neoblast

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ Figures

  ▻ In Situ Hybridization Data

  ▻ Sequences

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  neoblast


DEFINITON:

  A heterogeneous population of pluripotent, somatic adult stem cells and lineage primed progenitors that are required for maintenance and regeneration of all cell types in planaria, including the germline.


TERM DEFINITION CITATIONS:

  PMID:22899852, planaref-0000004, PMID:21566185, PMID:16311336


TERM CITATIONS:

Expand publication list


TERM ID:

  PLANA:0000429


ABOUT THIS TERM:

neoblast

  ↳is a material entity, progenitor cell and stem cell

  ↳contained in tail region, ventral region of the whole animal, copulatory region, posterior region of the whole animal, parapharyngeal region, prepharyngeal region, head region, dorsal region of the whole animal and anterior region of the whole animal

  ↳existence overlaps Stage 6, Stage 5, juvenile stage, asexual adult, adult hermaphrodite, Stage 8 and Stage 7

  ↳existence starts during or after Stage 5


Expand to see terms that develops from neoblast



DEPICTED BY:


BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


FIGURES:


Figure 9: Ontogeny of the adult neoblast compartment. 

Asynchronously cycling piwi-1+ cells fuel embryogenesis, giving rise to all temporary and definitive tissues. During S2, some piwi-1+ blastomeres (purple cells) exit the cell cycle and differentiate into temporary embryonic tissues (primitive ectoderm, temporary embryonic pharynx and primitive endoderm). The remaining piwi-1+ blastomeres, located in the embryonic wall (purple cells, S3-S4), continue to divide and express both early embryo enriched transcripts (turquoise arrow) and adult asexual neoblast enriched transcripts (red arrow). As organogenesis begins during S5, early embryo enriched transcripts are downregulated throughout the compartment (purple cells transition into red). Concomitantly, progenitor subpopulations required for definitive organ formation are specified via the heterogeneous expression of developmental transcription factors within the piwi-1+ population (colored cells denote different progenitor subpopulations). Adult pluripotent neoblasts, themselves a lineage, are established during S5 (red cells). Embryonic donor cells harvested during or after S6 function similarly to adult neoblasts (cNeoblast activity, gray arrow). Pluripotent and lineage-primed neoblasts established during embryogenesis are maintained throughout the lifetime of the animal, where they are required for tissue maintenance during homeostasis and formation of new tissue during regeneration.

 

 

back to top


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30001900Bruno-like proteinbruli-1Stage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8neoblast, blastomere
SMED30033466Histone H4Stage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, neoblast, primitive ectoderm, embryonic pharynx, blastomere
SMED30004304Proliferating cell nuclear antigenPCNAStage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8neoblast, blastomere
SMED30010115AFJ24744.1ribonucleoside diphosphate reductase subunit M2-2RRM2-2Stage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8neoblast, blastomere
SMED30007406Q2Q5Y9SMEDWI-1piwi-1Stage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8neoblast, blastomere
SMED30014446Q2Q5Y8SMEDWI-2piwi-2Stage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8neoblast, blastomere
SMED30001362ACC97187.1SMEDWI-3piwi-3Stage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8neoblast, blastomere
SMED30019097AFD29619.1SOXP-1SOXP-1Stage 4, Stage 5, Stage 6, Stage 7, Stage 8neoblast, sigma neoblast, blastomere
SMED30035063AFD29620.1SOXP-2SOXP-2Stage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8neoblast, sigma neoblast, blastomere
SMED30013909AHC00376.1tud-1tud-1Stage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8neoblast, blastomere
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30010115 ID=SMED30010115|Name=ribonucleoside diphosphate reductase subunit M2-2|organism=Schmidtea mediterranea sexual|type=transcript|length=1127bp
GTTTTTAATGAACTGAATCAGGTTTAATGCAAAATAGTCATTTTAATTTCTAGATAAATTAACAGTAATTCTTTCGAGAT
TAGATATTTATTATGGAGATTTTATTAACAGAAGATAAAAGTCGAATAGGATTTCTTAATATACAATATGAAGATATATG
GGAAATGTTTAATAAAGCTCGATCTTCATTTTGGACTGTAAATGAAGTTAATTTATCAAAAGATTTTGCTCACTGGAAAA
AAATGAATGACGATGAACGGTATTTCATTACTCACGTTCTTGCATTTTTTGCTGCCAGTGATGGAATTGTCAATGAAAAT
CTCGTCGAAAGATTCATTCAAGAAGTGAAAATTCCCGAAGCTGAGGCATTTTACAGTTTTCAAATTGCAATTGAAAACAT
TCATTCAGAAATGTATTCTCTATTAATCGATTCTTATGTTACTGATACAGAAACAAAGAATAAATTATTTAATGCCATCG
AAACTATGCCATGCGTTCAGAAAAAAGCTCAATGGGCATTGCGTTGGATTAGCGATAAAAAATCCACTTTTGGAACTAGA
GTTGTTGCATTTGCTGCTGTCGAGGGAATATTTTTCAGTGGTAGTTTTGCATCGATATTTTGGCTTAAAAAGCGTGGATT
AATGCCCGGATTATGTTTCAGCAACGAATTAATTAGCCGAGATGAAGGACTTCATTGCGATTTTGCTTGTTTGATGTTTA
AATATTTAAGTAGCAAACCGTCACCTGAACAAGTTTTGGATTTGATCAAAGAAGCTGTCGGAATCGAGAAGGAATTTCTC
ACCGACGCATTGCCGGTTTCATTGATTGGCATGAACGCTGAATCGATGTGTGAGTATATTGAATTTGTGGCCGACCGGCT
GCTGGTTGAATTGGGCTGTGACAAGTTCTGGAACACAGAGAACCCGTTGGATTTCATGGATAATATTTGCATCGATGGGA
AAACTAACTTCTTTGAGAAACGAGTCGGTGAATATTCCATGTCGAGCGTTGAGGACAAACACAAATTTGATGATGTCAAT
TTCGATATTGATTTTTGAGGGATTCCGTTTTTTGGCGCCAGTGTGCATTTAATGTGTTTTGGTTGTAATTGGCTATTTTT
GTTTGTT
>SMED30007406 ID=SMED30007406|Name=SMEDWI-1|organism=Schmidtea mediterranea sexual|type=transcript|length=2730bp
AATCGAATACATAAAAATTTATTTGACACCAAATACAAAGAGACATTAATCTACAAGTAAAATAAGCGTTCGCGAATTCT
GTCATTTATCGCTGGAGGAGTAACACCACGATGAATCTTGCCAACGAGTTCAGCCAAACGATGGGCATAATGCGTTGGAA
CAGGAACTCGGATTGTTCCCATCCAGTTAAAATACAAATGTGTTAACGAATAAGTTATTTGCTGCAATACACTCGGAGAC
ATAACTGAAACCTCATTTGTTTTCTTGTTTGTAAACTTAGTGTCCATAAGAACATTATAATTCGTAGGAGATGCTGTACC
TTTAGTTGTTTTCTGAGACACCAAGTAAAATTCATAGAAATTGGGTTTCACTATTTTCTCATCAACCACAGTACCAGGAT
TTGGATTAGCCCCATCTTTGAAAAATTTAACACTAATTCTCTTCTTAACCACAACATAAATAATTTGGGGCAAAGTTTGA
TTTTCGTAAATTTTCTCTATCATTTTCATAACAGCATCAGTTTCGAACTTTTTGGTAAATGCTAACTGTGAATCTCCAAC
ACCGTCACGATAAATAATCAAACGAAGAGGCATAGTGTTAAATTTGTTTTGGAATGTTGTAAGGGCCGTTAGGAAGTTTT
TGCCCAAATTTTCGTGAAATTCATTTTTACCTTTAGATGAATTGACAAAACTGATATACTGAGAAAATTTGGCACTAATT
GAAAATACGGATGCTTGAACAGATCTTTTACCGGTTTTGCTATGAAAAGTATCCAATCCTACAATCATAGTCGGTGCCAT
TTTAAGATTAATACCCCATGGGTCGTATCCTAATTTAGAAAACATTTGCATAACTGATTTATCTGCAACCGTTTTACGAC
GTCGATCATCTCTATTACTTCCGTTTCTCTGCGTCACACACTGAGTCAATAGACCTGTAGACATTGTAAAATTCTTTACT
TTTGCGTAAACTTTATCATCAGGAATGAACACTAATGCCATATGTACCTTGCTTACACGAATAAAATCTGTTAAAGCGTC
TTCAACTTCATTGGATCGACATGAAGATATACTGTCCATTGTGTAATTGATTCTTAATCTTCCTATTTCTCTTTTAACAT
CTTCAATAAAATTGTTGAAGTGACTAGGGTTTCGATCAACAACCAGTACACCAAAACGATGAGCTGTGCCTTTAGGAACG
TCAAATTTAATTTCCCCAAACTTCCAATCATCAGGGATTTTAGTATTAATTTTAACTTCGTTTGAAAATATATCAACTGG
AGCCAATTCACGACCACGAATCGTAATCGGTTGTTCTTCAATACACATCCCCCAGCTCTTCATATAATCTTTTGATTTCC
CAGCTCCGGTCCACTTACAAAAATCTCTTATGTCATTTAATCGTTCTCTAGGCTCACGTTTCAATACGGTTCCTAAATTC
TTTTGCAAATTTATATTACTTCTTTCACTATCCGAAAATCCACATAAATAGCATAATTCACCTGGAATTGATAAACTTTG
ATCTGTTTCTGTAGGTCCTTCAGGTTCATTTTCAGTTTTTTTCTTTTGGGCGAACCATCGATCGCTTGACTCGCGATATA
ACAAATGGTTGTTTGTCATTTTTCAAATTAATGTTATACCGTTGCTTGAAATAATTCAAATAGGATATCTTTTTATCGCC
TAGCTGAACCTCGTCATTAACATCCATTTCTTTAATATCTGAAATTCTATACGTCTTGTTATTATACTTGGTAATTATGT
CCCTTCCTATTAATTGATCAATTTGATCTCGTCGATACACTGATACTACATTGTTTTCATTTAGAACACGATTAATTCTT
TCAAGATAAAGTAAAGTCGAAGCAGTTCCATTTTCATTTGTTCCTCTTGTAATTGTAGTAGAATACCCTCCTAATATCTT
GAAATTGTCCATTTTAAAAAAGCTAGGTCCTTCTCGAATACCACCACTTTCACAATTTGATCCCAGAAAAAATTGTCTAC
CAATTTTTTCTTGTCCCATAAATATTTGAATATTATTAAATACAATATTTATCATCTGATAATATTCTTCAGAATTTTTT
AAAAACGTCGTCAGCAATCGTATGGAAATTTCAACATCTTTGATAACTAAGTTTTCTGTATCTTCATCTGAGTGCCACTT
AGAAGTCGTAAATAATCTTCTGCCATCAAAACAAAATGGTTGACCATTATTTTTGCTGTTTGCATAAGCTAATAATAACT
CTAGCTTAGTACGGATACTTTTATTCTCCATAACTACATCATACATGTAAAATGGTCCTTCGACTTTAATATTAAAGTTA
GCGTAGTTAGACTTGAGACTAACTACTCTTCCATCTTTCCCTATTTTGTCTGTAACTGTATCAGGCTGTAAAGCAGGTTC
AATAATTGCGAATCTTCTTTGGAGACCTCCTCTTCTTGGTCTTAAATTGGGATCACTTGTAACATTAGTTGAATCCATTT
CGTAAATTTGAGTAAAAATGTTAAAACAAAGACTTCGGTTTAAATAAACAAAATATACTATGTAAAACGATAAATATAAT
TGCTTTAATGGTTTATGATTTGTATTATATAATAATAATAATTTAATTTCCCTGTGAATATTATATTAAAATATAGTAAA
AATTACTCGTAAATGTGTGTTAAAGTAATAGGATTAAATTAAAATAAACATTTTACGAAATAAGTTCTAGTCAATTATGA
AGTCTTTTCT
>SMED30004304 ID=SMED30004304|Name=Proliferating cell nuclear antigen|organism=Schmidtea mediterranea sexual|type=transcript|length=907bp
CTAAAAGGTAATAATTTAAATTTAATTAGAACATTGTTTTAATATTCGGTTATATTCTCCATTATTCTAAATTATGTTTG
AAGCAAAATTAATAAAAGGCGAAGTTTGGAAAAAGGTTATAGAAGCTATAAAAGACTTAGTACAAGAAGCAACATTGGAT
TGCTCAGAAAATGGAATTAGTCTTCAAGCCATGGATACATCTCATGTGTCCTTAGTTAGTATGCTTCTTCGAAGTGATGG
TTTTGAGACTTATCGATGTGATAGAAATGTCAATCTCGGTCTTAATATAACAAGTGTTTCAAAAATTTTAAAGGCGCTTG
GTAGTAATGATTCCCTAACAATGAAAGCCGCTGATTCAAGTGAAACAATTTCGCTTTTGATAGAATCTGCAAATGAAAAT
GAATTATCTGAATACGAAATAAAATTAATGGACTTGGATGGAGATCACTTAGGTATACCAGATACTGAATATAAGTGCAT
TGTGAAAATGCCGAGTTCAAAGTTACAAAGAATATGTCGAGATTTAAGCCAAATTGGAGAAGCAATCACGATTTGTGTTA
CTAAAGATGGTGTAACTTTTGCTGCTGCTGGAGATCTAGGAAAAGGAGCTATAAAACTTAATCAAAATTCTAGTGCTGAC
AAAGAAAATGAAGGAGTAACTATTGAAATGACCGAACCTGTTTCGATGACATATTCATTGAGGTATTTCAATATGTTTAC
AAAGGCTGCACCTCTTTCTTCTCAAGTATCTCTGTCGTTGACTGAAAATGTTCCAGCAGTTATTGAGTTCATAATCGAAG
ATTTGGGATTTATTCGATATTACCTAGCTCCTAAAATCGAAGACGACGAGTGAAAGTTTAACTATTAATGTTGTATGTTT
AATAGATGTTATTTTGTTTAAAAAAAA
>SMED30013909 ID=SMED30013909|Name=tud-1|organism=Schmidtea mediterranea sexual|type=transcript|length=2414bp
ATTTAGAAAATGGAGGCAACTTGCGATGTTTTTTTAACGAATTTACCTAAGTCGATTAATGAAGTAGTTGTGAAGAACTT
ATTTTCTTCTGCTGGGAAAGTGTTAAAAGTGAAAATAATAGATGACAAAAGAAACGAAAATCAGAAGCTATGCTTCGTTG
GATTTCGAACTATGGATGAAGCATTAGAAGCCGTCAGAATTGCAGATAAATCTGATGCGTTTGGTGATCCAATTAGAGCC
AGTATATCAAAGAAGTGTTTAGACGGAATGGAGAATAATCAAAATAGATCAAATAATAACAGAAATGATTCAAGTTATAA
AGGAACTGATTCATTTTCAAGAAAGAGTGATTCTAATTTCAAGGATAGTGAAAAGTATCCAACAAACAATGGTGACTTTG
CACAAGTAAATCGTTTAAACAACGTTGGAAGAGGAAGAGGAATCCAGACTAAAATTATTAGTGGTCCACCTTCATTCAAA
ACTAATGAAATTAAGTTAAACGATATTAAACTTAAAACAAAAGAACTGATTGACATCGAAATCGTCGATTTAAGTAGAGT
TGACATTATACTTATAAGGCCAGTAAAGTCAACGGAAAATTCAAAAATTGAAATAGCAGATTTATTGTCACAAATAAATT
CAAATAAATCGAATCTAATGCCAGTTGACTGTCCTAAAATAGGAGATTTTTGTCTTGCAAAATGGACTGAAGATGATTGC
TATTATCGGGCTGAATTGTTAGATATATTAAAGGATGGATCTTTCAAAGTTACTTTTGTTGATGAAGGAACTTCGGGTGA
TATTGTGACTGATTTGAAACACATTCCGACTGGTGCTTTACAGCAGTATCCTAAACAATTTTTGAAGGTTTCAATCGGTT
GCTCAGACGCAAAAGAATTAATGTCATTTATTTTACAAGAGTCTGAAGGAAAGGTGATTAAAATTTATTGGCTCGGAGAA
TATTGTGATTCCGTGCCTGTTGTAAATTTATTTCTGAATGAAGATGAAATTGTGGAAAAATATACCCAAATAAATAAAGT
AAATATCAGGAAAAAATTCTCACAGACATTTGATGATCTCCCAGTACATAACCTCGAAACTAATTCACATTTTTCAATAG
CACCATCAATGTATAAAAACCGAAATGATTTTATTCTTCAGATGAAAACTTTCTCGGTATCTTTAAAGCAAAAAAAATGT
CCTACGGTTTTACCAATTCCTGGTGATATATGTATATATGAGAAAAGGAATGCTAATGGCGAATCATTTCTTCGTTGTGT
TATATTAAGGCGCCAACTTTTTTCTTTTGACATCGAGTTAATAGATATCGGTGAAAAAATAATGAATGTTAATATTGATC
ACCTGTACACAGTCGAAGATATTCATGTAAAAGACGCTCCCTGTGCTATTACTTGCGATTTAGATAGTTCTATTAATATA
GATGGTATTAAGCTCCCTCAAGATTTGATCGATGGTGTTCTCTTTAATCTTAAAAAGTACAACAAAAATAATAAATACAC
TGTAAATTTCATTTTACCACAAAAGAAAGCTTATGAATATGCAAAAGTATCATATAAAGATTTGATTGGTAAAAGCTTTA
AAGTAATAATGTCGCACGTTGTCTCTCCCATTAATTTCTTTATTCAACTTGATGATGGAGAGCATCAGCTTGCACTTGGA
GATATTCAAGAAAAATTAAATATTAATTATAATGGATCACCATTCAAAAGTGCTAGCGATGTTAAAGAAACTCAGGCAGT
TATTGCTCCTTTTATTGTTTCCGGAAGTGATGCGGAACTTTTTCGGGCTTATGTTTTAGAGAAACGAAAGGAATCTCCAC
AAATTCATGTATTGTTTATTGATTATGGTAATGATGAATGGGTGAATTATGAAACTTTACTGAATACAAATGAAGAATTA
GTTTCTAAACCAGGTTTCGCAATACATTGTAAATTATCTCTAAATATTAAGAAGGAAGCGTGGAGTCACGCTATTGAATT
ATTTAATGATTTAGCTGGTTATACTGAAAATGACCAGGGGACGTTTGTAATGCAGGTTATTAGTGTCGATGGTGATTCGT
TAGTTGTGGACTTGATTTCAGAACTGAAAGGTTCGTTGACGGCCATCTTAGAAAAAAGTGGTACATGTGTAAAGTCCAAT
GAACCAATATGTAATGGAGGAGGACCCCAAGTTAAATTAAATGGCGTTTCAAATGATAAATCTCAATCAGCTATTCTTGA
AAATTTATCTGAAGGAGAATTATATAAAAAATTTATTGAACTAGAACGGAGATTAAGTGCTTTAGAGATATTGATGAAAT
AATGCTACCCGCGCAATTAGTATTATCAAATTATGATAATCTAGTCTTGATGTGTTTAAAATTTTGTATTTTAACATAAA
TTTATTCCGTGTTG
>SMED30025482 ID=SMED30025482|Name=Histone H4|organism=Schmidtea mediterranea sexual|type=transcript|length=552bp
TGTCATTATCAAAATATTTTCAATATATAATAAATCAGAAATCACTAAACAGTCATTACTAAACTATTCTAACTCAAAAT
GTCTGGTCGAGGAAAAGGAGGAAAAGGCTTAGGTAAAGGTGGAGCTAAAAGACATAGAAAAGTTTTGCGAGACAACATCC
AAGGAATCACGAAACCAGCTATTAGAAGGTTAGCTCGCAGAGGTGGCGTGAAAAGAATTTCTGGTCTTATCTATGAAGAA
ACTAGAGGTGTTTTAAAGGTTTTCCTTGAAAACGTAATCAGAGATGCTGTTACTTACACTGAACATGCTAAGCGTAAGAC
AGTCACAGCTATGGATGTTGTTTATGCACTTAAACGACAAGGTCGTACTTTATACGGTTTTGGAGGGCCACAAATGTTGA
TTGTAGTGAATTGTTCAAATATTGTTATTCTATCTAGTAATTCTCAGCAATTTTATTAACGTTATTTAGAAATTAATTTT
ACAATTGCTAATTTCGAATGTTATATCTGGTGTCAATGTTCAGTTATATTATTTTACAAATGACTTGAAATG
>SMED30022389 ID=SMED30022389|Name=Proliferating cell nuclear antigen|organism=Schmidtea mediterranea sexual|type=transcript|length=915bp
GTTATTAACGTTATTGGACTATAGTTTTATTATCATAAATTTTTGAATAAAATTGAGATCTTCTTTTAATAATGCTATTT
GAAGCAAAATTAAATAAAGTAGATGCATTTAAAAAGCTGATTGATTCGGTTAAAGAATTAATCCAAGAAGCAGTTTTTGA
ATGTTCATCCAAAGGTATTGAATTACAAGCAATGGATAGTTCACATGTTAGTCTAATATTTCTTTTAATTAAAAAGCAAT
CTTTTTCGTCTTATAAATTTACGAGAAATGTATCTTTGGGTGTAAGTCTTGTAAGTCTATGTAAAATACTCAAACTTTCT
CAAATTAATGATTCAATTACAATTAAAGTTGATAATGAATGTGAAACAGTCGAATTTGTTTTCGAATCATCAGATAGTGA
TCGAATGTCTGAATTCAGTTTGAAGTTAATTGACTTGGATATTGACTGTTTAGCTATTCCGGAATCAGACTATGATTGCG
TAGCAACAATCCCGTCTGTAGAATTTAACAAAATATGCCAGCAATTAGCTGTTATTGGAAGCACTGTAACAATTGTAGTA
ACTAAACAGTCAATTCAATTTTCTTGCTCCGGAGACATGGGGAAAGGGAAAATATTATTAAATCAAACTGTAAATAAACC
GAGAATAGAAGATTCTATTAATATTGAAGTTGTTAATCCATTATCAATGGTTTACTCGCTTCGATTTTTTCATATATTCT
CGAAGGCCTATTCGCTTAGCAACAGAGTTTCTTTATCTTTTGCTAATAATTTCCCAGCTTTGGTGGAGTACAGCATGAAT
GAATTGGAAGGTCATCTACGATTTTACTTAGCTCCAAAATTAGATGATGATTGATTTTGCTCTTTTTCTAGTTTTGGGGT
GATATTTTAATTGTAGTGCTTTTTTAGTATGGTTA
>SMED30019097 ID=SMED30019097|Name=SOXP-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1596bp
GGAATAACAGCCAATTAGGGATCAGCTGCAATTTGGCCTATGATTGGACATTGATTTTTATAGTCTCAGGCGTTCTCAGC
TTACGTGTGCACCTTTTTAGTGGACACGTTAAATTTGATAGGTGCTTAGTGGTGTTGATTCCTGTTTGGAAACTGTATAT
AACCAAGGTTATTTGTTGCTTTGAGACAAATGCAACACAATCAAATAATTAATTATGCTATGTTCAAATTGTTCAAACAA
TCAGGATACTTTGAAATTATGGATGGTCCATTTAGCTTCTTGTCACCCATTACCTCCTGAATGGCTTAGTGAAAAGGCCA
AAGTATTAAATGATGACGAAAATCAGCGCCCCTATACAATTGTCACTGATTCCCGAAAAAGAAGGCGACGTCCAACCACA
CCAAGACCACTAAATACGTTCATGATTTTTTCGAGGCATATCAGACGAAATATTCTCTCAGTGTTTCCGGATGCATCAAA
TTCCCAATTAAGCAAAGAGCTTGGAATTTTATGGAAGAAAGTCACAAATGAAATTAAATCCCTTTATGAAGAAGAGGCAA
AGCGATTGGCTCAATTACATGCTCTTGAATTTCCCGATTATAAATATCAACCAAAGAAACGAGTCCGAAGATTTGGAAGA
GCGATTTATGATCGACAGCCCTGTACAACAGAAAGATCTAACTCAACTAGTGCAACAGACGAAGAAAATGGTAAAGACAA
TAATAGTGTTCAAGACGGTAGAAGATCAAGCGATATTGAGAATCAGTATATAAGATATTCAGTTTTGGGTAAAAATATTG
TAAAACGAGAATGTCAGTCCTTTAATAGTCCTTTAAAAAGCGACAACGTTAAATTGGAAACGCAAGAACAAGATTTTATC
CAAGCGATGCCCAAACCTCTAAACGTCCGAATAACGAATTACAACGAAAACAGTATATTTTTACGACAACAAAGATTACC
ATCAAGTAGCACAATGTATTTACTTCCTTCAGAAAACCTAATAATTAGTAATGGGATTATGGGATCACAGGACTTGGGTG
AGGATTATTGTAGAGAGTTGTATATAATTAATGATTTTTTCCCAGAAAATGTAAACATAGACGATGAAATTGATATAACA
GGAAACATTTTTAGCAATGATTTAGATTTAGAGTGGTCTGAAATTGATGAAAATTACAAACAAGATTTACCAAATCTTAA
TTCATTATTTCAACACTAATATATTTGATTTATAAAATATTTAAATATTTTTTATTAAACAGTCTTTTACATGTACATAT
AGTATTGGAACTCTTCTCTGACTTATAAGATAACAGAGATATTGTAATAAGATTAAATTGGTTATGTGTTTCGGTTTTTG
TAAGATTGGTAATTTTCAGAAGAATTTAGACTTTTTTCATGGAAATTGGAATTGAGAAACAAACTGAATAAAGAAACAAA
TTTTTGAAAAAAACGAAACAGATACTTATTATCAAAAGAAAATTATCTGAAGCATCGAGTCGGTATGAAAAATAAACTAA
TTAGTCAGAAAATTTTTGATGAAATAACGTCTAATGAAATTAAGATCTCCAAGGAATACTTTTTCTAACATTTGAT
>SMED30029163 ID=SMED30029163|Name=Histone H4|organism=Schmidtea mediterranea sexual|type=transcript|length=537bp
AGGTTACAGTTTTTCAACTAATACCTCAAAGAAATAATGAAAGATGGACAGTAGAGTTTTGTCACCATCAGGAGACCAAG
TGTCATTTAGGATGATAATAGCCCAGTTAAGGAATCTTGCTGATCTAATCAATGCCAAAAATATTACAAAATTTCGATTT
AAAAGAAGCTAAAGGAGAAAAATTACACGGAAAAGTTCAGAGGTACAACATCCAAGGCATCCCTAGGTCTGCAATTAAAC
GATTAGCACAAAAAAGAGGTGTGAAAAGAATTCATGGGCTTATTTACAAAGAAACAATATATGTTATCAAGTTAGTCCTT
GAAAATGTCATCTTATATGATATTAAATACACATTGCAAGCCAAGCAAGAAACTTTTACTGCCAAGGATGTTTTTAATAT
TCTTGAATGTTTGGAGTTTTCTATTTTGTGATAACATCCTTCCCCAAATGAAAGTTATCAGATCATTTTGCAAAGTTTGT
GAGAAGGGATATATATTTACCAACAAGAAAAATGTTTTGAATTTAAGAATAGGACTC
>SMED30014446 ID=SMED30014446|Name=SMEDWI-2|organism=Schmidtea mediterranea sexual|type=transcript|length=4773bp
ATTTAATTTTCGAAAAAAAATATGGAGGAAATACCAGTAAAAGTAGCTAAACTTGAAGCGAATGGAAGTGAAACAAGAGG
TAAAATGGGAAATCGTGGTGGCCTGAGAAGAACATTTAGAATTGTTGAACCTAACTTGCAACCTGCTGATATCACTGAAA
AAACAGGAAACATAGGAAGAACAGTTAAATTACAATCAAATTTTACCAAATTCTCTGTTTTGCGTTCAGAAAAGTTCATG
ATGTATGATTCCGTGTTTTCTCAAGTTGGTTTGTCACCCAAAGTAAAATTACAGTTTATTGTTCGAGTCTGCCAAGAAAA
TAAATTGCCAGGGGCTTTTTGTTTTGATGGAAGACGTCTATTTACTAGTGAAAAATGGCATGGAGAATCGGACATTCAAG
AATTTAGTCATGATGAAAAAAAAATGACACTAAGATTGGTATCAACTATCCTTCCTGAAACTGAAGAATATTACCAAATG
ATCAATGTATTACTCAATAATTTACAAGTAATGTTAGGTCAAGAAAGAATTGGTAAAGGTTATTTTTTAAGCCCAAATAT
TACAAAAGATGAAGTTCCCCGTAATTCTGGACCGACATTTTTTGAAACCAATAGTTTTAAAGTTCTTGGGGGCTTTGGTA
CAACTTTACAAAGAGGCACAAAACCAACTGGTGAATTAACCACTCTTTTATATATTGAGCGTATTAACAGAGTATTAAAC
GATAACTCTGTTATGAAGGCATACAACAGAAGAAGTATCGATCAGTTGATAGGCAGAGATATCATAACAAAATATAATAA
CAAAACTTATAGGATAAGTGAAATAAAAGAAATGAACGTAGATGAGAAATTTGAAATGGGTGGTAGAACTTTATCGTATG
CCGAATATTTTAAGGAACGATATAATATTCGATTAACTCAAGGCGATCAACCATTTGTTCTAACGCGAGTGAAGAAACCA
ATGCGTCGAGAAAGAAAGAAAAAAGACGAAGAAGGAGTGGAAAAAGAGAAAGAAAAAGAACGCGAAAAAGAGGCTCCAGA
AGAGAAGGACATGACTCTCAATATTCCTGGAGAGTTGTGTTTCTTATGTGGGTTTTCAGATCAAGAGAAATCGAATATGG
ATCTGCAGAAGAATTTAGGGTGCGTTTTAAAAAGAGAGCCACGTGAAAGATTGGATGATATACCAGCTTATTGTAACTGG
ATTAAAAATAGTGATGCGGCAACTGGAATGTGCAATAAATGGCAGCTGAAAATAGATAACAAACCATTAGAAATCGAAGG
TAGAGAATTACCTCCATGCGATGTAATAAGTGGTGGCAGCAAAATTAATGAAAAAATGGGAGATGATTGGAAATTTGGTC
GAGTTCAATTTGATATTAAGCGTGATCGTAAGCATGAAATCGATGTGGTCATCGTTGATCGAAATGACTTTCAGTATAAA
AATTTTATGAATGATGTGGAACAAGAATTAAGAAACATGAGAATTGATGCTCGAGTTGGAAAGGTTAATACTTGTGGTCC
AAATGATGTTGAAAGATGTTTGAATGATGCCGCTAGAAGTGGAAGTGGGTGTGCTAAAATGGCGCTGGTATTCGTCCCAG
ATGATAGAGTATATGCCAAGGTGAAATCATTTACCATGAGTACTGGTCTTTTAACCCAATGTGTAACAACACGTAATGGT
ACTAATAGAAACGATAAACGAAGAAAGGTGGTTTCAAGTAAAACCGTGATGCAAATATTTGCAAAATTCGGATATGATCC
ATGGACAGTTGAAATTAAATTGAGACCAACTATGATTGTCGGTATGGATACCTATCATAACAAGTCCAGCAAGAAATCAA
TTCAAGCATCTGTATTTTCGATCAACAGCACATTTACACAATATATGAGCTTTGTTAATTCTCCTAAAGGACGTCAGGAA
TTCCACGAAACTTTAGGCAAAAATTTCAATTTAGCGTTAGAAGATTTCAAGAAACGTTATGACATATTGCCCCAGCGAAT
TTTAGTCTTTAGAGATGGTGTTGGAGATAACCAACTTCAATTTACTAAAAATTTTGAAGTTGATGCAATGAAACCGCTTA
TTGAAAATATATACAAAGGCAACGGATTCCCTGTTCCACAAATCATTTATGTCATCGTAAAGAAAAGAGTCGGCACTAAG
CTTTTCAACAGAGGAAATAATCCAAATCCTGGAACTGTTGTGGATAAAGAAATTGTCAAACCGAATTTCTATGAATTTTT
CCTAGTTTCACAAAGAACAACGAAAGGAACTGCAACTCCAACTAATTATAATGTTTTAGAAGATACTCGATTGCTAACGA
AAAAAGGTACTATGGATCCTATGGCACCGAATGAGCTGCAAAAGATTACCTATGCTCTAACTCATTTATATTTCAATTGG
ATGGGAACTATCCGAGTTCCGGTTCCAGTGCATTATGCGCATAGATTGGCTGAATTAGTTGGAAAGGTGCATAAGGGCTC
TAATCCCGTTGCCATTAATGAAAGAATAAGAAATAGGCTCTTCTATTTATAAAAAGATCAAAACTTACATTTTTCTGTGT
TGATTACTATCCCAATTGTGGATTTAATTGTTTCTGAAAGCTGTTCATTCAAATTCTTCTGAAATCCATATTGATTCGTA
AGCAGCCTGTATTTGAATACTAAAATTGATAAAGTAGTTATAAGTATTGTAAAAGTATTAAATATTTGTTTATGTTATTC
GTAATACACTTGGGTTATTGCAATGTTTTAGTTGTTTTTCAATGATAATAAAGCTTAGCTGTATAAATTCTTTTAGGTTT
TTTAGAAGGTTTATTTATATCGTGTAATTGATTGTCGTGTTAATATTAATTAAATAAAAGTTTGATGTAATTGCTTTGTG
TTACGCATAATAAATCTTACGAAATTTCTGAATACAACTGCTGGTGATCGGGATATTGAATGCCGGGTCGTTTGAATTAA
TAATACAAATGCTTTCGATTATTGTCATTAATATTTTCTCCAGTGCGTAATGGGCCAGAGTTCCGGTGCCATGATTAATG
GTTCCTAAATTTTAGAAATAACATTTTGAATGACATGTTAAATGTGTATATAATAAATTTTCTAGTTTTTTTGCTAAGAT
TTTGAGAAATTTTAGTTACCTGTTTTTGTTAATTGCTTTGATAATTTCAATGCTGACACGTGCAGAATTTCACACATCTC
CAGCAGTCGACTGAATTCTTGGATTTTGTTTGATACAATTATGCTTGCAGATGTTATGGCGCATAGATCCAAGAAGGCTG
TGAATCTTGGGTCTTGTTTTGTAAAGGAAGCTTTGTAAAATATGATGGGACAGTTGCACATAAATTCTAGGAATCCAGAT
TTTAGGCAAGATTGAAGTAATGTTGAATGGTTCTATTATAGAATAATCAGTTGCACTTTTAGATAACCAATATACCACAA
AGAGCCATCCGCAAATTTTGAAAGCCCAAAGCATTGAATCGTTGTCTATGTTACTCAGTATAGACAGCAGTAAAATGGCG
CTTTTTTGATATTGTAAACCGAAATGATTACTAGAATTCATTGTTTCGTCAAGAGATTTCGCGAAACTCTGAATATTATC
TGATTGATTTGATACTATTCCTTGGAGTTTACAAATTGATTTCAGTTCCAAATTCATACTATTGTGTTCTGCTGATTTGC
TACTATTGGAGCTCTATAAGGAATTATTAGAATCAATTTTGGTTTGATAGTGGGTTTTGCAATCATTGGCTTATTGTGGG
TTGTGTAACCATGGAAGTAATTGTGAATAGTTATAGTGCTCGCTCTGCATAAAATAATATTTAATCAGTGCTTTAAAGTA
GATTTTTAACGATTATTATGAAAGATTTCTCTTATATATTAATGTTTTTGTATCCTTCAAAAGTTTACTAAAAATAATGC
ACATTTGAAATTTACGCGTTACCATAAAATGTCTGAAGTGGTCCAAAGCAATAAAAGCTTAAAAAGAAAGTTCTTGTTTT
TAAATGTATTGGGATATACTCCCACTAACCTTCCGTACTCCGCTGCCTCCCTTCCCATCACATACAATATTTGCTAGTTC
TACTTACAGAGTTGAAAATCGAAAAATTTTCCCAGTCAATGTCCATGATTATGCTGAATAAATTTTGTCCGAACATAATA
GAGATTGCCTCAGCCAGTATTTCTTTCGTTGTTGAGTTTTGATGAATGACATGTGAGACTAAATTTATGGACAACCATTG
ATTTTGGTTTTGCTGAAGTTGAGACTTCTTACGGTAAAGATAAACACGAAATAATGATAAACTCTAATCAAAAGATATTA
CAAACAAATATTATGATATCAAAACCTTCTGTCGAACCAAGGCACTTGTGTGAGATAATAAATGAAGAATGAATTCGAAA
AAGAAGTCATAATTCGAACATCGCTCCAGAATGCTGTCACTGACTTTGACTTCAATCACATTTTCCAATATTGAAATCAG
ACCGGCGATCACATGGACCCTTGATGATTCAGACTGACCACTGATTACGGGTTGATCGGTTAAATTATCTAGAGATTAAA
ATAATAGTCGGTAAAGGAAATTATCCATATAAACGGGAAACAGAAAAGTTTTAACCATGGTTTCAAAAGCTTTTGGGACT
ACCCCCAGCTTTGCAAAACAATTTTTTAACGCTCTTGTTATGACTTGAATCAACATTGTACAATTGTTACAATAGACTTG
ATGATTTACTTATTTACACCCCATCTAAATTGTTTCTTAACCCTTTGCCACCC
>SMED30000837 ID=SMED30000837|Name=Histone H4|organism=Schmidtea mediterranea sexual|type=transcript|length=1387bp
ATTAACACTAAATTTTGTTTATATAATGATTAAATATTTCAATAATCAATTAATTGAAAAATGTCTGGTCGTGGTAAAGG
AGGAAAAGGGTTAGGAAAAGGTGGAGCCAAGCGTCATCGTAAGGTTTTACGTGATAACATTCAAGGAATAACTAAGCCGG
CAATTAGAAGATTAGCTCGTAGAGGCGGAGTAAAAAGAATATCTGGTTTAATTTACGAAGAAACTCGTGGTGTTCTCAAA
GTTTTCCTGGAAAATGTTATAAGAGACGCTGTTACTTATACTGAACATGCTAAGCGTAAGACAGTAACTGCAATGGATGT
TGTTTACGCTCTTAAACGCCAAGGAAGAACTTTATACGGATTCGGAGGTTAAATGTGAAACCAATGATATTTTAAGCTAA
CATTTATTTGTTGAGAATGTTTATGGTCCTCCTTAGGGCCACAATTTTTGATTGTTTACTTTATTTTGTTAGCATTACGT
AATTTTACAGTGATTGGTTATCTTGCTGGTTGTCTGAAATATTAAATAATAATATGCTATAATTAAATGATATTAGTATA
GAAAACAAAAATCGGTTTTATTGTTTGATCAACACAATGAATATGTTTATCAATTATCATCATTTCCAGTTTTTCGATTT
CAGTTGATAATAATTATTTGCGAATTTGTGATTATATTTTCTAATGGGTTGCGAGACATAAATGAGCGTGCAGATATCAC
ATGCGAACCTGGTTCATGTAGTGTTTTGAGCTACACACTGCAGATAGACGATCAAATCTATAAAGTGAAAAAAGGGTTCA
AATCAGCTTGCAGCACCAGACTATGTGAAAATTGTGCTCACAAAGGTGATTGGTCAATGAGACTGATTGACGGAAACAAA
TATATGGTACGACAAGTCAATAAATGTTTAACTAATAATATTTTGGCAGTTGAGCAACTTTTCACAAATTTATATACTCC
TGTCTCAGATTTTACATGCTCCTTGCATAAGTGCTCTAAATATAATTATTCTTATAATGGAAATATGATTAGCTTTAGCT
ATATAGGAGTTTGTGACCATTCTTACTGTGACTCATGCCGCTATTCCGACAATTGGAGTCTATTAACCGGATATTTGCAG
CGGACGACCATTTCATGTTATGTTGTCGATAAAATTAGACTTGAAGATTATTTTCTCATTCCAGAGTTTACCGAAACCTT
CTATACACTAATTCGGAAATTAGCAATAACTATAAGCTGCGCTTCATTTTTGTGTTTGGTGATCATTCTTTTGGTTTGTT
TTGCTAAAAAATGAGATCTTACAGAAGCTTTAAGGAACTTAATTTTATTTAACAATATATTTATACTTAGATCTAATGCT
TTGAATGATCCTTTCGCAAGTCCATCC
>SMED30033466 ID=SMED30033466|Name=Histone H4|organism=Schmidtea mediterranea sexual|type=transcript|length=421bp
GATCTCACTATATAAATAAGTATTTGTCCCTATTAATTCATAACAATTATTCAACATGTCTGGTCGAGGTAAAGGAGGAA
AAGGACTAGGAAAAGGTGGAGCAAAGCGTCACAGAAAAGTCCTTCGTGATAACATTCAAGGTATCACAAAGCCAGCAATC
AGAAGATTAGCTCGTCGAGGTGGTGTTAAGAGAATTTCTGGATTGATATATGAAGAAACCCGAGGTGTTCTTAAAGTATT
CTTGGAAAATGTTATTAGAGACGCTGTGACATACACTGAGCACGCTAAGCGCAAGACAGTAACTGCCATGGATGTCGTCT
ATGCTTTGAAACGACAAGGAAGAACTTTGTACGGTTTTGGAGGTTAAATAACACTTTCATATTTGTGAATGTTTTAGCGG
CCCTCTTTAGGGCCACAAATG
>SMED30014692 ID=SMED30014692|Name=Histone H4|organism=Schmidtea mediterranea sexual|type=transcript|length=464bp
AAATCTATATAAATCTTATATGAGATAAATGTCAGGTCGAGGAAAAGGTGGAAAAGGTCTTGGTAAAGGAGGTGCTAAGA
GGCACAGAAAAGTATTGCGTGATAATATTCAAGGAATCACTAAACCTGCAATTAGACGTTTAGCAAGAAGAGGTGGCGTT
AAACGAATATCTGGGCTGATTTATGAAGAAACACGAGGTGTGCTGAAGGTTTTTCTGGAAAATATCATCCGCGATGCTGT
CACATATACGGAACACGCGAAGCGAAAAACCGTGACTGCAATGGATGTTGTTTATGCTTTGAAACGTCAAGGTCGAACTC
TTTATGGGTTCGGTGGATAATCATTTTGTATTTTATTATTTAATGTTGTAATTGCTATAATTGTTGCTAGTATTAATCTT
ATTTTAATAAATTATTTAACTGGATTTTAATTTAAATATGTCGGTTTTGTAAATCCAATTTGTA
>SMED30001362 ID=SMED30001362|Name=SMEDWI-3|organism=Schmidtea mediterranea sexual|type=transcript|length=3093bp
AATTAAGAGACAGCCATTTATGTTTATTTTTAAAATAAATAGTATATATTTAAGTTTCGAATTTTCAGCTACAATTTAAT
AGTACATAATTATACGATGTCAGGAAGTAGTGGAATAGGTAGAGGCCGCAGTCGTGGGCTGTTGATGCAAAAGTTTCTGA
ATAAAGATGTTCTTGTTCCTTCTGTTGAATCTTTAGAAGACAAAGCTCTTAATAAGCTAGGAATTCCACTTCCTGGGTCT
ACCGTAGAAAAAAATACAGAGTCAAGTTCTATATCAAGTGGAGATTCAAGAAGTAATCCCAGTGGAGATTCAAGAAATAA
CATAAAACTACAAGATAGTGATATTGAGAATCGCAATATTACCATTGTTACGCGACCATTATCCTGCATAGGCAGGGGTC
GGGGTTTAAGCAATCCCTCAAGTTTAACTACGTCATCGGGTAAATCGGATAAAATTACTGAAAACGAAGAACCTGGTCAA
ATTAAAAAGTTTGTAGGTCGCGGTAGAGGATTGTTGAATTCTCAGAAAGAATGTTCAAACTCTACTCCATCTGAAGTTTC
AAATGAATTGAAACAAATGAAAATTTCAAATGATGATAAAATGACGGTTTCTTCAGAAGCAAAGTCACAATTTGAGAACA
TTGAAAAACCTATTAGTAAATTTCGTCGACGCGAATATCCAACTCAAATAAAAGAACCATGTAATACAAGAAATGATTCA
TCGCCATCTTTAACTTTAAGTGCTAATTACGTTAAAGTTAGGACTACACAACCCCATATATATCAATACCATGTTTCCTT
TGCACCTCCGATAGATTCAAGGTTGATGAGAATTAAAATAGTTCAAGGGTTATCAGAATCAGATTTAGGGGTTGTCAAAG
AAGCAAGAGCTTTTGACGGTATGAATTTATACATTCCTCAACTTTTAAAAAATAAAGAGACAATAATTAAAGTAAACAAA
CCGACTGATAAGACTGTCGTGGATGTTAAAGTAGTTTTTACTAACAATGTTAATTTTAGTGAATGTCCTATGGTTTATAA
TGTTCTTTTTAAAAGAATTGAAAATTCCCTCAGAATGGTTAAAATTGGTAGGGATTATTTCTACCCTGAAAAAAAGATAG
TACTTGACCGTAGAAGGATGGAAATATGGCCGGGATATGTAACAAGTATCCAAAATTTTGACGGTGGTTTACTGTTACAA
TGCGATGTGTCACACAAAGTTATTCGAAATGATAGTGTGTATGACATAATGATGGAAATTAATAAAACTGTTAACAATAA
AGGTCAAATGCAAACTGCTGCGATTAATCAACTATTGGGTCAAATTGTGTTAACTCCTCACAATAACCGAAATTATAGAA
TTACTGATATAGATTGGGCTAAAAATTGTTTAAGTGAATTCGATAAAGGAGGCGAAAAAATTAGCTACCGGGATTATTTT
AAGAACACGTATGGGCTACAAATTCGTGATCTAGAGCAGCCTATGATAGTTAGTAAATCTAATAGCAGATCTGGTAAAAA
CCGAGGTCCCAAAGGATCAAAAGAAGTGGATGGTGGATTGGTCTATTTAATTCCAGAATTGTGTATGCTAACTGGTTTGA
CAGATGACATGATTAAAGATTTTCGTTTGATGAGAGAATTACACGAGCATTGTCGAGTTACTCCCAAGAAAAGACACGAA
GCCTTACTGGAATTCGTGGATAACATATATAGCTGTGAGGAAGCTAAGAAACTTTTAGGGTATTGGGGTATAACGATTGA
AAAGGACACTGTCAACATAAATGCTTGTAAAATGAATCCAGAAATGATATATTTTGGAAATGAAGCTTCTGTTAGTGCTG
GGGAACAAGCTGAATTTAAACAAGCCTTGGCACATAATAAAGTTATAGGTGGTATTCGTATTGAAAATTGGATATTAATT
TCTCCAAAAAGTTTACTGACAAAAGCAAATGGTCTGTTACAGGCTTTAATGAGCAAATCTCCTAGAGTTGGAGTTATGTT
TGGAAAACCCAAAATAGTTGAAATGAACAATGATCGAACAGAAGAGTATTTAAAAGAATTAAAGAGAAATGTGGCTCCTG
GTGTGCAGTTAGTAGTTACAATTTTATCTGCTGTTAGAGAAGATCGATACAATGCAATAAAAAAATTTTGTTATGTGGAT
TGTCCTGTTCCAAGTCAAGTGGTATTAGCCCAAACATTGAAAGAAGGGCCTAAATTAAATAGTGTGGCAGTTAATATAGC
CCTTCAAATAAACGCAAAATTAGGTGGAGAGCTGTGGGCTGTCAAAATACCTATTAAGAAGTTTATGGTTGTTGGACTTG
ATGTTTGGCATGATACTAAAGGGAGAAGTAGATCAGTTGGAGCCGTAGTTGGTTCAACTAATGCGCTATGCACAAGGTGG
TTTTCGAAATCGCATTTGCAAGAACAAGATAAAGAAATTATGTACGTATTACAGTCGTGTATGTTAAGCCTTTTAAAGGC
TTATTTTGAAGAAAATAATTTTTTGCCTGAGACTATCTTTATGTATAGGGATGGTGTTAGTGATGGTCAGTTAGGATATG
TTCAAAAAACTGAAATTGAACAATTCTTTAAAGTTTTTGAATCGTTTAGTGCTGATTATAAACCTAATATGGTATATAAT
GTTGTTCAAAAGAGAATAAATACTAGGCTCTATGTAAGTGATCCGAAAAATAAAGGACAAATAAATAACCCCAATCCTGG
TACAATTGTCGACCATACTGTTACGAGGGCTAACCTTTATGATTTTTTTCTTGTTTCTCAATCGGTTAGGCAGGGAACTG
TAACTCCGACGCATTACGTTGTTTTATGTGACAATTCTAAATACACTCCGCATCAGGTTCAGTTGATGGCTTATAAAACA
TGTCATATATATTACAATTGGCCGGGAACGGTTCGAGTACCAGCACCTTGTATGTATGCTCATAAATTGGCATATATGGT
TGGTCAGAATTTGAAAGCTGAACCTAGTAATCTTTTATGTGACAGACTTTTTTATTTGTAACATATGTGTTTCTATTTGT
ATTATTGTTAAACTGCATTTCGTAAAATAAATTAATTTCGTTATAAAAAAAAA
>SMED30001900 ID=SMED30001900|Name=Bruno-like protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1713bp
CTTTTGAGGGAAAAATAATTCTTTTATTAATAATGTTTCATCATTGGAATATAAAATAAAATATTAGGAGAAAACATAAG
TTAACCAACAATATTAGCCACATATTTCGTTTAATTATTGGTCTATCACTTTTCATTTTAACCAATTGTCTTGAGATAAT
GGAGAGTTTATCCTTAATTTTTATTATAAATCACTGGTTTTGATAGACTTATTAACAATGGAAAATTATTTCAAACTTTT
CGTTGGTCAGATACCTCGAAATACACCAGATAAAGAAATTAGACTTATTTTTGAAGCTTTTGGACCAATCTTTGAATTTT
TAATTTTAAGGGACAAGAAAACTGGTTTTCATAAAGGATGTGCTTTTGTTACATTTTATCATAAAGACTCTGCAGAAAAT
TGTCAAAAGGCGTTACATGACAAGAAAATCCTAAACGGGATGAATCGACCACTTCAAGTGAAACCAGCTAAAAATAAGTT
AGCAAAAAATTCAAGTTTGAATGGGGAAAATCAGACAGAAGAGCAGGTTTTCAGTGATGAAAGGAAATTGTTTGTTGGAA
TGTTGAGTAAAAATCAAACTGATGAAAATGTACAAAATATGTTCACAAAATTTGGCAAAATCGAAGAGTGCACTGTATTG
AAAGACCAAAATGGAAATAGTAAAGGATGTGCCTTTGTCAAATTCGTGAACCACACCGATGCTTGTGCAGCAATAAACGC
TCTTCATGCCAGTCAAAAAATGGAGGGTGCTTCATCCAGCCTTGTGGTTAAATTTGCTGACACGGATAAACAAAAACAAA
TAAGAAAATTGCAGCAATATATTCCAGATTTAAGCATTTTAAATTCGCGCATTCCTATTAATATTCCATACTATTCACAA
TACGGTACAATAATTAATCCAGAATATAATTCAACAATTCCTTCAAACCAATATATTCGAAATTGTAACGAATATATTCT
TGCTGCTCAAATTCAACAAATAAATTTGTTTTCTAATTTATCATCGGTCTACCCATCTAATTCAATAGTGTCAATGCCAT
CCAGCCATCCGGTACCAATGATTGACTATTCTGTTCCTATTAACAACTTTCCACAAACTGACCAAATAACAATGAAACCA
ATTGTTGATATACAGCCAATACCTCCAGAAGCTGTACACCGAACCATCGTAACTCCAGGATCACTCTTATCATATCCTTT
TCTTAATGTTCAAATTCCTACAGTATATCCAAACGCCTTTTCCAATGGAAATTTAACAAGTACAACACAAAGTTCAACAG
ATGTGAAAACCACTCCTTTGCCAACAGGTCCTGAAGGCTGCAATCTATTTATTTATCATCTGCCACAAGAAATTGGTGAT
TTACAATTATATCAAATTTTTATGCATTTTGGAAACGTTATCAGTTCTAAAGTTTATGTTGACAGAGCAACAAATCAAAG
CAAATGTTTTGGATTTGTCAGCTACGATGATCCGGCATGTGCCAATGCCGCCATCAAATCTATGAATGGATATCATATCG
GAACAAAAAGATTAAAAGTTCAGTTAAAAAAACCAAAAGAAGCAATAAACGAAATGAAAAACTTCAATCAAATGTTATCA
TCAACTCCCGACATAAACCAAGTATTTTGTTCATCCTAATGATTGTGATATTTTACAGGATTTTCTCGACCATATTGAAA
GCCTGATTGGTGATATGTAAAATGACCCACCGT
>SMED30035063 ID=SMED30035063|Name=SOXP-2|organism=Schmidtea mediterranea sexual|type=transcript|length=2664bp
TGTACATTGAATTCAATATTTAATAGTGATTAACTTATCCAAATTTTCAGCCACTTTTAGTTTAATTTGCGTGTTTTGTT
GAGCAGTTTTTATTGGCGCATTTTATAAAAAATACAAAACCAATCCAAATCAGTTTGAATCATTGTCAGATTTTAGTCGT
GCAAGATACATTATTTCATTTTAATTCTCTAGCATATGACATTTAAACATGGAGCTGAATTACTCGTTGAATGATAATAA
TTTCAATTTACAATTAGAAAGCGAGTCCTTGACTTATTTCGATTTATGCCAAAAATGTTCAGCGTACCAAAATAGTCTTA
GAGACTGGATGAAACATTTAGTTGACAGACATCCTTTACCTATTCAGTGGATGAGTGATTTGGCAAATAATTTAACAGAT
GATAAATTATCTAAGCCATATTCGACCGTTACAGAATCCCGTAAAAAACGCAAGAAGCATATCACTCCAAGGCCATTGAA
TAGTTTCATGATATTTTCCAGACATTTAAGAAGAAATGTTCTTATTTTCTTTAGTGATGCTTCAAATTCAGAAATAAGCA
AACTTCTTGGGAAGTTATGGAATAACATTCCAGCTACCATTAAATCGATGTATGATAATGAAGCTAAAAAGCTTGCAATT
TTACACTCCAAAGAATTTCCTGAATATAAATATCAACCTAAAAAGAAAAAAAAACAATATCTAACGAAATGCCCCATTAA
TTCCACACCTTTGTCGAGTAATTCATATGAAAGTATTCAAGATATTAATTCAGTAACGGATACACTACAGAATTCATCTA
ACAACTTACAAAAGGAAAGTAATCCGACCTCTGTTTCGTCTTATGGAAGCAATCAGGAATGTAATAATTCATTTAAGAAT
CATAGTGTACAGTCCAGCAATTTTCCCAAAGAAATCAACCATAAACCAAGTAGAAAAATTGAAAAGCAATCGTGCAAAAT
AAGTTCCAATCAAATAATGGATGATTCAGAAGGGGCTGAATCCAGTCCATCATCATTTAAAAACACCATTAAAAATGAAA
TTTATTCCTCTTATAGTCCATTTCTAAATGAATCCCATAGCATTCTTTCAGATTTAAGTTACTCTTCGTCTCTCAATAAC
GTTTCAAAACACACTAGCGATTCCATTATAACGAATTCTCCTATCAGAGAAGAAATTGTCTTAGAAAATAATCAGCCCTC
TCAACAGAATAATATAAACAATTACCGACACGTATTTCAGAGAACTTCGACTCTATCCAACAGTTTGTTGACCCCTTTAA
CCATTGTCACAGAAAAAGTTGACGAACAGAAAGATCTTCCACCATCAAGAATCAATATCCGATATGTGAAAATTAACAAA
CTACCGATTCAAACAAAATCCGATTTCCCATTGACTGGATATTTTCAAAATTTCAATAACGACTCAAATCTTCATTTTCA
GAGTTCCATTCACGCCCTGAATACGACATTGACTCCAGATCTGTCGGTAAAACGCGAAGCCACTGTCAACAACAGCATGA
CAGATTATATCAATCGAAAACGTACAAATGTCGATCCACTTATCATCGATGATATATTTGAAAACGAACAATTTGAAGAT
GAGGAAGTGTTGAATTTTGACAATCCTGATAACAATAACAGTTCTCCTTGGTCGTTTAAATCGCCTAACTTTAAAATATC
TACCGGTTCCTCGACACTGTCAGACAATCCGTACAAAGAACAGTTTTGTTCTTCCCCGTTCCATCTATCAGAAACTGATA
CTCAACCGATTCCAGTTCAACGATTGCCAGCAATCGGCTCATGGTTAAAGTCAAACTATTCTGAATTCATGATCTGATCC
AATCTATTATTCTATTCAATTGTCTGTTTTCATACAATTAGGATTACTTGTTATGAATTCTAGCTGATTTTGAGTGTGTT
TATAAAGCTTTTGTAACGCCTTTTCTATACAGATGTTCGATATATATATATAAATAAATAAATATAAATATATAACAATT
TTATTGACATTGTACAGTATTCCATAAGCCCGATCTTGTAACGCATTTATTACTATACTCAATAGACCAATCTATATGTT
CTCATAATTTCTATGTTGTTATTGTACACGGGAATTATTACTATAAATGATGCGAATTTATCACTTTGTAATTGAGGGAA
ATTATCGATCAATTTGCGCTTTCAGACATTTTTCATGTATAAACTTGTTTTTCTCTTTTTTATCATCAAAAATTTAATTT
TTTTGATATCGCTATTCATCATATTATTATTCTCCGTTGCATTTGTTAGATTATGTAAATTTTTATATGAAAATGTTGTT
ATTTATTGTATTTTTATACGATTTTTTGCTTTGGATACACTTTTATCAAATCATATTGCCAGTGTGAGCATTTATTGGAC
TTGTTGTTATTGCTGCTGCTCGAATAATTGCTTCATACGGGGAGTCTCGATATTTTCATGAAGCGATTTTCATGGTTGCC
GCTCTCCGCCGCCGCCATTCGGTGTAAATATCAATTGCATTGCCAGCACGTTTTCTCAAACTCAATTTTTGTACTCAATT
TCAATTGATTTATGTTCATTTTATTTTTCATAGAAATGAGTAAATAAATTTTCATAAATAGTTTTGTTTTCAATATTTTT
AGGAAATTTGAATGTGTCTCTAGA

 

back to top



PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in neoblast. Click this link to learn more about PAGE.


PAGE Curations: 6131


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
neoblastSMED30008506ribosomal protein S17 dd_Smed_v4_407_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001515annexin A11 dd_Smed_v4_1104_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004176thrombospondin type 3 repeat-containing protein dd_Smed_v4_1693_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004176thrombospondin type 3 repeat-containing protein dd_Smed_v4_2265_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005936Titin dd_Smed_v4_2438_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005936Titin dd_Smed_v4_13910_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022232glutathione S-transferase alpha 5 dd_Smed_v4_1206_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010216keratinocyte associated protein 2 dd_Smed_v4_1305_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035063Transcription factor Sox-7 dd_Smed_v4_8483_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000863328S ribosomal protein S15 mitochondrial dd_Smed_v4_2671_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006060Lysine-specific demethylase 5D dd_Smed_v4_15120_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006060Lysine-specific demethylase 5D dd_Smed_v4_3334_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009007Titin dd_Smed_v4_2438_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009007Titin dd_Smed_v4_13910_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010101STT3 oligosaccharyltransferase complex catalytic subunit A dd_Smed_v4_1174_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008204thrombospondin type 3 repeat-containing protein dd_Smed_v4_1693_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008204thrombospondin type 3 repeat-containing protein dd_Smed_v4_2265_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000938Homeobox protein six1b dd_Smed_v4_15471_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007788transcription elongation regulator 1 dd_Smed_v4_1147_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003453glutamate ionotropic receptor kainate type subunit 3 dd_Smed_v4_4267_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023062CUGBP Elav-like family member dd_Smed_v4_2592_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007616vacuolar protein sorting 13 homolog D dd_Smed_v4_2359_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007616vacuolar protein sorting 13 homolog D dd_Smed_v4_1081_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007616vacuolar protein sorting 13 homolog D dd_Smed_v4_890_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007616vacuolar protein sorting 13 homolog D dd_Smed_v4_6654_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027428Silk gland factor 1 dd_Smed_v4_10718_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009119ankyrin 3 dd_Smed_v4_1432_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004080Ribosomal protein S6 kinase alpha-5 dd_Smed_v4_16306_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000284electron transfer flavoprotein subunit beta dd_Smed_v4_2469_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000284electron transfer flavoprotein subunit beta dd_Smed_v4_1315_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000756erb-b2 receptor tyrosine kinase 4 dd_Smed_v4_11310_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008241Titin dd_Smed_v4_2438_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008241Titin dd_Smed_v4_13910_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018534Muscleblind-like protein dd_Smed_v4_2838_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008903Dystroglycan 1 dd_Smed_v4_11814_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001491pseudouridine synthase 3 dd_Smed_v4_16208_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026364Cellular tumor antigen p53 dd_Smed_v4_5563_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003249prohibitin dd_Smed_v4_1038_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011862Transcription factor SOX-6 dd_Smed_v4_7227_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015565N-alpha-acetyltransferase 15, NatA auxiliary subunit dd_Smed_v4_1343_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001679ATPase plasma membrane Ca2 transporting 3 dd_Smed_v4_1721_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007616mitochondrial ribosomal protein L58 dd_Smed_v4_2359_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007616mitochondrial ribosomal protein L58 dd_Smed_v4_1081_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007616mitochondrial ribosomal protein L58 dd_Smed_v4_890_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007616mitochondrial ribosomal protein L58 dd_Smed_v4_6654_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006583frizzled class receptor dd_Smed_v4_11650_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016491dystonin dd_Smed_v4_1205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016491dystonin dd_Smed_v4_655_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004380Ubiquitin carboxyl-terminal hydrolase CYLD dd_Smed_v4_10719_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010124protein arginine methyltransferase 8 dd_Smed_v4_1755_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010857hypothetical protein dd_Smed_v4_10618_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010857hypothetical protein dd_Smed_v4_10036_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010857hypothetical protein dd_Smed_v4_8531_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010857hypothetical protein dd_Smed_v4_6173_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001796Protein kinase domain-containing protein dd_Smed_v4_3286_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002369ribosomal protein S17 dd_Smed_v4_195_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002369ribosomal protein S17 dd_Smed_v4_407_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003462phosphorylase kinase regulatory subunit beta dd_Smed_v4_3657_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005993Ubiquitin carboxyl-terminal hydrolase CYLD dd_Smed_v4_10719_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019774Silk gland factor 1 dd_Smed_v4_10718_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010096proprotein convertase subtilisin/kexin type 2 dd_Smed_v4_1566_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000013transforming growth factor beta induced dd_Smed_v4_1088_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023874ABHD14A-ACY1 readthrough dd_Smed_v4_1519_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025757Transcription factor jun-1 dd_Smed_v4_4878_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001142Dystroglycan 1 dd_Smed_v4_11814_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009858splicing factor 3b subunit 4 dd_Smed_v4_2139_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022404tyrosyl-DNA phosphodiesterase 2 dd_Smed_v4_12962_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032613homeobox protein dd_Smed_v4_2442_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006209RRM domain-containing protein dd_Smed_v4_2924_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005748Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_1694_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001642La ribonucleoprotein 1B dd_Smed_v4_1885_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032592Transcription factor ovo-like homolog lin-48 dd_Smed_v4_10673_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023085ribosomal protein S6 kinase B2 dd_Smed_v4_11674_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED300118365-hydroxytryptamine (serotonin) receptor 1B dd_Smed_v4_21082_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014496NSA2 ribosome biogenesis factor dd_Smed_v4_1012_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020717electron transfer flavoprotein subunit beta dd_Smed_v4_2469_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020717electron transfer flavoprotein subunit beta dd_Smed_v4_1315_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010270alkylglycerone phosphate synthase dd_Smed_v4_2115_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013371ribosomal protein S26 dd_Smed_v4_222_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019756LDL receptor related protein 6 dd_Smed_v4_10112_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024625h1SMcT0006419.1 dd_Smed_v4_2100_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024108Zinc finger protein ztf-2 dd_Smed_v4_11240_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035949ubiquitin domain containing 1 dd_Smed_v4_2728_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028309Suppressor of cytokine signaling 7 dd_Smed_v4_12768_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017937WASP like actin nucleation promoting factor dd_Smed_v4_1987_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029313cabeza dd_Smed_v4_1370_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028738Band 4.1-like protein 3 dd_Smed_v4_1613_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009564dihydropyrimidinase dd_Smed_v4_1478_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014451Hepatocyte growth factor receptor dd_Smed_v4_12706_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027865asparagine synthetase domain containing 1 dd_Smed_v4_11324_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035929SWI/SNF related, matrix associated, actin dependent regulator of chromatin subfamily c member 2 dd_Smed_v4_1804_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032680ribosomal protein L3 dd_Smed_v4_13357_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032680ribosomal protein L3 dd_Smed_v4_12559_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015825rso RS00816 hypothetical protein dd_Smed_v4_2174_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007718flotillin dd_Smed_v4_1887_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031017hypothetical protein dd_Smed_v4_10618_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031017hypothetical protein dd_Smed_v4_10036_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031017hypothetical protein dd_Smed_v4_8531_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031017hypothetical protein dd_Smed_v4_6173_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016802vacuolar protein sorting 13 homolog D dd_Smed_v4_2359_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008015solute carrier family 25 member 19 dd_Smed_v4_7507_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004197acyl-CoA dehydrogenase family member 9 dd_Smed_v4_11107_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017896activator of HSP90 ATPase activity 1 dd_Smed_v4_2497_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004576ribophorin II dd_Smed_v4_538_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005365Serine/threonine-protein kinase ppk6 dd_Smed_v4_15228_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016458neurogenic locus notch homolog protein dd_Smed_v4_1967_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033252Cell adhesion molecule-related/down-regulated by oncogenes dd_Smed_v4_1968_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002662superoxide dismutase 2 dd_Smed_v4_1259_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024764ATP synthase F1 subunit delta dd_Smed_v4_1238_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006574tetraspanin 13 dd_Smed_v4_10784_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005255Homeobox protein cut-like 1 (Fragment) dd_Smed_v4_13843_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001490twinstar; transcript_id=FBtr0072188 dd_Smed_v4_260_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006944solute carrier family 35 member E1 dd_Smed_v4_5304_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004485collagen type V alpha 1 chain dd_Smed_v4_1070_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002962GC-rich sequence DNA-binding factor 2 dd_Smed_v4_11179_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002903Cyclic AMP-responsive element-binding protein 3-like protein 1 dd_Smed_v4_4539_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002154Cytosolic endo-beta-N-acetylglucosaminidase dd_Smed_v4_12165_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002611diacylglycerol kinase zeta dd_Smed_v4_1760_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033600minichromosome maintenance complex component 6 dd_Smed_v4_2682_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014989mitogen-activated protein kinase kinase kinase dd_Smed_v4_2589_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022596Uncharacterized protein dd_Smed_v4_245_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033211mitochondrial ribosomal protein S9 dd_Smed_v4_2348_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007126Mitogen-activated protein kinase-binding protein 1 dd_Smed_v4_7818_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006232Uncharacterized protein dd_Smed_v4_5321_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007676RING-type E3 ubiquitin transferase cysteine targeting dd_Smed_v4_11478_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005547acyl-CoA dehydrogenase family member 9 dd_Smed_v4_11107_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033794channel dd_Smed_v4_15923_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034254calreticulin dd_Smed_v4_220_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002690HEAT repeat containing 5B dd_Smed_v4_7872_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008868protein 38 dd_Smed_v4_7155_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001701ribosomal protein L7a dd_Smed_v4_296_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006542proteasome 20S subunit beta 2 dd_Smed_v4_2477_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009652HEAT repeat containing 5B dd_Smed_v4_7872_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000573pentatricopeptide repeat domain 3 dd_Smed_v4_1722_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000245zinc finger protein 470 dd_Smed_v4_2635_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001853Serine/threonine-protein kinase TIO dd_Smed_v4_1897_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033666ubiquitination factor E4A dd_Smed_v4_4558_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010208h1SMcT0020177.1 dd_Smed_v4_1954_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000763Expressed conserved protein dd_Smed_v4_1671_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010973zinc finger DHHC-type palmitoyltransferase 6 dd_Smed_v4_3462_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001499late endosomal/lysosomal adaptor, MAPK and MTOR activator 2 dd_Smed_v4_2137_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004908cell adhesion molecule L1 like dd_Smed_v4_1916_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030576ankyrin repeat and FYVE domain containing 1 dd_Smed_v4_13446_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005547Enigma dd_Smed_v4_11107_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004197Enigma dd_Smed_v4_11107_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027710RAB3C, member RAS oncogene family dd_Smed_v4_7977_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012699Polyribonucleotide 5'-hydroxyl-kinase Clp1 dd_Smed_v4_11378_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031142Serine/threonine-protein kinase shk2 dd_Smed_v4_12680_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034781thioredoxin domain containing 9 dd_Smed_v4_368_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019518Serine/threonine-protein kinase shk2 dd_Smed_v4_12680_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001291BUD31 homolog dd_Smed_v4_1359_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031874Serine protease HTRA2, mitochondrial dd_Smed_v4_12272_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005194notchless homolog 1 dd_Smed_v4_10113_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006182peptidylprolyl cis/trans isomerase, NIMA-interacting 1 dd_Smed_v4_4606_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002829tubulin folding cofactor D dd_Smed_v4_10610_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012688testis-specific serine/threonine-protein kinase dd_Smed_v4_13774_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031929Uncharacterized protein dd_Smed_v4_5281_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019864Gamma-aminobutyric acid receptor subunit gamma-3 dd_Smed_v4_10171_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020883Adhesive plaque matrix protein dd_Smed_v4_5453_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020883Adhesive plaque matrix protein dd_Smed_v4_1649_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017145ubiquitin carboxyl-terminal hydrolase dd_Smed_v4_4235_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012447filamin A dd_Smed_v4_2272_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026090FtsJ RNA 2'-O-methyltransferase 3 dd_Smed_v4_3186_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014822moesin dd_Smed_v4_611_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016975H2A clustered histone 21 dd_Smed_v4_15019_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029542heat shock protein family A (Hsp70) member 4 dd_Smed_v4_1087_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019657microsomal glutathione S-transferase 3 dd_Smed_v4_2049_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009031Uncharacterized protein dd_Smed_v4_5321_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008699rho guanine nucleotide exchange factor dd_Smed_v4_276_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008699ribosomal protein L7 dd_Smed_v4_276_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009769TAO kinase 2 dd_Smed_v4_4160_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008339peptidase inhibitor 15 dd_Smed_v4_4446_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008339peptidase inhibitor 15 dd_Smed_v4_924_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018991RecQ like helicase dd_Smed_v4_4882_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018991RecQ like helicase dd_Smed_v4_7318_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025910microtubule-associated protein dd_Smed_v4_2033_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017841sorting nexin 1 dd_Smed_v4_835_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022090Heterogeneous nuclear ribonucleoprotein at 87F dd_Smed_v4_1047_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022344radixin dd_Smed_v4_1131_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027578zinc finger protein 470 dd_Smed_v4_2635_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012789TATA element modulatory factor 1 dd_Smed_v4_3908_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006574eukaryotic translation initiation factor 4E family member 2 dd_Smed_v4_10784_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013606rho guanine nucleotide exchange factor dd_Smed_v4_276_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012847RecQ like helicase dd_Smed_v4_4882_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012847RecQ like helicase dd_Smed_v4_7318_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017042ATPase H transporting V1 subunit E1 dd_Smed_v4_1494_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008655tubulin alpha chain dd_Smed_v4_508_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013606ribosomal protein L7 dd_Smed_v4_276_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011329tetraspanin 1 dd_Smed_v4_5409_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022677delta 4-desaturase, sphingolipid 1 dd_Smed_v4_1100_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007839LRRCT domain-containing protein dd_Smed_v4_2180_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016722mitogen-activated protein kinase kinase kinase 5 dd_Smed_v4_4849_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014501Zonadhesin dd_Smed_v4_9030_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007902RecQ like helicase dd_Smed_v4_4882_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007902RecQ like helicase dd_Smed_v4_7318_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014750diacylglycerol kinase zeta dd_Smed_v4_1760_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025370RecQ like helicase dd_Smed_v4_4882_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025370RecQ like helicase dd_Smed_v4_7318_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020996ADP ribosylation factor GTPase activating protein 2 dd_Smed_v4_539_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013043Protein lozenge dd_Smed_v4_3565_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007406Protein piwi DQ186985.1smed_ncbi_20240424PMID:24704339
Vogg et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30007406Protein piwi DQ186985.1smed_ncbi_20240424PMID:23318641
Chen et al., 2013
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30027299PBX homeobox 3 KC353351.1smed_ncbi_20240424PMID:23318641
Chen et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30035373histone deacetylase 2 HDAC1smed_ncbi_20240424PMID:23629965
Zeng et al., 2013
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30032645chromobox 1 JN216838smed_ncbi_20240424PMID:23629965
Zeng et al., 2013
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30032563minichromosome maintenance complex component 5 JX070081smed_ncbi_20240424PMID:23629965
Zeng et al., 2013
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30007406Protein piwi DQ186985smed_ncbi_20240424PMID:23629965
Zeng et al., 2013
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30012293FACT complex subunit JX070080smed_ncbi_20240424PMID:23629965
Zeng et al., 2013
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30032631Forkhead box protein P4 KX531078.1smed_ncbi_20240424PMID:27551436
Wang et al., 2016
FACS sorted cell population asexual adult fluorescence in situ hybridization evidence
neoblastSMED30016141platelet activating factor acetylhydrolase 1b regulatory subunit 1 JQ650355.1smed_ncbi_20240424PMID:22411224
Cowles et al., 2012
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30020575nudE neurodevelopment protein 1 like 1 HO006501.1smed_ncbi_20240424PMID:22411224
Cowles et al., 2012
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30020436nudE neurodevelopment protein 1 like 1 HO006501.1smed_ncbi_20240424PMID:22411224
Cowles et al., 2012
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30020168mitogen-activated protein kinase 10 JNKsmed_ncbi_20240424PMID:24922054
Almuedo-Castillo et al., 2014
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30001386mitogen-activated protein kinase 10 JNKsmed_ncbi_20240424PMID:24922054
Almuedo-Castillo et al., 2014
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30034763mitogen-activated protein kinase 10 JNKsmed_ncbi_20240424PMID:24922054
Almuedo-Castillo et al., 2014
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30004277Innexin 7; transcript_id=FBtr0071035 AY067503smed_ncbi_20240424PMID:17670787
Oviedo et al., 2007
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30012037Innexin 7; transcript_id=FBtr0071035 AY067503smed_ncbi_20240424PMID:17670787
Oviedo et al., 2007
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30012037Innexin AY067503smed_ncbi_20240424PMID:17670787
Oviedo et al., 2007
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30016751Innexin 5 DQ851133smed_ncbi_20240424PMID:17670787
Oviedo et al., 2007
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30018622Innexin 5 DQ851133smed_ncbi_20240424PMID:17670787
Oviedo et al., 2007
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30013674motor neuron and pancreas homeobox 1 SmedASXL_008593SmedAsxl_ww_GCZZ01PMID:27034770
Currie et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30013674motor neuron and pancreas homeobox 1 SmedASXL_008593SmedAsxl_ww_GCZZ01PMID:27034770
Currie et al., 2016
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30029233Homeobox protein LOX2 (Fragment) SmedASXL_005553SmedAsxl_ww_GCZZ01PMID:27034770
Currie et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30029233Homeobox protein LOX2 (Fragment) SmedASXL_005553SmedAsxl_ww_GCZZ01PMID:27034770
Currie et al., 2016
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30011862Transcription factor SOX-6 SMED30019097smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028938protein disulfide isomerase family A member 6 SMED30017430smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005950transcriptional adapter 3 SMED30035424smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005950nemo like kinase SMED30035424smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027929tubulin beta 4B class IVb SMED30016265smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016265tubulin beta 4B class IVb SMED30027929smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000949 SMED30002872smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002872 SMED30000949smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007599 SMED30032778smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017445 SMED30033583smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014131Rapamycin-insensitive companion of mTOR JN815259.1smed_ncbi_20240424PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30007744 JQ278719.1smed_ncbi_20240424PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30007744 JQ278719smed_ncbi_20240424PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30025757Transcription factor jun-1 AFD29623smed_ncbi_20240424PMID:26062938
Tejada-Romero et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30033302RNA-binding protein MEX3B SmedASXL_011384SmedAsxl_ww_GCZZ01PMID:26114597
Zhu et al., 2015
FACS sorted cell population asexual adult colorimetric in situ hybridization evidence
neoblastSMED30031380Suppressor of hairy wing MF411143smed_ncbi_20240424PMID:29557542
Han et al., 2019
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30031380Suppressor of hairy wing MF411143smed_ncbi_20240424PMID:29557542
Han et al., 2019
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30031380Suppressor of hairy wing MF411143smed_ncbi_20240424PMID:29557542
Han et al., 2019
FACS sorted cell population asexual adult fluorescence in situ hybridization evidence
neoblastSMED30023910Suppressor of hairy wing MF411143smed_ncbi_20240424PMID:29557542
Han et al., 2019
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30023910Suppressor of hairy wing MF411143smed_ncbi_20240424PMID:29557542
Han et al., 2019
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30023910Suppressor of hairy wing MF411143smed_ncbi_20240424PMID:29557542
Han et al., 2019
FACS sorted cell population asexual adult fluorescence in situ hybridization evidence
neoblastSMED30022937RTF1 homolog, Paf1/RNA polymerase II complex component GU562964smed_ncbi_20240424PMID:20215344
Fernandéz-Taboada et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30003970Paired box protein Pax-5 SMED30006353smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30004169Paired box protein Pax-5 SMED30006353smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30011923Homeobox protein SIX6 SMED30010878smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30001362piwi like RNA-mediated gene silencing 1 dd_Smed_v4_1258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005571aldehyde dehydrogenase 18 family member A1 dd_Smed_v4_1060_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019097Transcription factor SOX-6 dd_Smed_v4_7227_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026014WD repeat and HMG-box DNA binding protein 1 dd_Smed_v4_11006_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027770high mobility group box 2 dd_Smed_v4_1646_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000158dipeptidyl peptidase 3 dd_Smed_v4_1031_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029098coproporphyrinogen oxidase dd_Smed_v4_2002_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016078Actin 5C dd_Smed_v4_246_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016078Actin 5C dd_Smed_v4_285_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007255C2H2-type domain-containing protein dd_Smed_v4_10103_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021960h1SMcT0016311.1 dd_Smed_v4_2224_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004081Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_1144_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010867adducin 1 dd_Smed_v4_2345_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009279dystonin dd_Smed_v4_1205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009279dystonin dd_Smed_v4_655_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009048dystonin dd_Smed_v4_1205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009048dystonin dd_Smed_v4_655_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009887macrophage erythroblast attacher, E3 ubiquitin ligase dd_Smed_v4_1168_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008568dynein cytoplasmic 1 heavy chain 1 dd_Smed_v4_1140_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006369integrin subunit beta 1 dd_Smed_v4_2017_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006193dystonin dd_Smed_v4_1205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006193dystonin dd_Smed_v4_655_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005517protein tyrosine phosphatase receptor type D dd_Smed_v4_10176_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007853CYFIP related Rac1 interactor B dd_Smed_v4_1856_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005988ribosomal protein L24 dd_Smed_v4_172_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006655ribosomal protein L32 dd_Smed_v4_149_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001657polyamine modulated factor 1 binding protein 1 dd_Smed_v4_2381_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004937eukaryotic translation elongation factor 2 dd_Smed_v4_186_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003885drebrin like dd_Smed_v4_1221_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001495ribosomal protein L15 dd_Smed_v4_193_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002742dystonin dd_Smed_v4_1205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002742dystonin dd_Smed_v4_655_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004082nipsnap homolog 2 dd_Smed_v4_2078_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013176Probable serine/threonine-protein kinase pats1 dd_Smed_v4_12105_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010046thrombospondin type 3 repeat-containing protein dd_Smed_v4_1693_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010046thrombospondin type 3 repeat-containing protein dd_Smed_v4_2265_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033100quinoid dihydropteridine reductase dd_Smed_v4_2408_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009634proteasome 20S subunit alpha 5 dd_Smed_v4_1154_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002925Protein jagged-1b dd_Smed_v4_12472_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031080Glycine-rich protein GRP33 dd_Smed_v4_1578_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001441Lysine-specific demethylase 5D dd_Smed_v4_15120_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001441Lysine-specific demethylase 5D dd_Smed_v4_3334_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016338adducin 1 dd_Smed_v4_2345_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED300172003'(2'), 5'-bisphosphate nucleotidase 1 dd_Smed_v4_1334_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004484ribosomal protein L8 dd_Smed_v4_108_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012379ankyrin 3 dd_Smed_v4_1432_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008726proteasome 20S subunit alpha 1 dd_Smed_v4_1278_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001272nuclear receptor coactivator 5 dd_Smed_v4_2395_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008756dynein axonemal heavy chain 6 dd_Smed_v4_14707_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008756dynein axonemal heavy chain 6 dd_Smed_v4_6538_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008506ribosomal protein S17 dd_Smed_v4_195_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016802vacuolar protein sorting 13 homolog D dd_Smed_v4_1081_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016802vacuolar protein sorting 13 homolog D dd_Smed_v4_890_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016802vacuolar protein sorting 13 homolog D dd_Smed_v4_6654_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026022DNL-type zinc finger protein dd_Smed_v4_2816_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023057polypyrimidine tract binding protein 2 dd_Smed_v4_2799_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023008Major egg antigen dd_Smed_v4_2189_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033282visinin-like protein 1 dd_Smed_v4_1970_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018649BRCA1 interacting protein C-terminal helicase 1 dd_Smed_v4_16638_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013495Hepatocyte growth factor receptor dd_Smed_v4_12706_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021808coiled-coil domain containing 150 dd_Smed_v4_14111_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED300279744a-hydroxytetrahydrobiopterin dehydratase dd_Smed_v4_1214_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027855aspartate dehydrogenase domain containing dd_Smed_v4_1769_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016802mitochondrial ribosomal protein L58 dd_Smed_v4_2359_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016802mitochondrial ribosomal protein L58 dd_Smed_v4_1081_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016802mitochondrial ribosomal protein L58 dd_Smed_v4_890_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016802mitochondrial ribosomal protein L58 dd_Smed_v4_6654_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002455ribosomal protein L6 dd_Smed_v4_205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001989NADH dehydrogenase (ubiquinone) SGDH subunit; transcript_id=FBtr0334094 dd_Smed_v4_3120_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011040Receptor-type tyrosine-protein phosphatase eta dd_Smed_v4_2645_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021464glucose-6-phosphate dehydrogenase dd_Smed_v4_2965_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018507ATPase plasma membrane Ca2 transporting 2 dd_Smed_v4_3170_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018507ATPase plasma membrane Ca2 transporting 2 dd_Smed_v4_4559_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013824unc-5 netrin receptor C dd_Smed_v4_10380_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016427non-specific serine/threonine protein kinase dd_Smed_v4_2251_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027991L-2-hydroxyglutarate dehydrogenase dd_Smed_v4_1758_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033785cell cycle and apoptosis regulator 2 dd_Smed_v4_1181_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010424DNA primase subunit 1 dd_Smed_v4_11558_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033117domain-containing protein dd_Smed_v4_16174_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010559asparagine synthetase domain containing 1 dd_Smed_v4_11324_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029142snazarus; transcript_id=FBtr0071092 dd_Smed_v4_1891_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3003350839S ribosomal protein L47 dd_Smed_v4_1861_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016967catechol-O-methyltransferase domain containing 1 dd_Smed_v4_1794_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030974Titin dd_Smed_v4_2438_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030974Titin dd_Smed_v4_13910_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012713h1SMcT0005694.1 dd_Smed_v4_198_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019321TIR domain-containing protein dd_Smed_v4_1838_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016760thrombospondin type 3 repeat-containing protein dd_Smed_v4_1693_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016760thrombospondin type 3 repeat-containing protein dd_Smed_v4_2265_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025465ADAM metallopeptidase domain 10 dd_Smed_v4_2341_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027693general transcription factor IIF subunit 2 dd_Smed_v4_2142_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001196Myosin tail domain-containing protein dd_Smed_v4_2912_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027280ribosomal protein lateral stalk subunit P0 dd_Smed_v4_161_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031017Uncharacterized protein dd_Smed_v4_10618_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031017Uncharacterized protein dd_Smed_v4_10036_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031017Uncharacterized protein dd_Smed_v4_8531_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031017Uncharacterized protein dd_Smed_v4_6173_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017265protocadherin 11 X-linked dd_Smed_v4_11223_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034411ABC transporter dd_Smed_v4_11552_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018899tetraspanin 1 dd_Smed_v4_354_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006358charged multivesicular body protein 6 dd_Smed_v4_1762_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022249Clathrin interactor 1 dd_Smed_v4_1563_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022037Protein kinase domain-containing protein dd_Smed_v4_1630_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024202ribosomal protein S14 dd_Smed_v4_139_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030239eukaryotic translation elongation factor 2 dd_Smed_v4_186_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006203Methyltransferase domain-containing protein dd_Smed_v4_3811_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013125ATPase plasma membrane Ca2 transporting 3 dd_Smed_v4_1721_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013577thrombospondin type 3 repeat-containing protein dd_Smed_v4_1693_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013577thrombospondin type 3 repeat-containing protein dd_Smed_v4_2265_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034290mitochondrial ribosomal protein L24 dd_Smed_v4_1638_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005998ribosomal protein L3 dd_Smed_v4_13357_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005998ribosomal protein L3 dd_Smed_v4_12559_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018389thrombospondin type 3 repeat-containing protein dd_Smed_v4_1693_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018389thrombospondin type 3 repeat-containing protein dd_Smed_v4_2265_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009316Forkhead box protein N3 dd_Smed_v4_11337_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011604acyl-CoA synthetase long chain family member 3 dd_Smed_v4_2153_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035984Mitochondrial 39S ribosomal protein L27 L27mt dd_Smed_v4_1828_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED300196064a-hydroxytetrahydrobiopterin dehydratase dd_Smed_v4_1214_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009189Protein kinase domain-containing protein dd_Smed_v4_1630_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019390Kelch domain-containing protein 9 dd_Smed_v4_7438_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001212tubulin alpha chain dd_Smed_v4_2697_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001212tubulin alpha chain dd_Smed_v4_2679_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001212tubulin alpha chain dd_Smed_v4_2143_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031380Suppressor of hairy wing dd_Smed_v4_2118_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006388peptidylprolyl isomerase A like 4G dd_Smed_v4_1508_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030477FKBP prolyl isomerase 4 dd_Smed_v4_1921_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020652hypothetical protein dd_Smed_v4_10618_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020652hypothetical protein dd_Smed_v4_10036_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020652hypothetical protein dd_Smed_v4_8531_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020652hypothetical protein dd_Smed_v4_6173_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026121ectonucleotide pyrophosphatase/phosphodiesterase 6 dd_Smed_v4_1269_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024698tetraspanin dd_Smed_v4_1719_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030755beclin 1 dd_Smed_v4_3010_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015758Eye-enriched kainate receptor dd_Smed_v4_4267_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015534ribosomal protein L21 dd_Smed_v4_189_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007742SEC61 translocon subunit alpha 2 dd_Smed_v4_282_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013018ribosomal protein S6 dd_Smed_v4_178_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014493ribosomal protein L5 dd_Smed_v4_151_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020652Uncharacterized protein dd_Smed_v4_10618_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020652Uncharacterized protein dd_Smed_v4_10036_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020652Uncharacterized protein dd_Smed_v4_8531_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020652Uncharacterized protein dd_Smed_v4_6173_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029202Uncharacterized protein dd_Smed_v4_10618_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029202Uncharacterized protein dd_Smed_v4_10036_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029202Uncharacterized protein dd_Smed_v4_8531_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029202Uncharacterized protein dd_Smed_v4_6173_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019119Protein kinase domain-containing protein dd_Smed_v4_3286_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013312calpain 11 dd_Smed_v4_1971_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015595shaking B dd_Smed_v4_3879_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019373golgin A4 dd_Smed_v4_12278_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020257h1SMcT0006001.1 dd_Smed_v4_1040_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009566Ts translation elongation factor, mitochondrial dd_Smed_v4_4240_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025401phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase dd_Smed_v4_3037_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015595Innexin dd_Smed_v4_3879_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026844MAK16 homolog dd_Smed_v4_1416_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023172Ribosomal protein L14; transcript_id=FBtr0076633 dd_Smed_v4_167_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020371hemicentin 1 dd_Smed_v4_1161_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028337cell cycle and apoptosis regulator 2 dd_Smed_v4_1181_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018542solute carrier family 4 member 7 dd_Smed_v4_3003_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020296Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_194_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024091Silk gland factor 1 dd_Smed_v4_10718_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019668prosaposin dd_Smed_v4_241_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015780solute carrier family 39 member 7 dd_Smed_v4_2793_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018542bicarbonate transporter-like dd_Smed_v4_3003_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013216Chromodomain-helicase-DNA-binding protein 9 dd_Smed_v4_12815_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013216Chromodomain-helicase-DNA-binding protein 9 dd_Smed_v4_7985_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024486poly(A) binding protein cytoplasmic 1 dd_Smed_v4_11729_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010561dumpy dd_Smed_v4_2649_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017339dynactin subunit 1 dd_Smed_v4_4065_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016589Synapsin dd_Smed_v4_3135_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032664bicarbonate transporter-like dd_Smed_v4_3003_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032110TNF receptor associated factor 5 dd_Smed_v4_1991_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021636genome dd_Smed_v4_12325_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010251BHLH domain-containing protein dd_Smed_v4_21717_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021467phosphoglycerate mutase 1 dd_Smed_v4_1742_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019891EFR3 homolog A dd_Smed_v4_3212_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027074Titin dd_Smed_v4_2438_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027074Titin dd_Smed_v4_13910_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008553phosphoenolpyruvate carboxykinase GTP dd_Smed_v4_196_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029676FKBP prolyl isomerase 6 dd_Smed_v4_3023_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010338proprotein convertase subtilisin/kexin type 2 dd_Smed_v4_1566_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028635phosphorylase kinase regulatory subunit beta dd_Smed_v4_3657_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029202hypothetical protein dd_Smed_v4_10618_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029202hypothetical protein dd_Smed_v4_10036_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029202hypothetical protein dd_Smed_v4_8531_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029202hypothetical protein dd_Smed_v4_6173_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024067NIMA related kinase 11 dd_Smed_v4_4352_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019516Cyclin H; transcript_id=FBtr0078439 dd_Smed_v4_10725_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024211Titin dd_Smed_v4_2438_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024211Titin dd_Smed_v4_13910_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016751Innexin 5 dd_Smed_v4_2810_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003989transformer 2 alpha homolog dd_Smed_v4_3781_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008943DEAD-box helicase 54 dd_Smed_v4_3250_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020589aspartate dehydrogenase domain containing dd_Smed_v4_1769_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025006golgin A4 dd_Smed_v4_12278_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022380phosphorylase kinase regulatory subunit beta dd_Smed_v4_3657_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005233Enah/Vasp-like dd_Smed_v4_2529_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031706protein tyrosine phosphatase non-receptor type 23 dd_Smed_v4_3351_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023155genome dd_Smed_v4_12325_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018630HMG box domain-containing protein dd_Smed_v4_1331_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027441C2H2-type domain-containing protein dd_Smed_v4_4303_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023672RING-type E3 ubiquitin transferase dd_Smed_v4_12595_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017206Band 4.1-like protein 2 dd_Smed_v4_2032_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031769phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase dd_Smed_v4_3037_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023400ankyrin 3 dd_Smed_v4_1432_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019477protein kinase C substrate 80K-H dd_Smed_v4_1730_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018622Innexin 5 dd_Smed_v4_2810_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021019Dipeptidase B dd_Smed_v4_181_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011041zinc finger BED-type containing 6 dd_Smed_v4_1310_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023910Suppressor of hairy wing dd_Smed_v4_2118_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020994decapping enzyme, scavenger dd_Smed_v4_1924_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032664solute carrier family 4 member 7 dd_Smed_v4_3003_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025876beclin 1 dd_Smed_v4_3010_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021307cabeza dd_Smed_v4_1370_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026887Myosin alkali light chain 1 dd_Smed_v4_223_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005670Uncharacterized protein dd_Smed_v4_279_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016564proprotein convertase subtilisin/kexin type 2 dd_Smed_v4_1566_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017670N-terminal Xaa-Pro-Lys N-methyltransferase 1 dd_Smed_v4_1236_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003730nuclear receptor coactivator 5 dd_Smed_v4_2395_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018978UDP-glucose ceramide glucosyltransferase dd_Smed_v4_2757_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025623Silk gland factor 1 dd_Smed_v4_10718_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003808protein tyrosine phosphatase non-receptor type 23 dd_Smed_v4_3351_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014207EFR3 homolog A dd_Smed_v4_3212_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019898Protein kinase domain-containing protein dd_Smed_v4_3286_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023487LSM14A mRNA processing body assembly factor dd_Smed_v4_1125_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016201ATPase H transporting V0 subunit c dd_Smed_v4_253_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014549prominin 1 dd_Smed_v4_1386_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016805glutamate ionotropic receptor kainate type subunit 3 dd_Smed_v4_4267_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009741proprotein convertase subtilisin/kexin type 2 dd_Smed_v4_1566_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017811actinin alpha 1 dd_Smed_v4_1492_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026696ribosomal protein S19 dd_Smed_v4_202_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000463stromal cell derived factor 2 like 1 dd_Smed_v4_1307_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017965zinc finger protein dd_Smed_v4_11647_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002600NACHT and WD repeat domain-containing protein 2 dd_Smed_v4_11466_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033090hypoxia up-regulated 1 dd_Smed_v4_2324_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030253calcium voltage-gated channel subunit alpha1 S dd_Smed_v4_10156_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004367serine and arginine rich splicing factor 12 dd_Smed_v4_1695_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020058heparan sulfate dd_Smed_v4_1054_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008917Tubulin alpha chain dd_Smed_v4_124_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008685Cylindromatosis dd_Smed_v4_1137_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021613Golgin subfamily B member 1-like dd_Smed_v4_10214_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021613Golgin subfamily B member 1-like dd_Smed_v4_11466_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007410TNF receptor-associated factor dd_Smed_v4_1110_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008086ESF1 nucleolar pre-rRNA processing protein homolog dd_Smed_v4_12089_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029971signal recognition particle 54 dd_Smed_v4_2045_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029589Ras GTPase-activating protein gap-2 dd_Smed_v4_11115_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013110kelch like ECH associated protein 1 dd_Smed_v4_1751_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035004NADH:ubiquinone oxidoreductase subunit A9 dd_Smed_v4_1524_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005206serine and arginine rich splicing factor dd_Smed_v4_1192_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026998cilia and flagella associated protein 251 dd_Smed_v4_11127_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013288Cylindromatosis dd_Smed_v4_1137_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023608ubiquitination factor E4A dd_Smed_v4_4558_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007839protein kinase cAMP-dependent type I regulatory subunit beta dd_Smed_v4_2180_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013470ras homolog family member A dd_Smed_v4_813_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018729chaperonin containing TCP1 subunit 5 dd_Smed_v4_544_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008411glutamate-cysteine ligase modifier subunit dd_Smed_v4_487_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003448glycine N-methyltransferase dd_Smed_v4_1127_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022665monoacylglycerol O-acyltransferase 2 dd_Smed_v4_4947_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021335receptor dd_Smed_v4_11488_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004345TNF alpha induced protein 8 like 3 dd_Smed_v4_11459_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029724LRRCT domain-containing protein dd_Smed_v4_2180_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008757piezo type mechanosensitive ion channel component 2 dd_Smed_v4_1447_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008757piezo type mechanosensitive ion channel component 2 dd_Smed_v4_7182_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021637Centrosomal protein of 44 kDa dd_Smed_v4_11524_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024939AH domain-containing protein dd_Smed_v4_3420_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004654triosephosphate isomerase 1 dd_Smed_v4_1402_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029979Retinoblastoma binding protein 5 dd_Smed_v4_4897_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014887golgin A4 dd_Smed_v4_19022_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014887golgin A4 dd_Smed_v4_15248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014887golgin A4 dd_Smed_v4_21084_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006576apoptosis inhibitor 5 dd_Smed_v4_2384_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013570glutaredoxin dd_Smed_v4_2158_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013519histone acetyltransferase 1 dd_Smed_v4_10558_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014645HP domain-containing protein dd_Smed_v4_4193_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014164VPS29 retromer complex component dd_Smed_v4_1727_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035963Adhesive plaque matrix protein dd_Smed_v4_5453_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035963Adhesive plaque matrix protein dd_Smed_v4_1649_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001264glutamate receptor dd_Smed_v4_10048_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032696tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon dd_Smed_v4_461_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033710solute carrier family 47 member 2 dd_Smed_v4_5125_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015546Cyclic AMP-responsive element-binding protein 3-like protein 1 dd_Smed_v4_1032_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028626family with sequence similarity 221 member A dd_Smed_v4_10324_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026774ChaC glutathione specific gamma- glutamylcyclotransferase 1 dd_Smed_v4_2439_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004593golgin A4 dd_Smed_v4_19022_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004593golgin A4 dd_Smed_v4_15248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004593golgin A4 dd_Smed_v4_21084_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013608The sequence of the model RefSeq protein was modified relative to this genomic sequence to represent the inferred CDS dd_Smed_v4_528_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021224Protein split ends dd_Smed_v4_4709_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034851collagen beta(1-O)galactosyltransferase 2 dd_Smed_v4_10276_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014565novel protein dd_Smed_v4_3745_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022101DS cell adhesion molecule like 1 dd_Smed_v4_5856_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007755LIM and SH3 protein 1 dd_Smed_v4_1218_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007685nuclear transcription factor, X-box binding 1 dd_Smed_v4_12234_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032893jade family PHD finger 1 dd_Smed_v4_11492_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029724protein kinase cAMP-dependent type I regulatory subunit beta dd_Smed_v4_2180_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028549armadillo repeat containing 1 dd_Smed_v4_11494_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014286ABC transmembrane type-1 domain-containing protein dd_Smed_v4_13596_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014430protocadherin 11 Y-linked dd_Smed_v4_11605_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029122DNA helicase dd_Smed_v4_11145_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024755solute carrier family 7 member 11 dd_Smed_v4_5465_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014286ABC-type xenobiotic transporter dd_Smed_v4_13596_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016952frizzled class receptor 5 dd_Smed_v4_11823_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000955tRNA methyltransferase 2 homolog A dd_Smed_v4_11602_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012752phosphatidylserine synthase 1 dd_Smed_v4_2855_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010506DnaJ heat shock protein family (Hsp40) member C3 dd_Smed_v4_4016_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025257Protein kinase, cAMP-dependent, catalytic subunit 1; transcript_id=FBtr0335495 dd_Smed_v4_2413_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002007unc-13 homolog A dd_Smed_v4_11394_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010451DNA polymerase epsilon, catalytic subunit dd_Smed_v4_13980_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019388transmembrane 9 superfamily member 4 dd_Smed_v4_2806_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005444nicalin dd_Smed_v4_1389_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015872collagen beta(1-O)galactosyltransferase 2 dd_Smed_v4_10276_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020269Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_395_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006481WD repeat domain 49 dd_Smed_v4_13248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012464prostaglandin E receptor 2 dd_Smed_v4_49258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015533mortality factor 4 like 1 dd_Smed_v4_5890_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007722malonyl-CoA-acyl carrier protein transacylase dd_Smed_v4_11450_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018002golgin A4 dd_Smed_v4_19022_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018002golgin A4 dd_Smed_v4_15248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018002golgin A4 dd_Smed_v4_21084_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004270splicing factor 3b subunit 1 dd_Smed_v4_2754_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002942golgin A4 dd_Smed_v4_19022_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002942golgin A4 dd_Smed_v4_15248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002942golgin A4 dd_Smed_v4_21084_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011350serine palmitoyltransferase long chain base subunit 1 dd_Smed_v4_1567_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008425phosphatidylinositol specific phospholipase C X domain containing 3 dd_Smed_v4_5433_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000179Major facilitator superfamily MFS profile domain-containing protein dd_Smed_v4_5351_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028914photorepair; transcript_id=FBtr0088838 dd_Smed_v4_2829_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009859ribosomal protein S24 dd_Smed_v4_164_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035132DEAH-box helicase 15 dd_Smed_v4_2043_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020990Guanine nucleotide exchange protein smcr8a dd_Smed_v4_129_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021224ankyrin repeat domain 11 dd_Smed_v4_4709_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002586serine palmitoyltransferase long chain base subunit 1 dd_Smed_v4_1567_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029603Adhesive plaque matrix protein dd_Smed_v4_5453_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029603Adhesive plaque matrix protein dd_Smed_v4_1649_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006985WD repeat domain 49 dd_Smed_v4_13248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015453poly(ADP-ribose) polymerase family member 3 dd_Smed_v4_2611_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001344COPI coat complex subunit beta 1 dd_Smed_v4_1208_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008169antigen dd_Smed_v4_1881_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002529RNA polymerase II subunit B dd_Smed_v4_2182_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001793O-linked N-acetylglucosamine (GlcNAc) transferase dd_Smed_v4_2939_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035906unc-13 homolog A dd_Smed_v4_11394_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009463WD repeat domain 49 dd_Smed_v4_13248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017242unc-13 homolog A dd_Smed_v4_11394_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005428SAP domain containing ribonucleoprotein dd_Smed_v4_2297_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011715splicing factor dd_Smed_v4_1177_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011204piezo type mechanosensitive ion channel component 1 dd_Smed_v4_1447_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014795serine/threonine kinase 17b dd_Smed_v4_10164_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020318WD repeat domain 49 dd_Smed_v4_13248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023379piezo type mechanosensitive ion channel component 2 dd_Smed_v4_1447_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023379piezo type mechanosensitive ion channel component 2 dd_Smed_v4_7182_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032823corin, serine peptidase dd_Smed_v4_129_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024738transmembrane p24 trafficking protein 7 dd_Smed_v4_1465_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016246Uncharacterized protein dd_Smed_v4_3842_3_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018486pre-mRNA processing factor 38; transcript_id=FBtr0088582 dd_Smed_v4_3382_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035315EEF1AKMT4-ECE2 readthrough dd_Smed_v4_8276_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021037small nuclear ribonucleoprotein 13 dd_Smed_v4_1928_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031328cationic amino acid transporter dd_Smed_v4_8652_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028040cysteine and glycine rich protein 2 dd_Smed_v4_373_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029507ribosomal protein L12 dd_Smed_v4_259_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017571prolyl-tRNA synthetase 2, mitochondrial dd_Smed_v4_12333_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018834RAN binding protein 1 dd_Smed_v4_3061_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030650proteasome 26S subunit, ATPase 4 dd_Smed_v4_1279_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028430secretory carrier membrane protein 5 dd_Smed_v4_2702_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025952zinc finger protein 12 dd_Smed_v4_2771_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000515Nuclear receptor corepressor 1 dd_Smed_v4_7709_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024574Nipped-B; transcript_id=FBtr0111119 dd_Smed_v4_3927_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029630Transcription factor TFIIIB component B'' dd_Smed_v4_8936_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001783mitochondrial ribosomal protein L17; transcript_id=FBtr0072503 dd_Smed_v4_3289_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031089ribosomal protein S12 dd_Smed_v4_268_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010001ATP binding cassette subfamily A member 3 dd_Smed_v4_2300_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020462zinc finger and BTB domain containing 8 opposite strand dd_Smed_v4_4680_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032238Sec23 homolog A, COPII coat complex component dd_Smed_v4_778_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003662protein phosphatase 2 regulatory subunit Balpha dd_Smed_v4_5857_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030766RNA binding motif protein 3 dd_Smed_v4_52_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017954cell division cycle 5 like dd_Smed_v4_4163_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030773atp-dependent rna helicase dd_Smed_v4_3743_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016497ubiquitin specific peptidase 8 dd_Smed_v4_4074_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014132signal peptidase complex subunit 3 dd_Smed_v4_1712_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016557aquaporin 2 dd_Smed_v4_6111_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010412glutamic-oxaloacetic transaminase 2 dd_Smed_v4_3531_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030448dual specificity protein phosphatase dd_Smed_v4_3617_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014020ATP binding cassette subfamily A member 4 dd_Smed_v4_2300_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026135CR6-interacting factor dd_Smed_v4_2807_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004517small nuclear ribonucleoprotein dd_Smed_v4_2444_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001485Putative ATP-dependent RNA helicase TDRD12 dd_Smed_v4_4638_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013398Pre-mRNA-splicing factor 38 dd_Smed_v4_1839_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021103LDL receptor repeat-containing protein egg-1 dd_Smed_v4_6524_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035492Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_12614_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033346Obg like ATPase 1 dd_Smed_v4_2199_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031842chromatin-remodeling ATPase INO80 dd_Smed_v4_4595_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017516collagen type XIII alpha 1 dd_Smed_v4_2197_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031538ALG1 chitobiosyldiphosphodolichol beta- mannosyltransferase dd_Smed_v4_2340_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016810KDEL endoplasmic reticulum protein retention receptor 1 dd_Smed_v4_3954_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019823adaptor related protein complex 3 subunit sigma 1 dd_Smed_v4_4819_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027978calcyphosine like dd_Smed_v4_4512_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028677general transcription factor IIF subunit 1 dd_Smed_v4_7287_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007186kinetochore protein nuf2 dd_Smed_v4_9349_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022806calcyphosine like dd_Smed_v4_4512_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009664macoilin dd_Smed_v4_2700_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010855protein tyrosine phosphatase receptor type D dd_Smed_v4_8199_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004317ATP binding cassette subfamily A member 4 dd_Smed_v4_2300_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023044ATP binding cassette subfamily A member 3 dd_Smed_v4_2300_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032624cilia and flagella associated protein 53 dd_Smed_v4_3219_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029143Mesoderm induction early response protein 1 dd_Smed_v4_8904_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035242Protein lin-54 homolog dd_Smed_v4_6481_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019931ATP binding cassette subfamily A member 3 dd_Smed_v4_2300_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028718epsin 2 dd_Smed_v4_4779_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020938haloacid dehalogenase like hydrolase domain containing 5 dd_Smed_v4_3674_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035671NADH:ubiquinone oxidoreductase subunit B8 dd_Smed_v4_2378_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030425Ubiquitin carboxyl-terminal hydrolase 7 dd_Smed_v4_1847_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021430SID1 transmembrane family member 2 dd_Smed_v4_6063_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008890haloacid dehalogenase like hydrolase domain containing 5 dd_Smed_v4_3674_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008485ribosomal protein S5 dd_Smed_v4_3206_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020730DOP1 leucine zipper like protein A dd_Smed_v4_6117_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035852ubiquitin A-52 residue ribosomal protein fusion product 1 dd_Smed_v4_176_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008768ubiquitin specific peptidase 8 dd_Smed_v4_4074_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004117peptidylprolyl isomerase G dd_Smed_v4_2064_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010680protein phosphatase 4 regulatory subunit 3A dd_Smed_v4_4095_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014083peptidylprolyl isomerase G dd_Smed_v4_2064_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015532early endosome antigen 1 dd_Smed_v4_5283_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029750Sec23 homolog A, COPII coat complex component dd_Smed_v4_778_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021105tubulin alpha 3d dd_Smed_v4_38_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019972kinesin family member 19 dd_Smed_v4_9460_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024809Ubiquitin carboxyl-terminal hydrolase 11 dd_Smed_v4_3085_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013028Nuclear receptor-binding protein 2 dd_Smed_v4_5859_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007434ferredoxin reductase dd_Smed_v4_8668_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020096ubiquitin specific peptidase 8 dd_Smed_v4_4074_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021105tubulin alpha 3d dd_Smed_v4_38_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010714DOP1 leucine zipper like protein A dd_Smed_v4_6117_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030240ferritin mitochondrial dd_Smed_v4_443_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012873Dmx like 2 dd_Smed_v4_5944_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020736NOP58 ribonucleoprotein dd_Smed_v4_1982_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020317heat shock protein 90 alpha family class A member 1 dd_Smed_v4_678_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021872AP2-associated protein kinase 1-like dd_Smed_v4_5124_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018708E3 ubiquitin-protein ligase RNF38 dd_Smed_v4_2844_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015912kinetochore protein nuf2 dd_Smed_v4_9349_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002994Mitochondrial import inner membrane translocase subunit TIM22 dd_Smed_v4_7699_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010757holocytochrome c synthase dd_Smed_v4_2573_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017945collagen type V alpha 1 chain dd_Smed_v4_840_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009776Collagen type IV alpha 1; transcript_id=FBtr0079002 dd_Smed_v4_2500_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035360peptidylprolyl isomerase A like 4G dd_Smed_v4_133_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029147ribosomal protein S7 dd_Smed_v4_204_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024800ubiquitin specific peptidase 8 dd_Smed_v4_4074_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029147anorexia; transcript_id=FBtr0091702 dd_Smed_v4_204_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021389suppressor-of-G2-allele-of-skp1; transcript_id=FBtr0081862 dd_Smed_v4_3826_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007394Phosphatidylinositol 4-kinase type 2-beta dd_Smed_v4_9125_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020379hdc homolog, cell cycle regulator dd_Smed_v4_6218_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019571Serine/threonine-protein kinase shk2 dd_Smed_v4_2822_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004297eukaryotic translation initiation factor 3 subunit K dd_Smed_v4_621_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027916DNA-directed RNA polymerases I II and III subunit dd_Smed_v4_3539_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024745ubiquitin specific peptidase 8 dd_Smed_v4_4074_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026337Uncharacterized protein dd_Smed_v4_4438_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003373Uncharacterized protein dd_Smed_v4_5189_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003214Mannosyl phosphorylinositol ceramide synthase SUR1 dd_Smed_v4_7248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018637heat shock protein family A (Hsp70) member 8 dd_Smed_v4_15_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000291intersectin 2 dd_Smed_v4_5505_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016907dual serine/threonine and tyrosine protein kinase dd_Smed_v4_6544_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006464Transcription factor 15 dd_Smed_v4_4998_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012974solute carrier family 25 member 3 dd_Smed_v4_543_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012642LUC7 like 2, pre-mRNA splicing factor dd_Smed_v4_4536_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030159Uncharacterized protein dd_Smed_v4_2072_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030159Uncharacterized protein dd_Smed_v4_4438_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019080chromosome transmission fidelity factor 18 dd_Smed_v4_13246_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019332general transcription factor IIH subunit 2 dd_Smed_v4_7018_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017608Nuclear transcription factor Y subunit A-1 dd_Smed_v4_9452_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023025protein phosphatase 3 regulatory subunit B, alpha dd_Smed_v4_4924_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016795protein phosphatase 2 scaffold subunit Aalpha dd_Smed_v4_687_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034127chymase 1 dd_Smed_v4_7541_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014435Marcal1; transcript_id=FBtr0078992 dd_Smed_v4_10238_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020872myosin IF dd_Smed_v4_1626_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025990nephrocystin 1 dd_Smed_v4_9990_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001828dynein axonemal assembly factor 3 dd_Smed_v4_6686_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032833Ig-like domain-containing protein dd_Smed_v4_475_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021684collagen type II alpha 1 chain dd_Smed_v4_8075_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007036Small nuclear ribonucleoprotein Sm D-like protein dd_Smed_v4_7745_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019471synaptotagmin 2 dd_Smed_v4_6730_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012843cyclase associated actin cytoskeleton regulatory protein 2 dd_Smed_v4_727_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014639Pantothenate kinase 2 dd_Smed_v4_7295_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002530UBA domain containing 1 dd_Smed_v4_8499_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024423family with sequence similarity 135 member A dd_Smed_v4_4890_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003741Glycine-rich protein GRP33 dd_Smed_v4_1393_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033136lectin mannose binding 1 dd_Smed_v4_9447_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033903ankyrin repeat and SOCS box containing 11 dd_Smed_v4_6779_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004634ubiquinol-cytochrome c reductase core protein 1 dd_Smed_v4_729_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013286diacylglycerol lipase beta dd_Smed_v4_13306_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014291Menage a trois 1 dd_Smed_v4_5889_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011386ankyrin repeat and SOCS box containing 11 dd_Smed_v4_6779_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024261ankyrin repeat and SOCS box containing 11 dd_Smed_v4_6779_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029321zinc finger dd_Smed_v4_6954_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018561Pantothenate kinase 2 dd_Smed_v4_7295_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019471synaptotagmin 2 dd_Smed_v4_6730_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007143G protein nucleolar 2 dd_Smed_v4_1134_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016723Uncharacterized protein dd_Smed_v4_2072_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016723Uncharacterized protein dd_Smed_v4_4438_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032373centrosomal protein 135 dd_Smed_v4_6933_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018697S1 motif domain-containing protein dd_Smed_v4_10802_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012262ankyrin repeat and SOCS box containing 11 dd_Smed_v4_6779_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010219reticulon 1 dd_Smed_v4_878_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022723integrator complex subunit 11 dd_Smed_v4_10577_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001755flotillin 1 dd_Smed_v4_4656_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003871h1SMcT0000358.1 dd_Smed_v4_2765_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007517IQ domain-containing protein E dd_Smed_v4_7345_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019790UBA domain containing 1 dd_Smed_v4_8499_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009816Ral GTPase activating protein non-catalytic subunit beta dd_Smed_v4_8678_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003234Chromodomain-helicase-DNA-binding protein 3 homolog dd_Smed_v4_9090_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030402alpha-aminoadipate reductase dd_Smed_v4_7198_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012480BUD13 homolog dd_Smed_v4_9510_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013027ankyrin repeat domain 7 dd_Smed_v4_7379_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007399Ribosomal RNA processing protein dd_Smed_v4_5604_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029792Polyubiquitin (Fragment) dd_Smed_v4_2001_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008638ankyrin repeat and SOCS box containing 11 dd_Smed_v4_6779_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021539diacylglycerol lipase beta dd_Smed_v4_13306_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010533extended synaptotagmin 2 dd_Smed_v4_5158_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000377Glutamate receptor-interacting protein 2-like dd_Smed_v4_5498_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025596Ca(2 )/calmodulin-responsive adenylate cyclase dd_Smed_v4_4439_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001455Bromodomain testis-specific protein dd_Smed_v4_6525_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003480AFG1 like ATPase dd_Smed_v4_4382_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010727N-lysine methyltransferase KMT5A-A dd_Smed_v4_5677_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018086WD repeat-containing protein 89 dd_Smed_v4_876_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028955solute carrier family 12 member 4 dd_Smed_v4_4389_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024350The sequence of the model RefSeq protein was modified relative to this genomic sequence to represent the inferred CDS dd_Smed_v4_209_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008978agmatinase dd_Smed_v4_6599_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003135Trans-golgi network protein 2 dd_Smed_v4_3825_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007047DNA-directed DNA polymerase dd_Smed_v4_6535_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021238aminolevulinate dehydratase dd_Smed_v4_6364_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008486Golgin subfamily B member 1-like dd_Smed_v4_10249_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008892atp-dependent rna helicase dd_Smed_v4_6143_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031029mitogen-activated protein kinase kinase kinase kinase 4 dd_Smed_v4_6230_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009134ribosomal protein L35 mitochondrial dd_Smed_v4_4419_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016880zinc finger RANBP2-type containing 2 dd_Smed_v4_1397_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000555AFG1 like ATPase dd_Smed_v4_4382_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004599mannose receptor C type 2 dd_Smed_v4_652_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001542caveolin dd_Smed_v4_6535_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011695galactosidase alpha dd_Smed_v4_606_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006125Zinc finger protein 142 dd_Smed_v4_14413_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018186ribosomal protein L10 like dd_Smed_v4_130_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005569fibrillarin like 1 dd_Smed_v4_4679_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017368h1SMcT0004996.1 dd_Smed_v4_7236_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021645Golgin subfamily B member 1-like dd_Smed_v4_10249_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014970Protein kinase domain-containing protein dd_Smed_v4_15869_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007106Trans-golgi network protein 2 dd_Smed_v4_3825_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001296actin related protein 2 dd_Smed_v4_623_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010627Homeobox protein dd_Smed_v4_8553_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014731h1SMcT0005156.1 dd_Smed_v4_5494_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006140NADH dehydrogenase (ubiquinone) 42 kDa subunit; transcript_id=FBtr0335194 dd_Smed_v4_5279_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000555AFG1 like ATPase dd_Smed_v4_4382_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007882mannose receptor C type 2 dd_Smed_v4_652_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035053pitrilysin metallopeptidase 1 dd_Smed_v4_5873_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026534ras homolog family member B dd_Smed_v4_578_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010334voltage dependent anion channel 1 dd_Smed_v4_1424_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019802zinc finger RANBP2-type containing 2 dd_Smed_v4_1397_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007567piwi-like protein 1 DQ186986.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
neoblastSMED30007567piwi-like protein 1 DQ186986.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
neoblastSMED30007567piwi-like protein 1 SMED30014446smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
neoblastSMED30007567piwi-like protein 1 SMED30014446smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
neoblastSMED30007567piwi-like protein 1 SMED30014446smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
neoblastSMED30013909Tudor domain-containing 6 KF781126smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
neoblastSMED30013909Tudor domain-containing 6 KF781126smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
neoblastSMED30013909Tudor domain-containing 6 KF781126smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
neoblastSMED30013909Tudor domain-containing 6 tud-1smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
neoblastSMED30013909Tudor domain-containing 6 tud-1smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
neoblastSMED30013909Tudor domain-containing 6 tud-1smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
neoblastSMED30004304proliferating cell nuclear antigen EU856391smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
neoblastSMED30004304proliferating cell nuclear antigen EU856391smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
neoblastSMED30004304proliferating cell nuclear antigen EU856391smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
neoblastSMED30007406Protein piwi DQ186985.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
neoblastSMED30007406Protein piwi DQ186985.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
neoblastSMED30007406Protein piwi DQ186985.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
neoblastSMED30010517 AFJ24744.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
neoblastSMED30010517 AFJ24744.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
neoblastSMED30010517 AFJ24744.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
neoblastSMED30010517 SMED30010115smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
neoblastSMED30010517 SMED30010115smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
neoblastSMED30010517 SMED30010115smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
neoblastSMED30010517 JX010501.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
neoblastSMED30010517 JX010501.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
neoblastSMED30010517 JX010501.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
neoblastSMED30010115 AFJ24744.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
neoblastSMED30010115 AFJ24744.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
neoblastSMED30010115 AFJ24744.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
neoblastSMED30010115 JX010501.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
neoblastSMED30010115 JX010501.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
neoblastSMED30010115 JX010501.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
neoblastSMED30035880methyl-CpG binding domain protein 3 KF664582smed_ncbi_20240424PMID:24063805
Jaber-Hijazi et al., 2013
whole organism juvenile stagecolorimetric in situ hybridization evidence
neoblastSMED30035880methyl-CpG binding domain protein 3 KF664582smed_ncbi_20240424PMID:24063805
Jaber-Hijazi et al., 2013
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
neoblastSMED30035880methyl-CpG binding domain protein 3 KF664582smed_ncbi_20240424PMID:24063805
Jaber-Hijazi et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30017456receptor protein-tyrosine kinase HM777016smed_ncbi_20240424PMID:21458439
Fraguas et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30010167Transcriptional repressor p66 coiled-coil MBD2-interaction domain-containing protein EC615093smed_ncbi_20240424PMID:27606067
Vásquez-Doorman et al., 2016
whole organism asexual adult RNA-sequencing evidence
neoblastSMED30010167Transcriptional repressor p66 coiled-coil MBD2-interaction domain-containing protein EC615093smed_ncbi_20240424PMID:27606067
Vásquez-Doorman et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30001362piwi like RNA-mediated gene silencing 1 EU586258smed_ncbi_20240424PMID:18456843
Palakodeti et al., 2008
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
neoblastSMED30024368 GU980571.1smed_ncbi_20240424PMID:20223763
Scimone et al., 2010
FACS sorted cell population asexual adult fluorescence in situ hybridization evidence
neoblastSMED30024368 GU980571.1smed_ncbi_20240424PMID:20223763
Scimone et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30009514H2B clustered histone 14 DN298006smed_ncbi_20240424PMID:28976975
Su et al., 2017
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30006369integrin subunit beta 1 KU961518.1smed_ncbi_20240424PMID:28893948
Abnave et al., 2017
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30004536Protein ovo KY964486smed_ncbi_20240424PMID:28893948
Abnave et al., 2017
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30023573zinc finger protein 575 KJ934814.1smed_ncbi_20240424PMID:28893948
Abnave et al., 2017
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30007406Protein piwi DQ186985.1smed_ncbi_20240424PMID:22445864
Tu et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30026364Cellular tumor antigen p53 AY068713.3smed_ncbi_20240424PMID:20040488
Pearson et al., 2010
FACS sorted cell population asexual adult fluorescence in situ hybridization evidence
neoblastSMED30026364Cellular tumor antigen p53 AY068713.3smed_ncbi_20240424PMID:20040488
Pearson et al., 2010
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30001362piwi like RNA-mediated gene silencing 1 DN315298smed_ncbi_20240424PMID:16344473
Zayas et al., 2005
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
neoblastSMED30014446piwi-like protein 1 DN303300smed_ncbi_20240424PMID:16344473
Zayas et al., 2005
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
neoblastSMED30007567piwi-like protein 1 DN303300smed_ncbi_20240424PMID:16344473
Zayas et al., 2005
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
neoblastSMED30007406Protein piwi DN313409smed_ncbi_20240424PMID:16344473
Zayas et al., 2005
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
neoblastSMED30010039Transcription factor GATA-3 dd_Smed_v4_8208_0_1dd_Smed_v4PMID:30471994
Scimone et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031351Transcription factor GATA-3 dd_Smed_v4_8208_0_1dd_Smed_v4PMID:30471994
Scimone et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002349 dd_Smed_v4_9910_0_1dd_Smed_v4PMID:30471994
Scimone et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023062CUGBP Elav-like family member DQ344977.2smed_ncbi_20240424PMID:29357350
de Sousa et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30007406Protein piwi DQ186985.1smed_ncbi_20240424PMID:29357350
de Sousa et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30007406Protein piwi DQ186985.1smed_ncbi_20240424PMID:29357350
de Sousa et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30009514H2B clustered histone 14 DN298006smed_ncbi_20240424PMID:24523458
Lin et al., 2014
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30007406Protein piwi DQ186985.1smed_ncbi_20240424PMID:24523458
Lin et al., 2014
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30021007Mediator of RNA polymerase II transcription subunit 14 SmedASXL_014533SmedAsxl_ww_GCZZ01PMID:25772472
Burrows et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30001362piwi like RNA-mediated gene silencing 1 dd_Smed_v6_1258_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016078Actin 5C dd_Smed_v6_246_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016078Actin 5C dd_Smed_v6_285_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005988ribosomal protein L24 dd_Smed_v6_172_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006655ribosomal protein L32 dd_Smed_v6_149_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001495ribosomal protein L15 dd_Smed_v6_193_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004484ribosomal protein L8 dd_Smed_v6_108_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008506ribosomal protein S17 dd_Smed_v6_195_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005936Titin dd_Smed_v6_15537_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009007Titin dd_Smed_v6_15537_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023062CUGBP Elav-like family member dd_Smed_v6_2592_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008241Titin dd_Smed_v6_15537_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003249prohibitin dd_Smed_v6_1038_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002369ribosomal protein S17 dd_Smed_v6_195_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013371ribosomal protein S26 dd_Smed_v6_222_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035929SWI/SNF related, matrix associated, actin dependent regulator of chromatin subfamily c member 2 dd_Smed_v6_1804_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023057polypyrimidine tract binding protein 2 dd_Smed_v6_2799_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002455ribosomal protein L6 dd_Smed_v6_205_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033785cell cycle and apoptosis regulator 2 dd_Smed_v6_1181_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030974Titin dd_Smed_v6_15537_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027280ribosomal protein lateral stalk subunit P0 dd_Smed_v6_161_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024202ribosomal protein S14 dd_Smed_v6_139_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030477FKBP prolyl isomerase 4 dd_Smed_v6_1921_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026121ectonucleotide pyrophosphatase/phosphodiesterase 6 dd_Smed_v6_1269_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015534ribosomal protein L21 dd_Smed_v6_189_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013018ribosomal protein S6 dd_Smed_v6_178_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014493ribosomal protein L5 dd_Smed_v6_151_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023172Ribosomal protein L14; transcript_id=FBtr0076633 dd_Smed_v6_167_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028337cell cycle and apoptosis regulator 2 dd_Smed_v6_1181_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027074Titin dd_Smed_v6_15537_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024211Titin dd_Smed_v6_15537_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018630HMG box domain-containing protein dd_Smed_v6_1331_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017670N-terminal Xaa-Pro-Lys N-methyltransferase 1 dd_Smed_v6_1236_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023487LSM14A mRNA processing body assembly factor dd_Smed_v6_1125_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026696ribosomal protein S19 dd_Smed_v6_202_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005206serine and arginine rich splicing factor dd_Smed_v6_1192_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026367polynucleotide kinase 3'-phosphatase dd_Smed_v6_1211_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016163ribosomal protein L27a dd_Smed_v6_155_1dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022560ribosomal protein L28 dd_Smed_v6_221_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029694kinesin light chain dd_Smed_v4_6449_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032645chromobox 1 dd_Smed_v4_928_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027427acyl-CoA synthetase short chain family member 1 dd_Smed_v4_6561_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003920nuclear cap binding protein subunit 1 dd_Smed_v4_6140_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032737CBF1-interacting co-repressor CIR N-terminal domain-containing protein dd_Smed_v4_5424_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025041ILK associated serine/threonine phosphatase dd_Smed_v4_2362_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019455LIM and senescent cell antigen-like-containing domain protein dd_Smed_v4_6647_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015471h1SMcT0017827.1 dd_Smed_v4_6156_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031061nucleobindin 2 dd_Smed_v4_6010_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012619Matrin-3 dd_Smed_v4_7366_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026279fumarylacetoacetate hydrolase dd_Smed_v4_916_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003354lysophosphatidylcholine acyltransferase 2 dd_Smed_v4_7365_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029695patched 1 dd_Smed_v4_7063_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035357major facilitator superfamily domain containing 11 dd_Smed_v4_9584_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016950utrophin dd_Smed_v4_5325_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015358vacuolar protein sorting 13 homolog B dd_Smed_v4_9569_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023714Nuclear factor 1 B-type dd_Smed_v4_7403_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED300279683'-phosphoadenosine 5'-phosphosulfate synthase 1 dd_Smed_v4_2536_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030305carboxypeptidase A6 dd_Smed_v4_2282_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025717C9orf72-SMCR8 complex subunit dd_Smed_v4_6804_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005207endosome-lysosome associated apoptosis and autophagy regulator family member 2 dd_Smed_v4_5144_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030234tubulin alpha chain dd_Smed_v4_648_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022991TLE family member 4, transcriptional corepressor dd_Smed_v4_4112_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021516inner membrane mitochondrial protein dd_Smed_v4_1605_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029780putative transcription factor ovo-like protein 3 dd_Smed_v4_7731_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033077H2B clustered histone 9 dd_Smed_v4_879_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035193heat shock protein 90 alpha family class B member 1 dd_Smed_v4_56_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035297XPA, DNA damage recognition and repair factor dd_Smed_v4_1950_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027123translocase of inner mitochondrial membrane 44 dd_Smed_v4_6502_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023825h1SMcT0015128.1 dd_Smed_v4_353_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022353prefoldin subunit 4 dd_Smed_v4_2296_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED300044405-hydroxytryptamine (serotonin) receptor 7; transcript_id=FBtr0085746 dd_Smed_v4_5341_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001805C9orf72-SMCR8 complex subunit dd_Smed_v4_6804_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022035dihydroorotate dehydrogenase (quinone) dd_Smed_v4_4266_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034342Domain of unknown function with conserved HDNR motif domain-containing protein dd_Smed_v4_6279_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008612sorting nexin 14 dd_Smed_v4_6581_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020344Uncharacterized protein dd_Smed_v4_7295_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013497MRT4 homolog, ribosome maturation factor dd_Smed_v4_1609_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033602methyltransferase like 21A dd_Smed_v4_7520_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011685ENAH actin regulator dd_Smed_v4_5085_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025067heat shock protein family A (Hsp70) member 5 dd_Smed_v4_511_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED300196185-hydroxytryptamine (serotonin) receptor 7; transcript_id=FBtr0085746 dd_Smed_v4_5341_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009928spliceosome associated factor 1, recruiter of U4/U6.U5 tri-snRNP dd_Smed_v4_5108_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034802small nuclear ribonucleoprotein D3 polypeptide