neoblast

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ Figures

  ▻ In Situ Hybridization Data

  ▻ Sequences

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  neoblast


DEFINITON:

  A heterogeneous population of pluripotent, somatic adult stem cells and lineage primed progenitors that are required for maintenance and regeneration of all cell types in planaria, including the germline.


TERM DEFINITION CITATIONS:

  planaref-0000004, PMID:21566185, PMID:22899852, PMID:16311336


TERM CITATIONS:

Expand publication list


TERM ID:

  PLANA:0000429


ABOUT THIS TERM:

neoblast

  ↳is a material entity, progenitor cell and stem cell

  ↳contained in tail, copulatory region, ventral region of the whole animal, posterior region of the whole animal, parapharyngeal region, prepharyngeal region, head, dorsal region of the whole animal and anterior region of the whole animal

  ↳develops from blastomere

  ↳existence overlaps Stage 6, juvenile, Stage 5, asexual adult, adult hermaphrodite, Stage 8 and Stage 7

  ↳existence starts during or after Stage 5


Expand to see terms that develops from neoblast



DEPICTED BY:


BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


FIGURES:


Figure 9: Ontogeny of the adult neoblast compartment. 

Asynchronously cycling piwi-1+ cells fuel embryogenesis, giving rise to all temporary and definitive tissues. During S2, some piwi-1+ blastomeres (purple cells) exit the cell cycle and differentiate into temporary embryonic tissues (primitive ectoderm, temporary embryonic pharynx and primitive endoderm). The remaining piwi-1+ blastomeres, located in the embryonic wall (purple cells, S3-S4), continue to divide and express both early embryo enriched transcripts (turquoise arrow) and adult asexual neoblast enriched transcripts (red arrow). As organogenesis begins during S5, early embryo enriched transcripts are downregulated throughout the compartment (purple cells transition into red). Concomitantly, progenitor subpopulations required for definitive organ formation are specified via the heterogeneous expression of developmental transcription factors within the piwi-1+ population (colored cells denote different progenitor subpopulations). Adult pluripotent neoblasts, themselves a lineage, are established during S5 (red cells). Embryonic donor cells harvested during or after S6 function similarly to adult neoblasts (cNeoblast activity, gray arrow). Pluripotent and lineage-primed neoblasts established during embryogenesis are maintained throughout the lifetime of the animal, where they are required for tissue maintenance during homeostasis and formation of new tissue during regeneration.

 

 

back to top


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30001900Bruno-like proteinbruli-1Stage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8neoblast, blastomere
SMED30033466Histone H4Stage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, neoblast, primitive ectoderm, embryonic pharynx, blastomere
SMED30004304Proliferating cell nuclear antigenPCNAStage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8neoblast, blastomere
SMED30010115AFJ24744.1ribonucleoside diphosphate reductase subunit M2-2RRM2-2Stage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8neoblast, blastomere
SMED30007406Q2Q5Y9SMEDWI-1piwi-1Stage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8neoblast, blastomere
SMED30014446Q2Q5Y8SMEDWI-2piwi-2Stage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8neoblast, blastomere
SMED30001362ACC97187.1SMEDWI-3piwi-3Stage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8neoblast, blastomere
SMED30019097AFD29619.1SOXP-1SOXP-1Stage 4, Stage 5, Stage 6, Stage 7, Stage 8neoblast, sigma neoblast, blastomere
SMED30035063AFD29620.1SOXP-2SOXP-2Stage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8neoblast, sigma neoblast, blastomere
SMED30013909AHC00376.1tud-1tud-1Stage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8neoblast, blastomere
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30010115 ID=SMED30010115|Name=ribonucleoside diphosphate reductase subunit M2-2|organism=Schmidtea mediterranea sexual|type=transcript|length=1127bp
GTTTTTAATGAACTGAATCAGGTTTAATGCAAAATAGTCATTTTAATTTCTAGATAAATTAACAGTAATTCTTTCGAGAT
TAGATATTTATTATGGAGATTTTATTAACAGAAGATAAAAGTCGAATAGGATTTCTTAATATACAATATGAAGATATATG
GGAAATGTTTAATAAAGCTCGATCTTCATTTTGGACTGTAAATGAAGTTAATTTATCAAAAGATTTTGCTCACTGGAAAA
AAATGAATGACGATGAACGGTATTTCATTACTCACGTTCTTGCATTTTTTGCTGCCAGTGATGGAATTGTCAATGAAAAT
CTCGTCGAAAGATTCATTCAAGAAGTGAAAATTCCCGAAGCTGAGGCATTTTACAGTTTTCAAATTGCAATTGAAAACAT
TCATTCAGAAATGTATTCTCTATTAATCGATTCTTATGTTACTGATACAGAAACAAAGAATAAATTATTTAATGCCATCG
AAACTATGCCATGCGTTCAGAAAAAAGCTCAATGGGCATTGCGTTGGATTAGCGATAAAAAATCCACTTTTGGAACTAGA
GTTGTTGCATTTGCTGCTGTCGAGGGAATATTTTTCAGTGGTAGTTTTGCATCGATATTTTGGCTTAAAAAGCGTGGATT
AATGCCCGGATTATGTTTCAGCAACGAATTAATTAGCCGAGATGAAGGACTTCATTGCGATTTTGCTTGTTTGATGTTTA
AATATTTAAGTAGCAAACCGTCACCTGAACAAGTTTTGGATTTGATCAAAGAAGCTGTCGGAATCGAGAAGGAATTTCTC
ACCGACGCATTGCCGGTTTCATTGATTGGCATGAACGCTGAATCGATGTGTGAGTATATTGAATTTGTGGCCGACCGGCT
GCTGGTTGAATTGGGCTGTGACAAGTTCTGGAACACAGAGAACCCGTTGGATTTCATGGATAATATTTGCATCGATGGGA
AAACTAACTTCTTTGAGAAACGAGTCGGTGAATATTCCATGTCGAGCGTTGAGGACAAACACAAATTTGATGATGTCAAT
TTCGATATTGATTTTTGAGGGATTCCGTTTTTTGGCGCCAGTGTGCATTTAATGTGTTTTGGTTGTAATTGGCTATTTTT
GTTTGTT
>SMED30007406 ID=SMED30007406|Name=SMEDWI-1|organism=Schmidtea mediterranea sexual|type=transcript|length=2730bp
AATCGAATACATAAAAATTTATTTGACACCAAATACAAAGAGACATTAATCTACAAGTAAAATAAGCGTTCGCGAATTCT
GTCATTTATCGCTGGAGGAGTAACACCACGATGAATCTTGCCAACGAGTTCAGCCAAACGATGGGCATAATGCGTTGGAA
CAGGAACTCGGATTGTTCCCATCCAGTTAAAATACAAATGTGTTAACGAATAAGTTATTTGCTGCAATACACTCGGAGAC
ATAACTGAAACCTCATTTGTTTTCTTGTTTGTAAACTTAGTGTCCATAAGAACATTATAATTCGTAGGAGATGCTGTACC
TTTAGTTGTTTTCTGAGACACCAAGTAAAATTCATAGAAATTGGGTTTCACTATTTTCTCATCAACCACAGTACCAGGAT
TTGGATTAGCCCCATCTTTGAAAAATTTAACACTAATTCTCTTCTTAACCACAACATAAATAATTTGGGGCAAAGTTTGA
TTTTCGTAAATTTTCTCTATCATTTTCATAACAGCATCAGTTTCGAACTTTTTGGTAAATGCTAACTGTGAATCTCCAAC
ACCGTCACGATAAATAATCAAACGAAGAGGCATAGTGTTAAATTTGTTTTGGAATGTTGTAAGGGCCGTTAGGAAGTTTT
TGCCCAAATTTTCGTGAAATTCATTTTTACCTTTAGATGAATTGACAAAACTGATATACTGAGAAAATTTGGCACTAATT
GAAAATACGGATGCTTGAACAGATCTTTTACCGGTTTTGCTATGAAAAGTATCCAATCCTACAATCATAGTCGGTGCCAT
TTTAAGATTAATACCCCATGGGTCGTATCCTAATTTAGAAAACATTTGCATAACTGATTTATCTGCAACCGTTTTACGAC
GTCGATCATCTCTATTACTTCCGTTTCTCTGCGTCACACACTGAGTCAATAGACCTGTAGACATTGTAAAATTCTTTACT
TTTGCGTAAACTTTATCATCAGGAATGAACACTAATGCCATATGTACCTTGCTTACACGAATAAAATCTGTTAAAGCGTC
TTCAACTTCATTGGATCGACATGAAGATATACTGTCCATTGTGTAATTGATTCTTAATCTTCCTATTTCTCTTTTAACAT
CTTCAATAAAATTGTTGAAGTGACTAGGGTTTCGATCAACAACCAGTACACCAAAACGATGAGCTGTGCCTTTAGGAACG
TCAAATTTAATTTCCCCAAACTTCCAATCATCAGGGATTTTAGTATTAATTTTAACTTCGTTTGAAAATATATCAACTGG
AGCCAATTCACGACCACGAATCGTAATCGGTTGTTCTTCAATACACATCCCCCAGCTCTTCATATAATCTTTTGATTTCC
CAGCTCCGGTCCACTTACAAAAATCTCTTATGTCATTTAATCGTTCTCTAGGCTCACGTTTCAATACGGTTCCTAAATTC
TTTTGCAAATTTATATTACTTCTTTCACTATCCGAAAATCCACATAAATAGCATAATTCACCTGGAATTGATAAACTTTG
ATCTGTTTCTGTAGGTCCTTCAGGTTCATTTTCAGTTTTTTTCTTTTGGGCGAACCATCGATCGCTTGACTCGCGATATA
ACAAATGGTTGTTTGTCATTTTTCAAATTAATGTTATACCGTTGCTTGAAATAATTCAAATAGGATATCTTTTTATCGCC
TAGCTGAACCTCGTCATTAACATCCATTTCTTTAATATCTGAAATTCTATACGTCTTGTTATTATACTTGGTAATTATGT
CCCTTCCTATTAATTGATCAATTTGATCTCGTCGATACACTGATACTACATTGTTTTCATTTAGAACACGATTAATTCTT
TCAAGATAAAGTAAAGTCGAAGCAGTTCCATTTTCATTTGTTCCTCTTGTAATTGTAGTAGAATACCCTCCTAATATCTT
GAAATTGTCCATTTTAAAAAAGCTAGGTCCTTCTCGAATACCACCACTTTCACAATTTGATCCCAGAAAAAATTGTCTAC
CAATTTTTTCTTGTCCCATAAATATTTGAATATTATTAAATACAATATTTATCATCTGATAATATTCTTCAGAATTTTTT
AAAAACGTCGTCAGCAATCGTATGGAAATTTCAACATCTTTGATAACTAAGTTTTCTGTATCTTCATCTGAGTGCCACTT
AGAAGTCGTAAATAATCTTCTGCCATCAAAACAAAATGGTTGACCATTATTTTTGCTGTTTGCATAAGCTAATAATAACT
CTAGCTTAGTACGGATACTTTTATTCTCCATAACTACATCATACATGTAAAATGGTCCTTCGACTTTAATATTAAAGTTA
GCGTAGTTAGACTTGAGACTAACTACTCTTCCATCTTTCCCTATTTTGTCTGTAACTGTATCAGGCTGTAAAGCAGGTTC
AATAATTGCGAATCTTCTTTGGAGACCTCCTCTTCTTGGTCTTAAATTGGGATCACTTGTAACATTAGTTGAATCCATTT
CGTAAATTTGAGTAAAAATGTTAAAACAAAGACTTCGGTTTAAATAAACAAAATATACTATGTAAAACGATAAATATAAT
TGCTTTAATGGTTTATGATTTGTATTATATAATAATAATAATTTAATTTCCCTGTGAATATTATATTAAAATATAGTAAA
AATTACTCGTAAATGTGTGTTAAAGTAATAGGATTAAATTAAAATAAACATTTTACGAAATAAGTTCTAGTCAATTATGA
AGTCTTTTCT
>SMED30004304 ID=SMED30004304|Name=Proliferating cell nuclear antigen|organism=Schmidtea mediterranea sexual|type=transcript|length=907bp
CTAAAAGGTAATAATTTAAATTTAATTAGAACATTGTTTTAATATTCGGTTATATTCTCCATTATTCTAAATTATGTTTG
AAGCAAAATTAATAAAAGGCGAAGTTTGGAAAAAGGTTATAGAAGCTATAAAAGACTTAGTACAAGAAGCAACATTGGAT
TGCTCAGAAAATGGAATTAGTCTTCAAGCCATGGATACATCTCATGTGTCCTTAGTTAGTATGCTTCTTCGAAGTGATGG
TTTTGAGACTTATCGATGTGATAGAAATGTCAATCTCGGTCTTAATATAACAAGTGTTTCAAAAATTTTAAAGGCGCTTG
GTAGTAATGATTCCCTAACAATGAAAGCCGCTGATTCAAGTGAAACAATTTCGCTTTTGATAGAATCTGCAAATGAAAAT
GAATTATCTGAATACGAAATAAAATTAATGGACTTGGATGGAGATCACTTAGGTATACCAGATACTGAATATAAGTGCAT
TGTGAAAATGCCGAGTTCAAAGTTACAAAGAATATGTCGAGATTTAAGCCAAATTGGAGAAGCAATCACGATTTGTGTTA
CTAAAGATGGTGTAACTTTTGCTGCTGCTGGAGATCTAGGAAAAGGAGCTATAAAACTTAATCAAAATTCTAGTGCTGAC
AAAGAAAATGAAGGAGTAACTATTGAAATGACCGAACCTGTTTCGATGACATATTCATTGAGGTATTTCAATATGTTTAC
AAAGGCTGCACCTCTTTCTTCTCAAGTATCTCTGTCGTTGACTGAAAATGTTCCAGCAGTTATTGAGTTCATAATCGAAG
ATTTGGGATTTATTCGATATTACCTAGCTCCTAAAATCGAAGACGACGAGTGAAAGTTTAACTATTAATGTTGTATGTTT
AATAGATGTTATTTTGTTTAAAAAAAA
>SMED30013909 ID=SMED30013909|Name=tud-1|organism=Schmidtea mediterranea sexual|type=transcript|length=2414bp
ATTTAGAAAATGGAGGCAACTTGCGATGTTTTTTTAACGAATTTACCTAAGTCGATTAATGAAGTAGTTGTGAAGAACTT
ATTTTCTTCTGCTGGGAAAGTGTTAAAAGTGAAAATAATAGATGACAAAAGAAACGAAAATCAGAAGCTATGCTTCGTTG
GATTTCGAACTATGGATGAAGCATTAGAAGCCGTCAGAATTGCAGATAAATCTGATGCGTTTGGTGATCCAATTAGAGCC
AGTATATCAAAGAAGTGTTTAGACGGAATGGAGAATAATCAAAATAGATCAAATAATAACAGAAATGATTCAAGTTATAA
AGGAACTGATTCATTTTCAAGAAAGAGTGATTCTAATTTCAAGGATAGTGAAAAGTATCCAACAAACAATGGTGACTTTG
CACAAGTAAATCGTTTAAACAACGTTGGAAGAGGAAGAGGAATCCAGACTAAAATTATTAGTGGTCCACCTTCATTCAAA
ACTAATGAAATTAAGTTAAACGATATTAAACTTAAAACAAAAGAACTGATTGACATCGAAATCGTCGATTTAAGTAGAGT
TGACATTATACTTATAAGGCCAGTAAAGTCAACGGAAAATTCAAAAATTGAAATAGCAGATTTATTGTCACAAATAAATT
CAAATAAATCGAATCTAATGCCAGTTGACTGTCCTAAAATAGGAGATTTTTGTCTTGCAAAATGGACTGAAGATGATTGC
TATTATCGGGCTGAATTGTTAGATATATTAAAGGATGGATCTTTCAAAGTTACTTTTGTTGATGAAGGAACTTCGGGTGA
TATTGTGACTGATTTGAAACACATTCCGACTGGTGCTTTACAGCAGTATCCTAAACAATTTTTGAAGGTTTCAATCGGTT
GCTCAGACGCAAAAGAATTAATGTCATTTATTTTACAAGAGTCTGAAGGAAAGGTGATTAAAATTTATTGGCTCGGAGAA
TATTGTGATTCCGTGCCTGTTGTAAATTTATTTCTGAATGAAGATGAAATTGTGGAAAAATATACCCAAATAAATAAAGT
AAATATCAGGAAAAAATTCTCACAGACATTTGATGATCTCCCAGTACATAACCTCGAAACTAATTCACATTTTTCAATAG
CACCATCAATGTATAAAAACCGAAATGATTTTATTCTTCAGATGAAAACTTTCTCGGTATCTTTAAAGCAAAAAAAATGT
CCTACGGTTTTACCAATTCCTGGTGATATATGTATATATGAGAAAAGGAATGCTAATGGCGAATCATTTCTTCGTTGTGT
TATATTAAGGCGCCAACTTTTTTCTTTTGACATCGAGTTAATAGATATCGGTGAAAAAATAATGAATGTTAATATTGATC
ACCTGTACACAGTCGAAGATATTCATGTAAAAGACGCTCCCTGTGCTATTACTTGCGATTTAGATAGTTCTATTAATATA
GATGGTATTAAGCTCCCTCAAGATTTGATCGATGGTGTTCTCTTTAATCTTAAAAAGTACAACAAAAATAATAAATACAC
TGTAAATTTCATTTTACCACAAAAGAAAGCTTATGAATATGCAAAAGTATCATATAAAGATTTGATTGGTAAAAGCTTTA
AAGTAATAATGTCGCACGTTGTCTCTCCCATTAATTTCTTTATTCAACTTGATGATGGAGAGCATCAGCTTGCACTTGGA
GATATTCAAGAAAAATTAAATATTAATTATAATGGATCACCATTCAAAAGTGCTAGCGATGTTAAAGAAACTCAGGCAGT
TATTGCTCCTTTTATTGTTTCCGGAAGTGATGCGGAACTTTTTCGGGCTTATGTTTTAGAGAAACGAAAGGAATCTCCAC
AAATTCATGTATTGTTTATTGATTATGGTAATGATGAATGGGTGAATTATGAAACTTTACTGAATACAAATGAAGAATTA
GTTTCTAAACCAGGTTTCGCAATACATTGTAAATTATCTCTAAATATTAAGAAGGAAGCGTGGAGTCACGCTATTGAATT
ATTTAATGATTTAGCTGGTTATACTGAAAATGACCAGGGGACGTTTGTAATGCAGGTTATTAGTGTCGATGGTGATTCGT
TAGTTGTGGACTTGATTTCAGAACTGAAAGGTTCGTTGACGGCCATCTTAGAAAAAAGTGGTACATGTGTAAAGTCCAAT
GAACCAATATGTAATGGAGGAGGACCCCAAGTTAAATTAAATGGCGTTTCAAATGATAAATCTCAATCAGCTATTCTTGA
AAATTTATCTGAAGGAGAATTATATAAAAAATTTATTGAACTAGAACGGAGATTAAGTGCTTTAGAGATATTGATGAAAT
AATGCTACCCGCGCAATTAGTATTATCAAATTATGATAATCTAGTCTTGATGTGTTTAAAATTTTGTATTTTAACATAAA
TTTATTCCGTGTTG
>SMED30025482 ID=SMED30025482|Name=Histone H4|organism=Schmidtea mediterranea sexual|type=transcript|length=552bp
TGTCATTATCAAAATATTTTCAATATATAATAAATCAGAAATCACTAAACAGTCATTACTAAACTATTCTAACTCAAAAT
GTCTGGTCGAGGAAAAGGAGGAAAAGGCTTAGGTAAAGGTGGAGCTAAAAGACATAGAAAAGTTTTGCGAGACAACATCC
AAGGAATCACGAAACCAGCTATTAGAAGGTTAGCTCGCAGAGGTGGCGTGAAAAGAATTTCTGGTCTTATCTATGAAGAA
ACTAGAGGTGTTTTAAAGGTTTTCCTTGAAAACGTAATCAGAGATGCTGTTACTTACACTGAACATGCTAAGCGTAAGAC
AGTCACAGCTATGGATGTTGTTTATGCACTTAAACGACAAGGTCGTACTTTATACGGTTTTGGAGGGCCACAAATGTTGA
TTGTAGTGAATTGTTCAAATATTGTTATTCTATCTAGTAATTCTCAGCAATTTTATTAACGTTATTTAGAAATTAATTTT
ACAATTGCTAATTTCGAATGTTATATCTGGTGTCAATGTTCAGTTATATTATTTTACAAATGACTTGAAATG
>SMED30022389 ID=SMED30022389|Name=Proliferating cell nuclear antigen|organism=Schmidtea mediterranea sexual|type=transcript|length=915bp
GTTATTAACGTTATTGGACTATAGTTTTATTATCATAAATTTTTGAATAAAATTGAGATCTTCTTTTAATAATGCTATTT
GAAGCAAAATTAAATAAAGTAGATGCATTTAAAAAGCTGATTGATTCGGTTAAAGAATTAATCCAAGAAGCAGTTTTTGA
ATGTTCATCCAAAGGTATTGAATTACAAGCAATGGATAGTTCACATGTTAGTCTAATATTTCTTTTAATTAAAAAGCAAT
CTTTTTCGTCTTATAAATTTACGAGAAATGTATCTTTGGGTGTAAGTCTTGTAAGTCTATGTAAAATACTCAAACTTTCT
CAAATTAATGATTCAATTACAATTAAAGTTGATAATGAATGTGAAACAGTCGAATTTGTTTTCGAATCATCAGATAGTGA
TCGAATGTCTGAATTCAGTTTGAAGTTAATTGACTTGGATATTGACTGTTTAGCTATTCCGGAATCAGACTATGATTGCG
TAGCAACAATCCCGTCTGTAGAATTTAACAAAATATGCCAGCAATTAGCTGTTATTGGAAGCACTGTAACAATTGTAGTA
ACTAAACAGTCAATTCAATTTTCTTGCTCCGGAGACATGGGGAAAGGGAAAATATTATTAAATCAAACTGTAAATAAACC
GAGAATAGAAGATTCTATTAATATTGAAGTTGTTAATCCATTATCAATGGTTTACTCGCTTCGATTTTTTCATATATTCT
CGAAGGCCTATTCGCTTAGCAACAGAGTTTCTTTATCTTTTGCTAATAATTTCCCAGCTTTGGTGGAGTACAGCATGAAT
GAATTGGAAGGTCATCTACGATTTTACTTAGCTCCAAAATTAGATGATGATTGATTTTGCTCTTTTTCTAGTTTTGGGGT
GATATTTTAATTGTAGTGCTTTTTTAGTATGGTTA
>SMED30019097 ID=SMED30019097|Name=SOXP-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1596bp
GGAATAACAGCCAATTAGGGATCAGCTGCAATTTGGCCTATGATTGGACATTGATTTTTATAGTCTCAGGCGTTCTCAGC
TTACGTGTGCACCTTTTTAGTGGACACGTTAAATTTGATAGGTGCTTAGTGGTGTTGATTCCTGTTTGGAAACTGTATAT
AACCAAGGTTATTTGTTGCTTTGAGACAAATGCAACACAATCAAATAATTAATTATGCTATGTTCAAATTGTTCAAACAA
TCAGGATACTTTGAAATTATGGATGGTCCATTTAGCTTCTTGTCACCCATTACCTCCTGAATGGCTTAGTGAAAAGGCCA
AAGTATTAAATGATGACGAAAATCAGCGCCCCTATACAATTGTCACTGATTCCCGAAAAAGAAGGCGACGTCCAACCACA
CCAAGACCACTAAATACGTTCATGATTTTTTCGAGGCATATCAGACGAAATATTCTCTCAGTGTTTCCGGATGCATCAAA
TTCCCAATTAAGCAAAGAGCTTGGAATTTTATGGAAGAAAGTCACAAATGAAATTAAATCCCTTTATGAAGAAGAGGCAA
AGCGATTGGCTCAATTACATGCTCTTGAATTTCCCGATTATAAATATCAACCAAAGAAACGAGTCCGAAGATTTGGAAGA
GCGATTTATGATCGACAGCCCTGTACAACAGAAAGATCTAACTCAACTAGTGCAACAGACGAAGAAAATGGTAAAGACAA
TAATAGTGTTCAAGACGGTAGAAGATCAAGCGATATTGAGAATCAGTATATAAGATATTCAGTTTTGGGTAAAAATATTG
TAAAACGAGAATGTCAGTCCTTTAATAGTCCTTTAAAAAGCGACAACGTTAAATTGGAAACGCAAGAACAAGATTTTATC
CAAGCGATGCCCAAACCTCTAAACGTCCGAATAACGAATTACAACGAAAACAGTATATTTTTACGACAACAAAGATTACC
ATCAAGTAGCACAATGTATTTACTTCCTTCAGAAAACCTAATAATTAGTAATGGGATTATGGGATCACAGGACTTGGGTG
AGGATTATTGTAGAGAGTTGTATATAATTAATGATTTTTTCCCAGAAAATGTAAACATAGACGATGAAATTGATATAACA
GGAAACATTTTTAGCAATGATTTAGATTTAGAGTGGTCTGAAATTGATGAAAATTACAAACAAGATTTACCAAATCTTAA
TTCATTATTTCAACACTAATATATTTGATTTATAAAATATTTAAATATTTTTTATTAAACAGTCTTTTACATGTACATAT
AGTATTGGAACTCTTCTCTGACTTATAAGATAACAGAGATATTGTAATAAGATTAAATTGGTTATGTGTTTCGGTTTTTG
TAAGATTGGTAATTTTCAGAAGAATTTAGACTTTTTTCATGGAAATTGGAATTGAGAAACAAACTGAATAAAGAAACAAA
TTTTTGAAAAAAACGAAACAGATACTTATTATCAAAAGAAAATTATCTGAAGCATCGAGTCGGTATGAAAAATAAACTAA
TTAGTCAGAAAATTTTTGATGAAATAACGTCTAATGAAATTAAGATCTCCAAGGAATACTTTTTCTAACATTTGAT
>SMED30029163 ID=SMED30029163|Name=Histone H4|organism=Schmidtea mediterranea sexual|type=transcript|length=537bp
AGGTTACAGTTTTTCAACTAATACCTCAAAGAAATAATGAAAGATGGACAGTAGAGTTTTGTCACCATCAGGAGACCAAG
TGTCATTTAGGATGATAATAGCCCAGTTAAGGAATCTTGCTGATCTAATCAATGCCAAAAATATTACAAAATTTCGATTT
AAAAGAAGCTAAAGGAGAAAAATTACACGGAAAAGTTCAGAGGTACAACATCCAAGGCATCCCTAGGTCTGCAATTAAAC
GATTAGCACAAAAAAGAGGTGTGAAAAGAATTCATGGGCTTATTTACAAAGAAACAATATATGTTATCAAGTTAGTCCTT
GAAAATGTCATCTTATATGATATTAAATACACATTGCAAGCCAAGCAAGAAACTTTTACTGCCAAGGATGTTTTTAATAT
TCTTGAATGTTTGGAGTTTTCTATTTTGTGATAACATCCTTCCCCAAATGAAAGTTATCAGATCATTTTGCAAAGTTTGT
GAGAAGGGATATATATTTACCAACAAGAAAAATGTTTTGAATTTAAGAATAGGACTC
>SMED30014446 ID=SMED30014446|Name=SMEDWI-2|organism=Schmidtea mediterranea sexual|type=transcript|length=4773bp
ATTTAATTTTCGAAAAAAAATATGGAGGAAATACCAGTAAAAGTAGCTAAACTTGAAGCGAATGGAAGTGAAACAAGAGG
TAAAATGGGAAATCGTGGTGGCCTGAGAAGAACATTTAGAATTGTTGAACCTAACTTGCAACCTGCTGATATCACTGAAA
AAACAGGAAACATAGGAAGAACAGTTAAATTACAATCAAATTTTACCAAATTCTCTGTTTTGCGTTCAGAAAAGTTCATG
ATGTATGATTCCGTGTTTTCTCAAGTTGGTTTGTCACCCAAAGTAAAATTACAGTTTATTGTTCGAGTCTGCCAAGAAAA
TAAATTGCCAGGGGCTTTTTGTTTTGATGGAAGACGTCTATTTACTAGTGAAAAATGGCATGGAGAATCGGACATTCAAG
AATTTAGTCATGATGAAAAAAAAATGACACTAAGATTGGTATCAACTATCCTTCCTGAAACTGAAGAATATTACCAAATG
ATCAATGTATTACTCAATAATTTACAAGTAATGTTAGGTCAAGAAAGAATTGGTAAAGGTTATTTTTTAAGCCCAAATAT
TACAAAAGATGAAGTTCCCCGTAATTCTGGACCGACATTTTTTGAAACCAATAGTTTTAAAGTTCTTGGGGGCTTTGGTA
CAACTTTACAAAGAGGCACAAAACCAACTGGTGAATTAACCACTCTTTTATATATTGAGCGTATTAACAGAGTATTAAAC
GATAACTCTGTTATGAAGGCATACAACAGAAGAAGTATCGATCAGTTGATAGGCAGAGATATCATAACAAAATATAATAA
CAAAACTTATAGGATAAGTGAAATAAAAGAAATGAACGTAGATGAGAAATTTGAAATGGGTGGTAGAACTTTATCGTATG
CCGAATATTTTAAGGAACGATATAATATTCGATTAACTCAAGGCGATCAACCATTTGTTCTAACGCGAGTGAAGAAACCA
ATGCGTCGAGAAAGAAAGAAAAAAGACGAAGAAGGAGTGGAAAAAGAGAAAGAAAAAGAACGCGAAAAAGAGGCTCCAGA
AGAGAAGGACATGACTCTCAATATTCCTGGAGAGTTGTGTTTCTTATGTGGGTTTTCAGATCAAGAGAAATCGAATATGG
ATCTGCAGAAGAATTTAGGGTGCGTTTTAAAAAGAGAGCCACGTGAAAGATTGGATGATATACCAGCTTATTGTAACTGG
ATTAAAAATAGTGATGCGGCAACTGGAATGTGCAATAAATGGCAGCTGAAAATAGATAACAAACCATTAGAAATCGAAGG
TAGAGAATTACCTCCATGCGATGTAATAAGTGGTGGCAGCAAAATTAATGAAAAAATGGGAGATGATTGGAAATTTGGTC
GAGTTCAATTTGATATTAAGCGTGATCGTAAGCATGAAATCGATGTGGTCATCGTTGATCGAAATGACTTTCAGTATAAA
AATTTTATGAATGATGTGGAACAAGAATTAAGAAACATGAGAATTGATGCTCGAGTTGGAAAGGTTAATACTTGTGGTCC
AAATGATGTTGAAAGATGTTTGAATGATGCCGCTAGAAGTGGAAGTGGGTGTGCTAAAATGGCGCTGGTATTCGTCCCAG
ATGATAGAGTATATGCCAAGGTGAAATCATTTACCATGAGTACTGGTCTTTTAACCCAATGTGTAACAACACGTAATGGT
ACTAATAGAAACGATAAACGAAGAAAGGTGGTTTCAAGTAAAACCGTGATGCAAATATTTGCAAAATTCGGATATGATCC
ATGGACAGTTGAAATTAAATTGAGACCAACTATGATTGTCGGTATGGATACCTATCATAACAAGTCCAGCAAGAAATCAA
TTCAAGCATCTGTATTTTCGATCAACAGCACATTTACACAATATATGAGCTTTGTTAATTCTCCTAAAGGACGTCAGGAA
TTCCACGAAACTTTAGGCAAAAATTTCAATTTAGCGTTAGAAGATTTCAAGAAACGTTATGACATATTGCCCCAGCGAAT
TTTAGTCTTTAGAGATGGTGTTGGAGATAACCAACTTCAATTTACTAAAAATTTTGAAGTTGATGCAATGAAACCGCTTA
TTGAAAATATATACAAAGGCAACGGATTCCCTGTTCCACAAATCATTTATGTCATCGTAAAGAAAAGAGTCGGCACTAAG
CTTTTCAACAGAGGAAATAATCCAAATCCTGGAACTGTTGTGGATAAAGAAATTGTCAAACCGAATTTCTATGAATTTTT
CCTAGTTTCACAAAGAACAACGAAAGGAACTGCAACTCCAACTAATTATAATGTTTTAGAAGATACTCGATTGCTAACGA
AAAAAGGTACTATGGATCCTATGGCACCGAATGAGCTGCAAAAGATTACCTATGCTCTAACTCATTTATATTTCAATTGG
ATGGGAACTATCCGAGTTCCGGTTCCAGTGCATTATGCGCATAGATTGGCTGAATTAGTTGGAAAGGTGCATAAGGGCTC
TAATCCCGTTGCCATTAATGAAAGAATAAGAAATAGGCTCTTCTATTTATAAAAAGATCAAAACTTACATTTTTCTGTGT
TGATTACTATCCCAATTGTGGATTTAATTGTTTCTGAAAGCTGTTCATTCAAATTCTTCTGAAATCCATATTGATTCGTA
AGCAGCCTGTATTTGAATACTAAAATTGATAAAGTAGTTATAAGTATTGTAAAAGTATTAAATATTTGTTTATGTTATTC
GTAATACACTTGGGTTATTGCAATGTTTTAGTTGTTTTTCAATGATAATAAAGCTTAGCTGTATAAATTCTTTTAGGTTT
TTTAGAAGGTTTATTTATATCGTGTAATTGATTGTCGTGTTAATATTAATTAAATAAAAGTTTGATGTAATTGCTTTGTG
TTACGCATAATAAATCTTACGAAATTTCTGAATACAACTGCTGGTGATCGGGATATTGAATGCCGGGTCGTTTGAATTAA
TAATACAAATGCTTTCGATTATTGTCATTAATATTTTCTCCAGTGCGTAATGGGCCAGAGTTCCGGTGCCATGATTAATG
GTTCCTAAATTTTAGAAATAACATTTTGAATGACATGTTAAATGTGTATATAATAAATTTTCTAGTTTTTTTGCTAAGAT
TTTGAGAAATTTTAGTTACCTGTTTTTGTTAATTGCTTTGATAATTTCAATGCTGACACGTGCAGAATTTCACACATCTC
CAGCAGTCGACTGAATTCTTGGATTTTGTTTGATACAATTATGCTTGCAGATGTTATGGCGCATAGATCCAAGAAGGCTG
TGAATCTTGGGTCTTGTTTTGTAAAGGAAGCTTTGTAAAATATGATGGGACAGTTGCACATAAATTCTAGGAATCCAGAT
TTTAGGCAAGATTGAAGTAATGTTGAATGGTTCTATTATAGAATAATCAGTTGCACTTTTAGATAACCAATATACCACAA
AGAGCCATCCGCAAATTTTGAAAGCCCAAAGCATTGAATCGTTGTCTATGTTACTCAGTATAGACAGCAGTAAAATGGCG
CTTTTTTGATATTGTAAACCGAAATGATTACTAGAATTCATTGTTTCGTCAAGAGATTTCGCGAAACTCTGAATATTATC
TGATTGATTTGATACTATTCCTTGGAGTTTACAAATTGATTTCAGTTCCAAATTCATACTATTGTGTTCTGCTGATTTGC
TACTATTGGAGCTCTATAAGGAATTATTAGAATCAATTTTGGTTTGATAGTGGGTTTTGCAATCATTGGCTTATTGTGGG
TTGTGTAACCATGGAAGTAATTGTGAATAGTTATAGTGCTCGCTCTGCATAAAATAATATTTAATCAGTGCTTTAAAGTA
GATTTTTAACGATTATTATGAAAGATTTCTCTTATATATTAATGTTTTTGTATCCTTCAAAAGTTTACTAAAAATAATGC
ACATTTGAAATTTACGCGTTACCATAAAATGTCTGAAGTGGTCCAAAGCAATAAAAGCTTAAAAAGAAAGTTCTTGTTTT
TAAATGTATTGGGATATACTCCCACTAACCTTCCGTACTCCGCTGCCTCCCTTCCCATCACATACAATATTTGCTAGTTC
TACTTACAGAGTTGAAAATCGAAAAATTTTCCCAGTCAATGTCCATGATTATGCTGAATAAATTTTGTCCGAACATAATA
GAGATTGCCTCAGCCAGTATTTCTTTCGTTGTTGAGTTTTGATGAATGACATGTGAGACTAAATTTATGGACAACCATTG
ATTTTGGTTTTGCTGAAGTTGAGACTTCTTACGGTAAAGATAAACACGAAATAATGATAAACTCTAATCAAAAGATATTA
CAAACAAATATTATGATATCAAAACCTTCTGTCGAACCAAGGCACTTGTGTGAGATAATAAATGAAGAATGAATTCGAAA
AAGAAGTCATAATTCGAACATCGCTCCAGAATGCTGTCACTGACTTTGACTTCAATCACATTTTCCAATATTGAAATCAG
ACCGGCGATCACATGGACCCTTGATGATTCAGACTGACCACTGATTACGGGTTGATCGGTTAAATTATCTAGAGATTAAA
ATAATAGTCGGTAAAGGAAATTATCCATATAAACGGGAAACAGAAAAGTTTTAACCATGGTTTCAAAAGCTTTTGGGACT
ACCCCCAGCTTTGCAAAACAATTTTTTAACGCTCTTGTTATGACTTGAATCAACATTGTACAATTGTTACAATAGACTTG
ATGATTTACTTATTTACACCCCATCTAAATTGTTTCTTAACCCTTTGCCACCC
>SMED30000837 ID=SMED30000837|Name=Histone H4|organism=Schmidtea mediterranea sexual|type=transcript|length=1387bp
ATTAACACTAAATTTTGTTTATATAATGATTAAATATTTCAATAATCAATTAATTGAAAAATGTCTGGTCGTGGTAAAGG
AGGAAAAGGGTTAGGAAAAGGTGGAGCCAAGCGTCATCGTAAGGTTTTACGTGATAACATTCAAGGAATAACTAAGCCGG
CAATTAGAAGATTAGCTCGTAGAGGCGGAGTAAAAAGAATATCTGGTTTAATTTACGAAGAAACTCGTGGTGTTCTCAAA
GTTTTCCTGGAAAATGTTATAAGAGACGCTGTTACTTATACTGAACATGCTAAGCGTAAGACAGTAACTGCAATGGATGT
TGTTTACGCTCTTAAACGCCAAGGAAGAACTTTATACGGATTCGGAGGTTAAATGTGAAACCAATGATATTTTAAGCTAA
CATTTATTTGTTGAGAATGTTTATGGTCCTCCTTAGGGCCACAATTTTTGATTGTTTACTTTATTTTGTTAGCATTACGT
AATTTTACAGTGATTGGTTATCTTGCTGGTTGTCTGAAATATTAAATAATAATATGCTATAATTAAATGATATTAGTATA
GAAAACAAAAATCGGTTTTATTGTTTGATCAACACAATGAATATGTTTATCAATTATCATCATTTCCAGTTTTTCGATTT
CAGTTGATAATAATTATTTGCGAATTTGTGATTATATTTTCTAATGGGTTGCGAGACATAAATGAGCGTGCAGATATCAC
ATGCGAACCTGGTTCATGTAGTGTTTTGAGCTACACACTGCAGATAGACGATCAAATCTATAAAGTGAAAAAAGGGTTCA
AATCAGCTTGCAGCACCAGACTATGTGAAAATTGTGCTCACAAAGGTGATTGGTCAATGAGACTGATTGACGGAAACAAA
TATATGGTACGACAAGTCAATAAATGTTTAACTAATAATATTTTGGCAGTTGAGCAACTTTTCACAAATTTATATACTCC
TGTCTCAGATTTTACATGCTCCTTGCATAAGTGCTCTAAATATAATTATTCTTATAATGGAAATATGATTAGCTTTAGCT
ATATAGGAGTTTGTGACCATTCTTACTGTGACTCATGCCGCTATTCCGACAATTGGAGTCTATTAACCGGATATTTGCAG
CGGACGACCATTTCATGTTATGTTGTCGATAAAATTAGACTTGAAGATTATTTTCTCATTCCAGAGTTTACCGAAACCTT
CTATACACTAATTCGGAAATTAGCAATAACTATAAGCTGCGCTTCATTTTTGTGTTTGGTGATCATTCTTTTGGTTTGTT
TTGCTAAAAAATGAGATCTTACAGAAGCTTTAAGGAACTTAATTTTATTTAACAATATATTTATACTTAGATCTAATGCT
TTGAATGATCCTTTCGCAAGTCCATCC
>SMED30033466 ID=SMED30033466|Name=Histone H4|organism=Schmidtea mediterranea sexual|type=transcript|length=421bp
GATCTCACTATATAAATAAGTATTTGTCCCTATTAATTCATAACAATTATTCAACATGTCTGGTCGAGGTAAAGGAGGAA
AAGGACTAGGAAAAGGTGGAGCAAAGCGTCACAGAAAAGTCCTTCGTGATAACATTCAAGGTATCACAAAGCCAGCAATC
AGAAGATTAGCTCGTCGAGGTGGTGTTAAGAGAATTTCTGGATTGATATATGAAGAAACCCGAGGTGTTCTTAAAGTATT
CTTGGAAAATGTTATTAGAGACGCTGTGACATACACTGAGCACGCTAAGCGCAAGACAGTAACTGCCATGGATGTCGTCT
ATGCTTTGAAACGACAAGGAAGAACTTTGTACGGTTTTGGAGGTTAAATAACACTTTCATATTTGTGAATGTTTTAGCGG
CCCTCTTTAGGGCCACAAATG
>SMED30014692 ID=SMED30014692|Name=Histone H4|organism=Schmidtea mediterranea sexual|type=transcript|length=464bp
AAATCTATATAAATCTTATATGAGATAAATGTCAGGTCGAGGAAAAGGTGGAAAAGGTCTTGGTAAAGGAGGTGCTAAGA
GGCACAGAAAAGTATTGCGTGATAATATTCAAGGAATCACTAAACCTGCAATTAGACGTTTAGCAAGAAGAGGTGGCGTT
AAACGAATATCTGGGCTGATTTATGAAGAAACACGAGGTGTGCTGAAGGTTTTTCTGGAAAATATCATCCGCGATGCTGT
CACATATACGGAACACGCGAAGCGAAAAACCGTGACTGCAATGGATGTTGTTTATGCTTTGAAACGTCAAGGTCGAACTC
TTTATGGGTTCGGTGGATAATCATTTTGTATTTTATTATTTAATGTTGTAATTGCTATAATTGTTGCTAGTATTAATCTT
ATTTTAATAAATTATTTAACTGGATTTTAATTTAAATATGTCGGTTTTGTAAATCCAATTTGTA
>SMED30001362 ID=SMED30001362|Name=SMEDWI-3|organism=Schmidtea mediterranea sexual|type=transcript|length=3093bp
AATTAAGAGACAGCCATTTATGTTTATTTTTAAAATAAATAGTATATATTTAAGTTTCGAATTTTCAGCTACAATTTAAT
AGTACATAATTATACGATGTCAGGAAGTAGTGGAATAGGTAGAGGCCGCAGTCGTGGGCTGTTGATGCAAAAGTTTCTGA
ATAAAGATGTTCTTGTTCCTTCTGTTGAATCTTTAGAAGACAAAGCTCTTAATAAGCTAGGAATTCCACTTCCTGGGTCT
ACCGTAGAAAAAAATACAGAGTCAAGTTCTATATCAAGTGGAGATTCAAGAAGTAATCCCAGTGGAGATTCAAGAAATAA
CATAAAACTACAAGATAGTGATATTGAGAATCGCAATATTACCATTGTTACGCGACCATTATCCTGCATAGGCAGGGGTC
GGGGTTTAAGCAATCCCTCAAGTTTAACTACGTCATCGGGTAAATCGGATAAAATTACTGAAAACGAAGAACCTGGTCAA
ATTAAAAAGTTTGTAGGTCGCGGTAGAGGATTGTTGAATTCTCAGAAAGAATGTTCAAACTCTACTCCATCTGAAGTTTC
AAATGAATTGAAACAAATGAAAATTTCAAATGATGATAAAATGACGGTTTCTTCAGAAGCAAAGTCACAATTTGAGAACA
TTGAAAAACCTATTAGTAAATTTCGTCGACGCGAATATCCAACTCAAATAAAAGAACCATGTAATACAAGAAATGATTCA
TCGCCATCTTTAACTTTAAGTGCTAATTACGTTAAAGTTAGGACTACACAACCCCATATATATCAATACCATGTTTCCTT
TGCACCTCCGATAGATTCAAGGTTGATGAGAATTAAAATAGTTCAAGGGTTATCAGAATCAGATTTAGGGGTTGTCAAAG
AAGCAAGAGCTTTTGACGGTATGAATTTATACATTCCTCAACTTTTAAAAAATAAAGAGACAATAATTAAAGTAAACAAA
CCGACTGATAAGACTGTCGTGGATGTTAAAGTAGTTTTTACTAACAATGTTAATTTTAGTGAATGTCCTATGGTTTATAA
TGTTCTTTTTAAAAGAATTGAAAATTCCCTCAGAATGGTTAAAATTGGTAGGGATTATTTCTACCCTGAAAAAAAGATAG
TACTTGACCGTAGAAGGATGGAAATATGGCCGGGATATGTAACAAGTATCCAAAATTTTGACGGTGGTTTACTGTTACAA
TGCGATGTGTCACACAAAGTTATTCGAAATGATAGTGTGTATGACATAATGATGGAAATTAATAAAACTGTTAACAATAA
AGGTCAAATGCAAACTGCTGCGATTAATCAACTATTGGGTCAAATTGTGTTAACTCCTCACAATAACCGAAATTATAGAA
TTACTGATATAGATTGGGCTAAAAATTGTTTAAGTGAATTCGATAAAGGAGGCGAAAAAATTAGCTACCGGGATTATTTT
AAGAACACGTATGGGCTACAAATTCGTGATCTAGAGCAGCCTATGATAGTTAGTAAATCTAATAGCAGATCTGGTAAAAA
CCGAGGTCCCAAAGGATCAAAAGAAGTGGATGGTGGATTGGTCTATTTAATTCCAGAATTGTGTATGCTAACTGGTTTGA
CAGATGACATGATTAAAGATTTTCGTTTGATGAGAGAATTACACGAGCATTGTCGAGTTACTCCCAAGAAAAGACACGAA
GCCTTACTGGAATTCGTGGATAACATATATAGCTGTGAGGAAGCTAAGAAACTTTTAGGGTATTGGGGTATAACGATTGA
AAAGGACACTGTCAACATAAATGCTTGTAAAATGAATCCAGAAATGATATATTTTGGAAATGAAGCTTCTGTTAGTGCTG
GGGAACAAGCTGAATTTAAACAAGCCTTGGCACATAATAAAGTTATAGGTGGTATTCGTATTGAAAATTGGATATTAATT
TCTCCAAAAAGTTTACTGACAAAAGCAAATGGTCTGTTACAGGCTTTAATGAGCAAATCTCCTAGAGTTGGAGTTATGTT
TGGAAAACCCAAAATAGTTGAAATGAACAATGATCGAACAGAAGAGTATTTAAAAGAATTAAAGAGAAATGTGGCTCCTG
GTGTGCAGTTAGTAGTTACAATTTTATCTGCTGTTAGAGAAGATCGATACAATGCAATAAAAAAATTTTGTTATGTGGAT
TGTCCTGTTCCAAGTCAAGTGGTATTAGCCCAAACATTGAAAGAAGGGCCTAAATTAAATAGTGTGGCAGTTAATATAGC
CCTTCAAATAAACGCAAAATTAGGTGGAGAGCTGTGGGCTGTCAAAATACCTATTAAGAAGTTTATGGTTGTTGGACTTG
ATGTTTGGCATGATACTAAAGGGAGAAGTAGATCAGTTGGAGCCGTAGTTGGTTCAACTAATGCGCTATGCACAAGGTGG
TTTTCGAAATCGCATTTGCAAGAACAAGATAAAGAAATTATGTACGTATTACAGTCGTGTATGTTAAGCCTTTTAAAGGC
TTATTTTGAAGAAAATAATTTTTTGCCTGAGACTATCTTTATGTATAGGGATGGTGTTAGTGATGGTCAGTTAGGATATG
TTCAAAAAACTGAAATTGAACAATTCTTTAAAGTTTTTGAATCGTTTAGTGCTGATTATAAACCTAATATGGTATATAAT
GTTGTTCAAAAGAGAATAAATACTAGGCTCTATGTAAGTGATCCGAAAAATAAAGGACAAATAAATAACCCCAATCCTGG
TACAATTGTCGACCATACTGTTACGAGGGCTAACCTTTATGATTTTTTTCTTGTTTCTCAATCGGTTAGGCAGGGAACTG
TAACTCCGACGCATTACGTTGTTTTATGTGACAATTCTAAATACACTCCGCATCAGGTTCAGTTGATGGCTTATAAAACA
TGTCATATATATTACAATTGGCCGGGAACGGTTCGAGTACCAGCACCTTGTATGTATGCTCATAAATTGGCATATATGGT
TGGTCAGAATTTGAAAGCTGAACCTAGTAATCTTTTATGTGACAGACTTTTTTATTTGTAACATATGTGTTTCTATTTGT
ATTATTGTTAAACTGCATTTCGTAAAATAAATTAATTTCGTTATAAAAAAAAA
>SMED30001900 ID=SMED30001900|Name=Bruno-like protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1713bp
CTTTTGAGGGAAAAATAATTCTTTTATTAATAATGTTTCATCATTGGAATATAAAATAAAATATTAGGAGAAAACATAAG
TTAACCAACAATATTAGCCACATATTTCGTTTAATTATTGGTCTATCACTTTTCATTTTAACCAATTGTCTTGAGATAAT
GGAGAGTTTATCCTTAATTTTTATTATAAATCACTGGTTTTGATAGACTTATTAACAATGGAAAATTATTTCAAACTTTT
CGTTGGTCAGATACCTCGAAATACACCAGATAAAGAAATTAGACTTATTTTTGAAGCTTTTGGACCAATCTTTGAATTTT
TAATTTTAAGGGACAAGAAAACTGGTTTTCATAAAGGATGTGCTTTTGTTACATTTTATCATAAAGACTCTGCAGAAAAT
TGTCAAAAGGCGTTACATGACAAGAAAATCCTAAACGGGATGAATCGACCACTTCAAGTGAAACCAGCTAAAAATAAGTT
AGCAAAAAATTCAAGTTTGAATGGGGAAAATCAGACAGAAGAGCAGGTTTTCAGTGATGAAAGGAAATTGTTTGTTGGAA
TGTTGAGTAAAAATCAAACTGATGAAAATGTACAAAATATGTTCACAAAATTTGGCAAAATCGAAGAGTGCACTGTATTG
AAAGACCAAAATGGAAATAGTAAAGGATGTGCCTTTGTCAAATTCGTGAACCACACCGATGCTTGTGCAGCAATAAACGC
TCTTCATGCCAGTCAAAAAATGGAGGGTGCTTCATCCAGCCTTGTGGTTAAATTTGCTGACACGGATAAACAAAAACAAA
TAAGAAAATTGCAGCAATATATTCCAGATTTAAGCATTTTAAATTCGCGCATTCCTATTAATATTCCATACTATTCACAA
TACGGTACAATAATTAATCCAGAATATAATTCAACAATTCCTTCAAACCAATATATTCGAAATTGTAACGAATATATTCT
TGCTGCTCAAATTCAACAAATAAATTTGTTTTCTAATTTATCATCGGTCTACCCATCTAATTCAATAGTGTCAATGCCAT
CCAGCCATCCGGTACCAATGATTGACTATTCTGTTCCTATTAACAACTTTCCACAAACTGACCAAATAACAATGAAACCA
ATTGTTGATATACAGCCAATACCTCCAGAAGCTGTACACCGAACCATCGTAACTCCAGGATCACTCTTATCATATCCTTT
TCTTAATGTTCAAATTCCTACAGTATATCCAAACGCCTTTTCCAATGGAAATTTAACAAGTACAACACAAAGTTCAACAG
ATGTGAAAACCACTCCTTTGCCAACAGGTCCTGAAGGCTGCAATCTATTTATTTATCATCTGCCACAAGAAATTGGTGAT
TTACAATTATATCAAATTTTTATGCATTTTGGAAACGTTATCAGTTCTAAAGTTTATGTTGACAGAGCAACAAATCAAAG
CAAATGTTTTGGATTTGTCAGCTACGATGATCCGGCATGTGCCAATGCCGCCATCAAATCTATGAATGGATATCATATCG
GAACAAAAAGATTAAAAGTTCAGTTAAAAAAACCAAAAGAAGCAATAAACGAAATGAAAAACTTCAATCAAATGTTATCA
TCAACTCCCGACATAAACCAAGTATTTTGTTCATCCTAATGATTGTGATATTTTACAGGATTTTCTCGACCATATTGAAA
GCCTGATTGGTGATATGTAAAATGACCCACCGT
>SMED30035063 ID=SMED30035063|Name=SOXP-2|organism=Schmidtea mediterranea sexual|type=transcript|length=2664bp
TGTACATTGAATTCAATATTTAATAGTGATTAACTTATCCAAATTTTCAGCCACTTTTAGTTTAATTTGCGTGTTTTGTT
GAGCAGTTTTTATTGGCGCATTTTATAAAAAATACAAAACCAATCCAAATCAGTTTGAATCATTGTCAGATTTTAGTCGT
GCAAGATACATTATTTCATTTTAATTCTCTAGCATATGACATTTAAACATGGAGCTGAATTACTCGTTGAATGATAATAA
TTTCAATTTACAATTAGAAAGCGAGTCCTTGACTTATTTCGATTTATGCCAAAAATGTTCAGCGTACCAAAATAGTCTTA
GAGACTGGATGAAACATTTAGTTGACAGACATCCTTTACCTATTCAGTGGATGAGTGATTTGGCAAATAATTTAACAGAT
GATAAATTATCTAAGCCATATTCGACCGTTACAGAATCCCGTAAAAAACGCAAGAAGCATATCACTCCAAGGCCATTGAA
TAGTTTCATGATATTTTCCAGACATTTAAGAAGAAATGTTCTTATTTTCTTTAGTGATGCTTCAAATTCAGAAATAAGCA
AACTTCTTGGGAAGTTATGGAATAACATTCCAGCTACCATTAAATCGATGTATGATAATGAAGCTAAAAAGCTTGCAATT
TTACACTCCAAAGAATTTCCTGAATATAAATATCAACCTAAAAAGAAAAAAAAACAATATCTAACGAAATGCCCCATTAA
TTCCACACCTTTGTCGAGTAATTCATATGAAAGTATTCAAGATATTAATTCAGTAACGGATACACTACAGAATTCATCTA
ACAACTTACAAAAGGAAAGTAATCCGACCTCTGTTTCGTCTTATGGAAGCAATCAGGAATGTAATAATTCATTTAAGAAT
CATAGTGTACAGTCCAGCAATTTTCCCAAAGAAATCAACCATAAACCAAGTAGAAAAATTGAAAAGCAATCGTGCAAAAT
AAGTTCCAATCAAATAATGGATGATTCAGAAGGGGCTGAATCCAGTCCATCATCATTTAAAAACACCATTAAAAATGAAA
TTTATTCCTCTTATAGTCCATTTCTAAATGAATCCCATAGCATTCTTTCAGATTTAAGTTACTCTTCGTCTCTCAATAAC
GTTTCAAAACACACTAGCGATTCCATTATAACGAATTCTCCTATCAGAGAAGAAATTGTCTTAGAAAATAATCAGCCCTC
TCAACAGAATAATATAAACAATTACCGACACGTATTTCAGAGAACTTCGACTCTATCCAACAGTTTGTTGACCCCTTTAA
CCATTGTCACAGAAAAAGTTGACGAACAGAAAGATCTTCCACCATCAAGAATCAATATCCGATATGTGAAAATTAACAAA
CTACCGATTCAAACAAAATCCGATTTCCCATTGACTGGATATTTTCAAAATTTCAATAACGACTCAAATCTTCATTTTCA
GAGTTCCATTCACGCCCTGAATACGACATTGACTCCAGATCTGTCGGTAAAACGCGAAGCCACTGTCAACAACAGCATGA
CAGATTATATCAATCGAAAACGTACAAATGTCGATCCACTTATCATCGATGATATATTTGAAAACGAACAATTTGAAGAT
GAGGAAGTGTTGAATTTTGACAATCCTGATAACAATAACAGTTCTCCTTGGTCGTTTAAATCGCCTAACTTTAAAATATC
TACCGGTTCCTCGACACTGTCAGACAATCCGTACAAAGAACAGTTTTGTTCTTCCCCGTTCCATCTATCAGAAACTGATA
CTCAACCGATTCCAGTTCAACGATTGCCAGCAATCGGCTCATGGTTAAAGTCAAACTATTCTGAATTCATGATCTGATCC
AATCTATTATTCTATTCAATTGTCTGTTTTCATACAATTAGGATTACTTGTTATGAATTCTAGCTGATTTTGAGTGTGTT
TATAAAGCTTTTGTAACGCCTTTTCTATACAGATGTTCGATATATATATATAAATAAATAAATATAAATATATAACAATT
TTATTGACATTGTACAGTATTCCATAAGCCCGATCTTGTAACGCATTTATTACTATACTCAATAGACCAATCTATATGTT
CTCATAATTTCTATGTTGTTATTGTACACGGGAATTATTACTATAAATGATGCGAATTTATCACTTTGTAATTGAGGGAA
ATTATCGATCAATTTGCGCTTTCAGACATTTTTCATGTATAAACTTGTTTTTCTCTTTTTTATCATCAAAAATTTAATTT
TTTTGATATCGCTATTCATCATATTATTATTCTCCGTTGCATTTGTTAGATTATGTAAATTTTTATATGAAAATGTTGTT
ATTTATTGTATTTTTATACGATTTTTTGCTTTGGATACACTTTTATCAAATCATATTGCCAGTGTGAGCATTTATTGGAC
TTGTTGTTATTGCTGCTGCTCGAATAATTGCTTCATACGGGGAGTCTCGATATTTTCATGAAGCGATTTTCATGGTTGCC
GCTCTCCGCCGCCGCCATTCGGTGTAAATATCAATTGCATTGCCAGCACGTTTTCTCAAACTCAATTTTTGTACTCAATT
TCAATTGATTTATGTTCATTTTATTTTTCATAGAAATGAGTAAATAAATTTTCATAAATAGTTTTGTTTTCAATATTTTT
AGGAAATTTGAATGTGTCTCTAGA

 

back to top



PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in neoblast. Click this link to learn more about PAGE.


PAGE Curations: 3076


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
neoblastSMED30007406SMEDWI-1SMESG000036375.1 DQ186985.1smed_ncbi_20200123PMID:24704339
Vogg et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30007406SMEDWI-1SMESG000036375.1 DQ186985.1smed_ncbi_20200123PMID:23318641
Chen et al., 2013
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30027299PBXSMESG000022232.1 SMESG000001913.1 KC353351.1smed_ncbi_20200123PMID:23318641
Chen et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30012293SPT16SMESG000033905.1 JX070080smed_ncbi_20200123PMID:23629965
Zeng et al., 2013
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30035373histone deacetylase 1SMESG000060876.1 HDAC1smed_ncbi_20200123PMID:23629965
Zeng et al., 2013
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30032645Heterochromatin protein 1-1SMESG000004606.1 JN216838smed_ncbi_20200123PMID:23629965
Zeng et al., 2013
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30032563MCM5SMESG000005389.1 JX070081smed_ncbi_20200123PMID:23629965
Zeng et al., 2013
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30032631Smed-AlbinoSMESG000068148.1 KX531078.1smed_ncbi_20200123PMID:27551436
Wang et al., 2016
FACS sorted cell population asexual adult fluorescence in situ hybridization evidence
neoblastSMED30020436Nuclear distribution protein nudE-like 1SMESG000016071.1 HO006501.1ncbi_smed_estsPMID:22411224
Cowles et al., 2012
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30016141lissencephaly-1SMESG000054739.1 SMESG000035997.1 JQ650355.1smed_ncbi_20200123PMID:22411224
Cowles et al., 2012
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30034763c-Jun N-terminal kinasesSMESG000043618.1 JNKsmed_ncbi_20200123PMID:24922054
Almuedo-Castillo et al., 2014
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30020168c-Jun N-terminal kinasesSMESG000043618.1 JNKsmed_ncbi_20200123PMID:24922054
Almuedo-Castillo et al., 2014
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30004277InnexinSMESG000055258.1 AY067503smed_ncbi_20200123PMID:17670787
Oviedo et al., 2007
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30012037InnexinSMESG000055258.1 AY067503smed_ncbi_20200123PMID:17670787
Oviedo et al., 2007
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30018622smedxin-11SMESG000034762.1 DQ851133smed_ncbi_20200123PMID:17670787
Oviedo et al., 2007
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30013674Hox class homeodomain protein DjAbd-BbSMESG000033048.1 SMED30013674smed_20140614PMID:27034770
Currie et al., 2016
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30013674Hox class homeodomain protein DjAbd-BbSMESG000033048.1 SmedASXL_008593SmedAsxl_ww_GCZZ01PMID:27034770
Currie et al., 2016
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30029233Homeodomain proteinSMESG000043155.1 SMED30029233smed_20140614PMID:27034770
Currie et al., 2016
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30029233Homeodomain proteinSMESG000043155.1 SmedASXL_005553SmedAsxl_ww_GCZZ01PMID:27034770
Currie et al., 2016
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30003764N-alpha-acetyltransferase 40SMESG000077166.1 SMED30003764smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019097SOXP-1SMESG000010063.1 SMED30019097smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005171SMED30005171SMESG000024345.1 SMED30005171smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011277Tspan1SMESG000066703.1 SMED30011277smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033583SMED30033583SMESG000060313.1 SMESG000049383.1 SMED30033583smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027929Tubulin beta chain SMED30027929smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010488SMED30010488SMESG000003538.1 SMED30010488smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000949Tgs-1SMESG000058876.1 SMED30000949smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000949Tgs-1SMESG000058876.1 SMED30002872smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002872Tgs-1SMESG000058876.1 SMED30000949smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002872Tgs-1SMESG000058876.1 SMED30002872smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022975Homeobox protein DTH-2SMESG000037282.1 SMED30022975smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035424NLK-1SMESG000023289.1 SMED30035424smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019803SMED30019803 SMED30019803smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023082SMED30023082SMESG000021722.1 SMED30023082smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005571Delta-1-pyrroline-5-carboxylate synthaseSMESG000045474.1 SMED30005571smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016265Tubulin beta chainSMESG000022928.1 SMED30016265smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007346Achaete-scute-like proteinSMESG000026861.1 SMED30007346smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017430Protein disulfide-isomeraseSMESG000023147.1 SMESG000017020.1 SMED30017430smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017430Protein disulfide-isomeraseSMESG000023147.1 SMESG000017020.1 SMED30028938smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028938Protein disulfide-isomerase A6SMESG000023147.1 SMESG000017020.1 SMED30017430smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028938Protein disulfide-isomerase A6SMESG000023147.1 SMESG000017020.1 SMED30028938smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033646SMED30033646SMESG000022408.1 SMED30033646smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007599SMED30007599 SMED30032778smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019234SMED30019234 SMED30019234smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032778SMED30032778 SMED30032778smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028798Farnesoic acid O-methyltransferaseSMESG000029910.1 SMED30028798smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007744SMED-SMAD6/7-1SMESG000002697.1 JQ278719.1smed_ncbi_20200123PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30007744SMED-SMAD6/7-1SMESG000002697.1 JQ278719smed_ncbi_20200123PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30014131RPTOR independent companion of MTOR, complex 2 aSMESG000033571.1 SMESG000033570.1 JN815259.1smed_ncbi_20200123PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30025757JUNLI-1SMESG000067959.1 AFD29623smed_ncbi_20200123PMID:26062938
Tejada-Romero et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30025910Microtubule-associated protein futschSMESG000030021.1 SMESG000025422.1 SmedASXL_011384SmedAsxl_ww_GCZZ01PMID:26114597
Zhu et al., 2015
FACS sorted cell population asexual adult colorimetric in situ hybridization evidence
neoblastSMED30033302RNA-binding protein MEX3BSMESG000030021.1 SMESG000025422.1 SmedASXL_011384SmedAsxl_ww_GCZZ01PMID:26114597
Zhu et al., 2015
FACS sorted cell population asexual adult colorimetric in situ hybridization evidence
neoblastSMED30031380Pogo transposable element with ZNF domainSMESG000014324.1 MF411143smed_ncbi_20200123PMID:29557542
Han et al., 2019
FACS sorted cell population asexual adult fluorescence in situ hybridization evidence
neoblastSMED30031380Pogo transposable element with ZNF domainSMESG000014324.1 MF411143smed_ncbi_20200123PMID:29557542
Han et al., 2019
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30031380Pogo transposable element with ZNF domainSMESG000014324.1 MF411143smed_ncbi_20200123PMID:29557542
Han et al., 2019
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30023910Pogo transposable element with ZNF domainSMESG000014324.1 MF411143smed_ncbi_20200123PMID:29557542
Han et al., 2019
FACS sorted cell population asexual adult fluorescence in situ hybridization evidence
neoblastSMED30023910Pogo transposable element with ZNF domainSMESG000014324.1 MF411143smed_ncbi_20200123PMID:29557542
Han et al., 2019
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30023910Pogo transposable element with ZNF domainSMESG000014324.1 MF411143smed_ncbi_20200123PMID:29557542
Han et al., 2019
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30022937RNA polymerase-associated protein RTF1-like proteinSMESG000029426.1 GU562964smed_ncbi_20200123PMID:20215344
Fernandéz-Taboada et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30023708ZFP-1SMESG000066384.1 SMED30023708smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30026364SMED-P53SMESG000078256.1 SMESG000078255.1 SMED30026364smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30012332EGR-1SMESG000034285.1 SMED30012332smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30006464TCF15SMESG000044395.1 SMED30006464smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30008505SOXP-3SMESG000051170.1 SMED30008505smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30000303HoxC12-like proteinSMESG000022668.1 SMED30000303smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30000938Homeobox domain-containing proteinSMESG000060967.1 SMED30000938smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30010878six3-1SMESG000009894.1 SMED30010878smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30011923SMED30011923SMESG000009894.1 SMED30010878smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30006353SMED30006353SMESG000004009.1 SMED30006353smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30023969LIM domain only protein 3SMESG000037556.1 SMED30023969smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30011950Transcription factor GATA-3SMESG000079514.1 SMED30011950smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30011047GLI-1SMESG000073727.1 SMED30011047smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30006011T box transcription factor tbx2SMESG000023378.1 SMED30006011smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30022628G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000060403.1 SMED30022628smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30032499C2H2-type domain-containing proteinSMESG000075452.1 SMED30032499smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30015704Hox class homeodomain protein DjAbd-Ba SMED30015704smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30019046SD2SMESG000021468.1 SMED30019046smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30000485SMED30000485SMESG000069311.1 SMED30000485smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30033839Sp5SMESG000023227.1 SMED30033839smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30003592SMED30003592SMESG000013335.1 dd_Smed_v4_10619_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002877IQ motif and SEC7 domain-containing protein 2SMESG000070179.1 dd_Smed_v4_8602_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003764N-alpha-acetyltransferase 40SMESG000077166.1 dd_Smed_v4_5816_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002081SMED30002081SMESG000047315.1 dd_Smed_v4_5128_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019097SOXP-1SMESG000010063.1 dd_Smed_v4_7227_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000448460S ribosomal protein L8SMESG000017087.1 dd_Smed_v4_108_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005171SMED30005171SMESG000024345.1 dd_Smed_v4_629_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033595Lipase_GDSL domain-containing proteinSMESG000081136.1 dd_Smed_v4_6241_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034829fancd2-like proteinSMESG000066544.1 dd_Smed_v4_12881_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033583SMED30033583SMESG000060313.1 SMESG000049383.1 dd_Smed_v4_158_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021776Histone H3SMESG000074574.1 SMESG000074479.1 dd_Smed_v4_8630_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027701ATP dependent RNA helicase DDX5SMESG000012031.1 dd_Smed_v4_3816_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023874Aminoacylase-1SMESG000028017.1 dd_Smed_v4_1519_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028420Nucleotide-binding oligomerization domain-containing protein 2SMESG000018415.1 dd_Smed_v4_10594_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020558transmembrane protein 143-likeSMESG000072164.1 dd_Smed_v4_3158_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024101Elongator complex protein 1SMESG000075698.1 dd_Smed_v4_10377_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021402Cell division cycle 20-like proteinSMESG000051492.1 dd_Smed_v4_10335_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030988T-complex protein 1 subunit thetaSMESG000023665.1 dd_Smed_v4_903_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024374Protein LSM14 homolog B-BSMESG000033950.1 dd_Smed_v4_1594_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022627SMED30022627SMESG000053935.1 dd_Smed_v4_4504_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025981SMED30025981SMESG000059781.1 dd_Smed_v4_12332_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029180Poly(A) polymeraseSMESG000072012.1 dd_Smed_v4_3033_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029180Poly(A) polymeraseSMESG000072012.1 dd_Smed_v4_1470_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027850Ubiquitin like 5SMESG000027082.1 dd_Smed_v4_1564_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033360SMED30033360SMESG000074320.1 dd_Smed_v4_12537_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026157GAS2-like 3SMESG000003786.1 SMESG000003788.1 SMESG000003787.1 dd_Smed_v4_3326_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025780Serine/threonine-protein kinase PLKSMESG000022441.1 dd_Smed_v4_4273_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035929SWI/SNF complex subunit SMARCC2SMESG000031576.1 SMESG000013315.1 dd_Smed_v4_1804_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030135AAA domain-containing proteinSMESG000045800.1 dd_Smed_v4_14599_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035373histone deacetylase 1SMESG000060876.1 dd_Smed_v4_695_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017896Activator of 90 kDa heat shock protein ATPase-like protein 1SMESG000066442.1 dd_Smed_v4_2497_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017941Clustered mitochondria protein homologSMESG000033500.1 dd_Smed_v4_1597_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015938C2H2-type domain-containing proteinSMESG000065334.1 dd_Smed_v4_1345_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011690Heterogeneous nuclear ribonucleoprotein A2SMESG000050993.1 SMESG000050994.1 dd_Smed_v4_1194_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019516cyclinH-like proteinSMESG000064359.1 dd_Smed_v4_10725_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013139SMED30013139SMESG000059266.1 SMESG000059254.1 dd_Smed_v4_301_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016148p21-activated protein kinase-interacting protein 1-like proteinSMESG000066454.1 dd_Smed_v4_13381_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013497Ribosome assembly factor mrt4SMESG000020510.1 dd_Smed_v4_1609_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019298Heterogeneous nuclear ribonucleoprotein LSMESG000005298.1 dd_Smed_v4_1327_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000905260S ribosomal protein L18SMESG000017166.1 dd_Smed_v4_128_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002106TFIIS N-terminal domain-containing proteinSMESG000058491.1 dd_Smed_v4_995_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013386netrin 1SMESG000006806.1 dd_Smed_v4_9795_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000598860S ribosomal protein L24SMESG000007869.1 SMESG000007858.1 SMESG000007847.1 dd_Smed_v4_172_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007143Nucleolar GTP-binding protein 2SMESG000026847.1 dd_Smed_v4_1134_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000013460S ribosomal protein L4SMESG000009479.1 dd_Smed_v4_211_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016279X1.B.G6.2SMESG000023119.1 dd_Smed_v4_6097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005932Tudor domain-containing protein 1SMESG000026637.1 dd_Smed_v4_3564_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000109640S ribosomal protein S23SMESG000017264.1 dd_Smed_v4_290_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019332General transcription factor IIH subunitSMESG000049453.1 dd_Smed_v4_7018_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010457cell division cycle and apoptosis regulator protein 1SMESG000052430.1 dd_Smed_v4_1608_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023708ZFP-1SMESG000066384.1 dd_Smed_v4_8720_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027672Plac8 onzin related protein 1SMESG000050229.1 SMESG000050221.1 dd_Smed_v4_1219_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025807RuvB-like helicaseSMESG000033997.1 SMESG000018207.1 dd_Smed_v4_2547_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031463VASA-1SMESG000067941.1 dd_Smed_v4_1985_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019741TetraspaninSMESG000021636.1 dd_Smed_v4_13516_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015481DNA topoisomerase 2SMESG000070153.1 SMESG000068232.1 SMESG000077027.1 dd_Smed_v4_1626_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018755Small ubiquitin-related modifierSMESG000018835.1 dd_Smed_v4_1253_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012188Small nuclear ribonucleoprotein FSMESG000025747.1 dd_Smed_v4_1056_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016088Protein arginine N-methyltransferase 6SMESG000017273.1 dd_Smed_v4_1336_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017379DJ-1SMESG000003454.1 dd_Smed_v4_1223_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015393SMED30015393SMESG000070153.1 SMESG000068232.1 SMESG000077027.1 dd_Smed_v4_1626_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011413Histone H2ASMESG000022910.1 SMESG000006040.1 dd_Smed_v4_12365_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020884UV excision repair protein RAD23SMESG000077827.1 dd_Smed_v4_10053_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021808SMED30021808SMESG000054507.1 dd_Smed_v4_14111_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020872Myosin IESMESG000070153.1 SMESG000068232.1 SMESG000077027.1 dd_Smed_v4_1626_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020974DNA topoisomerase 2SMESG000037559.1 SMESG000037557.1 dd_Smed_v4_4804_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025422GrpE protein homologSMESG000004230.1 dd_Smed_v4_1172_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033538DNA topoisomerase 2SMESG000037559.1 SMESG000037557.1 dd_Smed_v4_4804_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032420SMED30032420SMESG000050229.1 SMESG000050221.1 dd_Smed_v4_1219_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032052Cytoskeleton-associated protein 5-ASMESG000045157.1 dd_Smed_v4_16537_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032052Cytoskeleton-associated protein 5-ASMESG000045157.1 SMESG000045143.1 dd_Smed_v4_3967_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025079Cytoskeleton-associated protein 5-ASMESG000045157.1 dd_Smed_v4_16537_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031539Origin recognition complex subunit 4SMESG000043431.1 dd_Smed_v4_11263_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010779SMED30010779SMESG000007211.1 dd_Smed_v4_10146_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010424DNA primaseSMESG000070103.1 dd_Smed_v4_11558_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000501926S proteasome regulatory subunit 4 homologSMESG000020306.1 dd_Smed_v4_1222_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005194notchless-1SMESG000000678.1 dd_Smed_v4_10113_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006610WW domain-containing oxidoreductaseSMESG000077649.1 dd_Smed_v4_11724_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008015slc25a-14SMESG000015827.1 dd_Smed_v4_7507_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007722Malonyl-CoA-acyl carrier protein transacylaseSMESG000054426.1 dd_Smed_v4_11450_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004721SMED30004721SMESG000046687.1 dd_Smed_v4_1325_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004666ATP-dependent zinc metalloprotease FtsHSMESG000006323.1 dd_Smed_v4_1250_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009765Eukaryotic translation initiation factor 3 subunit HSMESG000043864.1 dd_Smed_v4_1220_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012293SPT16SMESG000033905.1 dd_Smed_v4_2595_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011372Queuosine salvage proteinSMESG000078335.1 dd_Smed_v4_5644_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012534SMED30012534SMESG000012031.1 dd_Smed_v4_747_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008750Origin recognition complex subunit 1SMESG000072187.1 dd_Smed_v4_8215_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004136DNA polymeraseSMESG000079942.1 SMESG000079687.1 SMESG000044739.1 SMESG000044729.1 SMESG000044723.1 SMESG000044721.1 SMESG000044720.1 SMESG000020739.1 dd_Smed_v4_9168_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004080PIM-1-like proteinSMESG000061809.1 SMESG000061808.1 dd_Smed_v4_16306_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027770high mobility group-2SMESG000020771.1 dd_Smed_v4_1646_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004472TransketolaseSMESG000000391.1 SMESG000000388.1 dd_Smed_v4_550_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024486cytoplasmic poly(A) binding proteinSMESG000004978.1 dd_Smed_v4_11729_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030310SMED30030310SMESG000057201.1 dd_Smed_v4_1531_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034335SMED30034335SMESG000009102.1 dd_Smed_v4_8341_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014647ANK_REP_REGION domain-containing proteinSMESG000012965.1 dd_Smed_v4_10291_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016090Translocated promoter region b, nuclear basket proteinSMESG000025908.1 dd_Smed_v4_2899_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016754SMED30016754SMESG000022487.1 dd_Smed_v4_8822_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008261SMED30008261SMESG000014357.1 dd_Smed_v4_5737_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006959H/ACA ribonucleoprotein complex subunitSMESG000056130.1 dd_Smed_v4_3239_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000170160S ribosomal protein L7aSMESG000020535.1 dd_Smed_v4_296_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016342TNF receptor associated factor-2SMESG000069962.1 SMESG000015001.1 SMESG000015027.1 dd_Smed_v4_4528_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018984prefoldin subunit 2SMESG000075156.1 SMESG000075150.1 dd_Smed_v4_1368_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005748HNF4SMESG000014588.1 dd_Smed_v4_1694_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006182Peptidyl-prolyl cis-trans isomeraseSMESG000057818.1 dd_Smed_v4_4606_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000103940S ribosomal protein S7SMESG000053117.1 SMESG000031967.1 SMESG000031033.1 SMESG000014878.1 dd_Smed_v4_204_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007894Exportin 1 (CRM1 homolog, yeast) bSMESG000025559.1 dd_Smed_v4_3264_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012822heterogeneous nuclear ribonucleoprotein A1 A2/B1SMESG000081075.1 dd_Smed_v4_986_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014415Protein FAM32ASMESG000034920.1 dd_Smed_v4_1341_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000573SMED30000573SMESG000050316.1 dd_Smed_v4_1722_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008905splicing factor U2af 38 kDa subunitSMESG000002360.1 dd_Smed_v4_6452_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011415Transmembrane protein 209SMESG000020027.1 dd_Smed_v4_4525_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003359nucleoporin 50 kDaSMESG000066593.1 dd_Smed_v4_5140_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012773Transformer 2 proteinSMESG000022369.1 dd_Smed_v4_2971_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014770SMED30014770SMESG000072181.1 dd_Smed_v4_5831_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002529DNA-directed RNA polymerase subunit betaSMESG000067331.1 dd_Smed_v4_2182_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000949Tgs-1SMESG000058876.1 dd_10988dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30000949Tgs-1SMESG000058876.1 dd_Smed_v4_10988_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012814Protein CWC15-like proteinSMESG000010770.1 dd_Smed_v4_2881_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002872Tgs-1SMESG000058876.1 dd_10988dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30002872Tgs-1SMESG000058876.1 dd_Smed_v4_10988_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004651SMED30004651SMESG000013099.1 dd_Smed_v4_14977_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001467SMED30001467SMESG000050635.1 dd_Smed_v4_14507_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007270DUF862 domain-containing proteinSMESG000024772.1 dd_Smed_v4_1503_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014582SMED30014582SMESG000061527.1 dd_Smed_v4_8888_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018964mediator complex 7SMESG000079767.1 dd_Smed_v4_5572_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018385Hydroxyacyl-coenzyme A dehydrogenase, mitochondrialSMESG000032777.1 dd_Smed_v4_725_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003920Nuclear cap-binding protein subunit 1SMESG000073304.1 dd_Smed_v4_6140_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003905Far upstream element-binding proteinSMESG000037106.1 dd_Smed_v4_812_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001731SMED30001731SMESG000042728.1 dd_Smed_v4_4859_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003788Mitochondrial import receptor subunit TOM70SMESG000070017.1 dd_Smed_v4_2190_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007287Nucleolar GTP-binding protein 1SMESG000074998.1 dd_Smed_v4_764_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013080G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000001813.1 dd_Smed_v4_19933_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017019NADH:ubiquinone oxidoreductase complex assembly factor 2SMESG000006742.1 dd_Smed_v4_7400_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001545SMED30001545SMESG000026136.1 dd_Smed_v4_4323_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001545SMED30001545SMESG000026136.1 dd_Smed_v4_7269_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000928360S ribosomal protein L18aSMESG000060163.1 dd_Smed_v4_437_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002262Heat shock cognate 71 kDa proteinSMESG000051570.1 SMESG000051567.1 SMESG000051541.1 SMESG000051540.1 dd_Smed_v4_320_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008172TNF receptor-associated factorSMESG000027149.1 dd_Smed_v4_10424_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005997SMED30005997SMESG000050405.1 dd_Smed_v4_1663_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000257426S proteasome regulatory subunit N11SMESG000056298.1 SMESG000056198.1 dd_Smed_v4_2126_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008895ATP-binding cassette sub-family F member 1SMESG000041811.1 dd_Smed_v4_1761_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001235Cilia and flagella associated protein 298SMESG000074029.1 dd_Smed_v4_3612_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016591Protein big brotherSMESG000068819.1 dd_Smed_v4_2875_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002797CLUMA_CG019785, isoform ASMESG000035961.1 SMESG000035962.1 dd_Smed_v4_3026_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015950Deoxyribonuclease II family proteinSMESG000062594.1 dd_Smed_v4_9160_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019623serrate RNA effector moleculeSMESG000030605.1 dd_Smed_v4_1872_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3001449360S ribosomal protein L5SMESG000004748.1 dd_Smed_v4_151_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005613N-acetyltransferase, putativeSMESG000007639.1 dd_Smed_v4_1763_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014769SMED30014769SMESG000032777.1 dd_Smed_v4_725_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019073SMED30019073SMESG000041235.1 dd_Smed_v4_13685_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015549Beta-catenin-like protein 1SMESG000029003.1 dd_Smed_v4_1800_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008295Heat shock cognate 71 kDa proteinSMESG000051570.1 SMESG000051567.1 SMESG000051541.1 SMESG000051540.1 dd_Smed_v4_320_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022501Fatty acid-binding protein, heartSMESG000029500.1 dd_Smed_v4_599_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026710Ubiquitin carboxyl-terminal hydrolaseSMESG000006297.1 dd_Smed_v4_7488_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3002077640S ribosomal protein S21SMESG000004954.1 dd_Smed_v4_84_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022975Homeobox protein DTH-2SMESG000037282.1 dd_Smed_v4_6729_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024106Mitochondrial ATP synthase subunit 9SMESG000059768.1 dd_Smed_v4_401_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035977Fragile X mental retardation proteinSMESG000013448.1 dd_Smed_v4_2105_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031782SMED30031782SMESG000002170.1 dd_Smed_v4_11867_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023189Glutaredoxin-3SMESG000036167.1 SMESG000036166.1 SMESG000036162.1 dd_Smed_v4_7185_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022083Voltage-gated potassium channel subunit beta-2SMESG000036167.1 SMESG000036166.1 SMESG000036162.1 dd_Smed_v4_7185_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3002954297 kDa heat shock proteinSMESG000019478.1 dd_Smed_v4_1087_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3002074960S acidic ribosomal protein P2SMESG000057890.1 dd_Smed_v4_556_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021740SMED30021740SMESG000073852.1 dd_Smed_v4_9444_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034634RRM domain-containing proteinSMESG000081357.1 dd_Smed_v4_2216_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024600Serine/arginine repetitive matrix protein 1SMESG000023657.1 dd_Smed_v4_3886_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028800Condensin complex subunit 1SMESG000009778.1 dd_Smed_v4_7047_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029911Pre-mRNA-processing factor 40SMESG000044274.1 dd_Smed_v4_1909_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025411ATP-binding cassette sub-family F member 3-likeSMESG000041811.1 dd_Smed_v4_1761_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020325Protein lin-54 homologSMESG000004147.1 dd_Smed_v4_4263_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028073Mitochondrial import inner membrane translocase subunit TIM23SMESG000041020.1 dd_Smed_v4_825_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030270Proteasome subunit betaSMESG000016299.1 dd_Smed_v4_1771_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025294rRNA 2'-O-methyltransferase fibrillarinSMESG000051648.1 dd_Smed_v4_2811_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3002151340S ribosomal protein S9SMESG000058106.1 dd_Smed_v4_92_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021711DNA-binding proteinSMESG000070983.1 dd_Smed_v4_2102_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3002234826S proteasome non-ATPase regulatory subunit 1SMESG000004988.1 dd_Smed_v4_1149_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023477Small nuclear ribonucleoprotein Sm D1SMESG000062388.1 dd_Smed_v4_1826_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021147Transcription elongation factor SPT5SMESG000063039.1 dd_Smed_v4_3492_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020462Protein archeaseSMESG000051205.1 dd_Smed_v4_4680_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030477peptidyl prolyl cis trans isomerase FKBP-1SMESG000026331.1 dd_Smed_v4_1921_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018716Acidic leucine-rich nuclear phosphoprotein 32 family member ASMESG000065271.1 dd_Smed_v4_1396_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005280SMED30005280SMESG000077104.1 dd_Smed_v4_4063_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009032Deoxycytidylate deaminaseSMESG000023231.1 dd_Smed_v4_6803_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010115ribonucleoside diphosphate reductase subunit M2-2SMESG000079368.1 SMESG000044188.1 SMESG000044184.1 dd_Smed_v4_2286_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001362SMEDWI-3SMESG000081970.1 dd_Smed_v4_1258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019098SMED30019098SMESG000037105.1 dd_Smed_v4_848_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017928SMED30017928SMESG000053935.1 dd_Smed_v4_4129_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004297Eukaryotic translation initiation factor 3 subunit KSMESG000017237.1 dd_Smed_v4_621_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009284Hsp70SMESG000056256.1 dd_Smed_v4_424_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017754SMED30017754SMESG000043124.1 dd_Smed_v4_3018_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015999aurora kinase-1SMESG000006604.1 dd_Smed_v4_9065_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021111Transcription initiation factor TFIID subunit 13SMESG000020879.1 dd_Smed_v4_11507_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029898Nicotinate-nucleotide pyrophosphorylase [carboxylating]SMESG000080771.1 dd_Smed_v4_2522_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034751Elongation factor G, mitochondrialSMESG000035436.1 dd_Smed_v4_1879_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022209ATPase family AAA domain containing proteinSMESG000003318.1 dd_Smed_v4_1807_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029366SMED30029366SMESG000080771.1 dd_Smed_v4_2522_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027550tRNA (adenine(58)-N(1))-methyltransferase non-catalytic subunit TRM6SMESG000072786.1 dd_Smed_v4_3327_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030213SMED30030213SMESG000012962.1 dd_Smed_v4_4581_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035415Helicase ATP-binding domain-containing proteinSMESG000025070.1 dd_Smed_v4_19858_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023288SMED30023288SMESG000064764.1 dd_Smed_v4_14271_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020640Mitochondrial genome maintenance exonuclease 1SMESG000050961.1 dd_Smed_v4_14245_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028154Serine/threonine kinase 33SMESG000076986.1 SMESG000076975.1 dd_Smed_v4_12461_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029702SUMO-conjugating enzyme UBC9SMESG000032133.1 dd_Smed_v4_1535_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030716RibonucleaseSMESG000022763.1 dd_Smed_v4_10404_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024082Phosphoribosylaminoimidazole-succinocarboxamide synthaseSMESG000056504.1 dd_Smed_v4_1421_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035004NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 9, mitochondrialSMESG000072630.1 dd_Smed_v4_1524_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020652Eukaryotic translation initiation factor 4GSMESG000045255.1 dd_Smed_v4_10618_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026844Protein MAK16 homologSMESG000060104.1 dd_Smed_v4_1416_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026022DNL-type domain-containing proteinSMESG000066940.1 dd_Smed_v4_2816_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008674SMED30008674 dd_Smed_v4_2720_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000891040S ribosomal protein S4SMESG000026320.1 dd_Smed_v4_82_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000310SMED30000310 dd_Smed_v4_9639_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004304Proliferating cell nuclear antigen dd_Smed_v4_1920_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015678Cyclin-dependent kinases regulatory subunit dd_Smed_v4_6668_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000639Microtubule-actin cross-linking factor 1-like isoform X28SMESG000017517.1 SMESG000017520.1 SMESG000017519.1 dd_Smed_v4_6577_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006905DNA endonuclease RBBP8SMESG000002586.1 dd_Smed_v4_12447_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009428YEATS domain-containing protein 4SMESG000030330.1 dd_Smed_v4_6828_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011104HTH La-type RNA-binding domain-containing proteinSMESG000000519.1 dd_Smed_v4_1420_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016719Histone H4 transcription factorSMESG000014193.1 SMESG000014189.1 dd_Smed_v4_12249_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011817SMED30011817SMESG000000519.1 dd_Smed_v4_1420_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012619SMED30012619SMESG000006885.1 dd_Smed_v4_7366_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012212NADH dehydrogenase subunit 1 dd_Smed_v4_258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001799NADH dehydrogenase subunit 5 dd_Smed_v4_258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001799NADH dehydrogenase subunit 5 dd_Smed_v4_957_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010253NADH dehydrogenase subunit 6 dd_Smed_v4_957_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004537Proteasome subunit betaSMESG000004962.1 dd_Smed_v4_1264_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013571NADH dehydrogenase subunit 4L dd_Smed_v4_344_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000702cytochrome b dd_Smed_v4_344_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008411Aldo_ket_red domain-containing proteinSMESG000053228.1 dd_Smed_v4_487_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011715Splicing factor, arginine/serine-rich 6SMESG000041210.1 dd_Smed_v4_1177_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003434SMED30003434SMESG000052485.1 dd_Smed_v4_1182_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005334SMED30005334 dd_Smed_v4_344_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001990zf-Tim10_DDP domain-containing proteinSMESG000071085.1 dd_Smed_v4_514_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007420hypothetical proteinSMESG000037088.1 SMESG000032688.1 dd_Smed_v4_10376_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008414NADH-ubiquinone oxidoreductase chain 3 dd_Smed_v4_289_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000396Flap endonuclease 1SMESG000020104.1 dd_Smed_v4_8206_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013833acetyl-CoA acetyltransferase, mitochondrialSMESG000056408.1 dd_Smed_v4_1377_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006065Abnormal spindle-like microcephaly-associated protein homolog dd_Smed_v4_15726_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004246SMED30004246 dd_Smed_v4_344_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016880Zinc finger Ran-binding domain-containing protein 2SMESG000017096.1 dd_Smed_v4_1397_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019802SMED30019802SMESG000017096.1 dd_Smed_v4_1397_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017437Cell cycle checkpoint control proteinSMESG000004888.1 SMESG000004675.1 dd_Smed_v4_14121_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005962CCHC-type domain-containing proteinSMESG000031867.1 dd_Smed_v4_6978_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001327DNA-directed RNA polymerases I, II, and III subunit RPABC4 dd_Smed_v4_2720_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011412Ribosomal protein L37 dd_Smed_v4_97_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010375cytochrome c oxidase subunit I dd_Smed_v4_753_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3001266028S ribosomal protein S16 dd_Smed_v4_1539_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003686NADH dehydrogenase subunit 2 dd_Smed_v4_505_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021048U1 small nuclear ribonucleoprotein CSMESG000005768.1 dd_Smed_v4_10739_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033785Cell division cycle and apoptosis regulator protein 1 dd_Smed_v4_1181_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023063Helicase POLQ-like protein dd_Smed_v4_13290_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031935SMED30031935SMESG000038209.1 dd_Smed_v4_14806_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028337SAP domain-containing protein dd_Smed_v4_1181_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026749Ribosomal RNA small subunit methyltransferase NEP1SMESG000016962.1 dd_Smed_v4_3246_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028689Histone-binding protein RBBP7 dd_Smed_v4_2065_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033600DNA replication licensing factor MCM6SMESG000038798.1 dd_Smed_v4_2682_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019702SMED30019702SMESG000016033.1 SMESG000000571.1 dd_Smed_v4_661_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015533MRG-1SMESG000022376.1 dd_Smed_v4_5890_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010227SMED30010227SMESG000078872.1 dd_Smed_v4_673_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011818C2H2-type domain-containing proteinSMESG000048024.1 dd_Smed_v4_892_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035880methyl-CpG binding domain 2/3SMESG000064034.1 SMESG000064035.1 dd_Smed_v4_3054_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022855Reactive oxygen species modulator 1 family proteinSMESG000039761.1 dd_Smed_v4_691_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034338SMED30034338SMESG000004213.1 dd_Smed_v4_9017_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031725SMED30031725SMESG000034628.1 dd_Smed_v4_9307_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022937RNA polymerase-associated protein RTF1-like proteinSMESG000029426.1 dd_Smed_v4_887_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030240FerritinSMESG000039456.1 SMESG000014076.1 dd_Smed_v4_443_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034728SUMO-activating enzyme subunit 1SMESG000036431.1 dd_Smed_v4_4443_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031235Tubulin alpha chainSMESG000017700.1 dd_Smed_v4_648_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023258Cell cycle associated protein 1aSMESG000043092.1 dd_Smed_v4_936_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3002751939S ribosomal protein L38, mitochondrialSMESG000074826.1 dd_Smed_v4_3715_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022935Small ubiquitin-related modifierSMESG000056595.1 dd_Smed_v4_265_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021509Nuclear autoantigenic sperm proteinSMESG000016858.1 dd_Smed_v4_5663_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035855Poly [ADP-ribose] polymeraseSMESG000067451.1 SMESG000060010.1 dd_Smed_v4_6154_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030050RNA 3'-terminal phosphate cyclase-like proteinSMESG000009463.1 dd_Smed_v4_3243_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3002653910 kDa heat shock protein, mitochondrialSMESG000000556.1 dd_Smed_v4_421_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035858SMED30035858SMESG000064034.1 SMESG000064035.1 dd_Smed_v4_3054_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022253Nuclear pore complex protein Nup160SMESG000074874.1 SMESG000074873.1 dd_Smed_v4_5203_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029334Anaphase-promoting complex subunit 2SMESG000048530.1 SMESG000022225.1 dd_Smed_v4_7937_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023257SMED30023257SMESG000016203.1 dd_Smed_v4_6987_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020704Poly [ADP-ribose] polymeraseSMESG000067451.1 SMESG000060010.1 dd_Smed_v4_6154_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021848RPOL4c domain-containing proteinSMESG000056546.1 dd_Smed_v4_4362_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022314116 kDa U5 small nuclear ribonucleoprotein componentSMESG000045983.1 SMESG000045982.1 dd_Smed_v4_4747_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024450Brix domain-containing proteinSMESG000022906.1 dd_Smed_v4_6350_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004081SMED30004081SMESG000040291.1 dd_Smed_v4_1144_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031423ATP synthase subunitSMESG000021514.1 dd_Smed_v4_428_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030077Growth hormone-inducible transmembrane proteinSMESG000029240.1 dd_Smed_v4_754_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030466Ribosomal RNA methyltransferase Nop2SMESG000042985.1 SMESG000007627.1 dd_Smed_v4_7417_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031378Serine:threonine protein kinase rio2SMESG000041471.1 dd_Smed_v4_5634_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024184Reverse transcriptase domain-containing proteinSMESG000066290.1 SMESG000050681.1 SMESG000050677.1 dd_Smed_v4_5608_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023745SMED30023745SMESG000016314.1 dd_Smed_v4_4907_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026629RRP12 isoform X2SMESG000033633.1 dd_Smed_v4_3007_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032563MCM5SMESG000005389.1 SmWIOct06_041568GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30032563MCM5SMESG000005389.1 SMED_00943_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30032563MCM5SMESG000005389.1 SMED_00943_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30032563MCM5SMESG000005389.1 SMED_09614_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30032563MCM5SMESG000005389.1 SMED_09614_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30032563MCM5SMESG000005389.1 SmWIOct06_009256GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30027500SMED30027500SMESG000016781.1 SMESG000016779.1 SMED_02177_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30027500SMED30027500SMESG000016781.1 SMESG000016779.1 SMED_02177_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30028552SMED30028552SMESG000035330.1 SMED_05187_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30021365SMED30021365SMESG000054174.1 SMESG000021959.1 SMED_14519_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30021365SMED30021365SMESG000054174.1 SMESG000021959.1 SMED_14519_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30035725Betaine--homocysteine S-methyltransferase 1SMESG000019342.1 SMED_01055_V2_1rGPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30035725Betaine--homocysteine S-methyltransferase 1SMESG000019342.1 SMED_01055_V2_1rGPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30028420Nucleotide-binding oligomerization domain-containing protein 2SMESG000018415.1 SMED_33297_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30028420Nucleotide-binding oligomerization domain-containing protein 2SMESG000018415.1 SMED_33297_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30035323EOG090X0AVISMESG000010474.1 SmWIOct06_026476GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30035323EOG090X0AVISMESG000010474.1 SMED_37584_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30035323EOG090X0AVISMESG000010474.1 SMED_37584_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30035323EOG090X0AVISMESG000010474.1 SMED_28958_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30035323EOG090X0AVISMESG000010474.1 SMED_28958_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30035323EOG090X0AVI SMED_17325_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30035323EOG090X0AVI SMED_37583_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30021402Cell division cycle 20-like proteinSMESG000051492.1 SMED_14318_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30021402Cell division cycle 20-like proteinSMESG000051492.1 SMED_14318_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30021402Cell division cycle 20-like proteinSMESG000051492.1 SmWIOct06_007116GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30022627SMED30022627SMESG000053935.1 SMED_01263_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30022627SMED30022627SMESG000053935.1 SmWIOct06_043235GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30022627SMED30022627SMESG000053935.1 SMED_37391_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30022627SMED30022627SMESG000053935.1 SMED_37391_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30022627SMED30022627SMESG000053935.1 SmWIOct06_035939GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30022627SMED30022627SMESG000053935.1 SMED_02039_V2_1rGPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30022627SMED30022627SMESG000053935.1 SMED_02039_V2_1rGPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30022627SMED30022627SMESG000053935.1 SMED_02039_V2_2rGPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30023147SMED30023147SMESG000032765.1 SMED_09519_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30023147SMED30023147SMESG000032765.1 SMED_09519_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30025981SMED30025981SMESG000059781.1 SMED_14575_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30025981SMED30025981SMESG000059781.1 SMED_14575_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30033239SMED30033239SMESG000051917.1 SMED_10870_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30033239SMED30033239SMESG000051917.1 SMED_10870_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30022584Oligodendrocyte transcription factorSMESG000060237.1 SMED_09022_V2_2GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30022584Oligodendrocyte transcription factorSMESG000060237.1 SMED_09022_V2_2GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30035142SMED30035142SMESG000021242.1 SMED_07871_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30035142SMED30035142SMESG000021242.1 SMED_07871_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30033360SMED30033360SMESG000074320.1 SMED_13022_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30033360SMED30033360SMESG000074320.1 SMED_13022_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30033360SMED30033360SMESG000074320.1 SmWIOct06_036443GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30025398Glyoxylate/hydroxypyruvate reductase BSMESG000080490.1 SMED_20236_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30025398Glyoxylate/hydroxypyruvate reductase BSMESG000080490.1 SMED_20236_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30034490FGFR1SMESG000036598.1 SMESG000036590.1 SMED30034490smed_20140614PMID:22385657
Wagner et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30034490FGFR1SMESG000036598.1 SMED_38140_V2_2GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30034490FGFR1SMESG000036598.1 SMED_38140_V2_2GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30034490FGFR1SMESG000036598.1 SMED_23395_V2_2GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30034490FGFR1SMESG000036598.1 SMED_23395_V2_2GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30034490FGFR1SMESG000036590.1 SMED_38141_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30034490FGFR1SMESG000036590.1 SMED_38141_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30034490FGFR1SMESG000036598.1 SMED_38140_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30034490FGFR1SMESG000036598.1 SMED_38140_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30034490FGFR1SMESG000036590.1 SMED_38141_V2_2GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30034490FGFR1SMESG000036590.1 SMED_38141_V2_2GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30034490FGFR1SMESG000036598.1 SMED_23395_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30034490FGFR1SMESG000036598.1 SMED_23395_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30034617SMED30034617SMESG000053935.1 SMED_01263_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30001057Mcm10 domain-containing proteinSMESG000014794.1 SMED_28579_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30001057Mcm10 domain-containing proteinSMESG000014794.1 SMED_28579_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30006344Glyoxylate/hydroxypyruvate reductase BSMESG000080490.1 SMED_20236_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30006344Glyoxylate/hydroxypyruvate reductase BSMESG000080490.1 SMED_20236_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30009506Baculoviral IAP repeat-containing protein 5SMESG000033647.1 SMED_32482_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30009506Baculoviral IAP repeat-containing protein 5SMESG000033647.1 SMED_32482_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30017903Timeless circadian clockSMESG000030310.1 SMESG000030307.1 SMED_34337_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30017903Timeless circadian clockSMESG000030310.1 SMESG000030307.1 SMED_34337_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30010978nuclear pore complex protein Nup155SMESG000035494.1 SMED_37221_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30010978nuclear pore complex protein Nup155SMESG000035494.1 SMED_37221_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30007328Nuclear transcription factor Y subunit alphaSMESG000031441.1 SMED_11577_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30007328Nuclear transcription factor Y subunit alphaSMESG000031441.1 SMED_11577_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30011181fidgetin-like protein 1SMESG000045800.1 SMED_32658_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30011181fidgetin-like protein 1SMESG000045800.1 SMED_32658_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30004598Cytoskeleton-associated protein 5-ASMESG000045157.1 SMED_11878_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30004598Cytoskeleton-associated protein 5-ASMESG000045157.1 SMED_11878_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30004598Cytoskeleton-associated protein 5-ASMESG000045157.1 SMESG000045143.1 SMED_06293_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30004598Cytoskeleton-associated protein 5-ASMESG000045157.1 SMED_06293_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30016537SMED30016537SMESG000072339.1 SMED_18010_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30016537SMED30016537SMESG000072339.1 SMED_18010_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30026014WD repeat and HMG-box DNA binding protein 1SMESG000076132.1 SMED_07458_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30026014WD repeat and HMG-box DNA binding protein 1SMESG000076132.1 SMED_07458_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30029304Endonuclease III homologSMESG000036384.1 SMED_32068_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30029304Endonuclease III homologSMESG000036384.1 SMED_32068_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30030198Lamin-B receptorSMESG000042131.1 SMED_02186_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30030198Lamin-B receptorSMESG000042131.1 SMED_02186_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30023109Cathepsin L2SMESG000049783.1 SMESG000049781.1 SMED_01698_V2_1rGPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30023109Cathepsin L2SMESG000049783.1 SMESG000049781.1 SMED_01698_V2_1rGPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30023109Cathepsin L2SMESG000049790.1 SMESG000049783.1 SMESG000049781.1 SMED_01698_V2_1rGPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30023109Cathepsin L2SMESG000049790.1 SMESG000049783.1 SMESG000049781.1 SMED_01698_V2_1rGPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30022978VASA-2SMESG000049071.1 SMED_01829_V2GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30022978VASA-2SMESG000049071.1 SMED_01829_V2GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED3003144714-3-3 protein beta/alphaSMESG000067831.1 SMED_04917_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED3003144714-3-3 protein beta/alphaSMESG000067831.1 SMED_04917_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30029780EGR-like protein 1SMESG000000960.1 SMED_23310_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30029780EGR-like protein 1SMESG000000960.1 SMED_23310_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30024555Cyclin-dependent kinaseSMESG000023609.1 SMED_26757_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30024555Cyclin-dependent kinaseSMESG000023609.1 SMED_26757_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30024555Cyclin-dependent kinaseSMESG000023609.1 SMESG000023590.1 SMED_07692_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30028415replication factor C subunit 2SMESG000041132.1 SMED_00701_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30028415replication factor C subunit 2SMESG000041132.1 SMED_00701_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30028415replication factor C subunit 2SMESG000041142.1 SMESG000041132.1 SMED_00701_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30028415replication factor C subunit 2SMESG000041142.1 SMESG000041132.1 SMED_00701_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30028415replication factor C subunit 2SMESG000041142.1 SMESG000041132.1 SmWIOct06_009661GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30028415replication factor C subunit 2SMESG000041142.1 SMESG000041132.1 SmWIOct06_019276GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30025757JUNLI-1SMESG000067959.1 SMED30025757smed_20140614PMID:22385657
Wagner et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30025757JUNLI-1SMESG000067959.1 SMED_29372_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30025757JUNLI-1SMESG000067959.1 SMED_29372_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30025757JUNLI-1SMESG000067959.1 SMED_21705_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30025757JUNLI-1SMESG000067959.1 SMED_21705_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30021781Tubulin beta chainSMESG000074579.1 SMESG000074423.1 SMED_05331_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30034829fancd2-like proteinSMESG000066544.1 SMED_29736_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30034829fancd2-like proteinSMESG000066544.1 SMED_29736_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30033583SMED30033583SMESG000060313.1 SMESG000049383.1 SMED_19200_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30033583SMED30033583SMESG000060313.1 SMESG000049383.1 SMED_19200_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30021776Histone H3SMESG000074574.1 SMESG000074479.1 SMED_05200_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30021776Histone H3SMESG000074574.1 SMESG000074479.1 SMED_05200_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30027701ATP dependent RNA helicase DDX5SMESG000012031.1 SMED_06736_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30022086Luc7 like protein-3SMESG000063299.1 dd_Smed_v4_6781_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034258Eukaryotic translation initiation factor 3 subunit ISMESG000034899.1 dd_Smed_v4_721_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032703SKIP_SNW domain-containing proteinSMESG000061372.1 dd_Smed_v4_2325_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027654tRNA-specific adenosine deaminase 1SMESG000016199.1 dd_Smed_v4_9448_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032770MORC family CW-type zinc finger proteinSMESG000080008.1 dd_Smed_v4_2907_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027120G2/M phase-specific E3 ubiquitin-protein ligaseSMESG000026497.1 dd_Smed_v4_6301_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022238Histone-binding protein RBBP4SMESG000062893.1 dd_Smed_v4_5055_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030917SMED30030917SMESG000009451.1 dd_Smed_v4_2363_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023007SMED30023007SMESG000063428.1 dd_Smed_v4_7289_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031697DNA-directed RNA polymerases I and III subunit RPAC1SMESG000066290.1 SMESG000050681.1 SMESG000050677.1 dd_Smed_v4_5608_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021243DNA-directed RNA polymerase subunitSMESG000080671.1 dd_Smed_v4_3867_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031315Ribosome production factor 1SMESG000035174.1 dd_Smed_v4_9839_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030516Myelin expression factor 2 isoform 2SMESG000020746.1 dd_Smed_v4_2707_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022891tRNA N6-adenosine threonylcarbamoyltransferaseSMESG000003633.1 dd_Smed_v4_3150_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032441cAMP-regulated phosphoprotein 19SMESG000032735.1 dd_Smed_v4_4126_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027868DNA-directed RNA polymerases I, II, and III subunit RPABC5SMESG000037774.1 dd_Smed_v4_8307_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031507Zinc finger and SCAN domain-containing protein 2SMESG000049972.1 SMESG000031902.1 dd_Smed_v4_13890_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035053Presequence protease mitochondrialSMESG000032460.1 dd_Smed_v4_5873_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022786Splicing factor 3b subunit 4SMESG000005564.1 dd_Smed_v4_3556_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024735SMED30024735SMESG000012126.1 dd_Smed_v4_7744_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012234Replication protein A subunitSMESG000045678.1 SMESG000005326.1 dd_Smed_v4_3342_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012240E3 ubiquitin-protein ligase RNF170SMESG000068288.1 SMESG000068286.1 dd_Smed_v4_802_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013303SAFB-like, transcription modulatorSMESG000004509.1 dd_Smed_v4_3681_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008468CCAAT/enhancer-binding protein zetaSMESG000071436.1 dd_Smed_v4_5545_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009026ATP-dependent RNA helicase DDX3XSMESG000046974.1 SMESG000046953.1 dd_Smed_v4_799_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014560SMED30014560SMESG000026537.1 dd_Smed_v4_858_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005569rRNA 2'-O-methyltransferase fibrillarinSMESG000027841.1 dd_Smed_v4_4679_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009673SMED30009673SMESG000040843.1 dd_Smed_v4_5502_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000691Eukaryotic initiation factor 4A-IIISMESG000078818.1 dd_Smed_v4_737_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001127Histone chaperone ASF1SMESG000057853.1 dd_Smed_v4_5120_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000024060S ribosomal protein L10aSMESG000027088.1 dd_Smed_v4_350_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003593Structural maintenance of chromosomes proteinSMESG000017173.1 SMESG000017172.1 dd_Smed_v4_3809_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018697Programmed cell death 11SMESG000005637.1 dd_Smed_v4_10802_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009887Macrophage erythroblast attacherSMESG000048410.1 dd_Smed_v4_1168_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000226539S ribosomal protein L30SMESG000018897.1 dd_Smed_v4_6177_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014746SMED30014746SMESG000040783.1 dd_Smed_v4_14673_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018127SMED30018127SMESG000014578.1 SMESG000014566.1 SMESG000014563.1 SMESG000014544.1 SMESG000014542.1 SMESG000014523.1 dd_Smed_v4_1543_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018834SMED30018834SMESG000010762.1 dd_Smed_v4_3061_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012300SMED30012300SMESG000013739.1 dd_Smed_v4_5519_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017018SMED30017018SMESG000007294.1 dd_Smed_v4_371_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018944SMED30018944SMESG000028183.1 dd_Smed_v4_592_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019468protein arginine methyltransferase 1-like proteinSMESG000038790.1 dd_Smed_v4_1302_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019272Myb_DNA-bind_7 domain-containing proteinSMESG000016335.1 SMESG000016302.1 dd_Smed_v4_8936_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012280dTTP/UTP pyrophosphataseSMESG000072046.1 dd_Smed_v4_4785_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018689retinoblastoma-like proteinSMESG000055551.1 dd_Smed_v4_6879_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013000SMED30013000SMESG000052428.1 dd_Smed_v4_4768_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013979SMED30013979SMESG000035951.1 dd_Smed_v4_4151_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013803SMED30013803SMESG000030421.1 dd_Smed_v4_9428_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019860SMED30019860SMESG000018897.1 dd_Smed_v4_6177_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009340SMED30009340SMESG000014578.1 SMESG000014566.1 SMESG000014563.1 SMESG000014544.1 SMESG000014542.1 SMESG000014523.1 dd_Smed_v4_1543_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010763UBR-type domain-containing proteinSMESG000037081.1 dd_Smed_v4_4379_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003997SMED30003997SMESG000059318.1 SMESG000059304.1 dd_Smed_v4_483_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019045Retrovirus-related Pol polyprotein from type-1 retrotransposable element R2SMESG000008724.1 SMESG000008723.1 dd_Smed_v4_5504_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011685SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily E member 1SMESG000020191.1 dd_Smed_v4_5085_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013876U3 small nucleolar RNA-associated protein 18SMESG000029672.1 dd_Smed_v4_3855_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000236940S ribosomal protein S17SMESG000037102.1 dd_Smed_v4_195_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012989BolA proteinSMESG000030815.1 dd_Smed_v4_1466_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000239240S ribosomal protein S15SMESG000015520.1 dd_Smed_v4_201_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3001301840S ribosomal protein S6SMESG000000674.1 dd_Smed_v4_178_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004214SMED30004214SMESG000055805.1 dd_Smed_v4_857_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016636rRNA adenine N(6)-methyltransferaseSMESG000026090.1 dd_Smed_v4_5268_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3001990360S ribosomal protein L13aSMESG000041483.1 dd_Smed_v4_287_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014130ATP synthase subunit fSMESG000067649.1 SMESG000060121.1 dd_Smed_v4_776_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010208Malate dehydrogenaseSMESG000035456.1 dd_Smed_v4_1954_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008540O-acyltransferaseSMESG000037749.1 dd_Smed_v4_4278_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3001029128S ribosomal protein S14SMESG000066757.1 dd_Smed_v4_4035_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019508SMED30019508SMESG000067154.1 dd_Smed_v4_6479_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019508SMED30019508SMESG000067154.1 dd_Smed_v4_6479_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012131Kelch like family member 40SMESG000008724.1 SMESG000008723.1 dd_Smed_v4_5504_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021678SMED30021678SMESG000063653.1 dd_Smed_v4_4127_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033346Obg-like ATPase 1SMESG000061866.1 dd_Smed_v4_2199_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030038ATP-dependent RNA helicaseSMESG000011907.1 dd_Smed_v4_596_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3002341340S ribosomal protein S25SMESG000059049.1 dd_Smed_v4_134_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029494Heat shock protein 70SMESG000051815.1 dd_Smed_v4_1459_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023889SMED30023889SMESG000055805.1 dd_Smed_v4_857_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027123Mitochondrial import inner membrane translocase subunit TIM44SMESG000075312.1 dd_Smed_v4_6502_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3002552260 kDa heat shock protein, mitochondrialSMESG000065325.1 dd_Smed_v4_141_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030013GTP-binding nuclear proteinSMESG000072524.1 SMESG000072522.1 dd_Smed_v4_330_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020914Death-associated protein 1SMESG000023167.1 dd_Smed_v4_955_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026750BTB domain containing 9SMESG000042098.1 SMESG000042085.1 dd_Smed_v4_4701_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020736nucleolar protein 58SMESG000071386.1 dd_Smed_v4_1982_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022078Translationally-controlled tumor protein homologSMESG000023212.1 dd_Smed_v4_136_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3003108940S ribosomal protein S12SMESG000052688.1 dd_Smed_v4_268_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032348SMED30032348SMESG000071220.1 dd_Smed_v4_6653_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031888La ribonucleoprotein domain family member 1BSMESG000004135.1 dd_Smed_v4_2617_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029523Splicing factor 3B subunit 3SMESG000000828.1 dd_Smed_v4_4241_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025738Stress-induced-phosphoprotein 1SMESG000011539.1 dd_Smed_v4_1986_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025338E3 ubiquitin-protein ligase CBLSMESG000072524.1 SMESG000072522.1 dd_Smed_v4_330_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029676peptidyl prolyl cis trans isomerase FKBP-2SMESG000078014.1 dd_Smed_v4_3023_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025331Lon protease homolog, mitochondrialSMESG000079071.1 dd_Smed_v4_3971_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023182PolyubiquitinSMESG000057324.1 dd_Smed_v4_516_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026744Protein LZICSMESG000026307.1 SMESG000026310.1 dd_Smed_v4_2475_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027075SMED30027075SMESG000067067.1 dd_Smed_v4_10631_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032250SMED30032250SMESG000072181.1 dd_Smed_v4_5831_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034263Trifunctional enzyme subunit alpha, mitochondrialSMESG000061749.1 dd_Smed_v4_863_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027700Lipoyl synthase, mitochondrialSMESG000004184.1 SMESG000004174.1 dd_Smed_v4_19176_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024389mitochondrial import receptor subunit TOM22 homologSMESG000027748.1 dd_Smed_v4_2455_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027718Lupus la ribonucleoprotein, putativeSMESG000028878.1 dd_Smed_v4_5312_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024839Mitochondrial ATP synthase subunit bSMESG000077800.1 dd_Smed_v4_905_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021142THO complex subunit 4SMESG000055869.1 dd_Smed_v4_860_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018750SMED30018750SMESG000032765.1 SMED_09519_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30016001SMED30016001SMESG000063470.1 SMED_14572_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30016001SMED30016001SMESG000063470.1 SMED_14572_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30012332EGR-1SMESG000034285.1 SMED30012332smed_20140614PMID:22385657
Wagner et al., 2012
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30012332EGR-1SMESG000034285.1 SMED30012332smed_20140614PMID:22385657
Wagner et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30012332EGR-1SMESG000034285.1 SmWIOct06_008915GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30012332EGR-1SMESG000034285.1 SMED_00244_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30012332EGR-1SMESG000034285.1 SMED_00244_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30012332EGR-1SMESG000034285.1 SmWIOct06_019211GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30015067bicaudal-C proteinSMESG000018259.1 SMED_20902_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30015067bicaudal-C proteinSMESG000018259.1 SMED_20902_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30018579SMED30018579SMESG000017019.1 SMED_05273_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30018579SMED30018579SMESG000017019.1 SMED_05273_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30018579SMED30018579SMESG000017019.1 SMED_05272_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30018579SMED30018579SMESG000017019.1 SMED_05272_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30000190SMED30000190SMESG000043124.1 SMED_20606_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30000190SMED30000190SMESG000043124.1 SMED_20606_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30012735SMED30012735SMESG000031317.1 SMED_10963_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30012735SMED30012735SMESG000031317.1 SMED_10963_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30017131DNA topoisomerase 2-binding protein 1SMESG000012344.1 SMED_16452_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30017131DNA topoisomerase 2-binding protein 1SMESG000012344.1 SMED_16452_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30017131DNA topoisomerase 2-binding protein 1SMESG000012344.1 SMED_26858_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30017131DNA topoisomerase 2-binding protein 1SMESG000012344.1 SMED_26858_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30006464TCF15SMESG000044395.1 SMED_02941_V2GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30006464TCF15SMESG000044395.1 SMED_02941_V2GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30008074CRAL-TRIO domain-containing proteinSMESG000009863.1 SmWIOct06_001714GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30008074CRAL-TRIO domain-containing proteinSMESG000009863.1 SMED_13183_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30008074CRAL-TRIO domain-containing proteinSMESG000009863.1 SMED_13183_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30012378Clathrin heavy chainSMESG000035457.1 SMED_00016_V2_1rGPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30017835Thiopurine S-methyltransferaseSMESG000042421.1 SMED_09533_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30017835Thiopurine S-methyltransferaseSMESG000042421.1 SMED_09533_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30017835Thiopurine S-methyltransferaseSMESG000042421.1 SmWIOct06_038623GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30002927SAM domain-containing proteinSMESG000041461.1 SMED_20461_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30002927SAM domain-containing proteinSMESG000041461.1 SMED_20461_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30002927SAM domain-containing proteinSMESG000041461.1 SmWIOct06_011737GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30013673SMED30013673SMESG000035327.1 SMED_15231_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30013673SMED30013673SMESG000035327.1 SMED_15231_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30010297Lamin-B2SMESG000047473.1 SMED_28943_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30010297Lamin-B2SMESG000047473.1 SMED_28943_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30011043Protein kinase domain-containing proteinSMESG000025533.1 SMED_04043_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30011043Protein kinase domain-containing proteinSMESG000025533.1 SMED_04043_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30016975histone H2ASMESG000049774.1 SMED_24237_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30016975histone H2ASMESG000049774.1 SMED_24237_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30010074TTF-type domain-containing proteinSMESG000076895.1 SMED_13911_V2_2GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30010074TTF-type domain-containing proteinSMESG000076895.1 SMED_13911_V2_2GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30007516SMED30007516SMESG000004411.1 SMED_12638_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30007516SMED30007516SMESG000004411.1 SMED_12638_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30004036FHL-1SMESG000004969.1 SMED_12559_V2GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30004036FHL-1SMESG000004969.1 SMED_12559_V2GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30004532Y box protein-1SMESG000058039.1 SMED_04459_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30006841Serine/threonine-protein phosphataseSMESG000067422.1 SMED_25041_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30006841Serine/threonine-protein phosphataseSMESG000067422.1 SMED_25041_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30006841Serine/threonine-protein phosphataseSMESG000067422.1 SMED_07436_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30006841Serine/threonine-protein phosphataseSMESG000067422.1 SMED_07436_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30005428CIP29SMESG000073815.1 SMED_10768_V2GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30000140SAM domain-containing proteinSMESG000041461.1 SMED_20461_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30000140SAM domain-containing proteinSMESG000041461.1 SmWIOct06_011737GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30004937Elongation factor 2SMESG000042430.1 dd_Smed_v4_186_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002776tRNA-binding domain-containing proteinSMESG000033588.1 dd_Smed_v4_1675_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000317640S ribosomal protein S2SMESG000051503.1 dd_Smed_v4_226_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004929Polypyrimidine tract binding protein 1SMESG000019377.1 dd_Smed_v4_3450_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003316SMED30003316SMESG000075349.1 dd_Smed_v4_3126_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009845Huntingtin-interacting protein KSMESG000064372.1 dd_Smed_v4_1948_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003234Chromodomain helicase DNA binding protein 5SMESG000069740.1 dd_Smed_v4_9090_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014750RRM domain-containing proteinSMESG000063924.1 dd_Smed_v4_1760_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002662Superoxide dismutaseSMESG000009484.1 dd_Smed_v4_1259_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004943SMED30004943SMESG000069576.1 dd_Smed_v4_9264_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000137Nuclear receptor binding SET domain protein 3SMESG000051054.1 dd_Smed_v4_9815_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018826Mov10 like RISC complex RNA helicase 1SMESG000069873.1 dd_Smed_v4_2121_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001140RRP15-like proteinSMESG000040122.1 dd_Smed_v4_8792_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027909Mov10 like RISC complex RNA helicase 1SMESG000069873.1 dd_Smed_v4_2121_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028966Proteasome subunit alpha typeSMESG000040163.1 dd_Smed_v4_1541_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025731Splicing factor 3B subunit 5SMESG000014121.1 dd_Smed_v4_2023_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030829Y-box proteinSMESG000032180.1 dd_Smed_v4_209_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029738Cytochrome b-c1 complex subunit Rieske, mitochondrialSMESG000009447.1 dd_Smed_v4_1515_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020565cleavage and polyadenylation specificity factor subunit 3SMESG000066903.1 SMESG000066712.1 SMESG000002177.1 dd_Smed_v4_2005_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026225SMED30026225SMESG000059698.1 dd_Smed_v4_188_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027697SMED30027697SMESG000012408.1 dd_Smed_v4_1776_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032682Methylmalonate-semialdehyde dehydrogenaseSMESG000039266.1 dd_Smed_v4_2050_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025467Heat shock protein 75 kDa, mitochondrialSMESG000016949.1 dd_Smed_v4_1445_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025098Epidermal growth factor receptor substrate 15-like 1SMESG000026804.1 dd_Smed_v4_3526_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035984Mitochondrial 39S ribosomal protein L27 L27mtSMESG000071293.1 dd_Smed_v4_1828_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024065LAS1-like proteinSMESG000074249.1 dd_Smed_v4_10589_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029634Kinesin family member 15SMESG000064131.1 dd_Smed_v4_11717_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023487Protein LSM14 homolog B-ASMESG000014632.1 dd_Smed_v4_1125_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010757Cytochrome c heme lyaseSMESG000012893.1 dd_Smed_v4_2573_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017944TetraspaninSMESG000080008.1 dd_Smed_v4_2907_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013516Zinc finger protein, putativeSMESG000002851.1 dd_Smed_v4_5428_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005941Cytochrome P450 family 46 subfamily A member 1SMESG000033650.1 dd_Smed_v4_7676_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007704ActinSMESG000051672.1 SMESG000051670.1 dd_Smed_v4_3_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002824Ribose-phosphate pyrophosphokinase 1SMESG000008493.1 SMESG000008469.1 dd_Smed_v4_2327_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013425NADH dehydrogenase ubiquinone 1 betaSMESG000011219.1 dd_Smed_v4_2640_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017211Mediator of RNA polymerase II transcription subunit 10SMESG000065706.1 dd_Smed_v4_5622_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003894SMED30003894SMESG000063428.1 dd_Smed_v4_7289_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010680Serine/threonine-protein phosphatase 4 regulatory subunit 3SMESG000060526.1 dd_Smed_v4_4095_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006209polyadenylate-binding protein 2SMESG000011330.1 dd_Smed_v4_2924_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007065Rtf2 domain-containing proteinSMESG000073131.1 dd_Smed_v4_8445_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015482Splicing factor 3B subunit 2SMESG000058116.1 dd_Smed_v4_2932_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010653tRNA-specific adenosine deaminase 1SMESG000016199.1 dd_Smed_v4_9448_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016064ATP synthase subunit gammaSMESG000008050.1 dd_Smed_v4_720_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018702Voltage-dependent anion-selective channel protein 2SMESG000053095.1 dd_Smed_v4_2119_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011835Mitochondrial ribosomal protein S6SMESG000049504.1 dd_Smed_v4_4442_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015034Mitochondrial ribonuclease P protein 3SMESG000023790.1 SMESG000022512.1 dd_Smed_v4_9514_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006970SMED30006970SMESG000009578.1 dd_Smed_v4_3566_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007474Tyrosyl-DNA phosphodiesterase 1SMESG000046266.1 SMESG000046256.1 dd_Smed_v4_8311_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011187SMED30011187SMESG000048845.1 SMESG000032557.1 dd_Smed_v4_9377_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006163SMED30006163SMESG000013361.1 dd_Smed_v4_6783_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018542slc4a-1SMESG000024335.1 dd_Smed_v4_3003_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006795protein arginine N-methyltransferase 3SMESG000016853.1 dd_Smed_v4_5624_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008437Nuclear and cytoplasmic polyadenylated RNA-binding proteinSMESG000044649.1 dd_Smed_v4_3605_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003730NCOA5SMESG000010804.1 dd_Smed_v4_2395_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009928U4/U6.U5 tri-snRNP-associated protein 1SMESG000047653.1 dd_Smed_v4_5108_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015739Aldo-keto reductaseSMESG000081151.1 dd_Smed_v4_1044_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007860SMED30007860SMESG000005610.1 dd_Smed_v4_5994_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012094Dehydrogenase/reductase SDR family member 4SMESG000033535.1 SMESG000033534.1 dd_Smed_v4_6646_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006140dNK domain-containing proteinSMESG000021357.1 dd_Smed_v4_5279_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010220slc7a-1SMESG000033535.1 SMESG000033534.1 dd_Smed_v4_6646_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001529Poly(U)-binding-splicing factor PUF60SMESG000046155.1 dd_Smed_v4_3853_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018953SMED30018953SMESG000030062.1 dd_Smed_v4_6172_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016835Proteasome subunit alpha typeSMESG000030651.1 dd_Smed_v4_1235_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007413SMED30007413SMESG000050371.1 dd_Smed_v4_261_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013338Protein kinase domain-containing proteinSMESG000030798.1 dd_Smed_v4_4255_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004303AT-rich interactive domain-containing protein 4ASMESG000047168.1 dd_Smed_v4_4030_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005236Exosome component 8SMESG000011515.1 dd_Smed_v4_7132_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002547Peptidyl-prolyl cis-trans isomeraseSMESG000052204.1 SMESG000006596.1 dd_Smed_v4_457_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000981DUF3421 domain-containing proteinSMESG000063428.1 dd_Smed_v4_7289_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005112Protein ZBED8SMESG000066290.1 SMESG000050681.1 SMESG000050677.1 dd_Smed_v4_5608_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009566SMED30009566SMESG000015985.1 dd_Smed_v4_4240_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019080Chromosome transmission fidelity factor 18SMESG000040188.1 dd_Smed_v4_13246_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019889SMED30019889SMESG000055277.1 dd_Smed_v4_19641_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020994M7GpppX diphosphataseSMESG000067774.1 dd_Smed_v4_1924_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021620Crossover junction endonuclease MUS81SMESG000023374.1 dd_Smed_v4_11322_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021079Splicing factor 3B subunit 2SMESG000041240.1 dd_Smed_v4_6657_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026849Ubiquitin-conjugating enzyme E2SMESG000030285.1 dd_Smed_v4_12569_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020301SMED30020301SMESG000048277.1 dd_Smed_v4_5676_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3003268060S ribosomal protein L3SMESG000081260.1 dd_Smed_v4_13357_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023411slc42a-1SMESG000048378.1 dd_Smed_v4_11756_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028341Pre-mRNA-splicing factor ATP-dependent RNA helicase PRP16SMESG000023160.1 dd_Smed_v4_1945_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021037RibonucloproteinSMESG000027962.1 dd_Smed_v4_1928_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020059U6 snRNA-associated Sm-like protein LSm1SMESG000056127.1 dd_Smed_v4_6794_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020312Pre-mRNA-splicing factor ATP-dependent RNA helicase DHX16-likeSMESG000014714.1 dd_Smed_v4_8001_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032797DnaJ homolog subfamily A member 1SMESG000012107.1 dd_Smed_v4_147_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020370DNA-directed RNA polymerase subunitSMESG000010459.1 dd_Smed_v4_1965_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035297DNA repair protein complementing XP-A cellsSMESG000010409.1 dd_Smed_v4_1950_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009514histone H2BSMESG000067931.1 DN298006ncbi_smed_estsPMID:21566185
Wagner et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30007406SMEDWI-1SMESG000036375.1 DQ186985.1smed_ncbi_20200123PMID:21566185
Wagner et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30004304Proliferating cell nuclear antigen EU856391smed_ncbi_20200123PMID:21566185
Wagner et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30004304Proliferating cell nuclear antigen DN300872ncbi_smed_estsPMID:21566185
Wagner et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30017008SMED30017008 H.39.11esmed_ncbi_20200123PMID:21566185
Wagner et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30017008SMED30017008 AY067447smed_ncbi_20200123PMID:21566185
Wagner et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30029410Phosphatidylinositol 3,4,5-trisphosphate 3-phosphatase and dual-specificity protein phosphatase PTENSMESG000043909.1 AY068282smed_ncbi_20200123PMID:19048075
Oviedo et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30018369Phosphatidylinositol 3,4,5-trisphosphate 3-phosphatase and dual-specificity protein phosphatase PTENSMESG000072902.1 AY066355smed_ncbi_20200123PMID:19048075
Oviedo et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30031978telomerase reverse transcriptase subunit isoform 2SMESG000061912.1 JF693291.1smed_ncbi_20200123PMID:22371573
Tan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30031978telomerase reverse transcriptase subunit isoform 2SMESG000061912.1 JF693291.1smed_ncbi_20200123PMID:22371573
Tan et al., 2012
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
neoblastSMED30031978telomerase reverse transcriptase subunit isoform 2SMESG000061910.1 SMESG000061912.1 SMED30031978smed_20140614PMID:22371573
Tan et al., 2012
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
neoblastSMED30031978telomerase reverse transcriptase subunit isoform 2SMESG000061910.1 SMESG000061912.1 SMED30031978smed_20140614PMID:22371573
Tan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30014446SMEDWI-2SMESG000069984.1 SMESG000069981.1 DQ186986.1smed_ncbi_20200123PMID:21806978
Iglesias et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30004677DNA topoisomerase 2SMESG000037559.1 SMESG000037557.1 SMED_13275_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30004677DNA topoisomerase 2SMESG000037565.1 SMESG000037559.1 SMESG000037557.1 SMED_13275_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30008015slc25a-14SMESG000015827.1 SMED_32127_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30008015slc25a-14SMESG000015827.1 SMED_32127_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30008015slc25a-14SMESG000015827.1 SMED_16535_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30008015slc25a-14SMESG000015827.1 SMED_16535_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30010418DNA topoisomerase 2SMESG000037559.1 SMESG000037557.1 SMED_13275_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30010418DNA topoisomerase 2SMESG000037565.1 SMESG000037559.1 SMESG000037557.1 SMED_13275_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30005530SMED30005530SMESG000011757.1 SMED_09813_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30005530SMED30005530SMESG000011757.1 SMED_09813_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30005716Histone acetyltransferase p300SMESG000002563.1 SMED_13428_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30005716Histone acetyltransferase p300SMESG000002563.1 SMED_13428_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30011372Queuosine salvage proteinSMESG000078335.1 SMED_12991_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30011372Queuosine salvage proteinSMESG000078335.1 SMED_12991_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30011372Queuosine salvage proteinSMESG000078335.1 SmWIOct06_013756GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30011148SMED30011148SMESG000051917.1 SMED_10870_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30011148SMED30011148SMESG000051917.1 SMED_10870_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30012534SMED30012534SMESG000012031.1 SMED_06736_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30012534SMED30012534SMESG000012031.1 SMED_06736_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30011774T-complex protein 1 subunit thetaSMESG000009544.1 SMED_06864_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30011774T-complex protein 1 subunit thetaSMESG000009544.1 SMED_06864_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30004243Retrovirus-related Pol polyprotein from type-1 retrotransposable element R2SMESG000078596.1 SMESG000046455.1 SMESG000044750.1 SMESG000020307.1 SMED_09200_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30004243Retrovirus-related Pol polyprotein from type-1 retrotransposable element R2SMESG000020307.1 SMED_09200_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30004136DNA polymeraseSMESG000079687.1 SMED_05156_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30004136DNA polymeraseSMESG000079687.1 SMED_05156_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30004136DNA polymeraseSMESG000079687.1 SMESG000044739.1 SMESG000044721.1 SMED_04360_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30004136DNA polymeraseSMESG000079687.1 SMESG000044739.1 SMESG000044721.1 SMED_04360_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30004136DNA polymeraseSMESG000044728.1 SMED_04360_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30004136DNA polymeraseSMESG000044728.1 SMED_04360_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED3000425660 kDa heat shock protein, mitochondrialSMESG000005331.1 SMED_07079_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED3000425660 kDa heat shock protein, mitochondrialSMESG000005331.1 SMED_07079_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30002742DystoninSMESG000043809.1 SMED_02081_V2_1rGPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30002742DystoninSMESG000043809.1 SMED_02081_V2_1rGPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30004080PIM-1-like proteinSMESG000061809.1 SMESG000061808.1 SMESG000032312.1 SMED_08691_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30004080PIM-1-like proteinSMESG000061809.1 SMESG000061808.1 SMESG000032312.1 SMED_08691_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30004080PIM-1-like proteinSMESG000061809.1 SMESG000061808.1 SMED_08691_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30004080PIM-1-like proteinSMESG000061809.1 SMESG000061808.1 SMED_08691_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30011277Tspan1SMESG000066703.1 SMED_28390_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30011277Tspan1SMESG000066703.1 SMED_28390_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30011277Tspan1SMESG000066703.1 SMED_12608_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30011277Tspan1SMESG000066703.1 SMED_12608_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30001391DNA replication licensing factor MCM8SMESG000004906.1 SMED_11330_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30001391DNA replication licensing factor MCM8SMESG000004906.1 SMED_11330_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30001391DNA replication licensing factor MCM8SMESG000004906.1 SMED_07904_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30001391DNA replication licensing factor MCM8SMESG000004906.1 SMED_07904_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30001391DNA replication licensing factor MCM8SMESG000004906.1 SMED_26504_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30001391DNA replication licensing factor MCM8SMESG000004906.1 SMED_26504_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30001212Tubulin alpha chainSMESG000027786.1 SMESG000079772.1 SMED_04541_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30001212Tubulin alpha chainSMESG000027786.1 SMESG000079772.1 SMED_04541_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30035904PROG-1SMESG000024882.1 SMESG000024707.1 SMED_01436_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30035904PROG-1SMESG000024882.1 SMESG000024707.1 SMED_01436_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30027770high mobility group-2SMESG000020771.1 SMED_09062_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30027770high mobility group-2SMESG000020771.1 SMED_09062_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30026364SMED-P53SMESG000078256.1 SMED_20048_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30026364SMED-P53SMESG000078256.1 SMED_20048_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30002911LipaseSMESG000074187.1 SMED_01065_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30002911LipaseSMESG000074187.1 SMED_01065_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30002911LipaseSMESG000074187.1 SMED_24410_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30002911LipaseSMESG000074187.1 SMED_24410_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30018750SMED30018750SMESG000032765.1 SMED_09519_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30007895Protein kinase domain-containing protein DN315983ncbi_smed_estsPMID:23235145
Hubert et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30029784histone lysine N methyltransferase MLL-1SMESG000027630.1 KC262346smed_ncbi_20200123PMID:23235145
Hubert et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30022027host cell factor-1SMESG000068250.1 KC262343smed_ncbi_20200123PMID:23235145
Hubert et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30005879Histone-lysine N-methyltransferaseSMESG000071222.1 DN309269ncbi_smed_estsPMID:23235145
Hubert et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30005879Histone-lysine N-methyltransferaseSMESG000071222.1 HO004937ncbi_smed_estsPMID:23235145
Hubert et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30010267wdr82-2SMESG000044331.1 KC262342smed_ncbi_20200123PMID:23235145
Hubert et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30019367Set1/Ash2 histone methyltransferase complex subunit ASH2SMESG000051162.1 DN305606ncbi_smed_estsPMID:23235145
Hubert et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30019367Set1/Ash2 histone methyltransferase complex subunit ASH2SMESG000051162.1 KC262336smed_ncbi_20200123PMID:23235145
Hubert et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30019367Set1/Ash2 histone methyltransferase complex subunit ASH2SMESG000051162.1 DN296978ncbi_smed_estsPMID:23235145
Hubert et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30023232Lysine methyltransferase 2ESMESG000051295.1 DN314063ncbi_smed_estsPMID:23235145
Hubert et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30023232Lysine methyltransferase 2ESMESG000051295.1 HO006509ncbi_smed_estsPMID:23235145
Hubert et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30026693CXXC-type zinc finger protein isoform 1SMESG000074165.1 DN310044ncbi_smed_estsPMID:23235145
Hubert et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30026693CXXC-type zinc finger protein isoform 1SMESG000074165.1 HO005298ncbi_smed_estsPMID:23235145
Hubert et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30026151WD repeat domain 82SMESG000059185.1 DN305959ncbi_smed_estsPMID:23235145
Hubert et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30026151WD repeat domain 82SMESG000059185.1 DN297595ncbi_smed_estsPMID:23235145
Hubert et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30033482Histone-lysine N-methyltransferaseSMESG000062296.1 DN301487ncbi_smed_estsPMID:23235145
Hubert et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30033482Histone-lysine N-methyltransferaseSMESG000062296.1 DN308184ncbi_smed_estsPMID:23235145
Hubert et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30029979Retinoblastoma-binding protein 5 homologSMESG000077004.1 DN308991ncbi_smed_estsPMID:23235145
Hubert et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30029979Retinoblastoma-binding protein 5 homologSMESG000077004.1 HO007192ncbi_smed_estsPMID:23235145
Hubert et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30033466Histone H4SMESG000070504.1 SMESG000070501.1 SMESG000011051.1 DN306099ncbi_smed_estsPMID:17376870
Wang et al., 2007
whole organism juvenile colorimetric in situ hybridization evidence
neoblastSMED30033466Histone H4SMESG000070504.1 SMESG000070501.1 SMESG000011051.1 DN306099ncbi_smed_estsPMID:17376870
Wang et al., 2007
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30034057SMED30034057 JQ917423smed_ncbi_20200123PMID:24120894
Rossi et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30034057SMED30034057 JQ917423smed_ncbi_20200123PMID:24120894
Rossi et al., 2014
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30031463VASA-1SMESG000067941.1 JQ425140.1smed_ncbi_20200123PMID:27523733
Lei et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30027770high mobility group-2SMESG000020771.1 SMED30027770smed_20140614PMID:27523733
Lei et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30011043Protein kinase domain-containing proteinSMESG000025533.1 SMED30011043smed_20140614PMID:27523733
Lei et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30017903Timeless circadian clockSMESG000030310.1 SMESG000030309.1 SMESG000030307.1 SMED30017903smed_20140614PMID:27523733
Lei et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30024555Cyclin-dependent kinaseSMESG000023609.1 SMESG000023590.1 SMED30024555smed_20140614PMID:27523733
Lei et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30025757JUNLI-1SMESG000067959.1 SMED30025757smed_20140614PMID:27523733
Lei et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30034490FGFR1SMESG000036598.1 SMESG000036590.1 JQ425160.1smed_ncbi_20200123PMID:27523733
Lei et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30034490FGFR1SMESG000036598.1 SMESG000036590.1 JQ425160.1smed_ncbi_20200123PMID:27523733
Lei et al., 2016
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30025780Serine/threonine-protein kinase PLKSMESG000022441.1 SMED30025780smed_20140614PMID:27523733
Lei et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30009204FGFR4SMESG000054557.1 SMED30009204smed_20140614PMID:27523733
Lei et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30009204FGFR4SMESG000054557.1 SMED30009204smed_20140614PMID:27523733
Lei et al., 2016
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30026496endonuclease/exonuclease/phosphatase family domain-containing protein 1-likeSMESG000041739.1 SMED30026496smed_20140614PMID:27523733
Lei et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED300224045'-tyrosyl-DNA phosphodiesteraseSMESG000024529.1 SMED30022404smed_20140614PMID:27523733
Lei et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30034594SMED30034594SMESG000074988.1 SMED30009590smed_20140614PMID:27523733
Lei et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30017456epidermal growth factor receptor 3SMESG000016935.1 egfr-3smed_ncbi_20200123PMID:27523733
Lei et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30017456epidermal growth factor receptor 3SMESG000016935.1 egfr-3smed_ncbi_20200123PMID:27523733
Lei et al., 2016
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30009590DNA repair and recombination protein RAD54BSMESG000074988.1 SMED30009590smed_20140614PMID:27523733
Lei et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30014813Y box protein-1SMESG000058039.1 SMED30014813smed_20140614PMID:27523733
Lei et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30009651NSD-1SMESG000015096.1 SMESG000015015.1 JQ425134.1smed_ncbi_20200123PMID:27523733
Lei et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30005823Protein kinase N2SMESG000014536.1 SMESG000014533.1 SMED30005823smed_20140614PMID:27523733
Lei et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30005246cyclin B-2SMESG000060055.1 SMED30005246smed_20140614PMID:27523733
Lei et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30019275FHA domain-containing proteinSMESG000022990.1 SMED30019275smed_20140614PMID:27523733
Lei et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30014394cyclin B-1SMESG000028669.1 SMED30014394smed_20140614PMID:27523733
Lei et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30006065Abnormal spindle-like microcephaly-associated protein homolog SMED30006065smed_20140614PMID:27523733
Lei et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30023063Helicase POLQ-like protein SMED30023063smed_20140614PMID:27523733
Lei et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30006364ATPase family-like proteinSMESG000027081.1 SMESG000027059.1 SMED30033118smed_20140614PMID:27523733
Lei et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30033118Spermatogenesis-associated protein 5SMESG000027081.1 SMESG000027059.1 SMED30033118smed_20140614PMID:27523733
Lei et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30023035SMED30023035SMESG000050427.1 SMED30023035smed_20140614PMID:27523733
Lei et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30018177insulin receptor-like 1 proteinSMESG000042173.1 JN049497.1smed_ncbi_20200123PMID:27523733
Lei et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30018177insulin receptor-like 1 proteinSMESG000042173.1 JN049497.1smed_ncbi_20200123PMID:27523733
Lei et al., 2016
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30030751Fibroblast growth factor receptorSMESG000022068.1 SMESG000022067.1 SMED30030751smed_20140614PMID:27523733
Lei et al., 2016
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30030751Fibroblast growth factor receptorSMESG000022068.1 SMESG000022067.1 SMED30030751smed_20140614PMID:27523733
Lei et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30003832cdk1-like protein FJ588601.1smed_ncbi_20200123PMID:27523733
Lei et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30000103DnaJ subfamily BSMESG000073794.1 GU591873smed_ncbi_20200123PMID:21356107
Fernández-Taboada et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30004469Splicing factor 3B subunit 1SMESG000025534.1 GU591865smed_ncbi_20200123PMID:21356107
Fernández-Taboada et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30012555Ras-related protein Rab-39BSMESG000056866.1 GU591871smed_ncbi_20200123PMID:21356107
Fernández-Taboada et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30030988T-complex protein 1 subunit thetaSMESG000023665.1 GU591864smed_ncbi_20200123PMID:21356107
Fernández-Taboada et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30009284Hsp70SMESG000056256.1 GU591875smed_ncbi_20200123PMID:21356107
Fernández-Taboada et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30013725cAMP-dependent protein kinase catalytic subunitSMESG000077752.1 GU591877smed_ncbi_20200123PMID:21356107
Fernández-Taboada et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30023331Transposon Ty3-I Gag-Pol polyprotein GU591867smed_ncbi_20200123PMID:21356107
Fernández-Taboada et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30022937RNA polymerase-associated protein RTF1-like proteinSMESG000029426.1 GU562964smed_ncbi_20200123PMID:21356107
Fernández-Taboada et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30023604HunchbackSMESG000062486.1 GU591876smed_ncbi_20200123PMID:21356107
Fernández-Taboada et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED3002552260 kDa heat shock protein, mitochondrialSMESG000065325.1 GU591874smed_ncbi_20200123PMID:21356107
Fernández-Taboada et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30013863Rac-1SMESG000024961.1 GU591872smed_ncbi_20200123PMID:21356107
Fernández-Taboada et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30005465Ras-related protein Rab-11ASMESG000073334.1 GU591870smed_ncbi_20200123PMID:21356107
Fernández-Taboada et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30007501lectin-like proteinSMESG000028264.1 GU591869smed_ncbi_20200123PMID:21356107
Fernández-Taboada et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30009514histone H2BSMESG000067931.1 KC916781smed_ncbi_20200123PMID:24903754
Rouhana et al., 2014
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30016975histone H2ASMESG000049774.1 KC916780smed_ncbi_20200123PMID:24903754
Rouhana et al., 2014
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30021776Histone H3SMESG000074574.1 SMESG000074479.1 KC916782smed_ncbi_20200123PMID:24903754
Rouhana et al., 2014
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30000270Histone H3SMESG000049112.1 SMESG000049109.1 KC916784smed_ncbi_20200123PMID:24903754
Rouhana et al., 2014
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30027563Ras and EF-hand domain-containing protein homologSMESG000049774.1 KC916780smed_ncbi_20200123PMID:24903754
Rouhana et al., 2014
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30033466Histone H4SMESG000070504.1 SMESG000070501.1 SMESG000011051.1 KC916777smed_ncbi_20200123PMID:24903754
Rouhana et al., 2014
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30029763histone H1SMESG000024348.1 SMESG000010800.1 KC916779smed_ncbi_20200123PMID:24903754
Rouhana et al., 2014
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30017680Histone H3SMESG000013634.1 KC916783smed_ncbi_20200123PMID:24903754
Rouhana et al., 2014
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30001428SMG-1SMESG000009788.1 JF894292smed_ncbi_20200123PMID:22479207
González-Estévez et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30006752TorSMESG000025384.1 JF894291smed_ncbi_20200123PMID:22479207
González-Estévez et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30022631Dimer_Tnp_hAT domain-containing proteinSMESG000049778.1 SMESG000048378.1 SMESG000039423.1 SMESG000039024.1 SMESG000024543.1 SMESG000022136.1 SMESG000002434.1 JF894290smed_ncbi_20200123PMID:22479207
González-Estévez et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30028047Regulatory-associated protein of mTORSMESG000049778.1 SMESG000048378.1 SMESG000039423.1 SMESG000039024.1 SMESG000024543.1 SMESG000022136.1 SMESG000002434.1 JF894290smed_ncbi_20200123PMID:22479207
González-Estévez et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30001723HTH CENPB-type domain-containing proteinSMESG000049778.1 SMESG000048378.1 SMESG000039423.1 SMESG000039024.1 SMESG000024543.1 SMESG000022136.1 SMESG000002434.1 JF894290smed_ncbi_20200123PMID:22479207
González-Estévez et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED3003144714-3-3 protein beta/alphaSMESG000067831.1 SMED30031447smed_20140614PMID:26711341
Duncan et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30009284Hsp70SMESG000056256.1 Hsp70smed_ncbi_20200123PMID:26711341
Duncan et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30017177Autophagy-related protein 9SMESG000013135.1 SMED30017177smed_20140614PMID:26711341
Duncan et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30034078SMED30034078SMESG000070890.1 SMED30034078smed_20140614PMID:26711341
Duncan et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30009514histone H2BSMESG000067931.1 DN290330ncbi_smed_estsPMID:16890156
Guo et al., 2006
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30009858Polyadenylate-binding proteinSMESG000044671.1 SMED30009858smed_20140614PMID:28807897
Bansal et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009858Polyadenylate-binding proteinSMESG000044671.1 SMED30009858smed_20140614PMID:28807897
Bansal et al., 2017
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30031773Msh2SMESG000016751.1 JF511467smed_ncbi_20200123PMID:21747960
Hollenbach et al., 2011
whole organism adult hermaphrodite RNA-sequencing evidence
neoblastSMED30031773Msh2SMESG000016751.1 JF511467smed_ncbi_20200123PMID:21747960
Hollenbach et al., 2011
whole organism asexual adult RNA-sequencing evidence
neoblastSMED30031773Msh2SMESG000016751.1 JF511467smed_ncbi_20200123PMID:21747960
Hollenbach et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30004304Proliferating cell nuclear antigen EU856391smed_ncbi_20200123PMID:21747960
Hollenbach et al., 2011
whole organism adult hermaphrodite RNA-sequencing evidence
neoblastSMED30004304Proliferating cell nuclear antigen EU856391smed_ncbi_20200123PMID:21747960
Hollenbach et al., 2011
whole organism asexual adult RNA-sequencing evidence
neoblastSMED30002877IQ motif and SEC7 domain-containing protein 2SMESG000070179.1 SMED_07038_V2_2GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30002877IQ motif and SEC7 domain-containing protein 2SMESG000070179.1 SMED_07038_V2_2GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30002877IQ motif and SEC7 domain-containing protein 2SMESG000070179.1 SMED_07038_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30002877IQ motif and SEC7 domain-containing protein 2SMESG000070179.1 SMED_07038_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30002877IQ motif and SEC7 domain-containing protein 2SMESG000070179.1 SmWIOct06_016157GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30003764N-alpha-acetyltransferase 40SMESG000077166.1 SMED_10477_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30034617SMED30034617SMESG000053935.1 SMED_01263_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30034617SMED30034617SMESG000053935.1 SmWIOct06_043235GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30034617SMED30034617SMESG000053935.1 SmWIOct06_035939GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30034617SMED30034617SMESG000053935.1 SMED_02039_V2_1rGPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30034617SMED30034617SMESG000053935.1 SMED_02039_V2_2rGPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30034617SMED30034617SMESG000053935.1 SMED_02039_V2_2rGPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30025661Aurora kinaseSMESG000016505.1 SMED_05327_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30025661Aurora kinaseSMESG000016505.1 SMED_05327_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30025661Aurora kinaseSMESG000016545.1 SMESG000016505.1 SMESG000004605.1 SmWIOct06_004921GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30025661Aurora kinaseSMESG000016545.1 SMESG000016505.1 SMESG000004605.1 SMED_12282_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30025661Aurora kinaseSMESG000016545.1 SMESG000016505.1 SMESG000004605.1 SMED_31282_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30025661Aurora kinaseSMESG000016545.1 SMESG000016505.1 SMESG000004605.1 SMED_31282_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30025661Aurora kinaseSMESG000016545.1 SMESG000004605.1 SMED_31282_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30025661Aurora kinaseSMESG000016545.1 SMESG000004605.1 SMED_31282_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30025661Aurora kinaseSMESG000016505.1 SmWIOct06_001228GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30025780Serine/threonine-protein kinase PLKSMESG000022441.1 SMED_16511_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30025780Serine/threonine-protein kinase PLKSMESG000022441.1 SMED_16511_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30025780Serine/threonine-protein kinase PLKSMESG000022441.1 SMED_07484_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30025780Serine/threonine-protein kinase PLKSMESG000022441.1 SMED_07484_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30035929SWI/SNF complex subunit SMARCC2SMESG000031576.1 SMESG000013315.1 SMED_24609_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30035929SWI/SNF complex subunit SMARCC2SMESG000031576.1 SMESG000013315.1 SMED_24609_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30030135AAA domain-containing proteinSMESG000045800.1 SMED_32658_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30030135AAA domain-containing proteinSMESG000045800.1 SMED_32658_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30027740SMED30027740SMESG000045107.1 SMED_17283_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30027740SMED30027740SMESG000045107.1 SMED_17283_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30027740SMED30027740SMESG000045107.1 SMED_38037_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30027740SMED30027740SMESG000045107.1 SMED_38037_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30008368RTEL1SMESG000064419.1 SMED_13828_V2GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30002348Cell division control proteinSMESG000070150.1 SMED_29386_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30002348Cell division control proteinSMESG000070150.1 SMED_29386_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30002348Cell division control proteinSMESG000070150.1 SmWIOct06_030436GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30013596Chromodomain-helicase-DNA-binding protein 1-likeSMESG000081089.1 SMED_13213_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30013596Chromodomain-helicase-DNA-binding protein 1-likeSMESG000081089.1 SMED_13213_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30002663TNF receptor-associated factorSMESG000018404.1 SMED_30483_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30002663TNF receptor-associated factorSMESG000018404.1 SMED_30483_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30017162Casein kinase II subunit betaSMESG000060292.1 SMED_08796_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30017162Casein kinase II subunit betaSMESG000060292.1 SMED_08796_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30009196Endoplasmic reticulum chaperone BiPSMESG000068215.1 SMED_27863_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30009196Endoplasmic reticulum chaperone BiPSMESG000068215.1 SMED_27863_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30009196Endoplasmic reticulum chaperone BiPSMESG000068215.1 SMED_27864_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30009196Endoplasmic reticulum chaperone BiPSMESG000068215.1 SMED_27864_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30001557Radial spoke head 1 homologSMESG000047536.1 SMED_31516_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30001557Radial spoke head 1 homologSMESG000047536.1 SMED_31516_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30002688Tubulin alpha chainSMESG000009951.1 SMED_03274_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30002688Tubulin alpha chainSMESG000009951.1 SMED_03274_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30006574Eukaryotic translation initiation factor 4E family member 2SMESG000002783.1 SMED_28034_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30006574Eukaryotic translation initiation factor 4E family member 2SMESG000002783.1 SMED_28034_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30010251Neurogenic differentiation factorSMESG000066244.1 SMED_05724_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30010251Neurogenic differentiation factorSMESG000066244.1 SMED_05724_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30001977SZ12-1SMESG000035646.1 SMED_28607_V2GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30001977SZ12-1SMESG000035646.1 SMED_28607_V2GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30006456ClaspinSMESG000049039.1 SMED_04282_V2_1GPL14150PMID:22385657
Wagner et al., 2012