visual system

The Planarian Anatomoy Ontology (PLANA) is a collection of terms curated from the literature and other organism anatomy ontologies to describe anatomical features, life cycle stages and developmental processes in the regenerative flatworm Schmidtea mediterranea. The latest version of the PLANA Ontology is available through the Open Biological and Biomedical Ontology Foundry (OBO) . PLANA Ontology terms are searchable at the EMBL-EBI Ontology Lookup Service (OLS) and the PLANA Ontology Terms Page.

Below, the Overview Section is populated with infomration from the OLS.

Additional experimental information related to PLANA Ontology terms can be found in the Additional Term Information Section.



    ▻ Planarian Anatomy Ontology Term Overview

    ▻ Additional Term Information

      ▻ Description

      ▻ Figures

      ▻ In Situ Hybridization Data

      ▻ Sequences

      ▻ References




    Planarian Anatomy Ontology Term Overview


    NAME:

      visual system


    DEFINITON:

      The sensory system subserving the sense of vision.


    TERM CITATIONS:

      

    TERM ID:

      PLANA:0000124


    ABOUT THIS TERM:

      visual system "is a" anatomical system

      visual system "existence overlaps" juvenile, asexual adult and sexually mature adult


      trail cell, eye and optic chiasma "is a" visual system


    BROWSE ONTOLOGY TREE (IN OLS):

    Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.


    Planarian Anatomy Ontology


    EXPLORE ONTOLOGY GRAPH:


    Dynamically explore this term by selecting additional relationships to display ( checkboxes on the right ) and by expanding nodes by double clicking on a node. Single click on a node to display the definition below.

     

    back to top


    Additional Term Information


    All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


    DESCRIPTION:   

    Genes required for production of all eye progenitors (eya, six-1/2), photoreceptor neuron differentiation (otxA), or pigment cup differentiation (sp6-9, dlx) were enriched during S5-S6 (Figure 1 – figure supplement 19 A, Figure 1 – source data 5, Figure 1 – source data 6)(Lapan and Reddien, 2011, 2012). The transcription factor ovo, a master regulator of eye development in planarians, showed statistically significant upregulation during S6, albeit with adjusted p-values and fold-changes that precluded its inclusion on the S6 enriched transcript list (Lapan and Reddien, 2012). ovo expression was first detected by WISH during S5-S6, in only a few cells per embryo (Figure 1 – figure supplement 19 B). During S7, two dorsolateral trails of ovo+ progenitors appeared along the anterior head margin, and these cells and their differentiating descendants likely generate the eye primordia (Figure 1 – figure supplement 19 B, blue arrowheads). The photoreceptor neurons, marked by opsin (Figure 1 – figure supplement 19 D), and the non-neuronal pigment cups, marked by tyrosinase (Figure 1 – figure supplement 19 E), were first visible during S7, consistent with published expression patterns for Spol-opsin and Spol-tph in elongated embryos (Martín-Durán et al., 2012). Growth of the eyes continued through S8. Moreover, co-expression of ovo and transcription factors required during eye differentiation, including eya, klf, six-1/2, soxB, sp6-9, otxA, meis and FoxQ2, was reported in elongated embryos (S7-S8) (Lapan and Reddien, 2012), suggesting that eye development during embryogenesis and adulthood may rely upon common genes and genetic regulatory networks. 


     

    back to top


    FIGURES:


    Figure 1 – figure supplement 19: Molecular markers for the developing eyes

    A, C: Average RPKM per embryo for transcripts required for eye progenitor specification (ovo, six-1/2, eya (purple)), for photoreceptor neuron differentiation (otxA,(red)), or pigment cup differentiation (sp6-9, dlx (blue)) (A), or with enriched expression in adult eye tissue (Lapan and Reddien, 2012) (C). Yolk (Y), S2-S8. Transcripts shown were enriched during S5, S6, S7 and/or S8, and are flagged in excel tables for S5-S8 enriched transcripts (Figure 1 – source data 5, Figure 1 – source data 6, Figure 1 – source data 7, Figure 1 – source data 8). 

    B, D-E: WISH developmental time course with riboprobes complementary to ovo (B), opsin (D), and tyrosinase (E), S5-S8.  Anterior: top (S6-S8). D: dorsal. Purple Arrowheads: developing eye tissue. Blue arrowheads: trail cells (eye progenitors). Scale bars: 100 µm.

     

     

    back to top


    IN SITU HYBRIDIZATION DATA:


    Smed IDAccessionNameAliasEnriched during stage(s)Tissue/PatternImages
    SMED30030594OpsinopsinStage 7, Stage 8photoreceptor neuron, visual system, eye
    SMED30018592AFP48372.1ovoovoStage 6, Stage 7, Stage 8trail cell, photoreceptor neuron, optic cup, pigment cup cell, visual system, eye
    SMED30006796AFC87780.1tyrosinasetyrosinaseStage 7, Stage 8optic cup, pigment cup cell, visual system, eye
    Click to see image symbols and abbreviations
    Abbreviation or symbolDefinition
    Ooral hemisphere
    Aaboral hemisphere
    Ddorsal
    Vventral
    Llateral
    black arrowheadembryonic pharynx
    red arrowheaddefinitive pharynx
    black arrowsprimitive gut
    yellow arrowsprimitive ectoderm cells
    cyan arrowsbrain
    cyan arrowheadsnerve cords
    blue arrowheadseye progenitors (trail cells)
    purple arrowheadseyes
    scale bar100 µm

     

    back to top


    SEQUENCES:

    smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

    >SMED30006796 ID=SMED30006796|Name=tyrosinase|organism=Schmidtea mediterranea sexual|type=transcript|length=1755bp
    TGTCAGTTTAGTCATGCTCGTAATCACAATAGGCATAGTCTTTGCATCTTTCTTACCTTTGAGTGACTGCCTAATCCCAA
    GGATTTGCAGTAGGAATGTCACTCTTTCTAATTCAACATGTTGTCCAATTTATAATGATTTTGTTTGCGGTGGTCCTTTT
    CGTGGATCTTGTGAAGTCTCCATTCTTTTTCAAAATCACACTGAGCACTCGGATGTTATCACCGGAAAATTGGAAAATGA
    CGACAGACTCAACTGGCCATCAAGATTTTTTAAATTTCTTTGCAGTTGCAAGTCAAACTATGATGGAATAGCCTGTGACA
    AGTGTAAATCAGGGTGGCAAGGGGAAAACTGTGAGGTGGTCTCCCCGAGAAAGATTAGACAAAATATTCTTAACATGAGA
    TCATACGATGTTTTTATTTTTTTATCGATACTGAACATCAGCAAATATCAGTTGGCCGATTTCCTGATCACAAATTCGTC
    CTCAAACCTTCACTGTGACCCTGTCAATGAAGACAACATTCAATTGGTCAATGCTTCCATTTATGATACAATGGTTTACT
    TACATTTCTATGCGTCCAGGAGTACAATGTCTAAAGAACTTATGGAATCCTGCACAGACAAGGATAACAAATTAGACTTC
    GCTCATAAAGGTCCAGCTTTTTTTACATGGCACCGACATTATTTACTGATGTTTGAAGACTTATTAAGGAGTATTGCAGT
    CGAACAATTTGGATATTATAATTTCACATTACCATATTGGGACTGGACGAATCAAATAACTTGTAATATATGTACAAATG
    ACTTACTTGGCGATATTCCCACTGAAGATCAAGAATCTAACAGCACATTTTTTAAATGGAAACCGATTTGCCCTCAGAAA
    CCTAACGATTTTGATTGTCATATTTGCGATCCAAGCCAGGAAGAACCTTTTTTATGGAGAAAATACTCATCAACGGTAGA
    CAGACTTCCTAATCAGAACGAAATTGATGAGTTATTCTCAATCAACCAATATGATTCGGAGCCCTTCAATTCCAGCTCAT
    TTAGTAGGAAAAGCTTTCGGAATTTTGCAGAGGGATATTATCGAGTTCATCCAAACTCAGATGATATGAAAATGAAAGAC
    ATTGGGAAGGGACTCCCCCATCAAAATATCATGATGCATAATATGTTTTATCAATGGAACTTGGATGGATTTCACAACGA
    GTCCCAATGATCCATTATTTCTACTACATCATACGTTTATGGACAAAATCTTTGAAATTTGGCTATTAAGAAATAGACGA
    TCTACATACCCTGGGAAATCTTCAACACCAATCGGGCAGCATGCTGACGATTTTATTGTGCCTTTCCTTCCACTAATCAG
    AAACAGGAATTTGTTTACTTCAGCAAATGAATTTGGCTACGCCTACGATAACAATATTGTTGGAAATAAATTGTTCACAA
    ATCATCAACTAGATTTCGAAAAGAGCTCATCGGAAATTTACTACATCCTAACGGCAGTTGCCTTTGTAGTACTAGTTGCG
    ATCGTCGTCGGATTGTACTGCTTCAGACCCAGTCAAATCAGTCACACGGCTTATGAATTCATTGAAGACCAGGAGCAGGA
    GGAAAAGACAAATTACTTTAACAACAATGAAAAAATGCCTCTACTGAAATGACAAGCCATTTCTGATGACTATTATAATA
    TTGTCACCTTAAATTTTCTTTGAAACAACTTTATTATTGACAAATTTTGAAGAATCCTTTTAAGCAAAATAAAGT
    >SMED30030594 ID=SMED30030594|Name=Opsin|organism=Schmidtea mediterranea sexual|type=transcript|length=1880bp
    AATAAAATGAAATTTATAATGCCATTGGTATTTACACTGTGGTTAATAACGATAATAATCAGAATTTTTAATGATAAATA
    TAGTAAACGATAACTAGTAACGGTAACCCTAATAATGAATGCTATATTACATATAGTAGTGTTACCAAAATTTTGGAATT
    TAAAATAATAAGTTTATTATGAGTGACCATGATAATAAAAAAGATTTTTAAATAAAATGATAATATTACTATATAGTCGG
    TTATAGTTCCGATTAGTCTACTATCGTAGACGTAATAAAAAGAGTTTAGTAACCTAATTTTCAATGTTTTTTGAAAGTTG
    CTCGTCTCTATGGCAACTTATTATCGTAAGGAAAATTTTCTACTTCACTATGATATTTTCGGAGTGAATTTATTGATTTA
    CATTCAAGGACTTTCACTATTGCATTTACTGAAGCGATCGTTTCATTTGGAACTCATATTTTCGCCCCTAATCGTTCTGG
    AATTTATTATTTATGATCCTTTATCTGACCTTAAAAATTTTCATATTCATGAGTGTCCAATCTTTTGCCAATTTGGGAAA
    TAAGCTCCTAGAAAATGCTACCTTCAATAATGAATCCCTTACAAAGTCAGTATGGCATTGGGATCCTGAATTTGAATCAA
    TTGTCCATCCGTACTGGCGGACTTTTGATATGGTGCCAGAAGTTTATCATTATTTAGTTGGAGTGTATATTTCTATTGTT
    GGAATATCGGGAGTTCTGGGAAATCTTCTTGTTCTTTACATATTTGCAAGCGCCAAAAGTTTAAGAACTCCTCCAAATAT
    GTTTATAATGAGTTTAGCAATTGGAGATTTGACATTTTCTGCTGTGAATGGCTTCCCCTTACTTACTATTTCAAGTTTTA
    ACACTCGATGGGCTTGGGGAAAATTAACGTGTGAGATTTATGGTTTCATCGGTGGTCTTTTTGGGTTTATATCCATCAAC
    ACAATGGCACTAATTTCTCTGGATAGGTATTTTGTTATTGCCCAACCATTTCAAACAATGAAATCCCTGACAATCAAAAG
    AGCAATAATCATGTTGGTTTTCGTATGGCTTTATTCATTAATTTGGTCAACACCGCCATTTTTTGGATATGGAAATTATG
    TGCCGGAAGGATTTCAAACGTCTTGTACATTCGACTATTTGACCCAATCAAAAGGTAACATAATATTCAATATTGGGATG
    TACATAGGAAATTTCATAATTCCCGTTGGAATAATTATATTTTGCTATTATCAAATTGTCAAAGCAGTGCGAGTACATGA
    ATTAGAAATGTTAAAAATGGCTCAAAAGATGAATGCATCTCATCCAACTTCCATGAAAACGGGTGCAAAAAAGGCTGATG
    TTCAAGCTGCAAAGATTTCTGTCATAATTGTCTTTTTATATATGTTATCATGGACACCATATGCAATAATTGCCCTTATG
    GCTCTCACAGGGCGTAGAGATCATCTGAATCCATACACTGCAGAATTGCCGGTACTCTTTGCTAAGACCTCAGCTATGTA
    CAACCCATTTATATACGCAATAAATCATCCAAAATTTCGAATTCAGCTGGAAAAGAAATTTCCATGTTTGATTTGTTGCT
    GTCCACCAAAACCAAAAGAAAGGGACACTACAAGTGCAGCATCAGCAACGAAACCGAGTAAATATCAGAGTGAAAGAGAA
    AGTTCAATGTCTCAACTGGATCCTGAAGACGATAAACAAGTCGTAGAAACCACCAAGAATCAAACCACAAGTGGACATAC
    AAATGAAGCTTACGAGAGTGAACAGAAGTAGTTGATGAAACTAAATTATTCTATTTTTAATGACACTAGATCTTTATAAT
    AATTTTATTTAAGGGAATGAGCACTGAATTTTGCGCAAAT
    >SMED30018592 ID=SMED30018592|Name=ovo|organism=Schmidtea mediterranea sexual|type=transcript|length=1211bp
    GTCATATTGAACACTGAGACTAGCTATCAATAGCTGACAATTAGACGTATAAAATGTTAGGGTACGCCTTTTTGGCCATT
    ATTTCACACCAAAATTTCCATGAGTATTTTTCTAATAAGCACTCTACTCGCAAACGATGACGAAATGCCCACAGATTTGT
    CATCGAAAACTGAAAAGATTGAAAACCATGAAAAATCTGAAAGGAATCTCTGCAAGTATTCCAGTCAGTTTCTTTCCTGT
    TTTTATTCACAGGAAATGTTGACACTACTTATGAGAAAAAATTTCATCAATCAATATTCATTTTATTTAAAGATTTTCTC
    GGGGTTTCCACAATTCGTCGATAACTTCAACTTAGTAAATCCAACAGATTTCACCGTCAATTCAAATTCAACAACAATTT
    TGCCCTCATTCAACTTCCATAAAACGTCATTGAATATCGAAATGAACACCTCACTGGCCAATTCTTCAAGCACTGGTAGG
    TCGTCTCCAACTGAAACTGTGTCTGAAAATCTTTGGTTAGAAAAAGTAAAGGTGGAAAAATATTTCCATTTAATTGAAAA
    TCTATCACAATCCCAAGAGAACATTGAAGACATTGTCAAAACGATCAAAGTCAAACGAAGAAATTTTGCTGAATATATTA
    AGAAACTTTACCTAAGTGATCCAGCCAAATTTAAGTTGACAAATGGTGGAGATGGAATAGTAAATCCATTTAGAAAACAA
    TTCAAAGAAGAACGAGATAAATCTATGGACAAATTTTGCATCGAAGTTAATCACAATTATCAATGTAAGATATGTAACAA
    GGTGTTTCCTTCCAAAAAGCACATGCAACGTCATATACGTTCACACGGTGTAAATTTTGATTGGTTGTGTAAATATTGTT
    TTAAACCGTTTATTGATTCCTACGATTTAAAACGACATACGAGAGTCCATACAGGAGTTCAACCATACAAATGTCAAAGT
    TGCACAAGAAAATTCAGTCAACGATGCTCATTGGAAAGTCATCAGGTGAAAATCCATGGAGTAGCACTGAATTATCTATA
    CAAAGAAAGAAGGAACAAGTTGTATCCGTGTGAAATCTGCAGTTATAGTACGTCTTGTAAAGCAACTTGGTTGAGTCACA
    TCATTCAGGAGCACCCGAATTCACTTTATGCAAAAGAAGAAGCACTCAAAGGAAAATACAACTGACTTTGAAAAATATTG
    ATTTTTCAAGC

     

    back to top


    ADDITIONAL REFERENCES:


    Lapan, S.W., and Reddien, P.W. (2011). dlx and sp6-9 Control optic cup regeneration in a prototypic eye. PLoS Genet 7, e1002226.

    Lapan, S.W., and Reddien, P.W. (2012). Transcriptome analysis of the planarian eye identifies ovo as a specific regulator of eye regeneration. Cell Rep 2, 294-307.

    Martín-Durán, J.M., Monjo, F., and Romero, R. (2012). Morphological and molecular development of the eyes during embryogenesis of the freshwater planarian Schmidtea polychroa. Dev Genes Evol 222, 45-54.

     

    back to top