAGTGGATTTAGACATGTTAAAACTGTAGAGTACACTCCGAGAT
TATTACATGTACGAGGGGAAAAACGTAACATCATTGTTTCTGAGGTGACTGCAACTAAACATAATTTAAATTCCAATGAT
GTGTTCATCTATGACACTGGAACTCACATTTTTGAGTGGATTGGAAAAGGTGCGAACAAAGATGAAAAGTTCAAAGGTCA
AGAATTTGCGCAAGCGCTAAATAGTGACCGCAATGGAAAGGCTAAAGTTGAAGTTGTCGACGAGGCAAATATATCAGAAA
ATCACGAATTCTACAAACATTTATCAGATTTACAACCCGACGAAGATGACAAATGGCAAAATAAGTTATCAGTTAAAGAT
AAGAAACTTTTTAGAATATCTGATGCCAGTGGATCTTTGAAATTCGAAAATATTGCTATTGGAAAATTTGCAAAAAAGGA
CATTAACGAAGATGATATTTTCATTGTTGACAACGGTTTAGAAGTATATGTTTATATTGGAGAAAACGCCAGCCCTAACG
AAAGGCAAAATGCCTTGATTTATGCCCATAATTACCTAAAACAAACCGAATATCCCCAAGTTCCGGTGACAGTAATGAAA
AAGGATGTCAAAGGCAAGAATGCTGAAAACTTCAATAAAGTAATTGAAGGATAAACTCTGGCAAATTTGTTTGTTATTTA
ATTCATAATTTATTTTCAATCTAACTAGGTTTTACTTTTCAATAATAAAATATTTATGTTTGTTTTAAAAAAAAA
>SMED30012543 ID=SMED30012543|Name=Spondin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=2035bp
CTCCAATGAAATGTTTACTTTTATAAATGACAAGCCTATTGTAAACAATGGAATGAAGACGGCTTACAAACAATGTTGCG
CCTGTGGAACTGCAAGTTATCGGGTGACTTTTCATGGGTTATGGAACAAAACAACTCATCCAAAAGAATGGCCAGAAGAA
AAAGGTCAGCTTCATTGGACAGATCCTATTGGAGTCACCCATAATCATAATTACTTTATTTATCATTTGGGAGGACAAGC
TTCATTTGCGGTTGGTAGTGTATGTACAACAGGAAATTCGAGATCTTTGAAAGAGGAATTCACCTTACCTGAAAATAGAT
TAAATGTTAAGAGTCTCTTTACGTCAGGCTGGTTAAATGGGGAAGAACAGCTAAATGAAGAGCGTTCAGGATTCATTTCT
GTTAATAGAACTCATAATTTATTTAGTATGATTTCAATGATGGGACCAAGTCCGGATTGGTGTACCGGAGTGTCAGGAAT
CGATCTTTGTATGGAAGGATGCAAATGGAAATCAAATCTCACTATACCTTTGTTTCCGTTTGATGCTGGAATACAGACTG
GGGAAACCTATAAACCTGAATCTATTACTCGGCTTGATGAACCGGAGCCTATTAAAGAAATCAGTAAAATTTGGATGAAA
AGTAGTCCGTTTACACCGAATGTTCCTGTTGCTGAATTAATTCTGACAAGAATCTCTCCAAAGACCGACGAAAAATGTTC
TAAATCCCCTATGAAAAATGTTGATGAATTTAATAAGTCAAATGAATTAATAAAACAAAATTATCGCGGTAAAAATAAAG
GAATAGCAAAATATAATGTTCTTGATGACCCCCAGCTGGCTCAGATGGCAAAAGCTTTTTGTGGATTTTCTCAATGGGCT
AGCTGGTCTCGGTGTTCAGTGGATTGTGGAGTTGGGGAATCTTCTCGTAAGCGAGAGTTGATCAAGAATTTTAAAAATGA
ATTATGTGTCCAGCTGCCAAGGAAAGAAACCAGATATTGCTATGGTCGACGAAGAAATTGTGATTTTTCTATGAAATGTA
GTCTTCTTCCGTGGACTGAATGGACTAAATGTACTGCTACTTGTAAAGAAGCAGGAAAGATAGCAAGATCGAGAAGATTC
GTGAGGGAGGCGGAACGAGAAGAATGTTTGAGAGAAGTGACACCAACTACTAGACTATATGAGGAAAAGCCATGTAAACT
CGATCAAACTGACAGCCGCTGTGATCCAGTGTCAATTTGCAGTGCTGGAAAATTGCCTCCTTGTACTAGAGGTAAACGTC
AAACAAGATATTTCTATCACGTCAAGACTGGAAAATGTGAACCGTTTTTTTATTTTAATTTTTGCCAGATTGGCCTAAAC
AACTTTCGCACTGAGGTAGACTGTGAGAAAATGTGCGTTAAAGCCATTGGTCAGCTGCCTGGAATTAAAAGATCAAATTT
AGCTCTTTTGCAGTTTCGAACTTCTTATTCAGGAGACCTTTCTCAAAAAGAAACTAAAATACCAGCTCAATGTTTCAACG
AAATAGAATCAGTAAAGACATGTATTCATAAATCTCCAAGAACCGTATGGTACTACAGTCACCGAAACCAGAAATGTCGT
TCTTTGGTGGATTTCGGTTGTCAGGGAAGTTTGAATAAGTTTTCTTCTTTTGAACAATGCATGAAGATTTGTCGACCTAA
TTTACAGAGTCGTTCTTCAACATCTGATAAAGTAGACTGCCAGGTCTCTAATTGGAGTTCCTGGAGGCCTTGCTCTAAAA
GCTGTGGCAAAGGAACACAGATCAGAAAGCGAATAATTTATAAAGATTCTCTTAATGGTGGAGAACCTTGTCCACTTCTT
TACGATTCTAGAGATTGTTACGGTATATCTTGCAATTAGAGATAGCCATAACTATTTTAGTTTATAAAAGCATTCATCCA
GGCCACAGTTGAAAAGCATTTTAATTATTAATAAATTTTAGAATTGTTAATTTTAGTATTTTAGTATATTTTTGCTGTAT
TTAGTGCAAAAAAAAAAGACGGGTATAAAAAGGTG

 

back to top


 

References

Hallez, P. (1887). Embryogénie des Dendrocoeles d’eau douce, Vol 16.

Ijima, I. (1884). Untersuchungeniiber den Bau und die Entwicklungsgeschichte der stisswasser-Dendrocoelen(Tricladen). Vol Bd. 40.

Le Moigne, A. (1963). Etude du developpement embryonnaire de Polycelis nigra (Turbellarie - Triclade). Bulletin de la Societe Zoologique de France 88, 403-422.

Metschnikoff, E. (1883). Die embryologie von Planaria polychroa. Zeitschrift fur wissenschaftliche Zoologie 38, 331-354.

 

back to top