pharynx progenitor cell

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ In Situ Hybridization Data

  ▻ Sequences

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  pharynx progenitor cell


DEFINITON:

  foxA1+ neoblasts and their post-mitotic, differentiating daughters required for maintenance and regeneration of the pharynx.


TERM DEFINITION CITATIONS:

  PMID:24737865, PMID:25254346


TERM ID:

  PLANA:0000110


ABOUT THIS TERM:

pharynx progenitor cell

  ↳is a anatomical entity and progenitor cell

  ↳develops into pharynx


BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30027428AFJ24799.1forkhead box A-1foxA1Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, digestive system, pharynx, pharynx progenitor cell, embryonic pharynx
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30027428 ID=SMED30027428|Name=forkhead box A-1|organism=Schmidtea mediterranea sexual|type=transcript|length=2149bp
ATCACTTGGTGCTGCTTTTTGCCCCGATAAATCTCTCGGTGCTCCAAAATTTGTGTAAGCGAGCAAAAGATGATTGGGCA
ATTTCTAGCACGTCATTCGGCAACGATGTTTACAAGTTTCTCTGATTGGATGATAAAGTAGAAACTTTCCGAAAATGAAA
CTTCTCCGAACATGCGCATACCGACTGAAAATTAACTCTAAGCCAGCCAATGGAATTGAAGCAAAATTCAAGAGAATATT
AATTGACTTCGCGAATGAACTCAAATTTTCTATTGGCGTATTGTGTGTGCCTCATTGTGAGTGGTTGCGATCGCATCTCA
AATTATTTACACACAAAAAAATAACGCACACAGACATTGAATAGATATATTTGATCAAGTCAATATCACAATGTCAATAT
TAGCTTTTTCTGAAGAAAGAAGACGAACTAGAAGAAAAACAACAACGAAATAGATTCGATAAGGCTACTGAGCGATTTTC
ATAATCTAAATATTATTTTATTATTGATACGGACAAAAATTGGTCTTTTACCAAGTACTACTAGATTGTTGATAAAGAGA
GGTTATTTAGATGCTTGGAAAAAATCCTTATGAAACTGCAATGAGCAACGTGTATTCTCTACCTCCGGGAGGTTCTATTT
ACAATATGAACCCGATGAGTATATCATCAGCTGGCTACAACTCTCAACAAGTATCAACACTATCGTTGAACTTGACCGGA
ATCGGACCTCATTCATTAAGCCCAATGAGTGCAAGCATGTCGGGTATAGCTGCAATGGCCGGTGGAATGAGACAAGGTCT
TGAGTTGGGTCTTGGTAGAAGTGATAGTCCAAGAGATAAAAATTCAATTTCCAATAACAACCGACCATATCAAAGAAGTT
ACACTCATGCCAAGCCTCCATACAGTTATATAAGTTTGATAACAATGGCGATTCAAAATTCTCCAGTAAACATGTGCACT
CTATCGGAGATCTATCAATTCATTATGGATCATTTTCCATACTATCGTCAAAATCAACAGCGATGGCAGAATTCGATTCG
ACATTCTTTGTCCTTCAACGATTGCTTTGTTAAGGTTAGTAGAAGCCCAGAAAAACCAGGTAAAGGCTCATATTGGACCT
TGCATCCTCAATCAGGTAACATGTTTGAAAACGGTTGTTATCTCAGAAGACAAAAGCGATTCAAAGATCCACACAGAGAA
ATCGGCAGACAGAGTCAAAGAGCTGCCACTGGTCCTGGATCAAATGTCACAGAAAACAATCACGACAACGCATCGCAAGA
AGCTAGTGATAACGCAGAAAGTGATACGAAACCCAACATCAAGCAACTTGATTTATCAAGCGATCTCTTAACTAATCAAG
GTCATAATATTAAAAATACTAATCCAACTTCTGTTAGTCAGAGTTGTTCGATGTTTCATCGGAAAAAGGAAAACTGCTCA
CCAGTAGAAATGAAATTGAATAACCAAAACCAACAATCAAACCAGCAAGAACATCCACAAATCCATTACAATCCCAATCA
GCAATTCTACTCAAATCAGCAAAACATTTTCCAACAAAGTTCTCTTGATCATTACAGTCTATTAGCATCCGATGATCCTC
TTGGTCAAGGTATGCACTTGCCACCAGGTGCAAATAGTGTTTTCGGACTTTACGGGGCACATAACTTACCAAACGATGAT
CAAATTTCAGTGTCATTACCATCGATATCCTTATCCGGACATCCGTATGACAATTTATCAACAGCAATGGCATATCAATA
TGAAGCATCTCAACACAATTCTTCATTACTAACGACAAGTAATCCGTTCTCAATAGATCGTTTGATGCATCCAAGACTAG
TCGCTGCAGCGATGGGGGTCAGTCCCCATGATACTCTATACGCAGGAGCTACCGGCCCATCAGTTGATCTAGAACACATG
AAATACTACTCAAACTACAACAATGTGCCTCCTTATTCCTCTGCAATGTCTGACTACTACAAATATGTACAAAATCCTCA
GCCGGGCAACAGCGACATGAGTCTTTGAATTGAGTCCATTGAAGTCTACGGCAGTTTCCTCGAAATTTCACATTCAACCA
GATGTTTATCGCCTAATATAAAGCTGTGTTTTTTTATTTATTTACAATTAAATCTTTGTACAAGAGATC

 

back to top



PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in pharynx progenitor cell. Click this link to learn more about PAGE.


PAGE Curations: 66


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
pharynx progenitor cellSMED30014748Ptk7SMESG000072430.1 SMED30014748smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30019774SMED30019774 SMED30019774smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30000763SMED30000763SMESG000011804.1 SMED30000763smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30007255Ras responsive element binding protein 1SMESG000059614.1 SMED30007255smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30000524SMED30000524SMESG000004865.1 SMED30000524smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30019234SMED30019234 SMED30019234smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30011180Kinesin-like protein KIF26ASMESG000051203.1 SMED30011180smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30010542G_PROTEIN_RECEP_F1_2 domain-containing protein SMED30010542smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30007744SMED-SMAD6/7-1SMESG000002697.1 SMED30007744smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30016078Actin, cytoplasmicSMESG000012332.1 SMESG000012317.1 SMED30016078smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30020508SMED30020508SMESG000021243.1 SMED30020508smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30021987SMED30021987SMESG000059819.1 SMED30021987smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30027428forkhead box A-1SMESG000065670.1 SMED30027428smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30021268SMED30021268SMESG000072897.1 SMED30021268smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30027929Tubulin beta chain SMED30027929smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30027672Plac8 onzin related protein 1SMESG000050229.1 SMED30027672smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30035336LLGL scribble cell polarity complex component 2SMESG000018172.1 SMED30035336smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30034737Protocadherin-1SMESG000005378.1 SMED30034737smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30025623SMED30025623SMESG000065670.1 SMED30027428smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30023924SMED30023924SMESG000030689.1 dd_561dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
pharynx progenitor cellSMED30032293SMED30032293SMESG000033462.1 dd_554dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
pharynx progenitor cellSMED30004654Triosephosphate isomeraseSMESG000027305.1 dd_Smed_v6_1402_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30010488SMED30010488SMESG000003538.1 dd_Smed_v6_70_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30013445TetraspaninSMESG000063435.1 dd_Smed_v6_389_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30016078Actin, cytoplasmicSMESG000012332.1 SMESG000012317.1 dd_Smed_v6_285_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30016078Actin, cytoplasmicSMESG000012332.1 SMESG000012317.1 SMESG000058958.1 SMESG000058954.1 dd_Smed_v6_246_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30013107Glyceraldehyde-3-phosphate dehydrogenaseSMESG000052353.1 dd_Smed_v6_78_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30009284Hsp70SMESG000056256.1 dd_Smed_v6_424_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30009737Testis-specific Y-encoded-like protein 1SMESG000026284.1 dd_Smed_v6_326_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30008718SMED30008718SMESG000012332.1 SMESG000012317.1 SMESG000058958.1 SMESG000058954.1 dd_Smed_v6_246_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED3001096960S ribosomal protein L6SMESG000019835.1 dd_Smed_v6_839_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED3001198260S ribosomal protein L17SMESG000009564.1 dd_Smed_v6_95_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30014980LaminSMESG000009886.1 dd_Smed_v6_850_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED3001160940S ribosomal protein S3SMESG000016955.1 dd_Smed_v6_269_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30021635Succinate dehydrogenase [ubiquinone] flavoprotein subunit, mitochondrialSMESG000008280.1 dd_Smed_v6_897_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30030038ATP-dependent RNA helicaseSMESG000011907.1 dd_Smed_v6_596_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30033402Nascent polypeptide-associated complex subunit betaSMESG000026176.1 dd_Smed_v6_358_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30023889SMED30023889SMESG000055805.1 dd_Smed_v6_857_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30032703SKIP_SNW domain-containing proteinSMESG000061372.1 dd_Smed_v6_2325_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED3003108940S ribosomal protein S12SMESG000052688.1 dd_Smed_v6_268_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30020269MyophilinSMESG000081505.1 SMESG000049198.1 SMESG000047694.1 SMESG000035451.1 SMESG000035348.1 dd_Smed_v6_395_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30023924SMED30023924SMESG000030689.1 dd_Smed_v6_561_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30032293SMED30032293SMESG000033462.1 dd_Smed_v6_554_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30026811DUF3421 domain-containing proteinSMESG000074377.1 dd_Smed_v6_766_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30032793SMED30032793SMESG000016943.1 dd_Smed_v6_3572_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30016186SMED30016186SMESG000033673.1 dd_Smed_v6_1071_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30018984prefoldin subunit 2SMESG000075156.1 SMESG000075150.1 dd_Smed_v6_1368_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED3000905260S ribosomal protein L18SMESG000017166.1 dd_Smed_v6_128_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30019288Reticulocalbin 3SMESG000012033.1 dd_Smed_v6_1417_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30018901SMED30018901SMESG000033673.1 dd_Smed_v6_1071_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30002774SMED30002774SMESG000017229.1 dd_Smed_v6_613_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30005014ATP synthase subunit alphaSMESG000004897.1 dd_Smed_v6_731_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30006541SMED30006541SMESG000012332.1 SMESG000012317.1 SMESG000058958.1 SMESG000058954.1 dd_Smed_v6_246_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30004214SMED30004214SMESG000055805.1 dd_Smed_v6_857_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED3000270360S ribosomal protein L23aSMESG000074545.1 dd_Smed_v6_281_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30008553Phosphoenolpyruvate carboxykinase [GTP]SMESG000062868.1 dd_Smed_v6_196_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30031646SMED30031646SMESG000010156.1 dd_Smed_v6_105_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30021590Spectrin beta chainSMESG000081696.1 dd_Smed_v6_1122_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30029471Collagen alpha-1(XXVIII) chainSMESG000033673.1 dd_Smed_v6_1071_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30022614T-complex protein 1 subunit alphaSMESG000067696.1 dd_Smed_v6_1025_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30031468Propionyl-CoA carboxylase alpha chain, mitochondrialSMESG000034830.1 dd_Smed_v6_1247_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30025467Heat shock protein 75 kDa, mitochondrialSMESG000016949.1 dd_Smed_v6_1445_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30029781SMED30029781 dd_Smed_v6_1213_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30022344FERM domain containing-1SMESG000070273.1 dd_Smed_v6_1131_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30031362SMED30031362SMESG000033673.1 dd_Smed_v6_1071_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynx progenitor cellSMED30030477peptidyl prolyl cis trans isomerase FKBP-1SMESG000026331.1 dd_Smed_v6_1921_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Note: Hover over icons to view figure legend

 

 

back to top