pigment cup



Overview

Non-neuronal, pigmented cells arrayed along the proximal side of the optic cup.

 

pigment cup

 

"PIGMENT CUP" TERM REFERENCES

PMID:21852957 , PMID:22884275

 

back to top


 

In Situ Hybridization Data

Smed IDAccessionNameAliasEnriched during stage(s)Tissue/PatternImages
SMED30018592AFP48372.1ovoovoStage 6, Stage 7, Stage 8eye, photoreceptor neuron, pigment cup, trail cell
SMED30006796AFC87780.1tyrosinasetyrosinaseStage 7, Stage 8eye, pigment cup

 

back to top


Sequences

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30006796 ID=SMED30006796|Name=tyrosinase|organism=Schmidtea mediterranea sexual|type=transcript|length=1755bp
TGTCAGTTTAGTCATGCTCGTAATCACAATAGGCATAGTCTTTGCATCTTTCTTACCTTTGAGTGACTGCCTAATCCCAA
GGATTTGCAGTAGGAATGTCACTCTTTCTAATTCAACATGTTGTCCAATTTATAATGATTTTGTTTGCGGTGGTCCTTTT
CGTGGATCTTGTGAAGTCTCCATTCTTTTTCAAAATCACACTGAGCACTCGGATGTTATCACCGGAAAATTGGAAAATGA
CGACAGACTCAACTGGCCATCAAGATTTTTTAAATTTCTTTGCAGTTGCAAGTCAAACTATGATGGAATAGCCTGTGACA
AGTGTAAATCAGGGTGGCAAGGGGAAAACTGTGAGGTGGTCTCCCCGAGAAAGATTAGACAAAATATTCTTAACATGAGA
TCATACGATGTTTTTATTTTTTTATCGATACTGAACATCAGCAAATATCAGTTGGCCGATTTCCTGATCACAAATTCGTC
CTCAAACCTTCACTGTGACCCTGTCAATGAAGACAACATTCAATTGGTCAATGCTTCCATTTATGATACAATGGTTTACT
TACATTTCTATGCGTCCAGGAGTACAATGTCTAAAGAACTTATGGAATCCTGCACAGACAAGGATAACAAATTAGACTTC
GCTCATAAAGGTCCAGCTTTTTTTACATGGCACCGACATTATTTACTGATGTTTGAAGACTTATTAAGGAGTATTGCAGT
CGAACAATTTGGATATTATAATTTCACATTACCATATTGGGACTGGACGAATCAAATAACTTGTAATATATGTACAAATG
ACTTACTTGGCGATATTCCCACTGAAGATCAAGAATCTAACAGCACATTTTTTAAATGGAAACCGATTTGCCCTCAGAAA
CCTAACGATTTTGATTGTCATATTTGCGATCCAAGCCAGGAAGAACCTTTTTTATGGAGAAAATACTCATCAACGGTAGA
CAGACTTCCTAATCAGAACGAAATTGATGAGTTATTCTCAATCAACCAATATGATTCGGAGCCCTTCAATTCCAGCTCAT
TTAGTAGGAAAAGCTTTCGGAATTTTGCAGAGGGATATTATCGAGTTCATCCAAACTCAGATGATATGAAAATGAAAGAC
ATTGGGAAGGGACTCCCCCATCAAAATATCATGATGCATAATATGTTTTATCAATGGAACTTGGATGGATTTCACAACGA
GTCCCAATGATCCATTATTTCTACTACATCATACGTTTATGGACAAAATCTTTGAAATTTGGCTATTAAGAAATAGACGA
TCTACATACCCTGGGAAATCTTCAACACCAATCGGGCAGCATGCTGACGATTTTATTGTGCCTTTCCTTCCACTAATCAG
AAACAGGAATTTGTTTACTTCAGCAAATGAATTTGGCTACGCCTACGATAACAATATTGTTGGAAATAAATTGTTCACAA
ATCATCAACTAGATTTCGAAAAGAGCTCATCGGAAATTTACTACATCCTAACGGCAGTTGCCTTTGTAGTACTAGTTGCG
ATCGTCGTCGGATTGTACTGCTTCAGACCCAGTCAAATCAGTCACACGGCTTATGAATTCATTGAAGACCAGGAGCAGGA
GGAAAAGACAAATTACTTTAACAACAATGAAAAAATGCCTCTACTGAAATGACAAGCCATTTCTGATGACTATTATAATA
TTGTCACCTTAAATTTTCTTTGAAACAACTTTATTATTGACAAATTTTGAAGAATCCTTTTAAGCAAAATAAAGT
>SMED30018592 ID=SMED30018592|Name=ovo|organism=Schmidtea mediterranea sexual|type=transcript|length=1211bp
GTCATATTGAACACTGAGACTAGCTATCAATAGCTGACAATTAGACGTATAAAATGTTAGGGTACGCCTTTTTGGCCATT
ATTTCACACCAAAATTTCCATGAGTATTTTTCTAATAAGCACTCTACTCGCAAACGATGACGAAATGCCCACAGATTTGT
CATCGAAAACTGAAAAGATTGAAAACCATGAAAAATCTGAAAGGAATCTCTGCAAGTATTCCAGTCAGTTTCTTTCCTGT
TTTTATTCACAGGAAATGTTGACACTACTTATGAGAAAAAATTTCATCAATCAATATTCATTTTATTTAAAGATTTTCTC
GGGGTTTCCACAATTCGTCGATAACTTCAACTTAGTAAATCCAACAGATTTCACCGTCAATTCAAATTCAACAACAATTT
TGCCCTCATTCAACTTCCATAAAACGTCATTGAATATCGAAATGAACACCTCACTGGCCAATTCTTCAAGCACTGGTAGG
TCGTCTCCAACTGAAACTGTGTCTGAAAATCTTTGGTTAGAAAAAGTAAAGGTGGAAAAATATTTCCATTTAATTGAAAA
TCTATCACAATCCCAAGAGAACATTGAAGACATTGTCAAAACGATCAAAGTCAAACGAAGAAATTTTGCTGAATATATTA
AGAAACTTTACCTAAGTGATCCAGCCAAATTTAAGTTGACAAATGGTGGAGATGGAATAGTAAATCCATTTAGAAAACAA
TTCAAAGAAGAACGAGATAAATCTATGGACAAATTTTGCATCGAAGTTAATCACAATTATCAATGTAAGATATGTAACAA
GGTGTTTCCTTCCAAAAAGCACATGCAACGTCATATACGTTCACACGGTGTAAATTTTGATTGGTTGTGTAAATATTGTT
TTAAACCGTTTATTGATTCCTACGATTTAAAACGACATACGAGAGTCCATACAGGAGTTCAACCATACAAATGTCAAAGT
TGCACAAGAAAATTCAGTCAACGATGCTCATTGGAAAGTCATCAGGTGAAAATCCATGGAGTAGCACTGAATTATCTATA
CAAAGAAAGAAGGAACAAGTTGTATCCGTGTGAAATCTGCAGTTATAGTACGTCTTGTAAAGCAACTTGGTTGAGTCACA
TCATTCAGGAGCACCCGAATTCACTTTATGCAAAAGAAGAAGCACTCAAAGGAAAATACAACTGACTTTGAAAAATATTG
ATTTTTCAAGC

 

back to top