neoblast

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ Figures

  ▻ In Situ Hybridization Data

  ▻ Sequences

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  neoblast


DEFINITON:

  A heterogeneous population of pluripotent, somatic adult stem cells and lineage primed progenitors that are required for maintenance and regeneration of all cell types in planaria, including the germline.


TERM DEFINITION CITATIONS:

  planaref-0000004, PMID:21566185, PMID:22899852, PMID:16311336


TERM CITATIONS:

Expand publication list


TERM ID:

  PLANA:0000429


ABOUT THIS TERM:

neoblast

  ↳is a material entity, progenitor cell and stem cell

  ↳contained in tail, copulatory region, ventral region of the whole animal, posterior region of the whole animal, parapharyngeal region, prepharyngeal region, head, dorsal region of the whole animal and anterior region of the whole animal

  ↳develops from blastomere

  ↳existence overlaps Stage 6, juvenile, Stage 5, asexual adult, adult hermaphrodite, Stage 8 and Stage 7

  ↳existence starts during or after Stage 5


Expand to see terms that develops from neoblast



DEPICTED BY:


BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


FIGURES:


Figure 9: Ontogeny of the adult neoblast compartment. 

Asynchronously cycling piwi-1+ cells fuel embryogenesis, giving rise to all temporary and definitive tissues. During S2, some piwi-1+ blastomeres (purple cells) exit the cell cycle and differentiate into temporary embryonic tissues (primitive ectoderm, temporary embryonic pharynx and primitive endoderm). The remaining piwi-1+ blastomeres, located in the embryonic wall (purple cells, S3-S4), continue to divide and express both early embryo enriched transcripts (turquoise arrow) and adult asexual neoblast enriched transcripts (red arrow). As organogenesis begins during S5, early embryo enriched transcripts are downregulated throughout the compartment (purple cells transition into red). Concomitantly, progenitor subpopulations required for definitive organ formation are specified via the heterogeneous expression of developmental transcription factors within the piwi-1+ population (colored cells denote different progenitor subpopulations). Adult pluripotent neoblasts, themselves a lineage, are established during S5 (red cells). Embryonic donor cells harvested during or after S6 function similarly to adult neoblasts (cNeoblast activity, gray arrow). Pluripotent and lineage-primed neoblasts established during embryogenesis are maintained throughout the lifetime of the animal, where they are required for tissue maintenance during homeostasis and formation of new tissue during regeneration.

 

 

back to top


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30001900Bruno-like proteinbruli-1Stage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8neoblast, blastomere
SMED30033466Histone H4Stage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, neoblast, primitive ectoderm, embryonic pharynx, blastomere
SMED30004304Proliferating cell nuclear antigenPCNAStage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8neoblast, blastomere
SMED30010115AFJ24744.1ribonucleoside diphosphate reductase subunit M2-2RRM2-2Stage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8neoblast, blastomere
SMED30007406Q2Q5Y9SMEDWI-1piwi-1Stage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8neoblast, blastomere
SMED30014446Q2Q5Y8SMEDWI-2piwi-2Stage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8neoblast, blastomere
SMED30001362ACC97187.1SMEDWI-3piwi-3Stage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8neoblast, blastomere
SMED30019097AFD29619.1SOXP-1SOXP-1Stage 4, Stage 5, Stage 6, Stage 7, Stage 8neoblast, sigma neoblast, blastomere
SMED30035063AFD29620.1SOXP-2SOXP-2Stage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8neoblast, sigma neoblast, blastomere
SMED30013909AHC00376.1tud-1tud-1Stage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8neoblast, blastomere
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30010115 ID=SMED30010115|Name=ribonucleoside diphosphate reductase subunit M2-2|organism=Schmidtea mediterranea sexual|type=transcript|length=1127bp
GTTTTTAATGAACTGAATCAGGTTTAATGCAAAATAGTCATTTTAATTTCTAGATAAATTAACAGTAATTCTTTCGAGAT
TAGATATTTATTATGGAGATTTTATTAACAGAAGATAAAAGTCGAATAGGATTTCTTAATATACAATATGAAGATATATG
GGAAATGTTTAATAAAGCTCGATCTTCATTTTGGACTGTAAATGAAGTTAATTTATCAAAAGATTTTGCTCACTGGAAAA
AAATGAATGACGATGAACGGTATTTCATTACTCACGTTCTTGCATTTTTTGCTGCCAGTGATGGAATTGTCAATGAAAAT
CTCGTCGAAAGATTCATTCAAGAAGTGAAAATTCCCGAAGCTGAGGCATTTTACAGTTTTCAAATTGCAATTGAAAACAT
TCATTCAGAAATGTATTCTCTATTAATCGATTCTTATGTTACTGATACAGAAACAAAGAATAAATTATTTAATGCCATCG
AAACTATGCCATGCGTTCAGAAAAAAGCTCAATGGGCATTGCGTTGGATTAGCGATAAAAAATCCACTTTTGGAACTAGA
GTTGTTGCATTTGCTGCTGTCGAGGGAATATTTTTCAGTGGTAGTTTTGCATCGATATTTTGGCTTAAAAAGCGTGGATT
AATGCCCGGATTATGTTTCAGCAACGAATTAATTAGCCGAGATGAAGGACTTCATTGCGATTTTGCTTGTTTGATGTTTA
AATATTTAAGTAGCAAACCGTCACCTGAACAAGTTTTGGATTTGATCAAAGAAGCTGTCGGAATCGAGAAGGAATTTCTC
ACCGACGCATTGCCGGTTTCATTGATTGGCATGAACGCTGAATCGATGTGTGAGTATATTGAATTTGTGGCCGACCGGCT
GCTGGTTGAATTGGGCTGTGACAAGTTCTGGAACACAGAGAACCCGTTGGATTTCATGGATAATATTTGCATCGATGGGA
AAACTAACTTCTTTGAGAAACGAGTCGGTGAATATTCCATGTCGAGCGTTGAGGACAAACACAAATTTGATGATGTCAAT
TTCGATATTGATTTTTGAGGGATTCCGTTTTTTGGCGCCAGTGTGCATTTAATGTGTTTTGGTTGTAATTGGCTATTTTT
GTTTGTT
>SMED30007406 ID=SMED30007406|Name=SMEDWI-1|organism=Schmidtea mediterranea sexual|type=transcript|length=2730bp
AATCGAATACATAAAAATTTATTTGACACCAAATACAAAGAGACATTAATCTACAAGTAAAATAAGCGTTCGCGAATTCT
GTCATTTATCGCTGGAGGAGTAACACCACGATGAATCTTGCCAACGAGTTCAGCCAAACGATGGGCATAATGCGTTGGAA
CAGGAACTCGGATTGTTCCCATCCAGTTAAAATACAAATGTGTTAACGAATAAGTTATTTGCTGCAATACACTCGGAGAC
ATAACTGAAACCTCATTTGTTTTCTTGTTTGTAAACTTAGTGTCCATAAGAACATTATAATTCGTAGGAGATGCTGTACC
TTTAGTTGTTTTCTGAGACACCAAGTAAAATTCATAGAAATTGGGTTTCACTATTTTCTCATCAACCACAGTACCAGGAT
TTGGATTAGCCCCATCTTTGAAAAATTTAACACTAATTCTCTTCTTAACCACAACATAAATAATTTGGGGCAAAGTTTGA
TTTTCGTAAATTTTCTCTATCATTTTCATAACAGCATCAGTTTCGAACTTTTTGGTAAATGCTAACTGTGAATCTCCAAC
ACCGTCACGATAAATAATCAAACGAAGAGGCATAGTGTTAAATTTGTTTTGGAATGTTGTAAGGGCCGTTAGGAAGTTTT
TGCCCAAATTTTCGTGAAATTCATTTTTACCTTTAGATGAATTGACAAAACTGATATACTGAGAAAATTTGGCACTAATT
GAAAATACGGATGCTTGAACAGATCTTTTACCGGTTTTGCTATGAAAAGTATCCAATCCTACAATCATAGTCGGTGCCAT
TTTAAGATTAATACCCCATGGGTCGTATCCTAATTTAGAAAACATTTGCATAACTGATTTATCTGCAACCGTTTTACGAC
GTCGATCATCTCTATTACTTCCGTTTCTCTGCGTCACACACTGAGTCAATAGACCTGTAGACATTGTAAAATTCTTTACT
TTTGCGTAAACTTTATCATCAGGAATGAACACTAATGCCATATGTACCTTGCTTACACGAATAAAATCTGTTAAAGCGTC
TTCAACTTCATTGGATCGACATGAAGATATACTGTCCATTGTGTAATTGATTCTTAATCTTCCTATTTCTCTTTTAACAT
CTTCAATAAAATTGTTGAAGTGACTAGGGTTTCGATCAACAACCAGTACACCAAAACGATGAGCTGTGCCTTTAGGAACG
TCAAATTTAATTTCCCCAAACTTCCAATCATCAGGGATTTTAGTATTAATTTTAACTTCGTTTGAAAATATATCAACTGG
AGCCAATTCACGACCACGAATCGTAATCGGTTGTTCTTCAATACACATCCCCCAGCTCTTCATATAATCTTTTGATTTCC
CAGCTCCGGTCCACTTACAAAAATCTCTTATGTCATTTAATCGTTCTCTAGGCTCACGTTTCAATACGGTTCCTAAATTC
TTTTGCAAATTTATATTACTTCTTTCACTATCCGAAAATCCACATAAATAGCATAATTCACCTGGAATTGATAAACTTTG
ATCTGTTTCTGTAGGTCCTTCAGGTTCATTTTCAGTTTTTTTCTTTTGGGCGAACCATCGATCGCTTGACTCGCGATATA
ACAAATGGTTGTTTGTCATTTTTCAAATTAATGTTATACCGTTGCTTGAAATAATTCAAATAGGATATCTTTTTATCGCC
TAGCTGAACCTCGTCATTAACATCCATTTCTTTAATATCTGAAATTCTATACGTCTTGTTATTATACTTGGTAATTATGT
CCCTTCCTATTAATTGATCAATTTGATCTCGTCGATACACTGATACTACATTGTTTTCATTTAGAACACGATTAATTCTT
TCAAGATAAAGTAAAGTCGAAGCAGTTCCATTTTCATTTGTTCCTCTTGTAATTGTAGTAGAATACCCTCCTAATATCTT
GAAATTGTCCATTTTAAAAAAGCTAGGTCCTTCTCGAATACCACCACTTTCACAATTTGATCCCAGAAAAAATTGTCTAC
CAATTTTTTCTTGTCCCATAAATATTTGAATATTATTAAATACAATATTTATCATCTGATAATATTCTTCAGAATTTTTT
AAAAACGTCGTCAGCAATCGTATGGAAATTTCAACATCTTTGATAACTAAGTTTTCTGTATCTTCATCTGAGTGCCACTT
AGAAGTCGTAAATAATCTTCTGCCATCAAAACAAAATGGTTGACCATTATTTTTGCTGTTTGCATAAGCTAATAATAACT
CTAGCTTAGTACGGATACTTTTATTCTCCATAACTACATCATACATGTAAAATGGTCCTTCGACTTTAATATTAAAGTTA
GCGTAGTTAGACTTGAGACTAACTACTCTTCCATCTTTCCCTATTTTGTCTGTAACTGTATCAGGCTGTAAAGCAGGTTC
AATAATTGCGAATCTTCTTTGGAGACCTCCTCTTCTTGGTCTTAAATTGGGATCACTTGTAACATTAGTTGAATCCATTT
CGTAAATTTGAGTAAAAATGTTAAAACAAAGACTTCGGTTTAAATAAACAAAATATACTATGTAAAACGATAAATATAAT
TGCTTTAATGGTTTATGATTTGTATTATATAATAATAATAATTTAATTTCCCTGTGAATATTATATTAAAATATAGTAAA
AATTACTCGTAAATGTGTGTTAAAGTAATAGGATTAAATTAAAATAAACATTTTACGAAATAAGTTCTAGTCAATTATGA
AGTCTTTTCT
>SMED30004304 ID=SMED30004304|Name=Proliferating cell nuclear antigen|organism=Schmidtea mediterranea sexual|type=transcript|length=907bp
CTAAAAGGTAATAATTTAAATTTAATTAGAACATTGTTTTAATATTCGGTTATATTCTCCATTATTCTAAATTATGTTTG
AAGCAAAATTAATAAAAGGCGAAGTTTGGAAAAAGGTTATAGAAGCTATAAAAGACTTAGTACAAGAAGCAACATTGGAT
TGCTCAGAAAATGGAATTAGTCTTCAAGCCATGGATACATCTCATGTGTCCTTAGTTAGTATGCTTCTTCGAAGTGATGG
TTTTGAGACTTATCGATGTGATAGAAATGTCAATCTCGGTCTTAATATAACAAGTGTTTCAAAAATTTTAAAGGCGCTTG
GTAGTAATGATTCCCTAACAATGAAAGCCGCTGATTCAAGTGAAACAATTTCGCTTTTGATAGAATCTGCAAATGAAAAT
GAATTATCTGAATACGAAATAAAATTAATGGACTTGGATGGAGATCACTTAGGTATACCAGATACTGAATATAAGTGCAT
TGTGAAAATGCCGAGTTCAAAGTTACAAAGAATATGTCGAGATTTAAGCCAAATTGGAGAAGCAATCACGATTTGTGTTA
CTAAAGATGGTGTAACTTTTGCTGCTGCTGGAGATCTAGGAAAAGGAGCTATAAAACTTAATCAAAATTCTAGTGCTGAC
AAAGAAAATGAAGGAGTAACTATTGAAATGACCGAACCTGTTTCGATGACATATTCATTGAGGTATTTCAATATGTTTAC
AAAGGCTGCACCTCTTTCTTCTCAAGTATCTCTGTCGTTGACTGAAAATGTTCCAGCAGTTATTGAGTTCATAATCGAAG
ATTTGGGATTTATTCGATATTACCTAGCTCCTAAAATCGAAGACGACGAGTGAAAGTTTAACTATTAATGTTGTATGTTT
AATAGATGTTATTTTGTTTAAAAAAAA
>SMED30013909 ID=SMED30013909|Name=tud-1|organism=Schmidtea mediterranea sexual|type=transcript|length=2414bp
ATTTAGAAAATGGAGGCAACTTGCGATGTTTTTTTAACGAATTTACCTAAGTCGATTAATGAAGTAGTTGTGAAGAACTT
ATTTTCTTCTGCTGGGAAAGTGTTAAAAGTGAAAATAATAGATGACAAAAGAAACGAAAATCAGAAGCTATGCTTCGTTG
GATTTCGAACTATGGATGAAGCATTAGAAGCCGTCAGAATTGCAGATAAATCTGATGCGTTTGGTGATCCAATTAGAGCC
AGTATATCAAAGAAGTGTTTAGACGGAATGGAGAATAATCAAAATAGATCAAATAATAACAGAAATGATTCAAGTTATAA
AGGAACTGATTCATTTTCAAGAAAGAGTGATTCTAATTTCAAGGATAGTGAAAAGTATCCAACAAACAATGGTGACTTTG
CACAAGTAAATCGTTTAAACAACGTTGGAAGAGGAAGAGGAATCCAGACTAAAATTATTAGTGGTCCACCTTCATTCAAA
ACTAATGAAATTAAGTTAAACGATATTAAACTTAAAACAAAAGAACTGATTGACATCGAAATCGTCGATTTAAGTAGAGT
TGACATTATACTTATAAGGCCAGTAAAGTCAACGGAAAATTCAAAAATTGAAATAGCAGATTTATTGTCACAAATAAATT
CAAATAAATCGAATCTAATGCCAGTTGACTGTCCTAAAATAGGAGATTTTTGTCTTGCAAAATGGACTGAAGATGATTGC
TATTATCGGGCTGAATTGTTAGATATATTAAAGGATGGATCTTTCAAAGTTACTTTTGTTGATGAAGGAACTTCGGGTGA
TATTGTGACTGATTTGAAACACATTCCGACTGGTGCTTTACAGCAGTATCCTAAACAATTTTTGAAGGTTTCAATCGGTT
GCTCAGACGCAAAAGAATTAATGTCATTTATTTTACAAGAGTCTGAAGGAAAGGTGATTAAAATTTATTGGCTCGGAGAA
TATTGTGATTCCGTGCCTGTTGTAAATTTATTTCTGAATGAAGATGAAATTGTGGAAAAATATACCCAAATAAATAAAGT
AAATATCAGGAAAAAATTCTCACAGACATTTGATGATCTCCCAGTACATAACCTCGAAACTAATTCACATTTTTCAATAG
CACCATCAATGTATAAAAACCGAAATGATTTTATTCTTCAGATGAAAACTTTCTCGGTATCTTTAAAGCAAAAAAAATGT
CCTACGGTTTTACCAATTCCTGGTGATATATGTATATATGAGAAAAGGAATGCTAATGGCGAATCATTTCTTCGTTGTGT
TATATTAAGGCGCCAACTTTTTTCTTTTGACATCGAGTTAATAGATATCGGTGAAAAAATAATGAATGTTAATATTGATC
ACCTGTACACAGTCGAAGATATTCATGTAAAAGACGCTCCCTGTGCTATTACTTGCGATTTAGATAGTTCTATTAATATA
GATGGTATTAAGCTCCCTCAAGATTTGATCGATGGTGTTCTCTTTAATCTTAAAAAGTACAACAAAAATAATAAATACAC
TGTAAATTTCATTTTACCACAAAAGAAAGCTTATGAATATGCAAAAGTATCATATAAAGATTTGATTGGTAAAAGCTTTA
AAGTAATAATGTCGCACGTTGTCTCTCCCATTAATTTCTTTATTCAACTTGATGATGGAGAGCATCAGCTTGCACTTGGA
GATATTCAAGAAAAATTAAATATTAATTATAATGGATCACCATTCAAAAGTGCTAGCGATGTTAAAGAAACTCAGGCAGT
TATTGCTCCTTTTATTGTTTCCGGAAGTGATGCGGAACTTTTTCGGGCTTATGTTTTAGAGAAACGAAAGGAATCTCCAC
AAATTCATGTATTGTTTATTGATTATGGTAATGATGAATGGGTGAATTATGAAACTTTACTGAATACAAATGAAGAATTA
GTTTCTAAACCAGGTTTCGCAATACATTGTAAATTATCTCTAAATATTAAGAAGGAAGCGTGGAGTCACGCTATTGAATT
ATTTAATGATTTAGCTGGTTATACTGAAAATGACCAGGGGACGTTTGTAATGCAGGTTATTAGTGTCGATGGTGATTCGT
TAGTTGTGGACTTGATTTCAGAACTGAAAGGTTCGTTGACGGCCATCTTAGAAAAAAGTGGTACATGTGTAAAGTCCAAT
GAACCAATATGTAATGGAGGAGGACCCCAAGTTAAATTAAATGGCGTTTCAAATGATAAATCTCAATCAGCTATTCTTGA
AAATTTATCTGAAGGAGAATTATATAAAAAATTTATTGAACTAGAACGGAGATTAAGTGCTTTAGAGATATTGATGAAAT
AATGCTACCCGCGCAATTAGTATTATCAAATTATGATAATCTAGTCTTGATGTGTTTAAAATTTTGTATTTTAACATAAA
TTTATTCCGTGTTG
>SMED30025482 ID=SMED30025482|Name=Histone H4|organism=Schmidtea mediterranea sexual|type=transcript|length=552bp
TGTCATTATCAAAATATTTTCAATATATAATAAATCAGAAATCACTAAACAGTCATTACTAAACTATTCTAACTCAAAAT
GTCTGGTCGAGGAAAAGGAGGAAAAGGCTTAGGTAAAGGTGGAGCTAAAAGACATAGAAAAGTTTTGCGAGACAACATCC
AAGGAATCACGAAACCAGCTATTAGAAGGTTAGCTCGCAGAGGTGGCGTGAAAAGAATTTCTGGTCTTATCTATGAAGAA
ACTAGAGGTGTTTTAAAGGTTTTCCTTGAAAACGTAATCAGAGATGCTGTTACTTACACTGAACATGCTAAGCGTAAGAC
AGTCACAGCTATGGATGTTGTTTATGCACTTAAACGACAAGGTCGTACTTTATACGGTTTTGGAGGGCCACAAATGTTGA
TTGTAGTGAATTGTTCAAATATTGTTATTCTATCTAGTAATTCTCAGCAATTTTATTAACGTTATTTAGAAATTAATTTT
ACAATTGCTAATTTCGAATGTTATATCTGGTGTCAATGTTCAGTTATATTATTTTACAAATGACTTGAAATG
>SMED30022389 ID=SMED30022389|Name=Proliferating cell nuclear antigen|organism=Schmidtea mediterranea sexual|type=transcript|length=915bp
GTTATTAACGTTATTGGACTATAGTTTTATTATCATAAATTTTTGAATAAAATTGAGATCTTCTTTTAATAATGCTATTT
GAAGCAAAATTAAATAAAGTAGATGCATTTAAAAAGCTGATTGATTCGGTTAAAGAATTAATCCAAGAAGCAGTTTTTGA
ATGTTCATCCAAAGGTATTGAATTACAAGCAATGGATAGTTCACATGTTAGTCTAATATTTCTTTTAATTAAAAAGCAAT
CTTTTTCGTCTTATAAATTTACGAGAAATGTATCTTTGGGTGTAAGTCTTGTAAGTCTATGTAAAATACTCAAACTTTCT
CAAATTAATGATTCAATTACAATTAAAGTTGATAATGAATGTGAAACAGTCGAATTTGTTTTCGAATCATCAGATAGTGA
TCGAATGTCTGAATTCAGTTTGAAGTTAATTGACTTGGATATTGACTGTTTAGCTATTCCGGAATCAGACTATGATTGCG
TAGCAACAATCCCGTCTGTAGAATTTAACAAAATATGCCAGCAATTAGCTGTTATTGGAAGCACTGTAACAATTGTAGTA
ACTAAACAGTCAATTCAATTTTCTTGCTCCGGAGACATGGGGAAAGGGAAAATATTATTAAATCAAACTGTAAATAAACC
GAGAATAGAAGATTCTATTAATATTGAAGTTGTTAATCCATTATCAATGGTTTACTCGCTTCGATTTTTTCATATATTCT
CGAAGGCCTATTCGCTTAGCAACAGAGTTTCTTTATCTTTTGCTAATAATTTCCCAGCTTTGGTGGAGTACAGCATGAAT
GAATTGGAAGGTCATCTACGATTTTACTTAGCTCCAAAATTAGATGATGATTGATTTTGCTCTTTTTCTAGTTTTGGGGT
GATATTTTAATTGTAGTGCTTTTTTAGTATGGTTA
>SMED30019097 ID=SMED30019097|Name=SOXP-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1596bp
GGAATAACAGCCAATTAGGGATCAGCTGCAATTTGGCCTATGATTGGACATTGATTTTTATAGTCTCAGGCGTTCTCAGC
TTACGTGTGCACCTTTTTAGTGGACACGTTAAATTTGATAGGTGCTTAGTGGTGTTGATTCCTGTTTGGAAACTGTATAT
AACCAAGGTTATTTGTTGCTTTGAGACAAATGCAACACAATCAAATAATTAATTATGCTATGTTCAAATTGTTCAAACAA
TCAGGATACTTTGAAATTATGGATGGTCCATTTAGCTTCTTGTCACCCATTACCTCCTGAATGGCTTAGTGAAAAGGCCA
AAGTATTAAATGATGACGAAAATCAGCGCCCCTATACAATTGTCACTGATTCCCGAAAAAGAAGGCGACGTCCAACCACA
CCAAGACCACTAAATACGTTCATGATTTTTTCGAGGCATATCAGACGAAATATTCTCTCAGTGTTTCCGGATGCATCAAA
TTCCCAATTAAGCAAAGAGCTTGGAATTTTATGGAAGAAAGTCACAAATGAAATTAAATCCCTTTATGAAGAAGAGGCAA
AGCGATTGGCTCAATTACATGCTCTTGAATTTCCCGATTATAAATATCAACCAAAGAAACGAGTCCGAAGATTTGGAAGA
GCGATTTATGATCGACAGCCCTGTACAACAGAAAGATCTAACTCAACTAGTGCAACAGACGAAGAAAATGGTAAAGACAA
TAATAGTGTTCAAGACGGTAGAAGATCAAGCGATATTGAGAATCAGTATATAAGATATTCAGTTTTGGGTAAAAATATTG
TAAAACGAGAATGTCAGTCCTTTAATAGTCCTTTAAAAAGCGACAACGTTAAATTGGAAACGCAAGAACAAGATTTTATC
CAAGCGATGCCCAAACCTCTAAACGTCCGAATAACGAATTACAACGAAAACAGTATATTTTTACGACAACAAAGATTACC
ATCAAGTAGCACAATGTATTTACTTCCTTCAGAAAACCTAATAATTAGTAATGGGATTATGGGATCACAGGACTTGGGTG
AGGATTATTGTAGAGAGTTGTATATAATTAATGATTTTTTCCCAGAAAATGTAAACATAGACGATGAAATTGATATAACA
GGAAACATTTTTAGCAATGATTTAGATTTAGAGTGGTCTGAAATTGATGAAAATTACAAACAAGATTTACCAAATCTTAA
TTCATTATTTCAACACTAATATATTTGATTTATAAAATATTTAAATATTTTTTATTAAACAGTCTTTTACATGTACATAT
AGTATTGGAACTCTTCTCTGACTTATAAGATAACAGAGATATTGTAATAAGATTAAATTGGTTATGTGTTTCGGTTTTTG
TAAGATTGGTAATTTTCAGAAGAATTTAGACTTTTTTCATGGAAATTGGAATTGAGAAACAAACTGAATAAAGAAACAAA
TTTTTGAAAAAAACGAAACAGATACTTATTATCAAAAGAAAATTATCTGAAGCATCGAGTCGGTATGAAAAATAAACTAA
TTAGTCAGAAAATTTTTGATGAAATAACGTCTAATGAAATTAAGATCTCCAAGGAATACTTTTTCTAACATTTGAT
>SMED30029163 ID=SMED30029163|Name=Histone H4|organism=Schmidtea mediterranea sexual|type=transcript|length=537bp
AGGTTACAGTTTTTCAACTAATACCTCAAAGAAATAATGAAAGATGGACAGTAGAGTTTTGTCACCATCAGGAGACCAAG
TGTCATTTAGGATGATAATAGCCCAGTTAAGGAATCTTGCTGATCTAATCAATGCCAAAAATATTACAAAATTTCGATTT
AAAAGAAGCTAAAGGAGAAAAATTACACGGAAAAGTTCAGAGGTACAACATCCAAGGCATCCCTAGGTCTGCAATTAAAC
GATTAGCACAAAAAAGAGGTGTGAAAAGAATTCATGGGCTTATTTACAAAGAAACAATATATGTTATCAAGTTAGTCCTT
GAAAATGTCATCTTATATGATATTAAATACACATTGCAAGCCAAGCAAGAAACTTTTACTGCCAAGGATGTTTTTAATAT
TCTTGAATGTTTGGAGTTTTCTATTTTGTGATAACATCCTTCCCCAAATGAAAGTTATCAGATCATTTTGCAAAGTTTGT
GAGAAGGGATATATATTTACCAACAAGAAAAATGTTTTGAATTTAAGAATAGGACTC
>SMED30014446 ID=SMED30014446|Name=SMEDWI-2|organism=Schmidtea mediterranea sexual|type=transcript|length=4773bp
ATTTAATTTTCGAAAAAAAATATGGAGGAAATACCAGTAAAAGTAGCTAAACTTGAAGCGAATGGAAGTGAAACAAGAGG
TAAAATGGGAAATCGTGGTGGCCTGAGAAGAACATTTAGAATTGTTGAACCTAACTTGCAACCTGCTGATATCACTGAAA
AAACAGGAAACATAGGAAGAACAGTTAAATTACAATCAAATTTTACCAAATTCTCTGTTTTGCGTTCAGAAAAGTTCATG
ATGTATGATTCCGTGTTTTCTCAAGTTGGTTTGTCACCCAAAGTAAAATTACAGTTTATTGTTCGAGTCTGCCAAGAAAA
TAAATTGCCAGGGGCTTTTTGTTTTGATGGAAGACGTCTATTTACTAGTGAAAAATGGCATGGAGAATCGGACATTCAAG
AATTTAGTCATGATGAAAAAAAAATGACACTAAGATTGGTATCAACTATCCTTCCTGAAACTGAAGAATATTACCAAATG
ATCAATGTATTACTCAATAATTTACAAGTAATGTTAGGTCAAGAAAGAATTGGTAAAGGTTATTTTTTAAGCCCAAATAT
TACAAAAGATGAAGTTCCCCGTAATTCTGGACCGACATTTTTTGAAACCAATAGTTTTAAAGTTCTTGGGGGCTTTGGTA
CAACTTTACAAAGAGGCACAAAACCAACTGGTGAATTAACCACTCTTTTATATATTGAGCGTATTAACAGAGTATTAAAC
GATAACTCTGTTATGAAGGCATACAACAGAAGAAGTATCGATCAGTTGATAGGCAGAGATATCATAACAAAATATAATAA
CAAAACTTATAGGATAAGTGAAATAAAAGAAATGAACGTAGATGAGAAATTTGAAATGGGTGGTAGAACTTTATCGTATG
CCGAATATTTTAAGGAACGATATAATATTCGATTAACTCAAGGCGATCAACCATTTGTTCTAACGCGAGTGAAGAAACCA
ATGCGTCGAGAAAGAAAGAAAAAAGACGAAGAAGGAGTGGAAAAAGAGAAAGAAAAAGAACGCGAAAAAGAGGCTCCAGA
AGAGAAGGACATGACTCTCAATATTCCTGGAGAGTTGTGTTTCTTATGTGGGTTTTCAGATCAAGAGAAATCGAATATGG
ATCTGCAGAAGAATTTAGGGTGCGTTTTAAAAAGAGAGCCACGTGAAAGATTGGATGATATACCAGCTTATTGTAACTGG
ATTAAAAATAGTGATGCGGCAACTGGAATGTGCAATAAATGGCAGCTGAAAATAGATAACAAACCATTAGAAATCGAAGG
TAGAGAATTACCTCCATGCGATGTAATAAGTGGTGGCAGCAAAATTAATGAAAAAATGGGAGATGATTGGAAATTTGGTC
GAGTTCAATTTGATATTAAGCGTGATCGTAAGCATGAAATCGATGTGGTCATCGTTGATCGAAATGACTTTCAGTATAAA
AATTTTATGAATGATGTGGAACAAGAATTAAGAAACATGAGAATTGATGCTCGAGTTGGAAAGGTTAATACTTGTGGTCC
AAATGATGTTGAAAGATGTTTGAATGATGCCGCTAGAAGTGGAAGTGGGTGTGCTAAAATGGCGCTGGTATTCGTCCCAG
ATGATAGAGTATATGCCAAGGTGAAATCATTTACCATGAGTACTGGTCTTTTAACCCAATGTGTAACAACACGTAATGGT
ACTAATAGAAACGATAAACGAAGAAAGGTGGTTTCAAGTAAAACCGTGATGCAAATATTTGCAAAATTCGGATATGATCC
ATGGACAGTTGAAATTAAATTGAGACCAACTATGATTGTCGGTATGGATACCTATCATAACAAGTCCAGCAAGAAATCAA
TTCAAGCATCTGTATTTTCGATCAACAGCACATTTACACAATATATGAGCTTTGTTAATTCTCCTAAAGGACGTCAGGAA
TTCCACGAAACTTTAGGCAAAAATTTCAATTTAGCGTTAGAAGATTTCAAGAAACGTTATGACATATTGCCCCAGCGAAT
TTTAGTCTTTAGAGATGGTGTTGGAGATAACCAACTTCAATTTACTAAAAATTTTGAAGTTGATGCAATGAAACCGCTTA
TTGAAAATATATACAAAGGCAACGGATTCCCTGTTCCACAAATCATTTATGTCATCGTAAAGAAAAGAGTCGGCACTAAG
CTTTTCAACAGAGGAAATAATCCAAATCCTGGAACTGTTGTGGATAAAGAAATTGTCAAACCGAATTTCTATGAATTTTT
CCTAGTTTCACAAAGAACAACGAAAGGAACTGCAACTCCAACTAATTATAATGTTTTAGAAGATACTCGATTGCTAACGA
AAAAAGGTACTATGGATCCTATGGCACCGAATGAGCTGCAAAAGATTACCTATGCTCTAACTCATTTATATTTCAATTGG
ATGGGAACTATCCGAGTTCCGGTTCCAGTGCATTATGCGCATAGATTGGCTGAATTAGTTGGAAAGGTGCATAAGGGCTC
TAATCCCGTTGCCATTAATGAAAGAATAAGAAATAGGCTCTTCTATTTATAAAAAGATCAAAACTTACATTTTTCTGTGT
TGATTACTATCCCAATTGTGGATTTAATTGTTTCTGAAAGCTGTTCATTCAAATTCTTCTGAAATCCATATTGATTCGTA
AGCAGCCTGTATTTGAATACTAAAATTGATAAAGTAGTTATAAGTATTGTAAAAGTATTAAATATTTGTTTATGTTATTC
GTAATACACTTGGGTTATTGCAATGTTTTAGTTGTTTTTCAATGATAATAAAGCTTAGCTGTATAAATTCTTTTAGGTTT
TTTAGAAGGTTTATTTATATCGTGTAATTGATTGTCGTGTTAATATTAATTAAATAAAAGTTTGATGTAATTGCTTTGTG
TTACGCATAATAAATCTTACGAAATTTCTGAATACAACTGCTGGTGATCGGGATATTGAATGCCGGGTCGTTTGAATTAA
TAATACAAATGCTTTCGATTATTGTCATTAATATTTTCTCCAGTGCGTAATGGGCCAGAGTTCCGGTGCCATGATTAATG
GTTCCTAAATTTTAGAAATAACATTTTGAATGACATGTTAAATGTGTATATAATAAATTTTCTAGTTTTTTTGCTAAGAT
TTTGAGAAATTTTAGTTACCTGTTTTTGTTAATTGCTTTGATAATTTCAATGCTGACACGTGCAGAATTTCACACATCTC
CAGCAGTCGACTGAATTCTTGGATTTTGTTTGATACAATTATGCTTGCAGATGTTATGGCGCATAGATCCAAGAAGGCTG
TGAATCTTGGGTCTTGTTTTGTAAAGGAAGCTTTGTAAAATATGATGGGACAGTTGCACATAAATTCTAGGAATCCAGAT
TTTAGGCAAGATTGAAGTAATGTTGAATGGTTCTATTATAGAATAATCAGTTGCACTTTTAGATAACCAATATACCACAA
AGAGCCATCCGCAAATTTTGAAAGCCCAAAGCATTGAATCGTTGTCTATGTTACTCAGTATAGACAGCAGTAAAATGGCG
CTTTTTTGATATTGTAAACCGAAATGATTACTAGAATTCATTGTTTCGTCAAGAGATTTCGCGAAACTCTGAATATTATC
TGATTGATTTGATACTATTCCTTGGAGTTTACAAATTGATTTCAGTTCCAAATTCATACTATTGTGTTCTGCTGATTTGC
TACTATTGGAGCTCTATAAGGAATTATTAGAATCAATTTTGGTTTGATAGTGGGTTTTGCAATCATTGGCTTATTGTGGG
TTGTGTAACCATGGAAGTAATTGTGAATAGTTATAGTGCTCGCTCTGCATAAAATAATATTTAATCAGTGCTTTAAAGTA
GATTTTTAACGATTATTATGAAAGATTTCTCTTATATATTAATGTTTTTGTATCCTTCAAAAGTTTACTAAAAATAATGC
ACATTTGAAATTTACGCGTTACCATAAAATGTCTGAAGTGGTCCAAAGCAATAAAAGCTTAAAAAGAAAGTTCTTGTTTT
TAAATGTATTGGGATATACTCCCACTAACCTTCCGTACTCCGCTGCCTCCCTTCCCATCACATACAATATTTGCTAGTTC
TACTTACAGAGTTGAAAATCGAAAAATTTTCCCAGTCAATGTCCATGATTATGCTGAATAAATTTTGTCCGAACATAATA
GAGATTGCCTCAGCCAGTATTTCTTTCGTTGTTGAGTTTTGATGAATGACATGTGAGACTAAATTTATGGACAACCATTG
ATTTTGGTTTTGCTGAAGTTGAGACTTCTTACGGTAAAGATAAACACGAAATAATGATAAACTCTAATCAAAAGATATTA
CAAACAAATATTATGATATCAAAACCTTCTGTCGAACCAAGGCACTTGTGTGAGATAATAAATGAAGAATGAATTCGAAA
AAGAAGTCATAATTCGAACATCGCTCCAGAATGCTGTCACTGACTTTGACTTCAATCACATTTTCCAATATTGAAATCAG
ACCGGCGATCACATGGACCCTTGATGATTCAGACTGACCACTGATTACGGGTTGATCGGTTAAATTATCTAGAGATTAAA
ATAATAGTCGGTAAAGGAAATTATCCATATAAACGGGAAACAGAAAAGTTTTAACCATGGTTTCAAAAGCTTTTGGGACT
ACCCCCAGCTTTGCAAAACAATTTTTTAACGCTCTTGTTATGACTTGAATCAACATTGTACAATTGTTACAATAGACTTG
ATGATTTACTTATTTACACCCCATCTAAATTGTTTCTTAACCCTTTGCCACCC
>SMED30000837 ID=SMED30000837|Name=Histone H4|organism=Schmidtea mediterranea sexual|type=transcript|length=1387bp
ATTAACACTAAATTTTGTTTATATAATGATTAAATATTTCAATAATCAATTAATTGAAAAATGTCTGGTCGTGGTAAAGG
AGGAAAAGGGTTAGGAAAAGGTGGAGCCAAGCGTCATCGTAAGGTTTTACGTGATAACATTCAAGGAATAACTAAGCCGG
CAATTAGAAGATTAGCTCGTAGAGGCGGAGTAAAAAGAATATCTGGTTTAATTTACGAAGAAACTCGTGGTGTTCTCAAA
GTTTTCCTGGAAAATGTTATAAGAGACGCTGTTACTTATACTGAACATGCTAAGCGTAAGACAGTAACTGCAATGGATGT
TGTTTACGCTCTTAAACGCCAAGGAAGAACTTTATACGGATTCGGAGGTTAAATGTGAAACCAATGATATTTTAAGCTAA
CATTTATTTGTTGAGAATGTTTATGGTCCTCCTTAGGGCCACAATTTTTGATTGTTTACTTTATTTTGTTAGCATTACGT
AATTTTACAGTGATTGGTTATCTTGCTGGTTGTCTGAAATATTAAATAATAATATGCTATAATTAAATGATATTAGTATA
GAAAACAAAAATCGGTTTTATTGTTTGATCAACACAATGAATATGTTTATCAATTATCATCATTTCCAGTTTTTCGATTT
CAGTTGATAATAATTATTTGCGAATTTGTGATTATATTTTCTAATGGGTTGCGAGACATAAATGAGCGTGCAGATATCAC
ATGCGAACCTGGTTCATGTAGTGTTTTGAGCTACACACTGCAGATAGACGATCAAATCTATAAAGTGAAAAAAGGGTTCA
AATCAGCTTGCAGCACCAGACTATGTGAAAATTGTGCTCACAAAGGTGATTGGTCAATGAGACTGATTGACGGAAACAAA
TATATGGTACGACAAGTCAATAAATGTTTAACTAATAATATTTTGGCAGTTGAGCAACTTTTCACAAATTTATATACTCC
TGTCTCAGATTTTACATGCTCCTTGCATAAGTGCTCTAAATATAATTATTCTTATAATGGAAATATGATTAGCTTTAGCT
ATATAGGAGTTTGTGACCATTCTTACTGTGACTCATGCCGCTATTCCGACAATTGGAGTCTATTAACCGGATATTTGCAG
CGGACGACCATTTCATGTTATGTTGTCGATAAAATTAGACTTGAAGATTATTTTCTCATTCCAGAGTTTACCGAAACCTT
CTATACACTAATTCGGAAATTAGCAATAACTATAAGCTGCGCTTCATTTTTGTGTTTGGTGATCATTCTTTTGGTTTGTT
TTGCTAAAAAATGAGATCTTACAGAAGCTTTAAGGAACTTAATTTTATTTAACAATATATTTATACTTAGATCTAATGCT
TTGAATGATCCTTTCGCAAGTCCATCC
>SMED30033466 ID=SMED30033466|Name=Histone H4|organism=Schmidtea mediterranea sexual|type=transcript|length=421bp
GATCTCACTATATAAATAAGTATTTGTCCCTATTAATTCATAACAATTATTCAACATGTCTGGTCGAGGTAAAGGAGGAA
AAGGACTAGGAAAAGGTGGAGCAAAGCGTCACAGAAAAGTCCTTCGTGATAACATTCAAGGTATCACAAAGCCAGCAATC
AGAAGATTAGCTCGTCGAGGTGGTGTTAAGAGAATTTCTGGATTGATATATGAAGAAACCCGAGGTGTTCTTAAAGTATT
CTTGGAAAATGTTATTAGAGACGCTGTGACATACACTGAGCACGCTAAGCGCAAGACAGTAACTGCCATGGATGTCGTCT
ATGCTTTGAAACGACAAGGAAGAACTTTGTACGGTTTTGGAGGTTAAATAACACTTTCATATTTGTGAATGTTTTAGCGG
CCCTCTTTAGGGCCACAAATG
>SMED30014692 ID=SMED30014692|Name=Histone H4|organism=Schmidtea mediterranea sexual|type=transcript|length=464bp
AAATCTATATAAATCTTATATGAGATAAATGTCAGGTCGAGGAAAAGGTGGAAAAGGTCTTGGTAAAGGAGGTGCTAAGA
GGCACAGAAAAGTATTGCGTGATAATATTCAAGGAATCACTAAACCTGCAATTAGACGTTTAGCAAGAAGAGGTGGCGTT
AAACGAATATCTGGGCTGATTTATGAAGAAACACGAGGTGTGCTGAAGGTTTTTCTGGAAAATATCATCCGCGATGCTGT
CACATATACGGAACACGCGAAGCGAAAAACCGTGACTGCAATGGATGTTGTTTATGCTTTGAAACGTCAAGGTCGAACTC
TTTATGGGTTCGGTGGATAATCATTTTGTATTTTATTATTTAATGTTGTAATTGCTATAATTGTTGCTAGTATTAATCTT
ATTTTAATAAATTATTTAACTGGATTTTAATTTAAATATGTCGGTTTTGTAAATCCAATTTGTA
>SMED30001362 ID=SMED30001362|Name=SMEDWI-3|organism=Schmidtea mediterranea sexual|type=transcript|length=3093bp
AATTAAGAGACAGCCATTTATGTTTATTTTTAAAATAAATAGTATATATTTAAGTTTCGAATTTTCAGCTACAATTTAAT
AGTACATAATTATACGATGTCAGGAAGTAGTGGAATAGGTAGAGGCCGCAGTCGTGGGCTGTTGATGCAAAAGTTTCTGA
ATAAAGATGTTCTTGTTCCTTCTGTTGAATCTTTAGAAGACAAAGCTCTTAATAAGCTAGGAATTCCACTTCCTGGGTCT
ACCGTAGAAAAAAATACAGAGTCAAGTTCTATATCAAGTGGAGATTCAAGAAGTAATCCCAGTGGAGATTCAAGAAATAA
CATAAAACTACAAGATAGTGATATTGAGAATCGCAATATTACCATTGTTACGCGACCATTATCCTGCATAGGCAGGGGTC
GGGGTTTAAGCAATCCCTCAAGTTTAACTACGTCATCGGGTAAATCGGATAAAATTACTGAAAACGAAGAACCTGGTCAA
ATTAAAAAGTTTGTAGGTCGCGGTAGAGGATTGTTGAATTCTCAGAAAGAATGTTCAAACTCTACTCCATCTGAAGTTTC
AAATGAATTGAAACAAATGAAAATTTCAAATGATGATAAAATGACGGTTTCTTCAGAAGCAAAGTCACAATTTGAGAACA
TTGAAAAACCTATTAGTAAATTTCGTCGACGCGAATATCCAACTCAAATAAAAGAACCATGTAATACAAGAAATGATTCA
TCGCCATCTTTAACTTTAAGTGCTAATTACGTTAAAGTTAGGACTACACAACCCCATATATATCAATACCATGTTTCCTT
TGCACCTCCGATAGATTCAAGGTTGATGAGAATTAAAATAGTTCAAGGGTTATCAGAATCAGATTTAGGGGTTGTCAAAG
AAGCAAGAGCTTTTGACGGTATGAATTTATACATTCCTCAACTTTTAAAAAATAAAGAGACAATAATTAAAGTAAACAAA
CCGACTGATAAGACTGTCGTGGATGTTAAAGTAGTTTTTACTAACAATGTTAATTTTAGTGAATGTCCTATGGTTTATAA
TGTTCTTTTTAAAAGAATTGAAAATTCCCTCAGAATGGTTAAAATTGGTAGGGATTATTTCTACCCTGAAAAAAAGATAG
TACTTGACCGTAGAAGGATGGAAATATGGCCGGGATATGTAACAAGTATCCAAAATTTTGACGGTGGTTTACTGTTACAA
TGCGATGTGTCACACAAAGTTATTCGAAATGATAGTGTGTATGACATAATGATGGAAATTAATAAAACTGTTAACAATAA
AGGTCAAATGCAAACTGCTGCGATTAATCAACTATTGGGTCAAATTGTGTTAACTCCTCACAATAACCGAAATTATAGAA
TTACTGATATAGATTGGGCTAAAAATTGTTTAAGTGAATTCGATAAAGGAGGCGAAAAAATTAGCTACCGGGATTATTTT
AAGAACACGTATGGGCTACAAATTCGTGATCTAGAGCAGCCTATGATAGTTAGTAAATCTAATAGCAGATCTGGTAAAAA
CCGAGGTCCCAAAGGATCAAAAGAAGTGGATGGTGGATTGGTCTATTTAATTCCAGAATTGTGTATGCTAACTGGTTTGA
CAGATGACATGATTAAAGATTTTCGTTTGATGAGAGAATTACACGAGCATTGTCGAGTTACTCCCAAGAAAAGACACGAA
GCCTTACTGGAATTCGTGGATAACATATATAGCTGTGAGGAAGCTAAGAAACTTTTAGGGTATTGGGGTATAACGATTGA
AAAGGACACTGTCAACATAAATGCTTGTAAAATGAATCCAGAAATGATATATTTTGGAAATGAAGCTTCTGTTAGTGCTG
GGGAACAAGCTGAATTTAAACAAGCCTTGGCACATAATAAAGTTATAGGTGGTATTCGTATTGAAAATTGGATATTAATT
TCTCCAAAAAGTTTACTGACAAAAGCAAATGGTCTGTTACAGGCTTTAATGAGCAAATCTCCTAGAGTTGGAGTTATGTT
TGGAAAACCCAAAATAGTTGAAATGAACAATGATCGAACAGAAGAGTATTTAAAAGAATTAAAGAGAAATGTGGCTCCTG
GTGTGCAGTTAGTAGTTACAATTTTATCTGCTGTTAGAGAAGATCGATACAATGCAATAAAAAAATTTTGTTATGTGGAT
TGTCCTGTTCCAAGTCAAGTGGTATTAGCCCAAACATTGAAAGAAGGGCCTAAATTAAATAGTGTGGCAGTTAATATAGC
CCTTCAAATAAACGCAAAATTAGGTGGAGAGCTGTGGGCTGTCAAAATACCTATTAAGAAGTTTATGGTTGTTGGACTTG
ATGTTTGGCATGATACTAAAGGGAGAAGTAGATCAGTTGGAGCCGTAGTTGGTTCAACTAATGCGCTATGCACAAGGTGG
TTTTCGAAATCGCATTTGCAAGAACAAGATAAAGAAATTATGTACGTATTACAGTCGTGTATGTTAAGCCTTTTAAAGGC
TTATTTTGAAGAAAATAATTTTTTGCCTGAGACTATCTTTATGTATAGGGATGGTGTTAGTGATGGTCAGTTAGGATATG
TTCAAAAAACTGAAATTGAACAATTCTTTAAAGTTTTTGAATCGTTTAGTGCTGATTATAAACCTAATATGGTATATAAT
GTTGTTCAAAAGAGAATAAATACTAGGCTCTATGTAAGTGATCCGAAAAATAAAGGACAAATAAATAACCCCAATCCTGG
TACAATTGTCGACCATACTGTTACGAGGGCTAACCTTTATGATTTTTTTCTTGTTTCTCAATCGGTTAGGCAGGGAACTG
TAACTCCGACGCATTACGTTGTTTTATGTGACAATTCTAAATACACTCCGCATCAGGTTCAGTTGATGGCTTATAAAACA
TGTCATATATATTACAATTGGCCGGGAACGGTTCGAGTACCAGCACCTTGTATGTATGCTCATAAATTGGCATATATGGT
TGGTCAGAATTTGAAAGCTGAACCTAGTAATCTTTTATGTGACAGACTTTTTTATTTGTAACATATGTGTTTCTATTTGT
ATTATTGTTAAACTGCATTTCGTAAAATAAATTAATTTCGTTATAAAAAAAAA
>SMED30001900 ID=SMED30001900|Name=Bruno-like protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1713bp
CTTTTGAGGGAAAAATAATTCTTTTATTAATAATGTTTCATCATTGGAATATAAAATAAAATATTAGGAGAAAACATAAG
TTAACCAACAATATTAGCCACATATTTCGTTTAATTATTGGTCTATCACTTTTCATTTTAACCAATTGTCTTGAGATAAT
GGAGAGTTTATCCTTAATTTTTATTATAAATCACTGGTTTTGATAGACTTATTAACAATGGAAAATTATTTCAAACTTTT
CGTTGGTCAGATACCTCGAAATACACCAGATAAAGAAATTAGACTTATTTTTGAAGCTTTTGGACCAATCTTTGAATTTT
TAATTTTAAGGGACAAGAAAACTGGTTTTCATAAAGGATGTGCTTTTGTTACATTTTATCATAAAGACTCTGCAGAAAAT
TGTCAAAAGGCGTTACATGACAAGAAAATCCTAAACGGGATGAATCGACCACTTCAAGTGAAACCAGCTAAAAATAAGTT
AGCAAAAAATTCAAGTTTGAATGGGGAAAATCAGACAGAAGAGCAGGTTTTCAGTGATGAAAGGAAATTGTTTGTTGGAA
TGTTGAGTAAAAATCAAACTGATGAAAATGTACAAAATATGTTCACAAAATTTGGCAAAATCGAAGAGTGCACTGTATTG
AAAGACCAAAATGGAAATAGTAAAGGATGTGCCTTTGTCAAATTCGTGAACCACACCGATGCTTGTGCAGCAATAAACGC
TCTTCATGCCAGTCAAAAAATGGAGGGTGCTTCATCCAGCCTTGTGGTTAAATTTGCTGACACGGATAAACAAAAACAAA
TAAGAAAATTGCAGCAATATATTCCAGATTTAAGCATTTTAAATTCGCGCATTCCTATTAATATTCCATACTATTCACAA
TACGGTACAATAATTAATCCAGAATATAATTCAACAATTCCTTCAAACCAATATATTCGAAATTGTAACGAATATATTCT
TGCTGCTCAAATTCAACAAATAAATTTGTTTTCTAATTTATCATCGGTCTACCCATCTAATTCAATAGTGTCAATGCCAT
CCAGCCATCCGGTACCAATGATTGACTATTCTGTTCCTATTAACAACTTTCCACAAACTGACCAAATAACAATGAAACCA
ATTGTTGATATACAGCCAATACCTCCAGAAGCTGTACACCGAACCATCGTAACTCCAGGATCACTCTTATCATATCCTTT
TCTTAATGTTCAAATTCCTACAGTATATCCAAACGCCTTTTCCAATGGAAATTTAACAAGTACAACACAAAGTTCAACAG
ATGTGAAAACCACTCCTTTGCCAACAGGTCCTGAAGGCTGCAATCTATTTATTTATCATCTGCCACAAGAAATTGGTGAT
TTACAATTATATCAAATTTTTATGCATTTTGGAAACGTTATCAGTTCTAAAGTTTATGTTGACAGAGCAACAAATCAAAG
CAAATGTTTTGGATTTGTCAGCTACGATGATCCGGCATGTGCCAATGCCGCCATCAAATCTATGAATGGATATCATATCG
GAACAAAAAGATTAAAAGTTCAGTTAAAAAAACCAAAAGAAGCAATAAACGAAATGAAAAACTTCAATCAAATGTTATCA
TCAACTCCCGACATAAACCAAGTATTTTGTTCATCCTAATGATTGTGATATTTTACAGGATTTTCTCGACCATATTGAAA
GCCTGATTGGTGATATGTAAAATGACCCACCGT
>SMED30035063 ID=SMED30035063|Name=SOXP-2|organism=Schmidtea mediterranea sexual|type=transcript|length=2664bp
TGTACATTGAATTCAATATTTAATAGTGATTAACTTATCCAAATTTTCAGCCACTTTTAGTTTAATTTGCGTGTTTTGTT
GAGCAGTTTTTATTGGCGCATTTTATAAAAAATACAAAACCAATCCAAATCAGTTTGAATCATTGTCAGATTTTAGTCGT
GCAAGATACATTATTTCATTTTAATTCTCTAGCATATGACATTTAAACATGGAGCTGAATTACTCGTTGAATGATAATAA
TTTCAATTTACAATTAGAAAGCGAGTCCTTGACTTATTTCGATTTATGCCAAAAATGTTCAGCGTACCAAAATAGTCTTA
GAGACTGGATGAAACATTTAGTTGACAGACATCCTTTACCTATTCAGTGGATGAGTGATTTGGCAAATAATTTAACAGAT
GATAAATTATCTAAGCCATATTCGACCGTTACAGAATCCCGTAAAAAACGCAAGAAGCATATCACTCCAAGGCCATTGAA
TAGTTTCATGATATTTTCCAGACATTTAAGAAGAAATGTTCTTATTTTCTTTAGTGATGCTTCAAATTCAGAAATAAGCA
AACTTCTTGGGAAGTTATGGAATAACATTCCAGCTACCATTAAATCGATGTATGATAATGAAGCTAAAAAGCTTGCAATT
TTACACTCCAAAGAATTTCCTGAATATAAATATCAACCTAAAAAGAAAAAAAAACAATATCTAACGAAATGCCCCATTAA
TTCCACACCTTTGTCGAGTAATTCATATGAAAGTATTCAAGATATTAATTCAGTAACGGATACACTACAGAATTCATCTA
ACAACTTACAAAAGGAAAGTAATCCGACCTCTGTTTCGTCTTATGGAAGCAATCAGGAATGTAATAATTCATTTAAGAAT
CATAGTGTACAGTCCAGCAATTTTCCCAAAGAAATCAACCATAAACCAAGTAGAAAAATTGAAAAGCAATCGTGCAAAAT
AAGTTCCAATCAAATAATGGATGATTCAGAAGGGGCTGAATCCAGTCCATCATCATTTAAAAACACCATTAAAAATGAAA
TTTATTCCTCTTATAGTCCATTTCTAAATGAATCCCATAGCATTCTTTCAGATTTAAGTTACTCTTCGTCTCTCAATAAC
GTTTCAAAACACACTAGCGATTCCATTATAACGAATTCTCCTATCAGAGAAGAAATTGTCTTAGAAAATAATCAGCCCTC
TCAACAGAATAATATAAACAATTACCGACACGTATTTCAGAGAACTTCGACTCTATCCAACAGTTTGTTGACCCCTTTAA
CCATTGTCACAGAAAAAGTTGACGAACAGAAAGATCTTCCACCATCAAGAATCAATATCCGATATGTGAAAATTAACAAA
CTACCGATTCAAACAAAATCCGATTTCCCATTGACTGGATATTTTCAAAATTTCAATAACGACTCAAATCTTCATTTTCA
GAGTTCCATTCACGCCCTGAATACGACATTGACTCCAGATCTGTCGGTAAAACGCGAAGCCACTGTCAACAACAGCATGA
CAGATTATATCAATCGAAAACGTACAAATGTCGATCCACTTATCATCGATGATATATTTGAAAACGAACAATTTGAAGAT
GAGGAAGTGTTGAATTTTGACAATCCTGATAACAATAACAGTTCTCCTTGGTCGTTTAAATCGCCTAACTTTAAAATATC
TACCGGTTCCTCGACACTGTCAGACAATCCGTACAAAGAACAGTTTTGTTCTTCCCCGTTCCATCTATCAGAAACTGATA
CTCAACCGATTCCAGTTCAACGATTGCCAGCAATCGGCTCATGGTTAAAGTCAAACTATTCTGAATTCATGATCTGATCC
AATCTATTATTCTATTCAATTGTCTGTTTTCATACAATTAGGATTACTTGTTATGAATTCTAGCTGATTTTGAGTGTGTT
TATAAAGCTTTTGTAACGCCTTTTCTATACAGATGTTCGATATATATATATAAATAAATAAATATAAATATATAACAATT
TTATTGACATTGTACAGTATTCCATAAGCCCGATCTTGTAACGCATTTATTACTATACTCAATAGACCAATCTATATGTT
CTCATAATTTCTATGTTGTTATTGTACACGGGAATTATTACTATAAATGATGCGAATTTATCACTTTGTAATTGAGGGAA
ATTATCGATCAATTTGCGCTTTCAGACATTTTTCATGTATAAACTTGTTTTTCTCTTTTTTATCATCAAAAATTTAATTT
TTTTGATATCGCTATTCATCATATTATTATTCTCCGTTGCATTTGTTAGATTATGTAAATTTTTATATGAAAATGTTGTT
ATTTATTGTATTTTTATACGATTTTTTGCTTTGGATACACTTTTATCAAATCATATTGCCAGTGTGAGCATTTATTGGAC
TTGTTGTTATTGCTGCTGCTCGAATAATTGCTTCATACGGGGAGTCTCGATATTTTCATGAAGCGATTTTCATGGTTGCC
GCTCTCCGCCGCCGCCATTCGGTGTAAATATCAATTGCATTGCCAGCACGTTTTCTCAAACTCAATTTTTGTACTCAATT
TCAATTGATTTATGTTCATTTTATTTTTCATAGAAATGAGTAAATAAATTTTCATAAATAGTTTTGTTTTCAATATTTTT
AGGAAATTTGAATGTGTCTCTAGA

 

back to top



PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in neoblast. Click this link to learn more about PAGE.


PAGE Curations: 5613


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
neoblastSMED30033663SMED30033663SMESG000054684.1 SMESG000054674.1 dd_Smed_v4_13582_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033663SMED30033663SMESG000054684.1 SMESG000054674.1 dd_Smed_v4_18196_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023502SMED30023502SMESG000060541.1 dd_Smed_v4_16242_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020829KH domain-containing proteinSMESG000069949.1 dd_Smed_v4_11601_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029053Protein chibby homolog 1SMESG000024740.1 dd_Smed_v4_12205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031155Thioredoxin-like proteinSMESG000033891.1 dd_Smed_v4_12826_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021074Nuclear transport factor 2SMESG000004940.1 dd_Smed_v4_3953_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023267Tubulin alpha chainSMESG000079660.1 dd_Smed_v4_2143_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023146Cell wall integrity and stress response component 1SMESG000035067.1 SMESG000035062.1 dd_Smed_v4_1356_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024126SMED30024126SMESG000053935.1 dd_Smed_v4_4129_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026124Dynein heavy chain, axonemalSMESG000040511.1 SMESG000040510.1 SMESG000040507.1 dd_Smed_v4_10846_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029741SMED30029741SMESG000056346.1 dd_Smed_v4_2250_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001362SMEDWI-3SMESG000081970.1 dd_Smed_v4_1258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008505SOXP-3SMESG000051170.1 dd_Smed_v4_5942_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017595RBBP4-1SMESG000037114.1 dd_Smed_v4_5609_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035880methyl-CpG binding domain 2/3SMESG000064034.1 SMESG000064035.1 dd_Smed_v4_3054_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034338SMED30034338SMESG000004213.1 dd_Smed_v4_9017_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025757JUNLI-1SMESG000067959.1 dd_Smed_v4_4878_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027307X1.A.B7.1SMESG000048213.1 SMESG000048212.1 SMESG000048209.1 SMESG000048206.1 SMESG000048204.1 dd_Smed_v4_750_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030013GTP-binding nuclear proteinSMESG000072524.1 SMESG000072522.1 dd_Smed_v4_330_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031235Tubulin alpha chainSMESG000017700.1 dd_Smed_v4_648_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034500early growth response-2SMESG000004840.1 dd_Smed_v4_9273_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032809SMED30032809SMESG000080771.1 dd_Smed_v4_2522_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034823SMED30034823SMESG000024340.1 dd_Smed_v4_822_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3003321128S ribosomal protein S9SMESG000018935.1 dd_Smed_v4_2348_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035063SOXP-2SMESG000074761.1 dd_Smed_v4_8483_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029898Nicotinate-nucleotide pyrophosphorylase [carboxylating]SMESG000080771.1 dd_Smed_v4_2522_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026863SLIT-ROBO Rho GTPase activating proteinSMESG000028956.1 dd_Smed_v4_8708_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029366SMED30029366SMESG000080771.1 dd_Smed_v4_2522_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035855Poly [ADP-ribose] polymeraseSMESG000067451.1 SMESG000060010.1 dd_Smed_v4_6154_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035858SMED30035858SMESG000064034.1 SMESG000064035.1 dd_Smed_v4_3054_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034055U5 small nuclear ribonucleoprotein 200 kDa helicaseSMESG000004936.1 dd_Smed_v4_3022_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030234Tubulin alpha chainSMESG000041107.1 dd_Smed_v4_758_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022937RNA polymerase-associated protein RTF1-like proteinSMESG000029426.1 dd_Smed_v4_887_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033583SMED30033583SMESG000060313.1 SMESG000049383.1 dd_Smed_v4_158_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021579SMED30021579SMESG000072336.1 dd_Smed_v4_14997_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033472Proteasome activator complex subunit 3SMESG000069494.1 dd_Smed_v4_1801_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED300266685-demethoxyubiquinone hydroxylase, mitochondrialSMESG000079448.1 dd_Smed_v4_5987_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021776Histone H3SMESG000074574.1 SMESG000074479.1 dd_Smed_v4_8630_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022491SMED30022491SMESG000079488.1 dd_Smed_v4_14660_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031782SMED30031782SMESG000002170.1 dd_Smed_v4_11867_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028549ARMC1SMESG000075605.1 dd_Smed_v4_11494_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3002954297 kDa heat shock proteinSMESG000019478.1 dd_Smed_v4_1087_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022511SMED30022511SMESG000019851.1 SMESG000019820.1 dd_Smed_v4_1094_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020396SMED30020396SMESG000046779.1 SMESG000024881.1 dd_Smed_v4_478_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034422Antigen KI-67SMESG000050427.1 dd_Smed_v4_13700_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021461Histone H2BSMESG000067906.1 dd_Smed_v4_4808_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020872Myosin IESMESG000070153.1 SMESG000068232.1 SMESG000077027.1 dd_Smed_v4_1626_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030829Y-box proteinSMESG000032180.1 dd_Smed_v4_209_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023430set nuclear proto-oncogeneSMESG000031906.1 SMESG000031905.1 dd_Smed_v4_618_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021509Nuclear autoantigenic sperm proteinSMESG000016858.1 dd_Smed_v4_5663_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029843Histone H3SMESG000067905.1 SMESG000067898.1 dd_Smed_v4_13347_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027566SMED30027566SMESG000075236.1 dd_Smed_v4_7519_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024824beta-catenin-1SMESG000039528.1 dd_Smed_v4_2688_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029980SMED30029980SMESG000005589.1 dd_Smed_v4_2921_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026622beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase 3SMESG000008883.1 dd_Smed_v4_12381_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020370DNA-directed RNA polymerase subunitSMESG000010459.1 dd_Smed_v4_1965_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022314116 kDa U5 small nuclear ribonucleoprotein componentSMESG000045983.1 SMESG000045982.1 dd_Smed_v4_4747_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027441ZNF207-1SMESG000077995.1 dd_Smed_v4_4303_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030135AAA domain-containing proteinSMESG000045800.1 dd_Smed_v4_14599_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013942DENN domain-containing protein 5BSMESG000072343.1 dd_Smed_v4_7039_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002774SMED30002774SMESG000017229.1 dd_Smed_v4_613_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018716Acidic leucine-rich nuclear phosphoprotein 32 family member ASMESG000065271.1 dd_Smed_v4_1396_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016357SMED30016357SMESG000061508.1 SMESG000027427.1 dd_Smed_v4_5483_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007662Nuclear pore complex protein Nup98-Nup96SMESG000022283.1 dd_Smed_v4_5347_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002529DNA-directed RNA polymerase subunit betaSMESG000067331.1 dd_Smed_v4_2182_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011677RRM domain-containing proteinSMESG000018666.1 SMESG000018665.1 dd_Smed_v4_10611_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000245560S ribosomal protein L6SMESG000076172.1 dd_Smed_v4_205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016088Protein arginine N-methyltransferase 6SMESG000017273.1 dd_Smed_v4_1336_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008984Protein phosphatase 1GSMESG000030206.1 dd_Smed_v4_2086_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003093SMED30003093SMESG000056847.1 SMESG000056843.1 SMESG000056838.1 SMESG000044770.1 SMESG000044762.1 SMESG000007140.1 dd_Smed_v4_1137_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014893Eukaryotic translation initiation factor 4E binding protein, putativeSMESG000001074.1 dd_Smed_v4_1204_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003599transverse filament protein SYCP-1SMESG000073774.1 dd_Smed_v4_18547_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013342SMED30013342SMESG000068114.1 dd_Smed_v4_10914_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012948Cytochrome c oxidase assembly factor 4, mitochondrialSMESG000011168.1 dd_Smed_v4_4811_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3001096960S ribosomal protein L6SMESG000019835.1 dd_Smed_v4_839_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005206Serine/arginine-rich splicing factor 1SMESG000075205.1 dd_Smed_v4_1192_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019709Pre-mRNA-splicing factor RBM22SMESG000059000.1 dd_Smed_v4_5573_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018385Hydroxyacyl-coenzyme A dehydrogenase, mitochondrialSMESG000032777.1 dd_Smed_v4_725_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3001553460S ribosomal protein L21SMESG000040216.1 dd_Smed_v4_189_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010364SMED30010364SMESG000056847.1 SMESG000056843.1 SMESG000056838.1 SMESG000044770.1 SMESG000044762.1 SMESG000007140.1 dd_Smed_v4_1137_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018937SMED30018937SMESG000004917.1 SMESG000004916.1 dd_Smed_v4_5623_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003672Mitochondrial import inner membrane translocase subunit TIM17SMESG000027783.1 SMESG000027888.1 dd_Smed_v4_904_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012435SMED30012435SMESG000054653.1 dd_Smed_v4_12960_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000480860S ribosomal protein L27aSMESG000005086.1 dd_Smed_v4_549_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016517ATFl1SMESG000044121.1 dd_Smed_v4_3847_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3001238340S ribosomal protein SASMESG000071180.1 dd_Smed_v4_171_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013398Pre-mRNA-splicing factor 38BSMESG000037911.1 dd_Smed_v4_1839_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010216Keratinocyte associated protein 2SMESG000055989.1 dd_Smed_v4_1305_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013833acetyl-CoA acetyltransferase, mitochondrialSMESG000056408.1 dd_Smed_v4_1377_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014413RNA-binding protein with serine-rich domainSMESG000010413.1 dd_Smed_v4_1431_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED300018021-JunSMESG000062649.1 dd_Smed_v4_5749_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000599860s ribosomal protein l3SMESG000081260.1 dd_Smed_v4_12559_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011875CTF/NF-I domain-containing proteinSMESG000028598.1 dd_Smed_v4_12312_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000289SMED30000289SMESG000076644.1 SMESG000076643.1 dd_Smed_v4_227_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016880Zinc finger Ran-binding domain-containing protein 2SMESG000017096.1 dd_Smed_v4_1397_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019802SMED30019802SMESG000017096.1 dd_Smed_v4_1397_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019021Importin-5SMESG000071264.1 SMESG000047886.1 dd_Smed_v4_665_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006476NEK8-2SMESG000043305.1 SMESG000043302.1 dd_Smed_v4_10144_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013392Pre-mRNA-splicing ATP-dependent RNA helicase PRP28SMESG000068237.1 dd_Smed_v4_5080_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018826Mov10 like RISC complex RNA helicase 1SMESG000069873.1 dd_Smed_v4_2121_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005154SMED30005154SMESG000049720.1 SMESG000049718.1 dd_Smed_v4_2225_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001140RRP15-like proteinSMESG000040122.1 dd_Smed_v4_8792_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010425Acid-sensing ion channel 4SMESG000027783.1 SMESG000027888.1 dd_Smed_v4_904_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014769SMED30014769SMESG000032777.1 dd_Smed_v4_725_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007001SMED30007001SMESG000072162.1 dd_Smed_v4_537_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023902Mitogen-activated protein kinase kinase kinase kinase 4SMESG000031711.1 dd_Smed_v4_1029_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026372Ig-like domain-containing proteinSMESG000003800.1 dd_Smed_v4_4231_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033346Obg-like ATPase 1SMESG000061866.1 dd_Smed_v4_2199_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034920G protein gamma domain-containing proteinSMESG000066557.1 dd_Smed_v4_1237_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022855Reactive oxygen species modulator 1 family proteinSMESG000039761.1 dd_Smed_v4_691_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025657SMED30025657SMESG000051020.1 dd_Smed_v4_3927_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025815SMED30025815SMESG000028784.1 SMESG000061889.1 dd_Smed_v4_3519_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025925SMED30025925SMESG000073870.1 dd_Smed_v4_359_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027909Mov10 like RISC complex RNA helicase 1SMESG000069873.1 dd_Smed_v4_2121_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029855Heterogeneous nuclear ribonucleoprotein FSMESG000009582.1 dd_Smed_v4_1957_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020948SMED30020948SMESG000024857.1 dd_Smed_v4_409_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022185SMED30022185SMESG000049166.1 dd_Smed_v4_3900_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032329SMED30032329SMESG000042387.1 dd_Smed_v4_6329_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024633SMED30024633SMESG000035561.1 dd_Smed_v4_2933_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033709Protein unc-80SMESG000014375.1 dd_Smed_v4_11471_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028966Proteasome subunit alpha typeSMESG000040163.1 dd_Smed_v4_1541_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020678G-protein, gamma subunit,domain-containing proteinSMESG000066557.1 dd_Smed_v4_1237_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024574Nipped-B proteinSMESG000051020.1 dd_Smed_v4_3927_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026515Bifunctional purine biosynthesis protein PURHSMESG000009882.1 dd_Smed_v4_3445_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3003415260S ribosomal protein L11SMESG000012668.1 SMESG000012475.1 dd_Smed_v4_144_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025897Leucine aminopeptidaseSMESG000037231.1 dd_Smed_v4_1475_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026979SMED30026979SMESG000076644.1 SMESG000076643.1 dd_Smed_v4_227_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023825LITAF domain-containing proteinSMESG000020853.1 dd_Smed_v4_353_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025331Lon protease homolog, mitochondrialSMESG000079071.1 dd_Smed_v4_3971_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024755Cationic amino acid transporterSMESG000081276.1 SMESG000081275.1 dd_Smed_v4_5465_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3002317260s ribosomal protein L14SMESG000022343.1 dd_Smed_v4_167_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027482Low-density lipoprotein receptor 1SMESG000049079.1 dd_Smed_v4_8647_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028908GTP cyclohydrolase 1 feedback regulatory proteinSMESG000042387.1 dd_Smed_v4_6329_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028718Epsin 2SMESG000042233.1 dd_Smed_v4_4779_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024329SMED30024329SMESG000051020.1 dd_Smed_v4_3927_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025467Heat shock protein 75 kDa, mitochondrialSMESG000016949.1 dd_Smed_v4_1445_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032456Aldehyde dehydrogenase,putativeSMESG000001708.1 dd_Smed_v4_400_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031331G/T mismatch-specific thymine DNA glycosylaseSMESG000067021.1 SMESG000000954.1 dd_Smed_v4_4053_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027850Ubiquitin like 5SMESG000027082.1 dd_Smed_v4_1564_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022344FERM domain containing-1SMESG000070273.1 dd_Smed_v4_1131_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026157GAS2-like 3SMESG000003786.1 SMESG000003788.1 SMESG000003787.1 dd_Smed_v4_3326_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030320Leucine-rich repeat and WD repeat-containing protein 1SMESG000061887.1 dd_Smed_v4_2942_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023477Small nuclear ribonucleoprotein Sm D1SMESG000062388.1 dd_Smed_v4_1826_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026185Si:ch211-210c8.6SMESG000081276.1 SMESG000081275.1 dd_Smed_v4_5465_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033752Tyrosine-protein kinaseSMESG000059352.1 SMESG000059351.1 dd_Smed_v4_420_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022905DihydropyrimidinaseSMESG000028784.1 SMESG000061889.1 dd_Smed_v4_3519_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020626RRM domain-containing proteinSMESG000018666.1 SMESG000018665.1 dd_Smed_v4_10611_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020940Small G protein signaling modulator 2SMESG000032335.1 SMESG000015108.1 SMESG000015275.1 dd_Smed_v4_3307_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009032Deoxycytidylate deaminaseSMESG000023231.1 dd_Smed_v4_6803_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009122spermatid elongation defective 1SMESG000010125.1 SMESG000001454.1 dd_Smed_v4_31167_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006574Eukaryotic translation initiation factor 4E family member 2SMESG000002783.1 dd_Smed_v4_10784_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017135Dual specificity mitogen-activated protein kinase kinase 6SMESG000017824.1 dd_Smed_v4_1568_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014925ATP-dependent DNA helicase DDX11SMESG000025070.1 dd_Smed_v4_19858_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004407DNA polymeraseSMESG000033372.1 dd_Smed_v4_12966_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013909tud-1SMESG000029236.1 SMESG000029232.1 dd_Smed_v4_1582_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004988Kinesin-like proteinSMESG000078501.1 SMESG000018967.1 dd_Smed_v4_9585_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010251Neurogenic differentiation factorSMESG000066244.1 dd_Smed_v4_21717_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006456ClaspinSMESG000049039.1 dd_Smed_v4_7575_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013672Mediator of RNA polymerase II transcription subunit 8SMESG000080873.1 dd_Smed_v4_5511_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000621640S ribosomal protein S8SMESG000047167.1 dd_Smed_v4_156_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001601Zinc finger-like proteinSMESG000026829.1 dd_Smed_v4_2946_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007480Protein kinase CSMESG000039865.1 SMESG000039854.1 SMESG000032749.1 SMESG000032747.1 dd_Smed_v4_4244_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017206Band 4.1 protein 2SMESG000062476.1 dd_Smed_v4_2032_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016057Receptor protein-tyrosine kinaseSMESG000070834.1 dd_Smed_v4_8641_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008103Mitochondrial import receptor subunit TOM20 homologSMESG000047476.1 dd_Smed_v4_2684_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011690Heterogeneous nuclear ribonucleoprotein A2SMESG000050993.1 SMESG000050994.1 dd_Smed_v4_1194_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005194notchless-1SMESG000000678.1 dd_Smed_v4_10113_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006905DNA endonuclease RBBP8SMESG000002586.1 dd_Smed_v4_12447_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017418Casein kinase II subunit alphaSMESG000024545.1 dd_Smed_v4_1000_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000080060S ribosomal protein L10aSMESG000025746.1 dd_Smed_v4_1750_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005444NicalinSMESG000032750.1 dd_Smed_v4_1389_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3001927340S ribosomal protein S3aSMESG000066540.1 SMESG000066537.1 dd_Smed_v4_163_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013386netrin 1SMESG000006806.1 dd_Smed_v4_9795_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013475SWI:SNF matrix associatedSMESG000013560.1 dd_Smed_v4_3355_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3001895450S ribosomal protein L7/L12SMESG000026245.1 dd_Smed_v4_2166_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007059Dihydrofolate reductaseSMESG000061712.1 dd_Smed_v4_7808_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012568Glycerol kinaseSMESG000023631.1 dd_Smed_v4_10169_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019468protein arginine methyltransferase 1-like proteinSMESG000038790.1 dd_Smed_v4_1302_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011777Cyclin t1SMESG000066586.1 dd_Smed_v4_1288_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007674G patch domain-containing protein 4SMESG000035189.1 dd_Smed_v4_1355_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008579ST13 Hsp70 interacting proteinSMESG000071677.1 SMESG000069228.1 SMESG000017570.1 SMESG000017358.1 SMESG000017347.1 SMESG000013728.1 SMESG000001430.1 dd_Smed_v4_668_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000102660S ribosomal protein L7SMESG000076604.1 dd_Smed_v4_1121_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003434SMED30003434SMESG000052485.1 dd_Smed_v4_1182_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010458SMED30010458SMESG000026243.1 dd_Smed_v4_7664_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013320Collagen alpha-2(IV) chainSMESG000002557.1 dd_Smed_v4_7811_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006163SMED30006163SMESG000013361.1 dd_Smed_v4_6783_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011661Eukaryotic translation initiation factor 3 subunit MSMESG000077210.1 dd_Smed_v4_2680_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012475PPFIA binding protein 1bSMESG000054431.1 dd_Smed_v4_7610_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005802SMED30005802SMESG000072483.1 dd_Smed_v4_5611_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004629Condensin complex subunit 2SMESG000037461.1 dd_Smed_v4_8491_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007420hypothetical proteinSMESG000037088.1 SMESG000032688.1 dd_Smed_v4_10376_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013260SAM domain-containing proteinSMESG000054431.1 dd_Smed_v4_7610_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013260SAM domain-containing proteinSMESG000010456.1 SMESG000002915.1 dd_Smed_v4_1968_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010848SMED30010848SMESG000023056.1 dd_Smed_v4_15657_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000565950S ribosomal protein L3, putativeSMESG000077764.1 dd_Smed_v4_2057_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3001301840S ribosomal protein S6SMESG000000674.1 dd_Smed_v4_178_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002902Triple functional domain proteinSMESG000061508.1 SMESG000027427.1 dd_Smed_v4_5483_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013609SMED30013609SMESG000052432.1 dd_Smed_v4_335_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000284Electron transfer flavoprotein subunit betaSMESG000025689.1 dd_Smed_v4_1315_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000448460S ribosomal protein L8SMESG000017087.1 dd_Smed_v4_108_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006391SMED30006391SMESG000026399.1 dd_Smed_v4_110_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000921RNA-binding protein Nova-1SMESG000066554.1 dd_Smed_v4_679_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002712Dynein heavy chain 3, axonemalSMESG000040511.1 SMESG000040510.1 SMESG000040507.1 dd_Smed_v4_10846_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007343Tud-1SMESG000043684.1 dd_Smed_v4_3741_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012402ADP-ribosylation factorSMESG000070321.1 SMESG000028849.1 SMESG000024160.1 SMESG000017435.1 SMESG000076591.1 SMESG000072318.1 SMESG000070034.1 SMESG000065320.1 SMESG000058718.1 SMESG000055407.1 SMESG000049597.1 SMESG000041187.1 SMESG000036810.1 SMESG000017533.1 SMESG000016079.1 SMESG000014105.1 SMESG000006480.1 SMESG000005275.1 SMESG000001086.1 dd_Smed_v4_641_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006792Argonaute 1SMESG000050993.1 SMESG000050994.1 dd_Smed_v4_1194_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021204SMED30021204SMESG000002557.1 dd_Smed_v4_7811_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035387Nuclear envelope integral membrane protein 1SMESG000002297.1 dd_Smed_v4_10531_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3003191640S ribosomal protein S30SMESG000065562.1 dd_Smed_v4_126_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030289Actin-1SMESG000066035.1 SMESG000066029.1 SMESG000066027.1 SMESG000066020.1 dd_Smed_v4_90_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021989Phosphatidylinositol N-acetylglucosaminyltransferase subunit PSMESG000077599.1 dd_Smed_v4_6100_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030350SMED30030350SMESG000053935.1 dd_Smed_v4_4129_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021483SMED30021483SMESG000070321.1 SMESG000028849.1 SMESG000024160.1 SMESG000017435.1 SMESG000076591.1 SMESG000072318.1 SMESG000070034.1 SMESG000065320.1 SMESG000058718.1 SMESG000055407.1 SMESG000049597.1 SMESG000041187.1 SMESG000036810.1 SMESG000017533.1 SMESG000016079.1 SMESG000014105.1 SMESG000006480.1 SMESG000005275.1 SMESG000001086.1 dd_Smed_v4_641_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021516MICOS complex subunit MIC60SMESG000066687.1 dd_Smed_v4_1605_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020615prohibitin-1SMESG000021272.1 dd_Smed_v4_1089_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022992Myosin heavy chainSMESG000062420.1 dd_Smed_v4_791_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029763histone H1SMESG000024348.1 SMESG000010800.1 dd_Smed_v4_601_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020070High mobility group protein B1SMESG000034017.1 dd_Smed_v4_1095_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021048U1 small nuclear ribonucleoprotein CSMESG000005768.1 dd_Smed_v4_10739_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3003350854S ribosomal protein L4, mitochondrialSMESG000002589.1 dd_Smed_v4_1861_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024665Citrate synthaseSMESG000052432.1 dd_Smed_v4_335_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034751Elongation factor G, mitochondrialSMESG000035436.1 dd_Smed_v4_1879_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021037RibonucloproteinSMESG000027962.1 dd_Smed_v4_1928_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020647SMED30020647SMESG000079340.1 dd_Smed_v4_11256_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025821Multiple PDZ domain crumbs cell polarity complex componentSMESG000053393.1 dd_Smed_v4_5376_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029203SMED30029203SMESG000026183.1 dd_Smed_v4_4644_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025401Trifunctional purine biosynthetic protein adenosine-3SMESG000044482.1 dd_Smed_v4_3037_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020640Mitochondrial genome maintenance exonuclease 1SMESG000050961.1 dd_Smed_v4_14245_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032803SMED30032803SMESG000062000.1 dd_Smed_v4_12831_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033538DNA topoisomerase 2SMESG000037559.1 SMESG000037557.1 dd_Smed_v4_4804_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024406Omega-amidase NIT2SMESG000071423.1 dd_Smed_v4_1734_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032682Methylmalonate-semialdehyde dehydrogenaseSMESG000039266.1 dd_Smed_v4_2050_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020312Pre-mRNA-splicing factor ATP-dependent RNA helicase DHX16-likeSMESG000014714.1 dd_Smed_v4_8001_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034215ubiquitin thioesterase ZRANB1SMESG000024558.1 dd_Smed_v4_2288_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025395Condensin complex subunit 2SMESG000037461.1 dd_Smed_v4_8491_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025294rRNA 2'-O-methyltransferase fibrillarinSMESG000051648.1 dd_Smed_v4_2811_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020124Ribosome biogenesis regulatory proteinSMESG000071880.1 dd_Smed_v4_2458_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024309Isocitrate dehydrogenase [NADP]SMESG000049154.1 dd_Smed_v4_449_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035004NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 9, mitochondrialSMESG000072630.1 dd_Smed_v4_1524_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025325Neurogenic locus notch proteinSMESG000063217.1 dd_Smed_v4_7067_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035984Mitochondrial 39S ribosomal protein L27 L27mtSMESG000071293.1 dd_Smed_v4_1828_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025807RuvB-like helicaseSMESG000033997.1 SMESG000018207.1 dd_Smed_v4_2547_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027178Multidrug resistance-associated protein 1SMESG000000275.1 SMESG000000273.1 SMESG000000262.1 SMESG000000250.1 SMESG000000247.1 SMESG000000245.1 dd_Smed_v4_9208_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021147Transcription elongation factor SPT5SMESG000063039.1 dd_Smed_v4_3492_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024468SMED30024468SMESG000047438.1 SMESG000028235.1 dd_Smed_v4_12953_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025220Eukaryotic initiation factor 4ASMESG000058317.1 dd_Smed_v4_349_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020974DNA topoisomerase 2SMESG000037559.1 SMESG000037557.1 dd_Smed_v4_4804_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015546Cyclic AMP-responsive element-binding protein 3SMESG000059546.1 dd_Smed_v4_1032_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010847SMED30010847SMESG000026789.1 dd_Smed_v4_10187_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006506Histone acetyltransferaseSMESG000049001.1 dd_Smed_v4_4706_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019516cyclinH-like proteinSMESG000064359.1 dd_Smed_v4_10725_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005546Coronin-1BSMESG000037126.1 SMESG000026646.1 dd_Smed_v4_448_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016673Cylindromatosis (turban tumor syndrome), bSMESG000056847.1 SMESG000056843.1 SMESG000056838.1 SMESG000044770.1 SMESG000044762.1 SMESG000007140.1 dd_Smed_v4_1137_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018984prefoldin subunit 2SMESG000075156.1 SMESG000075150.1 dd_Smed_v4_1368_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008283Glucose-repressible alcohol dehydrogenase transcriptional effectorSMESG000011011.1 dd_Smed_v4_5729_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003741KH domain-containing proteinSMESG000068335.1 dd_Smed_v4_1393_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013498LIM zinc-binding domain-containing proteinSMESG000072162.1 dd_Smed_v4_537_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001627Mitochondrial import receptor subunit TOM40SMESG000045558.1 dd_Smed_v4_4005_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013216Chromodomain-helicase-DNA-binding proteinSMESG000000092.1 dd_Smed_v4_12815_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013216Chromodomain-helicase-DNA-binding proteinSMESG000000092.1 dd_Smed_v4_7985_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011227Decapping enzyme like-1 proteinSMESG000037126.1 SMESG000026646.1 dd_Smed_v4_448_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007143Nucleolar GTP-binding protein 2SMESG000026847.1 dd_Smed_v4_1134_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018834SMED30018834SMESG000010762.1 dd_Smed_v4_3061_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014446SMEDWI-2SMESG000069984.1 SMESG000069981.1 dd_Smed_v4_756_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002777Serine/threonine-protein phosphatase 4 regulatory subunit 2SMESG000049039.1 dd_Smed_v4_7575_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009076ActinSMESG000066035.1 SMESG000066029.1 SMESG000066027.1 SMESG000066020.1 dd_Smed_v4_37_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009076ActinSMESG000066035.1 SMESG000066029.1 SMESG000066027.1 SMESG000066020.1 dd_Smed_v4_90_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010523SMED30010523SMESG000077800.1 SMESG000054046.1 SMESG000052058.1 SMESG000044674.1 SMESG000066333.1 SMESG000052053.1 SMESG000052952.1 SMESG000080770.1 SMESG000065333.1 SMESG000063486.1 SMESG000059844.1 SMESG000058646.1 SMESG000055266.1 SMESG000054970.1 SMESG000052813.1 SMESG000043147.1 SMESG000037745.1 SMESG000037601.1 SMESG000036070.1 SMESG000034880.1 SMESG000034368.1 SMESG000031415.1 SMESG000019663.1 SMESG000010897.1 SMESG000009005.1 SMESG000006729.1 SMESG000005029.1 SMESG000003989.1 dd_Smed_v4_1760_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013674Hox class homeodomain protein DjAbd-BbSMESG000033048.1 dd_Smed_v4_9061_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010267wdr82-2SMESG000044331.1 dd_Smed_v4_4830_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013445TetraspaninSMESG000063435.1 dd_Smed_v4_389_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004085hypothetical proteinSMESG000038086.1 dd_Smed_v4_5639_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002081SMED30002081SMESG000047315.1 dd_Smed_v4_5128_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004194SMED30004194SMESG000009646.1 dd_Smed_v4_23871_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004920Eukaryotic peptide chain release factor GTP-binding subunitSMESG000067151.1 SMESG000067136.1 dd_Smed_v4_1469_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002962GC-rich sequence DNA-binding factor 1SMESG000061662.1 dd_Smed_v4_11179_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005823Protein kinase N2SMESG000014536.1 SMESG000014533.1 dd_Smed_v4_7015_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007860SMED30007860SMESG000005610.1 dd_Smed_v4_5994_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004281Cytoskeleton-associated protein 5-ASMESG000045157.1 SMESG000045143.1 dd_Smed_v4_3967_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017448Heat shock 70 kDa proteinSMESG000077989.1 dd_Smed_v4_6850_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009491DNA polymerase alpha subunit BSMESG000051237.1 SMESG000051238.1 dd_Smed_v4_1195_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016181Protein regulator of cytokinesis 1aSMESG000006500.1 dd_Smed_v4_12013_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012699Protein CLP1 homologSMESG000020165.1 dd_Smed_v4_11378_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004136DNA polymeraseSMESG000079942.1 SMESG000079687.1 SMESG000044739.1 SMESG000044729.1 SMESG000044723.1 SMESG000044721.1 SMESG000044720.1 SMESG000020739.1 dd_Smed_v4_9168_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007406SMEDWI-1SMESG000036375.1 dd_Smed_v4_659_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004598Cytoskeleton-associated protein 5-ASMESG000045157.1 dd_Smed_v4_16537_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007567Lysosomal trafficking regulatorSMESG000069984.1 SMESG000069981.1 dd_Smed_v4_756_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030946DNA replication licensing factor MCM7SMESG000057772.1 dd_Smed_v4_4712_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022978VASA-2SMESG000049071.1 dd_Smed_v4_2082_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032563MCM5SMESG000005389.1 dd_Smed_v4_5764_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027258ATP-dependent RNA helicase TDRD9SMESG000016118.1 dd_Smed_v4_5842_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023062bruno-likeSMESG000021009.1 dd_Smed_v4_2592_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033466Histone H4SMESG000070504.1 SMESG000070501.1 SMESG000011051.1 dd_Smed_v4_6148_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028420Nucleotide-binding oligomerization domain-containing protein 2SMESG000018415.1 dd_Smed_v4_10594_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027299PBXSMESG000022232.1 SMESG000001913.1 dd_Smed_v4_3098_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023182PolyubiquitinSMESG000057324.1 dd_Smed_v4_516_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022627SMED30022627SMESG000053935.1 dd_Smed_v4_4504_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028428Poly [ADP-ribose] polymeraseSMESG000045968.1 dd_Smed_v4_10338_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026151WD repeat domain 82SMESG000059185.1 dd_Smed_v4_3926_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030295Peroxiredoxin-1SMESG000024235.1 dd_Smed_v4_3517_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026659ribonucleoside diphosphate reductase subunit M2SMESG000014842.1 dd_Smed_v4_5862_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025981SMED30025981SMESG000059781.1 dd_Smed_v4_12332_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028154Serine/threonine kinase 33SMESG000076986.1 SMESG000076975.1 dd_Smed_v4_12461_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027419msh6SMESG000073017.1 dd_Smed_v4_15463_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3002866540S ribosomal protein SASMESG000016079.1 dd_Smed_v4_8634_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023257SMED30023257SMESG000016203.1 dd_Smed_v4_6987_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022437Replication protein A2SMESG000049472.1 dd_Smed_v4_4341_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024368chromodomain helicase DNA-binding protein 4SMESG000068192.1 dd_Smed_v4_2331_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029979Retinoblastoma-binding protein 5 homologSMESG000077004.1 dd_Smed_v4_4897_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033360SMED30033360SMESG000074320.1 dd_Smed_v4_12537_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034520RAD51SMESG000056159.1 dd_Smed_v4_8626_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032052Cytoskeleton-associated protein 5-ASMESG000045157.1 dd_Smed_v4_16537_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032052Cytoskeleton-associated protein 5-ASMESG000045157.1 SMESG000045143.1 dd_Smed_v4_3967_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035929SWI/SNF complex subunit SMARCC2SMESG000031576.1 SMESG000013315.1 dd_Smed_v4_1804_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025079Cytoskeleton-associated protein 5-ASMESG000045157.1 dd_Smed_v4_16537_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016227DNA excision repair protein ERCC-6-likeSMESG000033073.1 dd_Smed_v4_11583_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004080PIM-1-like proteinSMESG000061809.1 SMESG000061808.1 dd_Smed_v4_16306_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004270SMED30004270SMESG000043639.1 dd_Smed_v4_2754_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012293SPT16SMESG000033905.1 dd_Smed_v4_2595_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009514histone H2BSMESG000067931.1 dd_Smed_v4_2520_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011687CBFD_NFYB_HMF domain-containing proteinSMESG000070171.1 dd_Smed_v4_12599_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002742DystoninSMESG000043809.1 SMESG000043799.1 dd_Smed_v4_1205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017928SMED30017928SMESG000053935.1 dd_Smed_v4_4129_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019011DNA repair protein RAD50SMESG000039247.1 SMESG000039215.1 dd_Smed_v4_11475_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017754SMED30017754SMESG000043124.1 dd_Smed_v4_3018_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001977SZ12-1SMESG000035646.1 dd_Smed_v4_9993_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000190SMED30000190SMESG000043124.1 dd_Smed_v4_3018_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009712epidermal growth factor receptor 1SMESG000070834.1 dd_Smed_v4_8641_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008086ESF1, nucleolar pre-rRNA processing protein, homologSMESG000043665.1 dd_Smed_v4_12089_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010297Lamin-B2SMESG000047473.1 dd_Smed_v4_6732_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013157KHD-1SMESG000070471.1 dd_Smed_v4_294_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010074TTF-type domain-containing proteinSMESG000076895.1 dd_Smed_v4_5933_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006591ZMYM-1SMESG000032185.1 SMESG000032173.1 dd_Smed_v4_3776_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003997SMED30003997SMESG000059318.1 SMESG000059304.1 dd_Smed_v4_483_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003997SMED30003997SMESG000059318.1 SMESG000059304.1 dd_Smed_v4_244_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009279DystoninSMESG000043809.1 SMESG000043799.1 dd_Smed_v4_1205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019057SMED30019057SMESG000016216.1 dd_Smed_v4_2283_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002436Histone H2ASMESG000072071.1 dd_Smed_v4_2787_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005428CIP29SMESG000073815.1 dd_Smed_v4_2297_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016021Chromatin assembly factor 1 subunit ASMESG000061926.1 dd_Smed_v4_8919_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018435Alpha-int-2SMESG000021746.1 dd_Smed_v4_3365_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016252SaposinSMESG000074184.1 SMESG000019975.1 dd_Smed_v4_266_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016901PROX-1SMESG000068287.1 dd_Smed_v4_13772_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016591Protein big brotherSMESG000068819.1 dd_Smed_v4_2875_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011755SMED30011755SMESG000074184.1 SMESG000019975.1 dd_Smed_v4_266_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010451DNA polymerase epsilon catalytic subunitSMESG000044743.1 SMESG000044635.1 dd_Smed_v4_13980_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016537SMED30016537SMESG000072339.1 dd_Smed_v4_16549_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033594Microtubule-associated protein 1ASMESG000014298.1 dd_Smed_v4_1301_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033594Microtubule-associated protein 1ASMESG000014298.1 dd_Smed_v4_3654_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020884UV excision repair protein RAD23SMESG000077827.1 dd_Smed_v4_10053_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034829fancd2-like proteinSMESG000066544.1 dd_Smed_v4_12881_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024926SMED30024926SMESG000006818.1 dd_Smed_v4_7539_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024872Cysteine and histidine-rich domain-containing protein 1SMESG000019808.1 dd_Smed_v4_1390_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028043HMG box-containing protein 1SMESG000010590.1 dd_Smed_v4_11388_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027991L-2-hydroxyglutarate dehydrogenase, mitochondrialSMESG000046453.1 SMESG000024353.1 dd_Smed_v4_1758_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021376SMED30021376SMESG000039147.1 dd_Smed_v4_18815_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027929Tubulin beta chainSMESG000022928.1 dd_Smed_v4_471_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027929Tubulin beta chainSMESG000022928.1 dd_Smed_v4_341_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020726P-type phospholipid transporterSMESG000040790.1 dd_Smed_v4_238_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021402Cell division cycle 20-like proteinSMESG000051492.1 dd_Smed_v4_10335_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021791Tubulin alpha chainSMESG000079660.1 dd_Smed_v4_2697_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021791Tubulin alpha chainSMESG000079660.1 dd_Smed_v4_2679_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027700Lipoyl synthase, mitochondrialSMESG000004184.1 SMESG000004174.1 dd_Smed_v4_19176_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014717WD repeat and FYVE domain-containing protein 3SMESG000039846.1 dd_Smed_v4_3398_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013870SMED30013870SMESG000014746.1 dd_Smed_v4_3255_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012275Splicing factor 45SMESG000038359.1 dd_Smed_v4_4530_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007341TBC1 domain family member 2BSMESG000078416.1 dd_Smed_v4_6508_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010653tRNA-specific adenosine deaminase 1SMESG000016199.1 dd_Smed_v4_9448_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014712Transcription factor 7-like 1SMESG000038786.1 dd_Smed_v4_8152_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009700Dynein light chain roadblockSMESG000061103.1 dd_Smed_v4_7991_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018624SMED30018624SMESG000052676.1 dd_Smed_v4_29437_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007304TNF receptor-associated factorSMESG000075241.1 dd_Smed_v4_4380_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009973mxi-1 proteinSMESG000047681.1 SMESG000016277.1 dd_Smed_v4_4415_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006777Collagen alpha-1(XV) chainSMESG000081921.1 dd_Smed_v4_3516_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009007SMED30009007SMESG000005752.1 dd_Smed_v4_2438_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014504Fer-1-relatedSMESG000075933.1 dd_Smed_v4_6816_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024736transmembrane protein 180SMESG000017241.1 dd_Smed_v4_4630_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021868coiled-coil domain-containing protein 39SMESG000072035.1 SMESG000072034.1 dd_Smed_v4_5955_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023081SMED30023081SMESG000043010.1 SMESG000007603.1 dd_Smed_v4_7118_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021001Protein kinaseSMESG000017252.1 SMESG000017249.1 SMESG000017248.1 dd_Smed_v4_311_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025718SMED30025718SMESG000014265.1 dd_Smed_v4_2897_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020015ABC transporter domain-containing proteinSMESG000015153.1 dd_Smed_v4_4142_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020244Protein kinase domain containing proteinSMESG000017252.1 SMESG000017249.1 SMESG000017248.1 dd_Smed_v4_311_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021070Protein kinase domain-containing proteinSMESG000017252.1 SMESG000017249.1 SMESG000017248.1 dd_Smed_v4_311_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021494DnaJ-like subfamily C member 25SMESG000035521.1 dd_Smed_v4_3301_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020996ADP-ribosylation factor GTPase-activating protein 2SMESG000008345.1 dd_Smed_v4_539_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029525SMED30029525SMESG000074822.1 dd_Smed_v4_15474_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029457S5 DRBM domain-containing proteinSMESG000023987.1 SMESG000017232.1 SMESG000080953.1 SMESG000080618.1 SMESG000072700.1 SMESG000069163.1 SMESG000065358.1 SMESG000064426.1 SMESG000062577.1 SMESG000062150.1 SMESG000060043.1 SMESG000057576.1 SMESG000056292.1 SMESG000054362.1 SMESG000052870.1 SMESG000051517.1 SMESG000050768.1 SMESG000050005.1 SMESG000049698.1 SMESG000045813.1 SMESG000041318.1 SMESG000040743.1 SMESG000039279.1 SMESG000038973.1 SMESG000038321.1 SMESG000029893.1 SMESG000028198.1 SMESG000023025.1 SMESG000021897.1 SMESG000018432.1 SMESG000018410.1 SMESG000017430.1 SMESG000006729.1 SMESG000005334.1 dd_Smed_v4_1692_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021914SMED30021914SMESG000047681.1 SMESG000016277.1 dd_Smed_v4_4415_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013451RRM domain-containing proteinSMESG000039881.1 dd_Smed_v4_1631_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017721SMED30017721SMESG000037259.1 dd_Smed_v4_4831_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001222persulfide dioxygenase ETHE1, mitochondrialSMESG000066719.1 SMESG000066710.1 dd_Smed_v4_4089_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019921SMED30019921SMESG000058949.1 dd_Smed_v4_10877_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016897SMED30016897SMESG000023253.1 dd_Smed_v4_1757_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012282Translocon-associated protein subunit alphaSMESG000013803.1 dd_Smed_v4_1657_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3001850460S ribosomal protein L30SMESG000022893.1 dd_Smed_v4_111_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015151Phosphatidylinositol transfer protein alpha isoformSMESG000080104.1 SMESG000075783.1 dd_Smed_v4_2926_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017944TetraspaninSMESG000080008.1 dd_Smed_v4_2907_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019874CalmodulinSMESG000010769.1 dd_Smed_v4_255_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004820Microfibrillar-associated protein 1SMESG000004991.1 dd_Smed_v4_2957_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006888RRM domain-containing proteinSMESG000048749.1 SMESG000048745.1 dd_Smed_v4_970_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007442SMED30007442SMESG000069832.1 dd_Smed_v4_5530_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005569rRNA 2'-O-methyltransferase fibrillarinSMESG000027841.1 dd_Smed_v4_4679_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013480DihydropyrimidinaseSMESG000060188.1 dd_Smed_v4_2040_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019092Glutathione S-transferaseSMESG000015099.1 SMESG000015094.1 SMESG000014182.1 dd_Smed_v4_1517_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000517Mitogen activated protein kinase kinase kinaseSMESG000017706.1 dd_Smed_v4_4486_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010912SMED30010912SMESG000005057.1 dd_Smed_v4_11259_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019668Proactivator polypeptideSMESG000042333.1 dd_Smed_v4_241_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005681Nkap_C domain-containing proteinSMESG000023380.1 dd_Smed_v4_6988_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017018SMED30017018SMESG000007294.1 dd_Smed_v4_371_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012188Small nuclear ribonucleoprotein FSMESG000025747.1 dd_Smed_v4_1056_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019230RIC1 domain-containing proteinSMESG000044023.1 dd_Smed_v4_9205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011575PR domain zinc finger protein 5SMESG000053925.1 dd_Smed_v4_11514_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012280dTTP/UTP pyrophosphataseSMESG000072046.1 dd_Smed_v4_4785_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012787MANSC domain-containing proteinSMESG000015184.1 dd_Smed_v4_5586_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013808fos-1SMESG000003328.1 dd_Smed_v4_2789_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019682Leukocyte receptor cluster member 8-like proteinSMESG000080104.1 SMESG000075783.1 dd_Smed_v4_2926_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014826Aldolase_II domain-containing proteinSMESG000044944.1 dd_Smed_v4_11759_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007406SMEDWI-1SMESG000036375.1 DQ186985.1smed_ncbi_20200123PMID:24704339
Vogg et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30007406SMEDWI-1SMESG000036375.1 DQ186985.1smed_ncbi_20200123PMID:23318641
Chen et al., 2013
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30027299PBXSMESG000022232.1 SMESG000001913.1 KC353351.1smed_ncbi_20200123PMID:23318641
Chen et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30032563MCM5SMESG000005389.1 JX070081smed_ncbi_20200123PMID:23629965
Zeng et al., 2013
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30012293SPT16SMESG000033905.1 JX070080smed_ncbi_20200123PMID:23629965
Zeng et al., 2013
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30032645Heterochromatin protein 1-1SMESG000004606.1 JN216838smed_ncbi_20200123PMID:23629965
Zeng et al., 2013
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30035373histone deacetylase 1SMESG000060876.1 HDAC1smed_ncbi_20200123PMID:23629965
Zeng et al., 2013
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30032631Smed-AlbinoSMESG000068148.1 KX531078.1smed_ncbi_20200123PMID:27551436
Wang et al., 2016
FACS sorted cell population asexual adult fluorescence in situ hybridization evidence
neoblastSMED30020436Nuclear distribution protein nudE-like 1SMESG000016071.1 HO006501.1ncbi_smed_estsPMID:22411224
Cowles et al., 2012
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30016141lissencephaly-1SMESG000054739.1 SMESG000035997.1 JQ650355.1smed_ncbi_20200123PMID:22411224
Cowles et al., 2012
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30020168c-Jun N-terminal kinasesSMESG000043618.1 JNKsmed_ncbi_20200123PMID:24922054
Almuedo-Castillo et al., 2014
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30034763c-Jun N-terminal kinasesSMESG000043618.1 JNKsmed_ncbi_20200123PMID:24922054
Almuedo-Castillo et al., 2014
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30018622smedxin-11SMESG000034762.1 DQ851133smed_ncbi_20200123PMID:17670787
Oviedo et al., 2007
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30004277InnexinSMESG000055258.1 AY067503smed_ncbi_20200123PMID:17670787
Oviedo et al., 2007
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30012037InnexinSMESG000055258.1 AY067503smed_ncbi_20200123PMID:17670787
Oviedo et al., 2007
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30013674Hox class homeodomain protein DjAbd-BbSMESG000033048.1 SMED30013674smed_20140614PMID:27034770
Currie et al., 2016
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30013674Hox class homeodomain protein DjAbd-BbSMESG000033048.1 SmedASXL_008593SmedAsxl_ww_GCZZ01PMID:27034770
Currie et al., 2016
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30029233Homeodomain proteinSMESG000043155.1 SMED30029233smed_20140614PMID:27034770
Currie et al., 2016
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30029233Homeodomain proteinSMESG000043155.1 SmedASXL_005553SmedAsxl_ww_GCZZ01PMID:27034770
Currie et al., 2016
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30019097SOXP-1SMESG000010063.1 SMED30019097smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035424NLK-1SMESG000023289.1 SMED30035424smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003764N-alpha-acetyltransferase 40SMESG000077166.1 SMED30003764smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005171SMED30005171SMESG000024345.1 SMED30005171smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033583SMED30033583SMESG000060313.1 SMESG000049383.1 SMED30033583smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011277Tspan1SMESG000066703.1 SMED30011277smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027929Tubulin beta chain SMED30027929smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023082SMED30023082SMESG000021722.1 SMED30023082smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022975Homeobox protein DTH-2SMESG000037282.1 SMED30022975smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000949Tgs-1SMESG000058876.1 SMED30002872smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000949Tgs-1SMESG000058876.1 SMED30000949smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002872Tgs-1SMESG000058876.1 SMED30002872smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002872Tgs-1SMESG000058876.1 SMED30000949smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007346Achaete-scute-like proteinSMESG000026861.1 SMED30007346smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010488SMED30010488SMESG000003538.1 SMED30010488smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017430Protein disulfide-isomeraseSMESG000023147.1 SMESG000017020.1 SMED30017430smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017430Protein disulfide-isomeraseSMESG000023147.1 SMESG000017020.1 SMED30028938smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028938Protein disulfide-isomerase A6SMESG000023147.1 SMESG000017020.1 SMED30017430smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028938Protein disulfide-isomerase A6SMESG000023147.1 SMESG000017020.1 SMED30028938smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033646SMED30033646SMESG000022408.1 SMED30033646smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019234SMED30019234 SMED30019234smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019803SMED30019803 SMED30019803smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032778SMED30032778 SMED30032778smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007599SMED30007599 SMED30032778smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016265Tubulin beta chainSMESG000022928.1 SMED30016265smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028798Farnesoic acid O-methyltransferaseSMESG000029910.1 SMED30028798smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005571Delta-1-pyrroline-5-carboxylate synthaseSMESG000045474.1 SMED30005571smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007744SMED-SMAD6/7-1SMESG000002697.1 JQ278719.1smed_ncbi_20200123PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30007744SMED-SMAD6/7-1SMESG000002697.1 JQ278719smed_ncbi_20200123PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30014131RPTOR independent companion of MTOR, complex 2 aSMESG000033571.1 SMESG000033570.1 JN815259.1smed_ncbi_20200123PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30025757JUNLI-1SMESG000067959.1 AFD29623smed_ncbi_20200123PMID:26062938
Tejada-Romero et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30025910Microtubule-associated protein futschSMESG000030021.1 SMESG000025422.1 SmedASXL_011384SmedAsxl_ww_GCZZ01PMID:26114597
Zhu et al., 2015
FACS sorted cell population asexual adult colorimetric in situ hybridization evidence
neoblastSMED30033302RNA-binding protein MEX3BSMESG000030021.1 SMESG000025422.1 SmedASXL_011384SmedAsxl_ww_GCZZ01PMID:26114597
Zhu et al., 2015
FACS sorted cell population asexual adult colorimetric in situ hybridization evidence
neoblastSMED30031380Pogo transposable element with ZNF domainSMESG000014324.1 MF411143smed_ncbi_20200123PMID:29557542
Han et al., 2019
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30031380Pogo transposable element with ZNF domainSMESG000014324.1 MF411143smed_ncbi_20200123PMID:29557542
Han et al., 2019
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30031380Pogo transposable element with ZNF domainSMESG000014324.1 MF411143smed_ncbi_20200123PMID:29557542
Han et al., 2019
FACS sorted cell population asexual adult fluorescence in situ hybridization evidence
neoblastSMED30023910Pogo transposable element with ZNF domainSMESG000014324.1 MF411143smed_ncbi_20200123PMID:29557542
Han et al., 2019
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30023910Pogo transposable element with ZNF domainSMESG000014324.1 MF411143smed_ncbi_20200123PMID:29557542
Han et al., 2019
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30023910Pogo transposable element with ZNF domainSMESG000014324.1 MF411143smed_ncbi_20200123PMID:29557542
Han et al., 2019
FACS sorted cell population asexual adult fluorescence in situ hybridization evidence
neoblastSMED30022937RNA polymerase-associated protein RTF1-like proteinSMESG000029426.1 GU562964smed_ncbi_20200123PMID:20215344
Fernandéz-Taboada et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
neoblastSMED30023708ZFP-1SMESG000066384.1 SMED30023708smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30026364SMED-P53SMESG000078256.1 SMESG000078255.1 SMED30026364smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30012332EGR-1SMESG000034285.1 SMED30012332smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30006464TCF15SMESG000044395.1 SMED30006464smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30008505SOXP-3SMESG000051170.1 SMED30008505smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30022628G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000060403.1 SMED30022628smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30000303HoxC12-like proteinSMESG000022668.1 SMED30000303smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30000938Homeobox domain-containing proteinSMESG000060967.1 SMED30000938smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30006353SMED30006353SMESG000004009.1 SMED30006353smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30019046SD2SMESG000021468.1 SMED30019046smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30011950Transcription factor GATA-3SMESG000079514.1 SMED30011950smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30011047GLI-1SMESG000073727.1 SMED30011047smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30006011T box transcription factor tbx2SMESG000023378.1 SMED30006011smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30015704Hox class homeodomain protein DjAbd-Ba SMED30015704smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30010878six3-1SMESG000009894.1 SMED30010878smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30011923SMED30011923SMESG000009894.1 SMED30010878smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30032499C2H2-type domain-containing proteinSMESG000075452.1 SMED30032499smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30000485SMED30000485SMESG000069311.1 SMED30000485smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30023969LIM domain only protein 3SMESG000037556.1 SMED30023969smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30033839Sp5SMESG000023227.1 SMED30033839smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30009651NSD-1SMESG000015096.1 SMESG000015015.1 dd_Smed_v4_11074_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013692Small HSP proteinSMESG000059879.1 SMESG000059868.1 SMESG000059853.1 dd_Smed_v4_1039_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019097SOXP-1SMESG000010063.1 dd_Smed_v4_7227_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018353Glycine amidinotransferase, mitochondrialSMESG000051964.1 dd_Smed_v4_920_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023708ZFP-1SMESG000066384.1 dd_Smed_v4_8720_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012458Importin subunit alphaSMESG000063514.1 dd_Smed_v4_3708_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014415Protein FAM32ASMESG000034920.1 dd_Smed_v4_1341_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011104HTH La-type RNA-binding domain-containing proteinSMESG000000519.1 dd_Smed_v4_1420_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018622smedxin-11SMESG000034762.1 dd_Smed_v4_2810_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006464TCF15SMESG000044395.1 dd_Smed_v4_4998_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011817SMED30011817SMESG000000519.1 dd_Smed_v4_1420_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016113SMED30016113SMESG000053522.1 dd_Smed_v4_548_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012378Clathrin heavy chainSMESG000035457.1 dd_Smed_v4_59_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001371P/Homo B domain-containing proteinSMESG000074553.1 SMESG000074551.1 dd_Smed_v4_1484_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007916SMED30007916SMESG000016771.1 dd_Smed_v4_11930_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015687RING-type domain-containing proteinSMESG000007981.1 dd_Smed_v4_10019_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015393SMED30015393SMESG000070153.1 SMESG000068232.1 SMESG000077027.1 dd_Smed_v4_1626_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014136Centrosome-associated protein 350SMESG000069358.1 dd_Smed_v4_20651_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017222Histone H2ASMESG000074553.1 SMESG000074551.1 dd_Smed_v4_1484_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011190Cytosolic Fe-S cluster assembly factor NUBP2 homologSMESG000019851.1 SMESG000019820.1 dd_Smed_v4_1094_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012889Family S33 non-peptidase homologue (S33 family)SMESG000021236.1 dd_Smed_v4_1414_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018630High mobility group proteinSMESG000052032.1 dd_Smed_v4_1331_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015533MRG-1SMESG000022376.1 dd_Smed_v4_5890_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017903Timeless circadian clockSMESG000030309.1 dd_Smed_v4_16022_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010208Malate dehydrogenaseSMESG000035456.1 dd_Smed_v4_1954_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017940Cathepsin L2SMESG000049722.1 dd_Smed_v4_175_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010906Structural maintenance of chromosomes proteinSMESG000059543.1 dd_Smed_v4_7123_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011181fidgetin-like protein 1SMESG000045800.1 dd_Smed_v4_14599_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000072retinoblastoma binding protein-1SMESG000007931.1 dd_Smed_v4_7612_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014394cyclin B-1SMESG000028669.1 dd_Smed_v4_11487_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017371Adenylosuccinate lyaseSMESG000014474.1 dd_Smed_v4_2280_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019073SMED30019073SMESG000041235.1 dd_Smed_v4_13685_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017782SMED30017782SMESG000079355.1 dd_Smed_v4_10665_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005365Serine/threonine-protein kinaseSMESG000007586.1 dd_Smed_v4_15228_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031773Msh2SMESG000016751.1 dd_Smed_v4_11434_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026560SMED30026560SMESG000037542.1 dd_Smed_v4_6734_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028415replication factor C subunit 2SMESG000041142.1 SMESG000041132.1 dd_Smed_v4_8732_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3002552260 kDa heat shock protein, mitochondrialSMESG000065325.1 dd_Smed_v4_141_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020821SMED30020821SMESG000014298.1 dd_Smed_v4_1301_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035904PROG-1SMESG000024882.1 SMESG000024707.1 dd_Smed_v4_332_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020421slc15a-8SMESG000033891.1 dd_Smed_v4_12826_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035725Betaine--homocysteine S-methyltransferase 1SMESG000019342.1 dd_Smed_v4_873_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029973Ribonucleoside-diphosphate reductaseSMESG000029273.1 dd_Smed_v4_1651_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027770high mobility group-2SMESG000020771.1 dd_Smed_v4_1646_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025584SMED30025584SMESG000077266.1 dd_Smed_v4_1066_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030988T-complex protein 1 subunit thetaSMESG000023665.1 dd_Smed_v4_903_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030543histone h2a.z-1SMESG000020395.1 dd_Smed_v4_2614_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026247stem loop binding proteinSMESG000060978.1 dd_Smed_v4_9628_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024735SMED30024735SMESG000012126.1 dd_Smed_v4_7744_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013759slc21a-2SMESG000028475.1 dd_Smed_v4_3499_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012735SMED30012735SMESG000031317.1 dd_Smed_v4_9229_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019006Tubulin beta chainSMESG000022928.1 dd_Smed_v4_341_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014131RPTOR independent companion of MTOR, complex 2 aSMESG000024212.1 SMESG000033570.1 dd_Smed_v4_9324_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012534SMED30012534SMESG000012031.1 dd_Smed_v4_747_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002537Y box protein-1SMESG000058013.1 dd_Smed_v4_35_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029304Endonuclease III homologSMESG000036384.1 dd_Smed_v4_9966_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026396Receptor expression-enhancing proteinSMESG000044545.1 dd_Smed_v4_5799_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023821DNA helicaseSMESG000060238.1 dd_Smed_v4_5956_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034728SUMO-activating enzyme subunit 1SMESG000036431.1 dd_Smed_v4_4443_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032708Chloride channel nucleotide sensitiveaSMESG000026632.1 dd_Smed_v4_3584_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027701ATP dependent RNA helicase DDX5SMESG000012031.1 dd_Smed_v4_3816_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027781Retinoblastoma binding protein-1SMESG000007931.1 dd_Smed_v4_7612_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30036024DNA primase large subunitSMESG000059950.1 SMESG000059945.1 SMESG000030269.1 SMESG000030252.1 dd_Smed_v4_13727_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027652SMED30027652SMESG000009812.1 dd_Smed_v4_7797_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031252SMED30031252SMESG000017120.1 dd_Smed_v4_6865_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035831SMED30035831SMESG000046586.1 dd_Smed_v4_2725_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033701chromobox protein homolog 1SMESG000055315.1 SMESG000055314.1 SMESG000054375.1 SMESG000054374.1 dd_Smed_v4_4855_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020704Poly [ADP-ribose] polymeraseSMESG000067451.1 SMESG000060010.1 dd_Smed_v4_6154_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022027host cell factor-1SMESG000068250.1 dd_Smed_v4_6196_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035848Tubulin beta chainSMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044888.1 SMESG000035755.1 dd_Smed_v4_83_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035373histone deacetylase 1SMESG000060876.1 dd_Smed_v4_695_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001515AnnexinSMESG000042839.1 dd_Smed_v4_1104_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005606Ubiquitin-like modifier-activating enzyme 1SMESG000070068.1 dd_Smed_v4_1107_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED300097175-aminolevulinate synthaseSMESG000078664.1 dd_Smed_v4_1226_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002926SMED30002926SMESG000039986.1 dd_Smed_v4_17517_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009749Myosin regulatory light chainSMESG000066092.1 SMESG000066078.1 dd_Smed_v4_445_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008568Cytoplasmic dynein 1 heavy chain 1SMESG000038603.1 SMESG000038602.1 dd_Smed_v4_1140_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007788Transcription elongation regulator 1SMESG000011919.1 dd_Smed_v4_1147_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002714transmembrane emp24 domain-containing protein eca-likeSMESG000073800.1 dd_Smed_v4_1023_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009634Proteasome subunit alpha typeSMESG000060349.1 dd_Smed_v4_1154_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003815SMED30003815SMESG000039247.1 SMESG000039215.1 dd_Smed_v4_11475_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009112plexin-D1-likeSMESG000033280.1 dd_Smed_v4_11809_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000317640S ribosomal protein S2SMESG000051503.1 dd_Smed_v4_226_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006481WD repeat-containing protein 49SMESG000041940.1 dd_Smed_v4_13248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006985WD repeat-containing protein 49SMESG000041940.1 dd_Smed_v4_13248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009444CubilinSMESG000058235.1 dd_Smed_v4_11447_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017379DJ-1SMESG000003454.1 dd_Smed_v4_1223_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000938Homeobox domain-containing proteinSMESG000060967.1 dd_Smed_v4_15471_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004903Cytochrome b-c1 complex subunit 2, mitochondrialSMESG000064836.1 dd_Smed_v4_1004_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019763CS domain-containing proteinSMESG000078259.1 SMESG000075881.1 SMESG000064589.1 SMESG000031042.1 SMESG000029607.1 SMESG000021352.1 SMESG000004064.1 dd_Smed_v4_3736_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011180Kinesin-like protein KIF26ASMESG000051203.1 dd_Smed_v4_8860_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003788Mitochondrial import receptor subunit TOM70SMESG000070017.1 dd_Smed_v4_2190_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001172Elongation factor 1-betaSMESG000026862.1 dd_Smed_v4_206_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000239240S ribosomal protein S15SMESG000015520.1 dd_Smed_v4_201_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000365Bifunctional heparan sulfate N-deacetylase/N-sulfotransferaseSMESG000046505.1 dd_Smed_v4_12192_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008895ATP-binding cassette sub-family F member 1SMESG000041811.1 dd_Smed_v4_1761_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006257SMED30006257SMESG000016925.1 dd_Smed_v4_12203_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005862Carbonyl reductase 1SMESG000009833.1 dd_Smed_v4_2165_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3001449360S ribosomal protein L5SMESG000004748.1 dd_Smed_v4_151_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006353SMED30006353SMESG000004009.1 dd_Smed_v4_7680_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000448Cysteine-rich proteinSMESG000044206.1 dd_Smed_v4_1185_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027563Ras and EF-hand domain-containing protein homologSMESG000049774.1 SMESG000049749.1 dd_Smed_v4_2966_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020614ATP-dependent RNA helicase DBP2SMESG000033349.1 dd_Smed_v4_594_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022975Homeobox protein DTH-2SMESG000037282.1 dd_Smed_v4_6729_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022560Ribosomal_L28e domain-containing proteinSMESG000026745.1 dd_Smed_v4_221_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024408Muscleblind proteinSMESG000073369.1 dd_Smed_v4_7489_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021079Splicing factor 3B subunit 2SMESG000041240.1 dd_Smed_v4_6657_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023874Aminoacylase-1SMESG000028017.1 dd_Smed_v4_1519_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3002074960S acidic ribosomal protein P2SMESG000057890.1 dd_Smed_v4_556_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025326CD2 antigen cytoplasmic tail-binding protein 2SMESG000017285.1 dd_Smed_v4_3537_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019886BCL3-1SMESG000023987.1 SMESG000017232.1 SMESG000080953.1 SMESG000080618.1 SMESG000072700.1 SMESG000069163.1 SMESG000065358.1 SMESG000064426.1 SMESG000062577.1 SMESG000062150.1 SMESG000060043.1 SMESG000057576.1 SMESG000056292.1 SMESG000054362.1 SMESG000052870.1 SMESG000051517.1 SMESG000050768.1 SMESG000050005.1 SMESG000049698.1 SMESG000045813.1 SMESG000041318.1 SMESG000040743.1 SMESG000039279.1 SMESG000038973.1 SMESG000038321.1 SMESG000029893.1 SMESG000028198.1 SMESG000023025.1 SMESG000021897.1 SMESG000018432.1 SMESG000018410.1 SMESG000017430.1 SMESG000006729.1 SMESG000005334.1 dd_Smed_v4_1692_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003135SMED30003135SMESG000011835.1 dd_Smed_v4_3825_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004800TNF receptor associated factor-2SMESG000075241.1 dd_Smed_v4_4380_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014567Synaptotagmin-like 5SMESG000010162.1 dd_Smed_v4_21069_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013177Importin subunit alphaSMESG000058125.1 SMESG000055942.1 dd_Smed_v4_590_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018632Protein kinase domain-containing proteinSMESG000017261.1 dd_Smed_v4_2030_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015235Amyloid-beta A4 precursor protein-binding family A member 2SMESG000028901.1 dd_Smed_v4_2836_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013600Ring box proteinSMESG000036014.1 dd_Smed_v4_1136_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017825SMED30017825SMESG000026672.1 dd_Smed_v4_13542_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019390kelch domain-containing protein 9SMESG000074761.1 dd_Smed_v4_7438_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015358Vacuolar protein sorting 13 homolog BSMESG000013041.1 dd_Smed_v4_9569_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016458SMED30016458SMESG000074522.1 SMESG000074521.1 dd_Smed_v4_1967_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027141SMED30027141SMESG000059828.1 dd_Smed_v4_1549_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020379DNA methyltransferase 1-associated proteinSMESG000023267.1 dd_Smed_v4_6218_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021151Corepressor interacting with RBPJ 1SMESG000027503.1 SMESG000027499.1 dd_Smed_v4_1892_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032843SMED30032843SMESG000062936.1 SMESG000024338.1 SMESG000024319.1 SMESG000024308.1 dd_Smed_v4_18000_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025026FCH and double SH3 domains proteinSMESG000023477.1 SMESG000006893.1 dd_Smed_v4_13998_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025755DNA-binding protein RFX5SMESG000072002.1 dd_Smed_v4_6108_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027645SMED30027645SMESG000054738.1 SMESG000035995.1 dd_Smed_v4_6659_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3002165739S ribosomal protein L23SMESG000037729.1 SMESG000037731.1 dd_Smed_v4_2551_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029142Sorting nexin-25-like proteinSMESG000002020.1 dd_Smed_v4_1891_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021906SMED30021906SMESG000038869.1 dd_Smed_v4_1046_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022612Ester hydrolase C11orf54-like proteinSMESG000027576.1 SMESG000007855.1 dd_Smed_v4_1733_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031902SMED30031902SMESG000055070.1 dd_Smed_v4_1410_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023515SMED30023515SMESG000023987.1 SMESG000017232.1 SMESG000080953.1 SMESG000080618.1 SMESG000072700.1 SMESG000069163.1 SMESG000065358.1 SMESG000064426.1 SMESG000062577.1 SMESG000062150.1 SMESG000060043.1 SMESG000057576.1 SMESG000056292.1 SMESG000054362.1 SMESG000052870.1 SMESG000051517.1 SMESG000050768.1 SMESG000050005.1 SMESG000049698.1 SMESG000045813.1 SMESG000041318.1 SMESG000040743.1 SMESG000039279.1 SMESG000038973.1 SMESG000038321.1 SMESG000029893.1 SMESG000028198.1 SMESG000023025.1 SMESG000021897.1 SMESG000018432.1 SMESG000018410.1 SMESG000017430.1 SMESG000006729.1 SMESG000005334.1 dd_Smed_v4_1692_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022331Translocon-associated protein, gamma subunitSMESG000066628.1 dd_Smed_v4_1265_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026337AnkyrinSMESG000000606.1 dd_Smed_v4_2072_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026337AnkyrinSMESG000019783.1 SMESG000019789.1 dd_Smed_v4_4438_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030159SMED30030159SMESG000000606.1 dd_Smed_v4_2072_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021238Delta-aminolevulinic acid dehydrataseSMESG000004221.1 dd_Smed_v4_6364_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030789Homeobox domain-containing proteinSMESG000049852.1 dd_Smed_v4_7324_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032367SMED30032367SMESG000023987.1 SMESG000017232.1 SMESG000080953.1 SMESG000080618.1 SMESG000072700.1 SMESG000069163.1 SMESG000065358.1 SMESG000064426.1 SMESG000062577.1 SMESG000062150.1 SMESG000060043.1 SMESG000057576.1 SMESG000056292.1 SMESG000054362.1 SMESG000052870.1 SMESG000051517.1 SMESG000050768.1 SMESG000050005.1 SMESG000049698.1 SMESG000045813.1 SMESG000041318.1 SMESG000040743.1 SMESG000039279.1 SMESG000038973.1 SMESG000038321.1 SMESG000029893.1 SMESG000028198.1 SMESG000023025.1 SMESG000021897.1 SMESG000018432.1 SMESG000018410.1 SMESG000017430.1 SMESG000006729.1 SMESG000005334.1 dd_Smed_v4_1692_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029291SMED30029291SMESG000025667.1 SMESG000016264.1 dd_Smed_v4_4390_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033431Protocadherin-11 X-linkedSMESG000072628.1 dd_Smed_v4_17019_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035950G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000055047.1 dd_Smed_v4_15925_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035542SMED30035542SMESG000062936.1 SMESG000024338.1 SMESG000024319.1 SMESG000024308.1 dd_Smed_v4_18000_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028898BZIP domain-containing proteinSMESG000067543.1 dd_Smed_v4_1399_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025736PHB domain-containing proteinSMESG000076275.1 dd_Smed_v4_5746_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021942Peptidyl-tRNA hydrolase 2, mitochondrial-like proteinSMESG000050572.1 dd_Smed_v4_8950_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034849Kyphoscoliosis peptidaseSMESG000061907.1 dd_Smed_v4_1109_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031880Family with sequence similarity 227 member BSMESG000052176.1 SMESG000046302.1 dd_Smed_v4_15102_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028737Tubby-like proteinSMESG000009644.1 dd_Smed_v4_10462_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026348SMED30026348SMESG000069520.1 dd_Smed_v4_1115_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025465disintegrin and metalloproteinase domain containing protein-2SMESG000076886.1 dd_Smed_v4_2341_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029792PolyubiquitinSMESG000079959.1 dd_Smed_v4_2001_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021940SMED30021940SMESG000017261.1 dd_Smed_v4_2030_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034045N(G),N(G)-dimethylarginine dimethylaminohydrolaseSMESG000056249.1 dd_Smed_v4_1460_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029738Cytochrome b-c1 complex subunit Rieske, mitochondrialSMESG000009447.1 dd_Smed_v4_1515_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED300231017-dehydrocholesterol reductaseSMESG000007895.1 dd_Smed_v4_8591_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022142SMED30022142SMESG000070064.1 SMESG000070059.1 dd_Smed_v4_3829_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029370Glucose-6-phosphate isomeraseSMESG000067583.1 dd_Smed_v4_1398_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020656SMED30020656SMESG000034285.1 dd_Smed_v4_3935_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020656SMED30020656 dd_Smed_v4_13429_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020643Chromosome 11 open reading frame 58SMESG000030362.1 dd_Smed_v4_6127_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032110TNF receptor-associated factorSMESG000039089.1 dd_Smed_v4_1991_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021537SMED30021537SMESG000056249.1 dd_Smed_v4_1460_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021479SMED30021479SMESG000017261.1 dd_Smed_v4_2030_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031354ATP synthase-coupling factor 6, mitochondrialSMESG000038869.1 dd_Smed_v4_1046_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033453Dimer_Tnp_hAT domain-containing proteinSMESG000001790.1 dd_Smed_v4_212_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023510Ornithine aminotransferaseSMESG000055175.1 dd_Smed_v4_1896_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027941SMED30027941SMESG000011835.1 dd_Smed_v4_3825_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021105Tubulin alpha chainSMESG000005506.1 SMESG000005505.1 SMESG000005493.1 SMESG000005489.1 SMESG000005487.1 dd_Smed_v4_38_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025978SMED30025978SMESG000069967.1 dd_Smed_v4_6939_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027092SMED30027092SMESG000078236.1 SMESG000032651.1 dd_Smed_v4_4949_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025098Epidermal growth factor receptor substrate 15-like 1SMESG000026804.1 dd_Smed_v4_3526_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029434SMED30029434SMESG000045809.1 dd_Smed_v4_6870_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023797RF_PROK_I domain-containing proteinSMESG000021177.1 dd_Smed_v4_2359_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3002979839S ribosomal protein L22SMESG000080731.1 dd_Smed_v4_2175_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030059Glutamate receptorSMESG000073268.1 dd_Smed_v4_7562_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007361SMED30007361SMESG000063825.1 dd_Smed_v4_569_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015457SMED30015457SMESG000022017.1 dd_Smed_v4_9360_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014560SMED30014560SMESG000026537.1 dd_Smed_v4_858_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011798E3 ubiquitin-protein ligase MIB2SMESG000043477.1 SMESG000010549.1 SMESG000010347.1 SMESG000010327.1 dd_Smed_v4_593_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007747Dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit 1SMESG000070862.1 dd_Smed_v4_853_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017409Ubiquitin-like domain-containing protein dd_Smed_v4_8353_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017092SMED30017092 dd_Smed_v4_33610_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006570SMED30006570 dd_Smed_v4_28656_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007012SMED30007012SMESG000027376.1 dd_Smed_v4_3090_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002680SMED30002680 dd_Smed_v4_11691_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007894Exportin 1 (CRM1 homolog, yeast) bSMESG000025559.1 dd_Smed_v4_3264_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015305TM2 domain-containing protein 1 dd_Smed_v4_2489_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014761SMED30014761 dd_Smed_v4_9748_0_3dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011747SMED30011747 dd_Smed_v4_494_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007277Tryptophan-2,3-dioxygenaseSMESG000075109.1 dd_Smed_v4_3550_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015202Splicing factor U2af subunit like proteinSMESG000002374.1 dd_Smed_v4_3092_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011479GGACT domain-containing protein dd_Smed_v4_7000_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013000SMED30013000SMESG000052428.1 dd_Smed_v4_4768_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008411Aldo_ket_red domain-containing proteinSMESG000053228.1 dd_Smed_v4_487_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013075Voltage-dependent anion channel 3SMESG000000196.1 dd_Smed_v4_738_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013676nesprin-1-likeSMESG000016747.1 SMESG000016745.1 dd_Smed_v4_5365_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012767SMED30012767 dd_Smed_v4_917_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008655Tubulin alpha chainSMESG000054547.1 dd_Smed_v4_508_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012572Leucine--tRNA ligaseSMESG000071689.1 dd_Smed_v4_9705_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018200RRM domain-containing protein dd_Smed_v4_8256_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019578Pre-mRNA-splicing factor ISY1 dd_Smed_v4_3703_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011287SMED30011287 dd_Smed_v4_14028_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006989Eukaryotic translation initiation factor 2-alpha kinase 3SMESG000032681.1 SMESG000032678.1 SMESG000032676.1 dd_Smed_v4_5111_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015720SMED30015720SMESG000005201.1 dd_Smed_v4_4267_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014403Mannosyl phosphorylinositol ceramide synthase SUR1 dd_Smed_v4_9783_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015758Glutamate receptor ionotropic kainate 3SMESG000005201.1 dd_Smed_v4_4267_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007825SMED30007825 dd_Smed_v4_13149_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016636rRNA adenine N(6)-methyltransferaseSMESG000026090.1 dd_Smed_v4_5268_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005604Secretory carrier-associated membrane protein dd_Smed_v4_8659_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011310SMED30011310 dd_Smed_v4_2712_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012816AminomethyltransferaseSMESG000012592.1 dd_Smed_v4_3994_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017339Dynactin 1bSMESG000029463.1 dd_Smed_v4_4065_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016092SMED30016092 dd_Smed_v4_3534_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007543nesprin-1-likeSMESG000016747.1 SMESG000016745.1 dd_Smed_v4_5365_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012260Dual specificity tyrosine-phosphorylation-regulated kinase 1A dd_Smed_v4_16782_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008744Cyclin-KSMESG000004055.1 dd_Smed_v4_2558_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012219Protein disulfide-isomeraseSMESG000041085.1 dd_Smed_v4_426_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017499SMED30017499 dd_Smed_v4_459_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018530SMED30018530 dd_Smed_v4_19281_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029447SMED30029447 dd_Smed_v4_5235_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022501Fatty acid-binding protein, heartSMESG000029500.1 dd_Smed_v4_599_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033804TransporterSMESG000003011.1 dd_Smed_v4_5713_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033554SMED30033554 dd_Smed_v4_492_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033456ATP-dependent (S)-NAD(P)H-hydrate dehydrataseSMESG000002442.1 dd_Smed_v4_3409_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028509SMED30028509 dd_Smed_v4_5296_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031987SMED30031987 dd_Smed_v4_3434_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027782SMED30027782SMESG000031406.1 dd_Smed_v4_3811_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3002315960S acidic ribosomal protein P2SMESG000009232.1 dd_Smed_v4_96_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028199Placenta specific protein 8 dd_Smed_v4_865_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035864M-phase inducer phosphataseSMESG000054042.1 dd_Smed_v4_7176_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022308SMED30022308 dd_Smed_v4_3253_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026678SMED30026678 dd_Smed_v4_3577_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027648SMED30027648 dd_Smed_v4_4009_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030317ATP-dependent (S)-NAD(P)H-hydrate dehydrataseSMESG000002442.1 dd_Smed_v4_3409_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029269Structural maintenance of chromosomes proteinSMESG000022017.1 dd_Smed_v4_9360_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3002143360S ribosomal protein L39 dd_Smed_v4_394_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020514SMED30020514 dd_Smed_v4_2709_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027315SMED30027315SMESG000023005.1 dd_Smed_v4_8220_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022793SMED30022793 dd_Smed_v4_9748_0_3dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026188ER membrane protein complex subunit 10 dd_Smed_v4_2594_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030050RNA 3'-terminal phosphate cyclase-like proteinSMESG000009463.1 dd_Smed_v4_3243_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023981SMED30023981SMESG000026344.1 SMESG000026343.1 dd_Smed_v4_5515_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021532Pre-mRNA-splicing factor syf2SMESG000009253.1 dd_Smed_v4_3218_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027710Ras-related protein Rab-3 dd_Smed_v4_7977_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020524SMED30020524 dd_Smed_v4_911_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029428SMED30029428SMESG000019958.1 dd_Smed_v4_5765_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035193Heat shock protein 90 dd_Smed_v4_56_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035174SMED30035174 dd_Smed_v4_6013_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034547SMED30034547 dd_Smed_v4_4369_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30027335H/ACA ribonucleoprotein complex subunit 3 dd_Smed_v4_967_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025717SMED30025717SMESG000031124.1 dd_Smed_v4_6804_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035298SMED30035298 dd_Smed_v4_4369_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034345SMED30034345 dd_Smed_v4_3966_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032304Hypotheticial protein dd_Smed_v4_8879_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034101SMED30034101 dd_Smed_v4_3534_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020375PHD finger-like domain-containing protein 5ASMESG000029843.1 dd_Smed_v4_2656_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028513Transcriptional activator protein Pur-beta dd_Smed_v4_346_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022575pescadillo-1SMESG000032689.1 dd_Smed_v4_900_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033528SMED30033528SMESG000031124.1 dd_Smed_v4_6804_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028902DNA-directed RNA polymeraseSMESG000026344.1 SMESG000026343.1 dd_Smed_v4_5515_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030386SMED30030386SMESG000026344.1 SMESG000026343.1 dd_Smed_v4_5515_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035024SMED30035024SMESG000074987.1 dd_Smed_v4_3607_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30028182SMED30028182SMESG000008006.1 dd_Smed_v4_8400_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30024232SMED30024232SMESG000047490.1 dd_Smed_v4_707_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30033811RNase H domain-containing protein dd_Smed_v4_35674_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30029727Zinc finger, C2H2 typeSMESG000073676.1 dd_Smed_v4_5177_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025780Serine/threonine-protein kinase PLKSMESG000022441.1 dd_Smed_v4_4273_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30023483INX-13SMESG000043575.1 dd_Smed_v4_11501_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031463VASA-1SMESG000067941.1 dd_Smed_v4_1985_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002877IQ motif and SEC7 domain-containing protein 2SMESG000070179.1 dd_Smed_v4_8602_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010115ribonucleoside diphosphate reductase subunit M2-2SMESG000079368.1 SMESG000044188.1 SMESG000044184.1 dd_Smed_v4_2286_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005246cyclin B-2SMESG000060055.1 dd_Smed_v4_7837_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30030681SMED30030681SMESG000038678.1 dd_Smed_v4_327_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30026364SMED-P53SMESG000078256.1 SMESG000078255.1 dd_Smed_v4_5563_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED300224045'-tyrosyl-DNA phosphodiesteraseSMESG000024529.1 dd_Smed_v4_12962_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035424NLK-1SMESG000023289.1 SMESG000023149.1 dd_Smed_v4_4172_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009224early growth response-3SMESG000000959.1 dd_Smed_v4_12410_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008015slc25a-14SMESG000015827.1 dd_Smed_v4_7507_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003764N-alpha-acetyltransferase 40SMESG000077166.1 dd_Smed_v4_5816_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002927SAM domain-containing proteinSMESG000041461.1 dd_Smed_v4_19710_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004593SMED30004593SMESG000009948.1 dd_Smed_v4_19022_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004593SMED30004593 dd_Smed_v4_15248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007516SMED30007516SMESG000004411.1 dd_Smed_v4_17796_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000140SAM domain-containing proteinSMESG000041461.1 dd_Smed_v4_19710_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011413Histone H2ASMESG000022910.1 SMESG000006040.1 dd_Smed_v4_12365_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30005171SMED30005171SMESG000024345.1 dd_Smed_v4_629_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3003144714-3-3 protein beta/alphaSMESG000067831.1 dd_Smed_v4_5419_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019741TetraspaninSMESG000021636.1 dd_Smed_v4_13516_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018649Regulator of telomere elongation helicase 1 homologSMESG000018012.1 dd_Smed_v4_16638_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014970Aurora kinase A-ASMESG000060356.1 dd_Smed_v4_15869_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018973Nuclear prelamin A recognition factor-likeSMESG000028508.1 dd_Smed_v4_10598_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021808SMED30021808SMESG000054507.1 dd_Smed_v4_14111_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022030EGR-like protein 1SMESG000000959.1 dd_Smed_v4_12410_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022030EGR-like protein 1SMESG000000960.1 dd_Smed_v4_7731_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30025421exonuclease 1-likeSMESG000064333.1 dd_Smed_v4_14547_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017368Diphthine methyltransferaseSMESG000060795.1 dd_Smed_v4_7236_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015999aurora kinase-1SMESG000006604.1 dd_Smed_v4_9065_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011372Queuosine salvage proteinSMESG000078335.1 dd_Smed_v4_5644_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013237Peptidase C50 domain-containing proteinSMESG000017514.1 SMESG000017512.1 dd_Smed_v4_6610_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006979DNA helicaseSMESG000052872.1 SMESG000023403.1 dd_Smed_v4_7682_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018566tRNA pseudouridine synthase ASMESG000053891.1 dd_Smed_v4_8828_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032688Cyclin-dependent kinase 1SMESG000052413.1 dd_Smed_v4_11265_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035415Helicase ATP-binding domain-containing proteinSMESG000025070.1 dd_Smed_v4_19858_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034043Cactin, spliceosome C complex subunitSMESG000026741.1 dd_Smed_v4_15273_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30031539Origin recognition complex subunit 4SMESG000043431.1 dd_Smed_v4_11263_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012075SMED30012075SMESG000059352.1 SMESG000059351.1 dd_Smed_v4_420_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30013542SMED30013542SMESG000052945.1 SMESG000027762.1 dd_Smed_v4_236_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016589SynapsinSMESG000063523.1 dd_Smed_v4_3135_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018724SMED30018724SMESG000036933.1 dd_Smed_v4_3235_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015575Collagen alpha-1(IV) chainSMESG000016766.1 dd_Smed_v4_2337_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018507Calcium-transporting ATPaseSMESG000038461.1 dd_Smed_v4_3170_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018507Calcium-transporting ATPaseSMESG000038461.1 dd_Smed_v4_4559_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017954Cell division cycle 5 proteinSMESG000035947.1 dd_Smed_v4_4163_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007474Tyrosyl-DNA phosphodiesterase 1SMESG000046266.1 SMESG000046256.1 dd_Smed_v4_8311_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017309SMED30017309SMESG000037799.1 dd_Smed_v4_4196_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011069AGO-2SMESG000047591.1 dd_Smed_v4_3861_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008425PI-PLC X domain-containing protein 3SMESG000075551.1 dd_Smed_v4_5433_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007498Ribosomal protein L19SMESG000057653.1 dd_Smed_v4_228_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30014194Stonin-1/2SMESG000017305.1 dd_Smed_v4_6859_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009849apaf1SMESG000063172.1 dd_Smed_v4_3375_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30019120Myb_DNA-bind_5 domain-containing proteinSMESG000029917.1 dd_Smed_v4_4675_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30011758PCIF1_WW domain-containing proteinSMESG000032335.1 SMESG000015108.1 SMESG000015275.1 dd_Smed_v4_3307_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020903THO complex subunit 2SMESG000079934.1 dd_Smed_v4_3159_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020206SMED30020206SMESG000005128.1 dd_Smed_v4_4156_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30020269MyophilinSMESG000081505.1 SMESG000049198.1 SMESG000047694.1 SMESG000035451.1 SMESG000035348.1 dd_Smed_v4_395_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003592SMED30003592SMESG000013335.1 dd_Smed_v4_10619_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018987SMED30018987SMESG000076175.1 dd_Smed_v4_11221_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002663TNF receptor-associated factorSMESG000018404.1 dd_Smed_v4_4392_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012332EGR-1SMESG000034285.1 dd_Smed_v4_3935_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015481DNA topoisomerase 2SMESG000070153.1 SMESG000068232.1 SMESG000077027.1 dd_Smed_v4_1626_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009284Hsp70SMESG000056256.1 dd_Smed_v4_424_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30018579SMED30018579SMESG000017019.1 dd_Smed_v4_13580_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032645Heterochromatin protein 1-1SMESG000004606.1 SMESG000004604.1 dd_Smed_v4_928_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034490FGFR1SMESG000036598.1 SMESG000036590.1 dd_Smed_v4_6020_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30032457SMED30032457SMESG000077599.1 dd_Smed_v4_6100_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30034403Prolyl 4-hydroxylase subunit alpha-2SMESG000060999.1 dd_Smed_v4_6625_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30012284SMED30012284SMESG000008538.1 dd_Smed_v4_15230_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000024060S ribosomal protein L10aSMESG000027088.1 dd_Smed_v4_350_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3001369960S ribosomal protein L9SMESG000003774.1 dd_Smed_v4_150_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000905260S ribosomal protein L18SMESG000017166.1 dd_Smed_v4_128_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002314SMED30002314SMESG000049166.1 dd_Smed_v4_3900_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30016719Histone H4 transcription factorSMESG000014193.1 SMESG000014189.1 dd_Smed_v4_12249_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30007977SMED30007977SMESG000020879.1 dd_Smed_v4_11507_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30010457cell division cycle and apoptosis regulator protein 1SMESG000052430.1 dd_Smed_v4_1608_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003951Tektin-4SMESG000016881.1 dd_Smed_v4_37536_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30004175Rho guanine nucleotide exchange factorSMESG000018733.1 dd_Smed_v4_4423_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED300197111,4-alpha-glucan-branching enzymeSMESG000060455.1 dd_Smed_v4_2161_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003560Teneurin-2SMESG000016735.1 dd_Smed_v4_5439_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3001918960S ribosomal protein L37aSMESG000078736.1 dd_Smed_v4_140_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30002133PolyubiquitinSMESG000039444.1 SMESG000014081.1 dd_Smed_v4_34_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006369Integrin betaSMESG000045564.1 dd_Smed_v4_2017_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30000343SMED30000343SMESG000016758.1 dd_Smed_v4_11194_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30015172Protein kinase CSMESG000039865.1 SMESG000039854.1 SMESG000032749.1 SMESG000032747.1 dd_Smed_v4_4244_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3001242160S ribosomal protein L37aSMESG000078736.1 dd_Smed_v4_140_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30003651apaf1SMESG000063172.1 dd_Smed_v4_3375_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3000665560S ribosomal protein L32SMESG000060036.1 dd_Smed_v4_149_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017670N-terminal Xaa-Pro-Lys N-methyltransferase 1SMESG000059668.1 dd_Smed_v4_1236_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30008111DnaJ homolog subfamily C member 2SMESG000080160.1 dd_Smed_v4_1353_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30006546tRNA 2'-phosphotransferase 1SMESG000068824.1 dd_Smed_v4_5292_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30001988Non-specific serine/threonine protein kinaseSMESG000036933.1 dd_Smed_v4_3235_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30017260Pre mRNA processing factor 6SMESG000011657.1 dd_Smed_v4_1153_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30009765Eukaryotic translation initiation factor 3 subunit HSMESG000043864.1 dd_Smed_v4_1220_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3002341340S ribosomal protein S25SMESG000059049.1 dd_Smed_v4_134_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED3002420240S ribosomal protein S14SMESG000036550.1 dd_Smed_v4_139_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30021620Crossover junction endonuclease MUS81SMESG000023374.1 dd_Smed_v4_11322_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30022089heterogeneous nuclear ribonucleoprotein KSMESG000033971.1 dd_Smed_v4_1569_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult