neoblast

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ Figures

  ▻ In Situ Hybridization Data

  ▻ Sequences

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  neoblast


DEFINITON:

  A heterogeneous population of pluripotent, somatic adult stem cells and lineage primed progenitors that are required for maintenance and regeneration of all cell types in planaria, including the germline.


TERM DEFINITION CITATIONS:

  planaref-0000004, PMID:21566185, PMID:22899852, PMID:16311336


TERM CITATIONS:

Expand publication list


TERM ID:

  PLANA:0000429


ABOUT THIS TERM:

neoblast

  ↳is a material entity, progenitor cell and stem cell

  ↳contained in tail, copulatory region, ventral region of the whole animal, posterior region of the whole animal, parapharyngeal region, prepharyngeal region, head, dorsal region of the whole animal and anterior region of the whole animal

  ↳develops from blastomere

  ↳existence overlaps Stage 6, juvenile, Stage 5, asexual adult, adult hermaphrodite, Stage 8 and Stage 7

  ↳existence starts during or after Stage 5


Expand to see terms that develops from neoblast



DEPICTED BY:


BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


FIGURES:


Figure 9: Ontogeny of the adult neoblast compartment. 

Asynchronously cycling piwi-1+ cells fuel embryogenesis, giving rise to all temporary and definitive tissues. During S2, some piwi-1+ blastomeres (purple cells) exit the cell cycle and differentiate into temporary embryonic tissues (primitive ectoderm, temporary embryonic pharynx and primitive endoderm). The remaining piwi-1+ blastomeres, located in the embryonic wall (purple cells, S3-S4), continue to divide and express both early embryo enriched transcripts (turquoise arrow) and adult asexual neoblast enriched transcripts (red arrow). As organogenesis begins during S5, early embryo enriched transcripts are downregulated throughout the compartment (purple cells transition into red). Concomitantly, progenitor subpopulations required for definitive organ formation are specified via the heterogeneous expression of developmental transcription factors within the piwi-1+ population (colored cells denote different progenitor subpopulations). Adult pluripotent neoblasts, themselves a lineage, are established during S5 (red cells). Embryonic donor cells harvested during or after S6 function similarly to adult neoblasts (cNeoblast activity, gray arrow). Pluripotent and lineage-primed neoblasts established during embryogenesis are maintained throughout the lifetime of the animal, where they are required for tissue maintenance during homeostasis and formation of new tissue during regeneration.

 

 

back to top


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30001900Bruno-like proteinbruli-1Stage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8neoblast, blastomere
SMED30033466Histone H4Stage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, neoblast, primitive ectoderm, embryonic pharynx, blastomere
SMED30004304Proliferating cell nuclear antigenPCNAStage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8neoblast, blastomere
SMED30010115AFJ24744.1ribonucleoside diphosphate reductase subunit M2-2RRM2-2Stage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8neoblast, blastomere
SMED30007406Q2Q5Y9SMEDWI-1piwi-1Stage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8neoblast, blastomere
SMED30014446Q2Q5Y8SMEDWI-2piwi-2Stage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8neoblast, blastomere
SMED30001362ACC97187.1SMEDWI-3piwi-3Stage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8neoblast, blastomere
SMED30019097AFD29619.1SOXP-1SOXP-1Stage 4, Stage 5, Stage 6, Stage 7, Stage 8neoblast, sigma neoblast, blastomere
SMED30035063AFD29620.1SOXP-2SOXP-2Stage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8neoblast, sigma neoblast, blastomere
SMED30013909AHC00376.1tud-1tud-1Stage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8neoblast, blastomere
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30010115 ID=SMED30010115|Name=ribonucleoside diphosphate reductase subunit M2-2|organism=Schmidtea mediterranea sexual|type=transcript|length=1127bp
GTTTTTAATGAACTGAATCAGGTTTAATGCAAAATAGTCATTTTAATTTCTAGATAAATTAACAGTAATTCTTTCGAGAT
TAGATATTTATTATGGAGATTTTATTAACAGAAGATAAAAGTCGAATAGGATTTCTTAATATACAATATGAAGATATATG
GGAAATGTTTAATAAAGCTCGATCTTCATTTTGGACTGTAAATGAAGTTAATTTATCAAAAGATTTTGCTCACTGGAAAA
AAATGAATGACGATGAACGGTATTTCATTACTCACGTTCTTGCATTTTTTGCTGCCAGTGATGGAATTGTCAATGAAAAT
CTCGTCGAAAGATTCATTCAAGAAGTGAAAATTCCCGAAGCTGAGGCATTTTACAGTTTTCAAATTGCAATTGAAAACAT
TCATTCAGAAATGTATTCTCTATTAATCGATTCTTATGTTACTGATACAGAAACAAAGAATAAATTATTTAATGCCATCG
AAACTATGCCATGCGTTCAGAAAAAAGCTCAATGGGCATTGCGTTGGATTAGCGATAAAAAATCCACTTTTGGAACTAGA
GTTGTTGCATTTGCTGCTGTCGAGGGAATATTTTTCAGTGGTAGTTTTGCATCGATATTTTGGCTTAAAAAGCGTGGATT
AATGCCCGGATTATGTTTCAGCAACGAATTAATTAGCCGAGATGAAGGACTTCATTGCGATTTTGCTTGTTTGATGTTTA
AATATTTAAGTAGCAAACCGTCACCTGAACAAGTTTTGGATTTGATCAAAGAAGCTGTCGGAATCGAGAAGGAATTTCTC
ACCGACGCATTGCCGGTTTCATTGATTGGCATGAACGCTGAATCGATGTGTGAGTATATTGAATTTGTGGCCGACCGGCT
GCTGGTTGAATTGGGCTGTGACAAGTTCTGGAACACAGAGAACCCGTTGGATTTCATGGATAATATTTGCATCGATGGGA
AAACTAACTTCTTTGAGAAACGAGTCGGTGAATATTCCATGTCGAGCGTTGAGGACAAACACAAATTTGATGATGTCAAT
TTCGATATTGATTTTTGAGGGATTCCGTTTTTTGGCGCCAGTGTGCATTTAATGTGTTTTGGTTGTAATTGGCTATTTTT
GTTTGTT
>SMED30007406 ID=SMED30007406|Name=SMEDWI-1|organism=Schmidtea mediterranea sexual|type=transcript|length=2730bp
AATCGAATACATAAAAATTTATTTGACACCAAATACAAAGAGACATTAATCTACAAGTAAAATAAGCGTTCGCGAATTCT
GTCATTTATCGCTGGAGGAGTAACACCACGATGAATCTTGCCAACGAGTTCAGCCAAACGATGGGCATAATGCGTTGGAA
CAGGAACTCGGATTGTTCCCATCCAGTTAAAATACAAATGTGTTAACGAATAAGTTATTTGCTGCAATACACTCGGAGAC
ATAACTGAAACCTCATTTGTTTTCTTGTTTGTAAACTTAGTGTCCATAAGAACATTATAATTCGTAGGAGATGCTGTACC
TTTAGTTGTTTTCTGAGACACCAAGTAAAATTCATAGAAATTGGGTTTCACTATTTTCTCATCAACCACAGTACCAGGAT
TTGGATTAGCCCCATCTTTGAAAAATTTAACACTAATTCTCTTCTTAACCACAACATAAATAATTTGGGGCAAAGTTTGA
TTTTCGTAAATTTTCTCTATCATTTTCATAACAGCATCAGTTTCGAACTTTTTGGTAAATGCTAACTGTGAATCTCCAAC
ACCGTCACGATAAATAATCAAACGAAGAGGCATAGTGTTAAATTTGTTTTGGAATGTTGTAAGGGCCGTTAGGAAGTTTT
TGCCCAAATTTTCGTGAAATTCATTTTTACCTTTAGATGAATTGACAAAACTGATATACTGAGAAAATTTGGCACTAATT
GAAAATACGGATGCTTGAACAGATCTTTTACCGGTTTTGCTATGAAAAGTATCCAATCCTACAATCATAGTCGGTGCCAT
TTTAAGATTAATACCCCATGGGTCGTATCCTAATTTAGAAAACATTTGCATAACTGATTTATCTGCAACCGTTTTACGAC
GTCGATCATCTCTATTACTTCCGTTTCTCTGCGTCACACACTGAGTCAATAGACCTGTAGACATTGTAAAATTCTTTACT
TTTGCGTAAACTTTATCATCAGGAATGAACACTAATGCCATATGTACCTTGCTTACACGAATAAAATCTGTTAAAGCGTC
TTCAACTTCATTGGATCGACATGAAGATATACTGTCCATTGTGTAATTGATTCTTAATCTTCCTATTTCTCTTTTAACAT
CTTCAATAAAATTGTTGAAGTGACTAGGGTTTCGATCAACAACCAGTACACCAAAACGATGAGCTGTGCCTTTAGGAACG
TCAAATTTAATTTCCCCAAACTTCCAATCATCAGGGATTTTAGTATTAATTTTAACTTCGTTTGAAAATATATCAACTGG
AGCCAATTCACGACCACGAATCGTAATCGGTTGTTCTTCAATACACATCCCCCAGCTCTTCATATAATCTTTTGATTTCC
CAGCTCCGGTCCACTTACAAAAATCTCTTATGTCATTTAATCGTTCTCTAGGCTCACGTTTCAATACGGTTCCTAAATTC
TTTTGCAAATTTATATTACTTCTTTCACTATCCGAAAATCCACATAAATAGCATAATTCACCTGGAATTGATAAACTTTG
ATCTGTTTCTGTAGGTCCTTCAGGTTCATTTTCAGTTTTTTTCTTTTGGGCGAACCATCGATCGCTTGACTCGCGATATA
ACAAATGGTTGTTTGTCATTTTTCAAATTAATGTTATACCGTTGCTTGAAATAATTCAAATAGGATATCTTTTTATCGCC
TAGCTGAACCTCGTCATTAACATCCATTTCTTTAATATCTGAAATTCTATACGTCTTGTTATTATACTTGGTAATTATGT
CCCTTCCTATTAATTGATCAATTTGATCTCGTCGATACACTGATACTACATTGTTTTCATTTAGAACACGATTAATTCTT
TCAAGATAAAGTAAAGTCGAAGCAGTTCCATTTTCATTTGTTCCTCTTGTAATTGTAGTAGAATACCCTCCTAATATCTT
GAAATTGTCCATTTTAAAAAAGCTAGGTCCTTCTCGAATACCACCACTTTCACAATTTGATCCCAGAAAAAATTGTCTAC
CAATTTTTTCTTGTCCCATAAATATTTGAATATTATTAAATACAATATTTATCATCTGATAATATTCTTCAGAATTTTTT
AAAAACGTCGTCAGCAATCGTATGGAAATTTCAACATCTTTGATAACTAAGTTTTCTGTATCTTCATCTGAGTGCCACTT
AGAAGTCGTAAATAATCTTCTGCCATCAAAACAAAATGGTTGACCATTATTTTTGCTGTTTGCATAAGCTAATAATAACT
CTAGCTTAGTACGGATACTTTTATTCTCCATAACTACATCATACATGTAAAATGGTCCTTCGACTTTAATATTAAAGTTA
GCGTAGTTAGACTTGAGACTAACTACTCTTCCATCTTTCCCTATTTTGTCTGTAACTGTATCAGGCTGTAAAGCAGGTTC
AATAATTGCGAATCTTCTTTGGAGACCTCCTCTTCTTGGTCTTAAATTGGGATCACTTGTAACATTAGTTGAATCCATTT
CGTAAATTTGAGTAAAAATGTTAAAACAAAGACTTCGGTTTAAATAAACAAAATATACTATGTAAAACGATAAATATAAT
TGCTTTAATGGTTTATGATTTGTATTATATAATAATAATAATTTAATTTCCCTGTGAATATTATATTAAAATATAGTAAA
AATTACTCGTAAATGTGTGTTAAAGTAATAGGATTAAATTAAAATAAACATTTTACGAAATAAGTTCTAGTCAATTATGA
AGTCTTTTCT
>SMED30004304 ID=SMED30004304|Name=Proliferating cell nuclear antigen|organism=Schmidtea mediterranea sexual|type=transcript|length=907bp
CTAAAAGGTAATAATTTAAATTTAATTAGAACATTGTTTTAATATTCGGTTATATTCTCCATTATTCTAAATTATGTTTG
AAGCAAAATTAATAAAAGGCGAAGTTTGGAAAAAGGTTATAGAAGCTATAAAAGACTTAGTACAAGAAGCAACATTGGAT
TGCTCAGAAAATGGAATTAGTCTTCAAGCCATGGATACATCTCATGTGTCCTTAGTTAGTATGCTTCTTCGAAGTGATGG
TTTTGAGACTTATCGATGTGATAGAAATGTCAATCTCGGTCTTAATATAACAAGTGTTTCAAAAATTTTAAAGGCGCTTG
GTAGTAATGATTCCCTAACAATGAAAGCCGCTGATTCAAGTGAAACAATTTCGCTTTTGATAGAATCTGCAAATGAAAAT
GAATTATCTGAATACGAAATAAAATTAATGGACTTGGATGGAGATCACTTAGGTATACCAGATACTGAATATAAGTGCAT
TGTGAAAATGCCGAGTTCAAAGTTACAAAGAATATGTCGAGATTTAAGCCAAATTGGAGAAGCAATCACGATTTGTGTTA
CTAAAGATGGTGTAACTTTTGCTGCTGCTGGAGATCTAGGAAAAGGAGCTATAAAACTTAATCAAAATTCTAGTGCTGAC
AAAGAAAATGAAGGAGTAACTATTGAAATGACCGAACCTGTTTCGATGACATATTCATTGAGGTATTTCAATATGTTTAC
AAAGGCTGCACCTCTTTCTTCTCAAGTATCTCTGTCGTTGACTGAAAATGTTCCAGCAGTTATTGAGTTCATAATCGAAG
ATTTGGGATTTATTCGATATTACCTAGCTCCTAAAATCGAAGACGACGAGTGAAAGTTTAACTATTAATGTTGTATGTTT
AATAGATGTTATTTTGTTTAAAAAAAA
>SMED30013909 ID=SMED30013909|Name=tud-1|organism=Schmidtea mediterranea sexual|type=transcript|length=2414bp
ATTTAGAAAATGGAGGCAACTTGCGATGTTTTTTTAACGAATTTACCTAAGTCGATTAATGAAGTAGTTGTGAAGAACTT
ATTTTCTTCTGCTGGGAAAGTGTTAAAAGTGAAAATAATAGATGACAAAAGAAACGAAAATCAGAAGCTATGCTTCGTTG
GATTTCGAACTATGGATGAAGCATTAGAAGCCGTCAGAATTGCAGATAAATCTGATGCGTTTGGTGATCCAATTAGAGCC
AGTATATCAAAGAAGTGTTTAGACGGAATGGAGAATAATCAAAATAGATCAAATAATAACAGAAATGATTCAAGTTATAA
AGGAACTGATTCATTTTCAAGAAAGAGTGATTCTAATTTCAAGGATAGTGAAAAGTATCCAACAAACAATGGTGACTTTG
CACAAGTAAATCGTTTAAACAACGTTGGAAGAGGAAGAGGAATCCAGACTAAAATTATTAGTGGTCCACCTTCATTCAAA
ACTAATGAAATTAAGTTAAACGATATTAAACTTAAAACAAAAGAACTGATTGACATCGAAATCGTCGATTTAAGTAGAGT
TGACATTATACTTATAAGGCCAGTAAAGTCAACGGAAAATTCAAAAATTGAAATAGCAGATTTATTGTCACAAATAAATT
CAAATAAATCGAATCTAATGCCAGTTGACTGTCCTAAAATAGGAGATTTTTGTCTTGCAAAATGGACTGAAGATGATTGC
TATTATCGGGCTGAATTGTTAGATATATTAAAGGATGGATCTTTCAAAGTTACTTTTGTTGATGAAGGAACTTCGGGTGA
TATTGTGACTGATTTGAAACACATTCCGACTGGTGCTTTACAGCAGTATCCTAAACAATTTTTGAAGGTTTCAATCGGTT
GCTCAGACGCAAAAGAATTAATGTCATTTATTTTACAAGAGTCTGAAGGAAAGGTGATTAAAATTTATTGGCTCGGAGAA
TATTGTGATTCCGTGCCTGTTGTAAATTTATTTCTGAATGAAGATGAAATTGTGGAAAAATATACCCAAATAAATAAAGT
AAATATCAGGAAAAAATTCTCACAGACATTTGATGATCTCCCAGTACATAACCTCGAAACTAATTCACATTTTTCAATAG
CACCATCAATGTATAAAAACCGAAATGATTTTATTCTTCAGATGAAAACTTTCTCGGTATCTTTAAAGCAAAAAAAATGT
CCTACGGTTTTACCAATTCCTGGTGATATATGTATATATGAGAAAAGGAATGCTAATGGCGAATCATTTCTTCGTTGTGT
TATATTAAGGCGCCAACTTTTTTCTTTTGACATCGAGTTAATAGATATCGGTGAAAAAATAATGAATGTTAATATTGATC
ACCTGTACACAGTCGAAGATATTCATGTAAAAGACGCTCCCTGTGCTATTACTTGCGATTTAGATAGTTCTATTAATATA
GATGGTATTAAGCTCCCTCAAGATTTGATCGATGGTGTTCTCTTTAATCTTAAAAAGTACAACAAAAATAATAAATACAC
TGTAAATTTCATTTTACCACAAAAGAAAGCTTATGAATATGCAAAAGTATCATATAAAGATTTGATTGGTAAAAGCTTTA
AAGTAATAATGTCGCACGTTGTCTCTCCCATTAATTTCTTTATTCAACTTGATGATGGAGAGCATCAGCTTGCACTTGGA
GATATTCAAGAAAAATTAAATATTAATTATAATGGATCACCATTCAAAAGTGCTAGCGATGTTAAAGAAACTCAGGCAGT
TATTGCTCCTTTTATTGTTTCCGGAAGTGATGCGGAACTTTTTCGGGCTTATGTTTTAGAGAAACGAAAGGAATCTCCAC
AAATTCATGTATTGTTTATTGATTATGGTAATGATGAATGGGTGAATTATGAAACTTTACTGAATACAAATGAAGAATTA
GTTTCTAAACCAGGTTTCGCAATACATTGTAAATTATCTCTAAATATTAAGAAGGAAGCGTGGAGTCACGCTATTGAATT
ATTTAATGATTTAGCTGGTTATACTGAAAATGACCAGGGGACGTTTGTAATGCAGGTTATTAGTGTCGATGGTGATTCGT
TAGTTGTGGACTTGATTTCAGAACTGAAAGGTTCGTTGACGGCCATCTTAGAAAAAAGTGGTACATGTGTAAAGTCCAAT
GAACCAATATGTAATGGAGGAGGACCCCAAGTTAAATTAAATGGCGTTTCAAATGATAAATCTCAATCAGCTATTCTTGA
AAATTTATCTGAAGGAGAATTATATAAAAAATTTATTGAACTAGAACGGAGATTAAGTGCTTTAGAGATATTGATGAAAT
AATGCTACCCGCGCAATTAGTATTATCAAATTATGATAATCTAGTCTTGATGTGTTTAAAATTTTGTATTTTAACATAAA
TTTATTCCGTGTTG
>SMED30025482 ID=SMED30025482|Name=Histone H4|organism=Schmidtea mediterranea sexual|type=transcript|length=552bp
TGTCATTATCAAAATATTTTCAATATATAATAAATCAGAAATCACTAAACAGTCATTACTAAACTATTCTAACTCAAAAT
GTCTGGTCGAGGAAAAGGAGGAAAAGGCTTAGGTAAAGGTGGAGCTAAAAGACATAGAAAAGTTTTGCGAGACAACATCC
AAGGAATCACGAAACCAGCTATTAGAAGGTTAGCTCGCAGAGGTGGCGTGAAAAGAATTTCTGGTCTTATCTATGAAGAA
ACTAGAGGTGTTTTAAAGGTTTTCCTTGAAAACGTAATCAGAGATGCTGTTACTTACACTGAACATGCTAAGCGTAAGAC
AGTCACAGCTATGGATGTTGTTTATGCACTTAAACGACAAGGTCGTACTTTATACGGTTTTGGAGGGCCACAAATGTTGA
TTGTAGTGAATTGTTCAAATATTGTTATTCTATCTAGTAATTCTCAGCAATTTTATTAACGTTATTTAGAAATTAATTTT
ACAATTGCTAATTTCGAATGTTATATCTGGTGTCAATGTTCAGTTATATTATTTTACAAATGACTTGAAATG
>SMED30022389 ID=SMED30022389|Name=Proliferating cell nuclear antigen|organism=Schmidtea mediterranea sexual|type=transcript|length=915bp
GTTATTAACGTTATTGGACTATAGTTTTATTATCATAAATTTTTGAATAAAATTGAGATCTTCTTTTAATAATGCTATTT
GAAGCAAAATTAAATAAAGTAGATGCATTTAAAAAGCTGATTGATTCGGTTAAAGAATTAATCCAAGAAGCAGTTTTTGA
ATGTTCATCCAAAGGTATTGAATTACAAGCAATGGATAGTTCACATGTTAGTCTAATATTTCTTTTAATTAAAAAGCAAT
CTTTTTCGTCTTATAAATTTACGAGAAATGTATCTTTGGGTGTAAGTCTTGTAAGTCTATGTAAAATACTCAAACTTTCT
CAAATTAATGATTCAATTACAATTAAAGTTGATAATGAATGTGAAACAGTCGAATTTGTTTTCGAATCATCAGATAGTGA
TCGAATGTCTGAATTCAGTTTGAAGTTAATTGACTTGGATATTGACTGTTTAGCTATTCCGGAATCAGACTATGATTGCG
TAGCAACAATCCCGTCTGTAGAATTTAACAAAATATGCCAGCAATTAGCTGTTATTGGAAGCACTGTAACAATTGTAGTA
ACTAAACAGTCAATTCAATTTTCTTGCTCCGGAGACATGGGGAAAGGGAAAATATTATTAAATCAAACTGTAAATAAACC
GAGAATAGAAGATTCTATTAATATTGAAGTTGTTAATCCATTATCAATGGTTTACTCGCTTCGATTTTTTCATATATTCT
CGAAGGCCTATTCGCTTAGCAACAGAGTTTCTTTATCTTTTGCTAATAATTTCCCAGCTTTGGTGGAGTACAGCATGAAT
GAATTGGAAGGTCATCTACGATTTTACTTAGCTCCAAAATTAGATGATGATTGATTTTGCTCTTTTTCTAGTTTTGGGGT
GATATTTTAATTGTAGTGCTTTTTTAGTATGGTTA
>SMED30019097 ID=SMED30019097|Name=SOXP-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1596bp
GGAATAACAGCCAATTAGGGATCAGCTGCAATTTGGCCTATGATTGGACATTGATTTTTATAGTCTCAGGCGTTCTCAGC
TTACGTGTGCACCTTTTTAGTGGACACGTTAAATTTGATAGGTGCTTAGTGGTGTTGATTCCTGTTTGGAAACTGTATAT
AACCAAGGTTATTTGTTGCTTTGAGACAAATGCAACACAATCAAATAATTAATTATGCTATGTTCAAATTGTTCAAACAA
TCAGGATACTTTGAAATTATGGATGGTCCATTTAGCTTCTTGTCACCCATTACCTCCTGAATGGCTTAGTGAAAAGGCCA
AAGTATTAAATGATGACGAAAATCAGCGCCCCTATACAATTGTCACTGATTCCCGAAAAAGAAGGCGACGTCCAACCACA
CCAAGACCACTAAATACGTTCATGATTTTTTCGAGGCATATCAGACGAAATATTCTCTCAGTGTTTCCGGATGCATCAAA
TTCCCAATTAAGCAAAGAGCTTGGAATTTTATGGAAGAAAGTCACAAATGAAATTAAATCCCTTTATGAAGAAGAGGCAA
AGCGATTGGCTCAATTACATGCTCTTGAATTTCCCGATTATAAATATCAACCAAAGAAACGAGTCCGAAGATTTGGAAGA
GCGATTTATGATCGACAGCCCTGTACAACAGAAAGATCTAACTCAACTAGTGCAACAGACGAAGAAAATGGTAAAGACAA
TAATAGTGTTCAAGACGGTAGAAGATCAAGCGATATTGAGAATCAGTATATAAGATATTCAGTTTTGGGTAAAAATATTG
TAAAACGAGAATGTCAGTCCTTTAATAGTCCTTTAAAAAGCGACAACGTTAAATTGGAAACGCAAGAACAAGATTTTATC
CAAGCGATGCCCAAACCTCTAAACGTCCGAATAACGAATTACAACGAAAACAGTATATTTTTACGACAACAAAGATTACC
ATCAAGTAGCACAATGTATTTACTTCCTTCAGAAAACCTAATAATTAGTAATGGGATTATGGGATCACAGGACTTGGGTG
AGGATTATTGTAGAGAGTTGTATATAATTAATGATTTTTTCCCAGAAAATGTAAACATAGACGATGAAATTGATATAACA
GGAAACATTTTTAGCAATGATTTAGATTTAGAGTGGTCTGAAATTGATGAAAATTACAAACAAGATTTACCAAATCTTAA
TTCATTATTTCAACACTAATATATTTGATTTATAAAATATTTAAATATTTTTTATTAAACAGTCTTTTACATGTACATAT
AGTATTGGAACTCTTCTCTGACTTATAAGATAACAGAGATATTGTAATAAGATTAAATTGGTTATGTGTTTCGGTTTTTG
TAAGATTGGTAATTTTCAGAAGAATTTAGACTTTTTTCATGGAAATTGGAATTGAGAAACAAACTGAATAAAGAAACAAA
TTTTTGAAAAAAACGAAACAGATACTTATTATCAAAAGAAAATTATCTGAAGCATCGAGTCGGTATGAAAAATAAACTAA
TTAGTCAGAAAATTTTTGATGAAATAACGTCTAATGAAATTAAGATCTCCAAGGAATACTTTTTCTAACATTTGAT
>SMED30029163 ID=SMED30029163|Name=Histone H4|organism=Schmidtea mediterranea sexual|type=transcript|length=537bp
AGGTTACAGTTTTTCAACTAATACCTCAAAGAAATAATGAAAGATGGACAGTAGAGTTTTGTCACCATCAGGAGACCAAG
TGTCATTTAGGATGATAATAGCCCAGTTAAGGAATCTTGCTGATCTAATCAATGCCAAAAATATTACAAAATTTCGATTT
AAAAGAAGCTAAAGGAGAAAAATTACACGGAAAAGTTCAGAGGTACAACATCCAAGGCATCCCTAGGTCTGCAATTAAAC
GATTAGCACAAAAAAGAGGTGTGAAAAGAATTCATGGGCTTATTTACAAAGAAACAATATATGTTATCAAGTTAGTCCTT
GAAAATGTCATCTTATATGATATTAAATACACATTGCAAGCCAAGCAAGAAACTTTTACTGCCAAGGATGTTTTTAATAT
TCTTGAATGTTTGGAGTTTTCTATTTTGTGATAACATCCTTCCCCAAATGAAAGTTATCAGATCATTTTGCAAAGTTTGT
GAGAAGGGATATATATTTACCAACAAGAAAAATGTTTTGAATTTAAGAATAGGACTC
>SMED30014446 ID=SMED30014446|Name=SMEDWI-2|organism=Schmidtea mediterranea sexual|type=transcript|length=4773bp
ATTTAATTTTCGAAAAAAAATATGGAGGAAATACCAGTAAAAGTAGCTAAACTTGAAGCGAATGGAAGTGAAACAAGAGG
TAAAATGGGAAATCGTGGTGGCCTGAGAAGAACATTTAGAATTGTTGAACCTAACTTGCAACCTGCTGATATCACTGAAA
AAACAGGAAACATAGGAAGAACAGTTAAATTACAATCAAATTTTACCAAATTCTCTGTTTTGCGTTCAGAAAAGTTCATG
ATGTATGATTCCGTGTTTTCTCAAGTTGGTTTGTCACCCAAAGTAAAATTACAGTTTATTGTTCGAGTCTGCCAAGAAAA
TAAATTGCCAGGGGCTTTTTGTTTTGATGGAAGACGTCTATTTACTAGTGAAAAATGGCATGGAGAATCGGACATTCAAG
AATTTAGTCATGATGAAAAAAAAATGACACTAAGATTGGTATCAACTATCCTTCCTGAAACTGAAGAATATTACCAAATG
ATCAATGTATTACTCAATAATTTACAAGTAATGTTAGGTCAAGAAAGAATTGGTAAAGGTTATTTTTTAAGCCCAAATAT
TACAAAAGATGAAGTTCCCCGTAATTCTGGACCGACATTTTTTGAAACCAATAGTTTTAAAGTTCTTGGGGGCTTTGGTA
CAACTTTACAAAGAGGCACAAAACCAACTGGTGAATTAACCACTCTTTTATATATTGAGCGTATTAACAGAGTATTAAAC
GATAACTCTGTTATGAAGGCATACAACAGAAGAAGTATCGATCAGTTGATAGGCAGAGATATCATAACAAAATATAATAA
CAAAACTTATAGGATAAGTGAAATAAAAGAAATGAACGTAGATGAGAAATTTGAAATGGGTGGTAGAACTTTATCGTATG
CCGAATATTTTAAGGAACGATATAATATTCGATTAACTCAAGGCGATCAACCATTTGTTCTAACGCGAGTGAAGAAACCA
ATGCGTCGAGAAAGAAAGAAAAAAGACGAAGAAGGAGTGGAAAAAGAGAAAGAAAAAGAACGCGAAAAAGAGGCTCCAGA
AGAGAAGGACATGACTCTCAATATTCCTGGAGAGTTGTGTTTCTTATGTGGGTTTTCAGATCAAGAGAAATCGAATATGG
ATCTGCAGAAGAATTTAGGGTGCGTTTTAAAAAGAGAGCCACGTGAAAGATTGGATGATATACCAGCTTATTGTAACTGG
ATTAAAAATAGTGATGCGGCAACTGGAATGTGCAATAAATGGCAGCTGAAAATAGATAACAAACCATTAGAAATCGAAGG
TAGAGAATTACCTCCATGCGATGTAATAAGTGGTGGCAGCAAAATTAATGAAAAAATGGGAGATGATTGGAAATTTGGTC
GAGTTCAATTTGATATTAAGCGTGATCGTAAGCATGAAATCGATGTGGTCATCGTTGATCGAAATGACTTTCAGTATAAA
AATTTTATGAATGATGTGGAACAAGAATTAAGAAACATGAGAATTGATGCTCGAGTTGGAAAGGTTAATACTTGTGGTCC
AAATGATGTTGAAAGATGTTTGAATGATGCCGCTAGAAGTGGAAGTGGGTGTGCTAAAATGGCGCTGGTATTCGTCCCAG
ATGATAGAGTATATGCCAAGGTGAAATCATTTACCATGAGTACTGGTCTTTTAACCCAATGTGTAACAACACGTAATGGT
ACTAATAGAAACGATAAACGAAGAAAGGTGGTTTCAAGTAAAACCGTGATGCAAATATTTGCAAAATTCGGATATGATCC
ATGGACAGTTGAAATTAAATTGAGACCAACTATGATTGTCGGTATGGATACCTATCATAACAAGTCCAGCAAGAAATCAA
TTCAAGCATCTGTATTTTCGATCAACAGCACATTTACACAATATATGAGCTTTGTTAATTCTCCTAAAGGACGTCAGGAA
TTCCACGAAACTTTAGGCAAAAATTTCAATTTAGCGTTAGAAGATTTCAAGAAACGTTATGACATATTGCCCCAGCGAAT
TTTAGTCTTTAGAGATGGTGTTGGAGATAACCAACTTCAATTTACTAAAAATTTTGAAGTTGATGCAATGAAACCGCTTA
TTGAAAATATATACAAAGGCAACGGATTCCCTGTTCCACAAATCATTTATGTCATCGTAAAGAAAAGAGTCGGCACTAAG
CTTTTCAACAGAGGAAATAATCCAAATCCTGGAACTGTTGTGGATAAAGAAATTGTCAAACCGAATTTCTATGAATTTTT
CCTAGTTTCACAAAGAACAACGAAAGGAACTGCAACTCCAACTAATTATAATGTTTTAGAAGATACTCGATTGCTAACGA
AAAAAGGTACTATGGATCCTATGGCACCGAATGAGCTGCAAAAGATTACCTATGCTCTAACTCATTTATATTTCAATTGG
ATGGGAACTATCCGAGTTCCGGTTCCAGTGCATTATGCGCATAGATTGGCTGAATTAGTTGGAAAGGTGCATAAGGGCTC
TAATCCCGTTGCCATTAATGAAAGAATAAGAAATAGGCTCTTCTATTTATAAAAAGATCAAAACTTACATTTTTCTGTGT
TGATTACTATCCCAATTGTGGATTTAATTGTTTCTGAAAGCTGTTCATTCAAATTCTTCTGAAATCCATATTGATTCGTA
AGCAGCCTGTATTTGAATACTAAAATTGATAAAGTAGTTATAAGTATTGTAAAAGTATTAAATATTTGTTTATGTTATTC
GTAATACACTTGGGTTATTGCAATGTTTTAGTTGTTTTTCAATGATAATAAAGCTTAGCTGTATAAATTCTTTTAGGTTT
TTTAGAAGGTTTATTTATATCGTGTAATTGATTGTCGTGTTAATATTAATTAAATAAAAGTTTGATGTAATTGCTTTGTG
TTACGCATAATAAATCTTACGAAATTTCTGAATACAACTGCTGGTGATCGGGATATTGAATGCCGGGTCGTTTGAATTAA
TAATACAAATGCTTTCGATTATTGTCATTAATATTTTCTCCAGTGCGTAATGGGCCAGAGTTCCGGTGCCATGATTAATG
GTTCCTAAATTTTAGAAATAACATTTTGAATGACATGTTAAATGTGTATATAATAAATTTTCTAGTTTTTTTGCTAAGAT
TTTGAGAAATTTTAGTTACCTGTTTTTGTTAATTGCTTTGATAATTTCAATGCTGACACGTGCAGAATTTCACACATCTC
CAGCAGTCGACTGAATTCTTGGATTTTGTTTGATACAATTATGCTTGCAGATGTTATGGCGCATAGATCCAAGAAGGCTG
TGAATCTTGGGTCTTGTTTTGTAAAGGAAGCTTTGTAAAATATGATGGGACAGTTGCACATAAATTCTAGGAATCCAGAT
TTTAGGCAAGATTGAAGTAATGTTGAATGGTTCTATTATAGAATAATCAGTTGCACTTTTAGATAACCAATATACCACAA
AGAGCCATCCGCAAATTTTGAAAGCCCAAAGCATTGAATCGTTGTCTATGTTACTCAGTATAGACAGCAGTAAAATGGCG
CTTTTTTGATATTGTAAACCGAAATGATTACTAGAATTCATTGTTTCGTCAAGAGATTTCGCGAAACTCTGAATATTATC
TGATTGATTTGATACTATTCCTTGGAGTTTACAAATTGATTTCAGTTCCAAATTCATACTATTGTGTTCTGCTGATTTGC
TACTATTGGAGCTCTATAAGGAATTATTAGAATCAATTTTGGTTTGATAGTGGGTTTTGCAATCATTGGCTTATTGTGGG
TTGTGTAACCATGGAAGTAATTGTGAATAGTTATAGTGCTCGCTCTGCATAAAATAATATTTAATCAGTGCTTTAAAGTA
GATTTTTAACGATTATTATGAAAGATTTCTCTTATATATTAATGTTTTTGTATCCTTCAAAAGTTTACTAAAAATAATGC
ACATTTGAAATTTACGCGTTACCATAAAATGTCTGAAGTGGTCCAAAGCAATAAAAGCTTAAAAAGAAAGTTCTTGTTTT
TAAATGTATTGGGATATACTCCCACTAACCTTCCGTACTCCGCTGCCTCCCTTCCCATCACATACAATATTTGCTAGTTC
TACTTACAGAGTTGAAAATCGAAAAATTTTCCCAGTCAATGTCCATGATTATGCTGAATAAATTTTGTCCGAACATAATA
GAGATTGCCTCAGCCAGTATTTCTTTCGTTGTTGAGTTTTGATGAATGACATGTGAGACTAAATTTATGGACAACCATTG
ATTTTGGTTTTGCTGAAGTTGAGACTTCTTACGGTAAAGATAAACACGAAATAATGATAAACTCTAATCAAAAGATATTA
CAAACAAATATTATGATATCAAAACCTTCTGTCGAACCAAGGCACTTGTGTGAGATAATAAATGAAGAATGAATTCGAAA
AAGAAGTCATAATTCGAACATCGCTCCAGAATGCTGTCACTGACTTTGACTTCAATCACATTTTCCAATATTGAAATCAG
ACCGGCGATCACATGGACCCTTGATGATTCAGACTGACCACTGATTACGGGTTGATCGGTTAAATTATCTAGAGATTAAA
ATAATAGTCGGTAAAGGAAATTATCCATATAAACGGGAAACAGAAAAGTTTTAACCATGGTTTCAAAAGCTTTTGGGACT
ACCCCCAGCTTTGCAAAACAATTTTTTAACGCTCTTGTTATGACTTGAATCAACATTGTACAATTGTTACAATAGACTTG
ATGATTTACTTATTTACACCCCATCTAAATTGTTTCTTAACCCTTTGCCACCC
>SMED30000837 ID=SMED30000837|Name=Histone H4|organism=Schmidtea mediterranea sexual|type=transcript|length=1387bp
ATTAACACTAAATTTTGTTTATATAATGATTAAATATTTCAATAATCAATTAATTGAAAAATGTCTGGTCGTGGTAAAGG
AGGAAAAGGGTTAGGAAAAGGTGGAGCCAAGCGTCATCGTAAGGTTTTACGTGATAACATTCAAGGAATAACTAAGCCGG
CAATTAGAAGATTAGCTCGTAGAGGCGGAGTAAAAAGAATATCTGGTTTAATTTACGAAGAAACTCGTGGTGTTCTCAAA
GTTTTCCTGGAAAATGTTATAAGAGACGCTGTTACTTATACTGAACATGCTAAGCGTAAGACAGTAACTGCAATGGATGT
TGTTTACGCTCTTAAACGCCAAGGAAGAACTTTATACGGATTCGGAGGTTAAATGTGAAACCAATGATATTTTAAGCTAA
CATTTATTTGTTGAGAATGTTTATGGTCCTCCTTAGGGCCACAATTTTTGATTGTTTACTTTATTTTGTTAGCATTACGT
AATTTTACAGTGATTGGTTATCTTGCTGGTTGTCTGAAATATTAAATAATAATATGCTATAATTAAATGATATTAGTATA
GAAAACAAAAATCGGTTTTATTGTTTGATCAACACAATGAATATGTTTATCAATTATCATCATTTCCAGTTTTTCGATTT
CAGTTGATAATAATTATTTGCGAATTTGTGATTATATTTTCTAATGGGTTGCGAGACATAAATGAGCGTGCAGATATCAC
ATGCGAACCTGGTTCATGTAGTGTTTTGAGCTACACACTGCAGATAGACGATCAAATCTATAAAGTGAAAAAAGGGTTCA
AATCAGCTTGCAGCACCAGACTATGTGAAAATTGTGCTCACAAAGGTGATTGGTCAATGAGACTGATTGACGGAAACAAA
TATATGGTACGACAAGTCAATAAATGTTTAACTAATAATATTTTGGCAGTTGAGCAACTTTTCACAAATTTATATACTCC
TGTCTCAGATTTTACATGCTCCTTGCATAAGTGCTCTAAATATAATTATTCTTATAATGGAAATATGATTAGCTTTAGCT
ATATAGGAGTTTGTGACCATTCTTACTGTGACTCATGCCGCTATTCCGACAATTGGAGTCTATTAACCGGATATTTGCAG
CGGACGACCATTTCATGTTATGTTGTCGATAAAATTAGACTTGAAGATTATTTTCTCATTCCAGAGTTTACCGAAACCTT
CTATACACTAATTCGGAAATTAGCAATAACTATAAGCTGCGCTTCATTTTTGTGTTTGGTGATCATTCTTTTGGTTTGTT
TTGCTAAAAAATGAGATCTTACAGAAGCTTTAAGGAACTTAATTTTATTTAACAATATATTTATACTTAGATCTAATGCT
TTGAATGATCCTTTCGCAAGTCCATCC
>SMED30033466 ID=SMED30033466|Name=Histone H4|organism=Schmidtea mediterranea sexual|type=transcript|length=421bp
GATCTCACTATATAAATAAGTATTTGTCCCTATTAATTCATAACAATTATTCAACATGTCTGGTCGAGGTAAAGGAGGAA
AAGGACTAGGAAAAGGTGGAGCAAAGCGTCACAGAAAAGTCCTTCGTGATAACATTCAAGGTATCACAAAGCCAGCAATC
AGAAGATTAGCTCGTCGAGGTGGTGTTAAGAGAATTTCTGGATTGATATATGAAGAAACCCGAGGTGTTCTTAAAGTATT
CTTGGAAAATGTTATTAGAGACGCTGTGACATACACTGAGCACGCTAAGCGCAAGACAGTAACTGCCATGGATGTCGTCT
ATGCTTTGAAACGACAAGGAAGAACTTTGTACGGTTTTGGAGGTTAAATAACACTTTCATATTTGTGAATGTTTTAGCGG
CCCTCTTTAGGGCCACAAATG
>SMED30014692 ID=SMED30014692|Name=Histone H4|organism=Schmidtea mediterranea sexual|type=transcript|length=464bp
AAATCTATATAAATCTTATATGAGATAAATGTCAGGTCGAGGAAAAGGTGGAAAAGGTCTTGGTAAAGGAGGTGCTAAGA
GGCACAGAAAAGTATTGCGTGATAATATTCAAGGAATCACTAAACCTGCAATTAGACGTTTAGCAAGAAGAGGTGGCGTT
AAACGAATATCTGGGCTGATTTATGAAGAAACACGAGGTGTGCTGAAGGTTTTTCTGGAAAATATCATCCGCGATGCTGT
CACATATACGGAACACGCGAAGCGAAAAACCGTGACTGCAATGGATGTTGTTTATGCTTTGAAACGTCAAGGTCGAACTC
TTTATGGGTTCGGTGGATAATCATTTTGTATTTTATTATTTAATGTTGTAATTGCTATAATTGTTGCTAGTATTAATCTT
ATTTTAATAAATTATTTAACTGGATTTTAATTTAAATATGTCGGTTTTGTAAATCCAATTTGTA
>SMED30001362 ID=SMED30001362|Name=SMEDWI-3|organism=Schmidtea mediterranea sexual|type=transcript|length=3093bp
AATTAAGAGACAGCCATTTATGTTTATTTTTAAAATAAATAGTATATATTTAAGTTTCGAATTTTCAGCTACAATTTAAT
AGTACATAATTATACGATGTCAGGAAGTAGTGGAATAGGTAGAGGCCGCAGTCGTGGGCTGTTGATGCAAAAGTTTCTGA
ATAAAGATGTTCTTGTTCCTTCTGTTGAATCTTTAGAAGACAAAGCTCTTAATAAGCTAGGAATTCCACTTCCTGGGTCT
ACCGTAGAAAAAAATACAGAGTCAAGTTCTATATCAAGTGGAGATTCAAGAAGTAATCCCAGTGGAGATTCAAGAAATAA
CATAAAACTACAAGATAGTGATATTGAGAATCGCAATATTACCATTGTTACGCGACCATTATCCTGCATAGGCAGGGGTC
GGGGTTTAAGCAATCCCTCAAGTTTAACTACGTCATCGGGTAAATCGGATAAAATTACTGAAAACGAAGAACCTGGTCAA
ATTAAAAAGTTTGTAGGTCGCGGTAGAGGATTGTTGAATTCTCAGAAAGAATGTTCAAACTCTACTCCATCTGAAGTTTC
AAATGAATTGAAACAAATGAAAATTTCAAATGATGATAAAATGACGGTTTCTTCAGAAGCAAAGTCACAATTTGAGAACA
TTGAAAAACCTATTAGTAAATTTCGTCGACGCGAATATCCAACTCAAATAAAAGAACCATGTAATACAAGAAATGATTCA
TCGCCATCTTTAACTTTAAGTGCTAATTACGTTAAAGTTAGGACTACACAACCCCATATATATCAATACCATGTTTCCTT
TGCACCTCCGATAGATTCAAGGTTGATGAGAATTAAAATAGTTCAAGGGTTATCAGAATCAGATTTAGGGGTTGTCAAAG
AAGCAAGAGCTTTTGACGGTATGAATTTATACATTCCTCAACTTTTAAAAAATAAAGAGACAATAATTAAAGTAAACAAA
CCGACTGATAAGACTGTCGTGGATGTTAAAGTAGTTTTTACTAACAATGTTAATTTTAGTGAATGTCCTATGGTTTATAA
TGTTCTTTTTAAAAGAATTGAAAATTCCCTCAGAATGGTTAAAATTGGTAGGGATTATTTCTACCCTGAAAAAAAGATAG
TACTTGACCGTAGAAGGATGGAAATATGGCCGGGATATGTAACAAGTATCCAAAATTTTGACGGTGGTTTACTGTTACAA
TGCGATGTGTCACACAAAGTTATTCGAAATGATAGTGTGTATGACATAATGATGGAAATTAATAAAACTGTTAACAATAA
AGGTCAAATGCAAACTGCTGCGATTAATCAACTATTGGGTCAAATTGTGTTAACTCCTCACAATAACCGAAATTATAGAA
TTACTGATATAGATTGGGCTAAAAATTGTTTAAGTGAATTCGATAAAGGAGGCGAAAAAATTAGCTACCGGGATTATTTT
AAGAACACGTATGGGCTACAAATTCGTGATCTAGAGCAGCCTATGATAGTTAGTAAATCTAATAGCAGATCTGGTAAAAA
CCGAGGTCCCAAAGGATCAAAAGAAGTGGATGGTGGATTGGTCTATTTAATTCCAGAATTGTGTATGCTAACTGGTTTGA
CAGATGACATGATTAAAGATTTTCGTTTGATGAGAGAATTACACGAGCATTGTCGAGTTACTCCCAAGAAAAGACACGAA
GCCTTACTGGAATTCGTGGATAACATATATAGCTGTGAGGAAGCTAAGAAACTTTTAGGGTATTGGGGTATAACGATTGA
AAAGGACACTGTCAACATAAATGCTTGTAAAATGAATCCAGAAATGATATATTTTGGAAATGAAGCTTCTGTTAGTGCTG
GGGAACAAGCTGAATTTAAACAAGCCTTGGCACATAATAAAGTTATAGGTGGTATTCGTATTGAAAATTGGATATTAATT
TCTCCAAAAAGTTTACTGACAAAAGCAAATGGTCTGTTACAGGCTTTAATGAGCAAATCTCCTAGAGTTGGAGTTATGTT
TGGAAAACCCAAAATAGTTGAAATGAACAATGATCGAACAGAAGAGTATTTAAAAGAATTAAAGAGAAATGTGGCTCCTG
GTGTGCAGTTAGTAGTTACAATTTTATCTGCTGTTAGAGAAGATCGATACAATGCAATAAAAAAATTTTGTTATGTGGAT
TGTCCTGTTCCAAGTCAAGTGGTATTAGCCCAAACATTGAAAGAAGGGCCTAAATTAAATAGTGTGGCAGTTAATATAGC
CCTTCAAATAAACGCAAAATTAGGTGGAGAGCTGTGGGCTGTCAAAATACCTATTAAGAAGTTTATGGTTGTTGGACTTG
ATGTTTGGCATGATACTAAAGGGAGAAGTAGATCAGTTGGAGCCGTAGTTGGTTCAACTAATGCGCTATGCACAAGGTGG
TTTTCGAAATCGCATTTGCAAGAACAAGATAAAGAAATTATGTACGTATTACAGTCGTGTATGTTAAGCCTTTTAAAGGC
TTATTTTGAAGAAAATAATTTTTTGCCTGAGACTATCTTTATGTATAGGGATGGTGTTAGTGATGGTCAGTTAGGATATG
TTCAAAAAACTGAAATTGAACAATTCTTTAAAGTTTTTGAATCGTTTAGTGCTGATTATAAACCTAATATGGTATATAAT
GTTGTTCAAAAGAGAATAAATACTAGGCTCTATGTAAGTGATCCGAAAAATAAAGGACAAATAAATAACCCCAATCCTGG
TACAATTGTCGACCATACTGTTACGAGGGCTAACCTTTATGATTTTTTTCTTGTTTCTCAATCGGTTAGGCAGGGAACTG
TAACTCCGACGCATTACGTTGTTTTATGTGACAATTCTAAATACACTCCGCATCAGGTTCAGTTGATGGCTTATAAAACA
TGTCATATATATTACAATTGGCCGGGAACGGTTCGAGTACCAGCACCTTGTATGTATGCTCATAAATTGGCATATATGGT
TGGTCAGAATTTGAAAGCTGAACCTAGTAATCTTTTATGTGACAGACTTTTTTATTTGTAACATATGTGTTTCTATTTGT
ATTATTGTTAAACTGCATTTCGTAAAATAAATTAATTTCGTTATAAAAAAAAA
>SMED30001900 ID=SMED30001900|Name=Bruno-like protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1713bp
CTTTTGAGGGAAAAATAATTCTTTTATTAATAATGTTTCATCATTGGAATATAAAATAAAATATTAGGAGAAAACATAAG
TTAACCAACAATATTAGCCACATATTTCGTTTAATTATTGGTCTATCACTTTTCATTTTAACCAATTGTCTTGAGATAAT
GGAGAGTTTATCCTTAATTTTTATTATAAATCACTGGTTTTGATAGACTTATTAACAATGGAAAATTATTTCAAACTTTT
CGTTGGTCAGATACCTCGAAATACACCAGATAAAGAAATTAGACTTATTTTTGAAGCTTTTGGACCAATCTTTGAATTTT
TAATTTTAAGGGACAAGAAAACTGGTTTTCATAAAGGATGTGCTTTTGTTACATTTTATCATAAAGACTCTGCAGAAAAT
TGTCAAAAGGCGTTACATGACAAGAAAATCCTAAACGGGATGAATCGACCACTTCAAGTGAAACCAGCTAAAAATAAGTT
AGCAAAAAATTCAAGTTTGAATGGGGAAAATCAGACAGAAGAGCAGGTTTTCAGTGATGAAAGGAAATTGTTTGTTGGAA
TGTTGAGTAAAAATCAAACTGATGAAAATGTACAAAATATGTTCACAAAATTTGGCAAAATCGAAGAGTGCACTGTATTG
AAAGACCAAAATGGAAATAGTAAAGGATGTGCCTTTGTCAAATTCGTGAACCACACCGATGCTTGTGCAGCAATAAACGC
TCTTCATGCCAGTCAAAAAATGGAGGGTGCTTCATCCAGCCTTGTGGTTAAATTTGCTGACACGGATAAACAAAAACAAA
TAAGAAAATTGCAGCAATATATTCCAGATTTAAGCATTTTAAATTCGCGCATTCCTATTAATATTCCATACTATTCACAA
TACGGTACAATAATTAATCCAGAATATAATTCAACAATTCCTTCAAACCAATATATTCGAAATTGTAACGAATATATTCT
TGCTGCTCAAATTCAACAAATAAATTTGTTTTCTAATTTATCATCGGTCTACCCATCTAATTCAATAGTGTCAATGCCAT
CCAGCCATCCGGTACCAATGATTGACTATTCTGTTCCTATTAACAACTTTCCACAAACTGACCAAATAACAATGAAACCA
ATTGTTGATATACAGCCAATACCTCCAGAAGCTGTACACCGAACCATCGTAACTCCAGGATCACTCTTATCATATCCTTT
TCTTAATGTTCAAATTCCTACAGTATATCCAAACGCCTTTTCCAATGGAAATTTAACAAGTACAACACAAAGTTCAACAG
ATGTGAAAACCACTCCTTTGCCAACAGGTCCTGAAGGCTGCAATCTATTTATTTATCATCTGCCACAAGAAATTGGTGAT
TTACAATTATATCAAATTTTTATGCATTTTGGAAACGTTATCAGTTCTAAAGTTTATGTTGACAGAGCAACAAATCAAAG
CAAATGTTTTGGATTTGTCAGCTACGATGATCCGGCATGTGCCAATGCCGCCATCAAATCTATGAATGGATATCATATCG
GAACAAAAAGATTAAAAGTTCAGTTAAAAAAACCAAAAGAAGCAATAAACGAAATGAAAAACTTCAATCAAATGTTATCA
TCAACTCCCGACATAAACCAAGTATTTTGTTCATCCTAATGATTGTGATATTTTACAGGATTTTCTCGACCATATTGAAA
GCCTGATTGGTGATATGTAAAATGACCCACCGT
>SMED30035063 ID=SMED30035063|Name=SOXP-2|organism=Schmidtea mediterranea sexual|type=transcript|length=2664bp
TGTACATTGAATTCAATATTTAATAGTGATTAACTTATCCAAATTTTCAGCCACTTTTAGTTTAATTTGCGTGTTTTGTT
GAGCAGTTTTTATTGGCGCATTTTATAAAAAATACAAAACCAATCCAAATCAGTTTGAATCATTGTCAGATTTTAGTCGT
GCAAGATACATTATTTCATTTTAATTCTCTAGCATATGACATTTAAACATGGAGCTGAATTACTCGTTGAATGATAATAA
TTTCAATTTACAATTAGAAAGCGAGTCCTTGACTTATTTCGATTTATGCCAAAAATGTTCAGCGTACCAAAATAGTCTTA
GAGACTGGATGAAACATTTAGTTGACAGACATCCTTTACCTATTCAGTGGATGAGTGATTTGGCAAATAATTTAACAGAT
GATAAATTATCTAAGCCATATTCGACCGTTACAGAATCCCGTAAAAAACGCAAGAAGCATATCACTCCAAGGCCATTGAA
TAGTTTCATGATATTTTCCAGACATTTAAGAAGAAATGTTCTTATTTTCTTTAGTGATGCTTCAAATTCAGAAATAAGCA
AACTTCTTGGGAAGTTATGGAATAACATTCCAGCTACCATTAAATCGATGTATGATAATGAAGCTAAAAAGCTTGCAATT
TTACACTCCAAAGAATTTCCTGAATATAAATATCAACCTAAAAAGAAAAAAAAACAATATCTAACGAAATGCCCCATTAA
TTCCACACCTTTGTCGAGTAATTCATATGAAAGTATTCAAGATATTAATTCAGTAACGGATACACTACAGAATTCATCTA
ACAACTTACAAAAGGAAAGTAATCCGACCTCTGTTTCGTCTTATGGAAGCAATCAGGAATGTAATAATTCATTTAAGAAT
CATAGTGTACAGTCCAGCAATTTTCCCAAAGAAATCAACCATAAACCAAGTAGAAAAATTGAAAAGCAATCGTGCAAAAT
AAGTTCCAATCAAATAATGGATGATTCAGAAGGGGCTGAATCCAGTCCATCATCATTTAAAAACACCATTAAAAATGAAA
TTTATTCCTCTTATAGTCCATTTCTAAATGAATCCCATAGCATTCTTTCAGATTTAAGTTACTCTTCGTCTCTCAATAAC
GTTTCAAAACACACTAGCGATTCCATTATAACGAATTCTCCTATCAGAGAAGAAATTGTCTTAGAAAATAATCAGCCCTC
TCAACAGAATAATATAAACAATTACCGACACGTATTTCAGAGAACTTCGACTCTATCCAACAGTTTGTTGACCCCTTTAA
CCATTGTCACAGAAAAAGTTGACGAACAGAAAGATCTTCCACCATCAAGAATCAATATCCGATATGTGAAAATTAACAAA
CTACCGATTCAAACAAAATCCGATTTCCCATTGACTGGATATTTTCAAAATTTCAATAACGACTCAAATCTTCATTTTCA
GAGTTCCATTCACGCCCTGAATACGACATTGACTCCAGATCTGTCGGTAAAACGCGAAGCCACTGTCAACAACAGCATGA
CAGATTATATCAATCGAAAACGTACAAATGTCGATCCACTTATCATCGATGATATATTTGAAAACGAACAATTTGAAGAT
GAGGAAGTGTTGAATTTTGACAATCCTGATAACAATAACAGTTCTCCTTGGTCGTTTAAATCGCCTAACTTTAAAATATC
TACCGGTTCCTCGACACTGTCAGACAATCCGTACAAAGAACAGTTTTGTTCTTCCCCGTTCCATCTATCAGAAACTGATA
CTCAACCGATTCCAGTTCAACGATTGCCAGCAATCGGCTCATGGTTAAAGTCAAACTATTCTGAATTCATGATCTGATCC
AATCTATTATTCTATTCAATTGTCTGTTTTCATACAATTAGGATTACTTGTTATGAATTCTAGCTGATTTTGAGTGTGTT
TATAAAGCTTTTGTAACGCCTTTTCTATACAGATGTTCGATATATATATATAAATAAATAAATATAAATATATAACAATT
TTATTGACATTGTACAGTATTCCATAAGCCCGATCTTGTAACGCATTTATTACTATACTCAATAGACCAATCTATATGTT
CTCATAATTTCTATGTTGTTATTGTACACGGGAATTATTACTATAAATGATGCGAATTTATCACTTTGTAATTGAGGGAA
ATTATCGATCAATTTGCGCTTTCAGACATTTTTCATGTATAAACTTGTTTTTCTCTTTTTTATCATCAAAAATTTAATTT
TTTTGATATCGCTATTCATCATATTATTATTCTCCGTTGCATTTGTTAGATTATGTAAATTTTTATATGAAAATGTTGTT
ATTTATTGTATTTTTATACGATTTTTTGCTTTGGATACACTTTTATCAAATCATATTGCCAGTGTGAGCATTTATTGGAC
TTGTTGTTATTGCTGCTGCTCGAATAATTGCTTCATACGGGGAGTCTCGATATTTTCATGAAGCGATTTTCATGGTTGCC
GCTCTCCGCCGCCGCCATTCGGTGTAAATATCAATTGCATTGCCAGCACGTTTTCTCAAACTCAATTTTTGTACTCAATT
TCAATTGATTTATGTTCATTTTATTTTTCATAGAAATGAGTAAATAAATTTTCATAAATAGTTTTGTTTTCAATATTTTT
AGGAAATTTGAATGTGTCTCTAGA

 

back to top



PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in neoblast. Click this link to learn more about PAGE.


PAGE Curations: 3076


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
neoblastSMED30031507Zinc finger and SCAN domain-containing protein 2SMESG000049972.1 SMESG000031902.1 dd_Smed_v4_13890_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020370DNA-directed RNA polymerase subunitSMESG000010459.1 dd_Smed_v4_1965_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3002950760S ribosomal protein L12SMESG000006898.1 dd_Smed_v4_259_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027184SMED30027184SMESG000077502.1 dd_Smed_v4_8164_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035929SWI/SNF complex subunit SMARCC2SMESG000031576.1 SMESG000013315.1 dd_Smed_v4_1804_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024735SMED30024735SMESG000012126.1 dd_Smed_v4_7744_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012234Replication protein A subunitSMESG000045678.1 SMESG000005326.1 dd_Smed_v4_3342_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009032Deoxycytidylate deaminaseSMESG000023231.1 dd_Smed_v4_6803_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003706SMED30003706SMESG000044313.1 SMESG000025783.1 SMESG000025782.1 dd_Smed_v4_8481_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004820Microfibrillar-associated protein 1SMESG000004991.1 dd_Smed_v4_2957_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009284Hsp70SMESG000056256.1 dd_Smed_v4_424_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013237Peptidase C50 domain-containing proteinSMESG000017514.1 SMESG000017512.1 dd_Smed_v4_6610_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001516SMED30001516SMESG000071385.1 dd_Smed_v4_6551_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015202Splicing factor U2af subunit like proteinSMESG000002374.1 dd_Smed_v4_3092_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000109640S ribosomal protein S23SMESG000017264.1 dd_Smed_v4_290_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008437Nuclear and cytoplasmic polyadenylated RNA-binding proteinSMESG000044649.1 dd_Smed_v4_3605_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001545SMED30001545SMESG000026136.1 dd_Smed_v4_7269_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001545SMED30001545SMESG000026136.1 dd_Smed_v4_4323_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016021Chromatin assembly factor 1 subunit ASMESG000061926.1 dd_Smed_v4_8919_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016591Protein big brotherSMESG000068819.1 dd_Smed_v4_2875_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018725Protein kinase domain-containing proteinSMESG000025288.1 dd_Smed_v4_19210_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002942SMED30002942SMESG000009948.1 dd_Smed_v4_21084_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016384Thymidylate kinaseSMESG000016181.1 dd_Smed_v4_3849_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016835Proteasome subunit alpha typeSMESG000030651.1 dd_Smed_v4_1235_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000270360S ribosomal protein L23aSMESG000074545.1 dd_Smed_v4_281_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006342Nuclear pore complex protein Nup133SMESG000034820.1 dd_Smed_v4_5977_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017371Adenylosuccinate lyaseSMESG000014474.1 dd_Smed_v4_2280_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019889SMED30019889SMESG000055277.1 dd_Smed_v4_19641_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3002797940S ribosomal protein S27SMESG000066109.1 SMESG000052687.1 SMESG000014240.1 SMESG000069832.1 SMESG000037642.1 dd_Smed_v4_106_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031646SMED30031646SMESG000010156.1 dd_Smed_v4_105_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020035DNA polymerase subunit gammaSMESG000050799.1 dd_Smed_v4_13411_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027435Peroxisome biogenesis factor 10SMESG000072041.1 dd_Smed_v4_10411_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025245Kinesin-like proteinSMESG000030852.1 dd_Smed_v4_13972_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023756ATP-dependent RNA helicase DBP2SMESG000012031.1 dd_Smed_v4_3816_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3002317260s ribosomal protein L14SMESG000022343.1 dd_Smed_v4_167_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030204SMED30030204SMESG000018900.1 dd_Smed_v4_10059_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029180Poly(A) polymeraseSMESG000072012.1 dd_Smed_v4_3033_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029180Poly(A) polymeraseSMESG000072012.1 dd_Smed_v4_1470_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035360Peptidyl-prolyl cis-trans isomeraseSMESG000006589.1 dd_Smed_v4_133_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024160SMED30024160SMESG000046560.1 dd_Smed_v4_1394_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033117ANK_REP_REGION domain-containing proteinSMESG000048145.1 dd_Smed_v4_16174_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016090Translocated promoter region b, nuclear basket proteinSMESG000025908.1 dd_Smed_v4_2899_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006378PRELI/MSF1 domain-containing proteinSMESG000034043.1 dd_Smed_v4_922_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006548Bromodomain-containing protein 7SMESG000060992.1 dd_Smed_v4_8872_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007734U2 snRNP auxiliary factor large subunitSMESG000018652.1 SMESG000018647.1 dd_Smed_v4_3025_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003965Zinc finger and SCAN domain-containing protein 2SMESG000031886.1 dd_Smed_v4_2890_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006182Peptidyl-prolyl cis-trans isomeraseSMESG000057818.1 dd_Smed_v4_4606_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001627Mitochondrial import receptor subunit TOM40SMESG000045558.1 dd_Smed_v4_4005_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000024060S ribosomal protein L10aSMESG000027088.1 dd_Smed_v4_350_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018697Programmed cell death 11SMESG000005637.1 dd_Smed_v4_10802_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018755Small ubiquitin-related modifierSMESG000018835.1 dd_Smed_v4_1253_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015999aurora kinase-1SMESG000006604.1 dd_Smed_v4_9065_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013263DNA damage-inducible protein 1SMESG000052545.1 dd_Smed_v4_2764_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000573SMED30000573SMESG000050316.1 dd_Smed_v4_1722_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009887Macrophage erythroblast attacherSMESG000048410.1 dd_Smed_v4_1168_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000226539S ribosomal protein L30SMESG000018897.1 dd_Smed_v4_6177_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007662Nuclear pore complex protein Nup98-Nup96SMESG000022283.1 dd_Smed_v4_5347_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006464TCF15SMESG000044395.1 dd_Smed_v4_4998_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010326TetraspaninSMESG000078589.1 dd_Smed_v4_2698_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011415Transmembrane protein 209SMESG000020027.1 dd_Smed_v4_4525_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010233DDE_3 domain-containing proteinSMESG000063405.1 dd_Smed_v4_13863_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011677RRM domain-containing proteinSMESG000018666.1 SMESG000018665.1 dd_Smed_v4_10611_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003162Chromatin assembly factor 1 subunit BSMESG000042345.1 dd_Smed_v4_5543_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016121Phosphorylated adapter RNA export proteinSMESG000070992.1 dd_Smed_v4_11764_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003234Chromodomain helicase DNA binding protein 5SMESG000069740.1 dd_Smed_v4_9090_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013803SMED30013803SMESG000030421.1 dd_Smed_v4_9428_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007474Tyrosyl-DNA phosphodiesterase 1SMESG000046266.1 SMESG000046256.1 dd_Smed_v4_8311_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000834SMED30000834SMESG000070604.1 SMESG000070322.1 SMESG000017548.1 dd_Smed_v4_2059_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013169Cactin, spliceosome C complex subunitSMESG000061791.1 dd_Smed_v4_8085_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006208Aconitate hydratase, mitochondrialSMESG000002904.1 dd_Smed_v4_979_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004920Eukaryotic peptide chain release factor GTP-binding subunitSMESG000067151.1 SMESG000067136.1 dd_Smed_v4_1469_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007274Bromodomain containing 7SMESG000060992.1 dd_Smed_v4_8872_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008172TNF receptor-associated factorSMESG000027149.1 dd_Smed_v4_10424_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004214SMED30004214SMESG000055805.1 dd_Smed_v4_857_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002662Superoxide dismutaseSMESG000009484.1 dd_Smed_v4_1259_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001235Cilia and flagella associated protein 298SMESG000074029.1 dd_Smed_v4_3612_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015950Deoxyribonuclease II family proteinSMESG000062594.1 dd_Smed_v4_9160_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013268SMED30013268SMESG000010034.1 dd_Smed_v4_13472_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000284Electron transfer flavoprotein subunit betaSMESG000025689.1 dd_Smed_v4_1315_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005793mitochondrial import inner membrane translocase subunit Tim16-likeSMESG000015627.1 dd_Smed_v4_1720_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000448460S ribosomal protein L8SMESG000017087.1 dd_Smed_v4_108_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007838SMED30007838SMESG000017434.1 dd_Smed_v4_11003_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017571Proline--tRNA ligaseSMESG000039017.1 dd_Smed_v4_12333_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019073SMED30019073SMESG000041235.1 dd_Smed_v4_13685_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015565N-alpha-acetyltransferase 16, NatA auxiliary subunit-like ProteinSMESG000044312.1 dd_Smed_v4_1343_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031338Calcium homeostasis endoplasmic reticulum proteinSMESG000008465.1 dd_Smed_v4_4684_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030077Growth hormone-inducible transmembrane proteinSMESG000029240.1 dd_Smed_v4_754_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030466Ribosomal RNA methyltransferase Nop2SMESG000042985.1 SMESG000007627.1 dd_Smed_v4_7417_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031378Serine:threonine protein kinase rio2SMESG000041471.1 dd_Smed_v4_5634_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024764ATP synthase subunit delta mitochondrialSMESG000057052.1 dd_Smed_v4_1238_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3002604960S ribosomal protein L35aSMESG000003977.1 dd_Smed_v4_318_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032345Si:ch211-275j6.5SMESG000077880.1 dd_Smed_v4_3623_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032770MORC family CW-type zinc finger proteinSMESG000080008.1 dd_Smed_v4_2907_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026750BTB domain containing 9SMESG000042098.1 SMESG000042085.1 dd_Smed_v4_4701_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030818Heterogeneous nuclear ribonucleoprotein KSMESG000021944.1 dd_Smed_v4_2111_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026121Ectonucleotide pyrophosphatase/phosphodiesterase family member 6SMESG000040292.1 dd_Smed_v4_1269_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3003415260S ribosomal protein L11SMESG000012668.1 SMESG000012475.1 dd_Smed_v4_144_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033876SMED30033876SMESG000064827.1 dd_Smed_v4_3731_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029676peptidyl prolyl cis trans isomerase FKBP-2SMESG000078014.1 dd_Smed_v4_3023_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021402Cell division cycle 20-like proteinSMESG000051492.1 dd_Smed_v4_10335_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032348SMED30032348SMESG000071220.1 dd_Smed_v4_6653_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3003321128S ribosomal protein S9SMESG000018935.1 dd_Smed_v4_2348_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035969Carbamoyl-phosphate synthase large chainSMESG000012911.1 dd_Smed_v4_7167_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029523Splicing factor 3B subunit 3SMESG000000828.1 dd_Smed_v4_4241_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020903THO complex subunit 2SMESG000079934.1 dd_Smed_v4_3159_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024665Citrate synthaseSMESG000052432.1 dd_Smed_v4_335_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031644Translation machinery-associated protein 7-like proteinSMESG000034009.1 dd_Smed_v4_563_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028145RNA polymerase-associated protein CTR9 homologSMESG000059268.1 dd_Smed_v4_2695_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032139SMED30032139SMESG000025700.1 dd_Smed_v4_355_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030988T-complex protein 1 subunit thetaSMESG000023665.1 dd_Smed_v4_903_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3003581640S ribosomal protein S13SMESG000042470.1 SMESG000042447.1 dd_Smed_v4_360_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023430set nuclear proto-oncogeneSMESG000031906.1 SMESG000031905.1 dd_Smed_v4_618_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032737SMED30032737SMESG000006908.1 dd_Smed_v4_5424_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021509Nuclear autoantigenic sperm proteinSMESG000016858.1 dd_Smed_v4_5663_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035831SMED30035831SMESG000046586.1 dd_Smed_v4_2725_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034697Testis-specific Y-encoded-like protein 1SMESG000027817.1 SMESG000027807.1 dd_Smed_v4_393_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032250SMED30032250SMESG000072181.1 dd_Smed_v4_5831_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029203SMED30029203SMESG000026183.1 dd_Smed_v4_4644_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029428SMED30029428SMESG000019958.1 dd_Smed_v4_5765_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025401Trifunctional purine biosynthetic protein adenosine-3SMESG000044482.1 dd_Smed_v4_3037_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027562SMED30027562SMESG000022880.1 dd_Smed_v4_3493_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028073Mitochondrial import inner membrane translocase subunit TIM23SMESG000041020.1 dd_Smed_v4_825_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034055U5 small nuclear ribonucleoprotein 200 kDa helicaseSMESG000004936.1 dd_Smed_v4_3022_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028677general transcription factor IIF 1SMESG000056086.1 dd_Smed_v4_7287_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033919RuvB-like helicaseSMESG000031725.1 dd_Smed_v4_3490_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3003269614-3-3 protein epsilonSMESG000058073.1 dd_Smed_v4_461_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026247stem loop binding proteinSMESG000060978.1 dd_Smed_v4_9628_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032456Aldehyde dehydrogenase,putativeSMESG000001708.1 dd_Smed_v4_400_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034162SMED30034162SMESG000069576.1 dd_Smed_v4_9264_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032645Heterochromatin protein 1-1SMESG000004606.1 SMESG000004604.1 dd_Smed_v4_928_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032441cAMP-regulated phosphoprotein 19SMESG000032735.1 dd_Smed_v4_4126_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028771SMED30028771SMESG000014464.1 dd_Smed_v4_3389_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020124Ribosome biogenesis regulatory proteinSMESG000071880.1 dd_Smed_v4_2458_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027868DNA-directed RNA polymerases I, II, and III subunit RPABC5SMESG000037774.1 dd_Smed_v4_8307_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028902DNA-directed RNA polymeraseSMESG000026344.1 SMESG000026343.1 dd_Smed_v4_5515_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030386SMED30030386SMESG000026344.1 SMESG000026343.1 dd_Smed_v4_5515_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035053Presequence protease mitochondrialSMESG000032460.1 dd_Smed_v4_5873_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028856Protein kinase CSMESG000021192.1 dd_Smed_v4_657_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031120SMED30031120SMESG000036622.1 dd_Smed_v4_9680_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027407SERPINE1 mRNA binding protein 1aSMESG000008791.1 dd_Smed_v4_697_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025220Eukaryotic initiation factor 4ASMESG000058317.1 dd_Smed_v4_349_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035373histone deacetylase 1SMESG000060876.1 dd_Smed_v4_695_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029877TIA1-like proteinSMESG000055075.1 SMESG000055074.1 dd_Smed_v4_3545_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003592SMED30003592SMESG000013335.1 dd_Smed_v4_10619_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013451RRM domain-containing proteinSMESG000039881.1 dd_Smed_v4_1631_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009874Translation initiation factor SUI1SMESG000021046.1 dd_Smed_v4_1681_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009026ATP-dependent RNA helicase DDX3XSMESG000046974.1 SMESG000046953.1 dd_Smed_v4_799_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011687CBFD_NFYB_HMF domain-containing proteinSMESG000070171.1 dd_Smed_v4_12599_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000652126S proteasome non-ATPase regulatory subunit 3SMESG000066329.1 SMESG000066317.1 dd_Smed_v4_1449_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005194notchless-1SMESG000000678.1 dd_Smed_v4_10113_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018984prefoldin subunit 2SMESG000075156.1 SMESG000075150.1 dd_Smed_v4_1368_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006905DNA endonuclease RBBP8SMESG000002586.1 dd_Smed_v4_12447_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003741KH domain-containing proteinSMESG000068335.1 dd_Smed_v4_1393_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019011DNA repair protein RAD50SMESG000039247.1 SMESG000039215.1 dd_Smed_v4_11475_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017418Casein kinase II subunit alphaSMESG000024545.1 dd_Smed_v4_1000_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006610WW domain-containing oxidoreductaseSMESG000077649.1 dd_Smed_v4_11724_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019298Heterogeneous nuclear ribonucleoprotein LSMESG000005298.1 dd_Smed_v4_1327_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018579SMED30018579SMESG000017019.1 dd_Smed_v4_13580_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000080060S ribosomal protein L10aSMESG000025746.1 dd_Smed_v4_1750_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005444NicalinSMESG000032750.1 dd_Smed_v4_1389_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009634Proteasome subunit alpha typeSMESG000060349.1 dd_Smed_v4_1154_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3001927340S ribosomal protein S3aSMESG000066540.1 SMESG000066537.1 dd_Smed_v4_163_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011104HTH La-type RNA-binding domain-containing proteinSMESG000000519.1 dd_Smed_v4_1420_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014746SMED30014746SMESG000040783.1 dd_Smed_v4_14673_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018127SMED30018127SMESG000014578.1 SMESG000014566.1 SMESG000014563.1 SMESG000014544.1 SMESG000014542.1 SMESG000014523.1 dd_Smed_v4_1543_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017131DNA topoisomerase 2-binding protein 1SMESG000012344.1 dd_Smed_v4_14737_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011817SMED30011817SMESG000000519.1 dd_Smed_v4_1420_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008086ESF1, nucleolar pre-rRNA processing protein, homologSMESG000043665.1 dd_Smed_v4_12089_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009845Huntingtin-interacting protein KSMESG000064372.1 dd_Smed_v4_1948_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007977SMED30007977SMESG000020879.1 dd_Smed_v4_11507_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3001616360S ribosomal protein L27aSMESG000034631.1 dd_Smed_v4_155_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014446SMEDWI-2SMESG000069984.1 SMESG000069981.1 dd_Smed_v4_756_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016088Protein arginine N-methyltransferase 6SMESG000017273.1 dd_Smed_v4_1336_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008984Protein phosphatase 1GSMESG000030206.1 dd_Smed_v4_2086_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014893Eukaryotic translation initiation factor 4E binding protein, putativeSMESG000001074.1 dd_Smed_v4_1204_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018702Voltage-dependent anion-selective channel protein 2SMESG000053095.1 dd_Smed_v4_2119_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010124protein arginine methyltransferase 1-like proteinSMESG000038804.1 dd_Smed_v4_1755_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013220Eukaryotic translation initiation factor 3 subunit DSMESG000020924.1 dd_Smed_v4_2254_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019834Guanine nucleotide-binding protein subunit beta-2-like 1SMESG000076568.1 dd_Smed_v4_174_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009340SMED30009340SMESG000014578.1 SMESG000014566.1 SMESG000014563.1 SMESG000014544.1 SMESG000014542.1 SMESG000014523.1 dd_Smed_v4_1543_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005206Serine/arginine-rich splicing factor 1SMESG000075205.1 dd_Smed_v4_1192_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004651SMED30004651SMESG000013099.1 dd_Smed_v4_14977_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007270DUF862 domain-containing proteinSMESG000024772.1 dd_Smed_v4_1503_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000898760S ribosomal protein L13-like proteinSMESG000036992.1 dd_Smed_v4_145_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000102660S ribosomal protein L7SMESG000076604.1 dd_Smed_v4_1121_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3001553460S ribosomal protein L21SMESG000040216.1 dd_Smed_v4_189_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004593SMED30004593SMESG000009948.1 dd_Smed_v4_19022_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004593SMED30004593 dd_Smed_v4_15248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001991DNA topoisomerase 2SMESG000064303.1 dd_Smed_v4_14064_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019763CS domain-containing proteinSMESG000078259.1 SMESG000075881.1 SMESG000064589.1 SMESG000031042.1 SMESG000029607.1 SMESG000021352.1 SMESG000004064.1 dd_Smed_v4_3736_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015936SMED30015936SMESG000032761.1 dd_Smed_v4_10217_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005802SMED30005802SMESG000072483.1 dd_Smed_v4_5611_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019057SMED30019057SMESG000016216.1 dd_Smed_v4_2283_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012216Heterogeneous nuclear ribonucleoprotein U-like 1SMESG000033768.1 dd_Smed_v4_1485_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003788Mitochondrial import receptor subunit TOM70SMESG000070017.1 dd_Smed_v4_2190_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001172Elongation factor 1-betaSMESG000026862.1 dd_Smed_v4_206_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007722Malonyl-CoA-acyl carrier protein transacylaseSMESG000054426.1 dd_Smed_v4_11450_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015739Aldo-keto reductaseSMESG000081151.1 dd_Smed_v4_1044_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006060Kinesin proteinSMESG000063375.1 dd_Smed_v4_15120_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3001301840S ribosomal protein S6SMESG000000674.1 dd_Smed_v4_178_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029911Pre-mRNA-processing factor 40SMESG000044274.1 dd_Smed_v4_1909_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026348SMED30026348SMESG000069520.1 dd_Smed_v4_1115_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027550tRNA (adenine(58)-N(1))-methyltransferase non-catalytic subunit TRM6SMESG000072786.1 dd_Smed_v4_3327_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027075SMED30027075SMESG000067067.1 dd_Smed_v4_10631_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034401DNA-directed RNA polymerase subunitSMESG000069361.1 dd_Smed_v4_11775_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020565cleavage and polyadenylation specificity factor subunit 3SMESG000066903.1 SMESG000066712.1 SMESG000002177.1 dd_Smed_v4_2005_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031697DNA-directed RNA polymerases I and III subunit RPAC1SMESG000066290.1 SMESG000050681.1 SMESG000050677.1 dd_Smed_v4_5608_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027718Lupus la ribonucleoprotein, putativeSMESG000028878.1 dd_Smed_v4_5312_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030516Myelin expression factor 2 isoform 2SMESG000020746.1 dd_Smed_v4_2707_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024406Omega-amidase NIT2SMESG000071423.1 dd_Smed_v4_1734_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022596SMED30022596SMESG000071344.1 dd_Smed_v4_245_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034487Ubiquitin carboxyl-terminal hydrolaseSMESG000033580.1 dd_Smed_v4_2505_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034271Eukaryotic translation initiation factor 5ASMESG000081077.1 dd_Smed_v4_484_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3002866540S ribosomal protein SASMESG000016079.1 dd_Smed_v4_8634_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032895Survival of motor neuron-related-splicing factor 30SMESG000050984.1 dd_Smed_v4_5356_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033478Dis3 exonuclease 1SMESG000057169.1 dd_Smed_v4_6527_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030574SMED30030574SMESG000067067.1 dd_Smed_v4_10631_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035024SMED30035024SMESG000074987.1 dd_Smed_v4_3607_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027441ZNF207-1SMESG000077995.1 dd_Smed_v4_4303_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024486cytoplasmic poly(A) binding proteinSMESG000004978.1 dd_Smed_v4_11729_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032513Transformer-2 proteinSMESG000052829.1 dd_Smed_v4_5257_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035187Cytochrome c oxidase copper chaperoneSMESG000050382.1 dd_Smed_v4_732_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3002979839S ribosomal protein L22SMESG000080731.1 dd_Smed_v4_2175_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020626RRM domain-containing proteinSMESG000018666.1 SMESG000018665.1 dd_Smed_v4_10611_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016227DNA excision repair protein ERCC-6-likeSMESG000033073.1 dd_Smed_v4_11583_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019741TetraspaninSMESG000021636.1 dd_Smed_v4_13516_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3001850460S ribosomal protein L30SMESG000022893.1 dd_Smed_v4_111_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010424DNA primaseSMESG000070103.1 dd_Smed_v4_11558_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004043Cytoskeleton-associated protein 5SMESG000045133.1 dd_Smed_v4_16467_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002592NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 3SMESG000016331.1 dd_Smed_v4_1078_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019468protein arginine methyltransferase 1-like proteinSMESG000038790.1 dd_Smed_v4_1302_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010457cell division cycle and apoptosis regulator protein 1SMESG000052430.1 dd_Smed_v4_1608_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004541SMED30004541SMESG000056767.1 dd_Smed_v4_13044_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007516SMED30007516SMESG000004411.1 dd_Smed_v4_17796_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014469DUF862 domain-containing proteinSMESG000007684.1 dd_Smed_v4_1938_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012435SMED30012435SMESG000054653.1 dd_Smed_v4_12960_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012014NADH:ubiquinone oxidoreductase NDUFS5-15kDaSMESG000011290.1 dd_Smed_v4_1674_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004082NIPSNAP domain-containing proteinSMESG000043687.1 dd_Smed_v4_2078_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012311DNA-(apurinic or apyrimidinic site) lyaseSMESG000036124.1 dd_Smed_v4_11417_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000239240S ribosomal protein S15SMESG000015520.1 dd_Smed_v4_201_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005157SMED30005157SMESG000054684.1 SMESG000054674.1 dd_Smed_v4_18196_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001057Mcm10 domain-containing proteinSMESG000014794.1 dd_Smed_v4_16334_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001057Mcm10 domain-containing proteinSMESG000014794.1 dd_Smed_v4_11868_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016901PROX-1SMESG000068287.1 dd_Smed_v4_13772_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007465Coiled coil domain containing protein 58SMESG000014824.1 dd_Smed_v4_1983_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005154SMED30005154SMESG000049720.1 SMESG000049718.1 dd_Smed_v4_2225_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017782SMED30017782SMESG000079355.1 dd_Smed_v4_10665_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019080Chromosome transmission fidelity factor 18SMESG000040188.1 dd_Smed_v4_13246_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3003090860S ribosomal protein L27SMESG000045074.1 dd_Smed_v4_200_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033565SMED30033565SMESG000050427.1 dd_Smed_v4_3777_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023821DNA helicaseSMESG000060238.1 dd_Smed_v4_5956_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032563MCM5SMESG000005389.1 dd_Smed_v4_5764_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034728SUMO-activating enzyme subunit 1SMESG000036431.1 dd_Smed_v4_4443_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032703SKIP_SNW domain-containing proteinSMESG000061372.1 dd_Smed_v4_2325_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021579SMED30021579SMESG000072336.1 dd_Smed_v4_14997_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021516MICOS complex subunit MIC60SMESG000066687.1 dd_Smed_v4_1605_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027641Serrate RNA effector moleculeSMESG000023055.1 dd_Smed_v4_3660_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3003350854S ribosomal protein L4, mitochondrialSMESG000002589.1 dd_Smed_v4_1861_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025738Stress-induced-phosphoprotein 1SMESG000011539.1 dd_Smed_v4_1986_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028865Sld5 domain-containing proteinSMESG000002897.1 dd_Smed_v4_9624_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021376SMED30021376SMESG000039147.1 dd_Smed_v4_18815_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034411ATP-binding cassette sub-family F member 3SMESG000049901.1 SMESG000049899.1 SMESG000049863.1 SMESG000049862.1 SMESG000049855.1 SMESG000049780.1 SMESG000049778.1 SMESG000022671.1 dd_Smed_v4_11552_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024374Protein LSM14 homolog B-BSMESG000033950.1 dd_Smed_v4_1594_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034043Cactin, spliceosome C complex subunitSMESG000026741.1 dd_Smed_v4_15273_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033559SMED30033559SMESG000076700.1 dd_Smed_v4_18869_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033538DNA topoisomerase 2SMESG000037559.1 SMESG000037557.1 dd_Smed_v4_4804_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029980SMED30029980SMESG000005589.1 dd_Smed_v4_2921_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023257SMED30023257SMESG000016203.1 dd_Smed_v4_6987_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024082Phosphoribosylaminoimidazole-succinocarboxamide synthaseSMESG000056504.1 dd_Smed_v4_1421_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035004NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 9, mitochondrialSMESG000072630.1 dd_Smed_v4_1524_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032052Cytoskeleton-associated protein 5-ASMESG000045157.1 SMESG000045143.1 dd_Smed_v4_3967_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032052Cytoskeleton-associated protein 5-ASMESG000045157.1 dd_Smed_v4_16537_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020652Eukaryotic translation initiation factor 4GSMESG000045255.1 dd_Smed_v4_10618_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035650U2 small nuclear ribonucleoprotein A'SMESG000014464.1 dd_Smed_v4_3389_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029899slc25a-30SMESG000044697.1 SMESG000022161.1 dd_Smed_v4_50_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020974DNA topoisomerase 2SMESG000037559.1 SMESG000037557.1 dd_Smed_v4_4804_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007406SMEDWI-1SMESG000036375.1 DQ186985.1smed_ncbi_20200123PMID:24704339
Vogg et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30007406SMEDWI-1SMESG000036375.1 DQ186985.1smed_ncbi_20200123PMID:23318641
Chen et al., 2013
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30027299PBXSMESG000022232.1 SMESG000001913.1 KC353351.1smed_ncbi_20200123PMID:23318641
Chen et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30012293SPT16SMESG000033905.1 JX070080smed_ncbi_20200123PMID:23629965
Zeng et al., 2013
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30032645Heterochromatin protein 1-1SMESG000004606.1 JN216838smed_ncbi_20200123PMID:23629965
Zeng et al., 2013
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30035373histone deacetylase 1SMESG000060876.1 HDAC1smed_ncbi_20200123PMID:23629965
Zeng et al., 2013
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30032563MCM5SMESG000005389.1 JX070081smed_ncbi_20200123PMID:23629965
Zeng et al., 2013
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30032631Smed-AlbinoSMESG000068148.1 KX531078.1smed_ncbi_20200123PMID:27551436
Wang et al., 2016
FACS sorted cell population asexual adult fluorescence in situ hybridization evidence
neoblastSMED30020436Nuclear distribution protein nudE-like 1SMESG000016071.1 HO006501.1ncbi_smed_estsPMID:22411224
Cowles et al., 2012
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30016141lissencephaly-1SMESG000054739.1 SMESG000035997.1 JQ650355.1smed_ncbi_20200123PMID:22411224
Cowles et al., 2012
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30034763c-Jun N-terminal kinasesSMESG000043618.1 JNKsmed_ncbi_20200123PMID:24922054
Almuedo-Castillo et al., 2014
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30020168c-Jun N-terminal kinasesSMESG000043618.1 JNKsmed_ncbi_20200123PMID:24922054
Almuedo-Castillo et al., 2014
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30012037InnexinSMESG000055258.1 AY067503smed_ncbi_20200123PMID:17670787
Oviedo et al., 2007
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30004277InnexinSMESG000055258.1 AY067503smed_ncbi_20200123PMID:17670787
Oviedo et al., 2007
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30018622smedxin-11SMESG000034762.1 DQ851133smed_ncbi_20200123PMID:17670787
Oviedo et al., 2007
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30029233Homeodomain proteinSMESG000043155.1 SMED30029233smed_20140614PMID:27034770
Currie et al., 2016
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30029233Homeodomain proteinSMESG000043155.1 SmedASXL_005553SmedAsxl_ww_GCZZ01PMID:27034770
Currie et al., 2016
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30013674Hox class homeodomain protein DjAbd-BbSMESG000033048.1 SMED30013674smed_20140614PMID:27034770
Currie et al., 2016
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30013674Hox class homeodomain protein DjAbd-BbSMESG000033048.1 SmedASXL_008593SmedAsxl_ww_GCZZ01PMID:27034770
Currie et al., 2016
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30035424NLK-1SMESG000023289.1 SMED30035424smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011277Tspan1SMESG000066703.1 SMED30011277smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003764N-alpha-acetyltransferase 40SMESG000077166.1 SMED30003764smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017430Protein disulfide-isomeraseSMESG000023147.1 SMESG000017020.1 SMED30017430smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017430Protein disulfide-isomeraseSMESG000023147.1 SMESG000017020.1 SMED30028938smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005171SMED30005171SMESG000024345.1 SMED30005171smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019803SMED30019803 SMED30019803smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022975Homeobox protein DTH-2SMESG000037282.1 SMED30022975smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033583SMED30033583SMESG000060313.1 SMESG000049383.1 SMED30033583smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028938Protein disulfide-isomerase A6SMESG000023147.1 SMESG000017020.1 SMED30017430smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028938Protein disulfide-isomerase A6SMESG000023147.1 SMESG000017020.1 SMED30028938smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007346Achaete-scute-like proteinSMESG000026861.1 SMED30007346smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010488SMED30010488SMESG000003538.1 SMED30010488smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033646SMED30033646SMESG000022408.1 SMED30033646smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019097SOXP-1SMESG000010063.1 SMED30019097smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007599SMED30007599 SMED30032778smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019234SMED30019234 SMED30019234smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032778SMED30032778 SMED30032778smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005571Delta-1-pyrroline-5-carboxylate synthaseSMESG000045474.1 SMED30005571smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027929Tubulin beta chain SMED30027929smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028798Farnesoic acid O-methyltransferaseSMESG000029910.1 SMED30028798smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016265Tubulin beta chainSMESG000022928.1 SMED30016265smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000949Tgs-1SMESG000058876.1 SMED30002872smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000949Tgs-1SMESG000058876.1 SMED30000949smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002872Tgs-1SMESG000058876.1 SMED30002872smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002872Tgs-1SMESG000058876.1 SMED30000949smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023082SMED30023082SMESG000021722.1 SMED30023082smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007744SMED-SMAD6/7-1SMESG000002697.1 JQ278719smed_ncbi_20200123PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30007744SMED-SMAD6/7-1SMESG000002697.1 JQ278719.1smed_ncbi_20200123PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30014131RPTOR independent companion of MTOR, complex 2 aSMESG000033571.1 SMESG000033570.1 JN815259.1smed_ncbi_20200123PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30025757JUNLI-1SMESG000067959.1 AFD29623smed_ncbi_20200123PMID:26062938
Tejada-Romero et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30025910Microtubule-associated protein futschSMESG000030021.1 SMESG000025422.1 SmedASXL_011384SmedAsxl_ww_GCZZ01PMID:26114597
Zhu et al., 2015
FACS sorted cell population asexual adult colorimetric in situ hybridization evidence
neoblastSMED30033302RNA-binding protein MEX3BSMESG000030021.1 SMESG000025422.1 SmedASXL_011384SmedAsxl_ww_GCZZ01PMID:26114597
Zhu et al., 2015
FACS sorted cell population asexual adult colorimetric in situ hybridization evidence
neoblastSMED30031380Pogo transposable element with ZNF domainSMESG000014324.1 MF411143smed_ncbi_20200123PMID:29557542
Han et al., 2019
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30031380Pogo transposable element with ZNF domainSMESG000014324.1 MF411143smed_ncbi_20200123PMID:29557542
Han et al., 2019
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30031380Pogo transposable element with ZNF domainSMESG000014324.1 MF411143smed_ncbi_20200123PMID:29557542
Han et al., 2019
FACS sorted cell population asexual adult fluorescence in situ hybridization evidence
neoblastSMED30023910Pogo transposable element with ZNF domainSMESG000014324.1 MF411143smed_ncbi_20200123PMID:29557542
Han et al., 2019
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30023910Pogo transposable element with ZNF domainSMESG000014324.1 MF411143smed_ncbi_20200123PMID:29557542
Han et al., 2019
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30023910Pogo transposable element with ZNF domainSMESG000014324.1 MF411143smed_ncbi_20200123PMID:29557542
Han et al., 2019
FACS sorted cell population asexual adult fluorescence in situ hybridization evidence
neoblastSMED30022937RNA polymerase-associated protein RTF1-like proteinSMESG000029426.1 GU562964smed_ncbi_20200123PMID:20215344
Fernandéz-Taboada et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30026364SMED-P53SMESG000078256.1 SMESG000078255.1 SMED30026364smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30008505SOXP-3SMESG000051170.1 SMED30008505smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30023708ZFP-1SMESG000066384.1 SMED30023708smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30019046SD2SMESG000021468.1 SMED30019046smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30032499C2H2-type domain-containing proteinSMESG000075452.1 SMED30032499smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30010878six3-1SMESG000009894.1 SMED30010878smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30011923SMED30011923SMESG000009894.1 SMED30010878smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30006464TCF15SMESG000044395.1 SMED30006464smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30015704Hox class homeodomain protein DjAbd-Ba SMED30015704smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30012332EGR-1SMESG000034285.1 SMED30012332smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30023969LIM domain only protein 3SMESG000037556.1 SMED30023969smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30033839Sp5SMESG000023227.1 SMED30033839smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30022628G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000060403.1 SMED30022628smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30000303HoxC12-like proteinSMESG000022668.1 SMED30000303smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30000938Homeobox domain-containing proteinSMESG000060967.1 SMED30000938smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30000485SMED30000485SMESG000069311.1 SMED30000485smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30006353SMED30006353SMESG000004009.1 SMED30006353smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30011950Transcription factor GATA-3SMESG000079514.1 SMED30011950smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30011047GLI-1SMESG000073727.1 SMED30011047smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30006011T box transcription factor tbx2SMESG000023378.1 SMED30006011smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30010115ribonucleoside diphosphate reductase subunit M2-2SMESG000079368.1 SMESG000044188.1 SMESG000044184.1 dd_Smed_v4_2286_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000501926S proteasome regulatory subunit 4 homologSMESG000020306.1 dd_Smed_v4_1222_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002673Coiled-coil domain-containing protein 89SMESG000017325.1 dd_Smed_v4_12263_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000317640S ribosomal protein S2SMESG000051503.1 dd_Smed_v4_226_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004470Thymidylate synthase-like ProteinSMESG000063577.1 dd_Smed_v4_1260_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003599transverse filament protein SYCP-1SMESG000073774.1 dd_Smed_v4_18547_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011043Protein kinase domain-containing proteinSMESG000025533.1 dd_Smed_v4_12789_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014813Y box protein-1SMESG000058013.1 dd_Smed_v4_35_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021243DNA-directed RNA polymerase subunitSMESG000080671.1 dd_Smed_v4_3867_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020054Transcription elongation factor spt6SMESG000058110.1 dd_Smed_v4_3968_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022253Nuclear pore complex protein Nup160SMESG000074874.1 SMESG000074873.1 dd_Smed_v4_5203_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED300231392-oxoglutarate and iron-dependent oxygenase domain-containing protein 1SMESG000053951.1 dd_Smed_v4_9466_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027482Low-density lipoprotein receptor 1SMESG000049079.1 dd_Smed_v4_8647_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023057Polypyrimidine tract-binding protein 1SMESG000018057.1 dd_Smed_v4_2799_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020312Pre-mRNA-splicing factor ATP-dependent RNA helicase DHX16-likeSMESG000014714.1 dd_Smed_v4_8001_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020043SJCHGC04876 proteinSMESG000058578.1 dd_Smed_v4_7237_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021074Nuclear transport factor 2SMESG000004940.1 dd_Smed_v4_3953_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020375PHD finger-like domain-containing protein 5ASMESG000029843.1 dd_Smed_v4_2656_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026135SMED30026135SMESG000016933.1 dd_Smed_v4_2807_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028914Photolyase/cryptochrome alpha/beta domain-containing proteinSMESG000003495.1 dd_Smed_v4_2829_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024126SMED30024126SMESG000053935.1 dd_Smed_v4_4129_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025592Xeroderma pigmentosum, complementation group CSMESG000075170.1 dd_Smed_v4_5100_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025957PolyubiquitinSMESG000057324.1 dd_Smed_v4_458_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022314116 kDa U5 small nuclear ribonucleoprotein componentSMESG000045983.1 SMESG000045982.1 dd_Smed_v4_4747_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023617replication factor C subunit 3SMESG000077027.1 SMESG000020661.1 dd_Smed_v4_9695_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021147Transcription elongation factor SPT5SMESG000063039.1 dd_Smed_v4_3492_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031742Glutamate receptor-likeSMESG000035961.1 SMESG000035962.1 dd_Smed_v4_3026_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026022DNL-type domain-containing proteinSMESG000066940.1 dd_Smed_v4_2816_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020462Protein archeaseSMESG000051205.1 dd_Smed_v4_4680_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020687Aspartate carbamoyltransferaseSMESG000012911.1 dd_Smed_v4_7167_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001783SMED30001783SMESG000040740.1 dd_Smed_v4_3289_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009783SMED30009783SMESG000049972.1 SMESG000031902.1 dd_Smed_v4_13890_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000310SMED30000310 dd_Smed_v4_9639_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004472TransketolaseSMESG000000391.1 SMESG000000388.1 dd_Smed_v4_550_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004367Serine/arginine-rich splicing factor 12SMESG000078309.1 SMESG000078308.1 dd_Smed_v4_1695_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011793Homeobox protein DTH-1SMESG000079512.1 dd_Smed_v4_2716_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015938C2H2-type domain-containing proteinSMESG000065334.1 dd_Smed_v4_1345_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004304Proliferating cell nuclear antigen dd_Smed_v4_1920_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019516cyclinH-like proteinSMESG000064359.1 dd_Smed_v4_10725_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004679PRKR-interacting protein 1SMESG000063632.1 SMESG000063625.1 SMESG000063624.1 dd_Smed_v4_8973_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013909tud-1SMESG000029236.1 SMESG000029232.1 dd_Smed_v4_1582_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016148p21-activated protein kinase-interacting protein 1-like proteinSMESG000066454.1 dd_Smed_v4_13381_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004297Eukaryotic translation initiation factor 3 subunit KSMESG000017237.1 dd_Smed_v4_621_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000103940S ribosomal protein S7SMESG000053117.1 SMESG000031967.1 SMESG000031033.1 SMESG000014878.1 dd_Smed_v4_204_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017754SMED30017754SMESG000043124.1 dd_Smed_v4_3018_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017211Mediator of RNA polymerase II transcription subunit 10SMESG000065706.1 dd_Smed_v4_5622_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000190SMED30000190SMESG000043124.1 dd_Smed_v4_3018_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003138Adenosine deaminaseSMESG000068461.1 SMESG000068458.1 dd_Smed_v4_6236_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000013460S ribosomal protein L4SMESG000009479.1 dd_Smed_v4_211_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009858Polyadenylate-binding proteinSMESG000044671.1 dd_Smed_v4_2139_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017552Cleavage stimulation factor subunit 3SMESG000022467.1 dd_Smed_v4_2751_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005932Tudor domain-containing protein 1SMESG000026637.1 dd_Smed_v4_3564_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002529DNA-directed RNA polymerase subunit betaSMESG000067331.1 dd_Smed_v4_2182_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001799NADH dehydrogenase subunit 5 dd_Smed_v4_957_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001799NADH dehydrogenase subunit 5 dd_Smed_v4_258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000245560S ribosomal protein L6SMESG000076172.1 dd_Smed_v4_205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011777Cyclin t1SMESG000066586.1 dd_Smed_v4_1288_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007674G patch domain-containing protein 4SMESG000035189.1 dd_Smed_v4_1355_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014826Aldolase_II domain-containing proteinSMESG000044944.1 dd_Smed_v4_11759_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018937SMED30018937SMESG000004917.1 SMESG000004916.1 dd_Smed_v4_5623_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3001337140S ribosomal protein S26SMESG000049997.1 SMESG000005227.1 dd_Smed_v4_222_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014496Ribosome biogenesis protein NSA2SMESG000028599.1 dd_Smed_v4_1012_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006347U2 small nuclear ribonucleoprotein B dd_Smed_v4_2274_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004281Cytoskeleton-associated protein 5-ASMESG000045157.1 SMESG000045143.1 dd_Smed_v4_3967_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006065Abnormal spindle-like microcephaly-associated protein homolog dd_Smed_v4_15726_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000667239S ribosomal protein L18SMESG000028266.1 dd_Smed_v4_2647_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007536Glycerol kinaseSMESG000032910.1 SMESG000032921.1 dd_Smed_v4_286_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005862Carbonyl reductase 1SMESG000009833.1 dd_Smed_v4_2165_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005029SMED30005029SMESG000069925.1 dd_Smed_v4_13790_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018486Pre-mRNA-splicing factor 38ASMESG000012763.1 dd_Smed_v4_3382_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019021Importin-5SMESG000071264.1 SMESG000047886.1 dd_Smed_v4_665_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003577Enhancer of yellow 2 transcription factorSMESG000004606.1 SMESG000004604.1 dd_Smed_v4_928_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013338Protein kinase domain-containing proteinSMESG000030798.1 dd_Smed_v4_4255_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005171SMED30005171SMESG000024345.1 dd_Smed_v4_629_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004366Tyrosine-protein kinase receptorSMESG000063632.1 SMESG000063625.1 SMESG000063624.1 dd_Smed_v4_8973_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003704SMED30003704SMESG000043698.1 dd_Smed_v4_1603_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000068639S ribosomal protein L51 mitochondrialSMESG000052255.1 SMESG000050605.1 dd_Smed_v4_5659_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026658SMED30026658SMESG000008925.1 dd_Smed_v4_376_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030498DUF862 domain-containing proteinSMESG000024663.1 dd_Smed_v4_1296_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034338SMED30034338SMESG000004213.1 dd_Smed_v4_9017_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022975Homeobox protein DTH-2SMESG000037282.1 dd_Smed_v4_6729_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032258TIR domain-containing proteinSMESG000006301.1 dd_Smed_v4_11412_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033595Lipase_GDSL domain-containing proteinSMESG000081136.1 dd_Smed_v4_6241_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033583SMED30033583SMESG000060313.1 SMESG000049383.1 dd_Smed_v4_158_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031235Tubulin alpha chainSMESG000017700.1 dd_Smed_v4_648_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021063SMED30021063SMESG000025889.1 dd_Smed_v4_17_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3002128728S ribosomal protein S18b mitochondrialSMESG000039826.1 dd_Smed_v4_3535_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023063Helicase POLQ-like protein dd_Smed_v4_13290_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024602SMED30024602SMESG000064764.1 dd_Smed_v4_14271_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023411slc42a-1SMESG000048378.1 dd_Smed_v4_11756_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034751Elongation factor G, mitochondrialSMESG000035436.1 dd_Smed_v4_1879_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031080KH domain-containing proteinSMESG000004103.1 dd_Smed_v4_1578_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022935Small ubiquitin-related modifierSMESG000056595.1 dd_Smed_v4_265_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022238Histone-binding protein RBBP4SMESG000062893.1 dd_Smed_v4_5055_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029738Cytochrome b-c1 complex subunit Rieske, mitochondrialSMESG000009447.1 dd_Smed_v4_1515_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030542Dynein light chainSMESG000003543.1 dd_Smed_v4_310_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021532Pre-mRNA-splicing factor syf2SMESG000009253.1 dd_Smed_v4_3218_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033663SMED30033663SMESG000054684.1 SMESG000054674.1 dd_Smed_v4_18196_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033663SMED30033663SMESG000054684.1 SMESG000054674.1 dd_Smed_v4_13582_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026225SMED30026225SMESG000059698.1 dd_Smed_v4_188_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023288SMED30023288SMESG000064764.1 dd_Smed_v4_14271_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030295Peroxiredoxin-1SMESG000024235.1 dd_Smed_v4_3517_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026659ribonucleoside diphosphate reductase subunit M2SMESG000014842.1 dd_Smed_v4_5862_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020640Mitochondrial genome maintenance exonuclease 1SMESG000050961.1 dd_Smed_v4_14245_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027697SMED30027697SMESG000012408.1 dd_Smed_v4_1776_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027916DNA-directed RNA polymerases I, II, and III subunit RPABC2SMESG000043360.1 dd_Smed_v4_3539_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022891tRNA N6-adenosine threonylcarbamoyltransferaseSMESG000003633.1 dd_Smed_v4_3150_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025294rRNA 2'-O-methyltransferase fibrillarinSMESG000051648.1 dd_Smed_v4_2811_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3002814060S ribosomal protein L22SMESG000001806.1 dd_Smed_v4_230_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021722Protein-tyrosine phosphatase mitochondrial 1-like proteinSMESG000010568.1 dd_Smed_v4_6276_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032193ATP-dependent RNA helicase DDX24SMESG000016093.1 dd_Smed_v4_7310_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034637SMED30034637SMESG000043348.1 SMESG000043344.1 dd_Smed_v4_6826_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034709DNA polymerase etaSMESG000019761.1 SMESG000010350.1 SMESG000010346.1 dd_Smed_v4_6500_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022575pescadillo-1SMESG000032689.1 dd_Smed_v4_900_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024309Isocitrate dehydrogenase [NADP]SMESG000049154.1 dd_Smed_v4_449_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030766Y box protein-1SMESG000058066.1 dd_Smed_v4_52_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022128ATP synthase subunit betaSMESG000036539.1 dd_Smed_v4_745_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026124Dynein heavy chain, axonemalSMESG000040511.1 SMESG000040510.1 SMESG000040507.1 dd_Smed_v4_10846_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003051SMED30003051SMESG000072417.1 dd_Smed_v4_6349_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008261SMED30008261SMESG000014357.1 dd_Smed_v4_5737_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013542SMED30013542SMESG000052945.1 SMESG000027762.1 dd_Smed_v4_236_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000353SMED30000353SMESG000062780.1 dd_Smed_v4_7503_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002318Mediator of RNA polymerase II transcription subunit 22SMESG000029018.1 dd_Smed_v4_8119_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014447SMED30014447SMESG000033944.1 SMESG000018200.1 dd_Smed_v4_5651_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000639Microtubule-actin cross-linking factor 1-like isoform X28SMESG000017517.1 SMESG000017520.1 SMESG000017519.1 dd_Smed_v4_6577_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004640Hydroxysteroid dehydrogenase-like protein 2SMESG000049117.1 dd_Smed_v4_956_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013212Histone H2ASMESG000015784.1 dd_Smed_v4_469_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005554SMED30005554SMESG000016237.1 SMESG000033358.1 dd_Smed_v4_507_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000344260S ribosomal protein L23SMESG000023040.1 dd_Smed_v4_242_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014415Protein FAM32ASMESG000034920.1 dd_Smed_v4_1341_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003894SMED30003894SMESG000063428.1 dd_Smed_v4_7289_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018834SMED30018834SMESG000010762.1 dd_Smed_v4_3061_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005681Nkap_C domain-containing proteinSMESG000023380.1 dd_Smed_v4_6988_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017018SMED30017018SMESG000007294.1 dd_Smed_v4_371_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018944SMED30018944SMESG000028183.1 dd_Smed_v4_592_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3001361360S ribosomal protein L26SMESG000066644.1 dd_Smed_v4_235_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016064ATP synthase subunit gammaSMESG000008050.1 dd_Smed_v4_720_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000949Tgs-1SMESG000058876.1 dd_10988dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30000949Tgs-1SMESG000058876.1 dd_Smed_v4_10988_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013979SMED30013979SMESG000035951.1 dd_Smed_v4_4151_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019860SMED30019860SMESG000018897.1 dd_Smed_v4_6177_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013157KHD-1SMESG000070471.1 dd_Smed_v4_294_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002872Tgs-1SMESG000058876.1 dd_10988dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30002872Tgs-1SMESG000058876.1 dd_Smed_v4_10988_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014582SMED30014582SMESG000061527.1 dd_Smed_v4_8888_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018964mediator complex 7SMESG000079767.1 dd_Smed_v4_5572_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018385Hydroxyacyl-coenzyme A dehydrogenase, mitochondrialSMESG000032777.1 dd_Smed_v4_725_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000985940S ribosomal protein S24SMESG000035929.1 dd_Smed_v4_164_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000270Histone H3SMESG000049112.1 SMESG000049109.1 dd_Smed_v4_532_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3001160940S ribosomal protein S3SMESG000016955.1 dd_Smed_v4_269_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019045Retrovirus-related Pol polyprotein from type-1 retrotransposable element R2SMESG000008724.1 SMESG000008723.1 dd_Smed_v4_5504_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003905Far upstream element-binding proteinSMESG000037106.1 dd_Smed_v4_812_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000378SMED30000378SMESG000061591.1 dd_Smed_v4_512_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007287Nucleolar GTP-binding protein 1SMESG000074998.1 dd_Smed_v4_764_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017019NADH:ubiquinone oxidoreductase complex assembly factor 2SMESG000006742.1 dd_Smed_v4_7400_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000928360S ribosomal protein L18aSMESG000060163.1 dd_Smed_v4_437_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002262Heat shock cognate 71 kDa proteinSMESG000051570.1 SMESG000051567.1 SMESG000051541.1 SMESG000051540.1 dd_Smed_v4_320_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017098Chaperone protein DnaJSMESG000015446.1 dd_Smed_v4_9791_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007498Ribosomal protein L19SMESG000057653.1 dd_Smed_v4_228_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014130ATP synthase subunit fSMESG000067649.1 SMESG000060121.1 dd_Smed_v4_776_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3001029128S ribosomal protein S14SMESG000066757.1 dd_Smed_v4_4035_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002911LipaseSMESG000074187.1 SMED_24410_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30002911LipaseSMESG000074187.1 SMED_24410_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30002911LipaseSMESG000074187.1 SMED_01065_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30002911LipaseSMESG000074187.1 SMED_01065_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30002877IQ motif and SEC7 domain-containing protein 2SMESG000070179.1 SMED_07038_V2_2GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30002877IQ motif and SEC7 domain-containing protein 2SMESG000070179.1 SMED_07038_V2_2GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30002877IQ motif and SEC7 domain-containing protein 2SMESG000070179.1 SmWIOct06_016157GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30002877IQ motif and SEC7 domain-containing protein 2SMESG000070179.1 SMED_07038_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30002877IQ motif and SEC7 domain-containing protein 2SMESG000070179.1 SMED_07038_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30019647Serine-protein kinase ATMSMESG000023629.1 SMED_14513_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30019647Serine-protein kinase ATMSMESG000023629.1 SMED_14513_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30014925ATP-dependent DNA helicase DDX11SMESG000025070.1 SMED_13419_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30014925ATP-dependent DNA helicase DDX11SMESG000025070.1 SMED_13419_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30014925ATP-dependent DNA helicase DDX11SMESG000025070.1 SMED_10972_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30014925ATP-dependent DNA helicase DDX11SMESG000025070.1 SMED_10972_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30004407DNA polymeraseSMESG000033372.1 SmWIOct06_028601GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30004407DNA polymeraseSMESG000033372.1 SmWIOct06_037845GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30004407DNA polymeraseSMESG000033372.1 SmWIOct06_019067GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30004407DNA polymeraseSMESG000033372.1 SMED_07764_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30004407DNA polymeraseSMESG000033372.1 SMED_07764_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30004407DNA polymeraseSMESG000033372.1 SmWIOct06_013095GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30004407DNA polymeraseSMESG000033372.1 SmWIOct06_038736GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30014572Cell division cycle protein 16SMESG000050387.1 SMED_14055_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30014572Cell division cycle protein 16SMESG000050387.1 SMED_14055_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30014572Cell division cycle protein 16SMESG000050387.1 SMED_34800_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30014572Cell division cycle protein 16SMESG000050387.1 SMED_34800_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30018395WD_REPEATS_REGION domain-containing proteinSMESG000032761.1 SMED_20702_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30018395WD_REPEATS_REGION domain-containing proteinSMESG000032761.1 SMED_20702_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30018649Regulator of telomere elongation helicase 1 homologSMESG000018012.1 SMED_23278_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30018649Regulator of telomere elongation helicase 1 homologSMESG000018012.1 SMED_23278_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30018649Regulator of telomere elongation helicase 1 homologSMESG000018012.1 SmWIOct06_026635GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30018649Regulator of telomere elongation helicase 1 homologSMESG000018012.1 SMED_10849_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30018649Regulator of telomere elongation helicase 1 homologSMESG000018012.1 SMED_10849_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30008015slc25a-14SMESG000015827.1 SMED_16535_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30008015slc25a-14SMESG000015827.1 SMED_16535_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30008015slc25a-14SMESG000015827.1 SMED_32127_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30008015slc25a-14SMESG000015827.1 SMED_32127_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30018210SMED30018210SMESG000002162.1 SMED_17231_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30018210SMED30018210SMESG000002162.1 SMED_17231_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30007934eukaryotic translation initiation factor 3 subunit CSMESG000025491.1 SMED_03255_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30007934eukaryotic translation initiation factor 3 subunit CSMESG000025491.1 SMED_03255_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30007934eukaryotic translation initiation factor 3 subunit CSMESG000025491.1 SmWIOct06_006962GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30017456epidermal growth factor receptor 3SMESG000016935.1 SMED_32179_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30016975histone H2ASMESG000049774.1 SMED_24237_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30016975histone H2ASMESG000049774.1 SMED_24237_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30009651NSD-1SMESG000015015.1 SMED_07236_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30009651NSD-1SMESG000015015.1 SMED_07236_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30009651NSD-1SMESG000015096.1 SMESG000015015.1 SMED_07236_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30009651NSD-1SMESG000015096.1 SMESG000015015.1 SMED_07236_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30009651NSD-1SMESG000015015.1 SmWIOct06_025372GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30009651NSD-1SMESG000015015.1 SMED_23187_V2_2GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30009651NSD-1SMESG000015015.1 SMED_23187_V2_2GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30009651NSD-1SMESG000015015.1 SMED_20741_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30009651NSD-1SMESG000015015.1 SMED_20741_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30009651NSD-1SMESG000015015.1 SmWIOct06_025395GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30009651NSD-1SMESG000015096.1 SMESG000015015.1 SMED30009651smed_20140614PMID:22385657
Wagner et al., 2012
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30009651NSD-1SMESG000015096.1 SMESG000015015.1 SMED30009651smed_20140614PMID:22385657
Wagner et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30023062bruno-likeSMESG000021009.1 DQ344977.2smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
neoblastSMED30023062bruno-likeSMESG000021009.1 ABC70476.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
neoblastSMED30023062bruno-likeSMESG000021009.1 ABC70476.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
neoblastSMED30023062bruno-likeSMESG000021009.1 ABC70476.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
neoblastSMED30007567Lysosomal trafficking regulatorSMESG000069984.1 SMESG000069981.1 SMED30014446smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
neoblastSMED30007567Lysosomal trafficking regulatorSMESG000069984.1 SMESG000069981.1 SMED30014446smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
neoblastSMED30007567Lysosomal trafficking regulatorSMESG000069984.1 SMESG000069981.1 SMED30014446smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
neoblastSMED30007567Lysosomal trafficking regulatorSMESG000069984.1 SMESG000069981.1 DQ186986.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
neoblastSMED30007567Lysosomal trafficking regulatorSMESG000069984.1 SMESG000069981.1 DQ186986.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
neoblastSMED30007567Lysosomal trafficking regulatorSMESG000069984.1 SMESG000069981.1 DQ186986.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
neoblastSMED30014446SMEDWI-2SMESG000069984.1 SMESG000069981.1 SMED30014446smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
neoblastSMED30014446SMEDWI-2SMESG000069984.1 SMESG000069981.1 SMED30014446smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
neoblastSMED30014446SMEDWI-2SMESG000069984.1 SMESG000069981.1 SMED30014446smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
neoblastSMED30014446SMEDWI-2SMESG000069984.1 SMESG000069981.1 DQ186986.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
neoblastSMED30014446SMEDWI-2SMESG000069984.1 SMESG000069981.1 DQ186986.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
neoblastSMED30014446SMEDWI-2SMESG000069984.1 SMESG000069981.1 DQ186986.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
neoblastSMED30001362SMEDWI-3SMESG000081970.1 ACC97187.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
neoblastSMED30001362SMEDWI-3SMESG000081970.1 ACC97187.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
neoblastSMED30001362SMEDWI-3SMESG000081970.1 ACC97187.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
neoblastSMED30001362SMEDWI-3SMESG000081970.1 EU586258.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
neoblastSMED30001362SMEDWI-3SMESG000081970.1 EU586258.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
neoblastSMED30001362SMEDWI-3SMESG000081970.1 EU586258.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
neoblastSMED30001362SMEDWI-3SMESG000081970.1 SMED30001362smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
neoblastSMED30001362SMEDWI-3SMESG000081970.1 SMED30001362smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
neoblastSMED30001362SMEDWI-3SMESG000081970.1 SMED30001362smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
neoblastSMED30035063SOXP-2SMESG000074761.1 SMED30035063smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
neoblastSMED30035063SOXP-2SMESG000074761.1 SMED30035063smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
neoblastSMED30035063SOXP-2SMESG000074761.1 SMED30035063smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
neoblastSMED30035063SOXP-2SMESG000074761.1 JQ425152.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
neoblastSMED30035063SOXP-2SMESG000074761.1 JQ425152.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
neoblastSMED30035063SOXP-2SMESG000074761.1 JQ425152.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
neoblastSMED30035063SOXP-2SMESG000074761.1 AFD29620.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
neoblastSMED30035063SOXP-2SMESG000074761.1 AFD29620.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
neoblastSMED30035063SOXP-2SMESG000074761.1 AFD29620.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
neoblastSMED30004304Proliferating cell nuclear antigen EU856391smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
neoblastSMED30004304Proliferating cell nuclear antigen EU856391smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
neoblastSMED30004304Proliferating cell nuclear antigen EU856391smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
neoblastSMED30004304Proliferating cell nuclear antigen SMED30004304smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
neoblastSMED30004304Proliferating cell nuclear antigen SMED30004304smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
neoblastSMED30004304Proliferating cell nuclear antigen SMED30004304smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
neoblastSMED30013909tud-1SMESG000029236.1 SMESG000029232.1 SMED30013909smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
neoblastSMED30013909tud-1SMESG000029236.1 SMESG000029232.1 SMED30013909smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
neoblastSMED30013909tud-1SMESG000029236.1 SMESG000029232.1 SMED30013909smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
neoblastSMED30013909tud-1SMESG000029236.1 SMESG000029232.1 KF781126smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
neoblastSMED30013909tud-1SMESG000029236.1 SMESG000029232.1 KF781126smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
neoblastSMED30013909tud-1SMESG000029236.1 SMESG000029232.1 KF781126smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
neoblastSMED30013909tud-1SMESG000029236.1 SMESG000029232.1 tud-1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
neoblastSMED30013909tud-1SMESG000029236.1 SMESG000029232.1 tud-1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
neoblastSMED30013909tud-1SMESG000029236.1 SMESG000029232.1 tud-1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
neoblastSMED30019097SOXP-1SMESG000010063.1 AFD29619.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
neoblastSMED30019097SOXP-1SMESG000010063.1 AFD29619.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
neoblastSMED30019097SOXP-1SMESG000010063.1 AFD29619.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
neoblastSMED30019097SOXP-1SMESG000010063.1 SMED30019097smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
neoblastSMED30019097SOXP-1SMESG000010063.1 SMED30019097smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
neoblastSMED30019097SOXP-1SMESG000010063.1 SMED30019097smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
neoblastSMED30019097SOXP-1SMESG000010063.1 JQ425151.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
neoblastSMED30019097SOXP-1SMESG000010063.1 JQ425151.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
neoblastSMED30019097SOXP-1SMESG000010063.1 JQ425151.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
neoblastSMED30007406SMEDWI-1SMESG000036375.1 SMED30007406smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
neoblastSMED30007406SMEDWI-1SMESG000036375.1 SMED30007406smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
neoblastSMED30007406SMEDWI-1SMESG000036375.1 SMED30007406smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
neoblastSMED30007406SMEDWI-1SMESG000036375.1 DQ186985.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
neoblastSMED30007406SMEDWI-1SMESG000036375.1 DQ186985.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
neoblastSMED30007406SMEDWI-1SMESG000036375.1 DQ186985.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
neoblastSMED30001900Bruno-like proteinSMESG000046617.1 SMED30001900smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
neoblastSMED30001900Bruno-like proteinSMESG000046617.1 SMED30001900smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
neoblastSMED30001900Bruno-like proteinSMESG000046617.1 SMED30001900smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
neoblastSMED30035880methyl-CpG binding domain 2/3SMESG000064034.1 KF664582smed_ncbi_20200123PMID:24063805
Jaber-Hijazi et al., 2013
whole organism juvenile colorimetric in situ hybridization evidence
neoblastSMED30035880methyl-CpG binding domain 2/3SMESG000064034.1 KF664582smed_ncbi_20200123PMID:24063805
Jaber-Hijazi et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30035880methyl-CpG binding domain 2/3SMESG000064034.1 KF664582smed_ncbi_20200123PMID:24063805
Jaber-Hijazi et al., 2013
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
neoblastSMED30035858SMED30035858SMESG000064034.1 KF664582smed_ncbi_20200123PMID:24063805
Jaber-Hijazi et al., 2013
whole organism juvenile colorimetric in situ hybridization evidence
neoblastSMED30035858SMED30035858SMESG000064034.1 KF664582smed_ncbi_20200123PMID:24063805
Jaber-Hijazi et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30035858SMED30035858SMESG000064034.1 KF664582smed_ncbi_20200123PMID:24063805
Jaber-Hijazi et al., 2013
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
neoblastSMED30007567Lysosomal trafficking regulatorSMESG000069984.1 SMESG000069981.1 DQ186986smed_ncbi_20200123PMID:16311336
Reddien et al., 2005
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30014446SMEDWI-2SMESG000069984.1 SMESG000069981.1 DQ186986smed_ncbi_20200123PMID:16311336
Reddien et al., 2005
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30007406SMEDWI-1SMESG000036375.1 DQ186985smed_ncbi_20200123PMID:16311336
Reddien et al., 2005
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30017456epidermal growth factor receptor 3SMESG000016935.1 HM777016smed_ncbi_20200123PMID:21458439
Fraguas et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30010167Transcriptional repressor p66-betaSMESG000077622.1 EC615093ncbi_smed_estsPMID:27606067
Vásquez-Doorman et al., 2016
whole organism asexual adult RNA-sequencing evidence
neoblastSMED30010167Transcriptional repressor p66-betaSMESG000077622.1 EC615093ncbi_smed_estsPMID:27606067
Vásquez-Doorman et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30001362SMEDWI-3SMESG000081970.1 EU586258smed_ncbi_20200123PMID:18456843
Palakodeti et al., 2008
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
neoblastSMED30024368chromodomain helicase DNA-binding protein 4SMESG000068192.1 GU980571.1smed_ncbi_20200123PMID:20223763
Scimone et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30024368chromodomain helicase DNA-binding protein 4SMESG000068192.1 GU980571.1smed_ncbi_20200123PMID:20223763
Scimone et al., 2010
FACS sorted cell population asexual adult fluorescence in situ hybridization evidence
neoblastSMED30009514histone H2BSMESG000067931.1 DN298006ncbi_smed_estsPMID:28976975
Su et al., 2017
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30006369Integrin betaSMESG000045564.1 KU961518.1smed_ncbi_20200123PMID:28893948
Abnave et al., 2017
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30023573SnailSMESG000064846.1 KJ934814.1smed_ncbi_20200123PMID:28893948
Abnave et al., 2017
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30004536Snail-1SMESG000076673.1 KY964486smed_ncbi_20200123PMID:28893948
Abnave et al., 2017
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30026364SMED-P53SMESG000078256.1 AY068713.3smed_ncbi_20200123PMID:20040488
Pearson et al., 2010
FACS sorted cell population asexual adult fluorescence in situ hybridization evidence
neoblastSMED30026364SMED-P53SMESG000078256.1 AY068713.3smed_ncbi_20200123PMID:20040488
Pearson et al., 2010
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30007567Lysosomal trafficking regulatorSMESG000069981.1 SMESG000069984.1 DN303300ncbi_smed_estsPMID:16344473
Zayas et al., 2005
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
neoblastSMED30014446SMEDWI-2SMESG000069981.1 SMESG000069984.1 DN303300ncbi_smed_estsPMID:16344473
Zayas et al., 2005
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
neoblastSMED30001362SMEDWI-3SMESG000081970.1 DN315298ncbi_smed_estsPMID:16344473
Zayas et al., 2005
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
neoblastSMED30007406SMEDWI-1SMESG000036375.1 DN313409ncbi_smed_estsPMID:16344473
Zayas et al., 2005
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
neoblastSMED30023062bruno-likeSMESG000021009.1 SMED30023062smed_20140614PMID:26457503
Tu et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30023708ZFP-1SMESG000066384.1 SMED30023708smed_20140614PMID:26457503
Tu et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30002349GATA456-2SMESG000022702.1 dd_Smed_v4_9910_0_1dd_Smed_v4PMID:30471994
Scimone et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031351GATA-binding factor 2SMESG000028503.1 dd_Smed_v4_8208_0_1dd_Smed_v4PMID:30471994
Scimone et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023062bruno-likeSMESG000021009.1 DQ344977.2smed_ncbi_20200123PMID:29357350
de Sousa et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30007406SMEDWI-1SMESG000036375.1 DQ186985.1smed_ncbi_20200123PMID:29357350
de Sousa et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30007406SMEDWI-1SMESG000036375.1 DQ186985.1smed_ncbi_20200123PMID:29357350
de Sousa et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30009514histone H2BSMESG000067931.1 DN298006ncbi_smed_estsPMID:24523458
Lin et al., 2014
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED300224045'-tyrosyl-DNA phosphodiesteraseSMESG000024529.1 dd_Smed_v4_12962_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028428Poly [ADP-ribose] polymeraseSMESG000045968.1 dd_Smed_v4_10338_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027700Lipoyl synthase, mitochondrialSMESG000004184.1 SMESG000004174.1 dd_Smed_v4_19176_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025421exonuclease 1-likeSMESG000064333.1 dd_Smed_v4_14547_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025981SMED30025981SMESG000059781.1 dd_Smed_v4_12332_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027419msh6SMESG000073017.1 dd_Smed_v4_15463_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023274Casein kinase I isoform gamma-1SMESG000007869.1 SMESG000007858.1 SMESG000007847.1 dd_Smed_v4_172_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026367Bifunctional polynucleotide phosphatase/kinaseSMESG000034225.1 dd_Smed_v4_1211_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025141SMED30025141SMESG000076211.1 SMESG000047610.1 dd_Smed_v4_2124_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034520RAD51SMESG000056159.1 dd_Smed_v4_8626_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026157GAS2-like 3SMESG000003786.1 SMESG000003788.1 SMESG000003787.1 dd_Smed_v4_3326_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021536Splicing factor 3A subunit 1SMESG000072847.1 dd_Smed_v4_1001_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021711DNA-binding proteinSMESG000070983.1 dd_Smed_v4_2102_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3002234826S proteasome non-ATPase regulatory subunit 1SMESG000004988.1 dd_Smed_v4_1149_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025780Serine/threonine-protein kinase PLKSMESG000022441.1 dd_Smed_v4_4273_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030135AAA domain-containing proteinSMESG000045800.1 dd_Smed_v4_14599_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029741SMED30029741SMESG000056346.1 dd_Smed_v4_2250_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023487Protein LSM14 homolog B-ASMESG000014632.1 dd_Smed_v4_1125_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001476Transcriptional repressor protein YY1B dd_Smed_v4_6684_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016754SMED30016754SMESG000022487.1 dd_Smed_v4_8822_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006959H/ACA ribonucleoprotein complex subunitSMESG000056130.1 dd_Smed_v4_3239_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009134SMED30009134SMESG000022478.1 dd_Smed_v4_4419_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017944TetraspaninSMESG000080008.1 dd_Smed_v4_2907_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006506Histone acetyltransferaseSMESG000049001.1 dd_Smed_v4_4706_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011303Syndecan binding protein (Syntenin) dd_Smed_v4_387_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003593Structural maintenance of chromosomes proteinSMESG000017173.1 SMESG000017172.1 dd_Smed_v4_3809_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012822heterogeneous nuclear ribonucleoprotein A1 A2/B1SMESG000081075.1 dd_Smed_v4_986_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013386netrin 1SMESG000006806.1 dd_Smed_v4_9795_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019800Tyrosine protein kinase-7 dd_Smed_v4_19037_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016279X1.B.G6.2SMESG000023119.1 dd_Smed_v4_6097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012773Transformer 2 proteinSMESG000022369.1 dd_Smed_v4_2971_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012212NADH dehydrogenase subunit 1 dd_Smed_v4_258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013571NADH dehydrogenase subunit 4L dd_Smed_v4_344_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000702cytochrome b dd_Smed_v4_344_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000723528S ribosomal protein S30, mitochondrialSMESG000042375.1 dd_Smed_v4_8469_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006696DNA-directed RNA polymerases I, II, and III subunit RPABC3 dd_Smed_v4_3675_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3001198260S ribosomal protein L17SMESG000009564.1 dd_Smed_v4_95_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004019SMED30004019SMESG000075505.1 dd_Smed_v4_8346_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010074TTF-type domain-containing proteinSMESG000076895.1 dd_Smed_v4_5933_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005334SMED30005334 dd_Smed_v4_344_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012993Cytochrome b-c1 complex subunit 6SMESG000040616.1 dd_Smed_v4_277_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003997SMED30003997SMESG000059318.1 SMESG000059304.1 dd_Smed_v4_483_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002603SMED30002603SMESG000053020.1 SMESG000053011.1 dd_Smed_v4_597_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016026SMED30016026SMESG000023441.1 dd_Smed_v4_4745_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018542slc4a-1SMESG000024335.1 dd_Smed_v4_3003_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019578Pre-mRNA-splicing factor ISY1 dd_Smed_v4_3703_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000480860S ribosomal protein L27aSMESG000005086.1 dd_Smed_v4_549_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006359Retrovirus-related Pol polyprotein from type-2 retrotransposable element R2DM dd_Smed_v4_32082_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009147SMED30009147 dd_Smed_v4_782_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000398760S ribosomal protein L29 dd_Smed_v4_481_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005997SMED30005997SMESG000050405.1 dd_Smed_v4_1663_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004441Origin recognition complex subunit 5SMESG000055362.1 SMESG000054627.1 dd_Smed_v4_12818_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005626Chromobox homolog 3a (HP1 gamma homolog, Drosophila)SMESG000039690.1 dd_Smed_v4_12608_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005626Chromobox homolog 3a (HP1 gamma homolog, Drosophila)SMESG000039690.1 dd_Smed_v4_8960_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016181Protein regulator of cytokinesis 1aSMESG000006500.1 dd_Smed_v4_12013_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018630High mobility group proteinSMESG000052032.1 dd_Smed_v4_1331_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011413Histone H2ASMESG000022910.1 SMESG000006040.1 dd_Smed_v4_12365_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006391SMED30006391SMESG000026399.1 dd_Smed_v4_110_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017670N-terminal Xaa-Pro-Lys N-methyltransferase 1SMESG000059668.1 dd_Smed_v4_1236_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011181fidgetin-like protein 1SMESG000045800.1 dd_Smed_v4_14599_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010451DNA polymerase epsilon catalytic subunitSMESG000044743.1 SMESG000044635.1 dd_Smed_v4_13980_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010896DNA ligaseSMESG000046648.1 dd_Smed_v4_7382_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017595RBBP4-1SMESG000037114.1 dd_Smed_v4_5609_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016537SMED30016537SMESG000072339.1 dd_Smed_v4_16549_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031929zf-LYAR domain-containing proteinSMESG000081140.1 dd_Smed_v4_5281_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3002737860S ribosomal protein L3SMESG000022732.1 dd_Smed_v4_127_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020733SMED30020733SMESG000013963.1 SMESG000013955.1 dd_Smed_v4_14808_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3002552260 kDa heat shock protein, mitochondrialSMESG000065325.1 dd_Smed_v4_141_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022560Ribosomal_L28e domain-containing proteinSMESG000026745.1 dd_Smed_v4_221_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024115Ubiquitin-40S ribosomal protein S27aSMESG000048830.1 dd_Smed_v4_121_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3002728060S acidic ribosomal protein P0SMESG000079482.1 dd_Smed_v4_161_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027991L-2-hydroxyglutarate dehydrogenase, mitochondrialSMESG000046453.1 SMESG000024353.1 dd_Smed_v4_1758_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020615prohibitin-1SMESG000021272.1 dd_Smed_v4_1089_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020070High mobility group protein B1SMESG000034017.1 dd_Smed_v4_1095_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021111Transcription initiation factor TFIID subunit 13SMESG000020879.1 dd_Smed_v4_11507_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021037RibonucloproteinSMESG000027962.1 dd_Smed_v4_1928_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023910Pogo transposable element with ZNF domainSMESG000014324.1 dd_Smed_v4_2118_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020464SMED30020464SMESG000013963.1 SMESG000013955.1 dd_Smed_v4_14808_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028154Serine/threonine kinase 33SMESG000076986.1 SMESG000076975.1 dd_Smed_v4_12461_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027904pre-mRNA-processing factor 19SMESG000078592.1 SMESG000045321.1 SMESG000045309.1 SMESG000020077.1 dd_Smed_v4_1276_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020216U6 snRNA-associated Sm-like protein LSm3SMESG000072617.1 dd_Smed_v4_1641_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023477Small nuclear ribonucleoprotein Sm D1SMESG000062388.1 dd_Smed_v4_1826_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024468SMED30024468SMESG000047438.1 SMESG000028235.1 dd_Smed_v4_12953_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001257NADH dehydrogenase [ubiquinone] flavoprotein 1, mitochondrialSMESG000074136.1 dd_Smed_v4_1843_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012289DnaJ homolog, subfamily C, member 8SMESG000074000.1 dd_Smed_v4_3872_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013303SAFB-like, transcription modulatorSMESG000004509.1 dd_Smed_v4_3681_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017135Dual specificity mitogen-activated protein kinase kinase 6SMESG000017824.1 dd_Smed_v4_1568_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001362SMEDWI-3SMESG000081970.1 dd_Smed_v4_1258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000665SMED30000665SMESG000025288.1 dd_Smed_v4_19210_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013425NADH dehydrogenase ubiquinone 1 betaSMESG000011219.1 dd_Smed_v4_2640_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017928SMED30017928SMESG000053935.1 dd_Smed_v4_4129_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017965SMED30017965SMESG000067645.1 SMESG000001051.1 dd_Smed_v4_11647_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007143Nucleolar GTP-binding protein 2SMESG000026847.1 dd_Smed_v4_1134_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000621640S ribosomal protein S8SMESG000047167.1 dd_Smed_v4_156_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3001420439S ribosomal protein L16SMESG000062742.1 dd_Smed_v4_2977_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012280dTTP/UTP pyrophosphataseSMESG000072046.1 dd_Smed_v4_4785_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002927SAM domain-containing proteinSMESG000041461.1 dd_Smed_v4_19710_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018440Cell division cycle 37 homolog (S. cerevisiae)SMESG000007277.1 dd_Smed_v4_779_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004903Cytochrome b-c1 complex subunit 2, mitochondrialSMESG000064836.1 dd_Smed_v4_1004_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011685SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily E member 1SMESG000020191.1 dd_Smed_v4_5085_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001192ras-related protein Rab-14SMESG000066109.1 SMESG000052687.1 SMESG000014240.1 SMESG000069832.1 SMESG000037642.1 dd_Smed_v4_106_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014136Centrosome-associated protein 350SMESG000069358.1 dd_Smed_v4_20651_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005823Protein kinase N2SMESG000014536.1 SMESG000014533.1 dd_Smed_v4_7015_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004081SMED30004081SMESG000040291.1 dd_Smed_v4_1144_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000140SAM domain-containing proteinSMESG000041461.1 dd_Smed_v4_19710_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000883926S proteasome non-ATPase regulatory subunit 12SMESG000057467.1 dd_Smed_v4_2546_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013600Ring box proteinSMESG000036014.1 dd_Smed_v4_1136_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3001360660S ribosomal protein L7SMESG000022296.1 dd_Smed_v4_276_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3001990360S ribosomal protein L13aSMESG000041483.1 dd_Smed_v4_287_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012816AminomethyltransferaseSMESG000012592.1 dd_Smed_v4_3994_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007343Tud-1SMESG000043684.1 dd_Smed_v4_3741_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020717Mitochondrial import inner membrane translocase subunit TIM50SMESG000025690.1 dd_Smed_v4_2469_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035880methyl-CpG binding domain 2/3SMESG000064034.1 SMESG000064035.1 dd_Smed_v4_3054_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3003144714-3-3 protein beta/alphaSMESG000067831.1 dd_Smed_v4_5419_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023745SMED30023745SMESG000016314.1 dd_Smed_v4_4907_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020614ATP-dependent RNA helicase DBP2SMESG000033349.1 dd_Smed_v4_594_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020925Pre-mRNA-processing-splicing factor 8SMESG000033553.1 SMESG000033568.1 SMESG000033550.1 dd_Smed_v4_2504_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026560SMED30026560SMESG000037542.1 dd_Smed_v4_6734_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026710Ubiquitin carboxyl-terminal hydrolaseSMESG000006297.1 dd_Smed_v4_7488_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028415replication factor C subunit 2SMESG000041142.1 SMESG000041132.1 dd_Smed_v4_8732_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027654tRNA-specific adenosine deaminase 1SMESG000016199.1 dd_Smed_v4_9448_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024926SMED30024926SMESG000006818.1 dd_Smed_v4_7539_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030350SMED30030350SMESG000053935.1 dd_Smed_v4_4129_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027701ATP dependent RNA helicase DDX5SMESG000012031.1 dd_Smed_v4_3816_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027781Retinoblastoma binding protein-1SMESG000007931.1 dd_Smed_v4_7612_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3002315960S acidic ribosomal protein P2SMESG000009232.1 dd_Smed_v4_96_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021079Splicing factor 3B subunit 2SMESG000041240.1 dd_Smed_v4_6657_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024961Transformer-2 betaSMESG000052833.1 dd_Smed_v4_4073_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020301SMED30020301SMESG000048277.1 dd_Smed_v4_5676_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024633SMED30024633SMESG000035561.1 dd_Smed_v4_2933_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022819SMED30022819SMESG000017227.1 dd_Smed_v4_8264_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029763histone H1SMESG000024348.1 SMESG000010800.1 dd_Smed_v4_601_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025326CD2 antigen cytoplasmic tail-binding protein 2SMESG000017285.1 dd_Smed_v4_3537_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025222H/ACA ribonucleoprotein complex subunit 4SMESG000029771.1 dd_Smed_v4_4087_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026515Bifunctional purine biosynthesis protein PURHSMESG000009882.1 dd_Smed_v4_3445_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021461Histone H2BSMESG000067906.1 dd_Smed_v4_4808_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3002751939S ribosomal protein L38, mitochondrialSMESG000074826.1 dd_Smed_v4_3715_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022982N(4)-(Beta-N-acetylglucosaminyl)-L-asparaginaseSMESG000003786.1 SMESG000003788.1 SMESG000003787.1 dd_Smed_v4_3326_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025331Lon protease homolog, mitochondrialSMESG000079071.1 dd_Smed_v4_3971_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027120G2/M phase-specific E3 ubiquitin-protein ligaseSMESG000026497.1 dd_Smed_v4_6301_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022627SMED30022627SMESG000053935.1 dd_Smed_v4_4504_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030213SMED30030213SMESG000012962.1 dd_Smed_v4_4581_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021388general transcription factor IIE 1SMESG000064941.1 dd_Smed_v4_8510_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023729Cold shock domain proteinSMESG000073546.1 dd_Smed_v4_392_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023981SMED30023981SMESG000026344.1 SMESG000026343.1 dd_Smed_v4_5515_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED3002653910 kDa heat shock protein, mitochondrialSMESG000000556.1 dd_Smed_v4_421_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035858SMED30035858SMESG000064034.1 SMESG000064035.1 dd_Smed_v4_3054_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026369Thiosulfate sulfurtransferase rhodanese-like domain-containing 1SMESG000003839.1 dd_Smed_v4_530_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026151WD repeat domain 82SMESG000059185.1 dd_Smed_v4_3926_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024389mitochondrial import receptor subunit TOM22 homologSMESG000027748.1 dd_Smed_v4_2455_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013735Elongation factor 1-alphaSMESG000061164.1 SMESG000061099.1 dd_Smed_v6_30_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013139SMED30013139SMESG000059266.1 SMESG000059254.1 dd_Smed_v6_301_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009035Zinc finger CCCH domain-containing protein 4SMESG000038705.1 dd_Smed_v6_6243_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017114Elongation factor 1-gammaSMESG000018714.1 dd_Smed_v6_308_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003764N-alpha-acetyltransferase 40SMESG000077166.1 dd_Smed_v6_5816_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3001096960S ribosomal protein L6SMESG000019835.1 dd_Smed_v6_839_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008579ST13 Hsp70 interacting proteinSMESG000071677.1 SMESG000069228.1 SMESG000017570.1 SMESG000017358.1 SMESG000017347.1 SMESG000013728.1 SMESG000001430.1 dd_Smed_v6_668_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030431U1 small nuclear ribonucleoprotein 70 kDaSMESG000010283.1 dd_Smed_v6_633_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022855Reactive oxygen species modulator 1 family proteinSMESG000039761.1 dd_Smed_v6_691_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034219PPM-type phosphatase domain-containing proteinSMESG000032910.1 SMESG000032921.1 dd_Smed_v6_286_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033077Histone H2BSMESG000077385.1 dd_Smed_v6_879_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3003108940S ribosomal protein S12SMESG000052688.1 dd_Smed_v6_268_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028145RNA polymerase-associated protein CTR9 homologSMESG000059268.1 dd_Smed_v6_2695_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3003581640S ribosomal protein S13SMESG000042470.1 SMESG000042447.1 dd_Smed_v6_360_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023430set nuclear proto-oncogeneSMESG000031906.1 SMESG000031905.1 dd_Smed_v6_618_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035831SMED30035831SMESG000046586.1 dd_Smed_v6_2725_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034697Testis-specific Y-encoded-like protein 1SMESG000027817.1 SMESG000027807.1 dd_Smed_v6_393_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030404Bifunctional glutamate/proline--tRNA ligaseSMESG000057140.1 dd_Smed_v6_2488_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032645Heterochromatin protein 1-1SMESG000004606.1 SMESG000004604.1 dd_Smed_v6_928_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020124Ribosome biogenesis regulatory proteinSMESG000071880.1 dd_Smed_v6_2458_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027407SERPINE1 mRNA binding protein 1aSMESG000008791.1 dd_Smed_v6_697_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035373histone deacetylase 1SMESG000060876.1 dd_Smed_v6_695_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009026ATP-dependent RNA helicase DDX3XSMESG000046974.1 SMESG000046953.1 dd_Smed_v6_799_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019011DNA repair protein RAD50SMESG000039247.1 SMESG000039215.1 dd_Smed_v6_11475_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019298Heterogeneous nuclear ribonucleoprotein LSMESG000005298.1 dd_Smed_v6_1327_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3001927340S ribosomal protein S3aSMESG000066540.1 SMESG000066537.1 dd_Smed_v6_163_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3001616360S ribosomal protein L27aSMESG000034631.1 dd_Smed_v6_155_1dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014446SMEDWI-2SMESG000069984.1 SMESG000069981.1 dd_Smed_v6_756_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008984Protein phosphatase 1GSMESG000030206.1 dd_Smed_v6_2086_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019834Guanine nucleotide-binding protein subunit beta-2-like 1SMESG000076568.1 dd_Smed_v6_174_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005206Serine/arginine-rich splicing factor 1SMESG000075205.1 dd_Smed_v6_1192_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000898760S ribosomal protein L13-like proteinSMESG000036992.1 dd_Smed_v6_145_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3001553460S ribosomal protein L21SMESG000040216.1 dd_Smed_v6_189_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005802SMED30005802SMESG000072483.1 dd_Smed_v6_5611_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019057SMED30019057SMESG000016216.1 dd_Smed_v6_2283_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015739Aldo-keto reductaseSMESG000081151.1 dd_Smed_v6_1044_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3001301840S ribosomal protein S6SMESG000000674.1 dd_Smed_v6_178_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005997SMED30005997SMESG000050405.1 dd_Smed_v6_1663_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018630High mobility group proteinSMESG000052032.1 dd_Smed_v6_1331_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006391SMED30006391SMESG000026399.1 dd_Smed_v6_110_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017670N-terminal Xaa-Pro-Lys N-methyltransferase 1SMESG000059668.1 dd_Smed_v6_1236_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031929zf-LYAR domain-containing proteinSMESG000081140.1 dd_Smed_v6_5281_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3002737860S ribosomal protein L3SMESG000022732.1 dd_Smed_v6_127_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034257CRAL-TRIO domain-containing proteinSMESG000009988.1 SMED_00966_V2_1rGPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED300266685-demethoxyubiquinone hydroxylase, mitochondrialSMESG000079448.1 SMED_05817_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED300266685-demethoxyubiquinone hydroxylase, mitochondrialSMESG000079448.1 SMED_05817_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30027770high mobility group-2SMESG000020771.1 SMED_09062_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30027770high mobility group-2SMESG000020771.1 SMED_09062_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30030681SMED30030681SMESG000038678.1 SMED_01590_V2_1rGPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30030681SMED30030681SMESG000038678.1 SMED_01590_V2_1rGPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30026267SMED30026267SMESG000016812.1 SMESG000016788.1 SMESG000016782.1 SMESG000016774.1 SMESG000016773.1 SMED_03310_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30026267SMED30026267SMESG000016812.1 SMESG000016788.1 SMESG000016784.1 SMESG000016782.1 SMESG000016778.1 SMESG000016774.1 SMESG000016773.1 SMED_03310_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30007813Ast6 proteinSMESG000072794.1 SMESG000072793.1 SMESG000072791.1 SMED_00098_V2_1rGPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30007813Ast6 proteinSMESG000072794.1 SMESG000072793.1 SMESG000072791.1 SMED_00098_V2_1rGPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30006374SMED30006374SMESG000049079.1 SmWIOct06_021848GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30016113SMED30016113SMESG000053522.1 SMED_00102_V2_1rGPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30016113SMED30016113SMESG000053522.1 SMED_00102_V2_1rGPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30005608SMED30005608SMESG000052262.1 SMESG000011360.1 SMED_23118_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30012889Family S33 non-peptidase homologue (S33 family)SMESG000021236.1 SMED_00375_V2_1rGPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30012889Family S33 non-peptidase homologue (S33 family)SMESG000021236.1 SMED_00375_V2_1rGPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30010978nuclear pore complex protein Nup155SMESG000035494.1 SMED_37221_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30010978nuclear pore complex protein Nup155SMESG000035494.1 SMED_37221_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30010915SMED30010915SMESG000052262.1 SMESG000011360.1 SMED_23118_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30035878Collagen alpha-1(XXVII) chain BSMESG000026649.1 SMED_02049_V2_1rGPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30035878Collagen alpha-1(XXVII) chain BSMESG000026649.1 SMED_02049_V2_1rGPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30020726P-type phospholipid transporterSMESG000040790.1 SMED_00003_V2_1rGPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30020726P-type phospholipid transporterSMESG000040790.1 SMED_00003_V2_1rGPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30027566SMED30027566SMESG000075236.1 SMED_01064_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30027566SMED30027566SMESG000075236.1 SMED_01064_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30029103Glutamine synthetaseSMESG000000228.1 SMESG000000212.1 SMED_00099_V2_1rGPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30029103Glutamine synthetaseSMESG000000228.1 SMESG000000212.1 SMED_00099_V2_1rGPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30029103Glutamine synthetaseSMESG000000228.1 SMESG000000227.1 SMESG000000225.1 SMESG000000212.1 SMED_00099_V2_1rGPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30029103Glutamine synthetaseSMESG000000228.1 SMESG000000227.1 SMESG000000225.1 SMESG000000212.1 SMED_00099_V2_1rGPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30009651NSD-1SMESG000015015.1 SMED_20741_V2_2GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30009651NSD-1SMESG000015015.1 SMED_20741_V2_2GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30009651NSD-1SMESG000015096.1 SMESG000015015.1 SMED_07236_V2_2GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30009651NSD-1SMESG000015096.1 SMESG000015015.1 SMED_07236_V2_2GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30009651NSD-1SMESG000015015.1 SMED_23187_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30009651NSD-1SMESG000015015.1 SMED_23187_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30017245DNA replication and sister chromatid cohesion 1SMESG000048533.1 SMESG000022220.1 SMED_31095_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30017245DNA replication and sister chromatid cohesion 1SMESG000048533.1 SMESG000022220.1 SMED_31095_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30019097SOXP-1SMESG000010063.1 SmWIOct06_023556GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30019097SOXP-1SMESG000010063.1 SMED_17522_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30019097SOXP-1SMESG000010063.1 SMED_17522_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30019097SOXP-1SMESG000010063.1 SMED30019097smed_20140614PMID:22385657
Wagner et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30019097SOXP-1SMESG000010063.1 SMED_11833_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30019097SOXP-1SMESG000010063.1 SMED_11833_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30019097SOXP-1SMESG000010063.1 SMED_11833_V2_2GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30019097SOXP-1SMESG000010063.1 SMED_11833_V2_2GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30005246cyclin B-2SMESG000060055.1 SMED_16263_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30005246cyclin B-2SMESG000060055.1 SMED_16263_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30005246cyclin B-2SMESG000060055.1 SmWIOct06_038417GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30005246cyclin B-2SMESG000060055.1 SMED_09349_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30005246cyclin B-2SMESG000060055.1 SMED_09349_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30007406SMEDWI-1SMESG000036375.1 SmWIOct06_100019GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30007406SMEDWI-1SMESG000036375.1 SmWIOct06_100034GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30007406SMEDWI-1SMESG000036375.1 SmWIOct06_100024GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30007406SMEDWI-1SMESG000036375.1 SmWIOct06_014491GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30007406SMEDWI-1SMESG000036375.1 SmWIOct06_100033GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30007406SMEDWI-1SMESG000036375.1 SmWIOct06_100023GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30007406SMEDWI-1SMESG000036375.1 SmWIOct06_100018GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30007406SMEDWI-1SMESG000036375.1 SMED_01384_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30007406SMEDWI-1SMESG000036375.1 SMED_01384_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30007406SMEDWI-1SMESG000036375.1 SMED_01384_V2_1rGPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30007406SMEDWI-1SMESG000036375.1 SMED_01384_V2_1rGPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30007406SMEDWI-1SMESG000036375.1 SmWIOct06_100035GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30007406SMEDWI-1SMESG000036375.1 SmWIOct06_100020GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30007406SMEDWI-1SMESG000036375.1 SmWIOct06_100022GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30007406SMEDWI-1SMESG000036375.1 DQ186985.1smed_ncbi_20200123PMID:22385657
Wagner et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30020884UV excision repair protein RAD23SMESG000077827.1 SMED_20631_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30020884UV excision repair protein RAD23SMESG000077827.1 SMED_20631_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30020884UV excision repair protein RAD23SMESG000077827.1 SmWIOct06_029267GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30024536SulfotransferaseSMESG000046026.1 SMED_29905_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30024536SulfotransferaseSMESG000046026.1 SMED_29905_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30021808SMED30021808SMESG000054507.1 SMED_35584_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30021808SMED30021808SMESG000054507.1 SMED_35246_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30021808SMED30021808SMESG000054507.1 SMED_35246_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30024908Wee1-like protein kinaseSMESG000073764.1 SMED_27054_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30024908Wee1-like protein kinaseSMESG000073764.1 SMED_27054_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30024555Cyclin-dependent kinaseSMESG000023609.1 SMESG000023590.1 SMED_07692_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30024555Cyclin-dependent kinaseSMESG000023609.1 SMED_26757_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30024555Cyclin-dependent kinaseSMESG000023609.1 SMED_26757_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30025757JUNLI-1SMESG000067959.1 SMED_21705_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30025757JUNLI-1SMESG000067959.1 SMED_21705_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30025757JUNLI-1SMESG000067959.1 SMED_29372_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30025757JUNLI-1SMESG000067959.1 SMED_29372_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30025757JUNLI-1SMESG000067959.1 SMED30025757smed_20140614PMID:22385657
Wagner et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30026815tRNA (guanine-N(7)-)-methyltransferase non-catalytic subunitSMESG000041742.1 SMED_30444_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30026815tRNA (guanine-N(7)-)-methyltransferase non-catalytic subunitSMESG000041742.1 SMED_30444_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30023920Arginine:serine rich splicing factorSMESG000013050.1 SMED_05855_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30023920Arginine:serine rich splicing factorSMESG000013050.1 SMED_05855_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30024872Cysteine and histidine-rich domain-containing protein 1SMESG000019808.1 SMED_00699_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30024872Cysteine and histidine-rich domain-containing protein 1SMESG000019808.1 SMED_00699_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30022491SMED30022491SMESG000079488.1 SMED_09635_V2_1GPL14150PMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence
neoblastSMED30022491SMED30022491SMESG000079488.1 SMED_09635_V2_1GPL14150_gene_modelsPMID:22385657
Wagner et al., 2012
whole organism asexual adult cDNA to DNA expression microarray evidence