muscle cell

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ In Situ Hybridization Data

  ▻ Sequences

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  muscle cell


DEFINITON:

  A mature contractile cell, commonly known as a myocyte. This cell has as part of its cytoplasm myofibrils organized in various patterns.


TERM DEFINITION CITATIONS:

  CL:0000187


TERM CITATIONS:


TERM ID:

  PLANA:0000101


ABOUT THIS TERM:

muscle cell

  ↳is a electrically responsive cell




DEPICTED BY:


BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30025388Myosin heavy chainDj-mhcStage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, musculature system, muscle cell, embryonic pharynx
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 ┬Ám

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30022992 ID=SMED30022992|Name=Myosin heavy chain|organism=Schmidtea mediterranea sexual|type=transcript|length=6157bp
ATATATATGCATCTCAAAATTGGAAATTAAATTATTAATTTTAATTTACTAACAAATTTTTGTTGTAAAATGGAAAATAT
TGATGCTAAAGACTTGCAATATTTACAAGTTGATAAAAGTTTAGTTTCTGACTCTGCTAATTTGTCTGATTGGGCTAACA
AAAAATTGGTTTGGATACCTGACGACAATGAAGGATTTATTTCAGGATCACTTATAGAAGAAAAAGGCGATGAAGCTACT
GTCAAACTGGAAAATGGCAAAACAATGAAATTACCAATTGAAAATGTTCAAAAAGTGAATCCACCAAAATTTTTTAAATC
TGAAGATATGGCAGATTTAACTTATTTGAATGAAGCATCAGTTCTATATAATTTAAAAGACAGATATTTTTCAGACTTAA
TATATACATATTCCGGATTATTTTGTGTCGTTGTAAATCCATACAAGCGCTTGCCTATTTATACAAATAATGTAATTGAG
TGGTACAAAGGTCGAAAACGTCACGAAAGACCGCCACATATTTACGCAGTTACTGATGTCGCATATCGAAATATGCTCCA
AGATAAAGAAAATCAATCAATTCTTTGCACTGGTGAATCCGGAGCAGGAAAAACTGAAAATACGAAAAAAGTTATTCAAT
ATTTGGCCTCAGTTGCAACTTCTTTGAAAAATCAAAAAACCACAGCCAGTAATGCATTGTCACAATTTTATGCTCACGAT
GTTAACATTGGAGAATTGGAGACCCAATTACTTCAGGCCAATCCGGTTTTAGAAGCTTTTGGAAATGCAAAGACTATCAA
AAACGATAATTCATCTCGTTTTGGTAAATTTATTCGAATCAATTTTGACACTTCTGGATTCATTTCCAGTGCAAACATAG
AAACATATTTATTGGAAAAAGCTAGAGTTATTAGACAGGCAGCTAATGAACGGTGCTTTCACGTGTTTTATCAGCTTCTT
CTTGGTGCAGACGACCGATTGAAAAAGGAATTAATCTTAGAAAATGTTTCTACATACAAACTTTTATCCAACGGCATGAT
AGCTGTACCAGATTACGATGAAAAGCAAATGTTTAAAGATACAGTCGAAGCTCTCGATATAATGGGGATTTCGAAAGACG
AACAAGAATCTATTTTCCGAGTTATAGCCGCAGTTTTACACATGGGAAATATCGAATTCAAACAAGAAAGAAGTTCGGAT
CAGGCTGCTTTACCAGACAATACAGTTGCTCAAAAGGTTGCTCATCTTCTCGGTTTACCGGTCACAGAAATGACCAAAGC
ACTGCTGAAACCAAAATTGAAAATTGGAAGAGAAGTTGTAGCAAAAGCTCAAACTAAAGAACAAGCCGAATTTTCCGTTG
AAGCTATAAGCAAATCAACATATGAAAGAATGTTTCGATGGCTGGTAATGAGAATAAATAGATCAATTGACAGAAATAGA
CAAAAAACTAATTTCATTGGCATTCTTGATATTGCTGGCTTTGAAATATTTGAAATAAACTCTTTTGAACAATTGTGTAT
AAACTATACCAACGAGAAATTGCAACAGCTTTTCAATCATACAATGTTTGTGCTAGAACAAGAAGAATACAGAAAAGAAA
ATATCAAATGGGAATTCATTGACTTTGGTCTTGATTTGCAGCCAACTATCGAACTAATTGAAAAGCCAATGGGTATTCTT
TCTTTGTTAGATGAAGAGTGCTTTTTCCCAAAAGCTACCACAAAGACATTTGTTGAAAAATTAATTAAAAACCAATCGAC
GCACCCTAAATTGAAAGCTACTGATTTTAGAGCAAAAGCAGATTTTGGGGTTATTCATTACGCGGGAAAAGTTGATTATG
TCTCCGATAATTGGCTGGTGAAAAATATGGATCCTCTTAATGAGAACGTTGTTAGTCTCTTACAAGAATCAAATGAAAGT
TTTGTCCAGACAATTTGGAAAGATGCAGAAAACATTATTGGCTTATCAACTACTACCGCCCAAGAATCTGCCTTTGGAGG
TGCAAAAACTACTCGCAAAGGAATGTTTAGAACCGTCGGTCAGCTTTACAAAGAATCATTAACGAAATTGATGGATGTTC
TGAATAATACCAATCCCAATTTTGTGAGATGTATCATTCCCAATCATGAAAAAAAATCTGGTAAAATCGATTCAAAATTG
GTTATTGATCAATTAAAATGTAATGGTGTGCTGGAGGGTATCAGAATATGCCGACAAGGATTTCCAAACCGAATTTTATT
CCAAGAGTTCAAACAACGTTATGGAATTCTTACACCAAATGTCATACTAAAAGGTTTTATGGACGGTCGAAAAGCAACAG
AATTAATGCTTGGAGAGTTGGATATTGATGCATCAAATTACAGAATTGGTCAGAGTAAAATATTTTTCAAAGCTGGAGTT
TTGGCTAGATTAGAGGAAGATCGAGATATTAAGTTGACTGAAATCATAGTCAAATTTCAATCTTATGCACGTGGATATTT
GGCAAGAAAAAATTTACAAAATCGATCGCAAAATCTCAATGCAATTAAAATTATTCAAAGAAATTGTAATGCATACTTAA
AATTGAGAAATTGGGCCTGGTGGAAATTATTCACACGTGTTAAGCCTCTATTAAGTGTTACAAGGCAAGAGGAAGTTGTG
GCTTTGAAGGAAGAAGAATTGAAAAAATCAAAAGAAACTCTCGAAAAGATGACTGCTGATTTCGAAACAACTAAGAAAAA
TTATGAATTTCTCATGGAAGAAAAAAATAAAATTCAGGAAGATTTGGAAAAGGAGCGTTTTGCATTGCAAGATATGGAAG
GGGAAAGAGAAAATTTGATCAAGCGATTAAAAGATATTGAATCAGATGCTCAAGAATGCGAGTCAAGAGAGATGGAAACA
AAAGACAAATGCAATAAATTGGAAATCGAGAAAAATAAATTACAAAATGAAATTTCACAGCTTAGCCAAAATTTAGAATC
AGAGGAACAGAACTTGCAAAAAGCTCAAGCAGACAAATTAAGTGCTGATAAACGAATTAAGGAACTGGAACAAAAAGTGG
CCGAATTAGAAGATAAACTTAACAAGTTAACTAAAGAGAAAAAGTCTCTAGAAGAGCGATTGGCTGATGTTATGTCTACT
TTGGCGGAAGAAGAAGAAAAGAGTAAACAATTAACGAAACTCAAATCCCGTCACGAAACAAGTATCACTGAATTAGAAGA
GAGATTGAGCAGAGAACAAGCAGCTCGACAAGATTTAGAAAAAACAAAGAGACGACTAGAAACTGAATTGTCTGAAAAAT
CTGATAATTTATCATCTCAAAGCCATACATATGAAGAAATTAGAATTACTCTTGAACGAGCAGAAACACAAATAATTCAA
ATGCAAGCTAAATTAGATGAAGAAACAACGGCAAAATCGTTGGCTCAGAGACAAATTCGAGACGCAGAAAACGTAATCAC
CGAAATCAAAGAAGATCTTGAAGCTGAAAAACGTTCAAAAGAGAGAGCTGAAAAAGCTAAGAGAGATTTAGCCGAAGAAA
TAGAATCTCTTAAAATGGAATTACTCGATACGGGAAATACATCAGAAGAACAGCAAAGCGTATTGCGCAAAAAAGAAGTT
GAATTACAAAATTTTAAAAAATCTTTTGAAGATGAAACAAAACGAACTGAACTTGAAATGCAAGAAATTCGTAAAAAAGC
CGCAGTAACGATTGAAAACCTCAACAATCAAATAGAAGCTGCTAACAAATCAAAACTTGTTGTTGAAAAGGCTAAATTAC
AGTTGCAAGAAGAACTTAATGATGCAAATAACGAATTAGCAAATTTAAGATCCTCCAAAGCTGACTCTGAAAAACTTAAG
AAGAACACAGAACTACAACTTTCAGAAATATCTCATCGCCTTTCAGAATCTGAAGAACACAAGCTAGATGCTGAATCAAA
ACTTAAAAAACAAACCGAGTTGGCTGACAAATTGGCTATGAATCTCGAAGAAATTGAAAGCAAATTGTCGCAATTAACTA
AATCTGAATTATCAGTTCGAAGTCAGTTAGCAGATTTACAAAAGGACTTTGAAGAAGAAACTCGATTAAAATTGAATGCT
CAAACTACATTAAGGCAGTTAGAAAGTCAATTTGCTTTATTAAAAGATCAATTAGAAGAGGAGCAACAATCAAAAGAAAA
TTTAGAAAGTCACGTACAAGCTCTACAGAGTCAAATGCAAGATGTCAAAAAGAAAGTTGAAGAAGATGCTCAACAGCTAT
TAGAATTTGATGAATCTCGTAAAAAAGTAATGCGTGAACGAGAAGAATTGCAGATTAGACTTGAAGAAGCAATCAATCAG
ACTGAAAGATCAGAAAAAGCTAAGCGAACAATTCAAGCCGAGCTTCAAGATGCATATCATGCCCTAGAAAGTCAGAAAAA
TGACCAAACTCAAAGTGATCGAAAACTTAAAAAAATGGAATCACAAGTCAATGAAACATTGAACTTGAATAAAAAATATT
TAGCTGAAAAGGATACATTAGAAAAAGAAAATCGTGAAAAAGAAACAAAAATCATGCAATTACAGAGAGAAATGAATGCA
AATGACGATAAACTTTCGGAATTGGAAAATGCAAAATCCTTACTGACTCGGCAATTGAATGAATTGGTTTCGAGCAAAGA
TGATGTTGGTAAAAATGTTGGCAGTTTAGAAAAGGCTAAAATTCAATTAGAAACCGATTTAGAGAATTGTAAAGTTACTA
TTGAAGAATTAGAAGAAGAAAATGCAACTCTTCAAATGAATAAAGAACGAGTTGAAATGCAATTAACTGCTACTAAAGCC
CAACTGGATAGGGAGCTAGCTTCCAAAGATGAAATGCACGATGAACAGTTCAGAATTATAAACAAAAAGCTTCGTGATGC
AGAAGCGGCACTTGAAGAAGAGCAGAAATCCAAAACAGCTATGGTTTCATTGAAAAAGAAAATAGAAAATGAGAACATGG
ATTTATTAAATCAATTAACAGAATCTGAGAAGGTCAAAGAAGAGCTGGCCAGACAGATTAAAAAATACCAAGGAAATTCT
AGCAATCTTCAAAGAGAAATGCAAGAACTTGTTGCTGCTAAAAATGATTATTTGAAGCAGATTAAAGAACTAGAAAAGCG
CTTACGTACTTCTGAAAGCAATGTAAACCAATTATCCGAAGACCTTTCGCAGTCTGAACGTGCTAAGAGAACCATTGCAT
CTGAAAGAGATGAAGCTTTAGAAGAAATTGCCACAATCACTATGGCTAGGGATACAGCTATTGCAGATAAAAAACGTATT
GAGAGTAGCATTTCAGCATTAAGCATGGATAATGAAGAATTGCAATTACTTTTGTCAGAATTAGAAGACAAAAATAAGAA
AATTATTTCTCAGTTAGAACAAGTTCAAAATGAATTAAATGTTGAACGACAAAATATAAGTAGATTAGAAAATCAAAAAT
CAACTGCCGAAAGACTGAATAAAGAATTGCATGATAAAATTGAAGAATTGGAAATGGAAGCTGGTAAAAAATATAAAGCT
ACAGTTGCTGCTCAACAAAGTAAAATCCAAAGTCTTGATTCTCAGCTGGACGCTAAAATTGAGGAAATAAACCAAGCTAA
TAGAAATAACAAGAAACTAGAAAGAAAGTTGAAAGAAATTATGGCTCTTATGGCTGATGAAACAAAGCGGGCTGACAATG
CAATCGAACAGATTGAAAAAGCCACTGGCAGATTTAAAAAAGCAGAGAGAAGTTTACAGATGGAACAAGAAAACAATTCT
GCTCTAAGTACACAAAATCGCCGATTACAACGAGATTTGGAAGAAGTAAATGAAACCAAAGAAGCACGGGACCAAGAAAT
TAAAATTCTTAAAACCAAAATCGACAGATTGGAAAAAAGAACACGCGCTGGGGGTCGACCTCTTAGAGGAGACGGTGGAT
CTGATGATGGGTTATCTGGAGATGGAGAATCCGTAACTGATTCTGCTTTAAAATCTGTTCAAGAAGACTAATTCAATAAG
TCCTAAAATGAACAATAAATTCTTGAATAATTAGTTAATACAAAAATTTTTGAATAATTTATATTTGGACTAACTTTTAA
TTCCTATTTGGTTTGCTCAATATATAATTGTTTTGATATATTTAATATTTCTATTTTATCAATTTGTGTACTTGGGG
>SMED30020435 ID=SMED30020435|Name=Myosin heavy chain|organism=Schmidtea mediterranea sexual|type=transcript|length=3615bp
TCTGAATTTAAACAAAGATATTCAATTTTGGCCGCAGATGTAATAGGGCAAGGATTTATTGATGGAAAACAGTGTACTGC
AAAGATAATGGAAGCAATCCAATTAGATAAAAACAACTACAGGCTTGGATCAACTAAAATCTTTTTCAAGGCCGGAGTAC
TTGCTCAGTTAGAAGACATGCGAGATGAGAAATTATCATCCATTTTGTCTGTATTCCAAGCACAGATGAGAGGATATATA
ATGAGAAAAGCATATAAGACATTGCAAGATCAACGAATTGCTCTTTCTCTCATTCAAAGAAACATCAGAAAATATTTATT
ACTAAAAACATGGCCATGGTGGAGACTATACACTAAAGTCAAACCACTCCTCAATATCGCAAGACAAGAAGAGGAGATGA
AGAAAGCTGCTGAAGAGTTGATTAAATTGAAAGAAGAATATGAAAAGATAGAAAAATTTAAAAAGGAATTGGAAGGTCAA
AATGTGGTTTTGCTTGAGCAGAAAAATGATTTATTTTTACAACTGCAAACAGAACAAGACAATCTTAGTGACGCTGAAGA
AAAGATTCAAAAGATGATCAATCAAAGAGTTGAAATGGAGAACCAATTTAAAGAATTAGAAGATAAATTAATGGATTCGG
AAGACATTCAAGATGAATTGGAAATCGAAAAAAAGAAATTGTTGTTGGATATGGATGAATTGAAATCGGACATTGACGAA
CTTGAAGTATCTTTAGAAAAGTCTGAACAAGAAAAACAAGCTCGCGATCAACAAATTAATAATTTGAAAGAAGAAATTCA
AAAACAAGATACTTCTATCGGAAAAGTTCAAAAGGAGAAAAAGACTCTAGAAGATAACTTAAATCAGACCAGAGAAGCTT
TAAATGCTGAAGAAGACAAGGTCAATCAGTTGACTAAAATCAAATCAAAATTGGAATCTGAAATAGATGAAATGGAAGAA
GCTCTAGAACGGGAAAAGAAGATCCGTGGAGATGTTGAAAAACTTAAACGGAAATTAGAAGCTGATCTCAAATCAAGCCT
TGATAACTGTAATGAGTTGGAAAATATAAAGCAGGAGTTAGAAGAAAATATTCAGAGAAAGGACATTGAAATATCAAAAT
TAAATGTCAAATTGGAAGATGAATCTTCAATTGTCACTCAACTTCAACGAAAAATTAAGGAATTACAAACTGTTATACAA
GATCTTGAAGAAGATCTAGAAGGTGAGAGACAAGGTCGATCAAAATCTGAAAAAGCTCGACAGTTGGCTGAACAAGAACT
CGATGAACTAGCTGACAGACTTGAAGAGCAGGGAGGTGCTACTATGGCACAAGTGGAATTGGCCAAGAAACGAGAAACTG
AATTAATGAAACTTAAAAAAGAATTACAAGATACCAATTTACAGAATGAGCAAATACTCAATGGTTTGAAAAAGAAAAAC
CAAGAAATTACCAATGAATTCTCCGAGCAAGTCGATCAAATAAATAAATCTAAATCAAAAATCGAAAAAGAAAAGGCGAC
TCTTAAGCATGATCTGGATGAATTTGTTTCTCAATTAGAATCTGTTTCAAAGCTAAAGGCCAATACAGAAAAACATTCAA
AACATTTAGAAAGTCAAATTATGGAATTGGAAAACAAAATAGACGAACAGAATCATCAAATATCAGAAATGGTTTCACAG
TCTAATAAAGACTCTCAAGCAATAATGTCTTTAGAACAACAACTAGAACAAGCAGAAAATGAAAATCACCAATTGAGCAA
ATCCAAACAACAATTCCTCCAACAAATTAATGACTGTAAATCGACTCTTGAAGACGAAGAAAAAGTAAAGGCCAAACTTT
TCAATGAAATTCGTAATCTGAATGATGAAATGGGCAATTTAAGATCCAGTTTGGAAGAAGAGCAAGAATCCAAAAGTGAA
ATTCAAAGGTCACTAGCAAAATCCCAATCTGAACTTGTACAAATGAAAAATAAATTTGATAGTGAAGGTTCAGGTCGCAT
TGAAGAAGTTGAAGAAGCTAAACGTAAGTTGCAAACGAAACTTCAAGACATGGAACAAGAATTTGACGCTATTAAAAATA
AATGCGCGCAACTTGAAAAAATCAAAATTCGTCTCACTGGAGAAATCGAAGACATGAGTGTTGATGTTGACAGAGCTAAT
GCAGTGGCTAATCAACTAGAAAAGAAACAAAAGAACTTTGACAAAACCGTCAGTGAATGGCAGTCTAAATGCAACTGCCT
TCAAACTGAAGTTGATGTTGCAAATCAAGAATCAAGATTTTTGTCAACCGAAGTATTTAAATGTAAAAGCCAAAACGAAG
AATTGCTTTCACAAATCGAAAATCTTAAACGAGAAAATAAGTCTCTCAGTGATGAAATTCACGATTTAACGGAACAACTA
AGTGATGGCGGAAAATCTGTTCACGATATAGAAAAGGCAAAACGAAAATTGGAAATAGAAAAGGAAGAACTGGAACAAGC
TTTGGAAGAAGCTGAATCAACATTGGAAAATGAAGAAGCCAAATTACAAAGAGCTCAGTTAGAGTTGAGTCAGATGAAAT
CAGATGTAGAAAAACGATTGTGTGAAAAGGAGGAAGATTTTGAAGGAACTCGCCGTAATCATCAAAGAGCAATGGAATCA
ATGCAAGCTTCTTTGGAGGCAGAAATTAAAATTAAACAGGACTCAATTAAAGCCAAGAAGAAGTTAGAACAAGAAATCAG
TGAACTCGAAGCCAATTTAGATCAAATCCAAAGACTGAAATCAGATGCTGATAAGAACAATTCAAGAATGCAACAGCAAA
TTCATGATTTACATTCAGAGATTGAACAAGAACAACACAGTAAAAACGAAGTCCGAGAACATGCTCAGATGGCTGAAAAG
AGATTTTTATCGGCTAATGGAGAACTAGAAGATTTGCGAGCCAAATTTGAACAATCAGATAGAAATCGTAGAAATGCTGA
ATCTGAGCTTCAAGATTTGAGTGATAAATACAATGAAAGCCAAGCACTGATCACTTCACTTCAAAGTTCAAAAAGAAAAA
TGGAAATGGATTACGTAGCTATGCAGTCCGATCTTGATGATATGTCAAACCATGTTCAACAAGCTGAGGAAAGAGCAAAG
AAAGCAGCTGGTGACGCTGCCCATATGTCAGAACAACTTCATCAAGAACAAGACAATAGTTTGCACACGGATAAAATGAG
GAAGCAAATGGAAATTCAAATCAAAGAAATGCAGTGTAAACTAGAAGAAGCCGAAAGTAATGTTTTGTCAGGCGGCAAAA
AGACTTTGGCAAAGTTAGAGTCAAAAATACGAGAATTGGAAACTAATCTTGATAACGAAATGAGAAAACATGCTGAAACT
CAAAAGAATTATCGCAAAGTAGATAGACGAATGAAAGAACTAACATTACAATTGGAAGACGATAGAGCTCAACAAGAAAA
ATCAAATCAAGTTATTGAAAAATTCCAAGGACAAATCAAAACCCTTCGAAAACAATTAGAAGAATCAGAAGAAGTTGCCG
TTTTGAATATTGCCAAATTTAAGAAAGTACAATGTGATTTTGAAGAAGCCGAAGAAAGAGCGAATGAATCGGAACAAGCT
TTACAAAAATTAAGA
>SMED30016281 ID=SMED30016281|Name=Myosin heavy chain|organism=Schmidtea mediterranea sexual|type=transcript|length=5986bp
CTAAAATTTAGTTGATTTCGATTGTTTGAATAAAAATATCTAATGGACCCATCAGATCCTGATTTTATCTACTTGGGAGT
CGACAGGAAAGCTTTATTGAAGCAATATGGCGACTCGTTTGATAGTAAAAAGAACATGTGGATACCGGATGAAAAGGAGG
GGTACATCGCAATTACCGTTGAAGAAACAAATGGCGATAAAGTAACTGTTAAAACCGATAAAGGAGAAACTAAAGTCGTC
AAGCAAGACTCCTTGGAACAAATGAATCCCCCCAAATTCATGATGATTGAAGACATGGCGAATTTAACATTTCTCAATGA
TGCCAGTGTATTTGATAATCTGAGACAAAGATATTACAAAAATCTGATTTATACTTACTCCGGACTGTTCTGTATTGCAG
TGAATCCTTATCGAAGATTTCCGATTTATACGTCCCAAGTAATTATGAAATATAAAGGAAAACGTAGAGGAGAAATGCCA
CCGCATATTTTCTCAATTTCGGATAATGCTTACTCAAATATGCTTGTCGATCGAGAAAATCAGTCTGTTTTGATTACTGG
AGAAAGTGGTGCTGGGAAAACTGAAAACACGAAAAAAGTTATTACTTACTTCGCCAATGTAGCAGCAGCAAGTAAAAAAG
ATGATGACGATCCATCGAAGAAAAAAGGTTCATTGGAAGATCAAATTGTACAAGCCAATCCTGTACTGGAGGCATACGGA
AACGCCAAAACAACTAGAAATAATAATTCGTCAAGATTTGGAAAATTCATCCGAATTCATTTTGGCACTAGTGGAAAAAT
TGCAGGAGCTGATATTGAGTTTTATTTGTTGGAGAAATCTCGTGTTATCTCACAGCAAAAAGGAGAAAGAAATTACCATA
TTTTCTATCAATTGCTTTCGGCAGGAGGGAAAAGTTACCACGATAAACTTTTGGTTACTGCTGATCCTGCTCTGTTTTCT
TTTATCAACCAAGGAGAATTGACGATTGACGGTGTTGATGATGAGGAAGAAATGAAACTTACTGATGAAGCCTTTAGTAT
TCTTGGGTTTTCCGATGAAGAGAAAATGAGTTTGTTTAAATGCACTACTTCAATCATGAATATGGGAGAAATGAAATTTA
AACAAAGACCCCGTGAAGAACAAGCCGAGGCTGATGGTACAACAGAAGCTGAAAAAGTCTCTTTCTTACTTGGAGTGAAT
GCCAAAGATCTAATGCAAGCAATTCTTAAACCCAAAGTCAAAGTAGGAAACGAATATGTAACGAAAGGTCAAAGCAAAGA
TCAGGTTTTATATTCTCTTGGAGCCTTAGCAAAATCTTTATATAACAGAATGTTTGCTTGGTTGGTTACTCGCGTGAACA
AAACGCTGGACACAAAAGTCAAAAGACAGTTTTTCATTGGTGTCTTAGATATTGCCGGATTTGAAATATTTGATTTCAAT
GGTTTCGAACAAATTTGTATCAACTATACTAATGAGAGACTCCAACAATTTTTCAATCACCATATGTTTGTTCTTGAACA
AGAGGAATATAAAAAAGAGGCCATTGACTGGGAGTTCATAGATTTTGGAATGGATCTCCAAGCTTGCATTGAGTTGATTG
AAAAGCCTATGGGTATTTTGTCGATTTTAGAGGAAGAATGTATGTTTCCCAAAGCAAGCGATCAAACATTGAAAGCTAAA
TTGTACGATAATCACTTGGGTAAAAGTCCGAATTTCGGAAAACCAAAACCACCAAAACCAGGACAACACGAAGCCCATTT
CGAATTACATCATTATGCTGGCAGTGTTCCATATAATATTACTGGGTGGTTGGAGAAAAATAAGGATCCATTGAACGAAA
GTGTTGTTGGATTACTCGGAGCATCTAAAGAATGTCTAGTAGCTTCTTTATTTGCACCGGCTGAAGATACAGGAAAACCC
GGAACCAAGAAAAAGGGTGGATCCTTTATGACTGTGTCATATATGCACAGGGAATCATTGAATAAATTGATGAAAAATCT
AATGAGTACAAGTCCACATTTTATTCGTTGCATTGTCCCCAATGAATTCAAACAACCAGGAGTTGTTGATGCGCATTTGG
TTATGCACCAACTTCATTGCAACGGTGTATTGGAAGGTATTAGGATTTGCAGAAAAGGATTCCCAAATAGAATGATCTAT
TCTGAATTCAAACAAAGATATTCAATTTTGGCACCGAATGCCATTCCACAAGGATTTGTTGAAGGCAAACAGGTCACTGA
TAAAATCCTCACAGCCATTCAACTGGACACAAATCTTTATCGCTTAGGAAATACCAAAGTATTTTTTAAAGCTGGAACAT
TGGCTCAACTTGAAGATATAAGAGACGAGAAACTTTCGTCGTTGATATCGTTGTTTCAAGCTCAAATTAGGGGATATTTA
ATGAGACGGCAATACAAAAAACTTCAAGATCAAAGAGTTGCTCTGTCTTTGATTCAAAGAAATATTAGAAAATATTTGGT
TTTGAGAACATGGACCTGGTGGAAATTGTTCACTAAAGTAAAGCCTATGCTTAATATTGCTCGCCAAGAAGAAGAAATGA
AAAAGGCAGCCGAAGAATTAGAAAAGCTGAAAGAGGAATTTGAAAAAACTGAAAAATATAAGAAAGAACTTGAAGAACAA
AATGTTACTTTACTTCAAGCAAAGAACGATTTATTCTTGCAGTTGCAAACTGAACAAGATAGTTTAGCTGACGCTGAAGA
GAAAGTATCTAAATTAGTTCTACAAAAGGCTGACATGGAAGGAAGAATTAAAGAACTTGAGGACTCACTTTCAGAAGAAG
AAAATTCAGCTTCAACATTAGAAGAAGCAAAAAAGAAACTCAATGCTGACATCGATGAATTGAAGAAAGATGTTGAAGAT
TTGGAATCATCTTTACAAAAAGCAGAACAAGAAAAAGTTGCAAAGGATCAGCAGATTAAATCCCTCAACGACAATGTTCG
TGAAAAAGAAGAACAATTAGCCAAAATGCAAAAGGAAAAGAAAGCTGCTGATGAATTACAAAAAAAAACAGAAGAATCAT
TGAAAGCCGAAGAAGAGAAAGTCAGTAACCTCAATAAAGCTAAAGCTAAATTAGAACAAGCCCTGGATGAAATGGAAGAA
AATCTTGGTCGAGAACAAAAAATTAGAGCAGATGTTGAAAAAGCAAAACGAAAAGTTGAAGGTGAACTTAAACAGAATCA
AGAGTTATTAAATGACTTGGAGCGCATAAAATCCGAACTTGAGGAACAATTAAAACGAAAAGAAATTGAATTGAATGGTG
CTAACTCTAAAATCGAAGATGAATCTAATTTAGTTGCAACACTTCAACGGAAGATCAAAGAACTTCAAGCCAGAATCCAA
GAATTAGAAGAAGACCTTGAGGCGGAAAGACAAGCAAGGGCAAAAGCTGAGAAAGCTAAACATCAATTGGAAGCGGAACT
TGAGGAAATCAGTGAAAGACTAGAAGAACAAGGAGGTGCAACTCAAGCCCAAACAGATTTAAATAAAAAACGAGAAGCTG
AACTCATAAAATTAAAGCGAGACTTGGAAGAGGCTAATATGCAACACGAACAAGCCTTGGTGCAAATGAGAAAGAAACAA
CAAGATACTAGCAATGAATTCGCAGATCAGTTAGATCAATTGCAAAAATCAAAATCAAAGATTGAAAGAGAAAAGAGTGA
ACTTAGAGCAGACATTGAAGATTTATCAAGTCAGCTGGAATCACTGAATAAGACCAAGGGAAATCTTGAAAAGTCAAATA
AAGCATTAGAAACCACAGTTTCAGATCTTCAAAACAAACTCGATGAATTAAGCAGACAATTGACAGAAGCAGGAAACGTC
AACAATCGAAATCAACATGAAAATAGTGAAATGCACAAAACCTTAGAAGACGCCGAATCACAAATAAACCAACTCGGAAA
GGCTAAACAACAACTCCAAGCGCAGCTAGAAGAGGCTAAACAAAATTTGGAAGATGAATCACGCGCAAAAGCAAAACTTA
ATGGAGATTTAAGAAATGCGATGAGTGATTTAGATGCATTACGGGAATCATTGGAAGAAGAACAAGAAGGCAAAAGCGAT
GTTCAAAGACAGCTTGTGAAAGTCCAAAATGAATTACAGCAACTTAAAGCAAATTCTCAAGGTACTGGAGGAGTGAGAAC
AGAAGAAATGGAAGAATTCAGACGAAAGATGAATGCCAGAATCCAAGAACTAGAAGAAGAATCGGAATCAAATAAATCTA
AATGCAGTCAATTAGAAAAAATGAAATCCAGACTTCAAGGAGAAATTGAAGATTTAGTGATAGATGTTGAAAGAGCCAAT
GGATTAGCATCGCAACTGGAAAAGAAACAGAAAAATGTTGACAAATTAATAGGCGAATGGCAAAAAAAATATTCAGAAAG
TCAACAGGAACTAGAAGTATCACTGAGAGAATCAAGAACAGTTTCCGCTGAAGTTTTCAAATTGAAATCACAATTAGAAA
ATTCTCAAGATCAAATCGAAAGTTTAAGAAGAGAAAATAAAAATCTATCTGATGAAATTCATGACTTAACTGAACAATTG
GGAGAAGGAGGACGAAATGTACATGAAATTGAAAAGACTCGAAAAAGAATTGAAATTGAAAGAGATGAATTACAACATGC
ATTAGAAGAAGCTGAATCAGCTTTGGAACAAGAAGAAGCTAAAAGCCAAAGAGCTCAGTTAGAAATAAGTCAAGCCCGTC
AAGAATCTGAAAGAAGACTTGCAGAAAAAGAAGAAGAATTTGAAGGTACACGAAAAAATCATCAACGAACACTCGAATCC
ATGCAAGCATCTCTTGAAGCTGAAGTTAGAGGACGAACTGAAGCAATGAAAATGAAAAAGAAGCTGGAGCATGATATTAA
TGAGCTTGAAGTTGGGTTAGACACGGCTAATAGACTGAAATCTGAACAAGAGAAAAATGCTAAGAAATATCAGCAACAAT
TAGCAGAAATGCAAGCTCAAGTTGAAGAACAGCATCATCAACGAGAGCAAGTTAGTGAACAGCTTGCGTTAACAGAACGA
AAATTAGGTATGATGCACGGAGAGCTGGAGGAAATGAAAAATATGTGTGATCATGCTGAAAAAAATAGAAAAGTCGCTGA
ATCTGAAAAGAATGAAGCCATTGATAAACTAAATGAGTTTTCAATTCAAAATTCTTCATTCATGGCAACTAAAAGAAAGA
TGGAAGCAGATTTAGCAGCAATGCAAGCTGACTTAGAAGAATCTACAAATGCAGCTAGACAAGCTAATGAACAATTGAAA
AAGGCAATATTTGATAATACTCGACTTTTCGATGAAATTAAACAAGAACAAGAACATGCTCAACAAGCTGAAAAAGCAAG
AAAGAATTTGGAGAGCCAGTTGAAAGAATTGCAATCAAAACTTGAAGAAGCAGAAGCAAATGTACTTAAAGGAGGCAAAA
AGGCTTTGAGTAAATTAGAGCAAAGAATAAGGGAATTGGAAGGCGAACTAGATGGTGAACAAAAACGACATGTTGAAACT
CAAAAGAATGCTAGAAAGTCAGATAGGCGACTGAAAGAAATTTCGTACCAGATCGACGAGGATAAAAAGAATCAAGATCG
AATGCAACAACTTATTGAAAGTTTACAAGCAAAAATAAAGACTTATAAACGACAAGTAGAAGAAGCTGAAGAAATCGCTG
CTGTGAATTTGGCAAAATATCGCAAAATTCAACAAGAGATTGAAGATTCTGAAGAGCGAGCTGATCAAGCTGAACAAGCT
TTACAAAAATTAAGAGCAAAGAATAGAAGCTCGGTATCTGTTAGTCGAGGAGCAAGTTCTGGACCTGGAACCAAAATTTC
TATAACTGCGACATCAATCCGCAGTGAGGACTAATCTGACAGAAAAAATTCATCATTAGGAAATATGCAATTAGTTAGCC
AATATTTCCCTTAGACTAGATTTTAAACCTTTAAGACATTTTTTTCAAATTAATAAAACGTTTTGA
>SMED30024552 ID=SMED30024552|Name=Myosin heavy chain|organism=Schmidtea mediterranea sexual|type=transcript|length=2149bp
TCACTGGAGTTAATAAACGACAAATTAAGGAAAAATGAACATGAACGATCCAGAAATGCAATACTTGGCCATTGACCGCA
AAGAATTGCTGAAAAGTTTAGATGTTGGGACTTTTGACAGTAAGAAAAATTGCTGGGTCCCCGATGAGAAGGAAATGTTT
GTGGCGGCGGAAATTAAATCCTCCTTAGGAGGTATTTTAAAAGTTCAAACGAAAAATGGAGAAAATCGTGAAGTTAAAGA
AGACGATATTCAACAAATGAATCCACCGAAATTCGAAATGATTGATGATATGGCTAATCTCACTTTTCTAAACGATGCTA
GTGTGTTACATAACCTAAAATCCCGTTATTACCGTGATTTGATATATACTTATTCTGGTCTGTTTTGTGTGGCTATAAAC
CCATATAAAAGAATTCCCATTTACACCCCAAGTATCATGCAGAAATTCAAGGGTAAACGAAAGACTGAAATGCCCCCCCA
TGTGTTCTCGGTATCCGACAACGCATATAATAACATGTTGAGAGATCGGGAAAATCAGTCCATTCTTATTACCGGTGAGA
GTGGTGCTGGTAAAACAGAAAACACTAAAAAAGTCATTTCCTATTTTGCTCAGGTGGCAGCCAATTCAAAAGATGAAGAT
AAAAGCAAAGGATCCCTTGAAGATCAAATTGTACAAGCTAATCCGGTTTTAGAAGCATATGGTAATGCAAAAACAAATAG
AAATAACAATTCCTCAAGATTTGGTAAATTCGTTAGAATTCATTTTGGATAACGGCAAAATTGCCGGAGCTGACATTGAA
TACTATCTTTTGGAAAAATCAAGAGTTGTCTCACAACAAAAAGGAGAAAGAAATTATCATATTTTCTACCAAATATTGTC
TAACAGTGCCAAAAACCTCCATGAAAAATTATTGATAGAACCAAATGCCAGCATTTATTCATTTATTAATCAAGGTGAAC
TAACAATTGACGGGGTGAATGATTCAGATGAATTCGCTTTGACTGATGAAGCGTTCGATGTTTTGGGTTTCACCACTGAA
GAAAAAATGGGACTTTTTAGATGCACAACTGCTATCATGAATATGGGTGAAATGAAATTTAAACAGCGTCCTCGTGAGGA
GCAAGCAGAAGCTGATGGTACTTCAGAAGCTGAAAAAGTTGCATTCTTACTCGGAGTAAATGCTAAAGATTTACTACAAG
CATTTTTGAAGCCAAAAGTAAAAGTTGGTACTGAATATGTTACTAAAGGACAAACTAAAGACCAGGTCTTGTTTGCTCAA
GGAGCGTTAGCTAAATCCATATATAGTCGTATGTTTTCTTGGTTGGTGACCAGAGTTAATAAAACTCTTGATACGAAAGT
GAAAAGGCAATGCTTTATTGGTGTGTTGGATATTGCCGGTTTTGAAATCTTTGAATATAACGGATTTGAACAACTGTGCA
TTAACTACACAAATGAAAGACTCCAACAATTTTTCAATCATCATATGTTCGTATTGGAACAAGAAGAGTATAAGAAAGAA
GCGATTGACTGGGAGTTTATAGACTTCGGATTAGATTTACAAGCTTGCATTGAACTTATTGAAAGACCAATGGGTATTCT
GTCAATTCTTGAGGAAGAGTGTATGTTTCCTAAAGCAACCGATGAGACTTTTGTTGCAAAATTGTATGAAAATCATCTGG
GTAAAAGTCCTAACTTTGGAAAACCAAAACCAAATGGTCAAGCAACTGCCCATTTTGAGTTACATCATTACGCTGGCTCT
GTTGGATATTCAATTACTGGATGGTTGATAAAAAATAAAGATCCAGTCAATGACAGTGTTCTTCAAACTTTAGGAGCTAG
TAAAGAAGCTCTTGTTGCTCAACTTTTTGCTCCTGCGGATGATGATGCTACTGGAAAGAAAAGGAAAGGAGGCAGCTTCT
TAACAGTATCGTTTGTTCACAGAGAATCTTTGAATAAACTTATGAAGAATTTACAAAGCACTAGTCCACATTTCATTAGA
TGTATTATTCCCAATGAATTAAAACAATCTGGATTCATTGACTCCCACTTAGTCCTACATCAACTTCATTGTAATGGTGT
GTTAGAAGGTATAAGAATATGTAGAAAAGGATTTCCAAATAGACTTATTTATTCTGAATTTAAACAAAG
>SMED30025388 ID=SMED30025388|Name=Myosin heavy chain|organism=Schmidtea mediterranea sexual|type=transcript|length=6089bp
TTTTTTTTCGAGTTTGTGCTAGAAATTAATTTCAGTTTGAAATTTTTTGCCTATTTCGAGTTCTTTGAAAACAATCTGAA
AACATGAACCCATCTGATCCCGATTTTCAATATCTCGGTGTCGACCGAAAAGCTTTAATGAAGCAGTATGGGGATTCCTT
TGACAGCAAGAAAAACTGTTGGATTCCTGACGAGAAAGAAGCCTTCATTGCGGCGACAATTGAAGATGCGTCTGGAGATG
TCTATACGGTCAAAACCGATAAAAGTGAAACCAAGACTGTTAAAAAGGACGAAATCGAACAAATGAATCCACCGAAATTT
TTGATGATTGAAGACATGGCAAATTTAACCTTTCTAAACGATGCCAGCGTTCTTGATAATTTAAGACAAAGATATTACAA
GAATCTGATTTATACCTACTCTGGACTGTTTTGTGTGACAATAAATCCATACAAAAGATTTCCAATTTACACCCCGCAGG
TGATTTCAAAATACAAAGGTAAACGACGAACTGAAATGCCTCCACATATTTTCTCGATATCCGACAATGCTTACACCAAC
ATGTTGGCGGACCGAGATAATCAATCTGTCTTAATTACTGGTGAAAGTGGAGCTGGGAAAACTGAAAATACAAAAAAAGT
TATCACTTATTTTGCACACGTTGCAGCTGCTACTAAAAAAGAAGAGGATGATACTGGAACTGGTCAAAAGAGAAAGGGAA
CATTGGAAGACCAAATCGTGCAAGCAAATCCTGTTTTAGAAGCATACGGTAACGCAAAAACTGTGCGAAACAACAATTCA
TCCAGATTTGGTAAATTCATTCGTATTCATTTCGGTACAAGTGGAAAAATAGCTGGAGCTGATATTGAATTTTACTTACT
CGAAAAATCGAGAGTAAATTCTCAACAGAAAGGTGAAAGAAACTATCACATTTTCTATCAAATTTTATCGAACGGAGGAA
AACCATTTCATGAAAAATTACTCATCTCTCCTGATCCAGCTTTGTATTCCTTCATTAATCAAGGTGAATTAACAATCGAT
GGAGTCGACGATGAAGAAGAAATGAAAATAACTGATGAAGCTTTCGACATTTTGGGATTTTCTGCCGAAGAAAAAATGAG
CTTGTTCAAGTGTACTTGCTCAATTTTAAACATGGGCGAAATGAAATTTAAACAAAGGCCAAGAGAAGAACAAGCCGAAG
CCGACGGTACTGCTGAAGCTGAGAAAGTGGCTTTTCTGTTGGGTGTCAATGCAAAAGATTTAATGCAATCGATTCTGAAA
CCGAAAGTTAAAGTTGGTAATGAATATGTCACAAAGGGGCAGAATAAAGATCAAGTTCTTTATTCGGTTGGTGCGCTAGC
AAAATCTCTTTACAACAGAATGTTTGCGTGGTTGGTTTTGAGAGTTAACAAAACCCTCGACACTAAAGTCAAGCGACAAT
TTTTCATCGGTGTTTTGGATATTGCCGGTTTCGAAATTTTCAATTTCAATGGATTTGAACAAATTTGTATTAATTACACC
AATGAAAGATTGCAGCAATTTTTTAACCATCACATGTTCGTGTTGGAACAGGAAGAGTACAAGAAGGAAGCGATCGATTG
GGAGTTCATTGATTTTGGAATGGATCTTCAAGCGTGCATTGAGCTCATTGAAAAGCCAATGGGTATTCTGTCAATCTTAG
AAGAAGAGTGCATGTTTCCGAAAGCATCTGATATGACATTTAAAGCAAAATTGTATGATAATCATCTCGGAAAAAGTCCC
AATTTTGGAAAGCCAAAACCTCCAAAACCCGGACAGGCTGAAGCTCACTTCGAATTGCATCACTATGCTGGCAGTGTGCC
ATACAATGTTACTGGTTGGCTGGAAAAGAATAAAGATCCTCTCAACGAAACTGTGATAAATCTACTTGCGGCAAGTAAAG
AGGCATTAGTTTCGAGTTTGTTTGCTCCGGCTGAAGATCCAAATAATACGGGTAAACGGAAAAAGGGTGGGGCCATGCAG
ACCATTTCTTCAACTCATAGGGAATCCTTGAATAAATTGATGAAAAATTTACAAAGTACCAGTCCACATTTTATCCGATG
CATTGTTCCAAACGAATTCAAACAACCTGGTGTAATCGACGCTCATTTGGTATTACATCAATTGCATTGTAACGGTGTCC
TTGAAGGCATCAGAATCTGTCGAAAGGGTTTCCCAAACAGAATGATTTATTCTGAATTTAAACAAAGATATTCTATCTTG
GCTCCAAATGCAATTCCACAGGGATTTGTTGAAGGCAAACAAGTAACGAGCAAAATTCTGGAAGCTGTTCAATTGGACAC
CAATCTTTACCGCCTGGGAAATACTAAGGTATTTTTCAAAGCTGGAACTTTGGCTGATTTAGAAGACATGCGTGATGAAA
AATTATCTTCACTGATTTCATTGTTTCAAGCTCAAATACGCGGATATTTGATGCGAAGACAATATAAAAAATTACAAGAT
CAGAGAGTTGCTCTATCTATCATTCAAAGAAATATTCGTAAATATCTTCTTCTGAGAACATGGCCATGGTGGAAATTGTA
TACCAAAGTTAAGCCACTTTTGAACATTGCTCGTCAAGAGGAAGAAATGAAAAAGGCCGCTGAAGAATTGACAAAATTAA
AGGAAGAATTCGAAAAAGTTGACAAATTCAAAAAAGAACTTGAAGAACAAAACGTCAAATTGTTGGAAGCTAAAAACGAT
TTGTTCTTACAATTACAAACCGAACAAGACAGTTTAGCCGATGCCGAGGAAAAGGTTTCAAAATTGGTTATGCAAAAAGC
CGATATGGAAGGAAGAATTAAAGAATTGGAAGATCACCTTCTAGAAGAAGAAGATAATGCTGCTGGACTGGAAGATATCA
AGAAGAAAATGCAGGGTGAGATTGAAGAGTTGAAAAAAGATGTTGTCGATTTGGAATCTTCATTACAAAAGGCTGAACAA
GAGAAAACCGCGAAAGATCAACAGATAAAATCGTTACAAGATCAAATGGCAAAACAAGAAGAAGAGATGAACAAATTGAA
AAAGGAGAAAAAGGCCGCCGATGAAGTGCAAAAGAAAACCGAAGAATCTCTACTAGCGGAAGAAGAGAAAGTCAAAAATC
TAAACAAAGCTAAAGCCAAATTGGAACAGACCATTGATGAGATGGAAGAAAACCTCTCGCGAGAACAGAAAATCCGAGCT
GACGTAGAAAAAGTTAAACGAAAAATCGAAACTGAACTGAAACAAACTCAAGAGACCGTAGACGATTTGGAAAGAGTAAA
ACGAGAATTAGAGGAACAATTGAAGCGCAAGGAAATGGAATTAGTCAATGCTTCATCGAAAATTGAAGACGAATCGGGAT
TAGTTGCCCAGCTTCAGAGGAAAATCAAAGAACTTCAAGCTCGAATTCAAGAATTGGAAGAAGATCTGGAAGCAGAAAGA
CAAGCCCGTGCAAAAGCAGAGAAAAGCCGACATCAACTCGAAGGCGAGTTGGAAGAATTGAGTGATCGACTGGAAGAACA
AGGAGGCGCAACCTCAGCTCAAATGGATCTCAATAAGAAGCGAGAGGCAGAATTAATGAAATTAAAGAGAGATTTAGAAG
AATCGAATATGCAACACGATCAGGTTATCGCACAAGCTCGAAAGAAGCAACAGGATGTTGTCAATGAATTCTCAGAACAG
CTCGATCAACTGCAGAAAGTCAAAGCTAAAGTTGAAAAAGAAAAGAATGAGATGAAAGAAGATTTAAATGACCTACAAGG
ACAGCTGGAATCATTAAATAAAGCCAAGGCTAACAGCGACAAACGAATCAAAGAAATCGAAGCTCAAAATTCCGAATTAC
AGGGCAAATTGGAAGAGGCAAATAGACATATCAATGATGCCAACAATACATCTGGAAAGAATCAACAAACCAATGCGGAA
CTCCAAGCACGTTTAGAAGAAGCCGAATCGCAAATCAATCAGCTGGGTAAAGTCAAGCAACAAATGCAGACTCAACTCGA
AGAAGCCAGGCAAATCGCTGAGGAAGAGTCGAGAGCAAAGGCTAAATTGAGTTCTGATGTTCGCAATCTCAATGCCGATT
TAGACAATCTCAGGGAGGCACTGGAAGAGGAAAATGAGAACAAAAGTGACATACAGAGACAGCTAGTTAAAGCTCAGGGA
GAAATGCAACAATTGAAGGCTAAATTCGAAGGCTCGGGATCCATTCGTTCAGAAGAGTTGGATGAAGCCAAGCGAAAGTT
TATGACACGAATCCATGAGCTGGAAGAGGAAGCTGAAACCGCCAAATCGAAAGCCGGACAACTAGAAAAAGTTAAAGCTC
GACTCCAAGGAGAAATCGAAGATATGCTGGTCGACGTTGACAGAGCGAATACACTCGCATCTCAGTTGGAAAAGAAGCAG
AAAACATTCGATAAAGTCGTGTCAGAATGGCAGCAGAAATATGCTGAATCTCAGGCGGAATTGGAAGCATCCCAGAGAGA
AAGCAGGACGATTTCAGCTGAGGTGTTTCGAATGAAAGCACAAATCGAAGAAAGTCAAGAGCAGTTGGAAAGCGTTAAAC
GGGAAAACAAAAATCTAGCAGATGAAATCCACGATTTGACAGAGCAAATCGGAGAAGGAGGTCGCAGTGTTCACGAAATC
GACAAAGCAAGGAAACGATTGGAAATGGAAAAGGAAGAATTGCAACATGCGTTAGAAGAAGCCGAACAAGCTTTGGAACA
GGAAGAAGCCAAGTCTCAACGATCACAACTGGAAATGAGCCAGATCAGACAAGAAATCGACAGGCGATTGGCTGAGAAGG
AAGAGGAATTCGAGGCCACTCGAGTCAATCATCAAAGAGCAATGGAGTCAATGGAAGCCTCACTTGAAGCCGAATCCAGA
GGCAGGGCTGAAGCAACGAAGATGAAAAAGAAACTGGAGCACGATATCGGTGAACTGGAAGTTGCAGTGGATACCGCCAA
CAGAATCCGATCGGAGCAAGAAAAGAACGCAAAGAAATTCCAGCAGCAAGTTCAAGAATTGCTATCAATGGTGGAGGATG
AGAAACACCAGAAGGATCAGATACGAGAGCAAACGACGATGACAGAAAGGAAATTGACAATGGTCCTGGCAGAGCTTGAG
GAGGTTCGTGGCTCATTGGAAAATTCCGAGAGAAACAGGAAAAATACCGAGAATGAGAAAATGGAAATAACTGATCGATT
GAATGAGTTGAGTGTCCAGAGCTCCGGTTTCATGGCTACCAAGCGGAAATTGGAAGCTGATTTGGCTGCTATGCAGTCCG
ATTTAGAGGAGGCCGCTACTGAAGCCCGACAAGCCAATGAACAAGCCAAGAAGGCTGTTGCTGACAGTGCGAGATTGTTT
GATGAAATCCGGCAAGAGCAGGAACACGCACAGCAAATCGATAAGATCAAGAAACAACTCGAGGCCCAAAATAAAGAATT
GCAAGCCAAATTAGATGAATCGGAGAATAATGCTTTGAAAGGTGGCAAAAAAGCCTTGAGCAAACTAGAGCAACGCGTTC
GTGAACTTGAAGCCGAATTAGACGGAGAACAAAAAAGACACGTTGAAAGTCAAAAGAACTCCAGAAAAGTTGAAAGACGG
CTTAAGGAGCTTGGATTACAAACCGACGAAGATAAGAAGAACCAAGAAAGATTGCAAGATCTGGTGGAGAAGCTTCAAGG
TAAAATCAAAACCTACAAACGCCAGGTGGAAGAGGCGGAAGAAATTGCTGCTGTAAACTTAGCAAAATACAGAAAGATCC
AACAGGAAATCGAAGATTCCGAAGAAAGAGCTGATCAAGCTGAACAAGCGTTGCAGAAGCTGAGGACCAAAAACCGCAGC
TCCGTTTCGACAGCGAGAGGCGGTAGCATGGCTCCCGGCATGACCACAGTGAAATCGACATCACTCTCTGTTTCGGCTTC
GAGCCGACGACAAGGTTCTAGTGTTTCCAGAGAGAGCTAAGTCAGAAATTCTAGTAACACAACGATAAATTATTAGGATT
TACTTAATTGACATTATTTGCATGTTATCAATTATTGGACACAATTTAGTGATGCTTTTATTTAATAAAATTTACATTTT
GAAAAAAAA

 

back to top



PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in muscle cell. Click this link to learn more about PAGE.


PAGE Curations: 2791


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
muscle cellSMED30022325SMED30022325SMESG000022410.1 SMESG000022409.1 dd_Smed_v4_1683_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016281Myosin heavy chainSMESG000056451.1 dd_Smed_v4_1434_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016281Myosin heavy chainSMESG000056451.1 dd_Smed_v4_432_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018233Troponin C, skeletal muscleSMESG000005066.1 dd_Smed_v4_12048_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018872Ig-like domain-containing proteinSMESG000042318.1 dd_Smed_v4_11702_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016880Zinc finger Ran-binding domain-containing protein 2SMESG000017096.1 dd_Smed_v4_1397_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30019802SMED30019802SMESG000017096.1 dd_Smed_v4_1397_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015373SMED30015373SMESG000000625.1 dd_Smed_v4_1629_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020070High mobility group protein B1SMESG000034017.1 dd_Smed_v4_1095_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020007Dystrobrevin betaSMESG000078318.1 dd_Smed_v4_12275_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015470SparcSMESG000024280.1 dd_Smed_v4_1021_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30019898Slc42a-1SMESG000048173.1 dd_Smed_v4_3286_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018242Guanine nucleotide binding protein subunitSMESG000068013.1 dd_Smed_v4_10481_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018061Ribose-5-phosphate isomeraseSMESG000004984.1 dd_Smed_v4_12956_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30010757Cytochrome c heme lyaseSMESG000012893.1 dd_Smed_v4_2573_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30010755Ig-like domain-containing proteinSMESG000068292.1 dd_Smed_v4_3852_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30007862DNA-binding regulatory protein, YebC/PmpR familySMESG000039610.1 dd_Smed_v4_2722_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30014170Luc7-like protein 3SMESG000047550.1 SMESG000047494.1 dd_Smed_v4_3724_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001797SMED30001797SMESG000055722.1 SMESG000043901.1 SMESG000034363.1 SMESG000034362.1 dd_Smed_v4_3685_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018491SMED30018491SMESG000000384.1 dd_Smed_v4_10941_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30002129Pyruvate dehydrogenase E1 component subunit betaSMESG000068622.1 dd_Smed_v4_3374_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30017418Casein kinase II subunit alphaSMESG000024545.1 dd_Smed_v4_1000_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED3001818660S ribosomal protein L10SMESG000079023.1 SMESG000034764.1 SMESG000008177.1 SMESG000008153.1 dd_Smed_v4_130_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30004158Tetratricopeptide repeat protein 25SMESG000049234.1 dd_Smed_v4_3933_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30013475SWI:SNF matrix associatedSMESG000013560.1 dd_Smed_v4_3355_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018834SMED30018834SMESG000010762.1 dd_Smed_v4_3061_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30017018SMED30017018SMESG000007294.1 dd_Smed_v4_371_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015482Splicing factor 3B subunit 2SMESG000058116.1 dd_Smed_v4_2932_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018039TNF receptor-associated factorSMESG000025998.1 SMESG000025982.1 SMESG000025980.1 SMESG000025963.1 SMESG000025934.1 SMESG000025901.1 SMESG000025797.1 SMESG000025794.1 SMESG000025517.1 dd_Smed_v4_1139_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED3000335326S proteasome non-ATPase regulatory subunit 2SMESG000010192.1 SMESG000001376.1 dd_Smed_v4_2481_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015595InnexinSMESG000032206.1 dd_Smed_v4_3879_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005804Translational activator GCN1SMESG000079354.1 dd_Smed_v4_3929_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30017619TNF receptor-associated factorSMESG000025998.1 SMESG000025982.1 SMESG000025980.1 SMESG000025963.1 SMESG000025934.1 SMESG000025901.1 SMESG000025797.1 SMESG000025794.1 SMESG000025517.1 dd_Smed_v4_1139_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015160SMED30015160SMESG000016267.1 SMESG000058374.1 dd_Smed_v4_3391_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30019538SMED30019538SMESG000078196.1 dd_Smed_v4_3823_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30002248Nucleoporin GLE1SMESG000003757.1 dd_Smed_v4_3943_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30014496Ribosome biogenesis protein NSA2SMESG000028599.1 dd_Smed_v4_1012_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30017231NEPH-3SMESG000022777.1 dd_Smed_v4_11280_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30019886BCL3-1SMESG000023987.1 SMESG000017232.1 SMESG000080953.1 SMESG000080618.1 SMESG000072700.1 SMESG000069163.1 SMESG000065358.1 SMESG000064426.1 SMESG000062577.1 SMESG000062150.1 SMESG000060043.1 SMESG000057576.1 SMESG000056292.1 SMESG000054362.1 SMESG000052870.1 SMESG000051517.1 SMESG000050768.1 SMESG000050005.1 SMESG000049698.1 SMESG000045813.1 SMESG000041318.1 SMESG000040743.1 SMESG000039279.1 SMESG000038973.1 SMESG000038321.1 SMESG000029893.1 SMESG000028198.1 SMESG000023025.1 SMESG000021897.1 SMESG000018432.1 SMESG000018410.1 SMESG000017430.1 SMESG000006729.1 SMESG000005334.1 dd_Smed_v4_1692_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30000065SMED30000065SMESG000049103.1 dd_Smed_v4_397_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005033vinculinSMESG000028193.1 dd_Smed_v4_3542_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015567Slc42a-1SMESG000048173.1 dd_Smed_v4_3286_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30006777Collagen alpha-1(XV) chainSMESG000081921.1 dd_Smed_v4_3516_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30010330slc25a-34SMESG000046675.1 dd_Smed_v4_2718_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30010330slc25a-34SMESG000046675.1 dd_Smed_v4_4480_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012149NPHS1-7SMESG000016267.1 SMESG000058374.1 dd_Smed_v4_3391_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30002597CalmodulinSMESG000008981.1 dd_Smed_v4_3441_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015589SMED30015589SMESG000063816.1 SMESG000010536.1 SMESG000045280.1 SMESG000029730.1 dd_Smed_v4_4145_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30019453Asparagine rich antigenSMESG000022424.1 dd_Smed_v4_10530_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30008801Heterogeneous nuclear ribonucleoprotein KSMESG000029221.1 dd_Smed_v4_3406_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30014788SMED30014788SMESG000081995.1 SMESG000080328.1 SMESG000080048.1 SMESG000078665.1 SMESG000077025.1 SMESG000076395.1 SMESG000075858.1 SMESG000066691.1 SMESG000062442.1 SMESG000060496.1 SMESG000054975.1 SMESG000054276.1 SMESG000051957.1 SMESG000049162.1 SMESG000046165.1 SMESG000036894.1 SMESG000035648.1 SMESG000034762.1 SMESG000030928.1 SMESG000030475.1 SMESG000030445.1 SMESG000030069.1 SMESG000029693.1 SMESG000029692.1 SMESG000029599.1 SMESG000029355.1 SMESG000027993.1 SMESG000027217.1 SMESG000022058.1 SMESG000020046.1 SMESG000014020.1 SMESG000012961.1 SMESG000010709.1 SMESG000007675.1 SMESG000006952.1 SMESG000004166.1 SMESG000003706.1 SMESG000002779.1 SMESG000002239.1 SMESG000001845.1 SMESG000080313.1 SMESG000066842.1 SMESG000050392.1 SMESG000048356.1 SMESG000042931.1 SMESG000033095.1 SMESG000018900.1 SMESG000017493.1 SMESG000015917.1 SMESG000004121.1 dd_Smed_v4_3574_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30007072Methylmalonyl-CoA epimeraseSMESG000021684.1 dd_Smed_v4_3348_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30017260Pre mRNA processing factor 6SMESG000011657.1 dd_Smed_v4_1153_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005322SMED30005322SMESG000078208.1 dd_Smed_v4_2727_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026658SMED30026658SMESG000008925.1 dd_Smed_v4_376_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020488IgLON family member 5SMESG000029293.1 SMESG000012554.1 dd_Smed_v4_16020_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026407Acetylcholine receptor subunit beta-like proteinSMESG000064521.1 dd_Smed_v4_12146_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032941TNF receptor associated factor 4SMESG000025998.1 SMESG000025982.1 SMESG000025980.1 SMESG000025963.1 SMESG000025934.1 SMESG000025901.1 SMESG000025797.1 SMESG000025794.1 SMESG000025517.1 dd_Smed_v4_1139_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020402SMED30020402SMESG000011919.1 dd_Smed_v4_1147_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED3002165739S ribosomal protein L23SMESG000037729.1 SMESG000037731.1 dd_Smed_v4_2551_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED3002797940S ribosomal protein S27SMESG000066109.1 SMESG000052687.1 SMESG000014240.1 SMESG000069832.1 SMESG000037642.1 dd_Smed_v4_106_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED3002604960S ribosomal protein L35aSMESG000003977.1 dd_Smed_v4_318_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30021186Glyoxylate reductase/hydroxypyruvate reductaseSMESG000004374.1 dd_Smed_v4_3230_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30031646SMED30031646SMESG000010156.1 dd_Smed_v4_105_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30034309FMRFamide-activated amiloride-sensitive sodium channelSMESG000064696.1 dd_Smed_v4_13556_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30023515SMED30023515SMESG000023987.1 SMESG000017232.1 SMESG000080953.1 SMESG000080618.1 SMESG000072700.1 SMESG000069163.1 SMESG000065358.1 SMESG000064426.1 SMESG000062577.1 SMESG000062150.1 SMESG000060043.1 SMESG000057576.1 SMESG000056292.1 SMESG000054362.1 SMESG000052870.1 SMESG000051517.1 SMESG000050768.1 SMESG000050005.1 SMESG000049698.1 SMESG000045813.1 SMESG000041318.1 SMESG000040743.1 SMESG000039279.1 SMESG000038973.1 SMESG000038321.1 SMESG000029893.1 SMESG000028198.1 SMESG000023025.1 SMESG000021897.1 SMESG000018432.1 SMESG000018410.1 SMESG000017430.1 SMESG000006729.1 SMESG000005334.1 dd_Smed_v4_1692_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30023587SMED30023587SMESG000063816.1 SMESG000010536.1 SMESG000045280.1 SMESG000029730.1 dd_Smed_v4_4145_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30021645SMED30021645SMESG000014085.1 SMESG000014086.1 SMESG000014087.1 dd_Smed_v4_10249_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020257DUF3421 domain-containing proteinSMESG000046742.1 dd_Smed_v4_1040_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30024115Ubiquitin-40S ribosomal protein S27aSMESG000048830.1 dd_Smed_v4_121_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020234Kinase D-interacting substrateSMESG000079991.1 dd_Smed_v4_11743_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30031282cAMP-dependent protein kinase regulatory subunitSMESG000078515.1 dd_Smed_v4_13623_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30027701ATP dependent RNA helicase DDX5SMESG000012031.1 dd_Smed_v4_3816_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30027506Ubiquitin-like domain-containing proteinSMESG000066583.1 dd_Smed_v4_14332_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30028043HMG box-containing protein 1SMESG000010590.1 dd_Smed_v4_11388_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30021365SMED30021365SMESG000021960.1 dd_Smed_v4_10157_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032367SMED30032367SMESG000023987.1 SMESG000017232.1 SMESG000080953.1 SMESG000080618.1 SMESG000072700.1 SMESG000069163.1 SMESG000065358.1 SMESG000064426.1 SMESG000062577.1 SMESG000062150.1 SMESG000060043.1 SMESG000057576.1 SMESG000056292.1 SMESG000054362.1 SMESG000052870.1 SMESG000051517.1 SMESG000050768.1 SMESG000050005.1 SMESG000049698.1 SMESG000045813.1 SMESG000041318.1 SMESG000040743.1 SMESG000039279.1 SMESG000038973.1 SMESG000038321.1 SMESG000029893.1 SMESG000028198.1 SMESG000023025.1 SMESG000021897.1 SMESG000018432.1 SMESG000018410.1 SMESG000017430.1 SMESG000006729.1 SMESG000005334.1 dd_Smed_v4_1692_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026987TNF receptor-associated factorSMESG000025998.1 SMESG000025982.1 SMESG000025980.1 SMESG000025963.1 SMESG000025934.1 SMESG000025901.1 SMESG000025797.1 SMESG000025794.1 SMESG000025517.1 dd_Smed_v4_1139_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30027268Histone H1BSMESG000071975.1 dd_Smed_v4_3898_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30031106Ribosomal protein S6 kinaseSMESG000068122.1 dd_Smed_v4_1228_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30027813A disintegrin and metalloproteinase with thrombospondin motifsSMESG000038885.1 dd_Smed_v4_10259_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022511SMED30022511SMESG000019851.1 SMESG000019820.1 dd_Smed_v4_1094_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020437Glutamate receptor ionotropic kainate 3SMESG000005192.1 dd_Smed_v4_13705_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022402Neurogenic locus Notch proteinSMESG000077889.1 dd_Smed_v4_10716_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022614T-complex protein 1 subunit alphaSMESG000067696.1 dd_Smed_v4_1025_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026515Bifunctional purine biosynthesis protein PURHSMESG000009882.1 dd_Smed_v4_3445_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020903THO complex subunit 2SMESG000079934.1 dd_Smed_v4_3159_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED3002751939S ribosomal protein L38, mitochondrialSMESG000074826.1 dd_Smed_v4_3715_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30021652Ras association domain family member 7aSMESG000080298.1 dd_Smed_v4_3722_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30027694SMED30027694SMESG000042511.1 dd_Smed_v4_13560_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020190SMED30020190SMESG000017823.1 dd_Smed_v4_3330_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30023756ATP-dependent RNA helicase DBP2SMESG000012031.1 dd_Smed_v4_3816_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035296ProtocadherinSMESG000014472.1 dd_Smed_v4_11579_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30030183SMED30030183SMESG000020128.1 dd_Smed_v4_12353_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30024775TransgelinSMESG000000987.1 dd_Smed_v4_1512_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30034056Voltage-gated hydrogen channel 1SMESG000070756.1 dd_Smed_v4_15085_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30027562SMED30027562SMESG000022880.1 dd_Smed_v4_3493_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020829KH domain-containing proteinSMESG000069949.1 dd_Smed_v4_11601_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020622SMED30020622SMESG000030693.1 dd_Smed_v4_15045_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020164SMED30020164SMESG000061910.1 dd_Smed_v4_14161_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026513SMED30026513SMESG000005268.1 dd_Smed_v4_1537_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30021266Uncoordinated 5SMESG000073898.1 dd_Smed_v4_10585_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032110TNF receptor-associated factorSMESG000039089.1 dd_Smed_v4_1991_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029564SMED30029564SMESG000028405.1 dd_Smed_v4_12746_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022090N-acetyltransferaseSMESG000026342.1 dd_Smed_v4_1047_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022090N-acetyltransferaseSMESG000026353.1 dd_Smed_v4_2527_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30034299RNA-binding protein 4SMESG000033438.1 dd_Smed_v4_1285_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032416GCR155SMESG000022544.1 SMESG000022542.1 dd_Smed_v4_15854_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032645Heterochromatin protein 1-1SMESG000004606.1 SMESG000004604.1 dd_Smed_v4_928_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032272FMN_red domain-containing proteinSMESG000023871.1 dd_Smed_v4_1834_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30024792Forkhead box protein F1SMESG000075929.1 dd_Smed_v4_15035_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30023527p2X purinoceptor 4SMESG000010795.1 dd_Smed_v4_10968_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032845SMED30032845SMESG000036221.1 dd_Smed_v4_16440_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30021387Glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase 1SMESG000061842.1 dd_Smed_v4_14708_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30006959H/ACA ribonucleoprotein complex subunitSMESG000056130.1 dd_Smed_v4_3239_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015457SMED30015457SMESG000022017.1 dd_Smed_v4_9360_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30004178SMED30004178SMESG000025475.1 dd_Smed_v4_2550_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30017516Collagen alpha-2(IV) chainSMESG000021729.1 dd_Smed_v4_2197_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018687E3 ubiquitin-protein ligase TRIM9SMESG000016119.1 dd_Smed_v4_9989_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015813slc3a-1SMESG000019192.1 SMESG000019184.1 dd_Smed_v4_2113_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015168CalponinSMESG000057599.1 dd_Smed_v4_273_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30003956SMED30003956SMESG000031083.1 dd_Smed_v4_9586_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED3000109640S ribosomal protein S23SMESG000017264.1 dd_Smed_v4_290_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30013808fos-1SMESG000003328.1 dd_Smed_v4_2789_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30013157KHD-1SMESG000070471.1 dd_Smed_v4_294_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30014747Pdz domain containing proteinSMESG000051965.1 dd_Smed_v4_8867_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005190SMED30005190SMESG000041069.1 dd_Smed_v4_237_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30017015Deferrochelatase/peroxidase YfeXSMESG000077723.1 dd_Smed_v4_2999_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018897Phorbol-ester/DAG-type domain-containing proteinSMESG000056465.1 dd_Smed_v4_25349_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018897Phorbol-ester/DAG-type domain-containing proteinSMESG000056465.1 dd_Smed_v4_2451_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30017555Lipopolysaccharide cholinephosphotransferaseSMESG000043355.1 dd_Smed_v4_2367_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30014539cAMP-dependent protein kinase type II regulatory subunitSMESG000019065.1 dd_Smed_v4_2902_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001172Elongation factor 1-betaSMESG000026862.1 dd_Smed_v4_206_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016078Actin, cytoplasmicSMESG000012332.1 SMESG000012317.1 SMESG000058954.1 dd_Smed_v4_246_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016078Actin, cytoplasmicSMESG000012332.1 SMESG000012317.1 dd_Smed_v4_285_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012419Non-specific serine/threonine protein kinaseSMESG000069962.1 SMESG000069953.1 SMESG000069952.1 dd_Smed_v4_3244_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30002010C2H2-type domain-containing proteinSMESG000070998.1 dd_Smed_v4_29263_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30003501Surface proteinSMESG000064752.1 dd_Smed_v4_3240_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30017371Adenylosuccinate lyaseSMESG000014474.1 dd_Smed_v4_2280_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30004756Small nuclear ribonucleoprotein Sm D2SMESG000032344.1 dd_Smed_v4_2994_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30031725SMED30031725SMESG000034628.1 dd_Smed_v4_9307_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022102N terminal kinase protein likeSMESG000008254.1 dd_Smed_v4_3470_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025010Eukaryotic translation initiation factor 3 subunit BSMESG000069603.1 dd_Smed_v4_2302_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30031975SMED30031975SMESG000021174.1 dd_Smed_v4_890_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30027693General transcription factor IIF subunit 2SMESG000026639.1 dd_Smed_v4_2142_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30023062bruno-likeSMESG000021009.1 dd_Smed_v4_2592_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029855Heterogeneous nuclear ribonucleoprotein FSMESG000009582.1 dd_Smed_v4_1957_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED3002950160S acidic ribosomal protein P1SMESG000062259.1 dd_Smed_v4_224_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30023258Cell cycle associated protein 1aSMESG000043092.1 dd_Smed_v4_936_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029269Structural maintenance of chromosomes proteinSMESG000022017.1 dd_Smed_v4_9360_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029349AdenosylhomocysteinaseSMESG000029405.1 dd_Smed_v4_3408_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026877HORMA domain-containing proteinSMESG000066514.1 dd_Smed_v4_2201_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025411ATP-binding cassette sub-family F member 3-likeSMESG000041811.1 dd_Smed_v4_1761_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026225SMED30026225SMESG000059698.1 dd_Smed_v4_188_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30034953SMED30034953SMESG000065075.1 dd_Smed_v4_102_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035963SMED30035963SMESG000071278.1 dd_Smed_v4_1649_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30030699Ephrin type-A receptor 4-BSMESG000077240.1 dd_Smed_v4_16483_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30028361Eukaryotic translation initiation factor 3 subunit FSMESG000005863.1 dd_Smed_v4_1642_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029603SMED30029603SMESG000071278.1 dd_Smed_v4_1649_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025141SMED30025141SMESG000076211.1 SMESG000047610.1 dd_Smed_v4_2124_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30031982NAD(P) transhydrogenase, mitochondrialSMESG000003962.1 dd_Smed_v4_2313_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30024611Terminal nucleotidyltransferase 5CSMESG000016756.1 dd_Smed_v4_3449_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30024611Terminal nucleotidyltransferase 5CSMESG000052359.1 dd_Smed_v4_4154_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026371SMED30026371SMESG000059828.1 dd_Smed_v4_2479_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30027691SMED30027691SMESG000062803.1 dd_Smed_v4_2245_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035984Mitochondrial 39S ribosomal protein L27 L27mtSMESG000071293.1 dd_Smed_v4_1828_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED3002950760S ribosomal protein L12SMESG000006898.1 dd_Smed_v4_259_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30033206GCR027SMESG000000740.1 dd_Smed_v4_24518_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026994SMED30026994SMESG000009315.1 dd_Smed_v4_22779_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029746NFX1-type zinc finger-containing protein 1-likeSMESG000034905.1 dd_Smed_v4_2581_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30033252Cell adhesion molecule-related/down-regulated by oncogenesSMESG000010456.1 SMESG000002915.1 dd_Smed_v4_1968_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001515AnnexinSMESG000042839.1 dd_Smed_v4_1104_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001286DNA polymerase nuSMESG000032684.1 dd_Smed_v4_10383_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30003521Transient receptor potential cation channel subfamily M member-like 2SMESG000005057.1 dd_Smed_v4_11259_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005349DUF4817 domain-containing proteinSMESG000065415.1 dd_Smed_v4_10251_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016546SMED30016546SMESG000051921.1 SMESG000051913.1 dd_Smed_v4_1175_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001272NCOA5SMESG000010804.1 dd_Smed_v4_2395_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30008024NFX1-type zinc finger-containing protein 1-likeSMESG000034891.1 SMESG000034868.1 SMESG000034856.1 dd_Smed_v4_10633_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30010740FERM and pleckstrin domain containing proteinSMESG000038155.1 dd_Smed_v4_14700_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30000038Ribosome-binding protein 1SMESG000031975.1 dd_Smed_v4_1111_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED3000501926S proteasome regulatory subunit 4 homologSMESG000020306.1 dd_Smed_v4_1222_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005845NPHS1-6SMESG000028689.1 dd_Smed_v4_10689_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30006610WW domain-containing oxidoreductaseSMESG000077649.1 dd_Smed_v4_11724_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30003409admp-1aSMESG000059598.1 SMESG000059596.1 SMESG000059595.1 dd_Smed_v4_12939_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30006576Apoptosis inhibitor 5SMESG000000547.1 dd_Smed_v4_2384_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED3000344260S ribosomal protein L23SMESG000023040.1 dd_Smed_v4_242_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30007143Nucleolar GTP-binding protein 2SMESG000026847.1 dd_Smed_v4_1134_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001335Muscarinic acetylcholine receptorSMESG000081829.1 dd_Smed_v4_14482_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30010912SMED30010912SMESG000005057.1 dd_Smed_v4_11259_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30019722secreted frizzled related protein 3SMESG000058717.1 dd_Smed_v4_11070_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015575Collagen alpha-1(IV) chainSMESG000016766.1 dd_Smed_v4_2337_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015257Polypeptide N-acetylgalactosaminyltransferaseSMESG000015194.1 dd_Smed_v4_22933_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015740PDZ/DHR/GLGF domain proteinSMESG000032390.1 dd_Smed_v4_11753_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30000705Serine/threonine-protein kinase OSR1SMESG000066296.1 dd_Smed_v4_1366_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015071Eyes absent homologSMESG000001561.1 dd_Smed_v4_11372_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016088Protein arginine N-methyltransferase 6SMESG000017273.1 dd_Smed_v4_1336_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30004537Proteasome subunit betaSMESG000004962.1 dd_Smed_v4_1264_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30008591Zinc finger MYM-type protein 1SMESG000042368.1 SMESG000042366.1 dd_Smed_v4_14779_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012814Protein CWC15-like proteinSMESG000010770.1 dd_Smed_v4_2881_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30006293SMED30006293SMESG000080447.1 SMESG000080442.1 dd_Smed_v4_10685_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032829Chromo domain-containing proteinSMESG000080004.1 SMESG000079430.1 SMESG000076652.1 SMESG000076091.1 SMESG000076042.1 SMESG000074857.1 SMESG000070393.1 SMESG000069936.1 SMESG000068687.1 SMESG000065866.1 SMESG000065288.1 SMESG000065178.1 SMESG000062279.1 SMESG000061056.1 SMESG000059025.1 SMESG000058180.1 SMESG000057864.1 SMESG000057533.1 SMESG000057427.1 SMESG000055140.1 SMESG000053372.1 SMESG000053240.1 SMESG000050587.1 SMESG000050353.1 SMESG000048922.1 SMESG000047874.1 SMESG000046659.1 SMESG000046053.1 SMESG000043782.1 SMESG000042816.1 SMESG000042302.1 SMESG000040179.1 SMESG000038292.1 SMESG000037212.1 SMESG000034701.1 SMESG000033592.1 SMESG000031049.1 SMESG000029555.1 SMESG000029226.1 SMESG000026530.1 SMESG000024597.1 SMESG000023611.1 SMESG000022236.1 SMESG000021499.1 SMESG000019334.1 SMESG000017989.1 SMESG000013698.1 SMESG000013635.1 SMESG000009102.1 SMESG000008351.1 SMESG000006220.1 SMESG000005221.1 SMESG000001234.1 SMESG000026425.1 dd_Smed_v4_9908_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30027578SMED30027578SMESG000072474.1 SMESG000072473.1 dd_Smed_v4_2635_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30034751Elongation factor G, mitochondrialSMESG000035436.1 dd_Smed_v4_1879_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30030643Methylmalonic aciduria and homocystinuria type D-like protein, mitochondrialSMESG000030431.1 dd_Smed_v4_2046_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029911Pre-mRNA-processing factor 40SMESG000044274.1 dd_Smed_v4_1909_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026979SMED30026979SMESG000076644.1 SMESG000076643.1 dd_Smed_v4_227_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30033020Histone acetyltransferase KAT6ASMESG000038926.1 dd_Smed_v4_11245_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30028353Dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit DAD1SMESG000050730.1 dd_Smed_v4_2109_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30036017SMED30036017SMESG000066362.1 dd_Smed_v4_6570_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035858SMED30035858SMESG000064034.1 SMESG000064035.1 dd_Smed_v4_3054_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30024625Expressed conserved proteinSMESG000056224.1 dd_Smed_v4_2100_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED3002317260s ribosomal protein L14SMESG000022343.1 dd_Smed_v4_167_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30034766EnolaseSMESG000052380.1 dd_Smed_v4_510_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029555Serine/arginine-rich splicing factor 4SMESG000045507.1 SMESG000045502.1 dd_Smed_v4_13817_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029555Serine/arginine-rich splicing factor 4SMESG000045501.1 dd_Smed_v4_473_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30028657SMED30028657SMESG000075746.1 dd_Smed_v4_17980_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED3002418960S ribosomal protein L31SMESG000017099.1 dd_Smed_v4_113_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30034827Histone-lysine N-methyltransferase SETMARSMESG000081574.1 SMESG000081529.1 SMESG000079557.1 SMESG000079250.1 SMESG000077556.1 SMESG000075496.1 SMESG000073961.1 SMESG000073618.1 SMESG000073174.1 SMESG000071859.1 SMESG000071198.1 SMESG000071073.1 SMESG000070153.1 SMESG000068262.1 SMESG000068028.1 SMESG000067334.1 SMESG000065567.1 SMESG000061192.1 SMESG000060952.1 SMESG000060260.1 SMESG000059623.1 SMESG000050492.1 SMESG000050479.1 SMESG000050299.1 SMESG000049776.1 SMESG000048159.1 SMESG000044971.1 SMESG000043973.1 SMESG000042620.1 SMESG000040932.1 SMESG000039792.1 SMESG000039741.1 SMESG000039356.1 SMESG000034716.1 SMESG000033763.1 SMESG000029286.1 SMESG000028614.1 SMESG000027381.1 SMESG000025022.1 SMESG000021522.1 SMESG000020398.1 SMESG000019968.1 SMESG000018320.1 SMESG000015216.1 SMESG000015117.1 SMESG000015102.1 SMESG000013389.1 SMESG000012534.1 SMESG000012464.1 SMESG000011278.1 SMESG000011147.1 SMESG000007021.1 SMESG000006554.1 SMESG000001897.1 SMESG000070487.1 SMESG000068881.1 SMESG000064552.1 SMESG000063831.1 SMESG000056926.1 SMESG000050300.1 SMESG000047318.1 SMESG000047014.1 SMESG000043279.1 SMESG000030931.1 SMESG000023641.1 SMESG000018675.1 SMESG000017256.1 SMESG000013665.1 SMESG000013089.1 SMESG000011196.1 SMESG000009621.1 SMESG000008519.1 SMESG000005066.1 dd_Smed_v4_129_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30033701chromobox protein homolog 1SMESG000055315.1 SMESG000055314.1 SMESG000054375.1 SMESG000054374.1 dd_Smed_v4_4855_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30024125otopetrin-2SMESG000031517.1 dd_Smed_v4_15458_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30034487Ubiquitin carboxyl-terminal hydrolaseSMESG000033580.1 dd_Smed_v4_2505_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30033400DNA replication complex GINS protein SLD5SMESG000062770.1 dd_Smed_v4_23589_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032373Centrosomal protein of 135 kDaSMESG000079518.1 SMESG000070566.1 dd_Smed_v4_6933_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30027246SMED30027246SMESG000047430.1 dd_Smed_v4_20269_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30023385Potassium channel subfamily K member 18SMESG000031911.1 dd_Smed_v4_15695_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30034254calreticulin-1SMESG000009012.1 dd_Smed_v4_220_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032366SMED30032366SMESG000080004.1 SMESG000079430.1 SMESG000076652.1 SMESG000076091.1 SMESG000076042.1 SMESG000074857.1 SMESG000070393.1 SMESG000069936.1 SMESG000068687.1 SMESG000065866.1 SMESG000065288.1 SMESG000065178.1 SMESG000062279.1 SMESG000061056.1 SMESG000059025.1 SMESG000058180.1 SMESG000057864.1 SMESG000057533.1 SMESG000057427.1 SMESG000055140.1 SMESG000053372.1 SMESG000053240.1 SMESG000050587.1 SMESG000050353.1 SMESG000048922.1 SMESG000047874.1 SMESG000046659.1 SMESG000046053.1 SMESG000043782.1 SMESG000042816.1 SMESG000042302.1 SMESG000040179.1 SMESG000038292.1 SMESG000037212.1 SMESG000034701.1 SMESG000033592.1 SMESG000031049.1 SMESG000029555.1 SMESG000029226.1 SMESG000026530.1 SMESG000024597.1 SMESG000023611.1 SMESG000022236.1 SMESG000021499.1 SMESG000019334.1 SMESG000017989.1 SMESG000013698.1 SMESG000013635.1 SMESG000009102.1 SMESG000008351.1 SMESG000006220.1 SMESG000005221.1 SMESG000001234.1 SMESG000026425.1 dd_Smed_v4_9908_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032478SMED30032478SMESG000065350.1 SMESG000058681.1 SMESG000023666.1 dd_Smed_v4_9347_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020341General transcription factor 3C polypeptide 5SMESG000017479.1 dd_Smed_v4_2071_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035004NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 9, mitochondrialSMESG000072630.1 dd_Smed_v4_1524_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30033412CLIP-associating protein 1SMESG000072426.1 dd_Smed_v4_5069_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30034385Elongation of very long chain fatty acids proteinSMESG000045477.1 dd_Smed_v4_2311_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30033688Cleft lip and palate transmembrane protein 1SMESG000033674.1 dd_Smed_v4_2152_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30030477peptidyl prolyl cis trans isomerase FKBP-1SMESG000026331.1 dd_Smed_v4_1921_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001476Transcriptional repressor protein YY1B dd_Smed_v4_6684_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018270SMED30018270 dd_Smed_v4_7704_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012087SMED30012087 dd_Smed_v4_13997_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015961SMED30015961 dd_Smed_v4_26920_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018003SMED30018003 dd_Smed_v4_20524_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30008373SMED30008373 dd_Smed_v4_6046_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30013199SMED30013199 dd_Smed_v4_22630_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016330SMED30016330 dd_Smed_v4_12993_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005825P2X purinoceptor 4SMESG000046729.1 dd_Smed_v4_7865_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30002616NK homeobox 4SMESG000018735.1 dd_Smed_v4_9259_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30002168Spondin-1SMESG000039905.1 dd_Smed_v4_8655_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30003568Chromo domain-containing proteinSMESG000080004.1 SMESG000079430.1 SMESG000076652.1 SMESG000076091.1 SMESG000076042.1 SMESG000074857.1 SMESG000070393.1 SMESG000069936.1 SMESG000068687.1 SMESG000065866.1 SMESG000065288.1 SMESG000065178.1 SMESG000062279.1 SMESG000061056.1 SMESG000059025.1 SMESG000058180.1 SMESG000057864.1 SMESG000057533.1 SMESG000057427.1 SMESG000055140.1 SMESG000053372.1 SMESG000053240.1 SMESG000050587.1 SMESG000050353.1 SMESG000048922.1 SMESG000047874.1 SMESG000046659.1 SMESG000046053.1 SMESG000043782.1 SMESG000042816.1 SMESG000042302.1 SMESG000040179.1 SMESG000038292.1 SMESG000037212.1 SMESG000034701.1 SMESG000033592.1 SMESG000031049.1 SMESG000029555.1 SMESG000029226.1 SMESG000026530.1 SMESG000024597.1 SMESG000023611.1 SMESG000022236.1 SMESG000021499.1 SMESG000019334.1 SMESG000017989.1 SMESG000013698.1 SMESG000013635.1 SMESG000009102.1 SMESG000008351.1 SMESG000006220.1 SMESG000005221.1 SMESG000001234.1 SMESG000026425.1 dd_Smed_v4_9908_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30002807Retrovirus-related Pol polyprotein from transposon dd_Smed_v4_12993_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30011747SMED30011747 dd_Smed_v4_494_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001680SMED30001680SMESG000002033.1 dd_Smed_v4_884_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30002598Histone-lysine N-methyltransferaseSMESG000039926.1 dd_Smed_v4_99_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30002598Histone-lysine N-methyltransferaseSMESG000039925.1 dd_Smed_v4_4755_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30014636Ribose-phosphate pyrophosphokinase dd_Smed_v4_8338_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009030Selenoprotein W dd_Smed_v4_572_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30003343Peptidyl-prolyl cis-trans isomeraseSMESG000038766.1 dd_Smed_v4_686_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30013571NADH dehydrogenase subunit 4L dd_Smed_v4_344_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30000702cytochrome b dd_Smed_v4_344_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30006106Chloride channel accessory 4SMESG000080916.1 dd_Smed_v4_968_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30000734SMED30000734 dd_Smed_v4_19622_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30008579ST13 Hsp70 interacting proteinSMESG000071677.1 SMESG000069228.1 SMESG000017570.1 SMESG000017358.1 SMESG000017347.1 SMESG000013728.1 SMESG000001430.1 dd_Smed_v4_668_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005334SMED30005334 dd_Smed_v4_344_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30010219Reticulon-like proteinSMESG000002945.1 dd_Smed_v4_878_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30003554DDE_3 domain-containing protein dd_Smed_v4_5882_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018200RRM domain-containing protein dd_Smed_v4_8256_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30006208Aconitate hydratase, mitochondrialSMESG000002904.1 dd_Smed_v4_979_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009147SMED30009147 dd_Smed_v4_782_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30002349GATA456-2SMESG000022702.1 dd_Smed_v4_9910_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30006347U2 small nuclear ribonucleoprotein B dd_Smed_v4_2274_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018026SMED30018026 dd_Smed_v4_20524_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005796Transposon Ty3-G Gag-Pol polyprotein dd_Smed_v4_12993_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30013798Dual specificity phosphatase 10 dd_Smed_v4_653_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001214Squamous cell carcinoma antigen recognized by T-cells 3SMESG000008868.1 dd_Smed_v4_6820_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30004246SMED30004246 dd_Smed_v4_344_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30007036Sm domain-containing proteinSMESG000078103.1 dd_Smed_v4_7745_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30000565Dynein heavy chainSMESG000065732.1 dd_Smed_v4_6941_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30010333SMED30010333SMESG000061908.1 dd_Smed_v4_2392_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30007387SMED30007387 dd_Smed_v4_23086_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30007434NADPH:adrenodoxin oxidoreductase, mitochondrialSMESG000050975.1 dd_Smed_v4_8668_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009941Peptidylprolyl isomeraseSMESG000028286.1 SMESG000004790.1 dd_Smed_v4_672_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30011383NEDD8 dd_Smed_v4_403_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30011412Ribosomal protein L37SMESG000055421.1 dd_Smed_v4_74_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30011412Ribosomal protein L37 dd_Smed_v4_97_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30019597Heterogeneous nuclear ribonucleoprotein,putative dd_Smed_v4_757_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30000248Ras-related protein Rab-11ASMESG000016036.1 dd_Smed_v4_4964_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30003909SMED30003909 dd_Smed_v4_9_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001478Dynamin-like proteinSMESG000002033.1 dd_Smed_v4_884_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30010375cytochrome c oxidase subunit I dd_Smed_v4_753_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30008221FTS and Hook-interacting proteinSMESG000025657.1 dd_Smed_v4_9831_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30000428Glutathione S-transferaseSMESG000016836.1 dd_Smed_v4_816_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30010227SMED30010227SMESG000078872.1 dd_Smed_v4_673_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30003686NADH dehydrogenase subunit 2 dd_Smed_v4_505_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30028299DDE_3 domain-containing protein dd_Smed_v4_6389_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029282Potassium voltage-gated channel protein Shal-like ProteinSMESG000081216.1 SMESG000081212.1 dd_Smed_v4_15876_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032853TTF-type domain-containing protein dd_Smed_v4_13305_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029355SMED30029355 dd_Smed_v4_7349_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30033080SMED30033080 dd_Smed_v4_9589_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30028106SMED30028106 dd_Smed_v4_5761_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED3003375660S ribosomal protein L37 dd_Smed_v4_97_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029249Serine/threonine-protein kinase NIM1SMESG000005159.1 dd_Smed_v4_15794_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035631SMED30035631 dd_Smed_v4_339_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029518Selenoprotein W dd_Smed_v4_572_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30028199Placenta specific protein 8 dd_Smed_v4_865_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032377PIGA proteinSMESG000081746.1 dd_Smed_v4_14814_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026678SMED30026678 dd_Smed_v4_3577_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30027947U3 small nucleolar RNA associated 22SMESG000015428.1 dd_Smed_v4_15147_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED3002143360S ribosomal protein L39 dd_Smed_v4_394_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035610SMED30035610SMESG000021277.1 dd_Smed_v4_16056_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30021918Dynein light chain dd_Smed_v4_13760_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035193Heat shock protein 90 dd_Smed_v4_56_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30031471SMED30031471SMESG000050535.1 SMESG000050533.1 dd_Smed_v4_5107_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035174SMED30035174 dd_Smed_v4_6013_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026346CCHC-type domain-containing protein dd_Smed_v4_17809_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30030887SMED30030887 dd_Smed_v4_339_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30027335H/ACA ribonucleoprotein complex subunit 3 dd_Smed_v4_967_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30023707Retrovirus-related Pol polyprotein from transposon dd_Smed_v4_12993_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026581Otopetrin-2-like isoform X1 isoform 2 dd_Smed_v4_7349_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30034101SMED30034101 dd_Smed_v4_3534_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032797DnaJ homolog subfamily A member 1SMESG000012107.1 dd_Smed_v4_147_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30033740SMED30033740 dd_Smed_v4_258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025154SMED30025154 dd_Smed_v4_9589_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029686SMED30029686 dd_Smed_v4_3400_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035464SMED30035464 dd_Smed_v4_3692_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035061SMED30035061 dd_Smed_v4_3400_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022007SMED30022007 dd_Smed_v4_90717_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032757DishevelledSMESG000049876.1 dd_Smed_v4_4639_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30030518Guanine nucleotide-binding protein 3 proteinSMESG000075369.1 dd_Smed_v4_676_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30028689Histone-binding protein RBBP7 dd_Smed_v4_2065_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035671NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 8, mitochondrial dd_Smed_v4_2378_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032656SMED30032656 dd_Smed_v4_5277_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018252Cathepsin L2SMESG000049723.1 dd_Smed_v4_48_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30008392SMED30008392 dd_Smed_v4_12032_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30008971SMED30008971 dd_Smed_v4_11595_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30019454Calcium-dependent protein kinaseSMESG000075370.1 dd_Smed_v4_4019_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30014878C-type lectin domain family 18 member ASMESG000066354.1 SMESG000066348.1 dd_Smed_v4_4737_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018389SMED30018389SMESG000054821.1 dd_Smed_v4_3684_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012778SMED30012778 dd_Smed_v4_17023_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016810ER lumen protein-retaining receptorSMESG000073757.1 dd_Smed_v4_3954_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30004099SMED30004099 dd_Smed_v4_15498_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005911SMED30005911 dd_Smed_v4_12_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016113SMED30016113SMESG000053522.1 dd_Smed_v4_548_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30014863PiggyBac transposable element-derived protein 4 dd_Smed_v4_13954_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30006202SMED30006202 dd_Smed_v4_15845_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30000559Transposon Ty3-I Gag-Pol polyprotein dd_Smed_v4_14472_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30007241SMED30007241 dd_Smed_v4_19475_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30017954Cell division cycle 5 proteinSMESG000035947.1 dd_Smed_v4_4163_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016964AnoctaminSMESG000033730.1 SMESG000033728.1 dd_Smed_v4_6514_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016491SMED30016491SMESG000043799.1 dd_Smed_v4_3767_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30017862Jagged 2-1SMESG000025147.1 dd_Smed_v4_4792_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001449Propionyl-CoA carboxylase subunit beta dd_Smed_v4_513_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001607SMED30001607 dd_Smed_v4_15845_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30010542G_PROTEIN_RECEP_F1_2 domain-containing protein dd_Smed_v4_13860_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30014787cGMP-dependent protein kinaseSMESG000016927.1 dd_Smed_v4_7139_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30014787cGMP-dependent protein kinaseSMESG000016927.1 dd_Smed_v4_27739_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30007223SMED30007223 dd_Smed_v4_17458_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015216SMED30015216SMESG000054494.1 dd_Smed_v4_5907_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30010198SMED30010198 dd_Smed_v4_15845_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30013634SMED30013634 dd_Smed_v4_14761_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30017618Rho GTPase activating protein 24SMESG000036427.1 dd_Smed_v4_6320_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015533MRG-1SMESG000022376.1 dd_Smed_v4_5890_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009718SMED30009718 dd_Smed_v4_12032_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005778SMED30005778 dd_Smed_v4_13855_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30019537Serine/threonine-protein phosphataseSMESG000015282.1 dd_Smed_v4_751_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30013261Retrovirus-related Pol polyprotein from transposon dd_Smed_v4_15498_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012385C2H2-type domain-containing protein dd_Smed_v4_17695_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012307G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000023846.1 dd_Smed_v4_477_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015694Histone H2ASMESG000067932.1 SMESG000067933.1 dd_Smed_v4_5156_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30008707F-box domain-containing proteinSMESG000026800.1 dd_Smed_v4_3719_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED3001266028S ribosomal protein S16 dd_Smed_v4_1539_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016727Protein unc-45 homolog ASMESG000054342.1 dd_Smed_v4_6344_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30017971ANK_REP_REGION domain-containing proteinSMESG000026132.1 dd_Smed_v4_6201_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015352ANK_REP_REGION domain-containing proteinSMESG000078716.1 dd_Smed_v4_9826_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009566SMED30009566SMESG000015985.1 dd_Smed_v4_4240_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30002859SMED30002859 dd_Smed_v4_17458_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30008748acetylcholine receptor subunit alpha-likeSMESG000020665.1 dd_Smed_v4_9799_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022101Down syndrome cell adhesion moleculeSMESG000048977.1 dd_Smed_v4_5856_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30024067Tyrosine-protein kinaseSMESG000056885.1 dd_Smed_v4_4352_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30028494SMED30028494SMESG000081428.1 dd_Smed_v4_6282_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022268SMED30022268SMESG000037949.1 SMESG000037948.1 dd_Smed_v4_316_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30021348Alanine aminotransferaseSMESG000007253.1 SMESG000007248.1 dd_Smed_v4_2988_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025671pim-1SMESG000017137.1 dd_Smed_v4_4012_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025164Protein NDRG4SMESG000065324.1 dd_Smed_v4_2911_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30031197Microtubule-associated protein 4SMESG000068843.1 dd_Smed_v4_7133_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032833TitinSMESG000076529.1 dd_Smed_v4_475_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30033019nou darake like-5SMESG000070953.1 dd_Smed_v4_5102_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30024804Superoxide dismutase [Cu-Zn]SMESG000020880.1 dd_Smed_v4_519_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025925SMED30025925SMESG000073870.1 dd_Smed_v4_359_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30031235Tubulin alpha chainSMESG000017700.1 dd_Smed_v4_648_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020245RAB5 interacting factorSMESG000026673.1 dd_Smed_v4_4780_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30021103Ig-like domain-containing proteinSMESG000042512.1 dd_Smed_v4_6524_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30030448Dual specificity protein phosphatase 10SMESG000078269.1 dd_Smed_v4_3617_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30023081SMED30023081SMESG000043010.1 SMESG000007603.1 dd_Smed_v4_7118_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029432SMED30029432SMESG000057599.1 dd_Smed_v4_635_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029432SMED30029432SMESG000057599.1 dd_Smed_v4_533_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029432SMED30029432SMESG000057599.1 dd_Smed_v4_450_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30027299PBXSMESG000022232.1 SMESG000001913.1 dd_Smed_v4_3098_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029694Kinesin light chainSMESG000023454.1 SMESG000018677.1 SMESG000018676.1 dd_Smed_v4_6449_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025205InnexinSMESG000078684.1 SMESG000060499.1 dd_Smed_v4_6114_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032138SMED30032138SMESG000013334.1 dd_Smed_v4_36108_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022535GTPase activating proteinSMESG000037949.1 SMESG000037948.1 dd_Smed_v4_316_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30023729Cold shock domain proteinSMESG000073546.1 dd_Smed_v4_392_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30024416Potassium channel tetramerization domain containing 1SMESG000067417.1 dd_Smed_v4_3793_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30030829Y-box proteinSMESG000032180.1 dd_Smed_v4_209_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022627SMED30022627SMESG000053935.1 dd_Smed_v4_4504_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30027388SMED30027388SMESG000037904.1 dd_Smed_v4_6832_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025272Laminin subunit gamma-1SMESG000019909.1 dd_Smed_v4_7359_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30034263Trifunctional enzyme subunit alpha, mitochondrialSMESG000061749.1 dd_Smed_v4_863_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30021703PDZ and LIM domain protein 7SMESG000064215.1 dd_Smed_v4_12834_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026602Wnt2-1SMESG000002069.1 dd_Smed_v4_13487_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032243Dnaj subfamily cSMESG000071133.1 dd_Smed_v4_4456_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30034539G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000006006.1 dd_Smed_v4_13150_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30034055U5 small nuclear ribonucleoprotein 200 kDa helicaseSMESG000004936.1 dd_Smed_v4_3022_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026043UTP--glucose-1-phosphate uridylyltransferaseSMESG000043519.1 dd_Smed_v4_3057_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025680Anosmin-1SMESG000033070.1 dd_Smed_v4_13188_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30031431FMRFamide-activated amiloride-sensitive sodium channelSMESG000016913.1 dd_Smed_v4_9790_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30030980S-phase kinase-associated protein 1SMESG000054815.1 dd_Smed_v4_1337_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30031256wntP-2SMESG000066476.1 dd_Smed_v4_7326_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035680Calmodulin-regulated spectrin-associated protein 1SMESG000017885.1 dd_Smed_v4_7356_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30031359Folate receptorSMESG000004287.1 dd_Smed_v4_8103_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025596Ca(2 )/calmodulin-responsive adenylate cyclaseSMESG000023584.1 dd_Smed_v4_4439_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020450Small conductance calcium-activated potassium channel proteinSMESG000036688.1 dd_Smed_v4_13309_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020254Regulator of G-protein signaling 3SMESG000057434.1 dd_Smed_v4_12613_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30033672slc25a-24SMESG000016412.1 dd_Smed_v4_8945_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025332Co-chaperone protein p23-1SMESG000068003.1 dd_Smed_v4_462_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30021366Glutamate receptorSMESG000069665.1 dd_Smed_v4_13399_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30027888Immunoglobulin superfamily member 10SMESG000021154.1 dd_Smed_v4_8690_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30021914SMED30021914SMESG000047681.1 SMESG000016277.1 dd_Smed_v4_4415_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30023907SMED30023907SMESG000042253.1 dd_Smed_v4_13413_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30033424Cytospin-ASMESG000025457.1 dd_Smed_v4_2554_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035493SMED30035493SMESG000075822.1 dd_Smed_v4_4495_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30023117HIV Tat-specific factor 1SMESG000021348.1 dd_Smed_v4_4508_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30024157SMED30024157SMESG000051501.1 dd_Smed_v4_12598_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022676Potassium voltage-gated channel subfamily A member 2SMESG000079731.1 dd_Smed_v4_14835_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30017896Activator of 90 kDa heat shock protein ATPase-like protein 1SMESG000066442.1 dd_Smed_v4_2497_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30017151E3 ubiquitin-protein ligase UBR4SMESG000020271.1 dd_Smed_v4_2422_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012293SPT16SMESG000033905.1 dd_Smed_v4_2595_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018877RNA-binding protein 39SMESG000003347.1 dd_Smed_v4_1932_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30011728Disks large-like protein 5SMESG000059889.1 dd_Smed_v4_2209_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30017754SMED30017754SMESG000043124.1 dd_Smed_v4_3018_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005936TitinSMESG000005752.1 dd_Smed_v4_2438_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005936TitinSMESG000005752.1 dd_Smed_v4_22711_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30000190SMED30000190SMESG000043124.1 dd_Smed_v4_3018_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30006541SMED30006541SMESG000012332.1 SMESG000012317.1 SMESG000058954.1 dd_Smed_v4_246_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001679Calcium-transporting ATPaseSMESG000014734.1 dd_Smed_v4_1721_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016664SMED30016664SMESG000011618.1 dd_Smed_v4_2370_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED3001361360S ribosomal protein L26SMESG000066644.1 dd_Smed_v4_235_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30000247SMED30000247SMESG000023639.1 SMESG000023635.1 dd_Smed_v4_3360_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30004791tumor suppressor candidate 3SMESG000016218.1 dd_Smed_v4_2352_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001873SMED30001873SMESG000016249.1 dd_Smed_v4_2556_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018637Heat shock cognate 70 kDa proteinSMESG000040632.1 dd_Smed_v4_15_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001933Heterogeneous nuclear ribonucleoproteinSMESG000055008.1 dd_Smed_v4_2383_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30014813Y box protein-1SMESG000058013.1 dd_Smed_v4_35_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED3000985940S ribosomal protein S24SMESG000035929.1 dd_Smed_v4_164_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30006221PHB domain-containing proteinSMESG000037334.1 dd_Smed_v4_6396_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009776Collagen IV NC1 domain-containing proteinSMESG000066546.1 dd_Smed_v4_2500_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009776Collagen IV NC1 domain-containing proteinSMESG000066546.1 dd_Smed_v4_3747_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30000245Zinc finger protein 112-likeSMESG000072474.1 SMESG000072473.1 dd_Smed_v4_2635_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30014946SMED30014946SMESG000013600.1 dd_Smed_v4_2499_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009729G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000010008.1 dd_Smed_v4_24203_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30004532Y box protein-1SMESG000058013.1 dd_Smed_v4_35_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30006369Integrin betaSMESG000045564.1 dd_Smed_v4_2017_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005428CIP29SMESG000073815.1 dd_Smed_v4_2297_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30014413RNA-binding protein with serine-rich domainSMESG000010413.1 dd_Smed_v4_1431_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012826SMED30012826SMESG000017012.1 SMESG000017011.1 dd_Smed_v4_309_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005837SMED30005837SMESG000016663.1 dd_Smed_v4_229_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015265translocon associated protein subunit deltaSMESG000067948.1 dd_Smed_v4_2051_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30007498Ribosomal protein L19SMESG000057653.1 dd_Smed_v4_228_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30000289SMED30000289SMESG000076644.1 SMESG000076643.1 dd_Smed_v4_227_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015413ras-related protein Rab-28-likeSMESG000007739.1 SMESG000007738.1 dd_Smed_v4_375_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009007SMED30009007SMESG000005752.1 dd_Smed_v4_2438_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015211SMED30015211SMESG000026762.1 dd_Smed_v4_3134_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30008744Cyclin-KSMESG000004055.1 dd_Smed_v4_2558_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005154SMED30005154SMESG000049720.1 SMESG000049718.1 dd_Smed_v4_2225_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035880methyl-CpG binding domain 2/3SMESG000064034.1 SMESG000064035.1 dd_Smed_v4_3054_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30021328SMED30021328SMESG000028190.1 dd_Smed_v4_17722_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30021151Corepressor interacting with RBPJ 1SMESG000027503.1 SMESG000027499.1 dd_Smed_v4_1892_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30033346Obg-like ATPase 1SMESG000061866.1 dd_Smed_v4_2199_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020925Pre-mRNA-processing-splicing factor 8SMESG000033553.1 SMESG000033568.1 SMESG000033550.1 dd_Smed_v4_2504_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026328Apoptosis-stimulating of p53 protein 1SMESG000029015.1 dd_Smed_v4_6453_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035317Phosphoglycerate kinaseSMESG000039090.1 dd_Smed_v4_972_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30031265Scavenger receptor class B member 1SMESG000058914.1 dd_Smed_v4_2951_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029494Heat shock protein 70SMESG000051815.1 dd_Smed_v4_1459_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30031260SMED30031260SMESG000013211.1 dd_Smed_v4_2357_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022929WntASMESG000051375.1 SMESG000037126.1 dd_Smed_v4_4877_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032703SKIP_SNW domain-containing proteinSMESG000061372.1 dd_Smed_v4_2325_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30028462Zinc finger protein castor-like protein 1SMESG000024266.1 dd_Smed_v4_2206_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30033090Hypoxia up-regulated protein 1SMESG000054253.1 dd_Smed_v4_2324_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30021485SMED30021485SMESG000059844.1 dd_Smed_v4_1328_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30031058Galanin receptor type 2SMESG000043375.1 SMESG000043376.1 dd_Smed_v4_18897_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035359SMED30035359SMESG000081574.1 SMESG000081529.1 SMESG000079557.1 SMESG000079250.1 SMESG000077556.1 SMESG000075496.1 SMESG000073961.1 SMESG000073618.1 SMESG000073174.1 SMESG000071859.1 SMESG000071198.1 SMESG000071073.1 SMESG000070153.1 SMESG000068262.1 SMESG000068028.1 SMESG000067334.1 SMESG000065567.1 SMESG000061192.1 SMESG000060952.1 SMESG000060260.1 SMESG000059623.1 SMESG000050492.1 SMESG000050479.1 SMESG000050299.1 SMESG000049776.1 SMESG000048159.1 SMESG000044971.1 SMESG000043973.1 SMESG000042620.1 SMESG000040932.1 SMESG000039792.1 SMESG000039741.1 SMESG000039356.1 SMESG000034716.1 SMESG000033763.1 SMESG000029286.1 SMESG000028614.1 SMESG000027381.1 SMESG000025022.1 SMESG000021522.1 SMESG000020398.1 SMESG000019968.1 SMESG000018320.1 SMESG000015216.1 SMESG000015117.1 SMESG000015102.1 SMESG000013389.1 SMESG000012534.1 SMESG000012464.1 SMESG000011278.1 SMESG000011147.1 SMESG000007021.1 SMESG000006554.1 SMESG000001897.1 SMESG000070487.1 SMESG000068881.1 SMESG000064552.1 SMESG000063831.1 SMESG000056926.1 SMESG000050300.1 SMESG000047318.1 SMESG000047014.1 SMESG000043279.1 SMESG000030931.1 SMESG000023641.1 SMESG000018675.1 SMESG000017256.1 SMESG000013665.1 SMESG000013089.1 SMESG000011196.1 SMESG000009621.1 SMESG000008519.1 SMESG000005066.1 dd_Smed_v4_129_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30023558Autophagy-related protein 3SMESG000062512.1 dd_Smed_v4_1915_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032014GCR320SMESG000028490.1 dd_Smed_v4_17008_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30027608SMED30027608SMESG000023253.1 dd_Smed_v4_1757_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035002GOLD domain-containing proteinSMESG000034989.1 dd_Smed_v4_2557_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026121Ectonucleotide pyrophosphatase/phosphodiesterase family member 6SMESG000040292.1 dd_Smed_v4_1269_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035143PiggyBac transposable element-derived protein 2SMESG000066442.1 dd_Smed_v4_2497_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026239Lysine--tRNA ligaseSMESG000001545.1 dd_Smed_v4_1118_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30030042Muscleblind proteinSMESG000056772.1 dd_Smed_v4_17985_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032774Four and A half lim domainsSMESG000074426.1 dd_Smed_v4_5014_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035063SOXP-2SMESG000074761.1 dd_Smed_v4_8483_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30023645SMED30023645SMESG000077254.1 dd_Smed_v4_16969_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30024587TNF receptor-associated factorSMESG000081574.1 SMESG000081529.1 SMESG000079557.1 SMESG000079250.1 SMESG000077556.1 SMESG000075496.1 SMESG000073961.1 SMESG000073618.1 SMESG000073174.1 SMESG000071859.1 SMESG000071198.1 SMESG000071073.1 SMESG000070153.1 SMESG000068262.1 SMESG000068028.1 SMESG000067334.1 SMESG000065567.1 SMESG000061192.1 SMESG000060952.1 SMESG000060260.1 SMESG000059623.1 SMESG000050492.1 SMESG000050479.1 SMESG000050299.1 SMESG000049776.1 SMESG000048159.1 SMESG000044971.1 SMESG000043973.1 SMESG000042620.1 SMESG000040932.1 SMESG000039792.1 SMESG000039741.1 SMESG000039356.1 SMESG000034716.1 SMESG000033763.1 SMESG000029286.1 SMESG000028614.1 SMESG000027381.1 SMESG000025022.1 SMESG000021522.1 SMESG000020398.1 SMESG000019968.1 SMESG000018320.1 SMESG000015216.1 SMESG000015117.1 SMESG000015102.1 SMESG000013389.1 SMESG000012534.1 SMESG000012464.1 SMESG000011278.1 SMESG000011147.1 SMESG000007021.1 SMESG000006554.1 SMESG000001897.1 SMESG000070487.1 SMESG000068881.1 SMESG000064552.1 SMESG000063831.1 SMESG000056926.1 SMESG000050300.1 SMESG000047318.1 SMESG000047014.1 SMESG000043279.1 SMESG000030931.1 SMESG000023641.1 SMESG000018675.1 SMESG000017256.1 SMESG000013665.1 SMESG000013089.1 SMESG000011196.1 SMESG000009621.1 SMESG000008519.1 SMESG000005066.1 dd_Smed_v4_129_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012092SMED30012092SMESG000073142.1 dd_Smed_v4_1835_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30019820PiggyBac transposable element-derived protein 4SMESG000065350.1 SMESG000058681.1 SMESG000023666.1 dd_Smed_v4_9347_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016287Reverse transcriptase domain-containing proteinSMESG000081574.1 SMESG000081529.1 SMESG000079557.1 SMESG000079250.1 SMESG000077556.1 SMESG000075496.1 SMESG000073961.1 SMESG000073618.1 SMESG000073174.1 SMESG000071859.1 SMESG000071198.1 SMESG000071073.1 SMESG000070153.1 SMESG000068262.1 SMESG000068028.1 SMESG000067334.1 SMESG000065567.1 SMESG000061192.1 SMESG000060952.1 SMESG000060260.1 SMESG000059623.1 SMESG000050492.1 SMESG000050479.1 SMESG000050299.1 SMESG000049776.1 SMESG000048159.1 SMESG000044971.1 SMESG000043973.1 SMESG000042620.1 SMESG000040932.1 SMESG000039792.1 SMESG000039741.1 SMESG000039356.1 SMESG000034716.1 SMESG000033763.1 SMESG000029286.1 SMESG000028614.1 SMESG000027381.1 SMESG000025022.1 SMESG000021522.1 SMESG000020398.1 SMESG000019968.1 SMESG000018320.1 SMESG000015216.1 SMESG000015117.1 SMESG000015102.1 SMESG000013389.1 SMESG000012534.1 SMESG000012464.1 SMESG000011278.1 SMESG000011147.1 SMESG000007021.1 SMESG000006554.1 SMESG000001897.1 SMESG000070487.1 SMESG000068881.1 SMESG000064552.1 SMESG000063831.1 SMESG000056926.1 SMESG000050300.1 SMESG000047318.1 SMESG000047014.1 SMESG000043279.1 SMESG000030931.1 SMESG000023641.1 SMESG000018675.1 SMESG000017256.1 SMESG000013665.1 SMESG000013089.1 SMESG000011196.1 SMESG000009621.1 SMESG000008519.1 SMESG000005066.1 dd_Smed_v4_129_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016327Ras GTPase-activating protein SynGAPSMESG000060891.1 SMESG000060888.1 SMESG000060447.1 dd_Smed_v4_11115_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30010187HTH CENPB-type domain-containing proteinSMESG000049778.1 SMESG000048378.1 SMESG000039423.1 SMESG000024543.1 SMESG000022136.1 SMESG000002434.1 SMESG000078403.1 dd_Smed_v4_12879_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30006399SMED30006399SMESG000075746.1 dd_Smed_v4_17980_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30011480XylosyltransferaseSMESG000025103.1 dd_Smed_v4_11313_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015723RNA-binding protein MusashiSMESG000045507.1 SMESG000045502.1 dd_Smed_v4_13817_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018004SMED30018004SMESG000039905.1 dd_Smed_v4_8655_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30019057SMED30019057SMESG000016216.1 dd_Smed_v4_2283_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012869Y-box-binding protein 1SMESG000032189.1 dd_Smed_v4_114_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012726SMED30012726SMESG000081574.1 SMESG000081529.1 SMESG000079557.1 SMESG000079250.1 SMESG000077556.1 SMESG000075496.1 SMESG000073961.1 SMESG000073618.1 SMESG000073174.1 SMESG000071859.1 SMESG000071198.1 SMESG000071073.1 SMESG000070153.1 SMESG000068262.1 SMESG000068028.1 SMESG000067334.1 SMESG000065567.1 SMESG000061192.1 SMESG000060952.1 SMESG000060260.1 SMESG000059623.1 SMESG000050492.1 SMESG000050479.1 SMESG000050299.1 SMESG000049776.1 SMESG000048159.1 SMESG000044971.1 SMESG000043973.1 SMESG000042620.1 SMESG000040932.1 SMESG000039792.1 SMESG000039741.1 SMESG000039356.1 SMESG000034716.1 SMESG000033763.1 SMESG000029286.1 SMESG000028614.1 SMESG000027381.1 SMESG000025022.1 SMESG000021522.1 SMESG000020398.1 SMESG000019968.1 SMESG000018320.1 SMESG000015216.1 SMESG000015117.1 SMESG000015102.1 SMESG000013389.1 SMESG000012534.1 SMESG000012464.1 SMESG000011278.1 SMESG000011147.1 SMESG000007021.1 SMESG000006554.1 SMESG000001897.1 SMESG000070487.1 SMESG000068881.1 SMESG000064552.1 SMESG000063831.1 SMESG000056926.1 SMESG000050300.1 SMESG000047318.1 SMESG000047014.1 SMESG000043279.1 SMESG000030931.1 SMESG000023641.1 SMESG000018675.1 SMESG000017256.1 SMESG000013665.1 SMESG000013089.1 SMESG000011196.1 SMESG000009621.1 SMESG000008519.1 SMESG000005066.1 dd_Smed_v4_129_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30019477Glucosidase 2 subunit betaSMESG000051850.1 dd_Smed_v4_1730_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30004731FMRFamide-activated amiloride-sensitive sodium channelSMESG000039581.1 dd_Smed_v4_18385_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED300184652',3'-cyclic nucleotide 3'-phosphodiesteraseSMESG000060338.1 dd_Smed_v4_2431_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015365Lysophosphatidic acid phosphatase type 6SMESG000000025.1 dd_Smed_v4_13744_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018630High mobility group proteinSMESG000052032.1 dd_Smed_v4_1331_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30019884Four and a half LIM domains 5SMESG000036525.1 dd_Smed_v4_3385_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30014130ATP synthase subunit fSMESG000067649.1 SMESG000060121.1 dd_Smed_v4_776_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012990G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000032545.1 dd_Smed_v4_17171_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016154SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily B member 1SMESG000018094.1 dd_Smed_v4_1963_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30002880Tetratricopeptide repeat domain 17SMESG000036512.1 dd_Smed_v4_11405_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018069DDE_Tnp_IS1595 domain-containing proteinSMESG000065350.1 SMESG000058681.1 SMESG000023666.1 dd_Smed_v4_9347_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30023733Sodium/potassium-transporting ATPase subunit beta-2SMESG000071416.1 dd_Smed_v4_7917_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30024412Guanine nucleotide-binding protein subunit gammaSMESG000014262.1 dd_Smed_v4_2883_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029822Neuronal acetylcholine receptor subunit alpha-4SMESG000021568.1 dd_Smed_v4_9503_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30023819BZIP domain-containing proteinSMESG000057821.1 dd_Smed_v4_8835_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029786usf proteinSMESG000064300.1 dd_Smed_v4_4871_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022937RNA polymerase-associated protein RTF1-like proteinSMESG000029426.1 dd_Smed_v4_887_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30023135Exonuclease 3'-5' domain-containing protein 1SMESG000053185.1 dd_Smed_v4_6723_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026663Tropomyosin Tod p 1.0102SMESG000074053.1 dd_Smed_v4_405_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30028559Serine/threonine kinase 32ASMESG000026303.1 dd_Smed_v4_6683_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30030789Homeobox domain-containing proteinSMESG000049852.1 dd_Smed_v4_7324_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30027044SMED30027044SMESG000024306.1 dd_Smed_v4_2634_0_2dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30024961Transformer-2 betaSMESG000052833.1 dd_Smed_v4_4073_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30024538Beta-amyloid-like proteinSMESG000025222.1 SMESG000025214.1 SMESG000025213.1 dd_Smed_v4_2561_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025907c-SKI_SMAD_bind domain-containing proteinSMESG000075612.1 SMESG000026079.1 SMESG000018825.1 SMESG000002232.1 dd_Smed_v4_6759_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30030752Tripartite motif-containing protein 2SMESG000023375.1 dd_Smed_v4_8395_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025338E3 ubiquitin-protein ligase CBLSMESG000072524.1 SMESG000072522.1 dd_Smed_v4_330_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020990Eukaryotic translation initiation factor 2 subunit 2SMESG000081574.1 SMESG000081529.1 SMESG000079557.1 SMESG000079250.1 SMESG000077556.1 SMESG000075496.1 SMESG000073961.1 SMESG000073618.1 SMESG000073174.1 SMESG000071859.1 SMESG000071198.1 SMESG000071073.1 SMESG000070153.1 SMESG000068262.1 SMESG000068028.1 SMESG000067334.1 SMESG000065567.1 SMESG000061192.1 SMESG000060952.1 SMESG000060260.1 SMESG000059623.1 SMESG000050492.1 SMESG000050479.1 SMESG000050299.1 SMESG000049776.1 SMESG000048159.1 SMESG000044971.1 SMESG000043973.1 SMESG000042620.1 SMESG000040932.1 SMESG000039792.1 SMESG000039741.1 SMESG000039356.1 SMESG000034716.1 SMESG000033763.1 SMESG000029286.1 SMESG000028614.1 SMESG000027381.1 SMESG000025022.1 SMESG000021522.1 SMESG000020398.1 SMESG000019968.1 SMESG000018320.1 SMESG000015216.1 SMESG000015117.1 SMESG000015102.1 SMESG000013389.1 SMESG000012534.1 SMESG000012464.1 SMESG000011278.1 SMESG000011147.1 SMESG000007021.1 SMESG000006554.1 SMESG000001897.1 SMESG000070487.1 SMESG000068881.1 SMESG000064552.1 SMESG000063831.1 SMESG000056926.1 SMESG000050300.1 SMESG000047318.1 SMESG000047014.1 SMESG000043279.1 SMESG000030931.1 SMESG000023641.1 SMESG000018675.1 SMESG000017256.1 SMESG000013665.1 SMESG000013089.1 SMESG000011196.1 SMESG000009621.1 SMESG000008519.1 SMESG000005066.1 dd_Smed_v4_129_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022935Small ubiquitin-related modifierSMESG000056595.1 dd_Smed_v4_265_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30030917SMED30030917SMESG000009451.1 dd_Smed_v4_2363_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025008SMED30025008SMESG000051756.1 dd_Smed_v4_9692_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30023812Protein canopy-like protein 3SMESG000068798.1 dd_Smed_v4_4234_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30024839Mitochondrial ATP synthase subunit bSMESG000077800.1 dd_Smed_v4_905_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30023860ParamyosinSMESG000058328.1 dd_Smed_v4_711_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020701Long-chain specific acyl-CoA dehydrogenaseSMESG000081574.1 SMESG000081529.1 SMESG000079557.1 SMESG000079250.1 SMESG000077556.1 SMESG000075496.1 SMESG000073961.1 SMESG000073618.1 SMESG000073174.1 SMESG000071859.1 SMESG000071198.1 SMESG000071073.1 SMESG000070153.1 SMESG000068262.1 SMESG000068028.1 SMESG000067334.1 SMESG000065567.1 SMESG000061192.1 SMESG000060952.1 SMESG000060260.1 SMESG000059623.1 SMESG000050492.1 SMESG000050479.1 SMESG000050299.1 SMESG000049776.1 SMESG000048159.1 SMESG000044971.1 SMESG000043973.1 SMESG000042620.1 SMESG000040932.1 SMESG000039792.1 SMESG000039741.1 SMESG000039356.1 SMESG000034716.1 SMESG000033763.1 SMESG000029286.1 SMESG000028614.1 SMESG000027381.1 SMESG000025022.1 SMESG000021522.1 SMESG000020398.1 SMESG000019968.1 SMESG000018320.1 SMESG000015216.1 SMESG000015117.1 SMESG000015102.1 SMESG000013389.1 SMESG000012534.1 SMESG000012464.1 SMESG000011278.1 SMESG000011147.1 SMESG000007021.1 SMESG000006554.1 SMESG000001897.1 SMESG000070487.1 SMESG000068881.1 SMESG000064552.1 SMESG000063831.1 SMESG000056926.1 SMESG000050300.1 SMESG000047318.1 SMESG000047014.1 SMESG000043279.1 SMESG000030931.1 SMESG000023641.1 SMESG000018675.1 SMESG000017256.1 SMESG000013665.1 SMESG000013089.1 SMESG000011196.1 SMESG000009621.1 SMESG000008519.1 SMESG000005066.1 dd_Smed_v4_129_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020388Glycerol-3-phosphate dehydrogenaseSMESG000076995.1 SMESG000076994.1 SMESG000076983.1 SMESG000076982.1 dd_Smed_v4_4928_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025561SMED30025561SMESG000023796.1 SMESG000022519.1 dd_Smed_v4_4282_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022796phosphatidylinositide phosphatase SAC2SMESG000079090.1 dd_Smed_v4_6584_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022691Expressed conserved proteinSMESG000024365.1 dd_Smed_v4_9325_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30030625Guanine nucleotide-binding protein G(o) subunit alphaSMESG000081487.1 dd_Smed_v4_9715_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30028061Bicaudal D proteinSMESG000060877.1 dd_Smed_v4_7219_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30027092SMED30027092SMESG000078236.1 SMESG000032651.1 dd_Smed_v4_4949_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022575pescadillo-1SMESG000032689.1 dd_Smed_v4_900_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026171SMED30026171SMESG000021782.1 dd_Smed_v4_2350_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022128ATP synthase subunit betaSMESG000036539.1 dd_Smed_v4_745_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30021159phosphatidylinositide phosphatase SAC2SMESG000079090.1 dd_Smed_v4_6584_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30028856Protein kinase CSMESG000021192.1 dd_Smed_v4_657_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30030326SMED30030326SMESG000001071.1 SMESG000001061.1 SMESG000001060.1 dd_Smed_v4_9824_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022035Dihydroorotate dehydrogenase (Quinone), mitochondrialSMESG000065729.1 dd_Smed_v4_4266_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30021949SMED30021949SMESG000025657.1 dd_Smed_v4_9831_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30014599Cell adhesion molecule-related/down-regulated by oncogenes isoform 2SMESG000063656.1 dd_Smed_v4_13217_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30006547SMED30006547SMESG000016698.1 dd_Smed_v4_13460_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015938C2H2-type domain-containing proteinSMESG000065334.1 dd_Smed_v4_1345_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005785SMED30005785SMESG000008183.1 dd_Smed_v4_13129_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30000107Arrestin_C domain-containing proteinSMESG000006781.1 dd_Smed_v4_8715_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30013935Eukaryotic translation initiation factor 5BSMESG000012316.1 dd_Smed_v4_1274_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30003645slc35a-3SMESG000020105.1 dd_Smed_v4_8149_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED3000905260S ribosomal protein L18SMESG000017166.1 dd_Smed_v4_128_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009213SMED30009213SMESG000036688.1 dd_Smed_v4_13309_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED300139585-hydroxytryptamine (Serotonin) receptor 2A, G protein-coupledSMESG000031149.1 dd_Smed_v4_13509_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30008639MyoD-like proteinSMESG000034317.1 dd_Smed_v4_12634_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009513Glycine amidinotransferase, mitochondrialSMESG000051953.1 dd_Smed_v4_899_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30008726Proteasome subunit alpha typeSMESG000074706.1 SMESG000074700.1 dd_Smed_v4_1278_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30007769SMED30007769SMESG000033620.1 dd_Smed_v4_14187_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016666SMED30016666SMESG000016698.1 dd_Smed_v4_13460_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30017051EGF-like domain-containing proteinSMESG000016698.1 dd_Smed_v4_13460_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30006109SMED30006109SMESG000081496.1 dd_Smed_v4_1273_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30002454Staphylococcal nuclease domain-containing proteinSMESG000062403.1 dd_Smed_v4_906_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED3000257426S proteasome regulatory subunit N11SMESG000056298.1 SMESG000056198.1 dd_Smed_v4_2126_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30002414Delta-like proteinSMESG000022173.1 dd_Smed_v4_13823_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015565N-alpha-acetyltransferase 16, NatA auxiliary subunit-like ProteinSMESG000044312.1 dd_Smed_v4_1343_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30004284InnexinSMESG000048827.1 dd_Smed_v4_13392_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30033594Microtubule-associated protein 1ASMESG000014298.1 dd_Smed_v4_1301_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30033594Microtubule-associated protein 1ASMESG000014298.1 dd_Smed_v4_3654_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED3003090860S ribosomal protein L27SMESG000045074.1 dd_Smed_v4_200_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035878Collagen alpha-1(XXVII) chain BSMESG000026651.1 SMESG000026649.1 dd_Smed_v4_649_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30034681cAMP-dependent protein kinase catalytic subunitSMESG000016651.1 dd_Smed_v4_911_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032957Diacylglycerol kinaseSMESG000023623.1 SMESG000017153.1 dd_Smed_v4_7792_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30031345Pyruvate dehydrogenase E1 component subunit alphaSMESG000073271.1 dd_Smed_v4_1310_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30033257Cytochrome c oxidase subunit 5BSMESG000050948.1 dd_Smed_v4_861_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022331Translocon-associated protein, gamma subunitSMESG000066628.1 dd_Smed_v4_1265_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020821SMED30020821SMESG000014298.1 dd_Smed_v4_1301_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035008Dipeptidyl peptidase 4SMESG000018885.1 dd_Smed_v4_9183_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022819SMED30022819SMESG000017227.1 dd_Smed_v4_8264_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032295COP9 signalosome complex subunit 2SMESG000023422.1 dd_Smed_v4_4989_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30023015LIM/homeobox proteinSMESG000001774.1 dd_Smed_v4_8190_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED3003065026S proteasome regulatory subunit 6BSMESG000022591.1 dd_Smed_v4_1279_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029676peptidyl prolyl cis trans isomerase FKBP-2SMESG000078014.1 dd_Smed_v4_3023_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020704Poly [ADP-ribose] polymeraseSMESG000067451.1 SMESG000060010.1 dd_Smed_v4_6154_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020634SMED30020634SMESG000081436.1 dd_Smed_v4_9784_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026577Acetyl-CoA C-acetyltransferaseSMESG000057173.1 dd_Smed_v4_5627_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020478negative regulator of reactive oxygen species-likeSMESG000080200.1 dd_Smed_v4_9875_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30023280TitinSMESG000041478.1 dd_Smed_v4_2928_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30027802Uroporphyrinogen-III synthaseSMESG000035357.1 dd_Smed_v4_4258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30031435SMED30031435SMESG000020814.1 dd_Smed_v4_5728_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029741SMED30029741SMESG000056346.1 dd_Smed_v4_2250_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30033426SMED30033426SMESG000028228.1 dd_Smed_v4_7872_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30007410TNF receptor-associated factor 2SMESG000018435.1 SMESG000018409.1 dd_Smed_v4_1110_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30011528PDZ and LIM domain proteinSMESG000015397.1 dd_Smed_v4_4618_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015546Cyclic AMP-responsive element-binding protein 3SMESG000059546.1 dd_Smed_v4_1032_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005280SMED30005280SMESG000077104.1 dd_Smed_v4_4063_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30000316Interferon-induced GTP-binding protein Mx1SMESG000002219.1 SMESG000002216.1 SMESG000002004.1 dd_Smed_v4_3169_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30014044SMED30014044SMESG000079607.1 SMESG000072955.1 SMESG000049847.1 SMESG000049844.1 SMESG000049832.1 SMESG000049812.1 SMESG000049806.1 SMESG000049805.1 SMESG000049772.1 SMESG000049767.1 SMESG000049756.1 SMESG000049745.1 SMESG000049740.1 SMESG000049739.1 SMESG000049695.1 SMESG000049688.1 SMESG000049683.1 SMESG000049676.1 SMESG000049665.1 SMESG000049663.1 SMESG000049647.1 SMESG000049621.1 SMESG000049614.1 SMESG000049601.1 SMESG000049567.1 SMESG000049548.1 SMESG000040301.1 SMESG000040257.1 SMESG000032755.1 SMESG000032715.1 SMESG000022696.1 SMESG000022691.1 SMESG000022676.1 SMESG000022665.1 SMESG000022640.1 SMESG000022619.1 SMESG000022612.1 dd_Smed_v4_490_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30004876Nuclear receptor subfamily 4 group ASMESG000063104.1 dd_Smed_v4_12229_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30007734U2 snRNP auxiliary factor large subunitSMESG000018652.1 SMESG000018647.1 dd_Smed_v4_3025_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30008917Tubulin alpha chainSMESG000079650.1 SMESG000010171.1 dd_Smed_v4_124_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012966SMED30012966SMESG000079607.1 SMESG000072955.1 SMESG000049847.1 SMESG000049844.1 SMESG000049832.1 SMESG000049812.1 SMESG000049806.1 SMESG000049805.1 SMESG000049772.1 SMESG000049767.1 SMESG000049756.1 SMESG000049745.1 SMESG000049740.1 SMESG000049739.1 SMESG000049695.1 SMESG000049688.1 SMESG000049683.1 SMESG000049676.1 SMESG000049665.1 SMESG000049663.1 SMESG000049647.1 SMESG000049621.1 SMESG000049614.1 SMESG000049601.1 SMESG000049567.1 SMESG000049548.1 SMESG000040301.1 SMESG000040257.1 SMESG000032755.1 SMESG000032715.1 SMESG000022696.1 SMESG000022691.1 SMESG000022676.1 SMESG000022665.1 SMESG000022640.1 SMESG000022619.1 SMESG000022612.1 dd_Smed_v4_490_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30007276SMED30007276SMESG000014766.1 dd_Smed_v4_10073_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016693InnexinSMESG000059204.1 dd_Smed_v4_3985_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30000112glutathione hydrolase 1 proenzyme isoform X2SMESG000047031.1 dd_Smed_v4_4591_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009224early growth response-3SMESG000000959.1 dd_Smed_v4_12410_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009224early growth response-3SMESG000000959.1 dd_Smed_v4_14711_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30006119X-box-binding protein 1SMESG000048111.1 dd_Smed_v4_415_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30008904Kinesin-associated protein 3SMESG000038958.1 dd_Smed_v4_4094_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30010611Tudor and KH domain containing-1SMESG000075675.1 dd_Smed_v4_3961_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015031COX assembly mitochondrial proteinSMESG000036571.1 dd_Smed_v4_6296_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30017135Dual specificity mitogen-activated protein kinase kinase 6SMESG000017824.1 dd_Smed_v4_1568_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30002742DystoninSMESG000043809.1 SMESG000043799.1 dd_Smed_v4_1205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30007747Dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit 1SMESG000070862.1 dd_Smed_v4_853_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012426SMED30012426SMESG000081547.1 dd_Smed_v4_12193_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30017945Fibrillar collagenSMESG000045473.1 dd_Smed_v4_840_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30004930Irregular chiasm C-roughest-like isoform X2SMESG000077979.1 dd_Smed_v4_12549_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016952Frizzled 5/8 proteinSMESG000005043.1 dd_Smed_v4_11823_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30000785Protocadherin-1SMESG000026621.1 dd_Smed_v4_6467_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED3000024060S ribosomal protein L10aSMESG000027088.1 dd_Smed_v4_350_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30019130Junctophilin-1SMESG000001306.1 dd_Smed_v4_4752_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30008787innexin-1SMESG000043134.1 dd_Smed_v4_11254_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30017876ATP-dependent 6-phosphofructokinaseSMESG000028432.1 dd_Smed_v4_3613_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30013784RUNX1 partner transcriptional co-repressor 1SMESG000019002.1 dd_Smed_v4_11134_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED3001895450S ribosomal protein L7/L12SMESG000026245.1 dd_Smed_v4_2166_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30007103slc7a-7SMESG000044247.1 dd_Smed_v4_2179_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015069ANK_REP_REGION domain-containing proteinSMESG000063648.1 dd_Smed_v4_10764_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30014348Four and a half LIM domains protein 1SMESG000006322.1 dd_Smed_v4_10293_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30014348Four and a half LIM domains protein 1SMESG000018217.1 dd_Smed_v4_1350_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001344Coatomer subunit betaSMESG000033847.1 dd_Smed_v4_1208_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30017716Tigger transposable element-derived protein 7SMESG000067500.1 dd_Smed_v4_12091_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001510Protein unc-79 homologSMESG000053097.1 dd_Smed_v4_6600_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005127Voltage-dependent L-type calcium channel subunit alphaSMESG000000524.1 dd_Smed_v4_8899_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016301Homeobox domain-containing proteinSMESG000002774.1 dd_Smed_v4_11198_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012935TGc domain-containing proteinSMESG000080370.1 dd_Smed_v4_4149_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30013845Phosphoglucomutase-1SMESG000046578.1 dd_Smed_v4_3503_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015764Formin binding protein 1bSMESG000000991.1 dd_Smed_v4_8489_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30003434SMED30003434SMESG000052485.1 dd_Smed_v4_1182_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012368Prominin (Prom) protein, putativeSMESG000025078.1 dd_Smed_v4_6506_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30004705SMED30004705SMESG000001306.1 dd_Smed_v4_4752_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30011674PapilinSMESG000003930.1 SMESG000003917.1 dd_Smed_v4_8833_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30017209DIX domain containing 1SMESG000033276.1 SMESG000003898.1 dd_Smed_v4_3834_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015655SMED30015655SMESG000019002.1 dd_Smed_v4_11134_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005484CAAX prenyl proteaseSMESG000031464.1 dd_Smed_v4_5271_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009279DystoninSMESG000043809.1 SMESG000043799.1 dd_Smed_v4_1205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30003246Structural maintenance of chromosomes proteinSMESG000036986.1 dd_Smed_v4_5865_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30006834MAP/microtubule affinity-regulating kinase 3SMESG000052500.1 dd_Smed_v4_4580_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009586SMED30009586SMESG000030829.1 dd_Smed_v4_10825_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018355SMED30018355SMESG000022833.1 dd_Smed_v4_10379_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001545SMED30001545SMESG000026136.1 dd_Smed_v4_7269_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001545SMED30001545SMESG000026136.1 dd_Smed_v4_4323_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED3000928360S ribosomal protein L18aSMESG000060163.1 dd_Smed_v4_437_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30006989Eukaryotic translation initiation factor 2-alpha kinase 3SMESG000032681.1 SMESG000032678.1 SMESG000032676.1 dd_Smed_v4_5111_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30017805CRAL-TRIO domain-containing proteinSMESG000009874.1 SMESG000009872.1 dd_Smed_v4_12402_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30004214SMED30004214SMESG000055805.1 dd_Smed_v4_857_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30010468RBR-type E3 ubiquitin transferaseSMESG000062644.1 dd_Smed_v4_3281_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30002915SMED30002915SMESG000027849.1 SMESG000054598.1 SMESG000054597.1 dd_Smed_v4_6188_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30004524cGMP-dependent protein kinaseSMESG000020772.1 dd_Smed_v4_8296_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30004524cGMP-dependent protein kinaseSMESG000020772.1 dd_Smed_v4_9039_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30003574SMED30003574SMESG000027849.1 SMESG000054598.1 SMESG000054597.1 dd_Smed_v4_6188_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30013305SMED30013305SMESG000079765.1 dd_Smed_v4_10395_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009873SMED30009873SMESG000016812.1 SMESG000016788.1 SMESG000016785.1 SMESG000016784.1 SMESG000016778.1 SMESG000016777.1 SMESG000016774.1 SMESG000016773.1 SMESG000016772.1 dd_Smed_v4_422_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30014533SMED30014533SMESG000023639.1 SMESG000023635.1 dd_Smed_v4_3360_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018208neurexin-1 isoform X16SMESG000066308.1 dd_Smed_v4_11832_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30000475Bestrophin homologSMESG000016298.1 dd_Smed_v4_10097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30007755LIM and SH3 domain protein 1SMESG000002154.1 dd_Smed_v4_1218_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30002002GRAM domain-containing proteinSMESG000004908.1 dd_Smed_v4_8544_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012219Protein disulfide-isomeraseSMESG000041085.1 dd_Smed_v4_426_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30010360Leucine Rich repeat-containing domain proteinSMESG000047911.1 SMESG000045664.1 dd_Smed_v4_2769_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30017243Protein-glucosylgalactosylhydroxylysine glucosidaseSMESG000009911.1 SMESG000009910.1 dd_Smed_v4_606_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015381Transmembrane GTPase MarfSMESG000003246.1 dd_Smed_v4_5932_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30014531Transmembrane protein 70-likeSMESG000026851.1 dd_Smed_v4_8324_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30002537Y box protein-1SMESG000058013.1 dd_Smed_v4_35_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30006002T-complex protein 1 subunit gammaSMESG000066978.1 dd_Smed_v4_435_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30007445RNA-binding protein 5SMESG000061908.1 dd_Smed_v4_2392_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009442Acetylcholine receptor subunit alpha-likeSMESG000068777.1 dd_Smed_v4_12182_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30031984Selenoprotein FSMESG000044517.1 dd_Smed_v4_2376_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30031984Selenoprotein F dd_Smed_v4_304_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020614ATP-dependent RNA helicase DBP2SMESG000033349.1 dd_Smed_v4_594_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025757JUNLI-1SMESG000067959.1 dd_Smed_v4_4878_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30023889SMED30023889SMESG000055805.1 dd_Smed_v4_857_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035904PROG-1SMESG000024882.1 SMESG000024707.1 dd_Smed_v4_332_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30021446TNF receptor associated factor-2SMESG000049696.1 SMESG000049688.1 SMESG000049683.1 SMESG000049676.1 SMESG000049663.1 SMESG000049649.1 SMESG000049621.1 SMESG000049614.1 SMESG000049603.1 SMESG000049567.1 SMESG000049545.1 SMESG000049503.1 dd_Smed_v4_3528_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30028254Polyglutamine-binding protein 1SMESG000040247.1 dd_Smed_v4_3489_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30030342RNA-binding protein 25SMESG000074815.1 dd_Smed_v4_7685_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029695patched-like proteinSMESG000003567.1 dd_Smed_v4_7063_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029869Polypeptide N-acetylgalactosaminyltransferaseSMESG000011837.1 dd_Smed_v4_6094_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029643Polypeptide N-acetylgalactosaminyltransferaseSMESG000011837.1 dd_Smed_v4_6094_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029899slc25a-30SMESG000044697.1 SMESG000022161.1 dd_Smed_v4_50_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30023469SMED30023469SMESG000067424.1 dd_Smed_v4_7353_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30023642Acyl-CoA dehydrogenase family member 9, mitochondrialSMESG000048318.1 dd_Smed_v4_6056_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30014482DUF3421 domain-containing proteinSMESG000051527.1 dd_Smed_v4_2232_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30008182SMED30008182SMESG000081731.1 SMESG000081727.1 dd_Smed_v4_622_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30013766Matrin-type domain-containing proteinSMESG000072403.1 dd_Smed_v4_1859_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009564DihydropyrimidinaseSMESG000002633.1 dd_Smed_v4_1478_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30000345PhosphodiesteraseSMESG000075722.1 dd_Smed_v4_8076_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009284Hsp70SMESG000056256.1 dd_Smed_v4_424_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30011701Filamin-ASMESG000017288.1 dd_Smed_v4_5496_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016196SMED30016196SMESG000059283.1 dd_Smed_v4_62_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30017946Actin-like protein 6ASMESG000022727.1 dd_Smed_v4_2794_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30007389Peripheral plasma membrane protein CASKSMESG000060582.1 dd_Smed_v4_7723_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016738ANK_REP_REGION domain-containing proteinSMESG000074861.1 SMESG000074860.1 dd_Smed_v4_1438_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016047Ubiquitin-conjugating enzyme E2 ZSMESG000032815.1 dd_Smed_v4_2721_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018655Collagen type IV alpha-3-binding proteinSMESG000032017.1 SMESG000017536.1 SMESG000032019.1 dd_Smed_v4_5076_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30011519Mediator of RNA polymerase II transcription subunit 21SMESG000036235.1 dd_Smed_v4_2670_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018708Protein regulator of cytokinesis 1SMESG000010278.1 dd_Smed_v4_2844_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30002428Gamma-aminobutyric acid receptor-associated proteinSMESG000026465.1 dd_Smed_v4_600_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30014446SMEDWI-2SMESG000069984.1 SMESG000069981.1 dd_Smed_v4_756_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012789Expressed conserved proteinSMESG000033789.1 SMESG000033788.1 dd_Smed_v4_3908_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30019808Zinc finger proteinSMESG000048367.1 dd_Smed_v4_5058_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30011047GLI-1SMESG000073727.1 dd_Smed_v4_7470_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30013220Eukaryotic translation initiation factor 3 subunit DSMESG000020924.1 dd_Smed_v4_2254_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018825rhomboid-like proteinSMESG000053833.1 dd_Smed_v4_13835_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30011454SMED30011454SMESG000080896.1 dd_Smed_v4_27160_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009339bak-1SMESG000011981.1 dd_Smed_v4_2588_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED3001160940S ribosomal protein S3SMESG000016955.1 dd_Smed_v4_269_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30011180Kinesin-like protein KIF26ASMESG000051203.1 dd_Smed_v4_8860_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30011056SMED30011056SMESG000009090.1 dd_Smed_v4_2432_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30011594Peripheral plasma membrane protein CASKSMESG000062837.1 dd_Smed_v4_5730_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30011869X1.A2.3SMESG000031290.1 dd_Smed_v4_4279_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012203NGFI-A-binding protein 1SMESG000013520.1 dd_Smed_v4_3973_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016017NeuroglianSMESG000005684.1 dd_Smed_v4_4031_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016591Protein big brotherSMESG000068819.1 dd_Smed_v4_2875_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED300120465'-AMP-activated protein kinase subunit beta-1SMESG000037698.1 dd_Smed_v4_6112_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30010637Nucleolar RNA helicase II/Gu proteinSMESG000065959.1 dd_Smed_v4_283_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30017381Protein polybromo-1SMESG000004446.1 dd_Smed_v4_4218_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016760HATPase_c domain-containing proteinSMESG000054821.1 SMESG000054819.1 dd_Smed_v4_2265_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035357follistatinSMESG000013298.1 dd_Smed_v4_9584_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026656Pre-mRNA-splicing factor CWC21SMESG000056252.1 dd_Smed_v4_4340_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026656Pre-mRNA-splicing factor CWC21SMESG000056252.1 dd_Smed_v4_3805_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026466Alpha-actininSMESG000040562.1 dd_Smed_v4_5647_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30033804TransporterSMESG000003011.1 dd_Smed_v4_5713_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30030077Growth hormone-inducible transmembrane proteinSMESG000029240.1 dd_Smed_v4_754_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30033551PhosphotransferaseSMESG000043559.1 dd_Smed_v4_4327_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30021194Calcitonin-like receptorSMESG000080399.1 dd_Smed_v4_7328_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022014TetraspaninSMESG000043678.1 dd_Smed_v4_2693_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30031389CalnexinSMESG000016275.1 dd_Smed_v4_632_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022869Cyclin-YSMESG000031613.1 dd_Smed_v4_8226_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025705Transient receptor potential ion channel M bSMESG000017090.1 dd_Smed_v4_6825_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30030156SMED30030156SMESG000032633.1 dd_Smed_v4_6252_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026932noggin-like protein 8SMESG000008387.1 dd_Smed_v4_8738_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30024863Transcription activator BRG1SMESG000076666.1 dd_Smed_v4_4141_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022804slc12a-1SMESG000043221.1 SMESG000043220.1 dd_Smed_v4_4047_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30034500early growth response-2SMESG000004840.1 dd_Smed_v4_9273_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029256SMED30029256SMESG000027017.1 dd_Smed_v4_7351_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30021545glutathione S transferase-1SMESG000003087.1 dd_Smed_v4_20_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30028544Zinc finger SWIM domain-containing proteinSMESG000007319.1 dd_Smed_v4_5222_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30034337CalpainSMESG000067771.1 dd_Smed_v4_5719_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029615SMED30029615SMESG000045448.1 dd_Smed_v4_943_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025215Fzd-1/2/7SMESG000040115.1 dd_Smed_v4_6353_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30028145RNA polymerase-associated protein CTR9 homologSMESG000059268.1 dd_Smed_v4_2695_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025731Splicing factor 3B subunit 5SMESG000014121.1 dd_Smed_v4_2023_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30024390Synaptotagmin like 4SMESG000042371.1 dd_Smed_v4_7945_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30024032SMED30024032SMESG000081731.1 SMESG000081727.1 dd_Smed_v4_622_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020942Transcription intermediary factor 1 ASMESG000065316.1 SMESG000065309.1 dd_Smed_v4_7122_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30033622Protocadherin-1SMESG000059440.1 dd_Smed_v4_6251_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026369Thiosulfate sulfurtransferase rhodanese-like domain-containing 1SMESG000003839.1 dd_Smed_v4_530_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30027887Interferon-induced GTP-binding protein Mx1SMESG000002025.1 dd_Smed_v4_7246_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035262Wilms tumor protein 1-interacting protein homologSMESG000031934.1 dd_Smed_v4_7984_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30021597Cyclin-dependent kinase 2-associated protein 2SMESG000041391.1 dd_Smed_v4_552_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032631Smed-AlbinoSMESG000068148.1 dd_Smed_v4_6316_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30027566SMED30027566SMESG000075236.1 dd_Smed_v4_7519_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30028761INO80 complex subunit BSMESG000037125.1 dd_Smed_v4_6244_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022184Protein transport protein Sec61 subunit betaSMESG000050010.1 SMESG000013437.1 dd_Smed_v4_418_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020325Protein lin-54 homologSMESG000004147.1 dd_Smed_v4_4263_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30027482Low-density lipoprotein receptor 1SMESG000049079.1 dd_Smed_v4_8647_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30030516Myelin expression factor 2 isoform 2SMESG000020746.1 dd_Smed_v4_2707_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022776Rho guanine nucleotide exchange factor 12SMESG000022871.1 dd_Smed_v4_6070_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029770ATP-binding cassette sub-family F member 2SMESG000071613.1 dd_Smed_v4_434_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30027364Epidermal growth factor Smed-egf-6SMESG000029319.1 dd_Smed_v4_6222_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035773SMED30035773SMESG000017090.1 dd_Smed_v4_6825_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30030305Peptidase_M14 domain-containing proteinSMESG000048042.1 dd_Smed_v4_2282_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026953Pre-mRNA polyadenylation factor FIP1SMESG000023126.1 dd_Smed_v4_2560_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30027070protein FAM136ASMESG000021181.1 dd_Smed_v4_6009_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30027983Glypican-1SMESG000032627.1 SMESG000033244.1 dd_Smed_v4_4078_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032120SMED30032120SMESG000021415.1 dd_Smed_v4_5753_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30023267Tubulin alpha chainSMESG000079660.1 dd_Smed_v4_2143_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035594Tau tubulin kinase 1aSMESG000068893.1 dd_Smed_v4_8160_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30028195SMED30028195SMESG000078660.1 dd_Smed_v4_8456_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025231radial spoke head protein 6 homolog ASMESG000079294.1 SMESG000044179.1 dd_Smed_v4_3854_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026811DUF3421 domain-containing proteinSMESG000074377.1 dd_Smed_v4_766_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026457Fumarate hydratase, class ISMESG000075499.1 SMESG000009591.1 dd_Smed_v4_2405_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30034767synaptotagmin-14SMESG000051011.1 SMESG000046823.1 dd_Smed_v4_9164_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018527Guanylate cyclaseSMESG000010241.1 dd_Smed_v4_7644_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30000377Membrane-associated guanylate kinase, WW and PDZ domain-containing protein 1SMESG000026494.1 dd_Smed_v4_5498_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30014525Dolichyl-diphosphooligosaccharide--protein glycosyltransferase 48 kDa subunitSMESG000010589.1 dd_Smed_v4_948_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018588MusashiSMESG000077233.1 dd_Smed_v4_8902_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005162Alpha-1,3-mannosyl-glycoprotein 2-beta-N-acetylglucosaminyltransferaseSMESG000034058.1 dd_Smed_v4_39007_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30013357Eukaryotic translation initiation factor 4H-like proteinSMESG000058217.1 dd_Smed_v4_4137_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30013228Ryanodine receptor relatedSMESG000000645.1 SMESG000000646.1 dd_Smed_v4_5582_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30008926ATP-dependent DNA helicaseSMESG000023939.1 dd_Smed_v4_6024_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30004581Dual specificity protein phosphatase 10SMESG000030100.1 dd_Smed_v4_3551_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30011418Cysteine-rich secretory proteinSMESG000066465.1 dd_Smed_v4_829_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30003270SMED30003270SMESG000052792.1 dd_Smed_v4_3513_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018507Calcium-transporting ATPaseSMESG000038461.1 dd_Smed_v4_3170_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018507Calcium-transporting ATPaseSMESG000038461.1 dd_Smed_v4_4559_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30006805G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000079690.1 SMESG000011532.1 dd_Smed_v4_9021_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30008311SMED30008311SMESG000006280.1 dd_Smed_v4_9073_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001195da proteinSMESG000032044.1 dd_Smed_v4_5579_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001663Expressed conserved proteinSMESG000057766.1 dd_Smed_v4_4288_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001663Expressed conserved proteinSMESG000057766.1 dd_Smed_v4_6533_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30006485Beta-1-syntrophinSMESG000005336.1 dd_Smed_v4_7105_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30008314IMD domain-containing proteinSMESG000038660.1 dd_Smed_v4_3500_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30008513SMED30008513SMESG000008541.1 dd_Smed_v4_8116_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012534SMED30012534SMESG000012031.1 dd_Smed_v4_747_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015115SMED30015115SMESG000078668.1 dd_Smed_v4_773_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30014979Protein bicaudal DSMESG000035031.1 dd_Smed_v4_758_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED300189611.C3.2SMESG000049306.1 dd_Smed_v4_406_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30004868NeuroD-2 proteinSMESG000081091.1 dd_Smed_v4_9906_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30008437Nuclear and cytoplasmic polyadenylated RNA-binding proteinSMESG000044649.1 dd_Smed_v4_3605_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30019763CS domain-containing proteinSMESG000078259.1 SMESG000075881.1 SMESG000064589.1 SMESG000031042.1 SMESG000029607.1 SMESG000021352.1 SMESG000004064.1 dd_Smed_v4_3736_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30003905Far upstream element-binding proteinSMESG000037106.1 dd_Smed_v4_812_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30019097SOXP-1SMESG000010063.1 dd_Smed_v4_7227_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30010540Gln-synt_C domain-containing proteinSMESG000064881.1 dd_Smed_v4_9076_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005807BasiginSMESG000039120.1 dd_Smed_v4_3356_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30011827PrefoldinSMESG000016835.1 dd_Smed_v4_2373_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30013444Methyltranfer_dom domain-containing proteinSMESG000044313.1 SMESG000025783.1 SMESG000025782.1 dd_Smed_v4_8481_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30014640Small heat shock protein p36SMESG000028601.1 dd_Smed_v4_6399_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015362SMED30015362SMESG000043289.1 dd_Smed_v4_80_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30007496C-type lectin domain-containing proteinSMESG000016262.1 dd_Smed_v4_5187_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30008363Homeobox protein Nkx-3.2SMESG000027004.1 dd_Smed_v4_30581_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30002902Triple functional domain proteinSMESG000061508.1 SMESG000027427.1 dd_Smed_v4_5483_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012139slc2a-2SMESG000081673.1 dd_Smed_v4_3190_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30011296SMED30011296SMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044888.1 SMESG000035755.1 dd_Smed_v4_83_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009954C-type lectin domain family 18 member ASMESG000066354.1 SMESG000066348.1 dd_Smed_v4_4737_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005231Polyadenylate-binding proteinSMESG000058745.1 dd_Smed_v4_93_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30019390kelch domain-containing protein 9SMESG000074761.1 dd_Smed_v4_7438_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005171SMED30005171<