muscle cell

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ In Situ Hybridization Data

  ▻ Sequences




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  muscle cell


DEFINITON:

  A mature contractile cell, commonly known as a myocyte. This cell has as part of its cytoplasm myofibrils organized in various patterns.


TERM DEFINITION CITATIONS:

  CL:0000187


TERM CITATIONS:


TERM ID:

  PLANA:0000101


ABOUT THIS TERM:

muscle cell

  ↳is a electrically responsive cell




DEPICTED BY:


BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30025388Myosin heavy chainDj-mhcStage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, musculature system, muscle cell, embryonic pharynx
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30022992 ID=SMED30022992|Name=Myosin heavy chain|organism=Schmidtea mediterranea sexual|type=transcript|length=6157bp
ATATATATGCATCTCAAAATTGGAAATTAAATTATTAATTTTAATTTACTAACAAATTTTTGTTGTAAAATGGAAAATAT
TGATGCTAAAGACTTGCAATATTTACAAGTTGATAAAAGTTTAGTTTCTGACTCTGCTAATTTGTCTGATTGGGCTAACA
AAAAATTGGTTTGGATACCTGACGACAATGAAGGATTTATTTCAGGATCACTTATAGAAGAAAAAGGCGATGAAGCTACT
GTCAAACTGGAAAATGGCAAAACAATGAAATTACCAATTGAAAATGTTCAAAAAGTGAATCCACCAAAATTTTTTAAATC
TGAAGATATGGCAGATTTAACTTATTTGAATGAAGCATCAGTTCTATATAATTTAAAAGACAGATATTTTTCAGACTTAA
TATATACATATTCCGGATTATTTTGTGTCGTTGTAAATCCATACAAGCGCTTGCCTATTTATACAAATAATGTAATTGAG
TGGTACAAAGGTCGAAAACGTCACGAAAGACCGCCACATATTTACGCAGTTACTGATGTCGCATATCGAAATATGCTCCA
AGATAAAGAAAATCAATCAATTCTTTGCACTGGTGAATCCGGAGCAGGAAAAACTGAAAATACGAAAAAAGTTATTCAAT
ATTTGGCCTCAGTTGCAACTTCTTTGAAAAATCAAAAAACCACAGCCAGTAATGCATTGTCACAATTTTATGCTCACGAT
GTTAACATTGGAGAATTGGAGACCCAATTACTTCAGGCCAATCCGGTTTTAGAAGCTTTTGGAAATGCAAAGACTATCAA
AAACGATAATTCATCTCGTTTTGGTAAATTTATTCGAATCAATTTTGACACTTCTGGATTCATTTCCAGTGCAAACATAG
AAACATATTTATTGGAAAAAGCTAGAGTTATTAGACAGGCAGCTAATGAACGGTGCTTTCACGTGTTTTATCAGCTTCTT
CTTGGTGCAGACGACCGATTGAAAAAGGAATTAATCTTAGAAAATGTTTCTACATACAAACTTTTATCCAACGGCATGAT
AGCTGTACCAGATTACGATGAAAAGCAAATGTTTAAAGATACAGTCGAAGCTCTCGATATAATGGGGATTTCGAAAGACG
AACAAGAATCTATTTTCCGAGTTATAGCCGCAGTTTTACACATGGGAAATATCGAATTCAAACAAGAAAGAAGTTCGGAT
CAGGCTGCTTTACCAGACAATACAGTTGCTCAAAAGGTTGCTCATCTTCTCGGTTTACCGGTCACAGAAATGACCAAAGC
ACTGCTGAAACCAAAATTGAAAATTGGAAGAGAAGTTGTAGCAAAAGCTCAAACTAAAGAACAAGCCGAATTTTCCGTTG
AAGCTATAAGCAAATCAACATATGAAAGAATGTTTCGATGGCTGGTAATGAGAATAAATAGATCAATTGACAGAAATAGA
CAAAAAACTAATTTCATTGGCATTCTTGATATTGCTGGCTTTGAAATATTTGAAATAAACTCTTTTGAACAATTGTGTAT
AAACTATACCAACGAGAAATTGCAACAGCTTTTCAATCATACAATGTTTGTGCTAGAACAAGAAGAATACAGAAAAGAAA
ATATCAAATGGGAATTCATTGACTTTGGTCTTGATTTGCAGCCAACTATCGAACTAATTGAAAAGCCAATGGGTATTCTT
TCTTTGTTAGATGAAGAGTGCTTTTTCCCAAAAGCTACCACAAAGACATTTGTTGAAAAATTAATTAAAAACCAATCGAC
GCACCCTAAATTGAAAGCTACTGATTTTAGAGCAAAAGCAGATTTTGGGGTTATTCATTACGCGGGAAAAGTTGATTATG
TCTCCGATAATTGGCTGGTGAAAAATATGGATCCTCTTAATGAGAACGTTGTTAGTCTCTTACAAGAATCAAATGAAAGT
TTTGTCCAGACAATTTGGAAAGATGCAGAAAACATTATTGGCTTATCAACTACTACCGCCCAAGAATCTGCCTTTGGAGG
TGCAAAAACTACTCGCAAAGGAATGTTTAGAACCGTCGGTCAGCTTTACAAAGAATCATTAACGAAATTGATGGATGTTC
TGAATAATACCAATCCCAATTTTGTGAGATGTATCATTCCCAATCATGAAAAAAAATCTGGTAAAATCGATTCAAAATTG
GTTATTGATCAATTAAAATGTAATGGTGTGCTGGAGGGTATCAGAATATGCCGACAAGGATTTCCAAACCGAATTTTATT
CCAAGAGTTCAAACAACGTTATGGAATTCTTACACCAAATGTCATACTAAAAGGTTTTATGGACGGTCGAAAAGCAACAG
AATTAATGCTTGGAGAGTTGGATATTGATGCATCAAATTACAGAATTGGTCAGAGTAAAATATTTTTCAAAGCTGGAGTT
TTGGCTAGATTAGAGGAAGATCGAGATATTAAGTTGACTGAAATCATAGTCAAATTTCAATCTTATGCACGTGGATATTT
GGCAAGAAAAAATTTACAAAATCGATCGCAAAATCTCAATGCAATTAAAATTATTCAAAGAAATTGTAATGCATACTTAA
AATTGAGAAATTGGGCCTGGTGGAAATTATTCACACGTGTTAAGCCTCTATTAAGTGTTACAAGGCAAGAGGAAGTTGTG
GCTTTGAAGGAAGAAGAATTGAAAAAATCAAAAGAAACTCTCGAAAAGATGACTGCTGATTTCGAAACAACTAAGAAAAA
TTATGAATTTCTCATGGAAGAAAAAAATAAAATTCAGGAAGATTTGGAAAAGGAGCGTTTTGCATTGCAAGATATGGAAG
GGGAAAGAGAAAATTTGATCAAGCGATTAAAAGATATTGAATCAGATGCTCAAGAATGCGAGTCAAGAGAGATGGAAACA
AAAGACAAATGCAATAAATTGGAAATCGAGAAAAATAAATTACAAAATGAAATTTCACAGCTTAGCCAAAATTTAGAATC
AGAGGAACAGAACTTGCAAAAAGCTCAAGCAGACAAATTAAGTGCTGATAAACGAATTAAGGAACTGGAACAAAAAGTGG
CCGAATTAGAAGATAAACTTAACAAGTTAACTAAAGAGAAAAAGTCTCTAGAAGAGCGATTGGCTGATGTTATGTCTACT
TTGGCGGAAGAAGAAGAAAAGAGTAAACAATTAACGAAACTCAAATCCCGTCACGAAACAAGTATCACTGAATTAGAAGA
GAGATTGAGCAGAGAACAAGCAGCTCGACAAGATTTAGAAAAAACAAAGAGACGACTAGAAACTGAATTGTCTGAAAAAT
CTGATAATTTATCATCTCAAAGCCATACATATGAAGAAATTAGAATTACTCTTGAACGAGCAGAAACACAAATAATTCAA
ATGCAAGCTAAATTAGATGAAGAAACAACGGCAAAATCGTTGGCTCAGAGACAAATTCGAGACGCAGAAAACGTAATCAC
CGAAATCAAAGAAGATCTTGAAGCTGAAAAACGTTCAAAAGAGAGAGCTGAAAAAGCTAAGAGAGATTTAGCCGAAGAAA
TAGAATCTCTTAAAATGGAATTACTCGATACGGGAAATACATCAGAAGAACAGCAAAGCGTATTGCGCAAAAAAGAAGTT
GAATTACAAAATTTTAAAAAATCTTTTGAAGATGAAACAAAACGAACTGAACTTGAAATGCAAGAAATTCGTAAAAAAGC
CGCAGTAACGATTGAAAACCTCAACAATCAAATAGAAGCTGCTAACAAATCAAAACTTGTTGTTGAAAAGGCTAAATTAC
AGTTGCAAGAAGAACTTAATGATGCAAATAACGAATTAGCAAATTTAAGATCCTCCAAAGCTGACTCTGAAAAACTTAAG
AAGAACACAGAACTACAACTTTCAGAAATATCTCATCGCCTTTCAGAATCTGAAGAACACAAGCTAGATGCTGAATCAAA
ACTTAAAAAACAAACCGAGTTGGCTGACAAATTGGCTATGAATCTCGAAGAAATTGAAAGCAAATTGTCGCAATTAACTA
AATCTGAATTATCAGTTCGAAGTCAGTTAGCAGATTTACAAAAGGACTTTGAAGAAGAAACTCGATTAAAATTGAATGCT
CAAACTACATTAAGGCAGTTAGAAAGTCAATTTGCTTTATTAAAAGATCAATTAGAAGAGGAGCAACAATCAAAAGAAAA
TTTAGAAAGTCACGTACAAGCTCTACAGAGTCAAATGCAAGATGTCAAAAAGAAAGTTGAAGAAGATGCTCAACAGCTAT
TAGAATTTGATGAATCTCGTAAAAAAGTAATGCGTGAACGAGAAGAATTGCAGATTAGACTTGAAGAAGCAATCAATCAG
ACTGAAAGATCAGAAAAAGCTAAGCGAACAATTCAAGCCGAGCTTCAAGATGCATATCATGCCCTAGAAAGTCAGAAAAA
TGACCAAACTCAAAGTGATCGAAAACTTAAAAAAATGGAATCACAAGTCAATGAAACATTGAACTTGAATAAAAAATATT
TAGCTGAAAAGGATACATTAGAAAAAGAAAATCGTGAAAAAGAAACAAAAATCATGCAATTACAGAGAGAAATGAATGCA
AATGACGATAAACTTTCGGAATTGGAAAATGCAAAATCCTTACTGACTCGGCAATTGAATGAATTGGTTTCGAGCAAAGA
TGATGTTGGTAAAAATGTTGGCAGTTTAGAAAAGGCTAAAATTCAATTAGAAACCGATTTAGAGAATTGTAAAGTTACTA
TTGAAGAATTAGAAGAAGAAAATGCAACTCTTCAAATGAATAAAGAACGAGTTGAAATGCAATTAACTGCTACTAAAGCC
CAACTGGATAGGGAGCTAGCTTCCAAAGATGAAATGCACGATGAACAGTTCAGAATTATAAACAAAAAGCTTCGTGATGC
AGAAGCGGCACTTGAAGAAGAGCAGAAATCCAAAACAGCTATGGTTTCATTGAAAAAGAAAATAGAAAATGAGAACATGG
ATTTATTAAATCAATTAACAGAATCTGAGAAGGTCAAAGAAGAGCTGGCCAGACAGATTAAAAAATACCAAGGAAATTCT
AGCAATCTTCAAAGAGAAATGCAAGAACTTGTTGCTGCTAAAAATGATTATTTGAAGCAGATTAAAGAACTAGAAAAGCG
CTTACGTACTTCTGAAAGCAATGTAAACCAATTATCCGAAGACCTTTCGCAGTCTGAACGTGCTAAGAGAACCATTGCAT
CTGAAAGAGATGAAGCTTTAGAAGAAATTGCCACAATCACTATGGCTAGGGATACAGCTATTGCAGATAAAAAACGTATT
GAGAGTAGCATTTCAGCATTAAGCATGGATAATGAAGAATTGCAATTACTTTTGTCAGAATTAGAAGACAAAAATAAGAA
AATTATTTCTCAGTTAGAACAAGTTCAAAATGAATTAAATGTTGAACGACAAAATATAAGTAGATTAGAAAATCAAAAAT
CAACTGCCGAAAGACTGAATAAAGAATTGCATGATAAAATTGAAGAATTGGAAATGGAAGCTGGTAAAAAATATAAAGCT
ACAGTTGCTGCTCAACAAAGTAAAATCCAAAGTCTTGATTCTCAGCTGGACGCTAAAATTGAGGAAATAAACCAAGCTAA
TAGAAATAACAAGAAACTAGAAAGAAAGTTGAAAGAAATTATGGCTCTTATGGCTGATGAAACAAAGCGGGCTGACAATG
CAATCGAACAGATTGAAAAAGCCACTGGCAGATTTAAAAAAGCAGAGAGAAGTTTACAGATGGAACAAGAAAACAATTCT
GCTCTAAGTACACAAAATCGCCGATTACAACGAGATTTGGAAGAAGTAAATGAAACCAAAGAAGCACGGGACCAAGAAAT
TAAAATTCTTAAAACCAAAATCGACAGATTGGAAAAAAGAACACGCGCTGGGGGTCGACCTCTTAGAGGAGACGGTGGAT
CTGATGATGGGTTATCTGGAGATGGAGAATCCGTAACTGATTCTGCTTTAAAATCTGTTCAAGAAGACTAATTCAATAAG
TCCTAAAATGAACAATAAATTCTTGAATAATTAGTTAATACAAAAATTTTTGAATAATTTATATTTGGACTAACTTTTAA
TTCCTATTTGGTTTGCTCAATATATAATTGTTTTGATATATTTAATATTTCTATTTTATCAATTTGTGTACTTGGGG
>SMED30020435 ID=SMED30020435|Name=Myosin heavy chain|organism=Schmidtea mediterranea sexual|type=transcript|length=3615bp
TCTGAATTTAAACAAAGATATTCAATTTTGGCCGCAGATGTAATAGGGCAAGGATTTATTGATGGAAAACAGTGTACTGC
AAAGATAATGGAAGCAATCCAATTAGATAAAAACAACTACAGGCTTGGATCAACTAAAATCTTTTTCAAGGCCGGAGTAC
TTGCTCAGTTAGAAGACATGCGAGATGAGAAATTATCATCCATTTTGTCTGTATTCCAAGCACAGATGAGAGGATATATA
ATGAGAAAAGCATATAAGACATTGCAAGATCAACGAATTGCTCTTTCTCTCATTCAAAGAAACATCAGAAAATATTTATT
ACTAAAAACATGGCCATGGTGGAGACTATACACTAAAGTCAAACCACTCCTCAATATCGCAAGACAAGAAGAGGAGATGA
AGAAAGCTGCTGAAGAGTTGATTAAATTGAAAGAAGAATATGAAAAGATAGAAAAATTTAAAAAGGAATTGGAAGGTCAA
AATGTGGTTTTGCTTGAGCAGAAAAATGATTTATTTTTACAACTGCAAACAGAACAAGACAATCTTAGTGACGCTGAAGA
AAAGATTCAAAAGATGATCAATCAAAGAGTTGAAATGGAGAACCAATTTAAAGAATTAGAAGATAAATTAATGGATTCGG
AAGACATTCAAGATGAATTGGAAATCGAAAAAAAGAAATTGTTGTTGGATATGGATGAATTGAAATCGGACATTGACGAA
CTTGAAGTATCTTTAGAAAAGTCTGAACAAGAAAAACAAGCTCGCGATCAACAAATTAATAATTTGAAAGAAGAAATTCA
AAAACAAGATACTTCTATCGGAAAAGTTCAAAAGGAGAAAAAGACTCTAGAAGATAACTTAAATCAGACCAGAGAAGCTT
TAAATGCTGAAGAAGACAAGGTCAATCAGTTGACTAAAATCAAATCAAAATTGGAATCTGAAATAGATGAAATGGAAGAA
GCTCTAGAACGGGAAAAGAAGATCCGTGGAGATGTTGAAAAACTTAAACGGAAATTAGAAGCTGATCTCAAATCAAGCCT
TGATAACTGTAATGAGTTGGAAAATATAAAGCAGGAGTTAGAAGAAAATATTCAGAGAAAGGACATTGAAATATCAAAAT
TAAATGTCAAATTGGAAGATGAATCTTCAATTGTCACTCAACTTCAACGAAAAATTAAGGAATTACAAACTGTTATACAA
GATCTTGAAGAAGATCTAGAAGGTGAGAGACAAGGTCGATCAAAATCTGAAAAAGCTCGACAGTTGGCTGAACAAGAACT
CGATGAACTAGCTGACAGACTTGAAGAGCAGGGAGGTGCTACTATGGCACAAGTGGAATTGGCCAAGAAACGAGAAACTG
AATTAATGAAACTTAAAAAAGAATTACAAGATACCAATTTACAGAATGAGCAAATACTCAATGGTTTGAAAAAGAAAAAC
CAAGAAATTACCAATGAATTCTCCGAGCAAGTCGATCAAATAAATAAATCTAAATCAAAAATCGAAAAAGAAAAGGCGAC
TCTTAAGCATGATCTGGATGAATTTGTTTCTCAATTAGAATCTGTTTCAAAGCTAAAGGCCAATACAGAAAAACATTCAA
AACATTTAGAAAGTCAAATTATGGAATTGGAAAACAAAATAGACGAACAGAATCATCAAATATCAGAAATGGTTTCACAG
TCTAATAAAGACTCTCAAGCAATAATGTCTTTAGAACAACAACTAGAACAAGCAGAAAATGAAAATCACCAATTGAGCAA
ATCCAAACAACAATTCCTCCAACAAATTAATGACTGTAAATCGACTCTTGAAGACGAAGAAAAAGTAAAGGCCAAACTTT
TCAATGAAATTCGTAATCTGAATGATGAAATGGGCAATTTAAGATCCAGTTTGGAAGAAGAGCAAGAATCCAAAAGTGAA
ATTCAAAGGTCACTAGCAAAATCCCAATCTGAACTTGTACAAATGAAAAATAAATTTGATAGTGAAGGTTCAGGTCGCAT
TGAAGAAGTTGAAGAAGCTAAACGTAAGTTGCAAACGAAACTTCAAGACATGGAACAAGAATTTGACGCTATTAAAAATA
AATGCGCGCAACTTGAAAAAATCAAAATTCGTCTCACTGGAGAAATCGAAGACATGAGTGTTGATGTTGACAGAGCTAAT
GCAGTGGCTAATCAACTAGAAAAGAAACAAAAGAACTTTGACAAAACCGTCAGTGAATGGCAGTCTAAATGCAACTGCCT
TCAAACTGAAGTTGATGTTGCAAATCAAGAATCAAGATTTTTGTCAACCGAAGTATTTAAATGTAAAAGCCAAAACGAAG
AATTGCTTTCACAAATCGAAAATCTTAAACGAGAAAATAAGTCTCTCAGTGATGAAATTCACGATTTAACGGAACAACTA
AGTGATGGCGGAAAATCTGTTCACGATATAGAAAAGGCAAAACGAAAATTGGAAATAGAAAAGGAAGAACTGGAACAAGC
TTTGGAAGAAGCTGAATCAACATTGGAAAATGAAGAAGCCAAATTACAAAGAGCTCAGTTAGAGTTGAGTCAGATGAAAT
CAGATGTAGAAAAACGATTGTGTGAAAAGGAGGAAGATTTTGAAGGAACTCGCCGTAATCATCAAAGAGCAATGGAATCA
ATGCAAGCTTCTTTGGAGGCAGAAATTAAAATTAAACAGGACTCAATTAAAGCCAAGAAGAAGTTAGAACAAGAAATCAG
TGAACTCGAAGCCAATTTAGATCAAATCCAAAGACTGAAATCAGATGCTGATAAGAACAATTCAAGAATGCAACAGCAAA
TTCATGATTTACATTCAGAGATTGAACAAGAACAACACAGTAAAAACGAAGTCCGAGAACATGCTCAGATGGCTGAAAAG
AGATTTTTATCGGCTAATGGAGAACTAGAAGATTTGCGAGCCAAATTTGAACAATCAGATAGAAATCGTAGAAATGCTGA
ATCTGAGCTTCAAGATTTGAGTGATAAATACAATGAAAGCCAAGCACTGATCACTTCACTTCAAAGTTCAAAAAGAAAAA
TGGAAATGGATTACGTAGCTATGCAGTCCGATCTTGATGATATGTCAAACCATGTTCAACAAGCTGAGGAAAGAGCAAAG
AAAGCAGCTGGTGACGCTGCCCATATGTCAGAACAACTTCATCAAGAACAAGACAATAGTTTGCACACGGATAAAATGAG
GAAGCAAATGGAAATTCAAATCAAAGAAATGCAGTGTAAACTAGAAGAAGCCGAAAGTAATGTTTTGTCAGGCGGCAAAA
AGACTTTGGCAAAGTTAGAGTCAAAAATACGAGAATTGGAAACTAATCTTGATAACGAAATGAGAAAACATGCTGAAACT
CAAAAGAATTATCGCAAAGTAGATAGACGAATGAAAGAACTAACATTACAATTGGAAGACGATAGAGCTCAACAAGAAAA
ATCAAATCAAGTTATTGAAAAATTCCAAGGACAAATCAAAACCCTTCGAAAACAATTAGAAGAATCAGAAGAAGTTGCCG
TTTTGAATATTGCCAAATTTAAGAAAGTACAATGTGATTTTGAAGAAGCCGAAGAAAGAGCGAATGAATCGGAACAAGCT
TTACAAAAATTAAGA
>SMED30016281 ID=SMED30016281|Name=Myosin heavy chain|organism=Schmidtea mediterranea sexual|type=transcript|length=5986bp
CTAAAATTTAGTTGATTTCGATTGTTTGAATAAAAATATCTAATGGACCCATCAGATCCTGATTTTATCTACTTGGGAGT
CGACAGGAAAGCTTTATTGAAGCAATATGGCGACTCGTTTGATAGTAAAAAGAACATGTGGATACCGGATGAAAAGGAGG
GGTACATCGCAATTACCGTTGAAGAAACAAATGGCGATAAAGTAACTGTTAAAACCGATAAAGGAGAAACTAAAGTCGTC
AAGCAAGACTCCTTGGAACAAATGAATCCCCCCAAATTCATGATGATTGAAGACATGGCGAATTTAACATTTCTCAATGA
TGCCAGTGTATTTGATAATCTGAGACAAAGATATTACAAAAATCTGATTTATACTTACTCCGGACTGTTCTGTATTGCAG
TGAATCCTTATCGAAGATTTCCGATTTATACGTCCCAAGTAATTATGAAATATAAAGGAAAACGTAGAGGAGAAATGCCA
CCGCATATTTTCTCAATTTCGGATAATGCTTACTCAAATATGCTTGTCGATCGAGAAAATCAGTCTGTTTTGATTACTGG
AGAAAGTGGTGCTGGGAAAACTGAAAACACGAAAAAAGTTATTACTTACTTCGCCAATGTAGCAGCAGCAAGTAAAAAAG
ATGATGACGATCCATCGAAGAAAAAAGGTTCATTGGAAGATCAAATTGTACAAGCCAATCCTGTACTGGAGGCATACGGA
AACGCCAAAACAACTAGAAATAATAATTCGTCAAGATTTGGAAAATTCATCCGAATTCATTTTGGCACTAGTGGAAAAAT
TGCAGGAGCTGATATTGAGTTTTATTTGTTGGAGAAATCTCGTGTTATCTCACAGCAAAAAGGAGAAAGAAATTACCATA
TTTTCTATCAATTGCTTTCGGCAGGAGGGAAAAGTTACCACGATAAACTTTTGGTTACTGCTGATCCTGCTCTGTTTTCT
TTTATCAACCAAGGAGAATTGACGATTGACGGTGTTGATGATGAGGAAGAAATGAAACTTACTGATGAAGCCTTTAGTAT
TCTTGGGTTTTCCGATGAAGAGAAAATGAGTTTGTTTAAATGCACTACTTCAATCATGAATATGGGAGAAATGAAATTTA
AACAAAGACCCCGTGAAGAACAAGCCGAGGCTGATGGTACAACAGAAGCTGAAAAAGTCTCTTTCTTACTTGGAGTGAAT
GCCAAAGATCTAATGCAAGCAATTCTTAAACCCAAAGTCAAAGTAGGAAACGAATATGTAACGAAAGGTCAAAGCAAAGA
TCAGGTTTTATATTCTCTTGGAGCCTTAGCAAAATCTTTATATAACAGAATGTTTGCTTGGTTGGTTACTCGCGTGAACA
AAACGCTGGACACAAAAGTCAAAAGACAGTTTTTCATTGGTGTCTTAGATATTGCCGGATTTGAAATATTTGATTTCAAT
GGTTTCGAACAAATTTGTATCAACTATACTAATGAGAGACTCCAACAATTTTTCAATCACCATATGTTTGTTCTTGAACA
AGAGGAATATAAAAAAGAGGCCATTGACTGGGAGTTCATAGATTTTGGAATGGATCTCCAAGCTTGCATTGAGTTGATTG
AAAAGCCTATGGGTATTTTGTCGATTTTAGAGGAAGAATGTATGTTTCCCAAAGCAAGCGATCAAACATTGAAAGCTAAA
TTGTACGATAATCACTTGGGTAAAAGTCCGAATTTCGGAAAACCAAAACCACCAAAACCAGGACAACACGAAGCCCATTT
CGAATTACATCATTATGCTGGCAGTGTTCCATATAATATTACTGGGTGGTTGGAGAAAAATAAGGATCCATTGAACGAAA
GTGTTGTTGGATTACTCGGAGCATCTAAAGAATGTCTAGTAGCTTCTTTATTTGCACCGGCTGAAGATACAGGAAAACCC
GGAACCAAGAAAAAGGGTGGATCCTTTATGACTGTGTCATATATGCACAGGGAATCATTGAATAAATTGATGAAAAATCT
AATGAGTACAAGTCCACATTTTATTCGTTGCATTGTCCCCAATGAATTCAAACAACCAGGAGTTGTTGATGCGCATTTGG
TTATGCACCAACTTCATTGCAACGGTGTATTGGAAGGTATTAGGATTTGCAGAAAAGGATTCCCAAATAGAATGATCTAT
TCTGAATTCAAACAAAGATATTCAATTTTGGCACCGAATGCCATTCCACAAGGATTTGTTGAAGGCAAACAGGTCACTGA
TAAAATCCTCACAGCCATTCAACTGGACACAAATCTTTATCGCTTAGGAAATACCAAAGTATTTTTTAAAGCTGGAACAT
TGGCTCAACTTGAAGATATAAGAGACGAGAAACTTTCGTCGTTGATATCGTTGTTTCAAGCTCAAATTAGGGGATATTTA
ATGAGACGGCAATACAAAAAACTTCAAGATCAAAGAGTTGCTCTGTCTTTGATTCAAAGAAATATTAGAAAATATTTGGT
TTTGAGAACATGGACCTGGTGGAAATTGTTCACTAAAGTAAAGCCTATGCTTAATATTGCTCGCCAAGAAGAAGAAATGA
AAAAGGCAGCCGAAGAATTAGAAAAGCTGAAAGAGGAATTTGAAAAAACTGAAAAATATAAGAAAGAACTTGAAGAACAA
AATGTTACTTTACTTCAAGCAAAGAACGATTTATTCTTGCAGTTGCAAACTGAACAAGATAGTTTAGCTGACGCTGAAGA
GAAAGTATCTAAATTAGTTCTACAAAAGGCTGACATGGAAGGAAGAATTAAAGAACTTGAGGACTCACTTTCAGAAGAAG
AAAATTCAGCTTCAACATTAGAAGAAGCAAAAAAGAAACTCAATGCTGACATCGATGAATTGAAGAAAGATGTTGAAGAT
TTGGAATCATCTTTACAAAAAGCAGAACAAGAAAAAGTTGCAAAGGATCAGCAGATTAAATCCCTCAACGACAATGTTCG
TGAAAAAGAAGAACAATTAGCCAAAATGCAAAAGGAAAAGAAAGCTGCTGATGAATTACAAAAAAAAACAGAAGAATCAT
TGAAAGCCGAAGAAGAGAAAGTCAGTAACCTCAATAAAGCTAAAGCTAAATTAGAACAAGCCCTGGATGAAATGGAAGAA
AATCTTGGTCGAGAACAAAAAATTAGAGCAGATGTTGAAAAAGCAAAACGAAAAGTTGAAGGTGAACTTAAACAGAATCA
AGAGTTATTAAATGACTTGGAGCGCATAAAATCCGAACTTGAGGAACAATTAAAACGAAAAGAAATTGAATTGAATGGTG
CTAACTCTAAAATCGAAGATGAATCTAATTTAGTTGCAACACTTCAACGGAAGATCAAAGAACTTCAAGCCAGAATCCAA
GAATTAGAAGAAGACCTTGAGGCGGAAAGACAAGCAAGGGCAAAAGCTGAGAAAGCTAAACATCAATTGGAAGCGGAACT
TGAGGAAATCAGTGAAAGACTAGAAGAACAAGGAGGTGCAACTCAAGCCCAAACAGATTTAAATAAAAAACGAGAAGCTG
AACTCATAAAATTAAAGCGAGACTTGGAAGAGGCTAATATGCAACACGAACAAGCCTTGGTGCAAATGAGAAAGAAACAA
CAAGATACTAGCAATGAATTCGCAGATCAGTTAGATCAATTGCAAAAATCAAAATCAAAGATTGAAAGAGAAAAGAGTGA
ACTTAGAGCAGACATTGAAGATTTATCAAGTCAGCTGGAATCACTGAATAAGACCAAGGGAAATCTTGAAAAGTCAAATA
AAGCATTAGAAACCACAGTTTCAGATCTTCAAAACAAACTCGATGAATTAAGCAGACAATTGACAGAAGCAGGAAACGTC
AACAATCGAAATCAACATGAAAATAGTGAAATGCACAAAACCTTAGAAGACGCCGAATCACAAATAAACCAACTCGGAAA
GGCTAAACAACAACTCCAAGCGCAGCTAGAAGAGGCTAAACAAAATTTGGAAGATGAATCACGCGCAAAAGCAAAACTTA
ATGGAGATTTAAGAAATGCGATGAGTGATTTAGATGCATTACGGGAATCATTGGAAGAAGAACAAGAAGGCAAAAGCGAT
GTTCAAAGACAGCTTGTGAAAGTCCAAAATGAATTACAGCAACTTAAAGCAAATTCTCAAGGTACTGGAGGAGTGAGAAC
AGAAGAAATGGAAGAATTCAGACGAAAGATGAATGCCAGAATCCAAGAACTAGAAGAAGAATCGGAATCAAATAAATCTA
AATGCAGTCAATTAGAAAAAATGAAATCCAGACTTCAAGGAGAAATTGAAGATTTAGTGATAGATGTTGAAAGAGCCAAT
GGATTAGCATCGCAACTGGAAAAGAAACAGAAAAATGTTGACAAATTAATAGGCGAATGGCAAAAAAAATATTCAGAAAG
TCAACAGGAACTAGAAGTATCACTGAGAGAATCAAGAACAGTTTCCGCTGAAGTTTTCAAATTGAAATCACAATTAGAAA
ATTCTCAAGATCAAATCGAAAGTTTAAGAAGAGAAAATAAAAATCTATCTGATGAAATTCATGACTTAACTGAACAATTG
GGAGAAGGAGGACGAAATGTACATGAAATTGAAAAGACTCGAAAAAGAATTGAAATTGAAAGAGATGAATTACAACATGC
ATTAGAAGAAGCTGAATCAGCTTTGGAACAAGAAGAAGCTAAAAGCCAAAGAGCTCAGTTAGAAATAAGTCAAGCCCGTC
AAGAATCTGAAAGAAGACTTGCAGAAAAAGAAGAAGAATTTGAAGGTACACGAAAAAATCATCAACGAACACTCGAATCC
ATGCAAGCATCTCTTGAAGCTGAAGTTAGAGGACGAACTGAAGCAATGAAAATGAAAAAGAAGCTGGAGCATGATATTAA
TGAGCTTGAAGTTGGGTTAGACACGGCTAATAGACTGAAATCTGAACAAGAGAAAAATGCTAAGAAATATCAGCAACAAT
TAGCAGAAATGCAAGCTCAAGTTGAAGAACAGCATCATCAACGAGAGCAAGTTAGTGAACAGCTTGCGTTAACAGAACGA
AAATTAGGTATGATGCACGGAGAGCTGGAGGAAATGAAAAATATGTGTGATCATGCTGAAAAAAATAGAAAAGTCGCTGA
ATCTGAAAAGAATGAAGCCATTGATAAACTAAATGAGTTTTCAATTCAAAATTCTTCATTCATGGCAACTAAAAGAAAGA
TGGAAGCAGATTTAGCAGCAATGCAAGCTGACTTAGAAGAATCTACAAATGCAGCTAGACAAGCTAATGAACAATTGAAA
AAGGCAATATTTGATAATACTCGACTTTTCGATGAAATTAAACAAGAACAAGAACATGCTCAACAAGCTGAAAAAGCAAG
AAAGAATTTGGAGAGCCAGTTGAAAGAATTGCAATCAAAACTTGAAGAAGCAGAAGCAAATGTACTTAAAGGAGGCAAAA
AGGCTTTGAGTAAATTAGAGCAAAGAATAAGGGAATTGGAAGGCGAACTAGATGGTGAACAAAAACGACATGTTGAAACT
CAAAAGAATGCTAGAAAGTCAGATAGGCGACTGAAAGAAATTTCGTACCAGATCGACGAGGATAAAAAGAATCAAGATCG
AATGCAACAACTTATTGAAAGTTTACAAGCAAAAATAAAGACTTATAAACGACAAGTAGAAGAAGCTGAAGAAATCGCTG
CTGTGAATTTGGCAAAATATCGCAAAATTCAACAAGAGATTGAAGATTCTGAAGAGCGAGCTGATCAAGCTGAACAAGCT
TTACAAAAATTAAGAGCAAAGAATAGAAGCTCGGTATCTGTTAGTCGAGGAGCAAGTTCTGGACCTGGAACCAAAATTTC
TATAACTGCGACATCAATCCGCAGTGAGGACTAATCTGACAGAAAAAATTCATCATTAGGAAATATGCAATTAGTTAGCC
AATATTTCCCTTAGACTAGATTTTAAACCTTTAAGACATTTTTTTCAAATTAATAAAACGTTTTGA
>SMED30024552 ID=SMED30024552|Name=Myosin heavy chain|organism=Schmidtea mediterranea sexual|type=transcript|length=2149bp
TCACTGGAGTTAATAAACGACAAATTAAGGAAAAATGAACATGAACGATCCAGAAATGCAATACTTGGCCATTGACCGCA
AAGAATTGCTGAAAAGTTTAGATGTTGGGACTTTTGACAGTAAGAAAAATTGCTGGGTCCCCGATGAGAAGGAAATGTTT
GTGGCGGCGGAAATTAAATCCTCCTTAGGAGGTATTTTAAAAGTTCAAACGAAAAATGGAGAAAATCGTGAAGTTAAAGA
AGACGATATTCAACAAATGAATCCACCGAAATTCGAAATGATTGATGATATGGCTAATCTCACTTTTCTAAACGATGCTA
GTGTGTTACATAACCTAAAATCCCGTTATTACCGTGATTTGATATATACTTATTCTGGTCTGTTTTGTGTGGCTATAAAC
CCATATAAAAGAATTCCCATTTACACCCCAAGTATCATGCAGAAATTCAAGGGTAAACGAAAGACTGAAATGCCCCCCCA
TGTGTTCTCGGTATCCGACAACGCATATAATAACATGTTGAGAGATCGGGAAAATCAGTCCATTCTTATTACCGGTGAGA
GTGGTGCTGGTAAAACAGAAAACACTAAAAAAGTCATTTCCTATTTTGCTCAGGTGGCAGCCAATTCAAAAGATGAAGAT
AAAAGCAAAGGATCCCTTGAAGATCAAATTGTACAAGCTAATCCGGTTTTAGAAGCATATGGTAATGCAAAAACAAATAG
AAATAACAATTCCTCAAGATTTGGTAAATTCGTTAGAATTCATTTTGGATAACGGCAAAATTGCCGGAGCTGACATTGAA
TACTATCTTTTGGAAAAATCAAGAGTTGTCTCACAACAAAAAGGAGAAAGAAATTATCATATTTTCTACCAAATATTGTC
TAACAGTGCCAAAAACCTCCATGAAAAATTATTGATAGAACCAAATGCCAGCATTTATTCATTTATTAATCAAGGTGAAC
TAACAATTGACGGGGTGAATGATTCAGATGAATTCGCTTTGACTGATGAAGCGTTCGATGTTTTGGGTTTCACCACTGAA
GAAAAAATGGGACTTTTTAGATGCACAACTGCTATCATGAATATGGGTGAAATGAAATTTAAACAGCGTCCTCGTGAGGA
GCAAGCAGAAGCTGATGGTACTTCAGAAGCTGAAAAAGTTGCATTCTTACTCGGAGTAAATGCTAAAGATTTACTACAAG
CATTTTTGAAGCCAAAAGTAAAAGTTGGTACTGAATATGTTACTAAAGGACAAACTAAAGACCAGGTCTTGTTTGCTCAA
GGAGCGTTAGCTAAATCCATATATAGTCGTATGTTTTCTTGGTTGGTGACCAGAGTTAATAAAACTCTTGATACGAAAGT
GAAAAGGCAATGCTTTATTGGTGTGTTGGATATTGCCGGTTTTGAAATCTTTGAATATAACGGATTTGAACAACTGTGCA
TTAACTACACAAATGAAAGACTCCAACAATTTTTCAATCATCATATGTTCGTATTGGAACAAGAAGAGTATAAGAAAGAA
GCGATTGACTGGGAGTTTATAGACTTCGGATTAGATTTACAAGCTTGCATTGAACTTATTGAAAGACCAATGGGTATTCT
GTCAATTCTTGAGGAAGAGTGTATGTTTCCTAAAGCAACCGATGAGACTTTTGTTGCAAAATTGTATGAAAATCATCTGG
GTAAAAGTCCTAACTTTGGAAAACCAAAACCAAATGGTCAAGCAACTGCCCATTTTGAGTTACATCATTACGCTGGCTCT
GTTGGATATTCAATTACTGGATGGTTGATAAAAAATAAAGATCCAGTCAATGACAGTGTTCTTCAAACTTTAGGAGCTAG
TAAAGAAGCTCTTGTTGCTCAACTTTTTGCTCCTGCGGATGATGATGCTACTGGAAAGAAAAGGAAAGGAGGCAGCTTCT
TAACAGTATCGTTTGTTCACAGAGAATCTTTGAATAAACTTATGAAGAATTTACAAAGCACTAGTCCACATTTCATTAGA
TGTATTATTCCCAATGAATTAAAACAATCTGGATTCATTGACTCCCACTTAGTCCTACATCAACTTCATTGTAATGGTGT
GTTAGAAGGTATAAGAATATGTAGAAAAGGATTTCCAAATAGACTTATTTATTCTGAATTTAAACAAAG
>SMED30025388 ID=SMED30025388|Name=Myosin heavy chain|organism=Schmidtea mediterranea sexual|type=transcript|length=6089bp
TTTTTTTTCGAGTTTGTGCTAGAAATTAATTTCAGTTTGAAATTTTTTGCCTATTTCGAGTTCTTTGAAAACAATCTGAA
AACATGAACCCATCTGATCCCGATTTTCAATATCTCGGTGTCGACCGAAAAGCTTTAATGAAGCAGTATGGGGATTCCTT
TGACAGCAAGAAAAACTGTTGGATTCCTGACGAGAAAGAAGCCTTCATTGCGGCGACAATTGAAGATGCGTCTGGAGATG
TCTATACGGTCAAAACCGATAAAAGTGAAACCAAGACTGTTAAAAAGGACGAAATCGAACAAATGAATCCACCGAAATTT
TTGATGATTGAAGACATGGCAAATTTAACCTTTCTAAACGATGCCAGCGTTCTTGATAATTTAAGACAAAGATATTACAA
GAATCTGATTTATACCTACTCTGGACTGTTTTGTGTGACAATAAATCCATACAAAAGATTTCCAATTTACACCCCGCAGG
TGATTTCAAAATACAAAGGTAAACGACGAACTGAAATGCCTCCACATATTTTCTCGATATCCGACAATGCTTACACCAAC
ATGTTGGCGGACCGAGATAATCAATCTGTCTTAATTACTGGTGAAAGTGGAGCTGGGAAAACTGAAAATACAAAAAAAGT
TATCACTTATTTTGCACACGTTGCAGCTGCTACTAAAAAAGAAGAGGATGATACTGGAACTGGTCAAAAGAGAAAGGGAA
CATTGGAAGACCAAATCGTGCAAGCAAATCCTGTTTTAGAAGCATACGGTAACGCAAAAACTGTGCGAAACAACAATTCA
TCCAGATTTGGTAAATTCATTCGTATTCATTTCGGTACAAGTGGAAAAATAGCTGGAGCTGATATTGAATTTTACTTACT
CGAAAAATCGAGAGTAAATTCTCAACAGAAAGGTGAAAGAAACTATCACATTTTCTATCAAATTTTATCGAACGGAGGAA
AACCATTTCATGAAAAATTACTCATCTCTCCTGATCCAGCTTTGTATTCCTTCATTAATCAAGGTGAATTAACAATCGAT
GGAGTCGACGATGAAGAAGAAATGAAAATAACTGATGAAGCTTTCGACATTTTGGGATTTTCTGCCGAAGAAAAAATGAG
CTTGTTCAAGTGTACTTGCTCAATTTTAAACATGGGCGAAATGAAATTTAAACAAAGGCCAAGAGAAGAACAAGCCGAAG
CCGACGGTACTGCTGAAGCTGAGAAAGTGGCTTTTCTGTTGGGTGTCAATGCAAAAGATTTAATGCAATCGATTCTGAAA
CCGAAAGTTAAAGTTGGTAATGAATATGTCACAAAGGGGCAGAATAAAGATCAAGTTCTTTATTCGGTTGGTGCGCTAGC
AAAATCTCTTTACAACAGAATGTTTGCGTGGTTGGTTTTGAGAGTTAACAAAACCCTCGACACTAAAGTCAAGCGACAAT
TTTTCATCGGTGTTTTGGATATTGCCGGTTTCGAAATTTTCAATTTCAATGGATTTGAACAAATTTGTATTAATTACACC
AATGAAAGATTGCAGCAATTTTTTAACCATCACATGTTCGTGTTGGAACAGGAAGAGTACAAGAAGGAAGCGATCGATTG
GGAGTTCATTGATTTTGGAATGGATCTTCAAGCGTGCATTGAGCTCATTGAAAAGCCAATGGGTATTCTGTCAATCTTAG
AAGAAGAGTGCATGTTTCCGAAAGCATCTGATATGACATTTAAAGCAAAATTGTATGATAATCATCTCGGAAAAAGTCCC
AATTTTGGAAAGCCAAAACCTCCAAAACCCGGACAGGCTGAAGCTCACTTCGAATTGCATCACTATGCTGGCAGTGTGCC
ATACAATGTTACTGGTTGGCTGGAAAAGAATAAAGATCCTCTCAACGAAACTGTGATAAATCTACTTGCGGCAAGTAAAG
AGGCATTAGTTTCGAGTTTGTTTGCTCCGGCTGAAGATCCAAATAATACGGGTAAACGGAAAAAGGGTGGGGCCATGCAG
ACCATTTCTTCAACTCATAGGGAATCCTTGAATAAATTGATGAAAAATTTACAAAGTACCAGTCCACATTTTATCCGATG
CATTGTTCCAAACGAATTCAAACAACCTGGTGTAATCGACGCTCATTTGGTATTACATCAATTGCATTGTAACGGTGTCC
TTGAAGGCATCAGAATCTGTCGAAAGGGTTTCCCAAACAGAATGATTTATTCTGAATTTAAACAAAGATATTCTATCTTG
GCTCCAAATGCAATTCCACAGGGATTTGTTGAAGGCAAACAAGTAACGAGCAAAATTCTGGAAGCTGTTCAATTGGACAC
CAATCTTTACCGCCTGGGAAATACTAAGGTATTTTTCAAAGCTGGAACTTTGGCTGATTTAGAAGACATGCGTGATGAAA
AATTATCTTCACTGATTTCATTGTTTCAAGCTCAAATACGCGGATATTTGATGCGAAGACAATATAAAAAATTACAAGAT
CAGAGAGTTGCTCTATCTATCATTCAAAGAAATATTCGTAAATATCTTCTTCTGAGAACATGGCCATGGTGGAAATTGTA
TACCAAAGTTAAGCCACTTTTGAACATTGCTCGTCAAGAGGAAGAAATGAAAAAGGCCGCTGAAGAATTGACAAAATTAA
AGGAAGAATTCGAAAAAGTTGACAAATTCAAAAAAGAACTTGAAGAACAAAACGTCAAATTGTTGGAAGCTAAAAACGAT
TTGTTCTTACAATTACAAACCGAACAAGACAGTTTAGCCGATGCCGAGGAAAAGGTTTCAAAATTGGTTATGCAAAAAGC
CGATATGGAAGGAAGAATTAAAGAATTGGAAGATCACCTTCTAGAAGAAGAAGATAATGCTGCTGGACTGGAAGATATCA
AGAAGAAAATGCAGGGTGAGATTGAAGAGTTGAAAAAAGATGTTGTCGATTTGGAATCTTCATTACAAAAGGCTGAACAA
GAGAAAACCGCGAAAGATCAACAGATAAAATCGTTACAAGATCAAATGGCAAAACAAGAAGAAGAGATGAACAAATTGAA
AAAGGAGAAAAAGGCCGCCGATGAAGTGCAAAAGAAAACCGAAGAATCTCTACTAGCGGAAGAAGAGAAAGTCAAAAATC
TAAACAAAGCTAAAGCCAAATTGGAACAGACCATTGATGAGATGGAAGAAAACCTCTCGCGAGAACAGAAAATCCGAGCT
GACGTAGAAAAAGTTAAACGAAAAATCGAAACTGAACTGAAACAAACTCAAGAGACCGTAGACGATTTGGAAAGAGTAAA
ACGAGAATTAGAGGAACAATTGAAGCGCAAGGAAATGGAATTAGTCAATGCTTCATCGAAAATTGAAGACGAATCGGGAT
TAGTTGCCCAGCTTCAGAGGAAAATCAAAGAACTTCAAGCTCGAATTCAAGAATTGGAAGAAGATCTGGAAGCAGAAAGA
CAAGCCCGTGCAAAAGCAGAGAAAAGCCGACATCAACTCGAAGGCGAGTTGGAAGAATTGAGTGATCGACTGGAAGAACA
AGGAGGCGCAACCTCAGCTCAAATGGATCTCAATAAGAAGCGAGAGGCAGAATTAATGAAATTAAAGAGAGATTTAGAAG
AATCGAATATGCAACACGATCAGGTTATCGCACAAGCTCGAAAGAAGCAACAGGATGTTGTCAATGAATTCTCAGAACAG
CTCGATCAACTGCAGAAAGTCAAAGCTAAAGTTGAAAAAGAAAAGAATGAGATGAAAGAAGATTTAAATGACCTACAAGG
ACAGCTGGAATCATTAAATAAAGCCAAGGCTAACAGCGACAAACGAATCAAAGAAATCGAAGCTCAAAATTCCGAATTAC
AGGGCAAATTGGAAGAGGCAAATAGACATATCAATGATGCCAACAATACATCTGGAAAGAATCAACAAACCAATGCGGAA
CTCCAAGCACGTTTAGAAGAAGCCGAATCGCAAATCAATCAGCTGGGTAAAGTCAAGCAACAAATGCAGACTCAACTCGA
AGAAGCCAGGCAAATCGCTGAGGAAGAGTCGAGAGCAAAGGCTAAATTGAGTTCTGATGTTCGCAATCTCAATGCCGATT
TAGACAATCTCAGGGAGGCACTGGAAGAGGAAAATGAGAACAAAAGTGACATACAGAGACAGCTAGTTAAAGCTCAGGGA
GAAATGCAACAATTGAAGGCTAAATTCGAAGGCTCGGGATCCATTCGTTCAGAAGAGTTGGATGAAGCCAAGCGAAAGTT
TATGACACGAATCCATGAGCTGGAAGAGGAAGCTGAAACCGCCAAATCGAAAGCCGGACAACTAGAAAAAGTTAAAGCTC
GACTCCAAGGAGAAATCGAAGATATGCTGGTCGACGTTGACAGAGCGAATACACTCGCATCTCAGTTGGAAAAGAAGCAG
AAAACATTCGATAAAGTCGTGTCAGAATGGCAGCAGAAATATGCTGAATCTCAGGCGGAATTGGAAGCATCCCAGAGAGA
AAGCAGGACGATTTCAGCTGAGGTGTTTCGAATGAAAGCACAAATCGAAGAAAGTCAAGAGCAGTTGGAAAGCGTTAAAC
GGGAAAACAAAAATCTAGCAGATGAAATCCACGATTTGACAGAGCAAATCGGAGAAGGAGGTCGCAGTGTTCACGAAATC
GACAAAGCAAGGAAACGATTGGAAATGGAAAAGGAAGAATTGCAACATGCGTTAGAAGAAGCCGAACAAGCTTTGGAACA
GGAAGAAGCCAAGTCTCAACGATCACAACTGGAAATGAGCCAGATCAGACAAGAAATCGACAGGCGATTGGCTGAGAAGG
AAGAGGAATTCGAGGCCACTCGAGTCAATCATCAAAGAGCAATGGAGTCAATGGAAGCCTCACTTGAAGCCGAATCCAGA
GGCAGGGCTGAAGCAACGAAGATGAAAAAGAAACTGGAGCACGATATCGGTGAACTGGAAGTTGCAGTGGATACCGCCAA
CAGAATCCGATCGGAGCAAGAAAAGAACGCAAAGAAATTCCAGCAGCAAGTTCAAGAATTGCTATCAATGGTGGAGGATG
AGAAACACCAGAAGGATCAGATACGAGAGCAAACGACGATGACAGAAAGGAAATTGACAATGGTCCTGGCAGAGCTTGAG
GAGGTTCGTGGCTCATTGGAAAATTCCGAGAGAAACAGGAAAAATACCGAGAATGAGAAAATGGAAATAACTGATCGATT
GAATGAGTTGAGTGTCCAGAGCTCCGGTTTCATGGCTACCAAGCGGAAATTGGAAGCTGATTTGGCTGCTATGCAGTCCG
ATTTAGAGGAGGCCGCTACTGAAGCCCGACAAGCCAATGAACAAGCCAAGAAGGCTGTTGCTGACAGTGCGAGATTGTTT
GATGAAATCCGGCAAGAGCAGGAACACGCACAGCAAATCGATAAGATCAAGAAACAACTCGAGGCCCAAAATAAAGAATT
GCAAGCCAAATTAGATGAATCGGAGAATAATGCTTTGAAAGGTGGCAAAAAAGCCTTGAGCAAACTAGAGCAACGCGTTC
GTGAACTTGAAGCCGAATTAGACGGAGAACAAAAAAGACACGTTGAAAGTCAAAAGAACTCCAGAAAAGTTGAAAGACGG
CTTAAGGAGCTTGGATTACAAACCGACGAAGATAAGAAGAACCAAGAAAGATTGCAAGATCTGGTGGAGAAGCTTCAAGG
TAAAATCAAAACCTACAAACGCCAGGTGGAAGAGGCGGAAGAAATTGCTGCTGTAAACTTAGCAAAATACAGAAAGATCC
AACAGGAAATCGAAGATTCCGAAGAAAGAGCTGATCAAGCTGAACAAGCGTTGCAGAAGCTGAGGACCAAAAACCGCAGC
TCCGTTTCGACAGCGAGAGGCGGTAGCATGGCTCCCGGCATGACCACAGTGAAATCGACATCACTCTCTGTTTCGGCTTC
GAGCCGACGACAAGGTTCTAGTGTTTCCAGAGAGAGCTAAGTCAGAAATTCTAGTAACACAACGATAAATTATTAGGATT
TACTTAATTGACATTATTTGCATGTTATCAATTATTGGACACAATTTAGTGATGCTTTTATTTAATAAAATTTACATTTT
GAAAAAAAA

 

back to top