musculature system

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ Description

  ▻ Figures

  ▻ In Situ Hybridization Data

  ▻ Sequences

  ▻ References

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  musculature system


DEFINITON:

  Total musculature of the planarian body.


TERM DEFINITION CITATIONS:

  UBERON:0001015


TERM CITATIONS:


TERM ID:

  PLANA:0000428


ABOUT THIS TERM:

musculature system

  ↳is a anatomical system

  ↳part of asexual organism and sexual organism


Expand to see terms that part of musculature system


BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


DESCRIPTION:   

S2-S4 embryos solely contain radial muscle fibers within the temporary embryonic pharynx (Figure 1 – figure supplement 17 C). Presumptive progenitors for body wall musculature, cells that coexpress piwi-1 and myoD, emerged during S5 (Figure 1 – figure supplement 17 A-B, Figure 6 C). myoD upregulation was first noted during S4, and was significantly enriched in S5 and S6 embryos (albeit the adjusted p-values were higher than the threshold set for inclusion in the S5 and S6 enriched transcript lists) (Figure 1 – figure supplement 17 A-B, Figure 1 – source data 5, Figure 1 – source data 6). While a genetic requirement for myoD in muscle cell regeneration has not been demonstrated conclusively during adulthood, myoD expression within the adult neoblast compartment has been observed previously (Scimone et al., 2014), and myoD knock-down impaired regeneration in two independent reports (Cowles et al., 2013; Reddien et al., 2005). mhc-1+ cells were first observed in the parenchyma during S5, without noticeable bias in distribution toward either the oral or aboral hemispheres (Figure 1 – figure supplement 17 C). Expression within the temporary embryonic pharynx remained strong through S6. During S6, fusiform mhc-1+ cells became more numerous, and were more densely packed beneath the presumptive dorsal surface of elongating embryos. As elongation proceeded, mhc-1+ cells were densely packed along the dorsoventral margin, particularly in the anterior half of the embryo (Figure 1 – figure supplement 17 C). The dorsal bias in mhc-1+ cell density was transient, and was not obvious by S7. myoD+ cells were located around the developing cephalic ganglia and ventral nerve cords, in S6-S8 embryos (Figure 1 – figure supplement 17 A). Concentrations of myoD+ cells, as well as mhc-1+ muscle cells, were seen around the definitive pharynx rudiment and along the developing tail stripe, a muscular septum that bifurcates the posterior gut and connects the dorsal and ventral body wall musculature (Figure 1 – figure supplement 17 A,C). Generation of robust, increasingly dense transverse and longitudinal body wall muscle fiber networks and enteric musculature proceeded during S7-S8 (Figure 1 – figure supplement 17 C).


 

back to top


FIGURES:


Figure 1 – figure supplement 17: Molecular markers for the developing musculature

A, C: Expression of the muscle progenitor marker myoD and the mature muscle marker mhc-1, Stages (S), S2-S8. Anterior: top (S6-S8).  O: oral hemisphere. A: aboral hemisphere. D: dorsal. V: ventral. Black arrowheads: temporary embryonic pharynx.  Red arrowheads: definitive pharynx. Cyan arrows: cephalic ganglia. Cyan arrowheads: ventral nerve cords. Scale bars: 100 µm. 

B, D: Average RPKM values per embryo for the putative muscle progenitor marker myoD (B) and transcripts enriched in adult muscle (D), Y (yolk), S2-S8. Transcripts in D showed enriched expression during S5, S6, S7 and/or S8 (n=166 transcripts, or 42% of the muscle cell enriched transcripts reported in (Wurtzel et al., 2015). Muscle-enriched transcripts are flagged in excel tables for S5-S8 enriched transcripts (Figure 1 – source data 5, Figure 1 – source data 6, Figure 1 – source data 7, Figure 1 – source data 8).

 

 

back to top


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30008639AAN03696.1MyoD-like proteinmyoDStage 5, Stage 6, Stage 7, Stage 8musculature system, muscle progenitor cell
SMED30025388Myosin heavy chainDj-mhcStage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, musculature system, muscle cell, embryonic pharynx
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30008639 ID=SMED30008639|Name=MyoD-like protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1606bp
GTTCATATTACCAACTGTTCGCCATTAATTCAGCCTGTTTTACGCCTCGTAACAACTGTTACTTCAACAATACCGATCCA
GCCCAATAAACAATGATACACTCCGGATCATTTCCAGGTTCCACTTGTCCGATTAACTATGACTATTCCGGTCCATACTC
AGCAGGTCTTGAGGCAGCTCCATTTTTAGTCAATCAAACCTGTCCATATAACACTGGAACAAATACAATGCCTCCTTCGT
TGTCACTAGTAGATAATATGATGATGAATAATTCCATGCATCTTTATGATAGACTGAATACTCATCATTCAGCGTCGTAT
TTTCCTCAGATTTTAAACAAAATCGAACAGAAATTACCAACAACCTCGAGTAAAACCACTCCATCAACATTGGTTTCAAC
ATCCTCCAATTCCATATCGAATTCTGAGTTTAATTCGTCGCGATCTTCGTCACAATTTCCAACATACGATTTGATTTCGT
CACTCAATAATAGCAACTACGACATGTACGATTCGCCCTATGCCGCCTATCTGGCCGCTGGTTATTATCAATCTCCTGGA
TTTGCGCTCAAACAGTACGACGCTGCTGGAACATCTCAACCATCAATGACAGATTTGTACCATTCATCACTAGCAGCCAG
TTCAGGCTTAAATTTGAATTATTCACAGCATAAATCGAGACATTTATCAGAAGATGCTGGATCATGCCAAGATCCGCAGT
CTCAAAATATCACAAGCAATAATCATCATAACAATTCGTATAGTCCAACAACTGCTGATTTCGGATCACCAAAAGCCTTA
TCAAGTAGCAGCCAGTCCATAAATGATGGAAGACAACCGACCAGTAGTAATTCCAGTCCTCAAAAACTATCACTAGCAAT
TGAACAACACTTATGTCCAAATAAAGAGGAACATGTGCTAGTTCCAGGGTCACATGGTCAATGCTTGTTGTGGGCCTGTA
AAGCTTGCAAAAAGAAAACGGTTCACGTTGATCGCCGCAAAGCGGCAACAATGCGTGAAAGACGTCGATTGAGAAAAGTG
AATGAAGCTTTTGAAACATTGAAACGAAGAACGAGCGGTAACCCAAATCAAAGAATGCCAAAAGTCGAAATTCTAAAGAA
CGCGATTGATTACATTGAGAGTTTGGAAGAGTTGTTGAATTCCGTGGGAAAATTACCTGCAACCGTTGGAGAATTGAAAG
AACGCCGCAAAAACAACCCAGAAAATTCGAGAACAGCAATCGCCGGAAAACAAAAGCCACTAAATAAAATTAATGATAAA
CAGAAAGCTGAAAACAAATATCCCGAGACCATCTGCAAACTCCCGACGACTAGGAAATCCTATGTTGCTTCCGACCTTGA
TCAGCAGATTTATCAATCAAACATGTTGAAGAGTTCAACTCTTGATCAACTTTCCTCGATAGTAGACAAAATCTCTACGA
CTAATACAACAATTGCCGACCATTCAATGGACGCTAAGCCCGAAAATAGTTGAATACATAACAAAACGCAACAAATATTA
TATTAACCTATTAATTTTGTTCTAAACTCGTTTGCCCTGATACATATTGTACATTTTCTTTCAATAGAATGTTCTTATAA
TTATAA
>SMED30016281 ID=SMED30016281|Name=Myosin heavy chain|organism=Schmidtea mediterranea sexual|type=transcript|length=5986bp
CTAAAATTTAGTTGATTTCGATTGTTTGAATAAAAATATCTAATGGACCCATCAGATCCTGATTTTATCTACTTGGGAGT
CGACAGGAAAGCTTTATTGAAGCAATATGGCGACTCGTTTGATAGTAAAAAGAACATGTGGATACCGGATGAAAAGGAGG
GGTACATCGCAATTACCGTTGAAGAAACAAATGGCGATAAAGTAACTGTTAAAACCGATAAAGGAGAAACTAAAGTCGTC
AAGCAAGACTCCTTGGAACAAATGAATCCCCCCAAATTCATGATGATTGAAGACATGGCGAATTTAACATTTCTCAATGA
TGCCAGTGTATTTGATAATCTGAGACAAAGATATTACAAAAATCTGATTTATACTTACTCCGGACTGTTCTGTATTGCAG
TGAATCCTTATCGAAGATTTCCGATTTATACGTCCCAAGTAATTATGAAATATAAAGGAAAACGTAGAGGAGAAATGCCA
CCGCATATTTTCTCAATTTCGGATAATGCTTACTCAAATATGCTTGTCGATCGAGAAAATCAGTCTGTTTTGATTACTGG
AGAAAGTGGTGCTGGGAAAACTGAAAACACGAAAAAAGTTATTACTTACTTCGCCAATGTAGCAGCAGCAAGTAAAAAAG
ATGATGACGATCCATCGAAGAAAAAAGGTTCATTGGAAGATCAAATTGTACAAGCCAATCCTGTACTGGAGGCATACGGA
AACGCCAAAACAACTAGAAATAATAATTCGTCAAGATTTGGAAAATTCATCCGAATTCATTTTGGCACTAGTGGAAAAAT
TGCAGGAGCTGATATTGAGTTTTATTTGTTGGAGAAATCTCGTGTTATCTCACAGCAAAAAGGAGAAAGAAATTACCATA
TTTTCTATCAATTGCTTTCGGCAGGAGGGAAAAGTTACCACGATAAACTTTTGGTTACTGCTGATCCTGCTCTGTTTTCT
TTTATCAACCAAGGAGAATTGACGATTGACGGTGTTGATGATGAGGAAGAAATGAAACTTACTGATGAAGCCTTTAGTAT
TCTTGGGTTTTCCGATGAAGAGAAAATGAGTTTGTTTAAATGCACTACTTCAATCATGAATATGGGAGAAATGAAATTTA
AACAAAGACCCCGTGAAGAACAAGCCGAGGCTGATGGTACAACAGAAGCTGAAAAAGTCTCTTTCTTACTTGGAGTGAAT
GCCAAAGATCTAATGCAAGCAATTCTTAAACCCAAAGTCAAAGTAGGAAACGAATATGTAACGAAAGGTCAAAGCAAAGA
TCAGGTTTTATATTCTCTTGGAGCCTTAGCAAAATCTTTATATAACAGAATGTTTGCTTGGTTGGTTACTCGCGTGAACA
AAACGCTGGACACAAAAGTCAAAAGACAGTTTTTCATTGGTGTCTTAGATATTGCCGGATTTGAAATATTTGATTTCAAT
GGTTTCGAACAAATTTGTATCAACTATACTAATGAGAGACTCCAACAATTTTTCAATCACCATATGTTTGTTCTTGAACA
AGAGGAATATAAAAAAGAGGCCATTGACTGGGAGTTCATAGATTTTGGAATGGATCTCCAAGCTTGCATTGAGTTGATTG
AAAAGCCTATGGGTATTTTGTCGATTTTAGAGGAAGAATGTATGTTTCCCAAAGCAAGCGATCAAACATTGAAAGCTAAA
TTGTACGATAATCACTTGGGTAAAAGTCCGAATTTCGGAAAACCAAAACCACCAAAACCAGGACAACACGAAGCCCATTT
CGAATTACATCATTATGCTGGCAGTGTTCCATATAATATTACTGGGTGGTTGGAGAAAAATAAGGATCCATTGAACGAAA
GTGTTGTTGGATTACTCGGAGCATCTAAAGAATGTCTAGTAGCTTCTTTATTTGCACCGGCTGAAGATACAGGAAAACCC
GGAACCAAGAAAAAGGGTGGATCCTTTATGACTGTGTCATATATGCACAGGGAATCATTGAATAAATTGATGAAAAATCT
AATGAGTACAAGTCCACATTTTATTCGTTGCATTGTCCCCAATGAATTCAAACAACCAGGAGTTGTTGATGCGCATTTGG
TTATGCACCAACTTCATTGCAACGGTGTATTGGAAGGTATTAGGATTTGCAGAAAAGGATTCCCAAATAGAATGATCTAT
TCTGAATTCAAACAAAGATATTCAATTTTGGCACCGAATGCCATTCCACAAGGATTTGTTGAAGGCAAACAGGTCACTGA
TAAAATCCTCACAGCCATTCAACTGGACACAAATCTTTATCGCTTAGGAAATACCAAAGTATTTTTTAAAGCTGGAACAT
TGGCTCAACTTGAAGATATAAGAGACGAGAAACTTTCGTCGTTGATATCGTTGTTTCAAGCTCAAATTAGGGGATATTTA
ATGAGACGGCAATACAAAAAACTTCAAGATCAAAGAGTTGCTCTGTCTTTGATTCAAAGAAATATTAGAAAATATTTGGT
TTTGAGAACATGGACCTGGTGGAAATTGTTCACTAAAGTAAAGCCTATGCTTAATATTGCTCGCCAAGAAGAAGAAATGA
AAAAGGCAGCCGAAGAATTAGAAAAGCTGAAAGAGGAATTTGAAAAAACTGAAAAATATAAGAAAGAACTTGAAGAACAA
AATGTTACTTTACTTCAAGCAAAGAACGATTTATTCTTGCAGTTGCAAACTGAACAAGATAGTTTAGCTGACGCTGAAGA
GAAAGTATCTAAATTAGTTCTACAAAAGGCTGACATGGAAGGAAGAATTAAAGAACTTGAGGACTCACTTTCAGAAGAAG
AAAATTCAGCTTCAACATTAGAAGAAGCAAAAAAGAAACTCAATGCTGACATCGATGAATTGAAGAAAGATGTTGAAGAT
TTGGAATCATCTTTACAAAAAGCAGAACAAGAAAAAGTTGCAAAGGATCAGCAGATTAAATCCCTCAACGACAATGTTCG
TGAAAAAGAAGAACAATTAGCCAAAATGCAAAAGGAAAAGAAAGCTGCTGATGAATTACAAAAAAAAACAGAAGAATCAT
TGAAAGCCGAAGAAGAGAAAGTCAGTAACCTCAATAAAGCTAAAGCTAAATTAGAACAAGCCCTGGATGAAATGGAAGAA
AATCTTGGTCGAGAACAAAAAATTAGAGCAGATGTTGAAAAAGCAAAACGAAAAGTTGAAGGTGAACTTAAACAGAATCA
AGAGTTATTAAATGACTTGGAGCGCATAAAATCCGAACTTGAGGAACAATTAAAACGAAAAGAAATTGAATTGAATGGTG
CTAACTCTAAAATCGAAGATGAATCTAATTTAGTTGCAACACTTCAACGGAAGATCAAAGAACTTCAAGCCAGAATCCAA
GAATTAGAAGAAGACCTTGAGGCGGAAAGACAAGCAAGGGCAAAAGCTGAGAAAGCTAAACATCAATTGGAAGCGGAACT
TGAGGAAATCAGTGAAAGACTAGAAGAACAAGGAGGTGCAACTCAAGCCCAAACAGATTTAAATAAAAAACGAGAAGCTG
AACTCATAAAATTAAAGCGAGACTTGGAAGAGGCTAATATGCAACACGAACAAGCCTTGGTGCAAATGAGAAAGAAACAA
CAAGATACTAGCAATGAATTCGCAGATCAGTTAGATCAATTGCAAAAATCAAAATCAAAGATTGAAAGAGAAAAGAGTGA
ACTTAGAGCAGACATTGAAGATTTATCAAGTCAGCTGGAATCACTGAATAAGACCAAGGGAAATCTTGAAAAGTCAAATA
AAGCATTAGAAACCACAGTTTCAGATCTTCAAAACAAACTCGATGAATTAAGCAGACAATTGACAGAAGCAGGAAACGTC
AACAATCGAAATCAACATGAAAATAGTGAAATGCACAAAACCTTAGAAGACGCCGAATCACAAATAAACCAACTCGGAAA
GGCTAAACAACAACTCCAAGCGCAGCTAGAAGAGGCTAAACAAAATTTGGAAGATGAATCACGCGCAAAAGCAAAACTTA
ATGGAGATTTAAGAAATGCGATGAGTGATTTAGATGCATTACGGGAATCATTGGAAGAAGAACAAGAAGGCAAAAGCGAT
GTTCAAAGACAGCTTGTGAAAGTCCAAAATGAATTACAGCAACTTAAAGCAAATTCTCAAGGTACTGGAGGAGTGAGAAC
AGAAGAAATGGAAGAATTCAGACGAAAGATGAATGCCAGAATCCAAGAACTAGAAGAAGAATCGGAATCAAATAAATCTA
AATGCAGTCAATTAGAAAAAATGAAATCCAGACTTCAAGGAGAAATTGAAGATTTAGTGATAGATGTTGAAAGAGCCAAT
GGATTAGCATCGCAACTGGAAAAGAAACAGAAAAATGTTGACAAATTAATAGGCGAATGGCAAAAAAAATATTCAGAAAG
TCAACAGGAACTAGAAGTATCACTGAGAGAATCAAGAACAGTTTCCGCTGAAGTTTTCAAATTGAAATCACAATTAGAAA
ATTCTCAAGATCAAATCGAAAGTTTAAGAAGAGAAAATAAAAATCTATCTGATGAAATTCATGACTTAACTGAACAATTG
GGAGAAGGAGGACGAAATGTACATGAAATTGAAAAGACTCGAAAAAGAATTGAAATTGAAAGAGATGAATTACAACATGC
ATTAGAAGAAGCTGAATCAGCTTTGGAACAAGAAGAAGCTAAAAGCCAAAGAGCTCAGTTAGAAATAAGTCAAGCCCGTC
AAGAATCTGAAAGAAGACTTGCAGAAAAAGAAGAAGAATTTGAAGGTACACGAAAAAATCATCAACGAACACTCGAATCC
ATGCAAGCATCTCTTGAAGCTGAAGTTAGAGGACGAACTGAAGCAATGAAAATGAAAAAGAAGCTGGAGCATGATATTAA
TGAGCTTGAAGTTGGGTTAGACACGGCTAATAGACTGAAATCTGAACAAGAGAAAAATGCTAAGAAATATCAGCAACAAT
TAGCAGAAATGCAAGCTCAAGTTGAAGAACAGCATCATCAACGAGAGCAAGTTAGTGAACAGCTTGCGTTAACAGAACGA
AAATTAGGTATGATGCACGGAGAGCTGGAGGAAATGAAAAATATGTGTGATCATGCTGAAAAAAATAGAAAAGTCGCTGA
ATCTGAAAAGAATGAAGCCATTGATAAACTAAATGAGTTTTCAATTCAAAATTCTTCATTCATGGCAACTAAAAGAAAGA
TGGAAGCAGATTTAGCAGCAATGCAAGCTGACTTAGAAGAATCTACAAATGCAGCTAGACAAGCTAATGAACAATTGAAA
AAGGCAATATTTGATAATACTCGACTTTTCGATGAAATTAAACAAGAACAAGAACATGCTCAACAAGCTGAAAAAGCAAG
AAAGAATTTGGAGAGCCAGTTGAAAGAATTGCAATCAAAACTTGAAGAAGCAGAAGCAAATGTACTTAAAGGAGGCAAAA
AGGCTTTGAGTAAATTAGAGCAAAGAATAAGGGAATTGGAAGGCGAACTAGATGGTGAACAAAAACGACATGTTGAAACT
CAAAAGAATGCTAGAAAGTCAGATAGGCGACTGAAAGAAATTTCGTACCAGATCGACGAGGATAAAAAGAATCAAGATCG
AATGCAACAACTTATTGAAAGTTTACAAGCAAAAATAAAGACTTATAAACGACAAGTAGAAGAAGCTGAAGAAATCGCTG
CTGTGAATTTGGCAAAATATCGCAAAATTCAACAAGAGATTGAAGATTCTGAAGAGCGAGCTGATCAAGCTGAACAAGCT
TTACAAAAATTAAGAGCAAAGAATAGAAGCTCGGTATCTGTTAGTCGAGGAGCAAGTTCTGGACCTGGAACCAAAATTTC
TATAACTGCGACATCAATCCGCAGTGAGGACTAATCTGACAGAAAAAATTCATCATTAGGAAATATGCAATTAGTTAGCC
AATATTTCCCTTAGACTAGATTTTAAACCTTTAAGACATTTTTTTCAAATTAATAAAACGTTTTGA
>SMED30020435 ID=SMED30020435|Name=Myosin heavy chain|organism=Schmidtea mediterranea sexual|type=transcript|length=3615bp
TCTGAATTTAAACAAAGATATTCAATTTTGGCCGCAGATGTAATAGGGCAAGGATTTATTGATGGAAAACAGTGTACTGC
AAAGATAATGGAAGCAATCCAATTAGATAAAAACAACTACAGGCTTGGATCAACTAAAATCTTTTTCAAGGCCGGAGTAC
TTGCTCAGTTAGAAGACATGCGAGATGAGAAATTATCATCCATTTTGTCTGTATTCCAAGCACAGATGAGAGGATATATA
ATGAGAAAAGCATATAAGACATTGCAAGATCAACGAATTGCTCTTTCTCTCATTCAAAGAAACATCAGAAAATATTTATT
ACTAAAAACATGGCCATGGTGGAGACTATACACTAAAGTCAAACCACTCCTCAATATCGCAAGACAAGAAGAGGAGATGA
AGAAAGCTGCTGAAGAGTTGATTAAATTGAAAGAAGAATATGAAAAGATAGAAAAATTTAAAAAGGAATTGGAAGGTCAA
AATGTGGTTTTGCTTGAGCAGAAAAATGATTTATTTTTACAACTGCAAACAGAACAAGACAATCTTAGTGACGCTGAAGA
AAAGATTCAAAAGATGATCAATCAAAGAGTTGAAATGGAGAACCAATTTAAAGAATTAGAAGATAAATTAATGGATTCGG
AAGACATTCAAGATGAATTGGAAATCGAAAAAAAGAAATTGTTGTTGGATATGGATGAATTGAAATCGGACATTGACGAA
CTTGAAGTATCTTTAGAAAAGTCTGAACAAGAAAAACAAGCTCGCGATCAACAAATTAATAATTTGAAAGAAGAAATTCA
AAAACAAGATACTTCTATCGGAAAAGTTCAAAAGGAGAAAAAGACTCTAGAAGATAACTTAAATCAGACCAGAGAAGCTT
TAAATGCTGAAGAAGACAAGGTCAATCAGTTGACTAAAATCAAATCAAAATTGGAATCTGAAATAGATGAAATGGAAGAA
GCTCTAGAACGGGAAAAGAAGATCCGTGGAGATGTTGAAAAACTTAAACGGAAATTAGAAGCTGATCTCAAATCAAGCCT
TGATAACTGTAATGAGTTGGAAAATATAAAGCAGGAGTTAGAAGAAAATATTCAGAGAAAGGACATTGAAATATCAAAAT
TAAATGTCAAATTGGAAGATGAATCTTCAATTGTCACTCAACTTCAACGAAAAATTAAGGAATTACAAACTGTTATACAA
GATCTTGAAGAAGATCTAGAAGGTGAGAGACAAGGTCGATCAAAATCTGAAAAAGCTCGACAGTTGGCTGAACAAGAACT
CGATGAACTAGCTGACAGACTTGAAGAGCAGGGAGGTGCTACTATGGCACAAGTGGAATTGGCCAAGAAACGAGAAACTG
AATTAATGAAACTTAAAAAAGAATTACAAGATACCAATTTACAGAATGAGCAAATACTCAATGGTTTGAAAAAGAAAAAC
CAAGAAATTACCAATGAATTCTCCGAGCAAGTCGATCAAATAAATAAATCTAAATCAAAAATCGAAAAAGAAAAGGCGAC
TCTTAAGCATGATCTGGATGAATTTGTTTCTCAATTAGAATCTGTTTCAAAGCTAAAGGCCAATACAGAAAAACATTCAA
AACATTTAGAAAGTCAAATTATGGAATTGGAAAACAAAATAGACGAACAGAATCATCAAATATCAGAAATGGTTTCACAG
TCTAATAAAGACTCTCAAGCAATAATGTCTTTAGAACAACAACTAGAACAAGCAGAAAATGAAAATCACCAATTGAGCAA
ATCCAAACAACAATTCCTCCAACAAATTAATGACTGTAAATCGACTCTTGAAGACGAAGAAAAAGTAAAGGCCAAACTTT
TCAATGAAATTCGTAATCTGAATGATGAAATGGGCAATTTAAGATCCAGTTTGGAAGAAGAGCAAGAATCCAAAAGTGAA
ATTCAAAGGTCACTAGCAAAATCCCAATCTGAACTTGTACAAATGAAAAATAAATTTGATAGTGAAGGTTCAGGTCGCAT
TGAAGAAGTTGAAGAAGCTAAACGTAAGTTGCAAACGAAACTTCAAGACATGGAACAAGAATTTGACGCTATTAAAAATA
AATGCGCGCAACTTGAAAAAATCAAAATTCGTCTCACTGGAGAAATCGAAGACATGAGTGTTGATGTTGACAGAGCTAAT
GCAGTGGCTAATCAACTAGAAAAGAAACAAAAGAACTTTGACAAAACCGTCAGTGAATGGCAGTCTAAATGCAACTGCCT
TCAAACTGAAGTTGATGTTGCAAATCAAGAATCAAGATTTTTGTCAACCGAAGTATTTAAATGTAAAAGCCAAAACGAAG
AATTGCTTTCACAAATCGAAAATCTTAAACGAGAAAATAAGTCTCTCAGTGATGAAATTCACGATTTAACGGAACAACTA
AGTGATGGCGGAAAATCTGTTCACGATATAGAAAAGGCAAAACGAAAATTGGAAATAGAAAAGGAAGAACTGGAACAAGC
TTTGGAAGAAGCTGAATCAACATTGGAAAATGAAGAAGCCAAATTACAAAGAGCTCAGTTAGAGTTGAGTCAGATGAAAT
CAGATGTAGAAAAACGATTGTGTGAAAAGGAGGAAGATTTTGAAGGAACTCGCCGTAATCATCAAAGAGCAATGGAATCA
ATGCAAGCTTCTTTGGAGGCAGAAATTAAAATTAAACAGGACTCAATTAAAGCCAAGAAGAAGTTAGAACAAGAAATCAG
TGAACTCGAAGCCAATTTAGATCAAATCCAAAGACTGAAATCAGATGCTGATAAGAACAATTCAAGAATGCAACAGCAAA
TTCATGATTTACATTCAGAGATTGAACAAGAACAACACAGTAAAAACGAAGTCCGAGAACATGCTCAGATGGCTGAAAAG
AGATTTTTATCGGCTAATGGAGAACTAGAAGATTTGCGAGCCAAATTTGAACAATCAGATAGAAATCGTAGAAATGCTGA
ATCTGAGCTTCAAGATTTGAGTGATAAATACAATGAAAGCCAAGCACTGATCACTTCACTTCAAAGTTCAAAAAGAAAAA
TGGAAATGGATTACGTAGCTATGCAGTCCGATCTTGATGATATGTCAAACCATGTTCAACAAGCTGAGGAAAGAGCAAAG
AAAGCAGCTGGTGACGCTGCCCATATGTCAGAACAACTTCATCAAGAACAAGACAATAGTTTGCACACGGATAAAATGAG
GAAGCAAATGGAAATTCAAATCAAAGAAATGCAGTGTAAACTAGAAGAAGCCGAAAGTAATGTTTTGTCAGGCGGCAAAA
AGACTTTGGCAAAGTTAGAGTCAAAAATACGAGAATTGGAAACTAATCTTGATAACGAAATGAGAAAACATGCTGAAACT
CAAAAGAATTATCGCAAAGTAGATAGACGAATGAAAGAACTAACATTACAATTGGAAGACGATAGAGCTCAACAAGAAAA
ATCAAATCAAGTTATTGAAAAATTCCAAGGACAAATCAAAACCCTTCGAAAACAATTAGAAGAATCAGAAGAAGTTGCCG
TTTTGAATATTGCCAAATTTAAGAAAGTACAATGTGATTTTGAAGAAGCCGAAGAAAGAGCGAATGAATCGGAACAAGCT
TTACAAAAATTAAGA
>SMED30022992 ID=SMED30022992|Name=Myosin heavy chain|organism=Schmidtea mediterranea sexual|type=transcript|length=6157bp
ATATATATGCATCTCAAAATTGGAAATTAAATTATTAATTTTAATTTACTAACAAATTTTTGTTGTAAAATGGAAAATAT
TGATGCTAAAGACTTGCAATATTTACAAGTTGATAAAAGTTTAGTTTCTGACTCTGCTAATTTGTCTGATTGGGCTAACA
AAAAATTGGTTTGGATACCTGACGACAATGAAGGATTTATTTCAGGATCACTTATAGAAGAAAAAGGCGATGAAGCTACT
GTCAAACTGGAAAATGGCAAAACAATGAAATTACCAATTGAAAATGTTCAAAAAGTGAATCCACCAAAATTTTTTAAATC
TGAAGATATGGCAGATTTAACTTATTTGAATGAAGCATCAGTTCTATATAATTTAAAAGACAGATATTTTTCAGACTTAA
TATATACATATTCCGGATTATTTTGTGTCGTTGTAAATCCATACAAGCGCTTGCCTATTTATACAAATAATGTAATTGAG
TGGTACAAAGGTCGAAAACGTCACGAAAGACCGCCACATATTTACGCAGTTACTGATGTCGCATATCGAAATATGCTCCA
AGATAAAGAAAATCAATCAATTCTTTGCACTGGTGAATCCGGAGCAGGAAAAACTGAAAATACGAAAAAAGTTATTCAAT
ATTTGGCCTCAGTTGCAACTTCTTTGAAAAATCAAAAAACCACAGCCAGTAATGCATTGTCACAATTTTATGCTCACGAT
GTTAACATTGGAGAATTGGAGACCCAATTACTTCAGGCCAATCCGGTTTTAGAAGCTTTTGGAAATGCAAAGACTATCAA
AAACGATAATTCATCTCGTTTTGGTAAATTTATTCGAATCAATTTTGACACTTCTGGATTCATTTCCAGTGCAAACATAG
AAACATATTTATTGGAAAAAGCTAGAGTTATTAGACAGGCAGCTAATGAACGGTGCTTTCACGTGTTTTATCAGCTTCTT
CTTGGTGCAGACGACCGATTGAAAAAGGAATTAATCTTAGAAAATGTTTCTACATACAAACTTTTATCCAACGGCATGAT
AGCTGTACCAGATTACGATGAAAAGCAAATGTTTAAAGATACAGTCGAAGCTCTCGATATAATGGGGATTTCGAAAGACG
AACAAGAATCTATTTTCCGAGTTATAGCCGCAGTTTTACACATGGGAAATATCGAATTCAAACAAGAAAGAAGTTCGGAT
CAGGCTGCTTTACCAGACAATACAGTTGCTCAAAAGGTTGCTCATCTTCTCGGTTTACCGGTCACAGAAATGACCAAAGC
ACTGCTGAAACCAAAATTGAAAATTGGAAGAGAAGTTGTAGCAAAAGCTCAAACTAAAGAACAAGCCGAATTTTCCGTTG
AAGCTATAAGCAAATCAACATATGAAAGAATGTTTCGATGGCTGGTAATGAGAATAAATAGATCAATTGACAGAAATAGA
CAAAAAACTAATTTCATTGGCATTCTTGATATTGCTGGCTTTGAAATATTTGAAATAAACTCTTTTGAACAATTGTGTAT
AAACTATACCAACGAGAAATTGCAACAGCTTTTCAATCATACAATGTTTGTGCTAGAACAAGAAGAATACAGAAAAGAAA
ATATCAAATGGGAATTCATTGACTTTGGTCTTGATTTGCAGCCAACTATCGAACTAATTGAAAAGCCAATGGGTATTCTT
TCTTTGTTAGATGAAGAGTGCTTTTTCCCAAAAGCTACCACAAAGACATTTGTTGAAAAATTAATTAAAAACCAATCGAC
GCACCCTAAATTGAAAGCTACTGATTTTAGAGCAAAAGCAGATTTTGGGGTTATTCATTACGCGGGAAAAGTTGATTATG
TCTCCGATAATTGGCTGGTGAAAAATATGGATCCTCTTAATGAGAACGTTGTTAGTCTCTTACAAGAATCAAATGAAAGT
TTTGTCCAGACAATTTGGAAAGATGCAGAAAACATTATTGGCTTATCAACTACTACCGCCCAAGAATCTGCCTTTGGAGG
TGCAAAAACTACTCGCAAAGGAATGTTTAGAACCGTCGGTCAGCTTTACAAAGAATCATTAACGAAATTGATGGATGTTC
TGAATAATACCAATCCCAATTTTGTGAGATGTATCATTCCCAATCATGAAAAAAAATCTGGTAAAATCGATTCAAAATTG
GTTATTGATCAATTAAAATGTAATGGTGTGCTGGAGGGTATCAGAATATGCCGACAAGGATTTCCAAACCGAATTTTATT
CCAAGAGTTCAAACAACGTTATGGAATTCTTACACCAAATGTCATACTAAAAGGTTTTATGGACGGTCGAAAAGCAACAG
AATTAATGCTTGGAGAGTTGGATATTGATGCATCAAATTACAGAATTGGTCAGAGTAAAATATTTTTCAAAGCTGGAGTT
TTGGCTAGATTAGAGGAAGATCGAGATATTAAGTTGACTGAAATCATAGTCAAATTTCAATCTTATGCACGTGGATATTT
GGCAAGAAAAAATTTACAAAATCGATCGCAAAATCTCAATGCAATTAAAATTATTCAAAGAAATTGTAATGCATACTTAA
AATTGAGAAATTGGGCCTGGTGGAAATTATTCACACGTGTTAAGCCTCTATTAAGTGTTACAAGGCAAGAGGAAGTTGTG
GCTTTGAAGGAAGAAGAATTGAAAAAATCAAAAGAAACTCTCGAAAAGATGACTGCTGATTTCGAAACAACTAAGAAAAA
TTATGAATTTCTCATGGAAGAAAAAAATAAAATTCAGGAAGATTTGGAAAAGGAGCGTTTTGCATTGCAAGATATGGAAG
GGGAAAGAGAAAATTTGATCAAGCGATTAAAAGATATTGAATCAGATGCTCAAGAATGCGAGTCAAGAGAGATGGAAACA
AAAGACAAATGCAATAAATTGGAAATCGAGAAAAATAAATTACAAAATGAAATTTCACAGCTTAGCCAAAATTTAGAATC
AGAGGAACAGAACTTGCAAAAAGCTCAAGCAGACAAATTAAGTGCTGATAAACGAATTAAGGAACTGGAACAAAAAGTGG
CCGAATTAGAAGATAAACTTAACAAGTTAACTAAAGAGAAAAAGTCTCTAGAAGAGCGATTGGCTGATGTTATGTCTACT
TTGGCGGAAGAAGAAGAAAAGAGTAAACAATTAACGAAACTCAAATCCCGTCACGAAACAAGTATCACTGAATTAGAAGA
GAGATTGAGCAGAGAACAAGCAGCTCGACAAGATTTAGAAAAAACAAAGAGACGACTAGAAACTGAATTGTCTGAAAAAT
CTGATAATTTATCATCTCAAAGCCATACATATGAAGAAATTAGAATTACTCTTGAACGAGCAGAAACACAAATAATTCAA
ATGCAAGCTAAATTAGATGAAGAAACAACGGCAAAATCGTTGGCTCAGAGACAAATTCGAGACGCAGAAAACGTAATCAC
CGAAATCAAAGAAGATCTTGAAGCTGAAAAACGTTCAAAAGAGAGAGCTGAAAAAGCTAAGAGAGATTTAGCCGAAGAAA
TAGAATCTCTTAAAATGGAATTACTCGATACGGGAAATACATCAGAAGAACAGCAAAGCGTATTGCGCAAAAAAGAAGTT
GAATTACAAAATTTTAAAAAATCTTTTGAAGATGAAACAAAACGAACTGAACTTGAAATGCAAGAAATTCGTAAAAAAGC
CGCAGTAACGATTGAAAACCTCAACAATCAAATAGAAGCTGCTAACAAATCAAAACTTGTTGTTGAAAAGGCTAAATTAC
AGTTGCAAGAAGAACTTAATGATGCAAATAACGAATTAGCAAATTTAAGATCCTCCAAAGCTGACTCTGAAAAACTTAAG
AAGAACACAGAACTACAACTTTCAGAAATATCTCATCGCCTTTCAGAATCTGAAGAACACAAGCTAGATGCTGAATCAAA
ACTTAAAAAACAAACCGAGTTGGCTGACAAATTGGCTATGAATCTCGAAGAAATTGAAAGCAAATTGTCGCAATTAACTA
AATCTGAATTATCAGTTCGAAGTCAGTTAGCAGATTTACAAAAGGACTTTGAAGAAGAAACTCGATTAAAATTGAATGCT
CAAACTACATTAAGGCAGTTAGAAAGTCAATTTGCTTTATTAAAAGATCAATTAGAAGAGGAGCAACAATCAAAAGAAAA
TTTAGAAAGTCACGTACAAGCTCTACAGAGTCAAATGCAAGATGTCAAAAAGAAAGTTGAAGAAGATGCTCAACAGCTAT
TAGAATTTGATGAATCTCGTAAAAAAGTAATGCGTGAACGAGAAGAATTGCAGATTAGACTTGAAGAAGCAATCAATCAG
ACTGAAAGATCAGAAAAAGCTAAGCGAACAATTCAAGCCGAGCTTCAAGATGCATATCATGCCCTAGAAAGTCAGAAAAA
TGACCAAACTCAAAGTGATCGAAAACTTAAAAAAATGGAATCACAAGTCAATGAAACATTGAACTTGAATAAAAAATATT
TAGCTGAAAAGGATACATTAGAAAAAGAAAATCGTGAAAAAGAAACAAAAATCATGCAATTACAGAGAGAAATGAATGCA
AATGACGATAAACTTTCGGAATTGGAAAATGCAAAATCCTTACTGACTCGGCAATTGAATGAATTGGTTTCGAGCAAAGA
TGATGTTGGTAAAAATGTTGGCAGTTTAGAAAAGGCTAAAATTCAATTAGAAACCGATTTAGAGAATTGTAAAGTTACTA
TTGAAGAATTAGAAGAAGAAAATGCAACTCTTCAAATGAATAAAGAACGAGTTGAAATGCAATTAACTGCTACTAAAGCC
CAACTGGATAGGGAGCTAGCTTCCAAAGATGAAATGCACGATGAACAGTTCAGAATTATAAACAAAAAGCTTCGTGATGC
AGAAGCGGCACTTGAAGAAGAGCAGAAATCCAAAACAGCTATGGTTTCATTGAAAAAGAAAATAGAAAATGAGAACATGG
ATTTATTAAATCAATTAACAGAATCTGAGAAGGTCAAAGAAGAGCTGGCCAGACAGATTAAAAAATACCAAGGAAATTCT
AGCAATCTTCAAAGAGAAATGCAAGAACTTGTTGCTGCTAAAAATGATTATTTGAAGCAGATTAAAGAACTAGAAAAGCG
CTTACGTACTTCTGAAAGCAATGTAAACCAATTATCCGAAGACCTTTCGCAGTCTGAACGTGCTAAGAGAACCATTGCAT
CTGAAAGAGATGAAGCTTTAGAAGAAATTGCCACAATCACTATGGCTAGGGATACAGCTATTGCAGATAAAAAACGTATT
GAGAGTAGCATTTCAGCATTAAGCATGGATAATGAAGAATTGCAATTACTTTTGTCAGAATTAGAAGACAAAAATAAGAA
AATTATTTCTCAGTTAGAACAAGTTCAAAATGAATTAAATGTTGAACGACAAAATATAAGTAGATTAGAAAATCAAAAAT
CAACTGCCGAAAGACTGAATAAAGAATTGCATGATAAAATTGAAGAATTGGAAATGGAAGCTGGTAAAAAATATAAAGCT
ACAGTTGCTGCTCAACAAAGTAAAATCCAAAGTCTTGATTCTCAGCTGGACGCTAAAATTGAGGAAATAAACCAAGCTAA
TAGAAATAACAAGAAACTAGAAAGAAAGTTGAAAGAAATTATGGCTCTTATGGCTGATGAAACAAAGCGGGCTGACAATG
CAATCGAACAGATTGAAAAAGCCACTGGCAGATTTAAAAAAGCAGAGAGAAGTTTACAGATGGAACAAGAAAACAATTCT
GCTCTAAGTACACAAAATCGCCGATTACAACGAGATTTGGAAGAAGTAAATGAAACCAAAGAAGCACGGGACCAAGAAAT
TAAAATTCTTAAAACCAAAATCGACAGATTGGAAAAAAGAACACGCGCTGGGGGTCGACCTCTTAGAGGAGACGGTGGAT
CTGATGATGGGTTATCTGGAGATGGAGAATCCGTAACTGATTCTGCTTTAAAATCTGTTCAAGAAGACTAATTCAATAAG
TCCTAAAATGAACAATAAATTCTTGAATAATTAGTTAATACAAAAATTTTTGAATAATTTATATTTGGACTAACTTTTAA
TTCCTATTTGGTTTGCTCAATATATAATTGTTTTGATATATTTAATATTTCTATTTTATCAATTTGTGTACTTGGGG
>SMED30024552 ID=SMED30024552|Name=Myosin heavy chain|organism=Schmidtea mediterranea sexual|type=transcript|length=2149bp
TCACTGGAGTTAATAAACGACAAATTAAGGAAAAATGAACATGAACGATCCAGAAATGCAATACTTGGCCATTGACCGCA
AAGAATTGCTGAAAAGTTTAGATGTTGGGACTTTTGACAGTAAGAAAAATTGCTGGGTCCCCGATGAGAAGGAAATGTTT
GTGGCGGCGGAAATTAAATCCTCCTTAGGAGGTATTTTAAAAGTTCAAACGAAAAATGGAGAAAATCGTGAAGTTAAAGA
AGACGATATTCAACAAATGAATCCACCGAAATTCGAAATGATTGATGATATGGCTAATCTCACTTTTCTAAACGATGCTA
GTGTGTTACATAACCTAAAATCCCGTTATTACCGTGATTTGATATATACTTATTCTGGTCTGTTTTGTGTGGCTATAAAC
CCATATAAAAGAATTCCCATTTACACCCCAAGTATCATGCAGAAATTCAAGGGTAAACGAAAGACTGAAATGCCCCCCCA
TGTGTTCTCGGTATCCGACAACGCATATAATAACATGTTGAGAGATCGGGAAAATCAGTCCATTCTTATTACCGGTGAGA
GTGGTGCTGGTAAAACAGAAAACACTAAAAAAGTCATTTCCTATTTTGCTCAGGTGGCAGCCAATTCAAAAGATGAAGAT
AAAAGCAAAGGATCCCTTGAAGATCAAATTGTACAAGCTAATCCGGTTTTAGAAGCATATGGTAATGCAAAAACAAATAG
AAATAACAATTCCTCAAGATTTGGTAAATTCGTTAGAATTCATTTTGGATAACGGCAAAATTGCCGGAGCTGACATTGAA
TACTATCTTTTGGAAAAATCAAGAGTTGTCTCACAACAAAAAGGAGAAAGAAATTATCATATTTTCTACCAAATATTGTC
TAACAGTGCCAAAAACCTCCATGAAAAATTATTGATAGAACCAAATGCCAGCATTTATTCATTTATTAATCAAGGTGAAC
TAACAATTGACGGGGTGAATGATTCAGATGAATTCGCTTTGACTGATGAAGCGTTCGATGTTTTGGGTTTCACCACTGAA
GAAAAAATGGGACTTTTTAGATGCACAACTGCTATCATGAATATGGGTGAAATGAAATTTAAACAGCGTCCTCGTGAGGA
GCAAGCAGAAGCTGATGGTACTTCAGAAGCTGAAAAAGTTGCATTCTTACTCGGAGTAAATGCTAAAGATTTACTACAAG
CATTTTTGAAGCCAAAAGTAAAAGTTGGTACTGAATATGTTACTAAAGGACAAACTAAAGACCAGGTCTTGTTTGCTCAA
GGAGCGTTAGCTAAATCCATATATAGTCGTATGTTTTCTTGGTTGGTGACCAGAGTTAATAAAACTCTTGATACGAAAGT
GAAAAGGCAATGCTTTATTGGTGTGTTGGATATTGCCGGTTTTGAAATCTTTGAATATAACGGATTTGAACAACTGTGCA
TTAACTACACAAATGAAAGACTCCAACAATTTTTCAATCATCATATGTTCGTATTGGAACAAGAAGAGTATAAGAAAGAA
GCGATTGACTGGGAGTTTATAGACTTCGGATTAGATTTACAAGCTTGCATTGAACTTATTGAAAGACCAATGGGTATTCT
GTCAATTCTTGAGGAAGAGTGTATGTTTCCTAAAGCAACCGATGAGACTTTTGTTGCAAAATTGTATGAAAATCATCTGG
GTAAAAGTCCTAACTTTGGAAAACCAAAACCAAATGGTCAAGCAACTGCCCATTTTGAGTTACATCATTACGCTGGCTCT
GTTGGATATTCAATTACTGGATGGTTGATAAAAAATAAAGATCCAGTCAATGACAGTGTTCTTCAAACTTTAGGAGCTAG
TAAAGAAGCTCTTGTTGCTCAACTTTTTGCTCCTGCGGATGATGATGCTACTGGAAAGAAAAGGAAAGGAGGCAGCTTCT
TAACAGTATCGTTTGTTCACAGAGAATCTTTGAATAAACTTATGAAGAATTTACAAAGCACTAGTCCACATTTCATTAGA
TGTATTATTCCCAATGAATTAAAACAATCTGGATTCATTGACTCCCACTTAGTCCTACATCAACTTCATTGTAATGGTGT
GTTAGAAGGTATAAGAATATGTAGAAAAGGATTTCCAAATAGACTTATTTATTCTGAATTTAAACAAAG
>SMED30025388 ID=SMED30025388|Name=Myosin heavy chain|organism=Schmidtea mediterranea sexual|type=transcript|length=6089bp
TTTTTTTTCGAGTTTGTGCTAGAAATTAATTTCAGTTTGAAATTTTTTGCCTATTTCGAGTTCTTTGAAAACAATCTGAA
AACATGAACCCATCTGATCCCGATTTTCAATATCTCGGTGTCGACCGAAAAGCTTTAATGAAGCAGTATGGGGATTCCTT
TGACAGCAAGAAAAACTGTTGGATTCCTGACGAGAAAGAAGCCTTCATTGCGGCGACAATTGAAGATGCGTCTGGAGATG
TCTATACGGTCAAAACCGATAAAAGTGAAACCAAGACTGTTAAAAAGGACGAAATCGAACAAATGAATCCACCGAAATTT
TTGATGATTGAAGACATGGCAAATTTAACCTTTCTAAACGATGCCAGCGTTCTTGATAATTTAAGACAAAGATATTACAA
GAATCTGATTTATACCTACTCTGGACTGTTTTGTGTGACAATAAATCCATACAAAAGATTTCCAATTTACACCCCGCAGG
TGATTTCAAAATACAAAGGTAAACGACGAACTGAAATGCCTCCACATATTTTCTCGATATCCGACAATGCTTACACCAAC
ATGTTGGCGGACCGAGATAATCAATCTGTCTTAATTACTGGTGAAAGTGGAGCTGGGAAAACTGAAAATACAAAAAAAGT
TATCACTTATTTTGCACACGTTGCAGCTGCTACTAAAAAAGAAGAGGATGATACTGGAACTGGTCAAAAGAGAAAGGGAA
CATTGGAAGACCAAATCGTGCAAGCAAATCCTGTTTTAGAAGCATACGGTAACGCAAAAACTGTGCGAAACAACAATTCA
TCCAGATTTGGTAAATTCATTCGTATTCATTTCGGTACAAGTGGAAAAATAGCTGGAGCTGATATTGAATTTTACTTACT
CGAAAAATCGAGAGTAAATTCTCAACAGAAAGGTGAAAGAAACTATCACATTTTCTATCAAATTTTATCGAACGGAGGAA
AACCATTTCATGAAAAATTACTCATCTCTCCTGATCCAGCTTTGTATTCCTTCATTAATCAAGGTGAATTAACAATCGAT
GGAGTCGACGATGAAGAAGAAATGAAAATAACTGATGAAGCTTTCGACATTTTGGGATTTTCTGCCGAAGAAAAAATGAG
CTTGTTCAAGTGTACTTGCTCAATTTTAAACATGGGCGAAATGAAATTTAAACAAAGGCCAAGAGAAGAACAAGCCGAAG
CCGACGGTACTGCTGAAGCTGAGAAAGTGGCTTTTCTGTTGGGTGTCAATGCAAAAGATTTAATGCAATCGATTCTGAAA
CCGAAAGTTAAAGTTGGTAATGAATATGTCACAAAGGGGCAGAATAAAGATCAAGTTCTTTATTCGGTTGGTGCGCTAGC
AAAATCTCTTTACAACAGAATGTTTGCGTGGTTGGTTTTGAGAGTTAACAAAACCCTCGACACTAAAGTCAAGCGACAAT
TTTTCATCGGTGTTTTGGATATTGCCGGTTTCGAAATTTTCAATTTCAATGGATTTGAACAAATTTGTATTAATTACACC
AATGAAAGATTGCAGCAATTTTTTAACCATCACATGTTCGTGTTGGAACAGGAAGAGTACAAGAAGGAAGCGATCGATTG
GGAGTTCATTGATTTTGGAATGGATCTTCAAGCGTGCATTGAGCTCATTGAAAAGCCAATGGGTATTCTGTCAATCTTAG
AAGAAGAGTGCATGTTTCCGAAAGCATCTGATATGACATTTAAAGCAAAATTGTATGATAATCATCTCGGAAAAAGTCCC
AATTTTGGAAAGCCAAAACCTCCAAAACCCGGACAGGCTGAAGCTCACTTCGAATTGCATCACTATGCTGGCAGTGTGCC
ATACAATGTTACTGGTTGGCTGGAAAAGAATAAAGATCCTCTCAACGAAACTGTGATAAATCTACTTGCGGCAAGTAAAG
AGGCATTAGTTTCGAGTTTGTTTGCTCCGGCTGAAGATCCAAATAATACGGGTAAACGGAAAAAGGGTGGGGCCATGCAG
ACCATTTCTTCAACTCATAGGGAATCCTTGAATAAATTGATGAAAAATTTACAAAGTACCAGTCCACATTTTATCCGATG
CATTGTTCCAAACGAATTCAAACAACCTGGTGTAATCGACGCTCATTTGGTATTACATCAATTGCATTGTAACGGTGTCC
TTGAAGGCATCAGAATCTGTCGAAAGGGTTTCCCAAACAGAATGATTTATTCTGAATTTAAACAAAGATATTCTATCTTG
GCTCCAAATGCAATTCCACAGGGATTTGTTGAAGGCAAACAAGTAACGAGCAAAATTCTGGAAGCTGTTCAATTGGACAC
CAATCTTTACCGCCTGGGAAATACTAAGGTATTTTTCAAAGCTGGAACTTTGGCTGATTTAGAAGACATGCGTGATGAAA
AATTATCTTCACTGATTTCATTGTTTCAAGCTCAAATACGCGGATATTTGATGCGAAGACAATATAAAAAATTACAAGAT
CAGAGAGTTGCTCTATCTATCATTCAAAGAAATATTCGTAAATATCTTCTTCTGAGAACATGGCCATGGTGGAAATTGTA
TACCAAAGTTAAGCCACTTTTGAACATTGCTCGTCAAGAGGAAGAAATGAAAAAGGCCGCTGAAGAATTGACAAAATTAA
AGGAAGAATTCGAAAAAGTTGACAAATTCAAAAAAGAACTTGAAGAACAAAACGTCAAATTGTTGGAAGCTAAAAACGAT
TTGTTCTTACAATTACAAACCGAACAAGACAGTTTAGCCGATGCCGAGGAAAAGGTTTCAAAATTGGTTATGCAAAAAGC
CGATATGGAAGGAAGAATTAAAGAATTGGAAGATCACCTTCTAGAAGAAGAAGATAATGCTGCTGGACTGGAAGATATCA
AGAAGAAAATGCAGGGTGAGATTGAAGAGTTGAAAAAAGATGTTGTCGATTTGGAATCTTCATTACAAAAGGCTGAACAA
GAGAAAACCGCGAAAGATCAACAGATAAAATCGTTACAAGATCAAATGGCAAAACAAGAAGAAGAGATGAACAAATTGAA
AAAGGAGAAAAAGGCCGCCGATGAAGTGCAAAAGAAAACCGAAGAATCTCTACTAGCGGAAGAAGAGAAAGTCAAAAATC
TAAACAAAGCTAAAGCCAAATTGGAACAGACCATTGATGAGATGGAAGAAAACCTCTCGCGAGAACAGAAAATCCGAGCT
GACGTAGAAAAAGTTAAACGAAAAATCGAAACTGAACTGAAACAAACTCAAGAGACCGTAGACGATTTGGAAAGAGTAAA
ACGAGAATTAGAGGAACAATTGAAGCGCAAGGAAATGGAATTAGTCAATGCTTCATCGAAAATTGAAGACGAATCGGGAT
TAGTTGCCCAGCTTCAGAGGAAAATCAAAGAACTTCAAGCTCGAATTCAAGAATTGGAAGAAGATCTGGAAGCAGAAAGA
CAAGCCCGTGCAAAAGCAGAGAAAAGCCGACATCAACTCGAAGGCGAGTTGGAAGAATTGAGTGATCGACTGGAAGAACA
AGGAGGCGCAACCTCAGCTCAAATGGATCTCAATAAGAAGCGAGAGGCAGAATTAATGAAATTAAAGAGAGATTTAGAAG
AATCGAATATGCAACACGATCAGGTTATCGCACAAGCTCGAAAGAAGCAACAGGATGTTGTCAATGAATTCTCAGAACAG
CTCGATCAACTGCAGAAAGTCAAAGCTAAAGTTGAAAAAGAAAAGAATGAGATGAAAGAAGATTTAAATGACCTACAAGG
ACAGCTGGAATCATTAAATAAAGCCAAGGCTAACAGCGACAAACGAATCAAAGAAATCGAAGCTCAAAATTCCGAATTAC
AGGGCAAATTGGAAGAGGCAAATAGACATATCAATGATGCCAACAATACATCTGGAAAGAATCAACAAACCAATGCGGAA
CTCCAAGCACGTTTAGAAGAAGCCGAATCGCAAATCAATCAGCTGGGTAAAGTCAAGCAACAAATGCAGACTCAACTCGA
AGAAGCCAGGCAAATCGCTGAGGAAGAGTCGAGAGCAAAGGCTAAATTGAGTTCTGATGTTCGCAATCTCAATGCCGATT
TAGACAATCTCAGGGAGGCACTGGAAGAGGAAAATGAGAACAAAAGTGACATACAGAGACAGCTAGTTAAAGCTCAGGGA
GAAATGCAACAATTGAAGGCTAAATTCGAAGGCTCGGGATCCATTCGTTCAGAAGAGTTGGATGAAGCCAAGCGAAAGTT
TATGACACGAATCCATGAGCTGGAAGAGGAAGCTGAAACCGCCAAATCGAAAGCCGGACAACTAGAAAAAGTTAAAGCTC
GACTCCAAGGAGAAATCGAAGATATGCTGGTCGACGTTGACAGAGCGAATACACTCGCATCTCAGTTGGAAAAGAAGCAG
AAAACATTCGATAAAGTCGTGTCAGAATGGCAGCAGAAATATGCTGAATCTCAGGCGGAATTGGAAGCATCCCAGAGAGA
AAGCAGGACGATTTCAGCTGAGGTGTTTCGAATGAAAGCACAAATCGAAGAAAGTCAAGAGCAGTTGGAAAGCGTTAAAC
GGGAAAACAAAAATCTAGCAGATGAAATCCACGATTTGACAGAGCAAATCGGAGAAGGAGGTCGCAGTGTTCACGAAATC
GACAAAGCAAGGAAACGATTGGAAATGGAAAAGGAAGAATTGCAACATGCGTTAGAAGAAGCCGAACAAGCTTTGGAACA
GGAAGAAGCCAAGTCTCAACGATCACAACTGGAAATGAGCCAGATCAGACAAGAAATCGACAGGCGATTGGCTGAGAAGG
AAGAGGAATTCGAGGCCACTCGAGTCAATCATCAAAGAGCAATGGAGTCAATGGAAGCCTCACTTGAAGCCGAATCCAGA
GGCAGGGCTGAAGCAACGAAGATGAAAAAGAAACTGGAGCACGATATCGGTGAACTGGAAGTTGCAGTGGATACCGCCAA
CAGAATCCGATCGGAGCAAGAAAAGAACGCAAAGAAATTCCAGCAGCAAGTTCAAGAATTGCTATCAATGGTGGAGGATG
AGAAACACCAGAAGGATCAGATACGAGAGCAAACGACGATGACAGAAAGGAAATTGACAATGGTCCTGGCAGAGCTTGAG
GAGGTTCGTGGCTCATTGGAAAATTCCGAGAGAAACAGGAAAAATACCGAGAATGAGAAAATGGAAATAACTGATCGATT
GAATGAGTTGAGTGTCCAGAGCTCCGGTTTCATGGCTACCAAGCGGAAATTGGAAGCTGATTTGGCTGCTATGCAGTCCG
ATTTAGAGGAGGCCGCTACTGAAGCCCGACAAGCCAATGAACAAGCCAAGAAGGCTGTTGCTGACAGTGCGAGATTGTTT
GATGAAATCCGGCAAGAGCAGGAACACGCACAGCAAATCGATAAGATCAAGAAACAACTCGAGGCCCAAAATAAAGAATT
GCAAGCCAAATTAGATGAATCGGAGAATAATGCTTTGAAAGGTGGCAAAAAAGCCTTGAGCAAACTAGAGCAACGCGTTC
GTGAACTTGAAGCCGAATTAGACGGAGAACAAAAAAGACACGTTGAAAGTCAAAAGAACTCCAGAAAAGTTGAAAGACGG
CTTAAGGAGCTTGGATTACAAACCGACGAAGATAAGAAGAACCAAGAAAGATTGCAAGATCTGGTGGAGAAGCTTCAAGG
TAAAATCAAAACCTACAAACGCCAGGTGGAAGAGGCGGAAGAAATTGCTGCTGTAAACTTAGCAAAATACAGAAAGATCC
AACAGGAAATCGAAGATTCCGAAGAAAGAGCTGATCAAGCTGAACAAGCGTTGCAGAAGCTGAGGACCAAAAACCGCAGC
TCCGTTTCGACAGCGAGAGGCGGTAGCATGGCTCCCGGCATGACCACAGTGAAATCGACATCACTCTCTGTTTCGGCTTC
GAGCCGACGACAAGGTTCTAGTGTTTCCAGAGAGAGCTAAGTCAGAAATTCTAGTAACACAACGATAAATTATTAGGATT
TACTTAATTGACATTATTTGCATGTTATCAATTATTGGACACAATTTAGTGATGCTTTTATTTAATAAAATTTACATTTT
GAAAAAAAA

 

back to top


ADDITIONAL REFERENCES:


Cowles, M.W., Brown, D.D., Nisperos, S.V., Stanley, B.N., Pearson, B.J., and Zayas, R.M. (2013). Genome-wide analysis of the bHLH gene family in planarians identifies factors required for adult neurogenesis and neuronal regeneration. Development 140, 4691-4702.

Reddien, P.W., Bermange, A.L., Murfitt, K.J., Jennings, J.R., and Sánchez Alvarado, A. (2005). Identification of genes needed for regeneration, stem cell function, and tissue homeostasis by systematic gene perturbation in planaria. Dev Cell 8, 635-649.

Scimone, M.L., Kravarik, K.M., Lapan, S.W., and Reddien, P.W. (2014). Neoblast specialization in regeneration of the planarian Schmidtea mediterranea. Stem Cell Reports 3, 339-352.

 

back to top



PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in musculature system. Click this link to learn more about PAGE.


PAGE Curations: 163


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
musculature systemSMED30009007Titin dd_Smed_v6_2438_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30008204thrombospondin type 3 repeat-containing protein dd_Smed_v6_1693_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30008204thrombospondin type 3 repeat-containing protein dd_Smed_v6_2265_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30006232Uncharacterized protein dd_Smed_v6_5321_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30015575collagen type IV alpha 2 chain dd_Smed_v6_2337_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30026371Uncharacterized protein dd_Smed_v6_1549_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30003562collagen type X alpha 1 chain dd_Smed_v6_701_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30027074Titin dd_Smed_v6_15537_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30027074Titin dd_Smed_v6_17069_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30027074Titin dd_Smed_v6_13910_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30027074Titin dd_Smed_v6_2438_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30008553phosphoenolpyruvate carboxykinase GTP dd_Smed_v6_196_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30018224adenylate kinase 1 dd_Smed_v6_1229_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30032833Ig-like domain-containing protein dd_Smed_v6_475_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30009279dystonin dd_Smed_v6_655_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30012386glycogen phosphorylase B dd_Smed_v6_1532_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30024211Titin dd_Smed_v6_15537_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30024211Titin dd_Smed_v6_17069_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30024211Titin dd_Smed_v6_13910_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30024211Titin dd_Smed_v6_2438_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30009274EF-hand domain-containing protein dd_Smed_v6_990_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30008655tubulin alpha chain dd_Smed_v6_508_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30015168calponin 3 dd_Smed_v6_450_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30015168calponin 3 dd_Smed_v6_273_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30008241Titin dd_Smed_v6_15537_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30008241Titin dd_Smed_v6_17069_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30008241Titin dd_Smed_v6_13910_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30008241Titin dd_Smed_v6_2438_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30015470Secreted protein, acidic, cysteine-rich; transcript_id=FBtr0085094 dd_Smed_v6_1021_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30009048dystonin dd_Smed_v6_655_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30023110filamin C dd_Smed_v6_810_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30035680Calmodulin-regulated spectrin-associated protein 1 dd_Smed_v6_7356_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30016760thrombospondin type 3 repeat-containing protein dd_Smed_v6_1693_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30016760thrombospondin type 3 repeat-containing protein dd_Smed_v6_2265_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30013416EF-hand domain-containing protein dd_Smed_v6_990_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30016491dystonin dd_Smed_v6_655_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30018643collagen type V alpha 2 dd_Smed_v6_832_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30026887Myosin alkali light chain 1 dd_Smed_v6_223_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30013577thrombospondin type 3 repeat-containing protein dd_Smed_v6_1693_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30013577thrombospondin type 3 repeat-containing protein dd_Smed_v6_2265_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30018389thrombospondin type 3 repeat-containing protein dd_Smed_v6_1693_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30018389thrombospondin type 3 repeat-containing protein dd_Smed_v6_2265_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30020593thrombospondin type 3 repeat-containing protein dd_Smed_v6_1693_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30020593thrombospondin type 3 repeat-containing protein dd_Smed_v6_2265_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30034381malate dehydrogenase 1 dd_Smed_v6_467_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30006193dystonin dd_Smed_v6_655_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30009430aldolase, fructose-bisphosphate A dd_Smed_v6_591_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30023860family with sequence similarity 184 member A dd_Smed_v6_711_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30011506SH2 domain-containing protein dd_Smed_v6_7305_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30029426 dd_Smed_v6_1187_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30010499 dd_Smed_v6_6915_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30010499 dd_Smed_v6_2869_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30009565 dd_Smed_v6_6915_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30009565 dd_Smed_v6_2869_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30031902 dd_Smed_v6_6915_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30031902 dd_Smed_v6_2869_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30020950 dd_Smed_v6_6915_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30020950 dd_Smed_v6_2869_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30030887 dd_Smed_v6_339_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30034101 dd_Smed_v6_3534_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30016092 dd_Smed_v6_3534_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30012826 dd_Smed_v6_309_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30018961 dd_Smed_v6_406_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30015041nuclear receptor SMED30015041smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
musculature systemSMED30022812protein tyrosine phosphatase receptor type F dd_12771dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
musculature systemSMED30034772Collagen alpha-1(XXV) chain dd_9565dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
musculature systemSMED30029875Collagen alpha-1(XXV) chain dd_9565dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
musculature systemSMED30012716Collagen alpha-1(XXV) chain dd_9565dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
musculature systemSMED30003461 dd_8528dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
musculature systemSMED30008639Transcription factor SUM-1 myoDsmed_ncbi_20240424PMID:25254346
Scimone et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
musculature systemSMED30023573zinc finger protein 575 KJ934814smed_ncbi_20240424PMID:25254346
Scimone et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
musculature systemSMED30008927Twist-related protein 2 KF487106.1smed_ncbi_20240424PMID:25254346
Scimone et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
musculature systemSMED30030115DEAD-box helicase 4 DN298916smed_ncbi_20240424PMID:16344473
Zayas et al., 2005
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
musculature systemSMED30026663tropomyosin 1 DN312526ncbi_smed_estsPMID:16344473
Zayas et al., 2005
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
musculature systemSMED30026663tropomyosin 1 DN312526smed_ncbi_20240424PMID:16344473
Zayas et al., 2005
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
musculature systemSMED30031256Wnt family member 4 EU296631smed_ncbi_20240424PMID:30485821
Tewari et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
musculature systemSMED30004654triosephosphate isomerase 1 dd_Smed_v6_1402_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30009076actin beta dd_Smed_v6_37_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30009076actin beta dd_Smed_v6_90_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30009076actin gamma 1 dd_Smed_v6_37_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30009076actin gamma 1 dd_Smed_v6_90_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30009749Myosin regulatory light chain 2 skeletal muscle isoform dd_Smed_v6_445_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30025388Paramyosin; transcript_id=FBtr0076594 dd_Smed_v6_579_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30001657polyamine modulated factor 1 binding protein 1 dd_Smed_v6_2381_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30000771AHNAK nucleoprotein 2 dd_Smed_v6_474_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30001359AHNAK nucleoprotein 2 dd_Smed_v6_474_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30035336LLGL scribble cell polarity complex component 1 dd_Smed_v6_2164_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30009031Uncharacterized protein dd_Smed_v6_5321_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30025553Uncharacterized protein dd_Smed_v6_4789_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30015353titin dd_Smed_v6_2544_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30013228ryanodine receptor 3 dd_Smed_v6_5582_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30017388collagen type I alpha 2 chain dd_Smed_v6_740_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30023280Ig-like domain-containing protein dd_Smed_v6_2928_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30017945collagen type V alpha 1 chain dd_Smed_v6_840_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30006180Cuticular protein 47Ef dd_Smed_v6_702_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30013107glyceraldehyde-3-phosphate dehydrogenase dd_Smed_v6_78_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30015413RAB28, member RAS oncogene family dd_Smed_v6_375_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30001497Rho guanine nucleotide exchange factor 17 dd_Smed_v6_2922_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30005039Unc-89; transcript_id=FBtr0113464 dd_Smed_v6_7371_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30002133ubiquitin B dd_Smed_v6_34_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30003429EF-hand domain-containing protein dd_Smed_v6_990_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30001807family with sequence similarity 184 member A dd_Smed_v6_249_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30002742dystonin dd_Smed_v6_655_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30002983Tropomyosin 2; transcript_id=FBtr0083080 dd_Smed_v6_436_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30002788h1SMcT0004685.1 dd_Smed_v6_1244_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30036005ATPase sarcoplasmic/endoplasmic reticulum Ca2 transporting 2 dd_Smed_v6_1772_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30029432calponin 3 dd_Smed_v6_450_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30029432calponin 3 dd_Smed_v6_273_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30017516collagen type XIII alpha 1 dd_Smed_v6_2197_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30034766enolase 1 dd_Smed_v6_510_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30021204Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v6_7811_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30011827h1SMcT0020942.1 dd_Smed_v6_2373_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30014371Uncharacterized protein dd_Smed_v6_1778_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30034531Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v6_1745_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30006773calpain 3 dd_Smed_v6_1752_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30026663tropomyosin 1 dd_Smed_v6_405_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30032160Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v6_1745_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30030352PDZ and LIM domain protein dd_Smed_v6_2888_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30007876Myosin regulatory light chain 2 skeletal muscle isoform dd_Smed_v6_803_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30034823Tropomyosin dd_Smed_v6_822_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30006279Tropomyosin dd_Smed_v6_822_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30011701Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v6_1745_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30006279Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v6_822_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30030974Titin dd_Smed_v6_15537_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30030974Titin dd_Smed_v6_17069_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30030974Titin dd_Smed_v6_13910_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30030974Titin dd_Smed_v6_2438_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30027141Uncharacterized protein dd_Smed_v6_1549_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30013320Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v6_7811_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30033424Calponin-homology CH domain-containing protein dd_Smed_v6_2554_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30034823Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v6_822_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30024775Muscle protein 20; transcript_id=FBtr0345532 dd_Smed_v6_1512_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30022612DUF1907 domain-containing protein dd_Smed_v6_1733_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30028040cysteine and glycine rich protein 2 dd_Smed_v6_373_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30009776Collagen type IV alpha 1; transcript_id=FBtr0079002 dd_Smed_v6_2500_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30035631hypoxanthine phosphoribosyltransferase 1 dd_Smed_v6_339_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30035631hypoxanthine phosphoribosyltransferase 1 dd_Smed_v6_7763_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30035218capping actin protein, gelsolin like dd_Smed_v6_1132_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30031625collagen type V alpha 2 chain dd_Smed_v6_402_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30027460troponin T3, fast skeletal type dd_Smed_v6_323_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30010046thrombospondin type 3 repeat-containing protein dd_Smed_v6_1693_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30010046thrombospondin type 3 repeat-containing protein dd_Smed_v6_2265_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30006311calponin 3 dd_Smed_v6_333_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30003613Troponin C at 25D; transcript_id=FBtr0079063 dd_Smed_v6_660_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30008609AHNAK nucleoprotein 2 dd_Smed_v6_474_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30028449high density lipoprotein binding protein dd_Smed_v6_553_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30016281synaptonemal complex protein 1 dd_Smed_v6_1434_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30016281synaptonemal complex protein 1 dd_Smed_v6_432_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30004176thrombospondin type 3 repeat-containing protein dd_Smed_v6_1693_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30004176thrombospondin type 3 repeat-containing protein dd_Smed_v6_2265_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30024367Major egg antigen dd_Smed_v6_2736_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30004975hypoxanthine phosphoribosyltransferase 1 dd_Smed_v6_339_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30004975hypoxanthine phosphoribosyltransferase 1 dd_Smed_v6_7763_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30020371hemicentin 1 dd_Smed_v6_1161_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30005936Titin dd_Smed_v6_15537_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30005936Titin dd_Smed_v6_17069_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30005936Titin dd_Smed_v6_13910_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30005936Titin dd_Smed_v6_2438_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30004485collagen type V alpha 1 chain dd_Smed_v6_1070_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30013408Sarcoplasmic dd_Smed_v6_1010_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30009007Titin dd_Smed_v6_15537_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30009007Titin dd_Smed_v6_17069_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
musculature systemSMED30009007Titin dd_Smed_v6_13910_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Note: Hover over icons to view figure legend

 

 

back to top