primitive ectoderm cell

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ In Situ Hybridization Data

  ▻ Sequences




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  primitive ectoderm cell


DEFINITON:

  Primitive ectoderm cells differentiate from the blastomere population, exit the cell cycle and interact to boud the embryo during Stage 2.


TERM DEFINITION CITATIONS:

  OCLC:464776945, OCLC:20423827, OCLC:82522822, PMID:28072387, planaref-0000001


TERM CITATIONS:


TERM ID:

  PLANA:0000211


ABOUT THIS TERM:

primitive ectoderm cell

  ↳is a ciliated epithelial cell, extraembryonic cell and material entity

  ↳contained in oral hemisphere and aboral hemisphere

  ↳develops from blastomere

  ↳existence overlaps Stage 4, Stage 3, Stage 5 and Stage 2

  ↳existence starts during or after Stage 2

  ↳part of primitive ectoderm


BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30014940Gelsolingelsolin-likeStage 2, Stage 3, Stage 4, Stage 5embryonic digestive system, primitive ectoderm cell, primitive ectoderm, embryonic pharynx
SMED30032088Spondin-1spondin1-likeStage 2, Stage 3, Stage 4primitive ectoderm cell, primitive ectoderm, blastomere
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30002168 ID=SMED30002168|Name=Spondin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=2693bp
CAATTGCTTAATAAAATTTTCCTTTCAATAATTACCGTAAAAGTTGATGAAATTAATTTTGAATATTTTATCCACTTTTT
TCATATTGAAATTTGATTTTGCTGAATGTTTCGGATTTTGTGACATTCAATTTCCGAAATCATACGTTGCCTTTTCCACT
AGATTCAATCTCTATACGAATCATGAAAAAGAAAAACTGACCAAAATCACCTCGTACATTCCTGATAAAACCTACGACAT
AACTGTGTCATTGAATGATAAAGCTATGCACGAAAAGTTGACAATAAAAGAAATATACGTCTTAGTCTCAAATGTTCACA
CGGAAATGGAAGAATTGTCGGAACATGACTGGAAAAACGCCGGTGAAGTGGTTTTTAATGTAACTCACGCATCCAAAACA
GAATATTGCCCCCAAAGAGCTTACGTTCAGTATTTATATACCCAACCCCAACATGTCACATTCTATTGGATAGCACCTAA
AATACCGAATTTTTGTATTAGAATAACAGTTATTTTGAAAATGAACGATTTGATTTCAGAAAGCAAATTCGAAGAAAGAT
CCCACTGGATATGTGAACAAAAAAGAAACAAAATGGATCAGATGCAAGCAGATCAATATGCATCTACCTCTTGCGCAATG
AAACAAAAAACTGATCCAGTTAAACAATGTAATATTGGATCAACAGCGGTATATAGAATGACAATTGAAAATAAATGGAA
TTTATTAAATCATTGGAAAGATTGGCCGGGCAAAGACGGGTATTCTCCTAAAATAACTCAATATCTCGGAGCTTCTCATT
CAAATGAGTTTAATATTTATCATCTTGGTGGAATGGCCAATGAAGGAGTTTCTCAGGTATGTGGAAACGGGAGCTACACT
GAATTGCAAAAGCAATTCTACAAAGCTGGGAACGGGATCATGACAGTTATATTGGCCAGGTCACTAGATGCGTCATCAAA
AACCAATAAAAGATCAGCACTGATTGTTGTAAATGCAACTCAACATTTGGTTAGTTTTCTTGCAAGACTTCATCCAAGTC
CCGATTGGTGCACAGGTCTAAGTAGATTTGATCTTTGTAACGGCTCATGCAAATGGCAAGAAAAATTTATCGTCCATTTA
TATCCTTGGGATGCCGGTGTTTACAGTGGAGAGACTTATTTAAATAAAAACGAGAAAACTAGACAGACTCCAATATGTCC
AATCACTAGCAGTTGGCCAAAGGATAACCCTTTCACGGTGATGAACGGAAAAATCAAAAATATCGGAGTGGTAACCTTCC
AATTAATACAAGAATATAACAAAAATGATAACCAGTATTGTAATTCTATTAATTCAATCCTTCAAGACGAAGCATACCAA
AATGAACCGAAATCCAGTGCTCTGAAATCAAATCCAGATAAAACCAGGCATTGCTTATTGTCAGAATGGAGTGAATGGAG
CTCTTGTTCAGAATCTTGTGGTAAAGGTGAAAAAACTCGTTACCGAAAACTGCTGAAAGGAAAATCCGAACAATGCATTG
AATCTTCCCTAACTAATACAGAGAGCTGTAGCAGTAAATGTTCGACAGTAATTTCATTCGAAACATGTTCGTTTCGCTTG
TGGGGCCAATGGAGCCCATGCAATGCTACTTGTTCCCAGAAGGGAATTATTCATAGGGAACGTGTTTTTATCAATGAACA
GGAAAAACACGAATGTATGCAATATTCCGAAATGAAAGCCTCTCTTGAATGTGCATTAGCAAGCGAGAGGTGCAAACCCG
ACGTGATCTGCAAGGAATATGTTTATCCTGGAGATTCGTGTTCTTGGTCTAGCCCATCACAAAGATTTTATTACGATTTT
TCTAGTGGAACTTGTAATGCATTTATTTACAAAGGCTGCTATGGGGGTCTGAATAATTTTCACACCTACGAGGAATGTAT
TTTACTCTGTCGACCAAAATTAAAAGAAACAGATCAAAGACGATTTAATACGCCAGAAACTTATCCCAACCGATGCGGAG
TTTCGATGACATGGGGAATCTTTTGTGATAGTCAATCTTCATCAAACCGTTGGTACTATGACAATATTAATAAAGAATGC
TACCGATTTCGTTTCGGGGGCTGTCGAGGGAATGCCAACAATTTCCGAACTAAAACTGAATGTCAAAATGTTTGCTTGAG
AGAAAAGTCTACTTCAACAACAACGACAACGATCAGTCAGCCAGTAACGGTAAGAAAAGTCTGCATCTATTCCAACTGGT
CGGACTGGAGTTCTTGTGATAACAACTGTCAAAATCAACAAACAAGAATAAGATTTTTAATTGAAAAAAATGACGACTGC
ACCGAAAGTATCAGTGAAACAAGAAAATGTCAATCAGAGAAATGCAATTCGCCAAATAACGGGTTTATTTCACTAAGGAA
TTGCAAGTATTCGAGTTGGTCGGAATGGTCGGCTTGTTCATCAAGATGCGGTCCTGGCGTTAGAGAGAGAAAGCGGAAGA
AACTTTCTCGTAATTGTAAACCGGAATTTCCGCAATTTACTGACCGAGAATCATGTTACAATGCTTGTGCTTATGACTGA
ATCCGGTAAAGAAAAAAAAACTGTCAATGTATTTGTGTCATGACATTTTACCTATTGTGCATTTCATTTTGTGAACTTTG
TTTGGTTTTTGATTTATTTTTTCTTGGTGTTTTTCTCTAGAATATGATTTGTT
>SMED30012543 ID=SMED30012543|Name=Spondin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=2035bp
CTCCAATGAAATGTTTACTTTTATAAATGACAAGCCTATTGTAAACAATGGAATGAAGACGGCTTACAAACAATGTTGCG
CCTGTGGAACTGCAAGTTATCGGGTGACTTTTCATGGGTTATGGAACAAAACAACTCATCCAAAAGAATGGCCAGAAGAA
AAAGGTCAGCTTCATTGGACAGATCCTATTGGAGTCACCCATAATCATAATTACTTTATTTATCATTTGGGAGGACAAGC
TTCATTTGCGGTTGGTAGTGTATGTACAACAGGAAATTCGAGATCTTTGAAAGAGGAATTCACCTTACCTGAAAATAGAT
TAAATGTTAAGAGTCTCTTTACGTCAGGCTGGTTAAATGGGGAAGAACAGCTAAATGAAGAGCGTTCAGGATTCATTTCT
GTTAATAGAACTCATAATTTATTTAGTATGATTTCAATGATGGGACCAAGTCCGGATTGGTGTACCGGAGTGTCAGGAAT
CGATCTTTGTATGGAAGGATGCAAATGGAAATCAAATCTCACTATACCTTTGTTTCCGTTTGATGCTGGAATACAGACTG
GGGAAACCTATAAACCTGAATCTATTACTCGGCTTGATGAACCGGAGCCTATTAAAGAAATCAGTAAAATTTGGATGAAA
AGTAGTCCGTTTACACCGAATGTTCCTGTTGCTGAATTAATTCTGACAAGAATCTCTCCAAAGACCGACGAAAAATGTTC
TAAATCCCCTATGAAAAATGTTGATGAATTTAATAAGTCAAATGAATTAATAAAACAAAATTATCGCGGTAAAAATAAAG
GAATAGCAAAATATAATGTTCTTGATGACCCCCAGCTGGCTCAGATGGCAAAAGCTTTTTGTGGATTTTCTCAATGGGCT
AGCTGGTCTCGGTGTTCAGTGGATTGTGGAGTTGGGGAATCTTCTCGTAAGCGAGAGTTGATCAAGAATTTTAAAAATGA
ATTATGTGTCCAGCTGCCAAGGAAAGAAACCAGATATTGCTATGGTCGACGAAGAAATTGTGATTTTTCTATGAAATGTA
GTCTTCTTCCGTGGACTGAATGGACTAAATGTACTGCTACTTGTAAAGAAGCAGGAAAGATAGCAAGATCGAGAAGATTC
GTGAGGGAGGCGGAACGAGAAGAATGTTTGAGAGAAGTGACACCAACTACTAGACTATATGAGGAAAAGCCATGTAAACT
CGATCAAACTGACAGCCGCTGTGATCCAGTGTCAATTTGCAGTGCTGGAAAATTGCCTCCTTGTACTAGAGGTAAACGTC
AAACAAGATATTTCTATCACGTCAAGACTGGAAAATGTGAACCGTTTTTTTATTTTAATTTTTGCCAGATTGGCCTAAAC
AACTTTCGCACTGAGGTAGACTGTGAGAAAATGTGCGTTAAAGCCATTGGTCAGCTGCCTGGAATTAAAAGATCAAATTT
AGCTCTTTTGCAGTTTCGAACTTCTTATTCAGGAGACCTTTCTCAAAAAGAAACTAAAATACCAGCTCAATGTTTCAACG
AAATAGAATCAGTAAAGACATGTATTCATAAATCTCCAAGAACCGTATGGTACTACAGTCACCGAAACCAGAAATGTCGT
TCTTTGGTGGATTTCGGTTGTCAGGGAAGTTTGAATAAGTTTTCTTCTTTTGAACAATGCATGAAGATTTGTCGACCTAA
TTTACAGAGTCGTTCTTCAACATCTGATAAAGTAGACTGCCAGGTCTCTAATTGGAGTTCCTGGAGGCCTTGCTCTAAAA
GCTGTGGCAAAGGAACACAGATCAGAAAGCGAATAATTTATAAAGATTCTCTTAATGGTGGAGAACCTTGTCCACTTCTT
TACGATTCTAGAGATTGTTACGGTATATCTTGCAATTAGAGATAGCCATAACTATTTTAGTTTATAAAAGCATTCATCCA
GGCCACAGTTGAAAAGCATTTTAATTATTAATAAATTTTAGAATTGTTAATTTTAGTATTTTAGTATATTTTTGCTGTAT
TTAGTGCAAAAAAAAAAGACGGGTATAAAAAGGTG
>SMED30012850 ID=SMED30012850|Name=Spondin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=2699bp
GGTGAATGAAAGATTGAAAGTAAACAAATTTATGAGACATTGACATTATTCATTTAACTTACATCACAGGACGACCAATA
TCACATAATACTTCTTCCTGTTTACAAGGTTGAAGTCGTTTATATAAATCGTCAAAGTCTCAGTTAAGATCATTGATATT
ATGAAAATTTACATCTTAATTTGGAATATCCTTTGGATGTTGCTATGTCTTCATTGGATGATCCAGGAAAGTTTTGCCAT
GAATACTAGAACCAATTGTTTTAAAATGCATAAAAAAACCTACCAAAAAGTCATGATGAAAGATGGAGAATTTCGAATAG
TAATTAGAGACATGAAAGGCAAAATGGCAGATAGATTCGAACCTGGTGAAAGCTATAGAATAATTTTGAATAATGCAATG
TATGGAATGGATTTCAGAGATTTTTCAATATTCGCGGCCTACGAGATGGAGGATTCGTTGCAAATGGAAAGTCATAAAAT
GATTCCCGATGAAGGACTTGGTCATTTTATTATAAATAAAAAATTTGGGTTGGTTGATTATAAATGTCCTAACAGAATGC
ATGGAAATGATAATATGTTTCTAACTTATGTAGAGTCGACATGGATAGCTCCGCATAATCCTATAAATTGTATTCGCTTT
GAGGCTCAAGTTGTAAAATTTGATTTTATGGTGTATGAAAGTATCGGACGTTTAGTAAAAGTTATTTGTCCAACAAAAAT
GTATAAAATGATTAGTGAAGAAAATAAAAACATGAAAATATCTAAACCTTTTGATGAGATGACTCCTATGGTTAAAGAAT
GTTGCGCTTGTGGAGTAGCGTCTTATAAAGTAACATTTATGGGGTTATGGTCAAAGAAAACTCATCCCAAAGATTGGCCA
AAACAAAAGAGCATGGTTCATTGGACCAATCTTATAGGGGCCACACATACTGGCGATTACTTTATATATTATAACGGTGG
TCAAGCAAGCCAGGCAGTTCAAAGTATTTGTTCATATGGAGATAGCACGGTTTTGAAACAGCAGTTCGCAGAAGAGACAA
TAAAACCGCATTTGAAGAGTTATTTTAATACTTCAGGCATGTGGAATGAAGACGAAATTGAACAGAGTAGATCGGGATTC
ATATCGGTTAATCGTACTCATCATTTCTTTAGCTTTCTCACAATGATGGGCCCAAGTCCTGATTGGTGTACTGGAGTAGC
AGCTGTAGACATGTGTATGAATGATTGTACATGGAAGGATGATTTCACCATGGATCTATTCCCATTTGATGCTGGAATTA
AAAACGGTTTCACATATTTCCCAGAAAATTCGGACAGGCAAGACATTCCTGATCCAATTAGAACAATCAACACTACATAT
ATGACCCAATTCCCTTTCACAGCAAATGTTCCAGTTGCCCGGGTAATTTATCAAAAGATCAAACCAAAACACAATTGGGA
GTGCACCAAGATGAATGCAAAACAAGTAAAAGAATTTGATGAAATGAATTCAAACAAAAACGGAAATTCTCAATTCGATG
GAAGTAGTTTGACGAAAAAACGCCGACACATTAACAAGAAAAGTCCCCTTGATGATCCGACTTTGGCCAATATGGCTACA
TTTTTGTGTATAACATCTCCATGGAGTGAGTGGACTAAATGTTCAGTTACGTGTGGCATTGGGACAGAGATGAGATCTCG
AGACATGTTGAAAAATGCTAAAACAGAATTATGTCGTCACTTACCTTTGCTTGAAAGTCGGACATGCGAAGGAAGAAAAC
GTTCGTGTGATTTCTCAGCACCATGTAGCCTTCTTTCCTGGTCAAGATGGGGTCCATGCAATGCAACTTGTGAGATGCAC
GGATACCAACAGAGATCTCGAATGTTTGCAAGATTTGAAGAAAAAGAGAAATGTCTCAAAAACAAAGAAAGACGATTTAA
AATTTTTGAAGAAAAACGGTGCAAAAAAGACACAGCCTTGTGTGACCCAGTTATTATATGTAGTGAGGGCCTAATAATGG
GCAGCAGCTGTGGCAAGCCTGTTATGAAATATTTCTATGATGCTGCCAAACACAGTTGTGTGCCTTTTGAATACCTCGGT
TGTAAAGGAAGTCTGAATAACTTTCCTTCTAAAATGTCTTGCGAAAAGACTTGCTTAGCAGCTGTCAATGCGCTGCCTCA
GTGGAGAAAAGACAAAATGGCTCACTTACAGTTTCAGTCTCAGTCGAATTCAGATAAACGAAAGAAAATGCCAACAATGG
CTAACAAATGTCGGCTTGAAGTAAAATACGGCGGAATGAATTGCGATGGAACAATGGGACCGGACATTCGATATTATTAT
GATAACAGAAATGGACGCTGTAGACAATTTAAATACACTGGCTGTGATGGGAATAGTAACAACTTCCGGTCTTATCACAG
CTGCATTAAGGCTTGCATGCCAGATCAAATCGACTTTATGAAAACTGCTCCGATCAAAGCTTGTCAAGTATCTGAGTGGT
CACATTGGGGTCCATGTTCTACGACCTGCGGTGTGGGAGAGAGATTCAAATGGCGATCTGTGCTTCGGCCGGCATTGAAT
GGCGGTCCAGCTTGTCCAGAGTTATTTCTATCGGAACCTTGTTTCGCGACAACTTGTTGAAAAATTTATATAAATTTTGT
ATCCATTTTTGATGACATTTATAATAATTTTATGGGTAAATATATTTTAGTTCTTCCTC
>SMED30014940 ID=SMED30014940|Name=Gelsolin|organism=Schmidtea mediterranea sexual|type=transcript|length=530bp
CAAATAAATTTTCGTTTCGTAATTATTTAAATTTCACATGTTTTTTATTTAACTATAAATTCTGGAAAATAAATTAATTT
TACATTCAATTAATTCAAACAATGAAATTAGATTTTAAAAGTAAATCATTTCTAGAATTTTTTGTTTTTTAAACTTTCTA
AAAAGGAAACAACTACGGAGCAGTCGAAGAAGTTCTTGTCACCGGACACAGAAAGTCTGACAAAACCGGAATGATAAAAC
AAAAAAACTACGATTGGAAAGATTCCAATTTGGCTTTGTTTGGATCAGACACGGAAAAATTAGTAAAAAAAACTTCCGCT
GAAACCGAACCAGCATGGAGAGTTGCTAAGGCAACTACGGTTCCAGGTTTATTTGTTTGGAGAATAGAAAAATTCAAAGT
CATCAGTTTACCAAAGGAAGAATTCGGAAAATTTTACAATGGAGATTCTTACATTATTTTGAAAATCAATAAAGAAGAAG
ACAGTCCGGAGTTGCTATACGATGTGCATTTTTGGATTGGAAAATATTCT
>SMED30022124 ID=SMED30022124|Name=Gelsolin|organism=Schmidtea mediterranea sexual|type=transcript|length=998bp
TGTACATTAGGATGAATATGGAACAGCAGCGTATAAAACCGTTGAGTTGGACACTTTACTCGACGATAAAGCCATTCAGC
ATAGAGAGGTGCAAGGAAATGAAACTGATCTTTTCAAATCTTATTTCCCAATTATGACAATTATGAAAGGCGGTTGCGAA
AGCGGTTTCCATCATGTTACCCCAGACAAATATGAACCGAGACTTTTACATTTCCGATGCACCGATCACAAGCATGTTGA
ATTGGTGGAGGTGAAACTTTCAAAGCAGGCTTTGGATTCGGAAGATGTTTTAATCTTAGACAATGGCTTAGAGGTTTTCC
AATGGAACGGAAAATTATCCAATAAAAATGAGAAATTTAAAGCCGCACAATTTTTGCAACAGTTGAAATCCGAAAGAAGC
GGACGTGTTAAGACCGATGTTTTGGATGAGGAATTCACTGCTGCCAACCATAGAATATTTAAATTGTTGCCAGATGTTCC
ATTTACAAAGAAAACTCAAAACGATTTAAATATGAGTAAAATGCTTTATCGATTGTCTGATGAAAGTGGAAAAATGACTT
TCTCCTGCATTTCTGAAGGATCAATTCCAAGGTCAATGTTAAAGGATGACGATGTCTACATGATTGACAATGGCAGACAT
TTGTTCGTGTATATTGGAGCACGGGCATCGCAGGAGGAAAAGAAGAACGCGATGTCATATGCCCACAACTACCTGAAGAC
GACTGAGCACCCACTTATCGGAATCACATGCCTCCAATCTGGTCAACATAACAAGGAATATGATCTTCAATTAGAATAGG
ATGTTAAATGATAATTTTGGAATATGTAATAAAAATTAACAAAGCAATTTTTTAAAAACAATAATTTCACAAAATAGGAA
TGAAAATCACAAAAGTATTAAAATTCCATCTATGAATTGAATATCACAATTATAAATTCTTCAACACATAAATCTTGAGC
GAAGCAATAACTTAAAGATTTCAAACATTTACCGCCGC
>SMED30032088 ID=SMED30032088|Name=Spondin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1776bp
TTACCTGAAAATAGATTAAATGTTAAGAGTCTCTTTACGTCAGGCTGGTTAAATGGGGAAGAACAGCTAAATGAAGAGCG
TTCTGGATTCGTTTCTGTTAATAGAACTCATAATTTATTTAGTATGATTTCAATGATGGGACCAAGTCCGGATTGGTGTA
CCGGAGTGTCAGGAATCGATCTTTGTATGGACGGATGCAAATGGAAATCAAATCTAACAATTCCTCTTTATCCTATCGAC
GCTGGAATACAAACTGGAGAGACCTACAAACCAAATAATGTCACAAGACTTGATGAACCCGACACTATTAGAGAAATTAA
TAAAATTTGGATGAAAAGTAATCCTTTTACTCCAGATACTCCAGTAGCAGAAATCACCCTCACCAGAGTAGAGCCACAGA
AAGACACACAATGTGTTAAAACTCCAGTTAAGGGTGTAAATGAATTTCAAAATGCACAAAAAGAGTCTAGATCTAACACG
CTCGGTAGAAATGGTGCCGTGGAAAAATATAATGTTCTAGATGATCCTCAGTTAGCTCAAATGGCAAAAGCCTTTTGTGG
ATTTTCCGAATGGACCAGCTGGTCACCATGTTCCGTAAAATGTGGAGAAGGTGAAACGTCTCGTACTAGAAATTTGATAA
AAAACTTGAAAAATGAATTGTGTATTCAATTGCCAAGAAAGGAGCAAAAAAATTGTGCCGGTGCTCGATTGGAATGTGAT
CTCTCAAAGAAATGTAGTCTATTACCTTGGAGCTCATGGAGTCCGTGTTCTGCATCTTGTACAACTGAAGGGAAAATGAT
CAGAATTAGAAAATTTGCGAGGTCAAAAGAAAAGGACGAATGCATGAAAAACGTCAAACCAGAAATTATTCTTCAACAAG
TGAAAACTTGTAAATTGGATAAAACGGACTTCCGATGTGATCCGATATCAATTTGCAGCGCCGGTAAATTGGCACCTTGC
ATCAATGGTAAACCCAAGACGAGATTTTTCTACCACATCAAAACTGGAAAATGCGAACCGTTTAAATACTATGATTGCAA
AAAAGGAAATCTGAACAATTTCCCAACTATAGATTCATGTGAAAATGTTTGCTCTAAAGTTATTCAGGAATTACCAAAAA
TAAGACGATCTAATTTAGCCTTGCTTCAAGCAAGAACATCTTATTCAGCTGAAGAGAGTCTTTCGCAAAAAGCCAAAAAC
ATTCCGGAATTCTGCTTTCATGAAGTGGATTCCAGTAAGACCTGCATGAAATCCAAACCAAAGACAATCTGGTATTATAG
TCATCGAAATCGAAAATGCCAATCACTGGTGGATTATGATTGTAAAGGAACTTTAAATAAGTTTTCGACTTTCGACGATT
GCATGAAAACCTGCCGACCTGATTCACAACTCGAATCATTGAAACTTGATAAAGTAGATTGTCAGGTCTCTGAATGGAGT
TTATGGAGGCCATGTTCAAAGTCATGCGGTTGGGGAACTCAATACAAGAAAAGAGTCATTCAAAAGGATTCATTGAATGG
GGGCTTACCATGTCCGGTGCTATATGAATCTCGAAAATGCTTTTCCAAACCTTGTTAATCTGTCAATATTTATTTAAAAA
TTGTTTTTTGTGAATTATAATTTCTATTTCTTAATCTATTTGAAAATGTAATAAATATTACTTTGCGTATTTGATTTAGT
TTAAAGTTTTCTCATTGGTCAATCCGCCGTTGCTAACCAATGAGATCGGCTACTACATCAATTGCGATAATTGACAGTGG
TGAGCAAACCTTTAAG
>SMED30035218 ID=SMED30035218|Name=Gelsolin|organism=Schmidtea mediterranea sexual|type=transcript|length=1573bp
TTATAACAGTCGCTTAATAAAATGATTAAAATCCTTAATTTTTAGTGAATTCAAATAACAAATTTTAAAATCTAATTAAT
AATTAAAATCTGTGACTTTGACAATCGATATGATAAAACAAAAAAAATACAACTGGAAAGACTCCAACTTATCTTTATTT
GGATCTGATACGGAAAAATTAGTCAAAAAAACTTCGTCGGAAACAGAAGCAGCATGGAAATTGGTAAAAACTGTAACTAC
ACCGAGTCTTTTTATTTGGAGAATTGAAAAATTTAAAGTTGTCAATTGGCCTAAAGAAGACTATGGGAAATTTTTCAATG
GAGATTCGTATATCATTTTAAAAATAAAAAAGGAAGAAAATAGTCCTGAATTATTTTATGATATTCATTTTTGGATTGGA
AAAAGAAGTACACAAGACGAGTATGGCACAGCTGCGTACAAAACAGTAGAACTAGATACATTTCTTGATGATAAAGCAAT
ACAGCATCGTGAAGTTCACGGTTTTGAATCTGATTTATTTAAGTCCTATTTTCCGGTTATTACAATAATGAAAGGCGGAT
GTGAAAGTGGTTTCAGACAAGTAACTCCAGAAAAATATGAACCAAGACTTTTACATTTTCACTGTGCTGATCAAAAACAT
GTTGAACTTGTAGAAGTGAAATTTTCAAAAAACTCTTTGGATTCAGGCGATGTATTTATTTTAGACAACGGACTAGAGGC
TTTTCAGTGGAATGGAAAACTATCAAATAAAAATGAGAAAGTTAAAGCAGCACAATTTTTACAGCAATTAGAATCAGAAC
GAAACGGTCGGTGCAAAACAGATGTATTAGACGAAGAAGATACTCCTTTGACGCATAAAATTTACAAATTACTACCTGAT
ACAGCTGTTACTAAGAAGGTTCACAAAGACTTGGCAATTTCCAAACGTCTGTATAGATTATCTGATGAGACAGGCAAAAT
AACGTTTTCTCTAATCTCAGAGGGCAAAACTCCAAAATCTATGCTGAAAGACAATGATGTGTTTATGATAGATAATGGGC
GACACATGTTTGTATATATTGGCGCCGGTGCGTCTCCGGATGAAAAGAAAAATGCAATGTCATATGCACATAATTACTTG
AAAGAAACTGACCATCCATTAATTGGAATTACTTGTCTCCAAGCTGGCCAGCATAGCAAAGAATTTGAGCTTCAATTGGA
CTAGAAAATGATTATGAAATTTTAAATTGCATGGCATTTCAATATTTTTAAATATTTGTGTTTTTACTTAATTTTTACAA
AATGCATGAGTTTATGGTAATTCATTTTCTTAGAAGAGTGAAGAAATATTTTTTTGTTTATGTATTTCATAAATTGCTTA
AATATAATTAAACCTAATGTATATATTGCTGTATTATTTGCTGTTACGAATATTATTGGGCTTGATAGAGCTATCAGAAC
TAACTCGCCATGCTCTTGATCATAACAAGAAATCTACGCAATCAATATATTTGTACCAAAAATCATAACCATTACAATTT
TCACCAACACAAATCAATCTAGTTTTTATTTGTTGCCAGAATCAAATTTTGGG

 

back to top