muscle cell

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ In Situ Hybridization Data

  ▻ Sequences

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  muscle cell


DEFINITON:

  A mature contractile cell, commonly known as a myocyte. This cell has as part of its cytoplasm myofibrils organized in various patterns.


TERM DEFINITION CITATIONS:

  CL:0000187


TERM CITATIONS:


TERM ID:

  PLANA:0000101


ABOUT THIS TERM:

muscle cell

  ↳is a electrically responsive cell




DEPICTED BY:


BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30025388Myosin heavy chainDj-mhcStage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, musculature system, muscle cell, embryonic pharynx
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 ┬Ám

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30022992 ID=SMED30022992|Name=Myosin heavy chain|organism=Schmidtea mediterranea sexual|type=transcript|length=6157bp
ATATATATGCATCTCAAAATTGGAAATTAAATTATTAATTTTAATTTACTAACAAATTTTTGTTGTAAAATGGAAAATAT
TGATGCTAAAGACTTGCAATATTTACAAGTTGATAAAAGTTTAGTTTCTGACTCTGCTAATTTGTCTGATTGGGCTAACA
AAAAATTGGTTTGGATACCTGACGACAATGAAGGATTTATTTCAGGATCACTTATAGAAGAAAAAGGCGATGAAGCTACT
GTCAAACTGGAAAATGGCAAAACAATGAAATTACCAATTGAAAATGTTCAAAAAGTGAATCCACCAAAATTTTTTAAATC
TGAAGATATGGCAGATTTAACTTATTTGAATGAAGCATCAGTTCTATATAATTTAAAAGACAGATATTTTTCAGACTTAA
TATATACATATTCCGGATTATTTTGTGTCGTTGTAAATCCATACAAGCGCTTGCCTATTTATACAAATAATGTAATTGAG
TGGTACAAAGGTCGAAAACGTCACGAAAGACCGCCACATATTTACGCAGTTACTGATGTCGCATATCGAAATATGCTCCA
AGATAAAGAAAATCAATCAATTCTTTGCACTGGTGAATCCGGAGCAGGAAAAACTGAAAATACGAAAAAAGTTATTCAAT
ATTTGGCCTCAGTTGCAACTTCTTTGAAAAATCAAAAAACCACAGCCAGTAATGCATTGTCACAATTTTATGCTCACGAT
GTTAACATTGGAGAATTGGAGACCCAATTACTTCAGGCCAATCCGGTTTTAGAAGCTTTTGGAAATGCAAAGACTATCAA
AAACGATAATTCATCTCGTTTTGGTAAATTTATTCGAATCAATTTTGACACTTCTGGATTCATTTCCAGTGCAAACATAG
AAACATATTTATTGGAAAAAGCTAGAGTTATTAGACAGGCAGCTAATGAACGGTGCTTTCACGTGTTTTATCAGCTTCTT
CTTGGTGCAGACGACCGATTGAAAAAGGAATTAATCTTAGAAAATGTTTCTACATACAAACTTTTATCCAACGGCATGAT
AGCTGTACCAGATTACGATGAAAAGCAAATGTTTAAAGATACAGTCGAAGCTCTCGATATAATGGGGATTTCGAAAGACG
AACAAGAATCTATTTTCCGAGTTATAGCCGCAGTTTTACACATGGGAAATATCGAATTCAAACAAGAAAGAAGTTCGGAT
CAGGCTGCTTTACCAGACAATACAGTTGCTCAAAAGGTTGCTCATCTTCTCGGTTTACCGGTCACAGAAATGACCAAAGC
ACTGCTGAAACCAAAATTGAAAATTGGAAGAGAAGTTGTAGCAAAAGCTCAAACTAAAGAACAAGCCGAATTTTCCGTTG
AAGCTATAAGCAAATCAACATATGAAAGAATGTTTCGATGGCTGGTAATGAGAATAAATAGATCAATTGACAGAAATAGA
CAAAAAACTAATTTCATTGGCATTCTTGATATTGCTGGCTTTGAAATATTTGAAATAAACTCTTTTGAACAATTGTGTAT
AAACTATACCAACGAGAAATTGCAACAGCTTTTCAATCATACAATGTTTGTGCTAGAACAAGAAGAATACAGAAAAGAAA
ATATCAAATGGGAATTCATTGACTTTGGTCTTGATTTGCAGCCAACTATCGAACTAATTGAAAAGCCAATGGGTATTCTT
TCTTTGTTAGATGAAGAGTGCTTTTTCCCAAAAGCTACCACAAAGACATTTGTTGAAAAATTAATTAAAAACCAATCGAC
GCACCCTAAATTGAAAGCTACTGATTTTAGAGCAAAAGCAGATTTTGGGGTTATTCATTACGCGGGAAAAGTTGATTATG
TCTCCGATAATTGGCTGGTGAAAAATATGGATCCTCTTAATGAGAACGTTGTTAGTCTCTTACAAGAATCAAATGAAAGT
TTTGTCCAGACAATTTGGAAAGATGCAGAAAACATTATTGGCTTATCAACTACTACCGCCCAAGAATCTGCCTTTGGAGG
TGCAAAAACTACTCGCAAAGGAATGTTTAGAACCGTCGGTCAGCTTTACAAAGAATCATTAACGAAATTGATGGATGTTC
TGAATAATACCAATCCCAATTTTGTGAGATGTATCATTCCCAATCATGAAAAAAAATCTGGTAAAATCGATTCAAAATTG
GTTATTGATCAATTAAAATGTAATGGTGTGCTGGAGGGTATCAGAATATGCCGACAAGGATTTCCAAACCGAATTTTATT
CCAAGAGTTCAAACAACGTTATGGAATTCTTACACCAAATGTCATACTAAAAGGTTTTATGGACGGTCGAAAAGCAACAG
AATTAATGCTTGGAGAGTTGGATATTGATGCATCAAATTACAGAATTGGTCAGAGTAAAATATTTTTCAAAGCTGGAGTT
TTGGCTAGATTAGAGGAAGATCGAGATATTAAGTTGACTGAAATCATAGTCAAATTTCAATCTTATGCACGTGGATATTT
GGCAAGAAAAAATTTACAAAATCGATCGCAAAATCTCAATGCAATTAAAATTATTCAAAGAAATTGTAATGCATACTTAA
AATTGAGAAATTGGGCCTGGTGGAAATTATTCACACGTGTTAAGCCTCTATTAAGTGTTACAAGGCAAGAGGAAGTTGTG
GCTTTGAAGGAAGAAGAATTGAAAAAATCAAAAGAAACTCTCGAAAAGATGACTGCTGATTTCGAAACAACTAAGAAAAA
TTATGAATTTCTCATGGAAGAAAAAAATAAAATTCAGGAAGATTTGGAAAAGGAGCGTTTTGCATTGCAAGATATGGAAG
GGGAAAGAGAAAATTTGATCAAGCGATTAAAAGATATTGAATCAGATGCTCAAGAATGCGAGTCAAGAGAGATGGAAACA
AAAGACAAATGCAATAAATTGGAAATCGAGAAAAATAAATTACAAAATGAAATTTCACAGCTTAGCCAAAATTTAGAATC
AGAGGAACAGAACTTGCAAAAAGCTCAAGCAGACAAATTAAGTGCTGATAAACGAATTAAGGAACTGGAACAAAAAGTGG
CCGAATTAGAAGATAAACTTAACAAGTTAACTAAAGAGAAAAAGTCTCTAGAAGAGCGATTGGCTGATGTTATGTCTACT
TTGGCGGAAGAAGAAGAAAAGAGTAAACAATTAACGAAACTCAAATCCCGTCACGAAACAAGTATCACTGAATTAGAAGA
GAGATTGAGCAGAGAACAAGCAGCTCGACAAGATTTAGAAAAAACAAAGAGACGACTAGAAACTGAATTGTCTGAAAAAT
CTGATAATTTATCATCTCAAAGCCATACATATGAAGAAATTAGAATTACTCTTGAACGAGCAGAAACACAAATAATTCAA
ATGCAAGCTAAATTAGATGAAGAAACAACGGCAAAATCGTTGGCTCAGAGACAAATTCGAGACGCAGAAAACGTAATCAC
CGAAATCAAAGAAGATCTTGAAGCTGAAAAACGTTCAAAAGAGAGAGCTGAAAAAGCTAAGAGAGATTTAGCCGAAGAAA
TAGAATCTCTTAAAATGGAATTACTCGATACGGGAAATACATCAGAAGAACAGCAAAGCGTATTGCGCAAAAAAGAAGTT
GAATTACAAAATTTTAAAAAATCTTTTGAAGATGAAACAAAACGAACTGAACTTGAAATGCAAGAAATTCGTAAAAAAGC
CGCAGTAACGATTGAAAACCTCAACAATCAAATAGAAGCTGCTAACAAATCAAAACTTGTTGTTGAAAAGGCTAAATTAC
AGTTGCAAGAAGAACTTAATGATGCAAATAACGAATTAGCAAATTTAAGATCCTCCAAAGCTGACTCTGAAAAACTTAAG
AAGAACACAGAACTACAACTTTCAGAAATATCTCATCGCCTTTCAGAATCTGAAGAACACAAGCTAGATGCTGAATCAAA
ACTTAAAAAACAAACCGAGTTGGCTGACAAATTGGCTATGAATCTCGAAGAAATTGAAAGCAAATTGTCGCAATTAACTA
AATCTGAATTATCAGTTCGAAGTCAGTTAGCAGATTTACAAAAGGACTTTGAAGAAGAAACTCGATTAAAATTGAATGCT
CAAACTACATTAAGGCAGTTAGAAAGTCAATTTGCTTTATTAAAAGATCAATTAGAAGAGGAGCAACAATCAAAAGAAAA
TTTAGAAAGTCACGTACAAGCTCTACAGAGTCAAATGCAAGATGTCAAAAAGAAAGTTGAAGAAGATGCTCAACAGCTAT
TAGAATTTGATGAATCTCGTAAAAAAGTAATGCGTGAACGAGAAGAATTGCAGATTAGACTTGAAGAAGCAATCAATCAG
ACTGAAAGATCAGAAAAAGCTAAGCGAACAATTCAAGCCGAGCTTCAAGATGCATATCATGCCCTAGAAAGTCAGAAAAA
TGACCAAACTCAAAGTGATCGAAAACTTAAAAAAATGGAATCACAAGTCAATGAAACATTGAACTTGAATAAAAAATATT
TAGCTGAAAAGGATACATTAGAAAAAGAAAATCGTGAAAAAGAAACAAAAATCATGCAATTACAGAGAGAAATGAATGCA
AATGACGATAAACTTTCGGAATTGGAAAATGCAAAATCCTTACTGACTCGGCAATTGAATGAATTGGTTTCGAGCAAAGA
TGATGTTGGTAAAAATGTTGGCAGTTTAGAAAAGGCTAAAATTCAATTAGAAACCGATTTAGAGAATTGTAAAGTTACTA
TTGAAGAATTAGAAGAAGAAAATGCAACTCTTCAAATGAATAAAGAACGAGTTGAAATGCAATTAACTGCTACTAAAGCC
CAACTGGATAGGGAGCTAGCTTCCAAAGATGAAATGCACGATGAACAGTTCAGAATTATAAACAAAAAGCTTCGTGATGC
AGAAGCGGCACTTGAAGAAGAGCAGAAATCCAAAACAGCTATGGTTTCATTGAAAAAGAAAATAGAAAATGAGAACATGG
ATTTATTAAATCAATTAACAGAATCTGAGAAGGTCAAAGAAGAGCTGGCCAGACAGATTAAAAAATACCAAGGAAATTCT
AGCAATCTTCAAAGAGAAATGCAAGAACTTGTTGCTGCTAAAAATGATTATTTGAAGCAGATTAAAGAACTAGAAAAGCG
CTTACGTACTTCTGAAAGCAATGTAAACCAATTATCCGAAGACCTTTCGCAGTCTGAACGTGCTAAGAGAACCATTGCAT
CTGAAAGAGATGAAGCTTTAGAAGAAATTGCCACAATCACTATGGCTAGGGATACAGCTATTGCAGATAAAAAACGTATT
GAGAGTAGCATTTCAGCATTAAGCATGGATAATGAAGAATTGCAATTACTTTTGTCAGAATTAGAAGACAAAAATAAGAA
AATTATTTCTCAGTTAGAACAAGTTCAAAATGAATTAAATGTTGAACGACAAAATATAAGTAGATTAGAAAATCAAAAAT
CAACTGCCGAAAGACTGAATAAAGAATTGCATGATAAAATTGAAGAATTGGAAATGGAAGCTGGTAAAAAATATAAAGCT
ACAGTTGCTGCTCAACAAAGTAAAATCCAAAGTCTTGATTCTCAGCTGGACGCTAAAATTGAGGAAATAAACCAAGCTAA
TAGAAATAACAAGAAACTAGAAAGAAAGTTGAAAGAAATTATGGCTCTTATGGCTGATGAAACAAAGCGGGCTGACAATG
CAATCGAACAGATTGAAAAAGCCACTGGCAGATTTAAAAAAGCAGAGAGAAGTTTACAGATGGAACAAGAAAACAATTCT
GCTCTAAGTACACAAAATCGCCGATTACAACGAGATTTGGAAGAAGTAAATGAAACCAAAGAAGCACGGGACCAAGAAAT
TAAAATTCTTAAAACCAAAATCGACAGATTGGAAAAAAGAACACGCGCTGGGGGTCGACCTCTTAGAGGAGACGGTGGAT
CTGATGATGGGTTATCTGGAGATGGAGAATCCGTAACTGATTCTGCTTTAAAATCTGTTCAAGAAGACTAATTCAATAAG
TCCTAAAATGAACAATAAATTCTTGAATAATTAGTTAATACAAAAATTTTTGAATAATTTATATTTGGACTAACTTTTAA
TTCCTATTTGGTTTGCTCAATATATAATTGTTTTGATATATTTAATATTTCTATTTTATCAATTTGTGTACTTGGGG
>SMED30020435 ID=SMED30020435|Name=Myosin heavy chain|organism=Schmidtea mediterranea sexual|type=transcript|length=3615bp
TCTGAATTTAAACAAAGATATTCAATTTTGGCCGCAGATGTAATAGGGCAAGGATTTATTGATGGAAAACAGTGTACTGC
AAAGATAATGGAAGCAATCCAATTAGATAAAAACAACTACAGGCTTGGATCAACTAAAATCTTTTTCAAGGCCGGAGTAC
TTGCTCAGTTAGAAGACATGCGAGATGAGAAATTATCATCCATTTTGTCTGTATTCCAAGCACAGATGAGAGGATATATA
ATGAGAAAAGCATATAAGACATTGCAAGATCAACGAATTGCTCTTTCTCTCATTCAAAGAAACATCAGAAAATATTTATT
ACTAAAAACATGGCCATGGTGGAGACTATACACTAAAGTCAAACCACTCCTCAATATCGCAAGACAAGAAGAGGAGATGA
AGAAAGCTGCTGAAGAGTTGATTAAATTGAAAGAAGAATATGAAAAGATAGAAAAATTTAAAAAGGAATTGGAAGGTCAA
AATGTGGTTTTGCTTGAGCAGAAAAATGATTTATTTTTACAACTGCAAACAGAACAAGACAATCTTAGTGACGCTGAAGA
AAAGATTCAAAAGATGATCAATCAAAGAGTTGAAATGGAGAACCAATTTAAAGAATTAGAAGATAAATTAATGGATTCGG
AAGACATTCAAGATGAATTGGAAATCGAAAAAAAGAAATTGTTGTTGGATATGGATGAATTGAAATCGGACATTGACGAA
CTTGAAGTATCTTTAGAAAAGTCTGAACAAGAAAAACAAGCTCGCGATCAACAAATTAATAATTTGAAAGAAGAAATTCA
AAAACAAGATACTTCTATCGGAAAAGTTCAAAAGGAGAAAAAGACTCTAGAAGATAACTTAAATCAGACCAGAGAAGCTT
TAAATGCTGAAGAAGACAAGGTCAATCAGTTGACTAAAATCAAATCAAAATTGGAATCTGAAATAGATGAAATGGAAGAA
GCTCTAGAACGGGAAAAGAAGATCCGTGGAGATGTTGAAAAACTTAAACGGAAATTAGAAGCTGATCTCAAATCAAGCCT
TGATAACTGTAATGAGTTGGAAAATATAAAGCAGGAGTTAGAAGAAAATATTCAGAGAAAGGACATTGAAATATCAAAAT
TAAATGTCAAATTGGAAGATGAATCTTCAATTGTCACTCAACTTCAACGAAAAATTAAGGAATTACAAACTGTTATACAA
GATCTTGAAGAAGATCTAGAAGGTGAGAGACAAGGTCGATCAAAATCTGAAAAAGCTCGACAGTTGGCTGAACAAGAACT
CGATGAACTAGCTGACAGACTTGAAGAGCAGGGAGGTGCTACTATGGCACAAGTGGAATTGGCCAAGAAACGAGAAACTG
AATTAATGAAACTTAAAAAAGAATTACAAGATACCAATTTACAGAATGAGCAAATACTCAATGGTTTGAAAAAGAAAAAC
CAAGAAATTACCAATGAATTCTCCGAGCAAGTCGATCAAATAAATAAATCTAAATCAAAAATCGAAAAAGAAAAGGCGAC
TCTTAAGCATGATCTGGATGAATTTGTTTCTCAATTAGAATCTGTTTCAAAGCTAAAGGCCAATACAGAAAAACATTCAA
AACATTTAGAAAGTCAAATTATGGAATTGGAAAACAAAATAGACGAACAGAATCATCAAATATCAGAAATGGTTTCACAG
TCTAATAAAGACTCTCAAGCAATAATGTCTTTAGAACAACAACTAGAACAAGCAGAAAATGAAAATCACCAATTGAGCAA
ATCCAAACAACAATTCCTCCAACAAATTAATGACTGTAAATCGACTCTTGAAGACGAAGAAAAAGTAAAGGCCAAACTTT
TCAATGAAATTCGTAATCTGAATGATGAAATGGGCAATTTAAGATCCAGTTTGGAAGAAGAGCAAGAATCCAAAAGTGAA
ATTCAAAGGTCACTAGCAAAATCCCAATCTGAACTTGTACAAATGAAAAATAAATTTGATAGTGAAGGTTCAGGTCGCAT
TGAAGAAGTTGAAGAAGCTAAACGTAAGTTGCAAACGAAACTTCAAGACATGGAACAAGAATTTGACGCTATTAAAAATA
AATGCGCGCAACTTGAAAAAATCAAAATTCGTCTCACTGGAGAAATCGAAGACATGAGTGTTGATGTTGACAGAGCTAAT
GCAGTGGCTAATCAACTAGAAAAGAAACAAAAGAACTTTGACAAAACCGTCAGTGAATGGCAGTCTAAATGCAACTGCCT
TCAAACTGAAGTTGATGTTGCAAATCAAGAATCAAGATTTTTGTCAACCGAAGTATTTAAATGTAAAAGCCAAAACGAAG
AATTGCTTTCACAAATCGAAAATCTTAAACGAGAAAATAAGTCTCTCAGTGATGAAATTCACGATTTAACGGAACAACTA
AGTGATGGCGGAAAATCTGTTCACGATATAGAAAAGGCAAAACGAAAATTGGAAATAGAAAAGGAAGAACTGGAACAAGC
TTTGGAAGAAGCTGAATCAACATTGGAAAATGAAGAAGCCAAATTACAAAGAGCTCAGTTAGAGTTGAGTCAGATGAAAT
CAGATGTAGAAAAACGATTGTGTGAAAAGGAGGAAGATTTTGAAGGAACTCGCCGTAATCATCAAAGAGCAATGGAATCA
ATGCAAGCTTCTTTGGAGGCAGAAATTAAAATTAAACAGGACTCAATTAAAGCCAAGAAGAAGTTAGAACAAGAAATCAG
TGAACTCGAAGCCAATTTAGATCAAATCCAAAGACTGAAATCAGATGCTGATAAGAACAATTCAAGAATGCAACAGCAAA
TTCATGATTTACATTCAGAGATTGAACAAGAACAACACAGTAAAAACGAAGTCCGAGAACATGCTCAGATGGCTGAAAAG
AGATTTTTATCGGCTAATGGAGAACTAGAAGATTTGCGAGCCAAATTTGAACAATCAGATAGAAATCGTAGAAATGCTGA
ATCTGAGCTTCAAGATTTGAGTGATAAATACAATGAAAGCCAAGCACTGATCACTTCACTTCAAAGTTCAAAAAGAAAAA
TGGAAATGGATTACGTAGCTATGCAGTCCGATCTTGATGATATGTCAAACCATGTTCAACAAGCTGAGGAAAGAGCAAAG
AAAGCAGCTGGTGACGCTGCCCATATGTCAGAACAACTTCATCAAGAACAAGACAATAGTTTGCACACGGATAAAATGAG
GAAGCAAATGGAAATTCAAATCAAAGAAATGCAGTGTAAACTAGAAGAAGCCGAAAGTAATGTTTTGTCAGGCGGCAAAA
AGACTTTGGCAAAGTTAGAGTCAAAAATACGAGAATTGGAAACTAATCTTGATAACGAAATGAGAAAACATGCTGAAACT
CAAAAGAATTATCGCAAAGTAGATAGACGAATGAAAGAACTAACATTACAATTGGAAGACGATAGAGCTCAACAAGAAAA
ATCAAATCAAGTTATTGAAAAATTCCAAGGACAAATCAAAACCCTTCGAAAACAATTAGAAGAATCAGAAGAAGTTGCCG
TTTTGAATATTGCCAAATTTAAGAAAGTACAATGTGATTTTGAAGAAGCCGAAGAAAGAGCGAATGAATCGGAACAAGCT
TTACAAAAATTAAGA
>SMED30016281 ID=SMED30016281|Name=Myosin heavy chain|organism=Schmidtea mediterranea sexual|type=transcript|length=5986bp
CTAAAATTTAGTTGATTTCGATTGTTTGAATAAAAATATCTAATGGACCCATCAGATCCTGATTTTATCTACTTGGGAGT
CGACAGGAAAGCTTTATTGAAGCAATATGGCGACTCGTTTGATAGTAAAAAGAACATGTGGATACCGGATGAAAAGGAGG
GGTACATCGCAATTACCGTTGAAGAAACAAATGGCGATAAAGTAACTGTTAAAACCGATAAAGGAGAAACTAAAGTCGTC
AAGCAAGACTCCTTGGAACAAATGAATCCCCCCAAATTCATGATGATTGAAGACATGGCGAATTTAACATTTCTCAATGA
TGCCAGTGTATTTGATAATCTGAGACAAAGATATTACAAAAATCTGATTTATACTTACTCCGGACTGTTCTGTATTGCAG
TGAATCCTTATCGAAGATTTCCGATTTATACGTCCCAAGTAATTATGAAATATAAAGGAAAACGTAGAGGAGAAATGCCA
CCGCATATTTTCTCAATTTCGGATAATGCTTACTCAAATATGCTTGTCGATCGAGAAAATCAGTCTGTTTTGATTACTGG
AGAAAGTGGTGCTGGGAAAACTGAAAACACGAAAAAAGTTATTACTTACTTCGCCAATGTAGCAGCAGCAAGTAAAAAAG
ATGATGACGATCCATCGAAGAAAAAAGGTTCATTGGAAGATCAAATTGTACAAGCCAATCCTGTACTGGAGGCATACGGA
AACGCCAAAACAACTAGAAATAATAATTCGTCAAGATTTGGAAAATTCATCCGAATTCATTTTGGCACTAGTGGAAAAAT
TGCAGGAGCTGATATTGAGTTTTATTTGTTGGAGAAATCTCGTGTTATCTCACAGCAAAAAGGAGAAAGAAATTACCATA
TTTTCTATCAATTGCTTTCGGCAGGAGGGAAAAGTTACCACGATAAACTTTTGGTTACTGCTGATCCTGCTCTGTTTTCT
TTTATCAACCAAGGAGAATTGACGATTGACGGTGTTGATGATGAGGAAGAAATGAAACTTACTGATGAAGCCTTTAGTAT
TCTTGGGTTTTCCGATGAAGAGAAAATGAGTTTGTTTAAATGCACTACTTCAATCATGAATATGGGAGAAATGAAATTTA
AACAAAGACCCCGTGAAGAACAAGCCGAGGCTGATGGTACAACAGAAGCTGAAAAAGTCTCTTTCTTACTTGGAGTGAAT
GCCAAAGATCTAATGCAAGCAATTCTTAAACCCAAAGTCAAAGTAGGAAACGAATATGTAACGAAAGGTCAAAGCAAAGA
TCAGGTTTTATATTCTCTTGGAGCCTTAGCAAAATCTTTATATAACAGAATGTTTGCTTGGTTGGTTACTCGCGTGAACA
AAACGCTGGACACAAAAGTCAAAAGACAGTTTTTCATTGGTGTCTTAGATATTGCCGGATTTGAAATATTTGATTTCAAT
GGTTTCGAACAAATTTGTATCAACTATACTAATGAGAGACTCCAACAATTTTTCAATCACCATATGTTTGTTCTTGAACA
AGAGGAATATAAAAAAGAGGCCATTGACTGGGAGTTCATAGATTTTGGAATGGATCTCCAAGCTTGCATTGAGTTGATTG
AAAAGCCTATGGGTATTTTGTCGATTTTAGAGGAAGAATGTATGTTTCCCAAAGCAAGCGATCAAACATTGAAAGCTAAA
TTGTACGATAATCACTTGGGTAAAAGTCCGAATTTCGGAAAACCAAAACCACCAAAACCAGGACAACACGAAGCCCATTT
CGAATTACATCATTATGCTGGCAGTGTTCCATATAATATTACTGGGTGGTTGGAGAAAAATAAGGATCCATTGAACGAAA
GTGTTGTTGGATTACTCGGAGCATCTAAAGAATGTCTAGTAGCTTCTTTATTTGCACCGGCTGAAGATACAGGAAAACCC
GGAACCAAGAAAAAGGGTGGATCCTTTATGACTGTGTCATATATGCACAGGGAATCATTGAATAAATTGATGAAAAATCT
AATGAGTACAAGTCCACATTTTATTCGTTGCATTGTCCCCAATGAATTCAAACAACCAGGAGTTGTTGATGCGCATTTGG
TTATGCACCAACTTCATTGCAACGGTGTATTGGAAGGTATTAGGATTTGCAGAAAAGGATTCCCAAATAGAATGATCTAT
TCTGAATTCAAACAAAGATATTCAATTTTGGCACCGAATGCCATTCCACAAGGATTTGTTGAAGGCAAACAGGTCACTGA
TAAAATCCTCACAGCCATTCAACTGGACACAAATCTTTATCGCTTAGGAAATACCAAAGTATTTTTTAAAGCTGGAACAT
TGGCTCAACTTGAAGATATAAGAGACGAGAAACTTTCGTCGTTGATATCGTTGTTTCAAGCTCAAATTAGGGGATATTTA
ATGAGACGGCAATACAAAAAACTTCAAGATCAAAGAGTTGCTCTGTCTTTGATTCAAAGAAATATTAGAAAATATTTGGT
TTTGAGAACATGGACCTGGTGGAAATTGTTCACTAAAGTAAAGCCTATGCTTAATATTGCTCGCCAAGAAGAAGAAATGA
AAAAGGCAGCCGAAGAATTAGAAAAGCTGAAAGAGGAATTTGAAAAAACTGAAAAATATAAGAAAGAACTTGAAGAACAA
AATGTTACTTTACTTCAAGCAAAGAACGATTTATTCTTGCAGTTGCAAACTGAACAAGATAGTTTAGCTGACGCTGAAGA
GAAAGTATCTAAATTAGTTCTACAAAAGGCTGACATGGAAGGAAGAATTAAAGAACTTGAGGACTCACTTTCAGAAGAAG
AAAATTCAGCTTCAACATTAGAAGAAGCAAAAAAGAAACTCAATGCTGACATCGATGAATTGAAGAAAGATGTTGAAGAT
TTGGAATCATCTTTACAAAAAGCAGAACAAGAAAAAGTTGCAAAGGATCAGCAGATTAAATCCCTCAACGACAATGTTCG
TGAAAAAGAAGAACAATTAGCCAAAATGCAAAAGGAAAAGAAAGCTGCTGATGAATTACAAAAAAAAACAGAAGAATCAT
TGAAAGCCGAAGAAGAGAAAGTCAGTAACCTCAATAAAGCTAAAGCTAAATTAGAACAAGCCCTGGATGAAATGGAAGAA
AATCTTGGTCGAGAACAAAAAATTAGAGCAGATGTTGAAAAAGCAAAACGAAAAGTTGAAGGTGAACTTAAACAGAATCA
AGAGTTATTAAATGACTTGGAGCGCATAAAATCCGAACTTGAGGAACAATTAAAACGAAAAGAAATTGAATTGAATGGTG
CTAACTCTAAAATCGAAGATGAATCTAATTTAGTTGCAACACTTCAACGGAAGATCAAAGAACTTCAAGCCAGAATCCAA
GAATTAGAAGAAGACCTTGAGGCGGAAAGACAAGCAAGGGCAAAAGCTGAGAAAGCTAAACATCAATTGGAAGCGGAACT
TGAGGAAATCAGTGAAAGACTAGAAGAACAAGGAGGTGCAACTCAAGCCCAAACAGATTTAAATAAAAAACGAGAAGCTG
AACTCATAAAATTAAAGCGAGACTTGGAAGAGGCTAATATGCAACACGAACAAGCCTTGGTGCAAATGAGAAAGAAACAA
CAAGATACTAGCAATGAATTCGCAGATCAGTTAGATCAATTGCAAAAATCAAAATCAAAGATTGAAAGAGAAAAGAGTGA
ACTTAGAGCAGACATTGAAGATTTATCAAGTCAGCTGGAATCACTGAATAAGACCAAGGGAAATCTTGAAAAGTCAAATA
AAGCATTAGAAACCACAGTTTCAGATCTTCAAAACAAACTCGATGAATTAAGCAGACAATTGACAGAAGCAGGAAACGTC
AACAATCGAAATCAACATGAAAATAGTGAAATGCACAAAACCTTAGAAGACGCCGAATCACAAATAAACCAACTCGGAAA
GGCTAAACAACAACTCCAAGCGCAGCTAGAAGAGGCTAAACAAAATTTGGAAGATGAATCACGCGCAAAAGCAAAACTTA
ATGGAGATTTAAGAAATGCGATGAGTGATTTAGATGCATTACGGGAATCATTGGAAGAAGAACAAGAAGGCAAAAGCGAT
GTTCAAAGACAGCTTGTGAAAGTCCAAAATGAATTACAGCAACTTAAAGCAAATTCTCAAGGTACTGGAGGAGTGAGAAC
AGAAGAAATGGAAGAATTCAGACGAAAGATGAATGCCAGAATCCAAGAACTAGAAGAAGAATCGGAATCAAATAAATCTA
AATGCAGTCAATTAGAAAAAATGAAATCCAGACTTCAAGGAGAAATTGAAGATTTAGTGATAGATGTTGAAAGAGCCAAT
GGATTAGCATCGCAACTGGAAAAGAAACAGAAAAATGTTGACAAATTAATAGGCGAATGGCAAAAAAAATATTCAGAAAG
TCAACAGGAACTAGAAGTATCACTGAGAGAATCAAGAACAGTTTCCGCTGAAGTTTTCAAATTGAAATCACAATTAGAAA
ATTCTCAAGATCAAATCGAAAGTTTAAGAAGAGAAAATAAAAATCTATCTGATGAAATTCATGACTTAACTGAACAATTG
GGAGAAGGAGGACGAAATGTACATGAAATTGAAAAGACTCGAAAAAGAATTGAAATTGAAAGAGATGAATTACAACATGC
ATTAGAAGAAGCTGAATCAGCTTTGGAACAAGAAGAAGCTAAAAGCCAAAGAGCTCAGTTAGAAATAAGTCAAGCCCGTC
AAGAATCTGAAAGAAGACTTGCAGAAAAAGAAGAAGAATTTGAAGGTACACGAAAAAATCATCAACGAACACTCGAATCC
ATGCAAGCATCTCTTGAAGCTGAAGTTAGAGGACGAACTGAAGCAATGAAAATGAAAAAGAAGCTGGAGCATGATATTAA
TGAGCTTGAAGTTGGGTTAGACACGGCTAATAGACTGAAATCTGAACAAGAGAAAAATGCTAAGAAATATCAGCAACAAT
TAGCAGAAATGCAAGCTCAAGTTGAAGAACAGCATCATCAACGAGAGCAAGTTAGTGAACAGCTTGCGTTAACAGAACGA
AAATTAGGTATGATGCACGGAGAGCTGGAGGAAATGAAAAATATGTGTGATCATGCTGAAAAAAATAGAAAAGTCGCTGA
ATCTGAAAAGAATGAAGCCATTGATAAACTAAATGAGTTTTCAATTCAAAATTCTTCATTCATGGCAACTAAAAGAAAGA
TGGAAGCAGATTTAGCAGCAATGCAAGCTGACTTAGAAGAATCTACAAATGCAGCTAGACAAGCTAATGAACAATTGAAA
AAGGCAATATTTGATAATACTCGACTTTTCGATGAAATTAAACAAGAACAAGAACATGCTCAACAAGCTGAAAAAGCAAG
AAAGAATTTGGAGAGCCAGTTGAAAGAATTGCAATCAAAACTTGAAGAAGCAGAAGCAAATGTACTTAAAGGAGGCAAAA
AGGCTTTGAGTAAATTAGAGCAAAGAATAAGGGAATTGGAAGGCGAACTAGATGGTGAACAAAAACGACATGTTGAAACT
CAAAAGAATGCTAGAAAGTCAGATAGGCGACTGAAAGAAATTTCGTACCAGATCGACGAGGATAAAAAGAATCAAGATCG
AATGCAACAACTTATTGAAAGTTTACAAGCAAAAATAAAGACTTATAAACGACAAGTAGAAGAAGCTGAAGAAATCGCTG
CTGTGAATTTGGCAAAATATCGCAAAATTCAACAAGAGATTGAAGATTCTGAAGAGCGAGCTGATCAAGCTGAACAAGCT
TTACAAAAATTAAGAGCAAAGAATAGAAGCTCGGTATCTGTTAGTCGAGGAGCAAGTTCTGGACCTGGAACCAAAATTTC
TATAACTGCGACATCAATCCGCAGTGAGGACTAATCTGACAGAAAAAATTCATCATTAGGAAATATGCAATTAGTTAGCC
AATATTTCCCTTAGACTAGATTTTAAACCTTTAAGACATTTTTTTCAAATTAATAAAACGTTTTGA
>SMED30024552 ID=SMED30024552|Name=Myosin heavy chain|organism=Schmidtea mediterranea sexual|type=transcript|length=2149bp
TCACTGGAGTTAATAAACGACAAATTAAGGAAAAATGAACATGAACGATCCAGAAATGCAATACTTGGCCATTGACCGCA
AAGAATTGCTGAAAAGTTTAGATGTTGGGACTTTTGACAGTAAGAAAAATTGCTGGGTCCCCGATGAGAAGGAAATGTTT
GTGGCGGCGGAAATTAAATCCTCCTTAGGAGGTATTTTAAAAGTTCAAACGAAAAATGGAGAAAATCGTGAAGTTAAAGA
AGACGATATTCAACAAATGAATCCACCGAAATTCGAAATGATTGATGATATGGCTAATCTCACTTTTCTAAACGATGCTA
GTGTGTTACATAACCTAAAATCCCGTTATTACCGTGATTTGATATATACTTATTCTGGTCTGTTTTGTGTGGCTATAAAC
CCATATAAAAGAATTCCCATTTACACCCCAAGTATCATGCAGAAATTCAAGGGTAAACGAAAGACTGAAATGCCCCCCCA
TGTGTTCTCGGTATCCGACAACGCATATAATAACATGTTGAGAGATCGGGAAAATCAGTCCATTCTTATTACCGGTGAGA
GTGGTGCTGGTAAAACAGAAAACACTAAAAAAGTCATTTCCTATTTTGCTCAGGTGGCAGCCAATTCAAAAGATGAAGAT
AAAAGCAAAGGATCCCTTGAAGATCAAATTGTACAAGCTAATCCGGTTTTAGAAGCATATGGTAATGCAAAAACAAATAG
AAATAACAATTCCTCAAGATTTGGTAAATTCGTTAGAATTCATTTTGGATAACGGCAAAATTGCCGGAGCTGACATTGAA
TACTATCTTTTGGAAAAATCAAGAGTTGTCTCACAACAAAAAGGAGAAAGAAATTATCATATTTTCTACCAAATATTGTC
TAACAGTGCCAAAAACCTCCATGAAAAATTATTGATAGAACCAAATGCCAGCATTTATTCATTTATTAATCAAGGTGAAC
TAACAATTGACGGGGTGAATGATTCAGATGAATTCGCTTTGACTGATGAAGCGTTCGATGTTTTGGGTTTCACCACTGAA
GAAAAAATGGGACTTTTTAGATGCACAACTGCTATCATGAATATGGGTGAAATGAAATTTAAACAGCGTCCTCGTGAGGA
GCAAGCAGAAGCTGATGGTACTTCAGAAGCTGAAAAAGTTGCATTCTTACTCGGAGTAAATGCTAAAGATTTACTACAAG
CATTTTTGAAGCCAAAAGTAAAAGTTGGTACTGAATATGTTACTAAAGGACAAACTAAAGACCAGGTCTTGTTTGCTCAA
GGAGCGTTAGCTAAATCCATATATAGTCGTATGTTTTCTTGGTTGGTGACCAGAGTTAATAAAACTCTTGATACGAAAGT
GAAAAGGCAATGCTTTATTGGTGTGTTGGATATTGCCGGTTTTGAAATCTTTGAATATAACGGATTTGAACAACTGTGCA
TTAACTACACAAATGAAAGACTCCAACAATTTTTCAATCATCATATGTTCGTATTGGAACAAGAAGAGTATAAGAAAGAA
GCGATTGACTGGGAGTTTATAGACTTCGGATTAGATTTACAAGCTTGCATTGAACTTATTGAAAGACCAATGGGTATTCT
GTCAATTCTTGAGGAAGAGTGTATGTTTCCTAAAGCAACCGATGAGACTTTTGTTGCAAAATTGTATGAAAATCATCTGG
GTAAAAGTCCTAACTTTGGAAAACCAAAACCAAATGGTCAAGCAACTGCCCATTTTGAGTTACATCATTACGCTGGCTCT
GTTGGATATTCAATTACTGGATGGTTGATAAAAAATAAAGATCCAGTCAATGACAGTGTTCTTCAAACTTTAGGAGCTAG
TAAAGAAGCTCTTGTTGCTCAACTTTTTGCTCCTGCGGATGATGATGCTACTGGAAAGAAAAGGAAAGGAGGCAGCTTCT
TAACAGTATCGTTTGTTCACAGAGAATCTTTGAATAAACTTATGAAGAATTTACAAAGCACTAGTCCACATTTCATTAGA
TGTATTATTCCCAATGAATTAAAACAATCTGGATTCATTGACTCCCACTTAGTCCTACATCAACTTCATTGTAATGGTGT
GTTAGAAGGTATAAGAATATGTAGAAAAGGATTTCCAAATAGACTTATTTATTCTGAATTTAAACAAAG
>SMED30025388 ID=SMED30025388|Name=Myosin heavy chain|organism=Schmidtea mediterranea sexual|type=transcript|length=6089bp
TTTTTTTTCGAGTTTGTGCTAGAAATTAATTTCAGTTTGAAATTTTTTGCCTATTTCGAGTTCTTTGAAAACAATCTGAA
AACATGAACCCATCTGATCCCGATTTTCAATATCTCGGTGTCGACCGAAAAGCTTTAATGAAGCAGTATGGGGATTCCTT
TGACAGCAAGAAAAACTGTTGGATTCCTGACGAGAAAGAAGCCTTCATTGCGGCGACAATTGAAGATGCGTCTGGAGATG
TCTATACGGTCAAAACCGATAAAAGTGAAACCAAGACTGTTAAAAAGGACGAAATCGAACAAATGAATCCACCGAAATTT
TTGATGATTGAAGACATGGCAAATTTAACCTTTCTAAACGATGCCAGCGTTCTTGATAATTTAAGACAAAGATATTACAA
GAATCTGATTTATACCTACTCTGGACTGTTTTGTGTGACAATAAATCCATACAAAAGATTTCCAATTTACACCCCGCAGG
TGATTTCAAAATACAAAGGTAAACGACGAACTGAAATGCCTCCACATATTTTCTCGATATCCGACAATGCTTACACCAAC
ATGTTGGCGGACCGAGATAATCAATCTGTCTTAATTACTGGTGAAAGTGGAGCTGGGAAAACTGAAAATACAAAAAAAGT
TATCACTTATTTTGCACACGTTGCAGCTGCTACTAAAAAAGAAGAGGATGATACTGGAACTGGTCAAAAGAGAAAGGGAA
CATTGGAAGACCAAATCGTGCAAGCAAATCCTGTTTTAGAAGCATACGGTAACGCAAAAACTGTGCGAAACAACAATTCA
TCCAGATTTGGTAAATTCATTCGTATTCATTTCGGTACAAGTGGAAAAATAGCTGGAGCTGATATTGAATTTTACTTACT
CGAAAAATCGAGAGTAAATTCTCAACAGAAAGGTGAAAGAAACTATCACATTTTCTATCAAATTTTATCGAACGGAGGAA
AACCATTTCATGAAAAATTACTCATCTCTCCTGATCCAGCTTTGTATTCCTTCATTAATCAAGGTGAATTAACAATCGAT
GGAGTCGACGATGAAGAAGAAATGAAAATAACTGATGAAGCTTTCGACATTTTGGGATTTTCTGCCGAAGAAAAAATGAG
CTTGTTCAAGTGTACTTGCTCAATTTTAAACATGGGCGAAATGAAATTTAAACAAAGGCCAAGAGAAGAACAAGCCGAAG
CCGACGGTACTGCTGAAGCTGAGAAAGTGGCTTTTCTGTTGGGTGTCAATGCAAAAGATTTAATGCAATCGATTCTGAAA
CCGAAAGTTAAAGTTGGTAATGAATATGTCACAAAGGGGCAGAATAAAGATCAAGTTCTTTATTCGGTTGGTGCGCTAGC
AAAATCTCTTTACAACAGAATGTTTGCGTGGTTGGTTTTGAGAGTTAACAAAACCCTCGACACTAAAGTCAAGCGACAAT
TTTTCATCGGTGTTTTGGATATTGCCGGTTTCGAAATTTTCAATTTCAATGGATTTGAACAAATTTGTATTAATTACACC
AATGAAAGATTGCAGCAATTTTTTAACCATCACATGTTCGTGTTGGAACAGGAAGAGTACAAGAAGGAAGCGATCGATTG
GGAGTTCATTGATTTTGGAATGGATCTTCAAGCGTGCATTGAGCTCATTGAAAAGCCAATGGGTATTCTGTCAATCTTAG
AAGAAGAGTGCATGTTTCCGAAAGCATCTGATATGACATTTAAAGCAAAATTGTATGATAATCATCTCGGAAAAAGTCCC
AATTTTGGAAAGCCAAAACCTCCAAAACCCGGACAGGCTGAAGCTCACTTCGAATTGCATCACTATGCTGGCAGTGTGCC
ATACAATGTTACTGGTTGGCTGGAAAAGAATAAAGATCCTCTCAACGAAACTGTGATAAATCTACTTGCGGCAAGTAAAG
AGGCATTAGTTTCGAGTTTGTTTGCTCCGGCTGAAGATCCAAATAATACGGGTAAACGGAAAAAGGGTGGGGCCATGCAG
ACCATTTCTTCAACTCATAGGGAATCCTTGAATAAATTGATGAAAAATTTACAAAGTACCAGTCCACATTTTATCCGATG
CATTGTTCCAAACGAATTCAAACAACCTGGTGTAATCGACGCTCATTTGGTATTACATCAATTGCATTGTAACGGTGTCC
TTGAAGGCATCAGAATCTGTCGAAAGGGTTTCCCAAACAGAATGATTTATTCTGAATTTAAACAAAGATATTCTATCTTG
GCTCCAAATGCAATTCCACAGGGATTTGTTGAAGGCAAACAAGTAACGAGCAAAATTCTGGAAGCTGTTCAATTGGACAC
CAATCTTTACCGCCTGGGAAATACTAAGGTATTTTTCAAAGCTGGAACTTTGGCTGATTTAGAAGACATGCGTGATGAAA
AATTATCTTCACTGATTTCATTGTTTCAAGCTCAAATACGCGGATATTTGATGCGAAGACAATATAAAAAATTACAAGAT
CAGAGAGTTGCTCTATCTATCATTCAAAGAAATATTCGTAAATATCTTCTTCTGAGAACATGGCCATGGTGGAAATTGTA
TACCAAAGTTAAGCCACTTTTGAACATTGCTCGTCAAGAGGAAGAAATGAAAAAGGCCGCTGAAGAATTGACAAAATTAA
AGGAAGAATTCGAAAAAGTTGACAAATTCAAAAAAGAACTTGAAGAACAAAACGTCAAATTGTTGGAAGCTAAAAACGAT
TTGTTCTTACAATTACAAACCGAACAAGACAGTTTAGCCGATGCCGAGGAAAAGGTTTCAAAATTGGTTATGCAAAAAGC
CGATATGGAAGGAAGAATTAAAGAATTGGAAGATCACCTTCTAGAAGAAGAAGATAATGCTGCTGGACTGGAAGATATCA
AGAAGAAAATGCAGGGTGAGATTGAAGAGTTGAAAAAAGATGTTGTCGATTTGGAATCTTCATTACAAAAGGCTGAACAA
GAGAAAACCGCGAAAGATCAACAGATAAAATCGTTACAAGATCAAATGGCAAAACAAGAAGAAGAGATGAACAAATTGAA
AAAGGAGAAAAAGGCCGCCGATGAAGTGCAAAAGAAAACCGAAGAATCTCTACTAGCGGAAGAAGAGAAAGTCAAAAATC
TAAACAAAGCTAAAGCCAAATTGGAACAGACCATTGATGAGATGGAAGAAAACCTCTCGCGAGAACAGAAAATCCGAGCT
GACGTAGAAAAAGTTAAACGAAAAATCGAAACTGAACTGAAACAAACTCAAGAGACCGTAGACGATTTGGAAAGAGTAAA
ACGAGAATTAGAGGAACAATTGAAGCGCAAGGAAATGGAATTAGTCAATGCTTCATCGAAAATTGAAGACGAATCGGGAT
TAGTTGCCCAGCTTCAGAGGAAAATCAAAGAACTTCAAGCTCGAATTCAAGAATTGGAAGAAGATCTGGAAGCAGAAAGA
CAAGCCCGTGCAAAAGCAGAGAAAAGCCGACATCAACTCGAAGGCGAGTTGGAAGAATTGAGTGATCGACTGGAAGAACA
AGGAGGCGCAACCTCAGCTCAAATGGATCTCAATAAGAAGCGAGAGGCAGAATTAATGAAATTAAAGAGAGATTTAGAAG
AATCGAATATGCAACACGATCAGGTTATCGCACAAGCTCGAAAGAAGCAACAGGATGTTGTCAATGAATTCTCAGAACAG
CTCGATCAACTGCAGAAAGTCAAAGCTAAAGTTGAAAAAGAAAAGAATGAGATGAAAGAAGATTTAAATGACCTACAAGG
ACAGCTGGAATCATTAAATAAAGCCAAGGCTAACAGCGACAAACGAATCAAAGAAATCGAAGCTCAAAATTCCGAATTAC
AGGGCAAATTGGAAGAGGCAAATAGACATATCAATGATGCCAACAATACATCTGGAAAGAATCAACAAACCAATGCGGAA
CTCCAAGCACGTTTAGAAGAAGCCGAATCGCAAATCAATCAGCTGGGTAAAGTCAAGCAACAAATGCAGACTCAACTCGA
AGAAGCCAGGCAAATCGCTGAGGAAGAGTCGAGAGCAAAGGCTAAATTGAGTTCTGATGTTCGCAATCTCAATGCCGATT
TAGACAATCTCAGGGAGGCACTGGAAGAGGAAAATGAGAACAAAAGTGACATACAGAGACAGCTAGTTAAAGCTCAGGGA
GAAATGCAACAATTGAAGGCTAAATTCGAAGGCTCGGGATCCATTCGTTCAGAAGAGTTGGATGAAGCCAAGCGAAAGTT
TATGACACGAATCCATGAGCTGGAAGAGGAAGCTGAAACCGCCAAATCGAAAGCCGGACAACTAGAAAAAGTTAAAGCTC
GACTCCAAGGAGAAATCGAAGATATGCTGGTCGACGTTGACAGAGCGAATACACTCGCATCTCAGTTGGAAAAGAAGCAG
AAAACATTCGATAAAGTCGTGTCAGAATGGCAGCAGAAATATGCTGAATCTCAGGCGGAATTGGAAGCATCCCAGAGAGA
AAGCAGGACGATTTCAGCTGAGGTGTTTCGAATGAAAGCACAAATCGAAGAAAGTCAAGAGCAGTTGGAAAGCGTTAAAC
GGGAAAACAAAAATCTAGCAGATGAAATCCACGATTTGACAGAGCAAATCGGAGAAGGAGGTCGCAGTGTTCACGAAATC
GACAAAGCAAGGAAACGATTGGAAATGGAAAAGGAAGAATTGCAACATGCGTTAGAAGAAGCCGAACAAGCTTTGGAACA
GGAAGAAGCCAAGTCTCAACGATCACAACTGGAAATGAGCCAGATCAGACAAGAAATCGACAGGCGATTGGCTGAGAAGG
AAGAGGAATTCGAGGCCACTCGAGTCAATCATCAAAGAGCAATGGAGTCAATGGAAGCCTCACTTGAAGCCGAATCCAGA
GGCAGGGCTGAAGCAACGAAGATGAAAAAGAAACTGGAGCACGATATCGGTGAACTGGAAGTTGCAGTGGATACCGCCAA
CAGAATCCGATCGGAGCAAGAAAAGAACGCAAAGAAATTCCAGCAGCAAGTTCAAGAATTGCTATCAATGGTGGAGGATG
AGAAACACCAGAAGGATCAGATACGAGAGCAAACGACGATGACAGAAAGGAAATTGACAATGGTCCTGGCAGAGCTTGAG
GAGGTTCGTGGCTCATTGGAAAATTCCGAGAGAAACAGGAAAAATACCGAGAATGAGAAAATGGAAATAACTGATCGATT
GAATGAGTTGAGTGTCCAGAGCTCCGGTTTCATGGCTACCAAGCGGAAATTGGAAGCTGATTTGGCTGCTATGCAGTCCG
ATTTAGAGGAGGCCGCTACTGAAGCCCGACAAGCCAATGAACAAGCCAAGAAGGCTGTTGCTGACAGTGCGAGATTGTTT
GATGAAATCCGGCAAGAGCAGGAACACGCACAGCAAATCGATAAGATCAAGAAACAACTCGAGGCCCAAAATAAAGAATT
GCAAGCCAAATTAGATGAATCGGAGAATAATGCTTTGAAAGGTGGCAAAAAAGCCTTGAGCAAACTAGAGCAACGCGTTC
GTGAACTTGAAGCCGAATTAGACGGAGAACAAAAAAGACACGTTGAAAGTCAAAAGAACTCCAGAAAAGTTGAAAGACGG
CTTAAGGAGCTTGGATTACAAACCGACGAAGATAAGAAGAACCAAGAAAGATTGCAAGATCTGGTGGAGAAGCTTCAAGG
TAAAATCAAAACCTACAAACGCCAGGTGGAAGAGGCGGAAGAAATTGCTGCTGTAAACTTAGCAAAATACAGAAAGATCC
AACAGGAAATCGAAGATTCCGAAGAAAGAGCTGATCAAGCTGAACAAGCGTTGCAGAAGCTGAGGACCAAAAACCGCAGC
TCCGTTTCGACAGCGAGAGGCGGTAGCATGGCTCCCGGCATGACCACAGTGAAATCGACATCACTCTCTGTTTCGGCTTC
GAGCCGACGACAAGGTTCTAGTGTTTCCAGAGAGAGCTAAGTCAGAAATTCTAGTAACACAACGATAAATTATTAGGATT
TACTTAATTGACATTATTTGCATGTTATCAATTATTGGACACAATTTAGTGATGCTTTTATTTAATAAAATTTACATTTT
GAAAAAAAA

 

back to top





PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in muscle cell. Click this link to learn more about PAGE.


PAGE Curations: 2323


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
muscle cellSMED30019535Protein lifeguard 2SMESG000057144.1 dd_Smed_v4_1586_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30014051TetraspaninSMESG000019444.1 dd_Smed_v4_11375_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30018039TNF receptor-associated factorSMESG000025998.1 SMESG000025982.1 SMESG000025980.1 SMESG000025963.1 SMESG000025934.1 SMESG000025901.1 SMESG000025797.1 SMESG000025794.1 SMESG000025517.1 dd_Smed_v4_1139_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30012110C2H2-type domain-containing proteinSMESG000064731.1 dd_Smed_v4_18947_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016666SMED30016666SMESG000016698.1 dd_Smed_v4_13460_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30019036SMED30019036SMESG000023295.1 dd_Smed_v4_10859_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30017051EGF-like domain-containing proteinSMESG000016698.1 dd_Smed_v4_13460_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30013109Heterogeneous nuclear ribonucleoprotein QSMESG000071117.1 dd_Smed_v4_10996_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30013260SAM domain-containing proteinSMESG000010456.1 SMESG000002915.1 dd_Smed_v4_1968_2_1dd_Smed_v4PMID:29674431
muscle cellSMED30013260SAM domain-containing proteinSMESG000054431.1 dd_Smed_v4_7610_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30013305SMED30013305SMESG000079765.1 dd_Smed_v4_10395_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30010770SMED30010770SMESG000019888.1 dd_Smed_v4_8158_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30010770SMED30010770SMESG000019889.1 SMESG000019888.1 dd_Smed_v4_12528_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30010772slc25a-32SMESG000010598.1 dd_Smed_v4_1662_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30022468secreted frizzled-related protein 1SMESG000075831.1 SMESG000029446.1 dd_Smed_v4_13985_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30022468secreted frizzled-related protein 1SMESG000075831.1 SMESG000029446.1 dd_Smed_v4_13985_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30021707SMED30021707SMESG000063964.1 dd_Smed_v4_11231_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30018750SMED30018750SMESG000032765.1 SMESG000032764.1 dd_Smed_v4_9225_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30019571Protein kinase domain containing proteinSMESG000024532.1 dd_Smed_v4_2822_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30019039MetalloendopeptidaseSMESG000005882.1 dd_Smed_v4_5652_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30019039MetalloendopeptidaseSMESG000005882.1 dd_Smed_v4_5652_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30019324Clathrin light chainSMESG000019387.1 dd_Smed_v4_2973_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30022889SeptinSMESG000079489.1 SMESG000049701.1 dd_Smed_v4_2586_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30024367Small heat shock protein p36SMESG000033587.1 dd_Smed_v4_2736_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023308SMED30023308SMESG000063568.1 dd_Smed_v4_762_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30024411Protein kinase domain-containing proteinSMESG000024532.1 dd_Smed_v4_2822_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30022804slc12a-1SMESG000043221.1 SMESG000043220.1 dd_Smed_v4_4047_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30025299E3 ubiquitin-protein ligase TRIM9SMESG000048786.1 dd_Smed_v4_8386_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30022797Striatin-interacting protein 1SMESG000044508.1 dd_Smed_v4_2332_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30024072Protein argonaute-3SMESG000051000.1 dd_Smed_v4_7594_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023147SMED30023147SMESG000032765.1 SMESG000032764.1 dd_Smed_v4_9225_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30021791Tubulin alpha chainSMESG000079660.1 dd_Smed_v4_2697_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30021791Tubulin alpha chainSMESG000079660.1 dd_Smed_v4_2679_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30021982Troponin ISMESG000036684.1 dd_Smed_v4_7974_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30024442Serine/threonine kinaseSMESG000079489.1 SMESG000049701.1 dd_Smed_v4_2586_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30020359Smed-NDK-3SMESG000046244.1 SMESG000046208.1 dd_Smed_v4_6604_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30026457Fumarate hydratase, class ISMESG000075499.1 SMESG000009591.1 dd_Smed_v4_2405_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30020315Dipeptidyl peptidase 4SMESG000018885.1 dd_Smed_v4_9183_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30002665CREB-binding proteinSMESG000048249.1 dd_Smed_v4_9154_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001897Tubulin alpha chainSMESG000079660.1 dd_Smed_v4_2697_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001897Tubulin alpha chainSMESG000079660.1 dd_Smed_v4_2679_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001680SMED30001680SMESG000002033.1 dd_Smed_v4_884_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001497Rho guanine nucleotide exchange factor 17SMESG000018133.1 dd_Smed_v4_2922_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001478Dynamin-like proteinSMESG000002033.1 dd_Smed_v4_884_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30031472SMED30031472SMESG000016767.1 dd_Smed_v4_10774_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30029426Baculoviral IAP repeat-containing protein 7SMESG000067789.1 dd_Smed_v4_1187_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30034837Potassium voltage-gated channel proteinSMESG000029097.1 dd_Smed_v4_13710_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30026987TNF receptor-associated factorSMESG000025998.1 SMESG000025982.1 SMESG000025980.1 SMESG000025963.1 SMESG000025934.1 SMESG000025901.1 SMESG000025797.1 SMESG000025794.1 SMESG000025517.1 dd_Smed_v4_1139_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30035110GCR158SMESG000012028.1 dd_Smed_v4_10399_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30030425Ubiquitin carboxyl-terminal hydrolase 7SMESG000050890.1 dd_Smed_v4_1847_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30031715Spectrin beta chainSMESG000035098.1 dd_Smed_v4_1684_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30028387F-box and leucine rich repeat protein 16SMESG000006324.1 dd_Smed_v4_12738_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023201SMED30023201SMESG000041543.1 dd_Smed_v4_1903_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30024109Non-specific serine/threonine protein kinaseSMESG000074914.1 dd_Smed_v4_11891_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30028575Serine/threonine-protein phosphatase with EF-handsSMESG000042202.1 dd_Smed_v4_11874_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30026123SMED30026123SMESG000061517.1 dd_Smed_v4_14659_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30033252Cell adhesion molecule-related/down-regulated by oncogenesSMESG000010456.1 SMESG000002915.1 dd_Smed_v4_1968_2_1dd_Smed_v4PMID:29674431
muscle cellSMED30004253HexosyltransferaseSMESG000042545.1 dd_Smed_v4_6589_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30017175ras GTPase-activating protein nGAP isoform X8SMESG000037132.1 SMESG000037110.1 dd_Smed_v4_6499_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30005459SMED30005459SMESG000014884.1 dd_Smed_v4_2661_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30006736colorectal mutant cancer proteinSMESG000002794.1 dd_Smed_v4_5396_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30011050hypothetical proteinSMESG000044135.1 dd_Smed_v4_8839_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016204cyclinG-like proteinSMESG000077612.1 dd_Smed_v4_6866_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30005488X1.C.D3.1SMESG000005130.1 dd_Smed_v4_3257_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30003343Peptidyl-prolyl cis-trans isomeraseSMESG000038766.1 dd_Smed_v4_686_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30013808fos-1SMESG000003328.1 dd_Smed_v4_2789_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30014980LaminSMESG000009886.1 dd_Smed_v4_850_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30012874Adenylate cyclase type 9SMESG000037351.1 dd_Smed_v4_2998_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30010890Y box binding protein 1SMESG000008704.1 dd_Smed_v4_347_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30005117SMED30005117SMESG000049162.1 dd_Smed_v4_2620_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30010468RBR-type E3 ubiquitin transferaseSMESG000062644.1 dd_Smed_v4_3281_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30010112SMED30010112SMESG000037132.1 SMESG000037110.1 dd_Smed_v4_6499_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30003321Kinase D-interacting substrateSMESG000080369.1 dd_Smed_v4_9630_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30008911FascinSMESG000037971.1 dd_Smed_v4_996_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30008748acetylcholine receptor subunit alpha-likeSMESG000020665.1 dd_Smed_v4_9799_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000054Rab-GAP TBC domain-containing proteinSMESG000003946.1 dd_Smed_v4_10066_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30003789SMED30003789SMESG000011613.1 dd_Smed_v4_11093_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30006547SMED30006547SMESG000016698.1 dd_Smed_v4_13460_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30007107SMED30007107SMESG000050890.1 dd_Smed_v4_1847_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30006092SMED30006092SMESG000020731.1 SMESG000020729.1 dd_Smed_v4_11220_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016952Frizzled 5/8 proteinSMESG000005043.1 dd_Smed_v4_11823_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30006095Aspartate aminotransferaseSMESG000022764.1 dd_Smed_v4_2004_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001679Calcium-transporting ATPaseSMESG000014734.1 dd_Smed_v4_1721_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001690SMED30001690SMESG000069322.1 dd_Smed_v4_12571_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30008402G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000075377.1 SMESG000003543.1 dd_Smed_v4_12494_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30004761Polypeptide N-acetylgalactosaminyltransferaseSMESG000076075.1 dd_Smed_v4_10587_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30015071Eyes absent homologSMESG000001561.1 dd_Smed_v4_11372_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000553Epithelial discoidin domain-containing receptorSMESG000069322.1 dd_Smed_v4_12571_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001376Collagen IV NC1 domain-containing proteinSMESG000071508.1 dd_Smed_v4_1579_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001376Collagen IV NC1 domain-containing proteinSMESG000071508.1 dd_Smed_v4_1579_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30003275Guanine nucleotide-binding protein G(O) subunit alphaSMESG000055191.1 dd_Smed_v4_1656_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30034629Golgi-associated plant pathogenesis-related protein 1SMESG000063568.1 dd_Smed_v4_762_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30025325Neurogenic locus notch proteinSMESG000063217.1 dd_Smed_v4_7067_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30034737Protocadherin-1SMESG000005378.1 dd_Smed_v4_10467_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30028809Transient receptor potential cation channel subfamily M member-like 2SMESG000004955.1 dd_Smed_v4_8493_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30028061Bicaudal D proteinSMESG000060877.1 dd_Smed_v4_7219_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30030412SCA7 domain-containing proteinSMESG000037107.1 dd_Smed_v4_6031_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30033789One cut domain family memberSMESG000007728.1 dd_Smed_v4_7877_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30036016Histone H2ASMESG000018807.1 dd_Smed_v4_7383_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30022087TNFR CD27 30 40 95 cysteine rich regionSMESG000065173.1 dd_Smed_v4_3783_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023469SMED30023469SMESG000067424.1 dd_Smed_v4_7353_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30014787cGMP-dependent protein kinaseSMESG000016927.1 dd_Smed_v4_7139_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30014787cGMP-dependent protein kinaseSMESG000016927.1 dd_Smed_v4_27739_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30014640Small heat shock protein p36SMESG000028601.1 dd_Smed_v4_6399_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30004698Small conductance calcium-activated potassium channel proteinSMESG000076156.1 dd_Smed_v4_14006_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30004214SMED30004214SMESG000055805.1 dd_Smed_v4_857_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000643Immunoglobulin superfamily member 10SMESG000051622.1 dd_Smed_v4_6576_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30010561SMED30010561SMESG000076582.1 SMESG000066271.1 dd_Smed_v4_2649_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30002902Triple functional domain proteinSMESG000061508.1 SMESG000027427.1 dd_Smed_v4_5483_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30019884Four and a half LIM domains 5SMESG000036525.1 dd_Smed_v4_3385_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000193Transposon Ty3-I Gag-Pol polyproteinSMESG000037107.1 dd_Smed_v4_6031_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30006180Fibrillar collagen NC1 domain-containing proteinSMESG000031448.1 dd_Smed_v4_702_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30006180Fibrillar collagen NC1 domain-containing proteinSMESG000031448.1 dd_Smed_v4_702_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30005099UPF0546 membrane protein AGAP012180SMESG000012908.1 dd_Smed_v4_10533_0_1dd_Smed_v4PMID:29674431
muscle cellSMED300120465'-AMP-activated protein kinase subunit beta-1SMESG000037698.1 dd_Smed_v4_6112_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30008241SMED30008241SMESG000005752.1 dd_Smed_v4_14706_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30003183Universal stress protein Rv1636SMESG000022085.1 dd_Smed_v4_3388_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30003729Dynein light chainSMESG000048100.1 dd_Smed_v4_5884_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30005322SMED30005322SMESG000078208.1 dd_Smed_v4_2727_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016580SMED30016580SMESG000044545.1 dd_Smed_v4_5799_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30006132PHB domain-containing proteinSMESG000048102.1 dd_Smed_v4_16206_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30022530Ectonucleotide pyrophosphatase/phosphodiesterase family member 5SMESG000023331.1 dd_Smed_v4_5829_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30034772Fibrillar collagen NC1 domain-containing proteinSMESG000077977.1 dd_Smed_v4_9565_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30034772Fibrillar collagen NC1 domain-containing proteinSMESG000077977.1 dd_Smed_v4_9565_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30034772Fibrillar collagen NC1 domain-containing proteinSMESG000077977.1 dd_Smed_v4_9565_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30030903E3 ubiquitin protein ligase synoviolinSMESG000040458.1 SMESG000040456.1 SMESG000038129.1 dd_Smed_v4_2194_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30030974SMED30030974SMESG000005752.1 dd_Smed_v4_14706_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30034846PaxillinSMESG000022586.1 SMESG000022579.1 SMESG000022578.1 dd_Smed_v4_9298_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30026396Receptor expression-enhancing proteinSMESG000044545.1 dd_Smed_v4_5799_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30028104Nou-darake-like-2SMESG000027359.1 dd_Smed_v4_8340_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30022256Eukaryotic elongation factor 2 kinaseSMESG000014704.1 dd_Smed_v4_2226_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30028591Protein kinaseSMESG000030545.1 dd_Smed_v4_11177_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30020283soxP-5SMESG000066725.1 dd_Smed_v4_9050_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023889SMED30023889SMESG000055805.1 dd_Smed_v4_857_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30034681cAMP-dependent protein kinase catalytic subunitSMESG000016651.1 dd_Smed_v4_911_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30035008Dipeptidyl peptidase 4SMESG000018885.1 dd_Smed_v4_9183_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30034500early growth response-2SMESG000004840.1 dd_Smed_v4_9273_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30021103Ig-like domain-containing proteinSMESG000042512.1 dd_Smed_v4_6524_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30021103Ig-like domain-containing proteinSMESG000042512.1 dd_Smed_v4_6524_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30030448Dual specificity protein phosphatase 10SMESG000078269.1 dd_Smed_v4_3617_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30028849One cut domain family memberSMESG000007728.1 dd_Smed_v4_7877_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30033291SMED30033291SMESG000030545.1 dd_Smed_v4_11177_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30028658early growth response-4SMESG000028801.1 SMESG000028800.1 dd_Smed_v4_9410_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30025215Fzd-1/2/7SMESG000040115.1 dd_Smed_v4_6353_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30026726RING domain ligase2 isoform 3SMESG000003596.1 dd_Smed_v4_5871_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30021992SMED30021992SMESG000037107.1 dd_Smed_v4_6031_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30026729PaxillinSMESG000022586.1 SMESG000022579.1 SMESG000022578.1 dd_Smed_v4_9298_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30030752Tripartite motif-containing protein 2SMESG000023375.1 dd_Smed_v4_8395_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30026863SLIT-ROBO Rho GTPase activating proteinSMESG000028956.1 dd_Smed_v4_8708_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30030406RBR-type E3 ubiquitin transferaseSMESG000049136.1 dd_Smed_v4_16493_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30030406RBR-type E3 ubiquitin transferaseSMESG000019889.1 SMESG000019888.1 dd_Smed_v4_12528_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30022561SMED30022561SMESG000040147.1 dd_Smed_v4_8897_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027110TNF receptor-associated factorSMESG000070236.1 SMESG000070235.1 dd_Smed_v4_7291_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023416ANK_REP_REGION domain-containing proteinSMESG000033773.1 dd_Smed_v4_5594_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30035066axis inhibition protein BSMESG000025925.1 dd_Smed_v4_5531_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30035066axis inhibition protein BSMESG000025925.1 dd_Smed_v4_5818_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023860ParamyosinSMESG000058328.1 dd_Smed_v4_711_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30002297PhosphodiesteraseSMESG000023094.1 dd_Smed_v4_6991_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30003613Calcium-binding protein, putativeSMESG000011029.1 dd_Smed_v4_660_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001022TNF receptor-associated factor 1-likeSMESG000049895.1 dd_Smed_v4_6017_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30003562Collagen type IV alpha 2 chainSMESG000077782.1 dd_Smed_v4_701_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30003562Collagen type IV alpha 2 chainSMESG000077782.1 dd_Smed_v4_701_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30016357SMED30016357SMESG000061508.1 SMESG000027427.1 dd_Smed_v4_5483_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30007889SMED30007889SMESG000062027.1 dd_Smed_v4_6700_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30017388Fibrillar collagenSMESG000024244.1 dd_Smed_v4_740_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30017388Fibrillar collagenSMESG000024244.1 dd_Smed_v4_740_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30017388Fibrillar collagenSMESG000024244.1 dd_Smed_v4_740_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30001038antichymotrypsin-2-like isoform X2SMESG000078707.1 dd_Smed_v4_5315_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30009184Ubiquitin carboxyl-terminal hydrolaseSMESG000040147.1 dd_Smed_v4_8897_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30009863Guanylate kinaseSMESG000052587.1 SMESG000052584.1 dd_Smed_v4_4875_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30015524Dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complexSMESG000072206.1 SMESG000025299.1 dd_Smed_v4_4750_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000527SMED30000527SMESG000034072.1 dd_Smed_v4_7973_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30012974slc25a-27SMESG000061901.1 dd_Smed_v4_543_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30018509Glutamate receptor interacting protein 1SMESG000009125.1 dd_Smed_v4_7659_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30007982Protein Tob1SMESG000080545.1 dd_Smed_v4_13216_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016080Deoxyhypusine hydroxylaseSMESG000051726.1 SMESG000051721.1 dd_Smed_v4_703_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30018389SMED30018389SMESG000054821.1 dd_Smed_v4_3684_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30018619Voltage-dependent L-type calcium channel subunit beta-2SMESG000007850.1 dd_Smed_v4_6006_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30014375noggin 2SMESG000056505.1 dd_Smed_v4_19527_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000203Glutamate receptor, metabotropicSMESG000064049.1 dd_Smed_v4_11092_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30014869Netrin receptor DCCSMESG000056891.1 dd_Smed_v4_7195_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30004084SMED30004084SMESG000011029.1 dd_Smed_v4_660_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016113SMED30016113SMESG000053522.1 dd_Smed_v4_548_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30006129BTB domain-containing proteinSMESG000042931.1 SMESG000042930.1 SMESG000027727.1 dd_Smed_v4_10272_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30002896SMED30002896SMESG000065225.1 SMESG000065211.1 SMESG000065210.1 dd_Smed_v4_7442_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30013334Glutathione peroxidaseSMESG000077750.1 dd_Smed_v4_662_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30004846Actin-binding LIM proteinSMESG000080177.1 dd_Smed_v4_5410_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30008311SMED30008311SMESG000006280.1 dd_Smed_v4_9073_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30013637UPF0546 membrane protein AGAP012180SMESG000012908.1 dd_Smed_v4_10533_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30006636Kinesin-like proteinSMESG000022785.1 dd_Smed_v4_6697_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30011506SH2 domain-containing proteinSMESG000006496.1 dd_Smed_v4_7305_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30009076ActinSMESG000066035.1 SMESG000066029.1 SMESG000066027.1 SMESG000066020.1 dd_Smed_v4_90_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30009076ActinSMESG000066035.1 SMESG000066029.1 SMESG000066027.1 SMESG000066020.1 dd_Smed_v4_37_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30013075Voltage-dependent anion channel 3SMESG000000196.1 dd_Smed_v4_738_0_1dd_Smed_v4PMID:29674431
muscle cellSMED3001647139S ribosomal protein L21 mitochondrialSMESG000072214.1 SMESG000024477.1 dd_Smed_v4_2553_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30012368Prominin (Prom) protein, putativeSMESG000025078.1 dd_Smed_v4_6506_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30018236Bromodomain adjacent to zinc finger domainSMESG000068165.1 dd_Smed_v4_7394_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000996Protein CASPSMESG000025654.1 dd_Smed_v4_5685_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30003276Protein atonal like protein 8SMESG000056587.1 dd_Smed_v4_9899_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30011577Lactamase_B domain-containing proteinSMESG000017976.1 dd_Smed_v4_1825_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30011180Kinesin-like protein KIF26ASMESG000051203.1 dd_Smed_v4_8860_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30011827PrefoldinSMESG000016835.1 dd_Smed_v4_2373_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30015728Proteasome subunit alpha typeSMESG000013387.1 dd_Smed_v4_2117_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30002349GATA456-2SMESG000022702.1 dd_Smed_v4_9910_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30007561Protocadherin-hSMESG000034072.1 dd_Smed_v4_7973_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30032433Neuron navigator 2SMESG000058374.1 dd_Smed_v4_2618_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027197UMP-CMP kinaseSMESG000056620.1 SMESG000031498.1 dd_Smed_v4_3353_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30025497secreted frizzled related protein 2SMESG000050379.1 dd_Smed_v4_8832_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30025497secreted frizzled related protein 2SMESG000050379.1 dd_Smed_v4_8832_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30027074SMED30027074SMESG000005752.1 dd_Smed_v4_15537_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30024625Expressed conserved proteinSMESG000056224.1 dd_Smed_v4_2100_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30031183SMB domain-containing proteinSMESG000079236.1 dd_Smed_v4_11622_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30029564SMED30029564SMESG000028405.1 dd_Smed_v4_12746_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30025680Anosmin-1SMESG000033070.1 dd_Smed_v4_13188_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30025680Anosmin-1SMESG000033070.1 dd_Smed_v4_13188_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30030980S-phase kinase-associated protein 1SMESG000054815.1 dd_Smed_v4_1337_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30031256wntP-2SMESG000066476.1 dd_Smed_v4_7326_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30031256wntP-2SMESG000066476.1 dd_Smed_v4_7326_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30022777SMED30022777SMESG000026662.1 dd_Smed_v4_5031_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027419msh6SMESG000073017.1 dd_Smed_v4_15463_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30021539Diacylglycerol lipase betaSMESG000046500.1 dd_Smed_v4_13306_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30032420SMED30032420SMESG000050229.1 SMESG000050221.1 dd_Smed_v4_1219_1_1dd_Smed_v4PMID:29674431
muscle cellSMED30023267Tubulin alpha chainSMESG000079660.1 dd_Smed_v4_2143_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027092SMED30027092SMESG000078236.1 SMESG000032651.1 dd_Smed_v4_4949_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30026110Acetolactate synthase, putativeSMESG000026596.1 dd_Smed_v4_1784_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30033229SMED30033229SMESG000040007.1 SMESG000039999.1 dd_Smed_v4_2299_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30024478SMED30024478SMESG000031417.1 dd_Smed_v4_10312_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30032845SMED30032845SMESG000036221.1 dd_Smed_v4_16440_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30032757DishevelledSMESG000049876.1 dd_Smed_v4_4639_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023907SMED30023907SMESG000042253.1 dd_Smed_v4_13413_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000153Netrin 1SMESG000006779.1 dd_Smed_v4_9737_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000153Netrin 1SMESG000006779.1 dd_Smed_v4_9737_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30005033vinculinSMESG000028193.1 dd_Smed_v4_3542_0_1dd_Smed_v4PMID:29674431
muscle cellSMED300070105-hydroxytryptamine receptor 1ASMESG000017736.1 dd_Smed_v4_5341_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30015172Protein kinase CSMESG000039865.1 SMESG000039854.1 SMESG000032749.1 SMESG000032747.1 dd_Smed_v4_4244_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30018630High mobility group proteinSMESG000052032.1 dd_Smed_v4_1331_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016788Zinc finger protein zicSMESG000052644.1 dd_Smed_v4_15531_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30003662Serine/threonine-protein phosphatase 2A 55 kDa regulatory subunit BSMESG000074250.1 dd_Smed_v4_5857_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001657ParamyosinSMESG000009422.1 SMESG000009423.1 dd_Smed_v4_2381_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30004756Small nuclear ribonucleoprotein Sm D2SMESG000032344.1 dd_Smed_v4_2994_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30013824Unc-5 netrin receptor BSMESG000040323.1 dd_Smed_v4_10380_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016760HATPase_c domain-containing proteinSMESG000054821.1 SMESG000054819.1 dd_Smed_v4_2265_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027141SMED30027141SMESG000059828.1 dd_Smed_v4_1549_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30021328SMED30021328SMESG000028190.1 dd_Smed_v4_17722_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30034851Procollagen galactosyltransferaseSMESG000037408.1 dd_Smed_v4_10276_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30026131SMED30026131SMESG000027311.1 dd_Smed_v4_1401_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30022433SMED30022433SMESG000036199.1 dd_Smed_v4_11599_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30029683SMED30029683SMESG000023213.1 SMESG000023211.1 dd_Smed_v4_3814_1_1dd_Smed_v4PMID:29674431
muscle cellSMED30022929WntASMESG000051375.1 SMESG000037126.1 dd_Smed_v4_4877_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30022929WntASMESG000051375.1 SMESG000037126.1 dd_Smed_v4_4877_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30022612Ester hydrolase C11orf54-like proteinSMESG000027576.1 SMESG000007855.1 dd_Smed_v4_1733_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30021645SMED30021645SMESG000014085.1 SMESG000014086.1 SMESG000014087.1 dd_Smed_v4_10249_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30035118leucine rich repeat and fibronectin type III domain containing-1SMESG000045027.1 dd_Smed_v4_10393_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30021485SMED30021485SMESG000059844.1 dd_Smed_v4_1328_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30029249Serine/threonine-protein kinase NIM1SMESG000005159.1 dd_Smed_v4_15794_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30031058Galanin receptor type 2SMESG000043375.1 SMESG000043376.1 dd_Smed_v4_18897_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30035218GelsolinSMESG000015535.1 dd_Smed_v4_1132_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027376SMED30027376SMESG000007018.1 SMESG000007017.1 dd_Smed_v4_1969_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30036005Calcium-transporting ATPaseSMESG000050554.1 dd_Smed_v4_1772_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30034381Malate dehydrogenaseSMESG000056995.1 dd_Smed_v4_467_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30035241Protein phosphatase 1 regulatory subunit 3ASMESG000078349.1 dd_Smed_v4_1526_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30028312Protein tyrosine phosphatase receptor type DSMESG000053906.1 dd_Smed_v4_12545_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30035413Small conductance calcium-activated potassium channel proteinSMESG000046614.1 dd_Smed_v4_15620_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30024211TitinSMESG000005752.1 dd_Smed_v4_13910_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30024211TitinSMESG000005752.1 dd_Smed_v4_17069_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30024211TitinSMESG000005752.1 dd_Smed_v4_33016_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30034702ATPase inhibitor mai-2-like proteinSMESG000074861.1 SMESG000074860.1 dd_Smed_v4_1438_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30034400Procollagen-lysine 2-oxoglutarate 5-dioxygenaseSMESG000016065.1 dd_Smed_v4_4942_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30034400Procollagen-lysine 2-oxoglutarate 5-dioxygenaseSMESG000016065.1 dd_Smed_v4_4942_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30030824ENTH domain-containing proteinSMESG000019746.1 dd_Smed_v4_1065_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30028905Chaperone protein DnaJSMESG000036199.1 dd_Smed_v4_11599_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30026564Ubiquitin carboxyl-terminal hydrolase family proteinSMESG000040007.1 SMESG000039999.1 dd_Smed_v4_2299_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30028353Dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit DAD1SMESG000050730.1 dd_Smed_v4_2109_1_1dd_Smed_v4PMID:29674431
muscle cellSMED30024775TransgelinSMESG000000987.1 dd_Smed_v4_1512_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30015470SparcSMESG000024280.1 dd_Smed_v4_1021_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30015470SparcSMESG000024280.1 dd_Smed_v4_1021_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30007876Myosin regulatory light chain, putativeSMESG000026825.1 dd_Smed_v4_803_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30019337Nuclear receptor domain-containing proteinSMESG000017345.1 dd_Smed_v4_14067_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30018061Ribose-5-phosphate isomeraseSMESG000004984.1 dd_Smed_v4_12956_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30015403Sushi/SCR/CCP domain-containing proteinSMESG000009422.1 SMESG000009423.1 dd_Smed_v4_2381_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000714Activated cdc42 kinase 1SMESG000060583.1 dd_Smed_v4_6522_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000112glutathione hydrolase 1 proenzyme isoform X2SMESG000047031.1 dd_Smed_v4_4591_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30017516Collagen alpha-2(IV) chainSMESG000021729.1 dd_Smed_v4_2197_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30017516Collagen alpha-2(IV) chainSMESG000021729.1 dd_Smed_v4_2197_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30017516Collagen alpha-2(IV) chainSMESG000021729.1 dd_Smed_v4_2197_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30013932SMED30013932SMESG000055456.1 dd_Smed_v4_8147_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30019451SMED30019451SMESG000054705.1 SMESG000038343.1 dd_Smed_v4_2229_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30018984prefoldin subunit 2SMESG000075156.1 SMESG000075150.1 dd_Smed_v4_1368_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30013480DihydropyrimidinaseSMESG000060188.1 dd_Smed_v4_2040_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30015813slc3a-1SMESG000019192.1 SMESG000019184.1 dd_Smed_v4_2113_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30012599E3 ubiquitin-protein ligase TM129SMESG000022818.1 dd_Smed_v4_8706_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30009787Laminin subunit alpha-2SMESG000056016.1 SMESG000056013.1 dd_Smed_v4_7924_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30017378Aldose 1-epimeraseSMESG000011518.1 dd_Smed_v4_1947_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30004488TetraspaninSMESG000008659.1 dd_Smed_v4_6501_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30011701Filamin-ASMESG000017288.1 dd_Smed_v4_5496_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30014371SMED30014371SMESG000077296.1 dd_Smed_v4_1778_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30011666SMED30011666SMESG000058269.1 dd_Smed_v4_7993_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000377Membrane-associated guanylate kinase, WW and PDZ domain-containing protein 1SMESG000026494.1 dd_Smed_v4_5498_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016738ANK_REP_REGION domain-containing proteinSMESG000074861.1 SMESG000074860.1 dd_Smed_v4_1438_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30019288Reticulocalbin 3SMESG000012033.1 dd_Smed_v4_1417_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30003403SMED30003403SMESG000074733.1 dd_Smed_v4_9825_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30018850Enhancer of polycomb-like proteinSMESG000074469.1 dd_Smed_v4_6631_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30002428Gamma-aminobutyric acid receptor-associated proteinSMESG000026465.1 dd_Smed_v4_600_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30019888Homeobox protein aristalessSMESG000020038.1 dd_Smed_v4_16955_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001807ParamyosinSMESG000016909.1 dd_Smed_v4_249_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001195da proteinSMESG000032044.1 dd_Smed_v4_5579_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30015064Cyclin-dependent kinase 11BSMESG000033370.1 dd_Smed_v4_3540_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30015353TwitchinSMESG000051697.1 dd_Smed_v4_2544_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016281Myosin heavy chainSMESG000056451.1 dd_Smed_v4_1434_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016281Myosin heavy chainSMESG000056451.1 dd_Smed_v4_432_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30004085hypothetical proteinSMESG000038086.1 dd_Smed_v4_5639_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000245Zinc finger protein 112-likeSMESG000072474.1 SMESG000072473.1 dd_Smed_v4_2635_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30004868NeuroD-2 proteinSMESG000081091.1 dd_Smed_v4_9906_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016206Kazal-type serine protease inhibitor domain-containing protein 1SMESG000033854.1 dd_Smed_v4_4437_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016206Kazal-type serine protease inhibitor domain-containing protein 1SMESG000033854.1 dd_Smed_v4_4437_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30006260Sh3 domain-binding glutamic acid-rich-like proteinSMESG000018980.1 dd_Smed_v4_4404_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30008007Discoidin domain-containing receptor 2SMESG000066441.1 dd_Smed_v4_6578_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30019973Sm domain-containing proteinSMESG000010119.1 SMESG000001288.1 dd_Smed_v4_10184_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30019973Sm domain-containing protein dd_Smed_v4_3610_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30017199Neuregulin 1SMESG000026010.1 dd_Smed_v4_12297_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30014015SMED30014015SMESG000022082.1 dd_Smed_v4_8317_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30013942DENN domain-containing protein 5BSMESG000072343.1 dd_Smed_v4_7039_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30005280SMED30005280SMESG000077104.1 dd_Smed_v4_4063_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30019898Slc42a-1SMESG000048173.1 dd_Smed_v4_3286_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30017192Acetylcholine receptor subunit beta-like proteinSMESG000029213.1 dd_Smed_v4_12535_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30018086Talin-1SMESG000019748.1 dd_Smed_v4_1233_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30018086Talin-1SMESG000019748.1 dd_Smed_v4_7313_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30014077SMED30014077SMESG000053808.1 dd_Smed_v4_7928_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30019874CalmodulinSMESG000010769.1 dd_Smed_v4_255_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30002503SMED30002503SMESG000062999.1 SMESG000062995.1 dd_Smed_v4_3686_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001010SMED30001010SMESG000039006.1 dd_Smed_v4_13470_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30008034Fukutin-related proteinSMESG000043202.1 SMESG000040730.1 SMESG000040722.1 SMESG000040691.1 SMESG000039390.1 SMESG000039363.1 SMESG000039356.1 SMESG000039355.1 SMESG000039343.1 dd_Smed_v4_13280_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30002972Ubiquitin-like modifier-activating enzyme 5SMESG000020505.1 dd_Smed_v4_2151_0_1dd_Smed_v4PMID:29674431
muscle cellSMED300118365-hydroxytryptamine receptorSMESG000004643.1 dd_Smed_v4_21082_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30002616NK homeobox 4SMESG000018735.1 dd_Smed_v4_9259_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30003769calmodulin-betaSMESG000067105.1 dd_Smed_v4_4944_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30014562DNA mismatch repair protein PMS2SMESG000004803.1 dd_Smed_v4_16760_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30015575Collagen alpha-1(IV) chainSMESG000016766.1 dd_Smed_v4_2337_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30015575Collagen alpha-1(IV) chainSMESG000016766.1 dd_Smed_v4_2337_0_1dd_Smed_v4PMID:30962434
muscle cellSMED300116841-phosphatidylinositol 4,5-bisphosphate phosphodiesteraseSMESG000049234.1 dd_Smed_v4_3221_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30014348Four and a half LIM domains protein 1SMESG000006322.1 dd_Smed_v4_10293_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30012440Voltage-dependent calcium channel gamma-1 subunitSMESG000012544.1 dd_Smed_v4_9946_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30006125C2H2-type domain-containing proteinSMESG000020158.1 dd_Smed_v4_14413_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30019934SMED30019934SMESG000009290.1 dd_Smed_v4_815_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30017206Band 4.1 protein 2SMESG000062476.1 dd_Smed_v4_2032_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30014144Phytanoyl-CoA dioxygenase domain-containing protein 1-likeSMESG000023010.1 dd_Smed_v4_1207_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30017430Protein disulfide-isomeraseSMESG000023147.1 dd_Smed_v4_250_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30011970Colobus proteinSMESG000005049.1 dd_Smed_v4_4427_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30013124Aldehyde dehydrogenase family proteinSMESG000049241.1 dd_Smed_v4_1493_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30018309Iroquois-class homeodomain protein IRX-4SMESG000061184.1 dd_Smed_v4_11500_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30006455Forkhead box protein N3SMESG000032627.1 SMESG000033244.1 dd_Smed_v4_4078_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30017898G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000076048.1 dd_Smed_v4_8643_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001663Expressed conserved proteinSMESG000057766.1 dd_Smed_v4_4288_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001663Expressed conserved proteinSMESG000057766.1 dd_Smed_v4_6533_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30004487SMED30004487SMESG000012170.1 SMESG000012168.1 dd_Smed_v4_1367_0_1dd_Smed_v4PMID:29674431
muscle cellSMED3001096960S ribosomal protein L6SMESG000019835.1 dd_Smed_v4_839_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30007850SMED30007850SMESG000001248.1 dd_Smed_v4_3418_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30014747Pdz domain containing proteinSMESG000051965.1 dd_Smed_v4_8867_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30017015Deferrochelatase/peroxidase YfeXSMESG000077723.1 dd_Smed_v4_2999_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30018897Phorbol-ester/DAG-type domain-containing proteinSMESG000056465.1 dd_Smed_v4_2451_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30009776Collagen IV NC1 domain-containing proteinSMESG000066546.1 dd_Smed_v4_2500_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30009776Collagen IV NC1 domain-containing proteinSMESG000066546.1 dd_Smed_v4_2500_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30009776Collagen IV NC1 domain-containing proteinSMESG000066546.1 dd_Smed_v4_3747_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30009776Collagen IV NC1 domain-containing proteinSMESG000066546.1 dd_Smed_v4_3747_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30013891Ig-like domain-containing proteinSMESG000075643.1 dd_Smed_v4_19460_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30003871Peptidylprolyl isomeraseSMESG000011025.1 dd_Smed_v4_2765_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30014539cAMP-dependent protein kinase type II regulatory subunitSMESG000019065.1 dd_Smed_v4_2902_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30005807BasiginSMESG000039120.1 dd_Smed_v4_3356_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30009975Rho-GAP domain-containing proteinSMESG000078332.1 dd_Smed_v4_5208_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30009975Rho-GAP domain-containing proteinSMESG000078332.1 dd_Smed_v4_7670_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30011869X1.A2.3SMESG000031290.1 dd_Smed_v4_4279_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30034775Ras-associating domain-containing proteinSMESG000002146.1 dd_Smed_v4_3216_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023280TitinSMESG000041478.1 dd_Smed_v4_2928_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30024929Rap guanine nucleotide exchange factor 2SMESG000033489.1 SMESG000033486.1 dd_Smed_v4_4950_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027802Uroporphyrinogen-III synthaseSMESG000035357.1 dd_Smed_v4_4258_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30029746NFX1-type zinc finger-containing protein 1-likeSMESG000034905.1 dd_Smed_v4_2581_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30031444Fasciclin-2SMESG000038431.1 dd_Smed_v4_7422_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30006663SMED30006663SMESG000029399.1 dd_Smed_v4_1499_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30018643Fibrillar collagen NC1 domain-containing proteinSMESG000028920.1 dd_Smed_v4_832_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30018643Fibrillar collagen NC1 domain-containing proteinSMESG000028920.1 dd_Smed_v4_832_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30018643Fibrillar collagen NC1 domain-containing proteinSMESG000028920.1 dd_Smed_v4_832_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30015567Slc42a-1SMESG000048173.1 dd_Smed_v4_3286_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001642La-related protein 1SMESG000015732.1 dd_Smed_v4_1885_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30006777Collagen alpha-1(XV) chainSMESG000081921.1 dd_Smed_v4_3516_1_1dd_Smed_v4PMID:29674431
muscle cellSMED30006777Collagen alpha-1(XV) chainSMESG000081921.1 dd_Smed_v4_3516_1_1dd_Smed_v4PMID:30962434
muscle cellSMED30000108Glycerol-3-phosphate dehydrogenase [NAD( )]SMESG000008767.1 dd_Smed_v4_4661_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016835Proteasome subunit alpha typeSMESG000030651.1 dd_Smed_v4_1235_0_1dd_Smed_v4PMID:29674431
muscle cellSMED3000665560S ribosomal protein L32SMESG000060036.1 dd_Smed_v4_149_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30008695SMED30008695SMESG000053808.1 dd_Smed_v4_7928_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30002517Expressed conserved proteinSMESG000004480.1 dd_Smed_v4_8607_0_1dd_Smed_v4PMID:29674431
muscle cellSMED300163635'-nucleotidase proteinSMESG000032250.1 dd_Smed_v4_3474_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30005154SMED30005154SMESG000049720.1 SMESG000049718.1 dd_Smed_v4_2225_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30017210SMED30017210SMESG000004480.1 dd_Smed_v4_8607_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30006813UDG domain-containing proteinSMESG000064938.1 dd_Smed_v4_10660_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30004666ATP-dependent zinc metalloprotease FtsHSMESG000006322.1 dd_Smed_v4_10293_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30012700SMED30012700SMESG000073126.1 dd_Smed_v4_13668_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30002458FerritinSMESG000076636.1 dd_Smed_v4_2638_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30025510UHRF1-binding protein 1-likeSMESG000044305.1 dd_Smed_v4_11401_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023733Sodium/potassium-transporting ATPase subunit beta-2SMESG000071416.1 dd_Smed_v4_7917_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30035357follistatinSMESG000013298.1 dd_Smed_v4_9584_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30035357follistatinSMESG000013298.1 dd_Smed_v4_9584_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30027460Troponin iSMESG000002071.1 dd_Smed_v4_323_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027460Troponin iSMESG000002071.1 dd_Smed_v6_323_0dd_Smed_v6PMID:29674432
muscle cellSMED30032941TNF receptor associated factor 4SMESG000025998.1 SMESG000025982.1 SMESG000025980.1 SMESG000025963.1 SMESG000025934.1 SMESG000025901.1 SMESG000025797.1 SMESG000025794.1 SMESG000025517.1 dd_Smed_v4_1139_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30025624E3 ubiquitin-protein ligase LRSAM1SMESG000046440.1 SMESG000027652.1 dd_Smed_v4_10841_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30035013SMED30035013SMESG000077800.1 SMESG000054046.1 SMESG000052058.1 SMESG000044674.1 SMESG000066333.1 SMESG000052053.1 SMESG000052952.1 SMESG000080770.1 SMESG000065333.1 SMESG000063486.1 SMESG000059844.1 SMESG000058646.1 SMESG000055266.1 SMESG000054970.1 SMESG000052813.1 SMESG000043147.1 SMESG000037745.1 SMESG000037601.1 SMESG000036070.1 SMESG000034880.1 SMESG000034368.1 SMESG000031415.1 SMESG000019663.1 SMESG000010897.1 SMESG000009005.1 SMESG000006729.1 SMESG000005029.1 SMESG000003989.1 dd_Smed_v4_1760_1_1dd_Smed_v4PMID:29674431
muscle cellSMED30023928Netrin-1SMESG000076695.1 dd_Smed_v4_8504_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023928Netrin-1SMESG000076695.1 dd_Smed_v4_8504_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30020821SMED30020821SMESG000014298.1 dd_Smed_v4_1301_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30026686Glutamate synthaseSMESG000077776.1 dd_Smed_v4_5074_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30035175AnoctaminSMESG000065607.1 dd_Smed_v4_6809_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30034531Filamin-ASMESG000017288.1 dd_Smed_v4_1745_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027297winged helix/forkhead transcription factorSMESG000077075.1 dd_Smed_v4_23249_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30020946ATP-dependent RNA helicase DHX8SMESG000038860.1 dd_Smed_v4_12329_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30034143SMED30034143SMESG000060913.1 dd_Smed_v4_12123_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30032549ATP-dependent RNA helicase abstraktSMESG000012362.1 dd_Smed_v4_7181_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027929Tubulin beta chainSMESG000022928.1 dd_Smed_v4_471_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30032160Calponin-homology (CH) domain-containing proteinSMESG000017288.1 dd_Smed_v4_1745_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30034056Voltage-gated hydrogen channel 1SMESG000070756.1 dd_Smed_v4_15085_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30021372Methyltransf_11 domain-containing proteinSMESG000007804.1 dd_Smed_v4_10513_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30021549Usp domain-containing proteinSMESG000079952.1 dd_Smed_v4_1092_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30035963SMED30035963SMESG000071278.1 dd_Smed_v4_1649_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30021537SMED30021537SMESG000056249.1 dd_Smed_v4_1460_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30031920calmodulin-like protein 3SMESG000067105.1 dd_Smed_v4_4944_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30020388Glycerol-3-phosphate dehydrogenaseSMESG000076995.1 SMESG000076994.1 SMESG000076983.1 SMESG000076982.1 dd_Smed_v4_4928_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023110FilaminSMESG000011386.1 dd_Smed_v4_810_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30024713Pyruvate carboxylaseSMESG000077941.1 dd_Smed_v4_2393_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023391AnkyrinSMESG000040152.1 dd_Smed_v4_3523_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027983Glypican-1SMESG000032627.1 SMESG000033244.1 dd_Smed_v4_4078_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30035424NLK-1SMESG000023289.1 SMESG000023149.1 dd_Smed_v4_4172_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30028938Protein disulfide-isomerase A6SMESG000023147.1 dd_Smed_v4_250_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30026371SMED30026371SMESG000059828.1 dd_Smed_v4_2479_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30032731Ribose-phosphate pyrophosphokinaseSMESG000062796.1 dd_Smed_v4_12495_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30035296ProtocadherinSMESG000014472.1 dd_Smed_v4_11579_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30028086SMED30028086SMESG000017091.1 dd_Smed_v4_5303_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30025821Multiple PDZ domain crumbs cell polarity complex componentSMESG000053393.1 dd_Smed_v4_5376_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30026614DDE_Tnp_IS1595 domain-containing proteinSMESG000080852.1 dd_Smed_v4_7818_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30029009SMED30029009SMESG000066935.1 dd_Smed_v4_4765_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30034248SMED30034248SMESG000005941.1 dd_Smed_v4_3832_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023885PDZ domain-containing proteinSMESG000012918.1 dd_Smed_v4_11887_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30034464Ig-like domain-containing proteinSMESG000012091.1 dd_Smed_v4_2864_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30026043UTP--glucose-1-phosphate uridylyltransferaseSMESG000043519.1 dd_Smed_v4_3057_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30032979slc6a-8SMESG000079327.1 SMESG000079326.1 dd_Smed_v4_2109_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027246SMED30027246SMESG000047430.1 dd_Smed_v4_20269_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027246SMED30027246SMESG000047430.1 dd_Smed_v4_20269_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30029437SMED30029437SMESG000033809.1 SMESG000033801.1 dd_Smed_v4_8849_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30033428SMED30033428SMESG000008865.1 dd_Smed_v4_2097_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30028562PhosphodiesteraseSMESG000077093.1 dd_Smed_v4_3394_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30032915Alkaline phosphataseSMESG000061191.1 dd_Smed_v4_8942_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30029391WD repeat-containing protein 59SMESG000025367.1 dd_Smed_v4_10474_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027097Imidazoleglycerol-phosphate dehydrataseSMESG000012538.1 dd_Smed_v4_12020_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30025553Cell polarity proteinSMESG000027800.1 dd_Smed_v4_4789_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30025553Cell polarity proteinSMESG000027800.1 dd_Smed_v6_4789_0_1dd_Smed_v6PMID:28461239
muscle cellSMED30033672slc25a-24SMESG000016412.1 dd_Smed_v4_8945_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30021902SMED30021902SMESG000066831.1 SMESG000066820.1 dd_Smed_v4_12244_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30032105Polypeptide N-acetylgalactosaminyltransferaseSMESG000025206.1 dd_Smed_v4_4615_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30022963anaphase-promoting complex subunit 1SMESG000010770.1 SMESG000012375.1 tr5_7361mu_Smed_v1PMID:25558068
muscle cellSMED30031990SMED30031990SMESG000025001.1 dd_Smed_v4_213_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30021547Protein kinase CSMESG000071570.1 dd_Smed_v4_4464_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30021949SMED30021949SMESG000025657.1 dd_Smed_v4_9831_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30030659Fer-1-relatedSMESG000070967.1 dd_Smed_v4_4648_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30030659Fer-1-relatedSMESG000075933.1 dd_Smed_v4_6816_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30007126Mitogen-activated protein kinase-binding protein 1SMESG000080852.1 dd_Smed_v4_7818_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30013304Enoyl-CoA delta isomerase 2SMESG000070742.1 SMESG000046541.1 SMESG000020638.1 dd_Smed_v4_5239_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30008707F-box domain-containing proteinSMESG000026800.1 dd_Smed_v4_3719_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30008221FTS and Hook-interacting proteinSMESG000025657.1 dd_Smed_v4_9831_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30007001SMED30007001SMESG000072162.1 dd_Smed_v4_537_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30019103TetraspaninSMESG000021627.1 dd_Smed_v4_1650_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30010494Glutamine synthetaseSMESG000003836.1 dd_Smed_v4_9056_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30032368C2 domain-containing proteinSMESG000059632.1 dd_Smed_v4_6358_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30021348Alanine aminotransferaseSMESG000007253.1 SMESG000007248.1 dd_Smed_v4_2988_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30034364Platelet-activating factor acetylhydrolase IB subunit gammaSMESG000016097.1 dd_Smed_v4_4977_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30035317Phosphoglycerate kinaseSMESG000039090.1 dd_Smed_v4_972_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30022873SMED30022873SMESG000024332.1 dd_Smed_v4_10527_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30031725SMED30031725SMESG000034628.1 dd_Smed_v4_9307_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30031625Collagen F-8SMESG000016282.1 dd_Smed_v4_402_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30031625Collagen F-8SMESG000016282.1 dd_Smed_v4_402_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30031625Collagen F-8SMESG000016282.1 dd_Smed_v4_402_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30032833TitinSMESG000076529.1 dd_Smed_v4_475_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30026663Tropomyosin Tod p 1.0102SMESG000074053.1 dd_Smed_v4_405_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30024195Guanylate cyclaseSMESG000065840.1 SMESG000065837.1 SMESG000011120.1 dd_Smed_v4_12305_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30020212Protein kinase CSMESG000071570.1 dd_Smed_v4_4464_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30025153SMED30025153SMESG000029777.1 dd_Smed_v4_13914_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30029040Sox transcription factorSMESG000050484.1 dd_Smed_v4_10201_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30026029Protocadherin alpha-2SMESG000059102.1 dd_Smed_v4_19925_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023352Vang-1SMESG000029281.1 dd_Smed_v4_9100_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30024011low-density lipoprotein receptor-related protein 2-likeSMESG000017299.1 dd_Smed_v4_6585_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30024011low-density lipoprotein receptor-related protein 2-likeSMESG000017299.1 dd_Smed_v4_6585_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30029432SMED30029432SMESG000057599.1 dd_Smed_v4_533_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30029432SMED30029432SMESG000057599.1 dd_Smed_v4_635_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30029432SMED30029432SMESG000057599.1 dd_Smed_v4_450_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30031493RNA binding motif single stranded interactingSMESG000005941.1 dd_Smed_v4_3832_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30022285tr5_12233SMESG000029156.1 tr5_12233smed_ncbi_20200123PMID:25558068
muscle cellSMED30022285tr5_12233SMESG000003359.1 tr5_12233smed_ncbi_20200123PMID:25558068
muscle cellSMED30022285tr5_12233SMESG000029156.1 dd_Smed_v4_13065_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027960NPHS1-1SMESG000029156.1 tr5_12233mu_Smed_v1PMID:25558068
muscle cellSMED30027960NPHS1-1SMESG000003359.1 tr5_12233mu_Smed_v1PMID:25558068
muscle cellSMED30027960NPHS1-1SMESG000003359.1 dd_Smed_v4_11987_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30022127MIP20649pSMESG000075164.1 dd_Smed_v4_13518_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30022127MIP20649pSMESG000075164.1 dd_Smed_v4_6811_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30022127MIP20649pSMESG000075164.1 dd_Smed_v4_6811_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30022127MIP20649pSMESG000075164.1 dd_Smed_v4_6811_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30021652Ras association domain family member 7aSMESG000080298.1 dd_Smed_v4_3722_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023025Calcineurin subunit B typeSMESG000019278.1 dd_Smed_v4_4924_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023740SMED30023740SMESG000064469.1 dd_Smed_v4_11762_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027431Protein arginine N-methyltransferase 7SMESG000008380.1 dd_Smed_v4_8814_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30033153Partitioning defective 3-likeSMESG000050856.1 dd_Smed_v4_11296_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30022796phosphatidylinositide phosphatase SAC2SMESG000079090.1 dd_Smed_v4_6584_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30032373Centrosomal protein of 135 kDaSMESG000079518.1 SMESG000070566.1 dd_Smed_v4_6933_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30025696Carbonic anhydraseSMESG000035022.1 dd_Smed_v4_10041_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30033879SMED30033879SMESG000023632.1 dd_Smed_v4_10785_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30021159phosphatidylinositide phosphatase SAC2SMESG000079090.1 dd_Smed_v4_6584_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30033412CLIP-associating protein 1SMESG000072426.1 dd_Smed_v4_5069_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30013298Protein kinase domain-containing proteinSMESG000045539.1 dd_Smed_v4_7046_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30017834Breast cancer anti-estrogen resistance protein 1 CRK-associated substrate p130casSMESG000028562.1 dd_Smed_v4_6476_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30019453Asparagine rich antigenSMESG000022424.1 dd_Smed_v4_10530_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30005207Si:dkey-153k10.9SMESG000055380.1 dd_Smed_v4_5144_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30002064Doublecortin domain-containing protein 2SMESG000040482.1 SMESG000040481.1 SMESG000040480.1 SMESG000038137.1 dd_Smed_v4_6464_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30010360Leucine Rich repeat-containing domain proteinSMESG000047911.1 SMESG000045664.1 dd_Smed_v4_2769_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30018576Protein phosphatase methylesterase 1SMESG000035884.1 dd_Smed_v4_5813_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016727Protein unc-45 homolog ASMESG000054342.1 dd_Smed_v4_6344_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30009048SMED30009048SMESG000043809.1 SMESG000043799.1 dd_Smed_v4_655_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30011320RING-box proteinSMESG000017110.1 dd_Smed_v4_3487_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30009905SMED30009905SMESG000000384.1 dd_Smed_v4_10941_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30035836Procollagen galactosyltransferase 1SMESG000064760.1 dd_Smed_v4_11681_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30026407Acetylcholine receptor subunit beta-like proteinSMESG000064521.1 dd_Smed_v4_12146_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30020213tensin isoform X3SMESG000033851.1 dd_Smed_v4_5620_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30026417SMED30026417SMESG000006455.1 dd_Smed_v4_11785_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30031050PHB domain-containing proteinSMESG000037334.1 dd_Smed_v4_6396_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30029780EGR-like protein 1SMESG000000960.1 dd_Smed_v4_7731_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30028777Protein unc-79 homologSMESG000053097.1 dd_Smed_v4_6600_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30031197Microtubule-associated protein 4SMESG000068843.1 dd_Smed_v4_7133_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30020257DUF3421 domain-containing proteinSMESG000046742.1 dd_Smed_v4_1040_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30020234Kinase D-interacting substrateSMESG000079991.1 dd_Smed_v4_11743_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30028571PellinoSMESG000081434.1 SMESG000029869.1 dd_Smed_v4_6534_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30022030EGR-like protein 1SMESG000000960.1 dd_Smed_v4_7731_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30022030EGR-like protein 1SMESG000000959.1 dd_Smed_v4_12410_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30025753SMED30025753SMESG000016791.1 dd_Smed_v4_10_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30021284SMED30021284SMESG000079527.1 dd_Smed_v4_2356_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30022220Ankyrin repeat domain-containing protein 27SMESG000058588.1 dd_Smed_v4_12122_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30020371Hemicentin-1SMESG000021248.1 dd_Smed_v4_1161_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30020371Hemicentin-1SMESG000021248.1 dd_Smed_v4_1161_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30033766Actin binding LIM protein family member 2SMESG000037349.1 dd_Smed_v4_12268_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30029487Smed-NDKSMESG000062038.1 dd_Smed_v4_11285_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023411slc42a-1SMESG000048384.1 dd_Smed_v4_1882_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30035881noggin-like protein 7SMESG000016086.1 dd_Smed_v4_10469_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30035881noggin-like protein 7SMESG000016086.1 dd_Smed_v4_10469_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30028026Abl interactor 2SMESG000055438.1 dd_Smed_v4_690_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30034720Smed-NDK-4SMESG000009032.1 dd_Smed_v4_12674_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30026602Wnt2-1SMESG000002069.1 dd_Smed_v4_13487_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30026602Wnt2-1SMESG000002069.1 dd_Smed_v4_13487_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30030785Arf-GAP with GTPase ANK repeat and PH domain-containing protein 1/3SMESG000075717.1 dd_Smed_v4_4301_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027842Speckle-type POZ proteinSMESG000075717.1 dd_Smed_v4_4301_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30028311Spectrin beta chainSMESG000066485.1 dd_Smed_v4_12996_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30028311Spectrin beta chainSMESG000066485.1 dd_Smed_v4_7344_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027566SMED30027566SMESG000075236.1 dd_Smed_v4_7519_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30030253Voltage-dependent L-type calcium channel subunit alphaSMESG000015876.1 dd_Smed_v4_10156_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30032446RNA binding protein fox-1SMESG000048633.1 SMESG000048632.1 SMESG000022263.1 SMESG000022262.1 dd_Smed_v4_7213_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30020273Pyruvate kinaseSMESG000063570.1 dd_Smed_v4_1511_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30031032Rho-associated protein kinaseSMESG000041847.1 dd_Smed_v4_11429_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30030025SynaptogyrinSMESG000051237.1 SMESG000051238.1 dd_Smed_v4_1195_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30017663Fer-1-relatedSMESG000070967.1 dd_Smed_v4_4648_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30017052Protein kinase domain-containing proteinSMESG000041213.1 dd_Smed_v4_8461_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30012426SMED30012426SMESG000081547.1 dd_Smed_v4_12193_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30013498LIM zinc-binding domain-containing proteinSMESG000072162.1 dd_Smed_v4_537_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30014794SMED30014794SMESG000075514.1 dd_Smed_v4_1900_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30019594Lipoma-preferred partnerSMESG000031084.1 dd_Smed_v4_12584_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30013386netrin 1SMESG000006806.1 dd_Smed_v4_9795_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000517Mitogen activated protein kinase kinase kinaseSMESG000017706.1 dd_Smed_v4_4486_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30018622smedxin-11SMESG000034762.1 dd_Smed_v4_2810_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30003269Reticulon-like proteinSMESG000007676.1 dd_Smed_v4_1796_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30006944slc35e1SMESG000034003.1 dd_Smed_v4_5304_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30007927C2H2-type domain-containing proteinSMESG000032739.1 dd_Smed_v4_3827_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30014501collagen alpha-1(I) chain isoform X4SMESG000071150.1 dd_Smed_v4_13610_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30014501collagen alpha-1(I) chain isoform X4SMESG000071152.1 SMESG000071150.1 dd_Smed_v4_9030_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30014501collagen alpha-1(I) chain isoform X4SMESG000071152.1 SMESG000071150.1 dd_Smed_v4_9030_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30014501collagen alpha-1(I) chain isoform X4SMESG000071152.1 SMESG000071150.1 dd_Smed_v4_9030_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30018507Calcium-transporting ATPaseSMESG000038461.1 dd_Smed_v4_4559_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30018507Calcium-transporting ATPaseSMESG000038461.1 dd_Smed_v4_3170_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30004674SMED30004674SMESG000063174.1 dd_Smed_v4_6229_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30002903Cyclic AMP-responsive element-binding protein 3-like proteinSMESG000065680.1 dd_Smed_v4_4539_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016950DystrophinSMESG000020523.1 dd_Smed_v4_5325_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000771SMED30000771SMESG000059918.1 SMESG000052306.1 SMESG000022407.1 dd_Smed_v4_1996_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000771SMED30000771SMESG000059918.1 SMESG000052306.1 SMESG000022407.1 dd_Smed_v4_474_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30012814Protein CWC15-like proteinSMESG000010770.1 SMESG000012375.1 tr5_7361mu_Smed_v1PMID:25558068
muscle cellSMED30008964SMED30008964SMESG000010167.1 dd_Smed_v4_8925_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30008578TitinSMESG000029197.1 dd_Smed_v4_866_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000524SMED30000524SMESG000004865.1 dd_Smed_v4_9063_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30013416Reticulocalbin-1SMESG000007225.1 dd_Smed_v4_990_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001359SMED30001359SMESG000059918.1 SMESG000052306.1 SMESG000022407.1 dd_Smed_v4_1996_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016623Potassium channel subfamily T member 1SMESG000042482.1 dd_Smed_v4_9739_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30017209DIX domain containing 1SMESG000033276.1 SMESG000003898.1 dd_Smed_v4_3834_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30008076Reverse transcriptase domain-containing proteinSMESG000008737.1 dd_Smed_v4_540_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30002449SMED30002449SMESG000051066.1 dd_Smed_v4_20805_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001139SMED30001139SMESG000058905.1 dd_Smed_v4_19192_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001254SMED30001254SMESG000025206.1 dd_Smed_v4_4615_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016132Nuclear receptor subfamily 4 group A member 1-like proteinSMESG000023455.1 SMESG000018675.1 dd_Smed_v4_15865_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30007744SMED-SMAD6/7-1SMESG000002697.1 dd_Smed_v4_9186_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30011438F-box domain-containing proteinSMESG000009226.1 dd_Smed_v4_10134_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30009816Ral GTPase-activating protein subunit betaSMESG000028929.1 dd_Smed_v4_8678_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30009274SMED30009274SMESG000007225.1 dd_Smed_v4_990_0_1dd_Smed_v4PMID:29674431
muscle cellSMED3000412414-3-3 protein beta/alphaSMESG000055903.1 dd_Smed_v4_138_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016487SMED30016487SMESG000071570.1 dd_Smed_v4_4464_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30007496C-type lectin domain-containing proteinSMESG000016262.1 dd_Smed_v4_5187_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30015365Lysophosphatidic acid phosphatase type 6SMESG000000025.1 dd_Smed_v4_13744_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30013810TeashirtSMESG000008973.1 KP003815.1smed_ncbi_20200123PMID:25725068
muscle cellSMED30002736DNA topoisomerase ISMESG000055403.1 dd_Smed_v4_2421_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30002983Tropomyosin-2SMESG000000190.1 dd_Smed_v4_436_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30006819Cyclin L1SMESG000075514.1 dd_Smed_v4_1900_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30012075SMED30012075SMESG000059352.1 SMESG000059351.1 dd_Smed_v4_420_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30006070SMED30006070SMESG000080798.1 SMESG000054735.1 SMESG000030429.1 dd_Smed_v4_6842_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016045Cysteine-rich proteinSMESG000044206.1 dd_Smed_v4_1185_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30006119X-box-binding protein 1SMESG000048111.1 dd_Smed_v4_415_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30011348Katanin p60 ATPase-containing subunit A1SMESG000069747.1 dd_Smed_v4_5163_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30013408Sarcoplasmic calcium-binding proteinSMESG000020808.1 dd_Smed_v4_1010_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30019771Ammonium transporter Rh type BSMESG000048384.1 dd_Smed_v4_1882_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000179MFS domain-containing proteinSMESG000060699.1 dd_Smed_v4_5351_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30017880Alpha-int-1SMESG000022733.1 dd_Smed_v4_11655_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30014207Protein EFR3 homolog ASMESG000057540.1 dd_Smed_v4_3212_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30011984partitioning defective 3 homolog isoform X2SMESG000071209.1 dd_Smed_v4_5548_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30012326SMED30012326SMESG000079518.1 SMESG000070566.1 dd_Smed_v4_6933_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30015808TNF receptor-associated factorSMESG000006455.1 dd_Smed_v4_11785_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30018491SMED30018491SMESG000000384.1 dd_Smed_v4_10941_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30014645HP domain-containing proteinSMESG000075965.1 dd_Smed_v4_4193_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30017945Fibrillar collagenSMESG000045473.1 dd_Smed_v4_840_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30017945Fibrillar collagenSMESG000045473.1 dd_Smed_v4_840_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30016269GCR158SMESG000062345.1 dd_Smed_v4_11380_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30017246Kinesin motor domain-containing proteinSMESG000028296.1 dd_Smed_v4_12679_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30019130Junctophilin-1SMESG000001306.1 dd_Smed_v4_4752_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30011055Evi/WlsSMESG000068488.1 dd_Smed_v4_9546_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30010183Frizzled-4SMESG000014322.1 dd_Smed_v4_7210_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30018560SMED30018560SMESG000004196.1 dd_Smed_v4_1162_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30017876ATP-dependent 6-phosphofructokinaseSMESG000028432.1 dd_Smed_v4_3613_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30008165Connector enhancer of kinase suppressor of ras 2SMESG000044449.1 SMESG000044448.1 dd_Smed_v4_4457_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30010051Smed-notumSMESG000004222.1 dd_Smed_v4_24180_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30015069ANK_REP_REGION domain-containing proteinSMESG000063648.1 dd_Smed_v4_10764_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30012710SMED30012710SMESG000066979.1 dd_Smed_v4_4593_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30005932Tudor domain-containing protein 1SMESG000026637.1 dd_Smed_v4_3564_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30008675Serine/threonine-protein phosphatase 2A regulatory subunit ASMESG000014991.1 dd_Smed_v4_3840_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30007679WTSSMESG000057360.1 dd_Smed_v4_6231_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001510Protein unc-79 homologSMESG000053097.1 dd_Smed_v4_6600_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000773SMED30000773SMESG000064133.1 dd_Smed_v4_5943_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30013157KHD-1SMESG000070471.1 dd_Smed_v4_294_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30002721beta-parvinSMESG000080798.1 SMESG000054735.1 SMESG000030429.1 dd_Smed_v4_6842_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30002721beta-parvinSMESG000080798.1 SMESG000054735.1 dd_Smed_v4_9524_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30007097Rho guanine nucleotide exchange factor 28SMESG000021797.1 dd_Smed_v4_5252_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30004705SMED30004705SMESG000001306.1 dd_Smed_v4_4752_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30019232SMED30019232SMESG000050994.1 dd_Smed_v4_2478_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30012203NGFI-A-binding protein 1SMESG000013520.1 dd_Smed_v4_3973_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30006989Eukaryotic translation initiation factor 2-alpha kinase 3SMESG000032681.1 SMESG000032678.1 SMESG000032676.1 dd_Smed_v4_5111_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30019756Low-density lipoprotein receptor-related proteinSMESG000010458.1 dd_Smed_v4_10112_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30015468SMED30015468SMESG000050994.1 dd_Smed_v4_2478_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30018604Neuronal calcium sensor 2SMESG000081434.1 SMESG000029869.1 dd_Smed_v4_6534_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000311RING-type domain-containing proteinSMESG000081132.1 dd_Smed_v4_6290_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30013633Arf-GAP with GTPase, ANK repeat and PH domain-containing protein 3SMESG000075717.1 dd_Smed_v4_4301_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30015682Thioredoxin domain-containing proteinSMESG000063824.1 dd_Smed_v4_6362_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016722Protein kinase domain-containing proteinSMESG000004938.1 dd_Smed_v4_4849_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30009007SMED30009007SMESG000005752.1 dd_Smed_v4_2438_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30014498SMED30014498SMESG000026106.1 dd_Smed_v4_6193_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001286DNA polymerase nuSMESG000032684.1 dd_Smed_v4_10383_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30014283LIM zinc-binding domain-containing proteinSMESG000013742.1 dd_Smed_v4_7540_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30005657Malic enzymeSMESG000045895.1 dd_Smed_v4_2140_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30010740FERM and pleckstrin domain containing proteinSMESG000038155.1 dd_Smed_v4_14700_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30011728Disks large-like protein 5SMESG000059889.1 dd_Smed_v4_2209_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30008787innexin-1SMESG000043134.1 dd_Smed_v4_11254_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30012386Alpha-1,4 glucan phosphorylaseSMESG000061417.1 dd_Smed_v4_1532_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30007103slc7a-7SMESG000044247.1 dd_Smed_v4_2179_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30019009Neuralized, putativeSMESG000038756.1 dd_Smed_v4_1934_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30017619TNF receptor-associated factorSMESG000025998.1 SMESG000025982.1 SMESG000025980.1 SMESG000025963.1 SMESG000025934.1 SMESG000025901.1 SMESG000025797.1 SMESG000025794.1 SMESG000025517.1 dd_Smed_v4_1139_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30003750Vang-3SMESG000046198.1 SMESG000046194.1 dd_Smed_v4_15787_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016193Septin-5SMESG000076922.1 dd_Smed_v4_1717_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30003166slc4a-4SMESG000039045.1 dd_Smed_v4_12290_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30010523SMED30010523SMESG000077800.1 SMESG000054046.1 SMESG000052058.1 SMESG000044674.1 SMESG000066333.1 SMESG000052053.1 SMESG000052952.1 SMESG000080770.1 SMESG000065333.1 SMESG000063486.1 SMESG000059844.1 SMESG000058646.1 SMESG000055266.1 SMESG000054970.1 SMESG000052813.1 SMESG000043147.1 SMESG000037745.1 SMESG000037601.1 SMESG000036070.1 SMESG000034880.1 SMESG000034368.1 SMESG000031415.1 SMESG000019663.1 SMESG000010897.1 SMESG000009005.1 SMESG000006729.1 SMESG000005029.1 SMESG000003989.1 dd_Smed_v4_1760_1_1dd_Smed_v4PMID:29674431
muscle cellSMED30015710Glycine receptor subunit alpha-3SMESG000008993.1 dd_Smed_v4_10794_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001056AcetylCoA_hyd_C domain-containing proteinSMESG000063866.1 dd_Smed_v4_1775_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30002655Ig-like domain-containing proteinSMESG000079770.1 dd_Smed_v4_1914_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30008973SMED30008973SMESG000017122.1 dd_Smed_v4_13867_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30010117SMED30010117SMESG000030021.1 SMESG000000893.1 dd_Smed_v4_2033_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30017231NEPH-3SMESG000022777.1 dd_Smed_v4_11280_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30013435MERSMESG000016263.1 dd_Smed_v4_2243_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30015061G protein regulated inducer of neurite outgrowthSMESG000062691.1 dd_Smed_v4_10294_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30002880Tetratricopeptide repeat domain 17SMESG000036512.1 dd_Smed_v4_11405_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30026182Sodium/potassium-transporting ATPase subunit beta-2SMESG000071416.1 dd_Smed_v4_7917_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30028462Zinc finger protein castor-like protein 1SMESG000024266.1 dd_Smed_v4_2206_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023399NFX1-type zinc finger-containing protein 1-likeSMESG000057303.1 dd_Smed_v4_10696_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30025910Microtubule-associated protein futschSMESG000030021.1 SMESG000000893.1 dd_Smed_v4_2033_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30025910Microtubule-associated protein futschSMESG000044270.1 SMESG000030021.1 SMESG000025422.1 dd_Smed_v4_1999_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027887Interferon-induced GTP-binding protein Mx1SMESG000002025.1 dd_Smed_v4_7246_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30028992Guanine nucleotide-binding protein subunit betaSMESG000038555.1 dd_Smed_v4_1615_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30026887Myosin light chain proteinSMESG000075512.1 dd_Smed_v4_223_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027052noggin-like protein 1SMESG000032255.1 dd_Smed_v4_14068_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30021467SMED30021467SMESG000013722.1 dd_Smed_v4_1742_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30030305Peptidase_M14 domain-containing proteinSMESG000048042.1 dd_Smed_v4_2282_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30029603SMED30029603SMESG000071278.1 dd_Smed_v4_1649_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30029811Tyrosine-protein kinase receptorSMESG000041792.1 dd_Smed_v4_7911_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30022844NEPH-3SMESG000022777.1 dd_Smed_v4_11280_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30008887Potassium channel subfamily K member 18SMESG000019203.1 dd_Smed_v4_15824_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000303HoxC12-like proteinSMESG000022668.1 dd_Smed_v4_12467_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30019702SMED30019702SMESG000016033.1 SMESG000000571.1 dd_Smed_v4_661_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30004470Thymidylate synthase-like ProteinSMESG000063577.1 dd_Smed_v4_1260_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30009480SMED30009480SMESG000063980.1 dd_Smed_v4_11408_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30009549RanBP-type and C3HC4-type zinc finger containing 1SMESG000038116.1 dd_Smed_v4_11851_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30009797Clathrin light chainSMESG000012224.1 dd_Smed_v4_1361_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30018859SMED30018859SMESG000014991.1 dd_Smed_v4_3840_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30017664Anosmin-1SMESG000069895.1 dd_Smed_v4_6746_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30010203C2H2-type domain-containing proteinSMESG000067728.1 dd_Smed_v4_1455_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30008285SMED30008285SMESG000015201.1 dd_Smed_v4_1927_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30022101Down syndrome cell adhesion moleculeSMESG000048977.1 dd_Smed_v4_5856_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30028574Cytochrome P450 2K1-like proteinSMESG000078092.1 SMESG000078091.1 dd_Smed_v4_2351_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30026466Alpha-actininSMESG000040562.1 dd_Smed_v4_5647_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30026372Ig-like domain-containing proteinSMESG000003800.1 dd_Smed_v4_4231_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30033774CatalaseSMESG000055572.1 dd_Smed_v4_859_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30024677SMED30024677SMESG000036686.1 dd_Smed_v4_30210_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30029729Cytosolic Fe-S cluster assembly factor nubp1SMESG000035133.1 dd_Smed_v4_3014_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30026079CDK5 regulatory subunit associated protein 1 like 1SMESG000011997.1 dd_Smed_v4_2358_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30024181PRELI domain-containing protein 1SMESG000023721.1 dd_Smed_v4_3507_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30024778SMB domain-containing proteinSMESG000022577.1 dd_Smed_v4_5786_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30030352PDZ domain-containing proteinSMESG000015639.1 dd_Smed_v4_2888_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30025205InnexinSMESG000078684.1 SMESG000060499.1 dd_Smed_v4_6114_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027069Tensin 1SMESG000060707.1 dd_Smed_v4_4494_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30035315Endothelin-converting enzyme 1SMESG000025056.1 dd_Smed_v4_8276_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30020714slc7a-4SMESG000017104.1 dd_Smed_v4_4211_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30029869Polypeptide N-acetylgalactosaminyltransferaseSMESG000011837.1 dd_Smed_v4_6094_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30035354Conserved oligomeric Golgi complex subunit 4SMESG000014264.1 dd_Smed_v4_4093_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023621Transmembrane protein 131SMESG000028913.1 dd_Smed_v4_6371_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30025807RuvB-like helicaseSMESG000033997.1 SMESG000018207.1 dd_Smed_v4_2547_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30029643Polypeptide N-acetylgalactosaminyltransferaseSMESG000011837.1 dd_Smed_v4_6094_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30033752Tyrosine-protein kinaseSMESG000059352.1 SMESG000059351.1 dd_Smed_v4_420_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30022786Splicing factor 3b subunit 4SMESG000005564.1 dd_Smed_v4_3556_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027672Plac8 onzin related protein 1SMESG000050229.1 SMESG000050221.1 dd_Smed_v4_1219_1_1dd_Smed_v4PMID:29674431
muscle cellSMED30024473hydroxyacyl dehydrogenase bSMESG000070850.1 dd_Smed_v4_1593_1_1dd_Smed_v4PMID:29674431
muscle cellSMED30024473hydroxyacyl dehydrogenase bSMESG000070850.1 dd_Smed_v4_1593_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30025882Protein FAM13ASMESG000052108.1 dd_Smed_v4_12046_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30033302RNA-binding protein MEX3BSMESG000044270.1 SMESG000030021.1 SMESG000025422.1 dd_Smed_v4_1999_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30031427Charged multivesicular body protein 1aSMESG000060068.1 dd_Smed_v4_1645_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30034290Ribosomal protein L24SMESG000014001.1 dd_Smed_v4_1638_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30022325SMED30022325SMESG000022410.1 SMESG000022409.1 dd_Smed_v4_1683_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30035039SMED30035039SMESG000057944.1 dd_Smed_v4_1019_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30033097SMED30033097SMESG000044449.1 SMESG000044448.1 dd_Smed_v4_4457_0_1dd_Smed_v4PMID:29674431
muscle cellSMED3000170160S ribosomal protein L7aSMESG000020535.1 dd_Smed_v4_296_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30005349DUF4817 domain-containing proteinSMESG000065415.1 dd_Smed_v4_10251_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30007858netrin receptor-like proteinSMESG000042475.1 dd_Smed_v4_11409_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30007199IlvB (bacterial acetolactate synthase)-likeSMESG000026596.1 dd_Smed_v4_1784_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001255IAP domain containing-1SMESG000031926.1 dd_Smed_v4_4082_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30002350Ig-like domain-containing proteinSMESG000006317.1 dd_Smed_v4_13555_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30005039Serine/threonine kinaseSMESG000022977.1 dd_Smed_v4_7371_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30006508SMED30006508SMESG000052644.1 dd_Smed_v4_15531_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30002925Alpha-2-macroglobulin-like protein 1SMESG000041500.1 dd_Smed_v4_12472_0_1dd_Smed_v4PMID:29674431
muscle cellSMED3000905260S ribosomal protein L18SMESG000017166.1 dd_Smed_v4_128_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30002952Conserved oligomeric Golgi complex subunit 4SMESG000014264.1 dd_Smed_v4_4093_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30009218Receptor expression-enhancing proteinSMESG000036637.1 dd_Smed_v4_1995_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000511G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000064707.1 dd_Smed_v4_16018_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30009115Polypyrimidine tract-binding protein 1SMESG000033951.1 dd_Smed_v4_14748_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30007480Protein kinase CSMESG000039865.1 SMESG000039854.1 SMESG000032749.1 SMESG000032747.1 dd_Smed_v4_4244_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30015704Hox class homeodomain protein DjAbd-BaSMESG000062714.1 dd_Smed_v4_12317_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30006583frizzled receptor-like proteinSMESG000004519.1 dd_Smed_v4_11650_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000222RNA binding protein MEX3BSMESG000071674.1 dd_Smed_v4_6053_0_1dd_Smed_v4PMID:29674431
muscle cellSMED3000109640S ribosomal protein S23SMESG000017264.1 dd_Smed_v4_290_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30007769SMED30007769SMESG000033620.1 dd_Smed_v4_14187_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30011014acetolactate synthase-like proteinSMESG000026596.1 dd_Smed_v4_1784_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30013342SMED30013342SMESG000068114.1 dd_Smed_v4_10914_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000557SMED30000557SMESG000037685.1 dd_Smed_v4_6614_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30013503Tpd52 like 1SMESG000013104.1 dd_Smed_v4_2467_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30010283Anosmin-1SMESG000067656.1 dd_Smed_v4_12201_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30006773Calpain-BSMESG000039299.1 dd_Smed_v4_1752_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30002614SMED30002614SMESG000064510.1 dd_Smed_v4_1635_1_1dd_Smed_v4PMID:29674431
muscle cellSMED30004176SMED30004176SMESG000054821.1 dd_Smed_v4_1693_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001299SMED30001299SMESG000010387.1 dd_Smed_v4_13587_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30002377DNA-binding proteinSMESG000062714.1 dd_Smed_v4_12317_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30004031Cyclin-dependent kinase 16SMESG000023289.1 SMESG000023149.1 dd_Smed_v4_4172_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30007465Coiled coil domain containing protein 58SMESG000014824.1 dd_Smed_v4_1983_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30009149ARF-GAP with dual PH domain-containing protein 1SMESG000066067.1 dd_Smed_v4_1479_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001212Tubulin alpha chainSMESG000079660.1 dd_Smed_v4_2143_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001212Tubulin alpha chainSMESG000079660.1 dd_Smed_v4_2697_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001212Tubulin alpha chainSMESG000079660.1 dd_Smed_v4_2679_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000446DNA-binding protein SATB1SMESG000010119.1 SMESG000001288.1 dd_Smed_v4_10184_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001622SMED30001622SMESG000040908.1 dd_Smed_v4_10356_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30033594Microtubule-associated protein 1ASMESG000014298.1 dd_Smed_v4_1301_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30033594Microtubule-associated protein 1ASMESG000014298.1 dd_Smed_v4_3654_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30030198Lamin-B receptorSMESG000042131.1 dd_Smed_v4_2016_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30031902SMED30031902SMESG000055070.1 dd_Smed_v4_1410_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30030415AminopeptidaseSMESG000026219.1 dd_Smed_v4_15623_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30033583SMED30033583SMESG000060313.1 SMESG000049383.1 dd_Smed_v4_158_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30026121Ectonucleotide pyrophosphatase/phosphodiesterase family member 6SMESG000040292.1 dd_Smed_v4_1269_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30021864Ras-like protein family member 12SMESG000000993.1 dd_Smed_v4_11635_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30022511SMED30022511SMESG000011997.1 dd_Smed_v4_2358_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30034045N(G),N(G)-dimethylarginine dimethylaminohydrolaseSMESG000056249.1 dd_Smed_v4_1460_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027470SMED30027470SMESG000042048.1 dd_Smed_v4_13103_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30025388Myosin heavy chainSMESG000013389.1 SMED30025388smed_20140614PMID:21566185
muscle cellSMED30025388Myosin heavy chainSMESG000013389.1 EC386316ncbi_smed_estsPMID:21566185
muscle cellSMED30025388Myosin heavy chainSMESG000013389.1 dd_Smed_v4_579_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30034820transferrin-1SMESG000027225.1 dd_Smed_v4_14478_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30018174Alpha-catulinSMESG000073827.1 SMESG000073816.1 dd_Smed_v4_10625_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016101SMED30016101SMESG000080786.1 dd_Smed_v4_14195_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30002609Liprin-alpha-4SMESG000048911.1 dd_Smed_v4_5468_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30002753X1.A5.1SMESG000062836.1 dd_Smed_v4_585_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30006006SMED30006006SMESG000007018.1 SMESG000007017.1 dd_Smed_v4_1969_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001036Receptor-type tyrosine-protein phosphatase betaSMESG000050003.1 SMESG000005247.1 dd_Smed_v4_5794_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000665SMED30000665SMESG000025288.1 dd_Smed_v4_19210_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30008388slc1a-4SMESG000064122.1 dd_Smed_v4_11206_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30007971Rho GTPase-activating proteinSMESG000066536.1 dd_Smed_v4_10828_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30017028Neurogenic locus notch-like proteinSMESG000063654.1 dd_Smed_v4_13045_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30008015slc25a-14SMESG000066536.1 dd_Smed_v4_10828_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30004455DUF2428 domain-containing proteinSMESG000032327.1 dd_Smed_v4_12316_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30003012G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000078101.1 dd_Smed_v4_14849_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30012095SMED30012095SMESG000030693.1 dd_Smed_v4_15045_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016268SMED30016268SMESG000077815.1 dd_Smed_v4_11543_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30006503InnexinSMESG000016539.1 dd_Smed_v4_13475_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30012872InnexinSMESG000016539.1 dd_Smed_v4_13475_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30008486SMED30008486SMESG000014085.1 SMESG000014086.1 SMESG000014087.1 dd_Smed_v4_10249_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30013686MAP3K-1SMESG000054386.1 dd_Smed_v4_5198_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30008756SMED30008756SMESG000007049.1 dd_Smed_v4_14707_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30018715SMED30018715SMESG000016285.1 dd_Smed_v4_12596_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30018725Protein kinase domain-containing proteinSMESG000025288.1 dd_Smed_v4_19210_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30013286sn1-specific diacylglycerol lipase betaSMESG000046500.1 dd_Smed_v4_13306_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30011663slc1a-5SMESG000064126.1 dd_Smed_v4_1106_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027645SMED30027645SMESG000054738.1 SMESG000035995.1 dd_Smed_v4_6659_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30035878Collagen alpha-1(XXVII) chain BSMESG000026651.1 SMESG000026649.1 dd_Smed_v4_649_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30035878Collagen alpha-1(XXVII) chain BSMESG000026651.1 SMESG000026649.1 dd_Smed_v4_649_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30030289Actin-1SMESG000066035.1 SMESG000066029.1 SMESG000066027.1 SMESG000066020.1 dd_Smed_v4_90_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30022812Receptor-type tyrosine-protein phosphatase SSMESG000068618.1 dd_Smed_v4_12771_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30033585Elongation of very long chain fatty acids proteinSMESG000021565.1 dd_Smed_v4_523_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30030789Homeobox domain-containing proteinSMESG000049852.1 dd_Smed_v4_7324_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30034823SMED30034823SMESG000024340.1 dd_Smed_v4_822_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30032774Four and A half lim domainsSMESG000074426.1 dd_Smed_v4_5014_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30021110Dynein heavy chain 17, axonemalSMESG000026263.1 dd_Smed_v4_10425_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30031297Reticulon-like proteinSMESG000079873.1 dd_Smed_v4_4451_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30020829KH domain-containing proteinSMESG000069949.1 dd_Smed_v4_11601_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30031551RING-type domain-containing proteinSMESG000076269.1 dd_Smed_v4_9026_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30028609rho GTPase-activating protein 39SMESG000029199.1 dd_Smed_v4_5836_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30020622SMED30020622SMESG000030693.1 dd_Smed_v4_15045_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023344Sn1-specific diacylglycerol lipase betaSMESG000046500.1 dd_Smed_v4_13306_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027541Tumor necrosis factor receptor-associated factor 3SMESG000049895.1 dd_Smed_v4_6017_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30028307Peptidase M20 domain-containing protein 2SMESG000037374.1 SMESG000037372.1 SMESG000037364.1 dd_Smed_v4_5148_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30020038Actinin alphaSMESG000040562.1 dd_Smed_v4_10174_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30034403Prolyl 4-hydroxylase subunit alpha-2SMESG000060999.1 dd_Smed_v4_6625_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30034403Prolyl 4-hydroxylase subunit alpha-2SMESG000060999.1 dd_Smed_v4_6625_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30014748Ptk7SMESG000072430.1 dd_Smed_v4_6999_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30004485Fibrillar collagenSMESG000038928.1 dd_Smed_v4_1070_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30004485Fibrillar collagenSMESG000038928.1 dd_Smed_v4_1070_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30004485Fibrillar collagenSMESG000038928.1 dd_Smed_v4_1070_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30000038Ribosome-binding protein 1SMESG000031975.1 dd_Smed_v4_1111_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30004938Anosmin-1SMESG000010608.1 dd_Smed_v4_10075_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30004930Irregular chiasm C-roughest-like isoform X2SMESG000077979.1 dd_Smed_v4_12549_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30006424Short transient receptor potential channel 4SMESG000039904.1 dd_Smed_v4_15627_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30013228Ryanodine receptor relatedSMESG000000645.1 SMESG000000646.1 dd_Smed_v4_5582_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30008926ATP-dependent DNA helicaseSMESG000023939.1 dd_Smed_v4_6024_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30008934Partitioning defective 3-like proteinSMESG000042842.1 dd_Smed_v4_11905_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30009430Fructose-bisphosphate aldolaseSMESG000006056.1 dd_Smed_v4_591_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30006293SMED30006293SMESG000080447.1 SMESG000080442.1 dd_Smed_v4_10685_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30012686Protein tincarSMESG000005995.1 dd_Smed_v4_6103_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30010044Rho GTPase-activating protein 7SMESG000056012.1 dd_Smed_v4_9530_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001160SMED30001160SMESG000000384.1 dd_Smed_v4_10941_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016134SMED30016134SMESG000045543.1 dd_Smed_v4_2401_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30006221PHB domain-containing proteinSMESG000037334.1 dd_Smed_v4_6396_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30009820ATP-dependent RNA helicase DHX8SMESG000038843.1 dd_Smed_v4_5357_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30006369Integrin betaSMESG000045564.1 dd_Smed_v4_2017_0_1dd_Smed_v4PMID:29674431
muscle cellSMED3000844110-formyltetrahydrofolate dehydrogenaseSMESG000005275.1 dd_Smed_v4_5787_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30009204FGFR4SMESG000054557.1 dd_Smed_v4_11024_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30009491DNA polymerase alpha subunit BSMESG000051237.1 SMESG000051238.1 dd_Smed_v4_1195_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016879hypothetical proteinSMESG000058269.1 dd_Smed_v4_7993_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30010330slc25a-34SMESG000046675.1 dd_Smed_v4_4480_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30010330slc25a-34SMESG000046675.1 dd_Smed_v4_2718_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000448Cysteine-rich proteinSMESG000044206.1 dd_Smed_v4_1185_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30005173Neuronal acetylcholine receptor subunit alpha 4SMESG000073518.1 dd_Smed_v4_10322_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30006792Argonaute 1SMESG000050994.1 dd_Smed_v4_2478_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30008553Phosphoenolpyruvate carboxykinase [GTP]SMESG000062868.1 dd_Smed_v4_196_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027302Tubulin alpha chainSMESG000078886.1 SMESG000078276.1 SMESG000073740.1 SMESG000069843.1 SMESG000067323.1 SMESG000066333.1 SMESG000063482.1 SMESG000063429.1 SMESG000062535.1 SMESG000055265.1 SMESG000052056.1 SMESG000051183.1 SMESG000049398.1 SMESG000047988.1 SMESG000041242.1 SMESG000039783.1 SMESG000034367.1 SMESG000031778.1 SMESG000025956.1 SMESG000023546.1 SMESG000018414.1 SMESG000017936.1 SMESG000015191.1 SMESG000014475.1 SMESG000009011.1 SMESG000008656.1 SMESG000005037.1 SMESG000003422.1 dd_Smed_v4_718_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30030897Ubox domain containing proteinSMESG000054668.1 dd_Smed_v4_2397_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30021684Fibrillar collagen NC1 domain-containing proteinSMESG000041598.1 dd_Smed_v4_8075_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30021684Fibrillar collagen NC1 domain-containing proteinSMESG000041598.1 dd_Smed_v4_8075_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30025017SMED30025017SMESG000026705.1 dd_Smed_v4_5525_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027303Methylcrotonoyl-CoA carboxylase 2 (beta)SMESG000035087.1 dd_Smed_v4_5574_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30031216Oxysterol-binding proteinSMESG000023068.1 dd_Smed_v4_3268_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30022014TetraspaninSMESG000043678.1 dd_Smed_v4_2693_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30026112Sorting nexin-27SMESG000081127.1 dd_Smed_v4_2513_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023961RING finger protein 150SMESG000026513.1 dd_Smed_v4_5532_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027578SMED30027578SMESG000072474.1 SMESG000072473.1 dd_Smed_v4_2635_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30025736PHB domain-containing proteinSMESG000076275.1 dd_Smed_v4_5746_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30028728GTP-binding protein rhoASMESG000076727.1 dd_Smed_v4_2784_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023132Carbonic anhydraseSMESG000035019.1 dd_Smed_v4_5411_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30028449High density lipoprotein binding protein (Vigilin)SMESG000016436.1 dd_Smed_v4_553_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30020643Chromosome 11 open reading frame 58SMESG000030362.1 dd_Smed_v4_6127_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027256SMED30027256SMESG000050003.1 SMESG000005247.1 dd_Smed_v4_5794_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023994SMED30023994SMESG000076399.1 dd_Smed_v4_5426_1_1dd_Smed_v4PMID:29674431
muscle cellSMED30021693Nicotinic acetylcholine receptor alpha 6 subunitSMESG000000214.1 SMESG000000209.1 dd_Smed_v4_9864_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027807Rho-GAP domain-containing proteinSMESG000024679.1 dd_Smed_v4_6099_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30024840LactadherinSMESG000001686.1 dd_Smed_v4_5463_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30024840LactadherinSMESG000001686.1 dd_Smed_v4_5463_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30022232Glutathione s-transferaseSMESG000016846.1 dd_Smed_v4_1206_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30017770Zinc finger MYM-type protein 1SMESG000042368.1 SMESG000042366.1 dd_Smed_v4_14779_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30019102SMED30019102SMESG000031415.1 SMESG000019663.1 dd_Smed_v4_15058_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30018078Glycine receptor subunit alpha-3SMESG000041885.1 dd_Smed_v4_11342_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016885Phytanoyl-CoA dioxygenase family proteinSMESG000077696.1 SMESG000077694.1 dd_Smed_v4_1292_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30015546Cyclic AMP-responsive element-binding protein 3SMESG000059546.1 dd_Smed_v4_1032_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30018600Calcitonin family peptide receptorSMESG000066855.1 dd_Smed_v4_13281_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30004876Nuclear receptor subfamily 4 group ASMESG000063104.1 dd_Smed_v4_12229_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30011615SMED30011615SMESG000036524.1 dd_Smed_v4_11034_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30014600SMED30014600SMESG000034334.1 dd_Smed_v4_15214_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30008024NFX1-type zinc finger-containing protein 1-likeSMESG000034891.1 SMESG000034868.1 SMESG000034856.1 dd_Smed_v4_10633_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30005146SMED30005146SMESG000068156.1 SMESG000064685.1 SMESG000011804.1 SMESG000010609.1 SMESG000062429.1 SMESG000053533.1 SMESG000015751.1 SMESG000001486.1 dd_Smed_v4_1671_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30012981Cyclic nucleotide gated channel 1SMESG000036524.1 dd_Smed_v4_11034_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30003142SMED30003142SMESG000029028.1 dd_Smed_v4_10003_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30017716Tigger transposable element-derived protein 7SMESG000067500.1 dd_Smed_v4_12091_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30018665TetraspaninSMESG000073695.1 dd_Smed_v4_12033_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30019192SMED30019192SMESG000072463.1 dd_Smed_v4_12173_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30009444CubilinSMESG000058235.1 dd_Smed_v4_11447_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016398Piezo-type mechanosensitive ion channel componentSMESG000051188.1 SMESG000002890.1 dd_Smed_v4_1447_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30010187HTH CENPB-type domain-containing proteinSMESG000049778.1 SMESG000048378.1 SMESG000039423.1 SMESG000024543.1 SMESG000022136.1 SMESG000002434.1 SMESG000078403.1 dd_Smed_v4_12879_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30014626CCHC-type domain-containing proteinSMESG000041616.1 dd_Smed_v4_13815_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016583SMED30016583SMESG000020949.1 dd_Smed_v4_13527_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30015424Retrovirus-related Pol polyprotein from type-1 retrotransposable element R2SMESG000062936.1 SMESG000024338.1 SMESG000024319.1 SMESG000024308.1 dd_Smed_v4_18000_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30007365TPA_inf: Pax-beta2 paired domain proteinSMESG000066574.1 dd_Smed_v4_14362_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30008751Liprin-alpha-2SMESG000024331.1 SMESG000024325.1 dd_Smed_v4_12307_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30010944SMED30010944SMESG000062936.1 SMESG000024338.1 SMESG000024319.1 SMESG000024308.1 dd_Smed_v4_18000_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30008385Solute carrier family 13 member 2SMESG000041335.1 dd_Smed_v4_12964_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30008063SMED30008063SMESG000043378.1 dd_Smed_v4_1685_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30009442Acetylcholine receptor subunit alpha-likeSMESG000068777.1 dd_Smed_v4_12182_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30020445SAM and SH3 domain-containing proteinSMESG000011174.1 dd_Smed_v4_16294_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30020825Protein I'm not dead yetSMESG000041335.1 dd_Smed_v4_12964_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30020347Transient receptor potential cation channelSMESG000004126.1 dd_Smed_v4_11377_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30020844Potassium voltage gated channel subfamily CSMESG000031518.1 dd_Smed_v4_11886_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023379Piezo-type mechanosensitive ion channel componentSMESG000051188.1 SMESG000002890.1 dd_Smed_v4_1447_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023379Piezo-type mechanosensitive ion channel componentSMESG000051188.1 dd_Smed_v4_7182_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30021387Glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase 1SMESG000061842.1 dd_Smed_v4_14708_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027865Asparagine synthetase domain-containing protein 1SMESG000078345.1 dd_Smed_v4_20991_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30025363SMED30025363SMESG000014711.1 dd_Smed_v4_1754_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30020656SMED30020656SMESG000003588.1 dd_Smed_v4_17155_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023930slit1SMESG000068721.1 dd_Smed_v4_12111_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30023930slit1SMESG000068721.1 dd_Smed_v4_12111_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30028657SMED30028657SMESG000075746.1 dd_Smed_v4_17980_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30028839hemicentin-1 isoform X2SMESG000003113.1 dd_Smed_v4_13903_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30031587Glycogen [starch] synthaseSMESG000042473.1 dd_Smed_v4_3119_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023573SnailSMESG000064846.1 dd_Smed_v4_10216_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30025399Toll-interacting proteinSMESG000056009.1 dd_Smed_v4_1937_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30020043SJCHGC04876 proteinSMESG000058578.1 dd_Smed_v4_7237_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30020013SMED30020013SMESG000042368.1 SMESG000042366.1 dd_Smed_v4_14779_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027628SMED30027628SMESG000077696.1 SMESG000077694.1 dd_Smed_v4_1292_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30032325Tensin 1SMESG000029243.1 dd_Smed_v4_17717_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30029457S5 DRBM domain-containing proteinSMESG000023987.1 SMESG000017232.1 SMESG000080953.1 SMESG000080618.1 SMESG000072700.1 SMESG000069163.1 SMESG000065358.1 SMESG000064426.1 SMESG000062577.1 SMESG000062150.1 SMESG000060043.1 SMESG000057576.1 SMESG000056292.1 SMESG000054362.1 SMESG000052870.1 SMESG000051517.1 SMESG000050768.1 SMESG000050005.1 SMESG000049698.1 SMESG000045813.1 SMESG000041318.1 SMESG000040743.1 SMESG000039279.1 SMESG000038973.1 SMESG000038321.1 SMESG000029893.1 SMESG000028198.1 SMESG000023025.1 SMESG000021897.1 SMESG000018432.1 SMESG000018410.1 SMESG000017430.1 SMESG000006729.1 SMESG000005334.1 dd_Smed_v4_1692_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30022375RRM domain-containing proteinSMESG000071670.1 dd_Smed_v4_3282_1_1dd_Smed_v4PMID:29674431
muscle cellSMED30022346SMED30022346SMESG000062604.1 dd_Smed_v4_12574_0_1dd_Smed_v4PMID:29674431
muscle cellSMED300215505-hydroxytryptamine receptor 2CSMESG000032682.1 SMESG000032679.1 dd_Smed_v4_16037_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30014655Ubiquitin-conjugating enzyme E2 ZSMESG000055888.1 dd_Smed_v4_2349_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30010138COP9 signalosome complex subunit 1SMESG000027211.1 dd_Smed_v4_2705_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000404SMED30000404SMESG000012897.1 dd_Smed_v4_6875_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30020000RNA binding motif single stranded interactingSMESG000010632.1 dd_Smed_v4_3575_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30005596SMED30005596SMESG000064097.1 dd_Smed_v4_9867_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000093Quinone oxidoreductaseSMESG000006168.1 dd_Smed_v4_2717_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30011221Heat shock 70 kDa protein homologSMESG000051815.1 dd_Smed_v4_1332_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30012817Methionine synthaseSMESG000054393.1 dd_Smed_v4_10302_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000147Inhibitor of growth proteinSMESG000056794.1 dd_Smed_v4_2936_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000513SMED30000513SMESG000068918.1 dd_Smed_v4_954_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30006833SMED30006833SMESG000065971.1 dd_Smed_v4_10521_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30003623Eukaryotic translation initiation factor 3 subunit LSMESG000026924.1 dd_Smed_v4_1668_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000188Amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferaseSMESG000010039.1 dd_Smed_v4_4975_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30017146Zinc finger homeobox protein 3SMESG000064905.1 dd_Smed_v4_7033_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001196Myosin headSMESG000049494.1 dd_Smed_v4_2912_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30010881SMED30010881SMESG000004195.1 dd_Smed_v4_991_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30011742smad4SMESG000013170.1 SMESG000013169.1 dd_Smed_v4_1923_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30018722AT rich interactive domain containing proteinSMESG000013107.1 dd_Smed_v4_13474_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30019871MTSS I-BAR domain containing 2SMESG000028682.1 dd_Smed_v4_6612_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30019996SMED30019996SMESG000023112.1 dd_Smed_v4_16124_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30010941dnaJ homolog subfamily B member 13SMESG000076708.1 dd_Smed_v4_4820_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30004335TBC1 domain family member 2BSMESG000012909.1 dd_Smed_v4_2925_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30004307HTH CENPB-type domain-containing proteinSMESG000014996.1 dd_Smed_v4_14458_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30013006MetalloproteaseSMESG000000125.1 dd_Smed_v4_9683_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30019886BCL3-1SMESG000023987.1 SMESG000017232.1 SMESG000080953.1 SMESG000080618.1 SMESG000072700.1 SMESG000069163.1 SMESG000065358.1 SMESG000064426.1 SMESG000062577.1 SMESG000062150.1 SMESG000060043.1 SMESG000057576.1 SMESG000056292.1 SMESG000054362.1 SMESG000052870.1 SMESG000051517.1 SMESG000050768.1 SMESG000050005.1 SMESG000049698.1 SMESG000045813.1 SMESG000041318.1 SMESG000040743.1 SMESG000039279.1 SMESG000038973.1 SMESG000038321.1 SMESG000029893.1 SMESG000028198.1 SMESG000023025.1 SMESG000021897.1 SMESG000018432.1 SMESG000018410.1 SMESG000017430.1 SMESG000006729.1 SMESG000005334.1 dd_Smed_v4_1692_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016571Thimet oligopeptidaseSMESG000014736.1 dd_Smed_v4_3546_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30010270Alkylglycerone-phosphate synthaseSMESG000016832.1 dd_Smed_v4_2115_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30002915SMED30002915SMESG000027849.1 SMESG000054598.1 SMESG000054597.1 dd_Smed_v4_6188_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30015111Guanylate cyclaseSMESG000005445.1 dd_Smed_v4_9955_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000043Fat inducing protein 1SMESG000054987.1 dd_Smed_v4_10388_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30003574SMED30003574SMESG000027849.1 SMESG000054598.1 SMESG000054597.1 dd_Smed_v4_6188_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30018486Pre-mRNA-splicing factor 38ASMESG000012763.1 dd_Smed_v4_3382_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30012271TalinSMESG000072542.1 dd_Smed_v4_2443_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30008097Cysteine-rich PDZ-binding proteinSMESG000051979.1 dd_Smed_v4_3121_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30018801InnexinSMESG000042154.1 dd_Smed_v4_15514_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30014533SMED30014533SMESG000023639.1 SMESG000023635.1 dd_Smed_v4_3360_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001117U14-Liphistoxin-Lth1a_1SMESG000018618.1 dd_Smed_v4_9141_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30015211SMED30015211SMESG000026762.1 dd_Smed_v4_3134_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30018013Protein F37C4.5SMESG000042992.1 SMESG000007398.1 dd_Smed_v4_3629_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30010473DEP domain-containing proteinSMESG000029435.1 dd_Smed_v4_8467_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30012799slc39a-3SMESG000027903.1 dd_Smed_v4_10160_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30009881YTH domain-containing proteinSMESG000039495.1 dd_Smed_v4_7162_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30013485cdk6-like proteinSMESG000055046.1 dd_Smed_v4_9430_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30003484SMED30003484SMESG000049494.1 dd_Smed_v4_2912_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000275SMED30000275SMESG000054298.1 SMESG000054297.1 dd_Smed_v4_5777_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30009001SMED30009001SMESG000000125.1 dd_Smed_v4_9683_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001148SMED30001148SMESG000041540.1 SMESG000041529.1 dd_Smed_v4_13075_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30003584Amyloid beta (A4) precursor protein bSMESG000057580.1 dd_Smed_v4_5336_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30005178Alkaline ceramidaseSMESG000043974.1 dd_Smed_v4_9570_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30024336E3 ubiquitin-protein ligase RNF13SMESG000013170.1 SMESG000013169.1 dd_Smed_v4_1923_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30029821RING-type domain-containing proteinSMESG000028227.1 dd_Smed_v4_7396_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30025175Ethanolamine kinase 1SMESG000039287.1 SMESG000039275.1 dd_Smed_v4_10949_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30028029FMRFamide-activated amiloride-sensitive sodium channelSMESG000069611.1 dd_Smed_v4_13880_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30026449Kinase-like domain-containing proteinSMESG000074921.1 SMESG000074915.1 dd_Smed_v4_1634_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30022453AquaporinSMESG000023352.1 dd_Smed_v4_1224_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30034558breast cancer type 2 susceptibility protein homologSMESG000039871.1 dd_Smed_v4_12551_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023439FMRFamide-activated amiloride-sensitive sodium channelSMESG000069611.1 dd_Smed_v4_13880_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023515SMED30023515SMESG000023987.1 SMESG000017232.1 SMESG000080953.1 SMESG000080618.1 SMESG000072700.1 SMESG000069163.1 SMESG000065358.1 SMESG000064426.1 SMESG000062577.1 SMESG000062150.1 SMESG000060043.1 SMESG000057576.1 SMESG000056292.1 SMESG000054362.1 SMESG000052870.1 SMESG000051517.1 SMESG000050768.1 SMESG000050005.1 SMESG000049698.1 SMESG000045813.1 SMESG000041318.1 SMESG000040743.1 SMESG000039279.1 SMESG000038973.1 SMESG000038321.1 SMESG000029893.1 SMESG000028198.1 SMESG000023025.1 SMESG000021897.1 SMESG000018432.1 SMESG000018410.1 SMESG000017430.1 SMESG000006729.1 SMESG000005334.1 dd_Smed_v4_1692_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30032367SMED30032367SMESG000023987.1 SMESG000017232.1 SMESG000080953.1 SMESG000080618.1 SMESG000072700.1 SMESG000069163.1 SMESG000065358.1 SMESG000064426.1 SMESG000062577.1 SMESG000062150.1 SMESG000060043.1 SMESG000057576.1 SMESG000056292.1 SMESG000054362.1 SMESG000052870.1 SMESG000051517.1 SMESG000050768.1 SMESG000050005.1 SMESG000049698.1 SMESG000045813.1 SMESG000041318.1 SMESG000040743.1 SMESG000039279.1 SMESG000038973.1 SMESG000038321.1 SMESG000029893.1 SMESG000028198.1 SMESG000023025.1 SMESG000021897.1 SMESG000018432.1 SMESG000018410.1 SMESG000017430.1 SMESG000006729.1 SMESG000005334.1 dd_Smed_v4_1692_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30032655Armadillo repeat-containing protein 6SMESG000039967.1 dd_Smed_v4_1357_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30022585SMED30022585SMESG000021277.1 dd_Smed_v4_16056_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30030042Muscleblind proteinSMESG000056772.1 dd_Smed_v4_17985_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30031259SMED30031259SMESG000007873.1 dd_Smed_v4_1289_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30020437Glutamate receptor ionotropic kainate 3SMESG000005192.1 dd_Smed_v4_13705_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30031252SMED30031252SMESG000017120.1 dd_Smed_v4_6865_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30035448Kinesin motor domain proteinSMESG000075721.1 dd_Smed_v4_11799_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30029516SMED30029516SMESG000019002.1 dd_Smed_v4_11134_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30020046AmidophosphoribosyltransferaseSMESG000000843.1 dd_Smed_v4_10667_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023158Frizzled-4SMESG000037982.1 SMESG000037981.1 dd_Smed_v4_13356_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30033962SCAN domain-containing protein 3SMESG000019002.1 dd_Smed_v4_11134_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023140Glutamate receptor ionotropic, NMDA 2BSMESG000021416.1 dd_Smed_v4_11481_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30021669Homeobox domain-containing proteinSMESG000022667.1 dd_Smed_v4_16227_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30032921SMED30032921SMESG000014996.1 dd_Smed_v4_14458_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30032276Protein kinase domain-containing proteinSMESG000081259.1 dd_Smed_v4_17081_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30035610SMED30035610SMESG000021277.1 dd_Smed_v4_16056_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30030948Thyroid hormone receptorSMESG000059170.1 dd_Smed_v4_7352_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30031468Propionyl-CoA carboxylase alpha chain, mitochondrialSMESG000034830.1 dd_Smed_v4_1247_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30024416Potassium channel tetramerization domain containing 1SMESG000067417.1 dd_Smed_v4_3793_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30021231SMED30021231SMESG000003588.1 dd_Smed_v4_17155_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30024216neurexin-2-likeSMESG000054585.1 dd_Smed_v4_23270_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30029761lhx1-5-1SMESG000043039.1 SMESG000016568.1 dd_Smed_v4_11521_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30024185slc10a-5SMESG000064830.1 dd_Smed_v4_11330_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30020851PHB domain-containing proteinSMESG000059569.1 dd_Smed_v4_7331_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30031642Ribosomal protein S24SMESG000041201.1 dd_Smed_v4_4359_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023741SMED30023741SMESG000019492.1 dd_Smed_v4_2007_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027813A disintegrin and metalloproteinase with thrombospondin motifsSMESG000038885.1 dd_Smed_v4_10259_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30027813A disintegrin and metalloproteinase with thrombospondin motifsSMESG000038885.1 dd_Smed_v4_10259_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30028787TNF receptor-associated factorSMESG000015087.1 dd_Smed_v4_2354_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30034505Cullin-1SMESG000008644.1 dd_Smed_v4_5770_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30025384hypothetical proteinSMESG000077040.1 dd_Smed_v4_7293_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30022938SMED30022938SMESG000057519.1 SMESG000057514.1 dd_Smed_v4_3277_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023825LITAF domain-containing proteinSMESG000020853.1 dd_Smed_v4_353_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30021772ADF-H domain-containing proteinSMESG000045466.1 dd_Smed_v4_10403_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30020724PhosphodiesteraseSMESG000058236.1 dd_Smed_v4_15988_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30025008SMED30025008SMESG000051756.1 dd_Smed_v4_9692_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023340PHB domain-containing proteinSMESG000009300.1 dd_Smed_v4_12172_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30028186SMED30028186SMESG000041765.1 dd_Smed_v4_4920_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027562SMED30027562SMESG000022880.1 dd_Smed_v4_3493_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30026334Nucleolar protein isoform 2SMESG000007822.1 dd_Smed_v4_7593_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30029267Atg2SMESG000025541.1 dd_Smed_v4_5758_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30020085Serine/threonine-protein kinase PLKSMESG000004941.1 dd_Smed_v4_13738_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30029202SMED30029202SMESG000045255.1 dd_Smed_v4_8531_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30035723nesprin-1-likeSMESG000023320.1 dd_Smed_v4_10282_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30032022Nucleotidyltransferase FAM46CSMESG000003588.1 dd_Smed_v4_5263_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30034467Protein tyrosine phosphatase type IVASMESG000078978.1 SMESG000078867.1 SMESG000010171.1 dd_Smed_v4_2239_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30031158Cytospin-ASMESG000025886.1 dd_Smed_v4_5788_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023739SMED30023739SMESG000057519.1 SMESG000057514.1 dd_Smed_v4_3277_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30028233pleckstrin homology-like domain family B member 2 isoform X1SMESG000057173.1 dd_Smed_v4_5627_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30026577Acetyl-CoA C-acetyltransferaseSMESG000057173.1 dd_Smed_v4_5627_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30035302Glycine receptor subunit alpha-2SMESG000077704.1 dd_Smed_v4_14666_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027997Carnitine O-palmitoyltransferase 1, liver isoformSMESG000072494.1 SMESG000072486.1 dd_Smed_v4_4901_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30020478negative regulator of reactive oxygen species-likeSMESG000080200.1 dd_Smed_v4_9875_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30025297HID1 domain containingSMESG000034495.1 dd_Smed_v4_7451_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30009248GPI-anchor transamidaseSMESG000038907.1 dd_Smed_v4_6456_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30004278KinaseSMESG000019079.1 dd_Smed_v4_3687_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001440TransporterSMESG000003011.1 dd_Smed_v4_5713_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30017149SMED30017149SMESG000079103.1 SMESG000074085.1 dd_Smed_v4_12799_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30004975Hypoxanthine phosphoribosyltransferaseSMESG000007399.1 dd_Smed_v4_7763_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30006080SMED30006080SMESG000069268.1 dd_Smed_v4_14211_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30019221SMED30019221SMESG000010252.1 dd_Smed_v4_2672_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30012938trimeric intracellular cation channel type 1B.1 isoform X1SMESG000016165.1 dd_Smed_v4_3001_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30018687E3 ubiquitin-protein ligase TRIM9SMESG000016119.1 dd_Smed_v4_9989_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30012306V-type proton ATPase subunit DSMESG000071275.1 dd_Smed_v4_1391_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30002129Pyruvate dehydrogenase E1 component subunit betaSMESG000068622.1 dd_Smed_v4_3374_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30005140SMED30005140SMESG000081443.1 dd_Smed_v4_2846_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30007894Exportin 1 (CRM1 homolog, yeast) bSMESG000025559.1 dd_Smed_v4_3264_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30013077SMED30013077SMESG000076350.1 dd_Smed_v4_7379_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30018210SMED30018210SMESG000003612.1 SMESG000002162.1 dd_Smed_v4_16259_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30013027SMED30013027SMESG000076350.1 dd_Smed_v4_7379_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30015029Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-1SMESG000003718.1 SMESG000018818.1 dd_Smed_v4_2872_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30011636TPR_REGION domain-containing proteinSMESG000045547.1 dd_Smed_v4_4557_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000805SMED30000805SMESG000070031.1 dd_Smed_v4_9487_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30019830Kinase-like domain-containing proteinSMESG000010252.1 dd_Smed_v4_2672_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30012867NEPH-2SMESG000071657.1 dd_Smed_v4_12118_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016277TNF receptor-associated factorSMESG000015087.1 dd_Smed_v4_2354_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001244electron transfer flavoprotein subunit alpha, mitochondrialSMESG000054248.1 dd_Smed_v4_1889_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30018922PH domain-containing proteinSMESG000015201.1 dd_Smed_v4_1927_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30006311CalponinSMESG000067773.1 dd_Smed_v4_333_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30010855Receptor-type tyrosine-protein phosphatase FSMESG000038449.1 SMESG000038447.1 SMESG000035516.1 dd_Smed_v4_8199_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30017698Peptide methionine sulfoxide reductase MsrBSMESG000022336.1 dd_Smed_v4_1344_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30010667SMED30010667SMESG000010252.1 dd_Smed_v4_2672_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30017424G_PROTEIN_RECEP_F3_4 domain-containing proteinSMESG000024293.1 dd_Smed_v4_8408_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30008671PhosphodiesteraseSMESG000021196.1 dd_Smed_v4_8589_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000545nuclear factor of activated T-cells 5-likeSMESG000001287.1 dd_Smed_v4_5978_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30010958mitochondrial calcium uniporter regulator 1SMESG000000112.1 dd_Smed_v4_6195_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30009557methionine synthase reductaseSMESG000061482.1 dd_Smed_v4_3947_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30012921Ras GTPase-activating protein gap-2SMESG000003718.1 SMESG000018818.1 dd_Smed_v4_2872_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30015219SMED30015219SMESG000067773.1 dd_Smed_v4_333_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30010540Gln-synt_C domain-containing proteinSMESG000064881.1 dd_Smed_v4_9076_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000445Protocadherin 2 gamma c6 sCP1SMESG000053174.1 dd_Smed_v4_7871_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30007610Guanine nucleotide-binding protein G(q) subunit alphaSMESG000022892.1 dd_Smed_v4_3755_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30017439SMED30017439SMESG000000381.1 SMESG000000382.1 dd_Smed_v4_2318_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016021Chromatin assembly factor 1 subunit ASMESG000061926.1 dd_Smed_v4_8919_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30019793slc16a-8SMESG000026692.1 dd_Smed_v4_1284_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30008163Usp domain-containing proteinSMESG000039918.1 dd_Smed_v4_2433_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30006044SMED30006044SMESG000034607.1 dd_Smed_v4_6645_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30004524cGMP-dependent protein kinaseSMESG000020772.1 dd_Smed_v4_9039_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30004524cGMP-dependent protein kinaseSMESG000020772.1 dd_Smed_v4_8296_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30002010C2H2-type domain-containing proteinSMESG000070998.1 dd_Smed_v4_29263_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30015620Nuclear receptor domain-containing proteinSMESG000066789.1 dd_Smed_v4_5200_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016224SMED30016224SMESG000034607.1 dd_Smed_v4_6645_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30013737SMED30013737SMESG000017032.1 dd_Smed_v4_11755_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016804neurexin-1 isoform X19SMESG000058569.1 dd_Smed_v4_13697_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30003944EF-hand domain family, member D1SMESG000009754.1 dd_Smed_v4_1467_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30017117SMED30017117SMESG000010252.1 dd_Smed_v4_2672_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30010984dynactin subunit 3SMESG000010771.1 dd_Smed_v4_7456_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30014121PDZ and LIM domain protein 7SMESG000029617.1 dd_Smed_v4_10318_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30013977Sh3bp2SMESG000072396.1 dd_Smed_v4_10440_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30014032SMED30014032SMESG000000381.1 SMESG000000382.1 dd_Smed_v4_2318_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30015352ANK_REP_REGION domain-containing proteinSMESG000078716.1 dd_Smed_v4_9826_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30017817SMED30017817SMESG000041765.1 dd_Smed_v4_4920_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023872Zinc finger MYM-type protein 5SMESG000055398.1 dd_Smed_v4_11239_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30021635Succinate dehydrogenase [ubiquinone] flavoprotein subunit, mitochondrialSMESG000008280.1 dd_Smed_v4_897_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027869slc2a-10SMESG000056221.1 dd_Smed_v4_10218_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30026328Apoptosis-stimulating of p53 protein 1SMESG000029015.1 dd_Smed_v4_6453_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30021194Calcitonin-like receptorSMESG000080399.1 dd_Smed_v4_7328_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30022519p2X purinoceptor 4SMESG000020579.1 dd_Smed_v4_9166_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30029142Sorting nexin-25-like proteinSMESG000002020.1 dd_Smed_v4_1891_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30025578Neuropilin and tolloid-like proteinSMESG000018088.1 SMESG000018087.1 SMESG000018085.1 dd_Smed_v4_8579_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30026255LMBR1 domain containing protein 2SMESG000022468.1 dd_Smed_v4_8597_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30026643slc6a-6SMESG000050382.1 dd_Smed_v4_6616_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30025431Glutamate receptor ionotropic, NMDA 3ASMESG000071734.1 dd_Smed_v4_14623_1_1dd_Smed_v4PMID:29674431
muscle cellSMED30035571Protein disulfide-isomerase A5SMESG000005268.1 dd_Smed_v4_2070_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30026932noggin-like protein 8SMESG000008387.1 dd_Smed_v4_8738_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30026932noggin-like protein 8SMESG000008387.1 dd_Smed_v4_8738_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027886SMED30027886SMESG000003427.1 dd_Smed_v4_2708_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30021189SMED30021189SMESG000081490.1 dd_Smed_v4_1635_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30031329Protein tyrosine phosphatase receptor type BSMESG000050003.1 SMESG000005247.1 dd_Smed_v4_5794_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023664Tr-type G domain-containing proteinSMESG000040079.1 dd_Smed_v4_9327_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30033121Phosphatidylinositol 3,4,5-trisphosphate 3-phosphatase TPTE2SMESG000060206.1 dd_Smed_v4_4925_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30032389slc24a-1SMESG000010390.1 dd_Smed_v4_5868_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30031029Protein kinaseSMESG000025153.1 SMESG000025152.1 dd_Smed_v4_6230_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30029167slc22a-8SMESG000040243.1 dd_Smed_v4_10826_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30033622Protocadherin-1SMESG000059440.1 dd_Smed_v4_6251_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30031778SMED30031778SMESG000007978.1 dd_Smed_v4_8009_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30032384C4b binding protein beta chainSMESG000011729.1 dd_Smed_v4_13071_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30034766EnolaseSMESG000052380.1 dd_Smed_v4_510_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30030871Dual specificity tyrosine-phosphorylation-regulated kinase 1BSMESG000064415.1 dd_Smed_v4_3773_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30025561SMED30025561SMESG000023796.1 SMESG000022519.1 dd_Smed_v4_4282_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30032272FMN_red domain-containing proteinSMESG000023871.1 dd_Smed_v4_1834_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30025367V-type proton ATPase catalytic subunit ASMESG000028157.1 dd_Smed_v4_959_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30031239SMED30031239SMESG000075552.1 dd_Smed_v4_7660_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30031500UDP-N-acetylhexosamine pyrophosphorylaseSMESG000055005.1 dd_Smed_v4_2150_1_1dd_Smed_v4PMID:29674431
muscle cellSMED30029772ATP synthase subunit s-like proteinSMESG000001388.1 dd_Smed_v4_4736_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30029434SMED30029434SMESG000045809.1 dd_Smed_v4_6870_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30020652Eukaryotic translation initiation factor 4GSMESG000045255.1 dd_Smed_v4_10618_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30034385Elongation of very long chain fatty acids proteinSMESG000045477.1 dd_Smed_v4_2311_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30030062SMED30030062SMESG000049230.1 dd_Smed_v4_3251_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30034335SMED30034335SMESG000009102.1 dd_Smed_v4_8341_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30024457Guanine nucleotide exchange factorSMESG000044434.1 dd_Smed_v4_6608_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30025307SMED30025307SMESG000019406.1 dd_Smed_v4_3766_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30034005Glutaminyl-peptide cyclotransferaseSMESG000060259.1 dd_Smed_v4_4861_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023434Adaptin ear-binding coat-associated protein 1/2SMESG000075852.1 dd_Smed_v4_4328_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023642Acyl-CoA dehydrogenase family member 9, mitochondrialSMESG000048318.1 dd_Smed_v4_6056_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30009636RNA polymerase II subunit A C-terminal domain phosphatase SSU72SMESG000002994.1 dd_Smed_v4_3141_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30005523Alpha-actininSMESG000026000.1 dd_Smed_v4_1951_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30012922NPHS1-2SMESG000021277.1 dd_Smed_v4_16056_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30009207musculinSMESG000018258.1 dd_Smed_v4_16070_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30002690HEAT repeat-containing protein 5B-like ProteinSMESG000028228.1 dd_Smed_v4_7872_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30007276SMED30007276SMESG000014766.1 dd_Smed_v4_10073_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30010559Glutamine amidotransferase type-2 domain-containing proteinSMESG000078345.1 dd_Smed_v4_20991_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30007715SMED30007715SMESG000048230.1 dd_Smed_v4_8747_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30002742DystoninSMESG000043809.1 SMESG000043799.1 dd_Smed_v4_1205_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001960Eukaryotic translation initiation factor 4 gamma 2SMESG000061587.1 dd_Smed_v4_6383_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001797SMED30001797SMESG000055722.1 SMESG000043901.1 SMESG000034363.1 SMESG000034362.1 dd_Smed_v4_3685_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30002783TNF receptor-associated factorSMESG000049199.1 SMESG000039087.1 dd_Smed_v4_8933_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000345PhosphodiesteraseSMESG000075722.1 dd_Smed_v4_8076_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30005845NPHS1-6SMESG000028689.1 dd_Smed_v4_10689_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30003418Guanine nucleotide-binding protein subunit betaSMESG000018712.1 dd_Smed_v4_1184_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000858Protein YIPFSMESG000025076.1 dd_Smed_v4_3454_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000107Arrestin_C domain-containing proteinSMESG000006781.1 dd_Smed_v4_8715_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30013497Ribosome assembly factor mrt4SMESG000020510.1 dd_Smed_v4_1609_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30013740Fork-head domain-containing proteinSMESG000065690.1 dd_Smed_v4_17749_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30009119Ankyrin-2SMESG000058557.1 dd_Smed_v4_1432_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30013666Acetyltransferase component of pyruvate dehydrogenase complexSMESG000002956.1 dd_Smed_v4_1069_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30007155SMED30007155SMESG000021277.1 dd_Smed_v4_16056_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016830slc39a-5SMESG000015061.1 dd_Smed_v4_11586_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30013784RUNX1 partner transcriptional co-repressor 1SMESG000019002.1 dd_Smed_v4_11134_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001579SMED30001579SMESG000064601.1 dd_Smed_v4_15533_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30008639MyoD-like proteinSMESG000034317.1 dd_Smed_v4_12634_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30012379SMED30012379SMESG000058557.1 dd_Smed_v4_1432_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30010391SMED30010391SMESG000075746.1 dd_Smed_v4_17980_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000247SMED30000247SMESG000023639.1 SMESG000023635.1 dd_Smed_v4_3360_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000305CDGSH iron-sulfur domain-containing proteinSMESG000056141.1 dd_Smed_v4_2098_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30004946Zona pellucida-like domain proteinSMESG000052888.1 SMESG000001180.1 dd_Smed_v4_17259_1_1dd_Smed_v4PMID:29674431
muscle cellSMED30011047GLI-1SMESG000073727.1 dd_Smed_v4_7470_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30008591Zinc finger MYM-type protein 1SMESG000042368.1 SMESG000042366.1 dd_Smed_v4_14779_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30006886SMED30006886SMESG000024489.1 dd_Smed_v4_5366_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30018825rhomboid-like proteinSMESG000053833.1 dd_Smed_v4_13835_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30006399SMED30006399SMESG000075746.1 dd_Smed_v4_17980_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30015755SMED30015755SMESG000023987.1 SMESG000017232.1 SMESG000080953.1 SMESG000080618.1 SMESG000072700.1 SMESG000069163.1 SMESG000065358.1 SMESG000064426.1 SMESG000062577.1 SMESG000062150.1 SMESG000060043.1 SMESG000057576.1 SMESG000056292.1 SMESG000054362.1 SMESG000052870.1 SMESG000051517.1 SMESG000050768.1 SMESG000050005.1 SMESG000049698.1 SMESG000045813.1 SMESG000041318.1 SMESG000040743.1 SMESG000039279.1 SMESG000038973.1 SMESG000038321.1 SMESG000029893.1 SMESG000028198.1 SMESG000023025.1 SMESG000021897.1 SMESG000018432.1 SMESG000018410.1 SMESG000017430.1 SMESG000006729.1 SMESG000005334.1 dd_Smed_v4_1692_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30009392NephrinSMESG000021277.1 dd_Smed_v4_16056_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30015655SMED30015655SMESG000019002.1 dd_Smed_v4_11134_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30002374phytanoyl-CoA dioxygenase domain-containing protein 1 homologSMESG000077696.1 SMESG000077694.1 dd_Smed_v4_1292_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30009279DystoninSMESG000043809.1 SMESG000043799.1 dd_Smed_v4_1205_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30019864Neur_chan_LBD domain-containing proteinSMESG000008589.1 dd_Smed_v4_10171_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000994SMED30000994SMESG000023987.1 SMESG000017232.1 SMESG000080953.1 SMESG000080618.1 SMESG000072700.1 SMESG000069163.1 SMESG000065358.1 SMESG000064426.1 SMESG000062577.1 SMESG000062150.1 SMESG000060043.1 SMESG000057576.1 SMESG000056292.1 SMESG000054362.1 SMESG000052870.1 SMESG000051517.1 SMESG000050768.1 SMESG000050005.1 SMESG000049698.1 SMESG000045813.1 SMESG000041318.1 SMESG000040743.1 SMESG000039279.1 SMESG000038973.1 SMESG000038321.1 SMESG000029893.1 SMESG000028198.1 SMESG000023025.1 SMESG000021897.1 SMESG000018432.1 SMESG000018410.1 SMESG000017430.1 SMESG000006729.1 SMESG000005334.1 dd_Smed_v4_1692_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30014102Carbonic anhydrase-relatedSMESG000056463.1 dd_Smed_v4_15243_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001455SMED30001455SMESG000012934.1 dd_Smed_v4_103_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30004731FMRFamide-activated amiloride-sensitive sodium channelSMESG000039581.1 dd_Smed_v4_18385_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30019300Histone deacetylase,putativeSMESG000006246.1 dd_Smed_v4_1997_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30008778SMED30008778SMESG000004626.1 dd_Smed_v4_13872_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30007718Flotillin-1SMESG000063612.1 dd_Smed_v4_1887_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30018224Adenylate kinaseSMESG000077377.1 SMESG000076900.1 SMESG000063429.1 SMESG000060686.1 SMESG000043019.1 SMESG000031308.1 SMESG000028811.1 SMESG000023833.1 SMESG000023573.1 SMESG000019820.1 SMESG000011532.1 SMESG000052813.1 dd_Smed_v4_1229_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000475Bestrophin homologSMESG000016298.1 dd_Smed_v4_10097_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30015494SMED30015494SMESG000071114.1 dd_Smed_v4_10579_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30015608acidic repeat-containing proteinSMESG000016996.1 dd_Smed_v4_14607_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023151Ubiquitin-like domain-containing proteinSMESG000007655.1 dd_Smed_v4_6237_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023819BZIP domain-containing proteinSMESG000057821.1 dd_Smed_v4_8835_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027132Calcineurin subunit B typeSMESG000081409.1 dd_Smed_v4_5589_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30020855Guanine nucleotide-binding protein G(o) subunit alphaSMESG000081490.1 dd_Smed_v4_1635_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30033804TransporterSMESG000003011.1 dd_Smed_v4_5713_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30034412E3 ubiquitin-protein ligase CBLSMESG000056433.1 dd_Smed_v4_6780_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30031439Protein quiverSMESG000051720.1 dd_Smed_v4_6926_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023135Exonuclease 3'-5' domain-containing protein 1SMESG000053185.1 dd_Smed_v4_6723_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023567Proteasome subunit alpha typeSMESG000074161.1 dd_Smed_v4_3387_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30022104Phosphoribosyl pyrophosphate synthase-associated protein 2SMESG000007561.1 dd_Smed_v4_4658_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30031352SMED30031352SMESG000006235.1 dd_Smed_v4_6275_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30024996Fzd-4-2SMESG000038967.1 dd_Smed_v4_13186_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30032665SMED30032665SMESG000024489.1 dd_Smed_v4_5366_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30029526Glutamate [NMDA] receptor subunit 1SMESG000010110.1 SMESG000001343.1 dd_Smed_v4_8187_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30021209Mitogen-activated protein kinaseSMESG000075533.1 dd_Smed_v4_1282_0_1dd_Smed_v4PMID:29674431
muscle cellSMED300306021.E7.3SMESG000064601.1 dd_Smed_v4_15533_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30026996ATP-dependent rRNA helicase RRP3SMESG000067540.1 SMESG000060310.1 dd_Smed_v4_8047_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30033709Protein unc-80SMESG000014375.1 dd_Smed_v4_5118_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30033709Protein unc-80SMESG000014375.1 dd_Smed_v4_11471_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023657Cleavage stimulation factor subunit 2SMESG000009931.1 dd_Smed_v4_3081_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30035631SMED30035631 dd_Smed_v4_339_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30021600Pyridine nucleotide-disulfide oxidoreductase domain-containing protein 1SMESG000020914.1 dd_Smed_v4_7078_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027361Adenylate kinaseSMESG000039607.1 SMESG000006671.1 dd_Smed_v4_9001_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30022819SMED30022819SMESG000017227.1 dd_Smed_v4_8264_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30033483C2H2-type domain-containing protein dd_Smed_v4_17318_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30030113Exocyst complex component 4SMESG000070793.1 dd_Smed_v4_8308_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30034936SMED30034936 dd_Smed_v4_13714_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027918SMED30027918SMESG000017254.1 dd_Smed_v4_6909_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30025214Golgi to ER traffic protein 4 homologSMESG000078605.1 dd_Smed_v4_7734_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30021694Heat shock transcription factorSMESG000056045.1 dd_Smed_v4_9099_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30024702SMED30024702SMESG000051373.1 dd_Smed_v4_7070_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30029841Mediator of RNA polymerase II transcription subunit 6SMESG000055392.1 dd_Smed_v4_5633_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30035174SMED30035174 dd_Smed_v4_6013_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30025202SMED30025202SMESG000047662.1 dd_Smed_v4_6132_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30032364VASt domain-containing proteinSMESG000004391.1 dd_Smed_v4_9355_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30028046Atlastin-1-likeSMESG000048488.1 dd_Smed_v4_4450_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30030887SMED30030887 dd_Smed_v4_339_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30029954SMED30029954SMESG000019748.1 dd_Smed_v4_7313_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30032220SMED30032220SMESG000053553.1 dd_Smed_v4_5885_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30034101SMED30034101 dd_Smed_v4_3534_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30030002L-aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferaseSMESG000018744.1 dd_Smed_v4_4391_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30031978telomerase reverse transcriptase subunit isoform 2 dd_Smed_v4_56732_0_2dd_Smed_v4PMID:29674431
muscle cellSMED30025014Vacuolar protein sorting 25 homologSMESG000018311.1 dd_Smed_v4_5009_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027390Ubiquitin-conjugating enzyme E2 SSMESG000043009.1 SMESG000007604.1 dd_Smed_v4_7621_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30035828SMED30035828 dd_Smed_v4_1325_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30031905SMED30031905SMESG000004351.1 dd_Smed_v4_6343_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30030957SMED30030957 dd_Smed_v4_12854_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30035848Tubulin beta chainSMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044888.1 SMESG000035755.1 dd_Smed_v4_83_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000316Interferon-induced GTP-binding protein Mx1SMESG000002219.1 SMESG000002216.1 SMESG000002004.1 dd_Smed_v4_3169_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30012043Calcium-transporting ATPaseSMESG000063816.1 SMESG000010536.1 SMESG000045280.1 SMESG000029730.1 dd_Smed_v4_4145_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30009565SMED30009565SMESG000055070.1 dd_Smed_v4_2869_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30019785Rab GTPase-activating protein 1SMESG000005104.1 dd_Smed_v4_5522_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30009224early growth response-3SMESG000000959.1 dd_Smed_v4_12410_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30009224early growth response-3SMESG000000959.1 dd_Smed_v4_14711_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30012501Solute carrier family 4 member 1 adaptor proteinSMESG000074111.1 dd_Smed_v4_8435_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30017165Succinate--CoA ligase [ADP-forming] subunit beta, mitochondrialSMESG000015204.1 dd_Smed_v4_2298_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30011798E3 ubiquitin-protein ligase MIB2SMESG000043477.1 SMESG000010549.1 SMESG000010347.1 SMESG000010327.1 dd_Smed_v4_593_1_1dd_Smed_v4PMID:29674431
muscle cellSMED30010666Prolyl 4-hydroxylase subunit alpha-1-like proteinSMESG000005668.1 dd_Smed_v4_2877_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30010666Prolyl 4-hydroxylase subunit alpha-1-like proteinSMESG000005668.1 dd_Smed_v4_2877_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30005741Actin-related protein 2/3 complex subunitSMESG000015778.1 dd_Smed_v4_978_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30006182Peptidyl-prolyl cis-trans isomeraseSMESG000057818.1 dd_Smed_v4_4606_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000033VASt domain-containing proteinSMESG000033356.1 dd_Smed_v4_9149_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000014slc20a-1SMESG000012546.1 dd_Smed_v4_1270_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30007012SMED30007012SMESG000027376.1 dd_Smed_v4_3090_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30003949Insulin-degrading enzymeSMESG000016400.1 dd_Smed_v4_9500_1_1dd_Smed_v4PMID:29674431
muscle cellSMED30009541NADH-cytochrome b5 reductaseSMESG000061572.1 SMESG000061559.1 dd_Smed_v4_1468_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30005936TitinSMESG000005752.1 dd_Smed_v4_22711_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30005936TitinSMESG000005752.1 dd_Smed_v4_2438_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001446RNA-binding protein 25SMESG000074806.1 dd_Smed_v4_3955_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30012275Splicing factor 45SMESG000038359.1 dd_Smed_v4_4530_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30019032CLIP-associating protein 1SMESG000016277.1 dd_Smed_v4_5503_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30006209polyadenylate-binding protein 2SMESG000011330.1 dd_Smed_v4_2924_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30012265Forkhead box proteinSMESG000037782.1 SMESG000037781.1 dd_Smed_v4_3040_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30018848SMED30018848SMESG000030069.1 dd_Smed_v4_8359_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30004739TNF receptor-associated factorSMESG000014725.1 SMESG000014724.1 SMESG000014706.1 SMESG000014702.1 SMESG000014700.1 dd_Smed_v4_4420_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30010856CCR4-NOT transcription complex subunit 6SMESG000023679.1 dd_Smed_v4_5045_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001873SMED30001873SMESG000016249.1 dd_Smed_v4_2556_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30006563SEC7 domain-containing proteinSMESG000042180.1 dd_Smed_v4_9423_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30006252SMED30006252SMESG000022827.1 dd_Smed_v4_2123_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30019683SMED30019683SMESG000031186.1 dd_Smed_v4_10687_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30010927Superkiller viralicidic activity 2-like 2SMESG000063270.1 dd_Smed_v4_10108_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30019538SMED30019538SMESG000078196.1 dd_Smed_v4_3823_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30010394Transmembrane 9 superfamily memberSMESG000016907.1 dd_Smed_v4_2737_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30003920Nuclear cap-binding protein subunit 1SMESG000073304.1 dd_Smed_v4_6140_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30008314IMD domain-containing proteinSMESG000038660.1 dd_Smed_v4_3500_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30011974Protein SCAISMESG000039882.1 dd_Smed_v4_12456_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001300deoxynucleoside triphosphate triphosphohydrolase SAMHD1SMESG000079646.1 dd_Smed_v4_5518_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30008233Serine/threonine-protein phosphataseSMESG000023415.1 dd_Smed_v4_581_0_1dd_Smed_v4PMID:29674431
muscle cellSMED300189611.C3.2SMESG000049306.1 dd_Smed_v4_406_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30004687F-box/LRR-repeat protein 2SMESG000081003.1 SMESG000080999.1 SMESG000080997.1 dd_Smed_v4_6761_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30013021SMED30013021SMESG000025420.1 dd_Smed_v4_2995_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30017032slc2a-11SMESG000025420.1 dd_Smed_v4_2995_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30002371SMED30002371SMESG000009747.1 dd_Smed_v4_6698_0_1dd_Smed_v4PMID:29674431
muscle cellSMED3000565950S ribosomal protein L3, putativeSMESG000077764.1 dd_Smed_v4_2057_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016017NeuroglianSMESG000005684.1 dd_Smed_v4_4031_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016591Protein big brotherSMESG000068819.1 dd_Smed_v4_2875_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30019952Histone-arginine methyltransferase CARMERSMESG000043856.1 dd_Smed_v4_6133_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000788SMED30000788SMESG000035357.1 dd_Smed_v4_2571_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30015413ras-related protein Rab-28-likeSMESG000007739.1 SMESG000007738.1 dd_Smed_v4_375_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30004024SMED30004024SMESG000022827.1 dd_Smed_v4_2123_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30015589SMED30015589SMESG000063816.1 SMESG000010536.1 SMESG000045280.1 SMESG000029730.1 dd_Smed_v4_4145_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000248Ras-related protein Rab-11ASMESG000016036.1 dd_Smed_v4_4964_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30011980G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000060945.1 dd_Smed_v4_14651_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30018969V-SNARE coiled-coil homology domain-containing proteinSMESG000026855.1 dd_Smed_v4_3046_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30019320Stromal interaction molecule 2SMESG000052167.1 SMESG000045892.1 SMESG000045881.1 dd_Smed_v4_7756_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30019200Cytochrome b561/ferric reductase transmembrane,domain-containing proteinSMESG000021389.1 dd_Smed_v4_4028_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30015074RNA-binding protein 34SMESG000041747.1 dd_Smed_v4_5246_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30004113SMED30004113 dd_Smed_v4_15124_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001768SMED30001768SMESG000031130.1 dd_Smed_v4_5251_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30012087SMED30012087 dd_Smed_v4_13997_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30013751SMED30013751SMESG000019957.1 dd_Smed_v4_3938_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30008392SMED30008392 dd_Smed_v4_12032_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30014066Mitochondrial inner membrane protein OXA1-likeSMESG000037478.1 dd_Smed_v4_4254_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30018080SMED30018080 dd_Smed_v4_14761_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30018003SMED30018003 dd_Smed_v4_20524_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30008971SMED30008971 dd_Smed_v4_11595_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30008828Slc15a-8SMESG000009967.1 dd_Smed_v4_5075_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30008373SMED30008373 dd_Smed_v4_6046_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30014268SMED30014268 dd_Smed_v4_15257_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30004118Tubulin beta chainSMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044888.1 SMESG000035755.1 dd_Smed_v4_83_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30003355Ig-like domain-containing proteinSMESG000001556.1 SMESG000001555.1 dd_Smed_v4_8246_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30014468Histone-lysine N-methyltransferase SETMAR dd_Smed_v4_16659_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30010080SMED30010080 dd_Smed_v4_20648_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30013199SMED30013199 dd_Smed_v4_22630_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016566RT_RNaseH_2 domain-containing protein dd_Smed_v4_13439_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000784SMED30000784 dd_Smed_v4_16621_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30014535SMED30014535SMESG000004048.1 dd_Smed_v4_5948_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30014719SMED30014719 dd_Smed_v4_13735_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30015805SMED30015805SMESG000061114.1 dd_Smed_v4_8475_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30005911SMED30005911 dd_Smed_v4_12_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30004289nuclear protein localization protein 4 homologSMESG000025775.1 dd_Smed_v4_5277_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30006249SMED30006249 dd_Smed_v4_14427_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30014675EOG090X07HGSMESG000068479.1 dd_Smed_v4_5173_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30018464DNA replication complex GINS protein PSF1SMESG000057051.1 SMESG000057052.1 dd_Smed_v4_4317_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30002598Histone-lysine N-methyltransferaseSMESG000039926.1 dd_Smed_v4_99_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30006202SMED30006202 dd_Smed_v4_15845_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30002895ThioredoxinSMESG000023197.1 dd_Smed_v4_6702_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016592PPIP5K2_N domain-containing proteinSMESG000064337.1 dd_Smed_v4_6469_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30004856PWWP domain-containing proteinSMESG000068720.1 dd_Smed_v4_8454_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30014427Procollagen-lysine 2-oxoglutarate 5-dioxygenase dd_Smed_v4_3457_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30014427Procollagen-lysine 2-oxoglutarate 5-dioxygenase dd_Smed_v4_3457_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30000734SMED30000734 dd_Smed_v4_19622_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016973Protein FRA10AC1 homologSMESG000029054.1 dd_Smed_v4_7308_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30012841InnexinSMESG000070656.1 dd_Smed_v4_8019_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001449Propionyl-CoA carboxylase subunit beta dd_Smed_v4_513_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30007474Tyrosyl-DNA phosphodiesterase 1SMESG000046266.1 SMESG000046256.1 dd_Smed_v4_8311_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001607SMED30001607 dd_Smed_v4_15845_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30006782Pecanex_C domain-containing proteinSMESG000057835.1 dd_Smed_v4_4696_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30005069N-alpha-acetyltransferase 30SMESG000063933.1 dd_Smed_v4_8724_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30003554DDE_3 domain-containing protein dd_Smed_v4_5882_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30019735InnexinSMESG000070656.1 dd_Smed_v4_8019_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000082Leucine-rich repeat-containing protein 40SMESG000063073.1 dd_Smed_v4_9666_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30009225Pyridoxal kinaseSMESG000011589.1 dd_Smed_v4_6613_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30010542G_PROTEIN_RECEP_F1_2 domain-containing protein dd_Smed_v4_13860_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30019831FerritinSMESG000003695.1 dd_Smed_v4_3974_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30005188Venom allergen 5 dd_Smed_v4_607_1_1dd_Smed_v4PMID:29674431
muscle cellSMED30008414NADH-ubiquinone oxidoreductase chain 3 dd_Smed_v4_289_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30008167SMED30008167SMESG000033046.1 dd_Smed_v4_4545_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30005555Tigger transposable element-derived protein 1 dd_Smed_v4_20966_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30010443Death-associated protein 1 dd_Smed_v4_946_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30011296SMED30011296SMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044888.1 SMESG000035755.1 dd_Smed_v4_83_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000362SMED30000362SMESG000040041.1 dd_Smed_v4_9526_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016092SMED30016092 dd_Smed_v4_3534_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30012499Transcription initiation factor TFIID subunit 10SMESG000080497.1 dd_Smed_v4_7424_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30005315Transient receptor potential cation channel, subfamily A, member 1aSMESG000014208.1 dd_Smed_v4_86413_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30006400SMED30006400 dd_Smed_v4_22968_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30010375cytochrome c oxidase subunit I dd_Smed_v4_753_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016839Programmed cell death protein 6SMESG000036586.1 dd_Smed_v4_3585_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30014279Rna/rnp complex 1 interacting phosphataseSMESG000010123.1 SMESG000001476.1 dd_Smed_v4_4501_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30002859SMED30002859 dd_Smed_v4_17458_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30026271C-type lectin domain-containing proteinSMESG000034284.1 dd_Smed_v4_1489_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30031987SMED30031987 dd_Smed_v4_3434_0_1dd_Smed_v4PMID:29674431
muscle cellSMED300218046-phosphogluconolactonaseSMESG000064720.1 dd_Smed_v4_7692_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023841SMED30023841SMESG000041250.1 dd_Smed_v4_6437_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30022869Cyclin-YSMESG000031613.1 dd_Smed_v4_8226_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30029215Mitogen-activated protein kinaseSMESG000012868.1 dd_Smed_v4_6042_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30028242AlkB homolog 3, alpha-ketoglutaratedependent dioxygenaseSMESG000044993.1 dd_Smed_v4_7441_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30025313Thioredoxin glutathione reductaseSMESG000020047.1 dd_Smed_v4_960_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30030520SMED30030520SMESG000064337.1 dd_Smed_v4_6469_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30019962Protein phosphatase 1 regulatory subunitSMESG000061419.1 dd_Smed_v4_8791_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027610SMED30027610SMESG000001789.1 dd_Smed_v4_3076_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30034671Ligand of Numb protein X 2SMESG000061485.1 dd_Smed_v4_8994_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30024231Protein phosphatase 1 regulatory subunit 3ASMESG000033999.1 SMESG000018209.1 dd_Smed_v4_4959_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30032106SMED30032106SMESG000080318.1 dd_Smed_v4_8948_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30035575Voltage gated potassium channelSMESG000035416.1 dd_Smed_v4_18793_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30033595Lipase_GDSL domain-containing proteinSMESG000081136.1 dd_Smed_v4_6241_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30032957Diacylglycerol kinaseSMESG000023623.1 SMESG000017153.1 dd_Smed_v4_7792_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30031005A disintegrin and metalloproteinase with thrombospondin motifs 2SMESG000051172.1 dd_Smed_v4_16551_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30020900SMED30020900SMESG000022827.1 dd_Smed_v4_2123_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023587SMED30023587SMESG000063816.1 SMESG000010536.1 SMESG000045280.1 SMESG000029730.1 dd_Smed_v4_4145_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30031010RRM domain-containing proteinSMESG000028681.1 dd_Smed_v4_5327_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30031203U4/U6 X U5 tri-snRNP complex subunit Prp4 family proteinSMESG000026747.1 dd_Smed_v4_3433_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30021778Tyrosine-protein kinaseSMESG000043611.1 dd_Smed_v4_9075_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30035965Neuron navigator 2SMESG000036210.1 dd_Smed_v4_7701_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30024618SMED30024618SMESG000024253.1 dd_Smed_v4_12294_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027947U3 small nucleolar RNA associated 22SMESG000015428.1 dd_Smed_v4_15147_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30034470PDZ ring finger protein 4SMESG000021620.1 dd_Smed_v4_5781_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30020408SMED30020408SMESG000049199.1 SMESG000039087.1 dd_Smed_v4_8933_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30030329Surfeit locus protein 4SMESG000071627.1 dd_Smed_v4_3044_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30034706SMED30034706SMESG000041505.1 dd_Smed_v4_6997_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027773Non-specific serine/threonine protein kinaseSMESG000024532.1 dd_Smed_v4_5481_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30031471SMED30031471SMESG000050535.1 SMESG000050533.1 dd_Smed_v4_5107_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30034303Exportin-4SMESG000055190.1 dd_Smed_v4_10330_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30033676MAP kinase-activating death domain proteinSMESG000026842.1 dd_Smed_v4_8355_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30031780Ras-related protein Rab-5ASMESG000065500.1 dd_Smed_v4_2991_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30031351GATA-binding factor 2SMESG000028503.1 dd_Smed_v4_8208_0_1dd_Smed_v4PMID:29674431
muscle cellSMED300276035'-AMP-activated protein kinase subunit gamma-2SMESG000078418.1 dd_Smed_v4_8677_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30024446receptor tyrosine kinase-1SMESG000025275.1 dd_Smed_v4_8651_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30024406Omega-amidase NIT2SMESG000071423.1 dd_Smed_v4_1734_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30033982Terminal uridylyltransferase 7SMESG000007068.1 dd_Smed_v4_10161_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30024657Serine-threonine-protein phosphatase 6 regulatory subunit 3SMESG000006995.1 dd_Smed_v4_2815_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30032093Protein kinase domain-containing proteinSMESG000024489.1 dd_Smed_v4_5366_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30032093Protein kinase domain-containing proteinSMESG000024489.1 dd_Smed_v4_4401_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30032093Protein kinase domain-containing proteinSMESG000024489.1 SMESG000024487.1 dd_Smed_v4_5789_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30030716RibonucleaseSMESG000022763.1 dd_Smed_v4_10404_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30029695patched-like proteinSMESG000003567.1 dd_Smed_v4_7063_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30024560Receptor type tyrosine protein phosphatase zetaSMESG000041505.1 dd_Smed_v4_6997_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30030107Metastasis associated protein MTA1SMESG000062477.1 dd_Smed_v4_3995_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023408Protein RER1SMESG000033447.1 dd_Smed_v4_1498_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30026035SMED30026035SMESG000024811.1 SMESG000024808.1 dd_Smed_v4_9935_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30035307Forkhead box C1SMESG000015673.1 dd_Smed_v4_16297_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30026171SMED30026171SMESG000021782.1 dd_Smed_v4_2350_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023519TNF receptor-associated factor 3SMESG000070058.1 dd_Smed_v4_4827_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30033864pim-3SMESG000014593.1 dd_Smed_v4_6420_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30035871SMED30035871SMESG000055722.1 SMESG000043901.1 SMESG000034363.1 SMESG000034362.1 dd_Smed_v4_3685_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30033426SMED30033426SMESG000028228.1 dd_Smed_v4_7872_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30013079Succinate dehydrogenase [ubiquinone] cytochrome b small subunitSMESG000075449.1 dd_Smed_v4_982_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30015060SMED30015060SMESG000041505.1 dd_Smed_v4_6997_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30015768adenomatous polyposis coli-like proteinSMESG000045688.1 SMESG000005328.1 dd_Smed_v4_6966_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30015721Diacylglycerol kinaseSMESG000023623.1 SMESG000017153.1 dd_Smed_v4_7792_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30004957AnoctaminSMESG000033730.1 SMESG000033728.1 dd_Smed_v4_6514_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30012192Metallophosphoesterase MPPED2SMESG000074768.1 dd_Smed_v4_9610_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30006356slc21a-1SMESG000025236.1 dd_Smed_v4_8289_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30007809SMED30007809SMESG000020598.1 SMESG000020597.1 dd_Smed_v4_5190_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30013108Syntaxin-binding protein 1SMESG000013817.1 dd_Smed_v4_7111_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000510SMED30000510SMESG000010788.1 SMESG000042308.1 dd_Smed_v4_4800_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30003138Adenosine deaminaseSMESG000068461.1 SMESG000068458.1 dd_Smed_v4_6236_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001265Serine/threonine kinaseSMESG000004364.1 dd_Smed_v4_5328_1_1dd_Smed_v4PMID:29674431
muscle cellSMED30002168Spondin-1SMESG000039905.1 dd_Smed_v4_8655_0_1dd_Smed_v4PMID:29674431
muscle cellSMED300119385'-AMP-activated protein kinase subunit gamma-1SMESG000078418.1 dd_Smed_v4_8677_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30015890Protein lethal(2) giant larvaeSMESG000072512.1 dd_Smed_v4_7127_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016522DDE_3 domain-containing proteinSMESG000003593.1 dd_Smed_v4_9148_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30012464SMED30012464SMESG000035411.1 dd_Smed_v4_49258_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016964AnoctaminSMESG000033730.1 SMESG000033728.1 dd_Smed_v4_6514_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30013222Calcium-activated potassium channel slo-1, putativeSMESG000050831.1 dd_Smed_v4_5509_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000852cGMP-dependent protein kinaseSMESG000008788.1 dd_Smed_v4_8259_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000852cGMP-dependent protein kinaseSMESG000008788.1 dd_Smed_v4_7174_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30013845Phosphoglucomutase-1SMESG000046578.1 dd_Smed_v4_3503_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30007607SMED30007607SMESG000050535.1 SMESG000050533.1 dd_Smed_v4_5107_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30004743Fibronectin type-III domain-containing protein 3aSMESG000010713.1 dd_Smed_v4_4612_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30018004SMED30018004SMESG000039905.1 dd_Smed_v4_8655_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30002034SMED30002034SMESG000001789.1 dd_Smed_v4_3076_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30009362Inositol-pentakisphosphate 2-kinaseSMESG000069691.1 dd_Smed_v4_7143_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001678Succinate dehydrogenase [ubiquinone] iron-sulfur subunit, mitochondrialSMESG000020764.1 dd_Smed_v4_925_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30009652HEAT repeat-containing protein 5BSMESG000028228.1 dd_Smed_v4_7872_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016516Protein diaphanous homolog 2SMESG000057806.1 dd_Smed_v4_2533_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30010386Protein kinase domain-containing proteinSMESG000024811.1 SMESG000024808.1 dd_Smed_v4_9935_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30014504Fer-1-relatedSMESG000075933.1 dd_Smed_v4_6816_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30017608SMED30017608SMESG000031442.1 dd_Smed_v4_9452_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30017495SMED30017495 dd_Smed_v4_16978_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30013542SMED30013542SMESG000052945.1 SMESG000027762.1 dd_Smed_v4_236_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30010877Calcium load-activated calcium channelSMESG000016852.1 dd_Smed_v4_2854_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30013533Dolichol-phosphate mannosyltransferase subunit 1SMESG000008665.1 dd_Smed_v4_5598_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30008246Pre-mRNA-splicing factor CWC22 homologSMESG000049553.1 dd_Smed_v4_5597_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30011670DerlinSMESG000024268.1 dd_Smed_v4_2882_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30008283Glucose-repressible alcohol dehydrogenase transcriptional effectorSMESG000011011.1 dd_Smed_v4_5729_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016330SMED30016330 dd_Smed_v4_12993_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30009649SMED30009649 dd_Smed_v4_12854_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30014930DIS3-like exonuclease 2SMESG000077915.1 dd_Smed_v4_7044_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30005825P2X purinoceptor 4SMESG000046729.1 dd_Smed_v4_7865_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30019038SMED30019038 dd_Smed_v4_12777_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30004099SMED30004099 dd_Smed_v4_15498_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30002807Retrovirus-related Pol polyprotein from transposon dd_Smed_v4_12993_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30003956SMED30003956SMESG000031083.1 dd_Smed_v4_9586_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30009858Polyadenylate-binding proteinSMESG000044671.1 SMED30009858smed_20140614PMID:28807897
muscle cellSMED30003852SMED30003852SMESG000068031.1 dd_Smed_v4_8885_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30015957Transcription elongation factor A protein 1SMESG000027575.1 dd_Smed_v4_3176_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30018648SMED30018648SMESG000041679.1 dd_Smed_v4_5618_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016395Small subunit ribosomal protein S27SMESG000021355.1 dd_Smed_v4_6708_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30007895Protein kinase domain-containing proteinSMESG000080647.1 SMESG000010878.1 SMESG000010854.1 dd_Smed_v4_2866_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30017824SMED30017824SMESG000029435.1 dd_Smed_v4_8467_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30015350C2H2-type domain-containing protein dd_Smed_v4_17318_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016375SMED30016375 dd_Smed_v4_18038_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016647Pyridine nucleotide-disulfide oxidoreductase domain-containing 1SMESG000020914.1 dd_Smed_v4_7078_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30012572Leucine--tRNA ligaseSMESG000071689.1 dd_Smed_v4_9705_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30006679SyndecanSMESG000007514.1 dd_Smed_v4_4546_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30015897SMED30015897 dd_Smed_v4_13855_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30018603Receptor expression-enhancing proteinSMESG000043862.1 dd_Smed_v4_838_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30019132ATP-binding cassette subfamily B member 8SMESG000038762.1 dd_Smed_v4_9641_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30005796Transposon Ty3-G Gag-Pol polyprotein dd_Smed_v4_12993_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016207Wnt5SMESG000055035.1 dd_Smed_v4_15469_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30003690SMED30003690SMESG000031442.1 dd_Smed_v4_9452_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30005778SMED30005778 dd_Smed_v4_13855_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30003181Reverse transcriptase domain-containing protein dd_Smed_v4_17157_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30013470Rho-related GTP-binding proteinSMESG000001635.1 dd_Smed_v4_813_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30008157Rhodanese-like proteinSMESG000030828.1 dd_Smed_v4_880_0_1dd_Smed_v4PMID:29674431
muscle cellSMED3000680826S proteasome non-ATPase regulatory subunit 8SMESG000035221.1 dd_Smed_v4_3245_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30013261Retrovirus-related Pol polyprotein from transposon dd_Smed_v4_15498_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30006201SMED30006201 dd_Smed_v4_12854_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30014908slc46a-3SMESG000065064.1 dd_Smed_v4_7847_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30029822Neuronal acetylcholine receptor subunit alpha-4SMESG000021568.1 dd_Smed_v4_9503_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30020379DNA methyltransferase 1-associated proteinSMESG000023267.1 dd_Smed_v4_6218_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30025610Repressor of the inhibitor of the protein kinase dd_Smed_v4_1325_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30026859PlsC domain-containing proteinSMESG000028760.1 dd_Smed_v4_8757_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30029786usf proteinSMESG000064300.1 dd_Smed_v4_4871_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30024933SMED30024933 dd_Smed_v4_13855_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30031336MusashiSMESG000071202.1 dd_Smed_v4_7323_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30021617Neuronal acetylcholine receptor subunit alpha-2SMESG000040082.1 dd_Smed_v4_8486_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30033019nou darake like-5SMESG000070953.1 dd_Smed_v4_5102_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30032841HEAT repeat-containing protein 6-likeSMESG000057619.1 dd_Smed_v4_8372_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30033602Protein N-lysine methyltransferase METTL21ASMESG000033082.1 dd_Smed_v4_7520_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023735SMED30023735 dd_Smed_v4_13855_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30028912Nidogen 2a (osteonidogen)SMESG000016993.1 SMESG000016992.1 SMESG000016991.1 dd_Smed_v4_25_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30025783NADPH--cytochrome P450 reductaseSMESG000022047.1 dd_Smed_v4_542_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30031270E3 UFM1-protein ligase 1SMESG000023187.1 dd_Smed_v4_5571_1_1dd_Smed_v4PMID:29674431
muscle cellSMED30035995p53 induced proteinSMESG000037354.1 dd_Smed_v4_9539_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30033902sec1 family domain-containing protein 1SMESG000044570.1 dd_Smed_v4_2992_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30035463DiaphanousSMESG000027849.1 SMESG000054598.1 SMESG000054597.1 dd_Smed_v4_6188_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027108SMED30027108SMESG000027849.1 SMESG000054598.1 SMESG000054597.1 dd_Smed_v4_6188_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30024822SHSP domain-containing protein dd_Smed_v4_15128_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027550tRNA (adenine(58)-N(1))-methyltransferase non-catalytic subunit TRM6SMESG000072786.1 dd_Smed_v4_3327_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30036017SMED30036017SMESG000066362.1 dd_Smed_v4_6570_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30034967Myosin headSMESG000049494.1 dd_Smed_v4_2912_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30020795Selenoprotein OSMESG000058657.1 dd_Smed_v4_7029_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30025379matrix metalloproteinaseSMESG000049445.1 dd_Smed_v4_3902_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30025379matrix metalloproteinaseSMESG000049445.1 dd_Smed_v4_3902_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30022247p53 induced proteinSMESG000037354.1 dd_Smed_v4_9539_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023707Retrovirus-related Pol polyprotein from transposon dd_Smed_v4_12993_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30022463SMED30022463 dd_Smed_v4_1325_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30032516Upstream activation factor subunit UAF30SMESG000064350.1 dd_Smed_v4_7810_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30034494F-box-like/WD repeat-containing protein TBL1XR1-BSMESG000057676.1 dd_Smed_v4_3247_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027342Transient receptor potential channel,putativeSMESG000018612.1 dd_Smed_v4_13048_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30026923Sulfhydryl oxidaseSMESG000015310.1 dd_Smed_v4_8516_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027816Histone-binding protein RBBP4SMESG000043499.1 dd_Smed_v4_5104_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30025723LadybirdSMESG000063219.1 dd_Smed_v4_31435_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30028015Pyruvate kinaseSMESG000068454.1 dd_Smed_v4_4738_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30026779SMED30026779SMESG000010790.1 dd_Smed_v4_7584_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30033478Dis3 exonuclease 1SMESG000057169.1 dd_Smed_v4_6527_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30025926Tyrosine-protein kinaseSMESG000051839.1 dd_Smed_v4_2366_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023805Protein disulfide-isomerase A4SMESG000010656.1 dd_Smed_v4_4906_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30033173Proteasome subunit betaSMESG000027891.1 dd_Smed_v4_1241_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30029018Zinc finger protein ZPR1SMESG000080868.1 dd_Smed_v4_4302_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30035873Mitochondrial 28S ribosomal protein S21SMESG000059504.1 dd_Smed_v4_1993_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30033424Cytospin-ASMESG000025457.1 dd_Smed_v4_2554_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30035483phenylalanine--tRNA ligase alpha subunit-likeSMESG000051669.1 dd_Smed_v4_3224_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30030459SMED30030459SMESG000041220.1 dd_Smed_v4_14151_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30015531Nuclear envelope phosphatase-regulatory subunit 1SMESG000076783.1 dd_Smed_v4_7741_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30005821SMED30005821SMESG000009284.1 dd_Smed_v4_3178_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30005298CCHC-type domain-containing proteinSMESG000007097.1 dd_Smed_v4_7965_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30011622DNA-directed RNA polymerase II subunit RPB11SMESG000055029.1 dd_Smed_v4_4232_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000664Protein kinaseSMESG000026488.1 dd_Smed_v4_6431_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30007067SMED30007067SMESG000023796.1 SMESG000022519.1 dd_Smed_v4_4282_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30010068Formin-like protein 15SMESG000035694.1 SMESG000035692.1 dd_Smed_v4_8222_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30008869Arginine--tRNA ligaseSMESG000066154.1 dd_Smed_v4_5334_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30012932RapunzelSMESG000037569.1 dd_Smed_v4_811_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30010466Ribosomal protein S2SMESG000028845.1 dd_Smed_v4_3836_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30003218SMED30003218SMESG000027728.1 dd_Smed_v4_9752_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30010627Homeobox proteinSMESG000078684.1 dd_Smed_v4_8553_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016120Phosphoribosyl pyrophosphate synthase-associated protein 2SMESG000007561.1 dd_Smed_v4_4658_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30015515Mannose-binding protein CSMESG000046618.1 SMESG000031111.1 dd_Smed_v4_3266_0_1dd_Smed_v4PMID:30962434
muscle cellSMED30015515Mannose-binding protein CSMESG000046618.1 SMESG000031111.1 dd_Smed_v4_3266_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000165Formin-like protein 15SMESG000035694.1 SMESG000035692.1 dd_Smed_v4_8222_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30005274Tripeptidyl peptidase 2SMESG000074726.1 dd_Smed_v4_8122_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30003589Exocyst complex component 7SMESG000028363.1 dd_Smed_v4_7926_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30019100FAD synthaseSMESG000076936.1 dd_Smed_v4_8204_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000096son of sevenless-1SMESG000004512.1 dd_Smed_v4_5081_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30010729TIA-1-related RNA binding proteinSMESG000055085.1 dd_Smed_v4_2434_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30004019SMED30004019SMESG000075505.1 dd_Smed_v4_8346_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30002142Sarcosine dehydrogenaseSMESG000068610.1 dd_Smed_v4_4280_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30004578SMED30004578SMESG000066093.1 SMESG000066079.1 dd_Smed_v4_3986_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30011072MBOAT7SMESG000059008.1 dd_Smed_v4_7223_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30017555Lipopolysaccharide cholinephosphotransferaseSMESG000043355.1 dd_Smed_v4_2367_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30008035Secretory carrier-associated membrane proteinSMESG000037804.1 dd_Smed_v4_8593_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30008750Origin recognition complex subunit 1SMESG000072187.1 dd_Smed_v4_8215_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30014246Ras-related protein Rab-5ASMESG000064914.1 dd_Smed_v4_796_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30014008MBOAT2SMESG000066852.1 dd_Smed_v4_3131_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30002133PolyubiquitinSMESG000039444.1 SMESG000014081.1 dd_Smed_v4_34_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001060Dipeptidyl-peptidase 9SMESG000036809.1 dd_Smed_v4_8398_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30007686StAR-related lipid transfer (START) domain containing 7SMESG000005586.1 dd_Smed_v4_4116_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30006224SMED30006224SMESG000069268.1 dd_Smed_v4_14211_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30015261bax-1SMESG000037989.1 SMESG000037406.1 dd_Smed_v4_9696_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30012646SMED30012646SMESG000047460.1 dd_Smed_v4_5132_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30005148Protocadherin-9SMESG000022791.1 dd_Smed_v4_7807_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30015694Histone H2ASMESG000067932.1 SMESG000067933.1 dd_Smed_v4_5156_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30013924Chloride intracellular channel 4SMESG000007126.1 dd_Smed_v4_13202_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30009319Peptidyl-tRNA hydrolaseSMESG000050574.1 dd_Smed_v4_2074_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30003962Granulin bSMESG000018760.1 dd_Smed_v4_2701_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30005737Death-associated protein kinase 1SMESG000048879.1 dd_Smed_v4_9475_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30031290Acid-sensing ion channel 1SMESG000047581.1 dd_Smed_v4_12037_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30028453Lysosomal alpha-glucosidaseSMESG000005050.1 dd_Smed_v4_1062_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30028035Cytoplasmic dynein 1 intermediate chainSMESG000045332.1 dd_Smed_v4_10472_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30035659SMED30035659SMESG000076572.1 dd_Smed_v4_1912_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30020485Serine/threonine-protein phosphataseSMESG000019044.1 dd_Smed_v4_3429_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027961SMED30027961SMESG000007561.1 dd_Smed_v4_4658_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30022031SANT domain-containing proteinSMESG000016334.1 dd_Smed_v4_10781_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30023659Acid-sensing ion channel 1SMESG000016710.1 dd_Smed_v4_12878_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30020956Lysosomal alpha-glucosidaseSMESG000005050.1 dd_Smed_v4_1062_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30020989Glycine-rich domain-containing protein 1SMESG000047460.1 dd_Smed_v4_5132_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30034451Transmembrane protein 220SMESG000010766.1 SMESG000010767.1 dd_Smed_v4_1981_0_1dd_Smed_v4PMID:29674431
muscle cellSMED3003335426S proteasome non-ATPase regulatory subunit 11SMESG000048466.1 dd_Smed_v4_2135_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30020665E3 ubiquitin-ligase RNF185-likeSMESG000060298.1 dd_Smed_v4_5004_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30035968HECT and RLD domain containing E3 ubiquitin protein ligase family member 1SMESG000006057.1 dd_Smed_v4_9316_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30020986SMED30020986SMESG000061227.1 dd_Smed_v4_1936_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30032947cilia- and flagella-associated protein 46SMESG000014116.1 SMESG000014118.1 dd_Smed_v4_14103_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30030310SMED30030310SMESG000057201.1 dd_Smed_v4_1531_0_1dd_Smed_v4PMID:29674431
muscle cellSMED3003258926S proteasome regulatory subunit 6A homologSMESG000005152.1 dd_Smed_v4_1855_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30025577G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000026034.1 dd_Smed_v4_14785_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30020430Very-long-chain (3R)-3-hydroxyacyl-CoA dehydrataseSMESG000034959.1 dd_Smed_v4_3998_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001723HTH CENPB-type domain-containing proteinSMESG000049778.1 SMESG000048378.1 SMESG000039423.1 SMESG000024543.1 SMESG000022136.1 SMESG000002434.1 SMESG000078403.1 dd_Smed_v4_12879_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30001801NME/NM23 nucleoside diphosphate kinase 1SMESG000008082.1 dd_Smed_v4_1096_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30002006SMED30002006SMESG000037097.1 SMESG000037096.1 dd_Smed_v4_12526_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30000763SMED30000763SMESG000068156.1 SMESG000064685.1 SMESG000011804.1 SMESG000010609.1 SMESG000062429.1 SMESG000053533.1 SMESG000015751.1 SMESG000001486.1 dd_Smed_v4_1671_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30003064SMED30003064SMESG000046622.1 dd_Smed_v4_17337_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30002259SAM and SH3 domain-containing proteinSMESG000011174.1 dd_Smed_v4_16294_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016436SH3 domain proteinSMESG000080362.1 dd_Smed_v4_6830_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30016091Ubiquitin-conjugating enzyme E2 J2SMESG000064580.1 dd_Smed_v4_2733_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30029327slc8a-1SMESG000077236.1 dd_Smed_v4_3303_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30025511C2H2-type domain-containing proteinSMESG000027290.1 dd_Smed_v4_6459_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30026999Eukaryotic translation initiation factor 3 subunit CSMESG000061315.1 dd_Smed_v4_5221_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30020179Insulin-degrading enzymeSMESG000016400.1 dd_Smed_v4_9500_1_1dd_Smed_v4PMID:29674431
muscle cellSMED30020022ETS homologous factor isoform X2SMESG000069597.1 dd_Smed_v4_7247_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027774SMED30027774SMESG000064580.1 dd_Smed_v4_2733_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30034809SMED30034809SMESG000019881.1 dd_Smed_v4_8696_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30025134Casein kinase ISMESG000013694.1 dd_Smed_v4_4561_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30031687TNF receptor-associated factorSMESG000014725.1 SMESG000014724.1 SMESG000014706.1 SMESG000014702.1 SMESG000014700.1 dd_Smed_v4_4420_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30020501NHR domain-containing proteinSMESG000040495.1 dd_Smed_v4_7168_1_1dd_Smed_v4PMID:29674431
muscle cellSMED30027362DnaJ-like proteinSMESG000077692.1 dd_Smed_v4_3460_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027268Histone H1BSMESG000071975.1 dd_Smed_v4_3898_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30031519Tyrosine-protein kinaseSMESG000020289.1 dd_Smed_v4_9416_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30033046Protein FAM76BSMESG000071772.1 dd_Smed_v4_6213_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30028040Cysteine and glycine-rich proteinSMESG000049512.1 dd_Smed_v4_373_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30020678G-protein, gamma subunit,domain-containing proteinSMESG000066557.1 dd_Smed_v4_1237_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30030187Replication stress response regulator SDE2SMESG000046900.1 dd_Smed_v4_5448_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30025194Protein kinase domain-containing proteinSMESG000063617.1 dd_Smed_v4_4553_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30034906SMED30034906SMESG000019881.1 dd_Smed_v4_8696_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30031735E3 ubiquitin-protein ligase PDZRN3SMESG000080284.1 dd_Smed_v4_4699_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30029159SMED30029159SMESG000029594.1 SMESG000029589.1 dd_Smed_v4_315_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30027745molybdate-anion transporter isoform X2SMESG000027072.1 dd_Smed_v4_3699_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30029349AdenosylhomocysteinaseSMESG000029405.1 dd_Smed_v4_3408_0_1dd_Smed_v4PMID:29674431
muscle cellSMED30032520MAGUK p55 subfamily member 7SMESG000016277.1 dd_Smed_v4_5503_0_1dd_Smed_v4PMID:29674431
muscle cellSMED300296502-oxoisovalerate dehydrogenase subunit beta, mitochondrialSMESG000043691.1 dd_Smed_v4_2949_0_1dd_Smed_v4