muscle cell

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ In Situ Hybridization Data

  ▻ Sequences

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  muscle cell


DEFINITON:

  A mature contractile cell, commonly known as a myocyte. This cell has as part of its cytoplasm myofibrils organized in various patterns.


TERM DEFINITION CITATIONS:

  CL:0000187


TERM CITATIONS:


TERM ID:

  PLANA:0000101


ABOUT THIS TERM:

muscle cell

  ↳is a electrically responsive cell




DEPICTED BY:


BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30025388Myosin heavy chainDj-mhcStage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, musculature system, muscle cell, embryonic pharynx
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 ┬Ám

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30022992 ID=SMED30022992|Name=Myosin heavy chain|organism=Schmidtea mediterranea sexual|type=transcript|length=6157bp
ATATATATGCATCTCAAAATTGGAAATTAAATTATTAATTTTAATTTACTAACAAATTTTTGTTGTAAAATGGAAAATAT
TGATGCTAAAGACTTGCAATATTTACAAGTTGATAAAAGTTTAGTTTCTGACTCTGCTAATTTGTCTGATTGGGCTAACA
AAAAATTGGTTTGGATACCTGACGACAATGAAGGATTTATTTCAGGATCACTTATAGAAGAAAAAGGCGATGAAGCTACT
GTCAAACTGGAAAATGGCAAAACAATGAAATTACCAATTGAAAATGTTCAAAAAGTGAATCCACCAAAATTTTTTAAATC
TGAAGATATGGCAGATTTAACTTATTTGAATGAAGCATCAGTTCTATATAATTTAAAAGACAGATATTTTTCAGACTTAA
TATATACATATTCCGGATTATTTTGTGTCGTTGTAAATCCATACAAGCGCTTGCCTATTTATACAAATAATGTAATTGAG
TGGTACAAAGGTCGAAAACGTCACGAAAGACCGCCACATATTTACGCAGTTACTGATGTCGCATATCGAAATATGCTCCA
AGATAAAGAAAATCAATCAATTCTTTGCACTGGTGAATCCGGAGCAGGAAAAACTGAAAATACGAAAAAAGTTATTCAAT
ATTTGGCCTCAGTTGCAACTTCTTTGAAAAATCAAAAAACCACAGCCAGTAATGCATTGTCACAATTTTATGCTCACGAT
GTTAACATTGGAGAATTGGAGACCCAATTACTTCAGGCCAATCCGGTTTTAGAAGCTTTTGGAAATGCAAAGACTATCAA
AAACGATAATTCATCTCGTTTTGGTAAATTTATTCGAATCAATTTTGACACTTCTGGATTCATTTCCAGTGCAAACATAG
AAACATATTTATTGGAAAAAGCTAGAGTTATTAGACAGGCAGCTAATGAACGGTGCTTTCACGTGTTTTATCAGCTTCTT
CTTGGTGCAGACGACCGATTGAAAAAGGAATTAATCTTAGAAAATGTTTCTACATACAAACTTTTATCCAACGGCATGAT
AGCTGTACCAGATTACGATGAAAAGCAAATGTTTAAAGATACAGTCGAAGCTCTCGATATAATGGGGATTTCGAAAGACG
AACAAGAATCTATTTTCCGAGTTATAGCCGCAGTTTTACACATGGGAAATATCGAATTCAAACAAGAAAGAAGTTCGGAT
CAGGCTGCTTTACCAGACAATACAGTTGCTCAAAAGGTTGCTCATCTTCTCGGTTTACCGGTCACAGAAATGACCAAAGC
ACTGCTGAAACCAAAATTGAAAATTGGAAGAGAAGTTGTAGCAAAAGCTCAAACTAAAGAACAAGCCGAATTTTCCGTTG
AAGCTATAAGCAAATCAACATATGAAAGAATGTTTCGATGGCTGGTAATGAGAATAAATAGATCAATTGACAGAAATAGA
CAAAAAACTAATTTCATTGGCATTCTTGATATTGCTGGCTTTGAAATATTTGAAATAAACTCTTTTGAACAATTGTGTAT
AAACTATACCAACGAGAAATTGCAACAGCTTTTCAATCATACAATGTTTGTGCTAGAACAAGAAGAATACAGAAAAGAAA
ATATCAAATGGGAATTCATTGACTTTGGTCTTGATTTGCAGCCAACTATCGAACTAATTGAAAAGCCAATGGGTATTCTT
TCTTTGTTAGATGAAGAGTGCTTTTTCCCAAAAGCTACCACAAAGACATTTGTTGAAAAATTAATTAAAAACCAATCGAC
GCACCCTAAATTGAAAGCTACTGATTTTAGAGCAAAAGCAGATTTTGGGGTTATTCATTACGCGGGAAAAGTTGATTATG
TCTCCGATAATTGGCTGGTGAAAAATATGGATCCTCTTAATGAGAACGTTGTTAGTCTCTTACAAGAATCAAATGAAAGT
TTTGTCCAGACAATTTGGAAAGATGCAGAAAACATTATTGGCTTATCAACTACTACCGCCCAAGAATCTGCCTTTGGAGG
TGCAAAAACTACTCGCAAAGGAATGTTTAGAACCGTCGGTCAGCTTTACAAAGAATCATTAACGAAATTGATGGATGTTC
TGAATAATACCAATCCCAATTTTGTGAGATGTATCATTCCCAATCATGAAAAAAAATCTGGTAAAATCGATTCAAAATTG
GTTATTGATCAATTAAAATGTAATGGTGTGCTGGAGGGTATCAGAATATGCCGACAAGGATTTCCAAACCGAATTTTATT
CCAAGAGTTCAAACAACGTTATGGAATTCTTACACCAAATGTCATACTAAAAGGTTTTATGGACGGTCGAAAAGCAACAG
AATTAATGCTTGGAGAGTTGGATATTGATGCATCAAATTACAGAATTGGTCAGAGTAAAATATTTTTCAAAGCTGGAGTT
TTGGCTAGATTAGAGGAAGATCGAGATATTAAGTTGACTGAAATCATAGTCAAATTTCAATCTTATGCACGTGGATATTT
GGCAAGAAAAAATTTACAAAATCGATCGCAAAATCTCAATGCAATTAAAATTATTCAAAGAAATTGTAATGCATACTTAA
AATTGAGAAATTGGGCCTGGTGGAAATTATTCACACGTGTTAAGCCTCTATTAAGTGTTACAAGGCAAGAGGAAGTTGTG
GCTTTGAAGGAAGAAGAATTGAAAAAATCAAAAGAAACTCTCGAAAAGATGACTGCTGATTTCGAAACAACTAAGAAAAA
TTATGAATTTCTCATGGAAGAAAAAAATAAAATTCAGGAAGATTTGGAAAAGGAGCGTTTTGCATTGCAAGATATGGAAG
GGGAAAGAGAAAATTTGATCAAGCGATTAAAAGATATTGAATCAGATGCTCAAGAATGCGAGTCAAGAGAGATGGAAACA
AAAGACAAATGCAATAAATTGGAAATCGAGAAAAATAAATTACAAAATGAAATTTCACAGCTTAGCCAAAATTTAGAATC
AGAGGAACAGAACTTGCAAAAAGCTCAAGCAGACAAATTAAGTGCTGATAAACGAATTAAGGAACTGGAACAAAAAGTGG
CCGAATTAGAAGATAAACTTAACAAGTTAACTAAAGAGAAAAAGTCTCTAGAAGAGCGATTGGCTGATGTTATGTCTACT
TTGGCGGAAGAAGAAGAAAAGAGTAAACAATTAACGAAACTCAAATCCCGTCACGAAACAAGTATCACTGAATTAGAAGA
GAGATTGAGCAGAGAACAAGCAGCTCGACAAGATTTAGAAAAAACAAAGAGACGACTAGAAACTGAATTGTCTGAAAAAT
CTGATAATTTATCATCTCAAAGCCATACATATGAAGAAATTAGAATTACTCTTGAACGAGCAGAAACACAAATAATTCAA
ATGCAAGCTAAATTAGATGAAGAAACAACGGCAAAATCGTTGGCTCAGAGACAAATTCGAGACGCAGAAAACGTAATCAC
CGAAATCAAAGAAGATCTTGAAGCTGAAAAACGTTCAAAAGAGAGAGCTGAAAAAGCTAAGAGAGATTTAGCCGAAGAAA
TAGAATCTCTTAAAATGGAATTACTCGATACGGGAAATACATCAGAAGAACAGCAAAGCGTATTGCGCAAAAAAGAAGTT
GAATTACAAAATTTTAAAAAATCTTTTGAAGATGAAACAAAACGAACTGAACTTGAAATGCAAGAAATTCGTAAAAAAGC
CGCAGTAACGATTGAAAACCTCAACAATCAAATAGAAGCTGCTAACAAATCAAAACTTGTTGTTGAAAAGGCTAAATTAC
AGTTGCAAGAAGAACTTAATGATGCAAATAACGAATTAGCAAATTTAAGATCCTCCAAAGCTGACTCTGAAAAACTTAAG
AAGAACACAGAACTACAACTTTCAGAAATATCTCATCGCCTTTCAGAATCTGAAGAACACAAGCTAGATGCTGAATCAAA
ACTTAAAAAACAAACCGAGTTGGCTGACAAATTGGCTATGAATCTCGAAGAAATTGAAAGCAAATTGTCGCAATTAACTA
AATCTGAATTATCAGTTCGAAGTCAGTTAGCAGATTTACAAAAGGACTTTGAAGAAGAAACTCGATTAAAATTGAATGCT
CAAACTACATTAAGGCAGTTAGAAAGTCAATTTGCTTTATTAAAAGATCAATTAGAAGAGGAGCAACAATCAAAAGAAAA
TTTAGAAAGTCACGTACAAGCTCTACAGAGTCAAATGCAAGATGTCAAAAAGAAAGTTGAAGAAGATGCTCAACAGCTAT
TAGAATTTGATGAATCTCGTAAAAAAGTAATGCGTGAACGAGAAGAATTGCAGATTAGACTTGAAGAAGCAATCAATCAG
ACTGAAAGATCAGAAAAAGCTAAGCGAACAATTCAAGCCGAGCTTCAAGATGCATATCATGCCCTAGAAAGTCAGAAAAA
TGACCAAACTCAAAGTGATCGAAAACTTAAAAAAATGGAATCACAAGTCAATGAAACATTGAACTTGAATAAAAAATATT
TAGCTGAAAAGGATACATTAGAAAAAGAAAATCGTGAAAAAGAAACAAAAATCATGCAATTACAGAGAGAAATGAATGCA
AATGACGATAAACTTTCGGAATTGGAAAATGCAAAATCCTTACTGACTCGGCAATTGAATGAATTGGTTTCGAGCAAAGA
TGATGTTGGTAAAAATGTTGGCAGTTTAGAAAAGGCTAAAATTCAATTAGAAACCGATTTAGAGAATTGTAAAGTTACTA
TTGAAGAATTAGAAGAAGAAAATGCAACTCTTCAAATGAATAAAGAACGAGTTGAAATGCAATTAACTGCTACTAAAGCC
CAACTGGATAGGGAGCTAGCTTCCAAAGATGAAATGCACGATGAACAGTTCAGAATTATAAACAAAAAGCTTCGTGATGC
AGAAGCGGCACTTGAAGAAGAGCAGAAATCCAAAACAGCTATGGTTTCATTGAAAAAGAAAATAGAAAATGAGAACATGG
ATTTATTAAATCAATTAACAGAATCTGAGAAGGTCAAAGAAGAGCTGGCCAGACAGATTAAAAAATACCAAGGAAATTCT
AGCAATCTTCAAAGAGAAATGCAAGAACTTGTTGCTGCTAAAAATGATTATTTGAAGCAGATTAAAGAACTAGAAAAGCG
CTTACGTACTTCTGAAAGCAATGTAAACCAATTATCCGAAGACCTTTCGCAGTCTGAACGTGCTAAGAGAACCATTGCAT
CTGAAAGAGATGAAGCTTTAGAAGAAATTGCCACAATCACTATGGCTAGGGATACAGCTATTGCAGATAAAAAACGTATT
GAGAGTAGCATTTCAGCATTAAGCATGGATAATGAAGAATTGCAATTACTTTTGTCAGAATTAGAAGACAAAAATAAGAA
AATTATTTCTCAGTTAGAACAAGTTCAAAATGAATTAAATGTTGAACGACAAAATATAAGTAGATTAGAAAATCAAAAAT
CAACTGCCGAAAGACTGAATAAAGAATTGCATGATAAAATTGAAGAATTGGAAATGGAAGCTGGTAAAAAATATAAAGCT
ACAGTTGCTGCTCAACAAAGTAAAATCCAAAGTCTTGATTCTCAGCTGGACGCTAAAATTGAGGAAATAAACCAAGCTAA
TAGAAATAACAAGAAACTAGAAAGAAAGTTGAAAGAAATTATGGCTCTTATGGCTGATGAAACAAAGCGGGCTGACAATG
CAATCGAACAGATTGAAAAAGCCACTGGCAGATTTAAAAAAGCAGAGAGAAGTTTACAGATGGAACAAGAAAACAATTCT
GCTCTAAGTACACAAAATCGCCGATTACAACGAGATTTGGAAGAAGTAAATGAAACCAAAGAAGCACGGGACCAAGAAAT
TAAAATTCTTAAAACCAAAATCGACAGATTGGAAAAAAGAACACGCGCTGGGGGTCGACCTCTTAGAGGAGACGGTGGAT
CTGATGATGGGTTATCTGGAGATGGAGAATCCGTAACTGATTCTGCTTTAAAATCTGTTCAAGAAGACTAATTCAATAAG
TCCTAAAATGAACAATAAATTCTTGAATAATTAGTTAATACAAAAATTTTTGAATAATTTATATTTGGACTAACTTTTAA
TTCCTATTTGGTTTGCTCAATATATAATTGTTTTGATATATTTAATATTTCTATTTTATCAATTTGTGTACTTGGGG
>SMED30020435 ID=SMED30020435|Name=Myosin heavy chain|organism=Schmidtea mediterranea sexual|type=transcript|length=3615bp
TCTGAATTTAAACAAAGATATTCAATTTTGGCCGCAGATGTAATAGGGCAAGGATTTATTGATGGAAAACAGTGTACTGC
AAAGATAATGGAAGCAATCCAATTAGATAAAAACAACTACAGGCTTGGATCAACTAAAATCTTTTTCAAGGCCGGAGTAC
TTGCTCAGTTAGAAGACATGCGAGATGAGAAATTATCATCCATTTTGTCTGTATTCCAAGCACAGATGAGAGGATATATA
ATGAGAAAAGCATATAAGACATTGCAAGATCAACGAATTGCTCTTTCTCTCATTCAAAGAAACATCAGAAAATATTTATT
ACTAAAAACATGGCCATGGTGGAGACTATACACTAAAGTCAAACCACTCCTCAATATCGCAAGACAAGAAGAGGAGATGA
AGAAAGCTGCTGAAGAGTTGATTAAATTGAAAGAAGAATATGAAAAGATAGAAAAATTTAAAAAGGAATTGGAAGGTCAA
AATGTGGTTTTGCTTGAGCAGAAAAATGATTTATTTTTACAACTGCAAACAGAACAAGACAATCTTAGTGACGCTGAAGA
AAAGATTCAAAAGATGATCAATCAAAGAGTTGAAATGGAGAACCAATTTAAAGAATTAGAAGATAAATTAATGGATTCGG
AAGACATTCAAGATGAATTGGAAATCGAAAAAAAGAAATTGTTGTTGGATATGGATGAATTGAAATCGGACATTGACGAA
CTTGAAGTATCTTTAGAAAAGTCTGAACAAGAAAAACAAGCTCGCGATCAACAAATTAATAATTTGAAAGAAGAAATTCA
AAAACAAGATACTTCTATCGGAAAAGTTCAAAAGGAGAAAAAGACTCTAGAAGATAACTTAAATCAGACCAGAGAAGCTT
TAAATGCTGAAGAAGACAAGGTCAATCAGTTGACTAAAATCAAATCAAAATTGGAATCTGAAATAGATGAAATGGAAGAA
GCTCTAGAACGGGAAAAGAAGATCCGTGGAGATGTTGAAAAACTTAAACGGAAATTAGAAGCTGATCTCAAATCAAGCCT
TGATAACTGTAATGAGTTGGAAAATATAAAGCAGGAGTTAGAAGAAAATATTCAGAGAAAGGACATTGAAATATCAAAAT
TAAATGTCAAATTGGAAGATGAATCTTCAATTGTCACTCAACTTCAACGAAAAATTAAGGAATTACAAACTGTTATACAA
GATCTTGAAGAAGATCTAGAAGGTGAGAGACAAGGTCGATCAAAATCTGAAAAAGCTCGACAGTTGGCTGAACAAGAACT
CGATGAACTAGCTGACAGACTTGAAGAGCAGGGAGGTGCTACTATGGCACAAGTGGAATTGGCCAAGAAACGAGAAACTG
AATTAATGAAACTTAAAAAAGAATTACAAGATACCAATTTACAGAATGAGCAAATACTCAATGGTTTGAAAAAGAAAAAC
CAAGAAATTACCAATGAATTCTCCGAGCAAGTCGATCAAATAAATAAATCTAAATCAAAAATCGAAAAAGAAAAGGCGAC
TCTTAAGCATGATCTGGATGAATTTGTTTCTCAATTAGAATCTGTTTCAAAGCTAAAGGCCAATACAGAAAAACATTCAA
AACATTTAGAAAGTCAAATTATGGAATTGGAAAACAAAATAGACGAACAGAATCATCAAATATCAGAAATGGTTTCACAG
TCTAATAAAGACTCTCAAGCAATAATGTCTTTAGAACAACAACTAGAACAAGCAGAAAATGAAAATCACCAATTGAGCAA
ATCCAAACAACAATTCCTCCAACAAATTAATGACTGTAAATCGACTCTTGAAGACGAAGAAAAAGTAAAGGCCAAACTTT
TCAATGAAATTCGTAATCTGAATGATGAAATGGGCAATTTAAGATCCAGTTTGGAAGAAGAGCAAGAATCCAAAAGTGAA
ATTCAAAGGTCACTAGCAAAATCCCAATCTGAACTTGTACAAATGAAAAATAAATTTGATAGTGAAGGTTCAGGTCGCAT
TGAAGAAGTTGAAGAAGCTAAACGTAAGTTGCAAACGAAACTTCAAGACATGGAACAAGAATTTGACGCTATTAAAAATA
AATGCGCGCAACTTGAAAAAATCAAAATTCGTCTCACTGGAGAAATCGAAGACATGAGTGTTGATGTTGACAGAGCTAAT
GCAGTGGCTAATCAACTAGAAAAGAAACAAAAGAACTTTGACAAAACCGTCAGTGAATGGCAGTCTAAATGCAACTGCCT
TCAAACTGAAGTTGATGTTGCAAATCAAGAATCAAGATTTTTGTCAACCGAAGTATTTAAATGTAAAAGCCAAAACGAAG
AATTGCTTTCACAAATCGAAAATCTTAAACGAGAAAATAAGTCTCTCAGTGATGAAATTCACGATTTAACGGAACAACTA
AGTGATGGCGGAAAATCTGTTCACGATATAGAAAAGGCAAAACGAAAATTGGAAATAGAAAAGGAAGAACTGGAACAAGC
TTTGGAAGAAGCTGAATCAACATTGGAAAATGAAGAAGCCAAATTACAAAGAGCTCAGTTAGAGTTGAGTCAGATGAAAT
CAGATGTAGAAAAACGATTGTGTGAAAAGGAGGAAGATTTTGAAGGAACTCGCCGTAATCATCAAAGAGCAATGGAATCA
ATGCAAGCTTCTTTGGAGGCAGAAATTAAAATTAAACAGGACTCAATTAAAGCCAAGAAGAAGTTAGAACAAGAAATCAG
TGAACTCGAAGCCAATTTAGATCAAATCCAAAGACTGAAATCAGATGCTGATAAGAACAATTCAAGAATGCAACAGCAAA
TTCATGATTTACATTCAGAGATTGAACAAGAACAACACAGTAAAAACGAAGTCCGAGAACATGCTCAGATGGCTGAAAAG
AGATTTTTATCGGCTAATGGAGAACTAGAAGATTTGCGAGCCAAATTTGAACAATCAGATAGAAATCGTAGAAATGCTGA
ATCTGAGCTTCAAGATTTGAGTGATAAATACAATGAAAGCCAAGCACTGATCACTTCACTTCAAAGTTCAAAAAGAAAAA
TGGAAATGGATTACGTAGCTATGCAGTCCGATCTTGATGATATGTCAAACCATGTTCAACAAGCTGAGGAAAGAGCAAAG
AAAGCAGCTGGTGACGCTGCCCATATGTCAGAACAACTTCATCAAGAACAAGACAATAGTTTGCACACGGATAAAATGAG
GAAGCAAATGGAAATTCAAATCAAAGAAATGCAGTGTAAACTAGAAGAAGCCGAAAGTAATGTTTTGTCAGGCGGCAAAA
AGACTTTGGCAAAGTTAGAGTCAAAAATACGAGAATTGGAAACTAATCTTGATAACGAAATGAGAAAACATGCTGAAACT
CAAAAGAATTATCGCAAAGTAGATAGACGAATGAAAGAACTAACATTACAATTGGAAGACGATAGAGCTCAACAAGAAAA
ATCAAATCAAGTTATTGAAAAATTCCAAGGACAAATCAAAACCCTTCGAAAACAATTAGAAGAATCAGAAGAAGTTGCCG
TTTTGAATATTGCCAAATTTAAGAAAGTACAATGTGATTTTGAAGAAGCCGAAGAAAGAGCGAATGAATCGGAACAAGCT
TTACAAAAATTAAGA
>SMED30016281 ID=SMED30016281|Name=Myosin heavy chain|organism=Schmidtea mediterranea sexual|type=transcript|length=5986bp
CTAAAATTTAGTTGATTTCGATTGTTTGAATAAAAATATCTAATGGACCCATCAGATCCTGATTTTATCTACTTGGGAGT
CGACAGGAAAGCTTTATTGAAGCAATATGGCGACTCGTTTGATAGTAAAAAGAACATGTGGATACCGGATGAAAAGGAGG
GGTACATCGCAATTACCGTTGAAGAAACAAATGGCGATAAAGTAACTGTTAAAACCGATAAAGGAGAAACTAAAGTCGTC
AAGCAAGACTCCTTGGAACAAATGAATCCCCCCAAATTCATGATGATTGAAGACATGGCGAATTTAACATTTCTCAATGA
TGCCAGTGTATTTGATAATCTGAGACAAAGATATTACAAAAATCTGATTTATACTTACTCCGGACTGTTCTGTATTGCAG
TGAATCCTTATCGAAGATTTCCGATTTATACGTCCCAAGTAATTATGAAATATAAAGGAAAACGTAGAGGAGAAATGCCA
CCGCATATTTTCTCAATTTCGGATAATGCTTACTCAAATATGCTTGTCGATCGAGAAAATCAGTCTGTTTTGATTACTGG
AGAAAGTGGTGCTGGGAAAACTGAAAACACGAAAAAAGTTATTACTTACTTCGCCAATGTAGCAGCAGCAAGTAAAAAAG
ATGATGACGATCCATCGAAGAAAAAAGGTTCATTGGAAGATCAAATTGTACAAGCCAATCCTGTACTGGAGGCATACGGA
AACGCCAAAACAACTAGAAATAATAATTCGTCAAGATTTGGAAAATTCATCCGAATTCATTTTGGCACTAGTGGAAAAAT
TGCAGGAGCTGATATTGAGTTTTATTTGTTGGAGAAATCTCGTGTTATCTCACAGCAAAAAGGAGAAAGAAATTACCATA
TTTTCTATCAATTGCTTTCGGCAGGAGGGAAAAGTTACCACGATAAACTTTTGGTTACTGCTGATCCTGCTCTGTTTTCT
TTTATCAACCAAGGAGAATTGACGATTGACGGTGTTGATGATGAGGAAGAAATGAAACTTACTGATGAAGCCTTTAGTAT
TCTTGGGTTTTCCGATGAAGAGAAAATGAGTTTGTTTAAATGCACTACTTCAATCATGAATATGGGAGAAATGAAATTTA
AACAAAGACCCCGTGAAGAACAAGCCGAGGCTGATGGTACAACAGAAGCTGAAAAAGTCTCTTTCTTACTTGGAGTGAAT
GCCAAAGATCTAATGCAAGCAATTCTTAAACCCAAAGTCAAAGTAGGAAACGAATATGTAACGAAAGGTCAAAGCAAAGA
TCAGGTTTTATATTCTCTTGGAGCCTTAGCAAAATCTTTATATAACAGAATGTTTGCTTGGTTGGTTACTCGCGTGAACA
AAACGCTGGACACAAAAGTCAAAAGACAGTTTTTCATTGGTGTCTTAGATATTGCCGGATTTGAAATATTTGATTTCAAT
GGTTTCGAACAAATTTGTATCAACTATACTAATGAGAGACTCCAACAATTTTTCAATCACCATATGTTTGTTCTTGAACA
AGAGGAATATAAAAAAGAGGCCATTGACTGGGAGTTCATAGATTTTGGAATGGATCTCCAAGCTTGCATTGAGTTGATTG
AAAAGCCTATGGGTATTTTGTCGATTTTAGAGGAAGAATGTATGTTTCCCAAAGCAAGCGATCAAACATTGAAAGCTAAA
TTGTACGATAATCACTTGGGTAAAAGTCCGAATTTCGGAAAACCAAAACCACCAAAACCAGGACAACACGAAGCCCATTT
CGAATTACATCATTATGCTGGCAGTGTTCCATATAATATTACTGGGTGGTTGGAGAAAAATAAGGATCCATTGAACGAAA
GTGTTGTTGGATTACTCGGAGCATCTAAAGAATGTCTAGTAGCTTCTTTATTTGCACCGGCTGAAGATACAGGAAAACCC
GGAACCAAGAAAAAGGGTGGATCCTTTATGACTGTGTCATATATGCACAGGGAATCATTGAATAAATTGATGAAAAATCT
AATGAGTACAAGTCCACATTTTATTCGTTGCATTGTCCCCAATGAATTCAAACAACCAGGAGTTGTTGATGCGCATTTGG
TTATGCACCAACTTCATTGCAACGGTGTATTGGAAGGTATTAGGATTTGCAGAAAAGGATTCCCAAATAGAATGATCTAT
TCTGAATTCAAACAAAGATATTCAATTTTGGCACCGAATGCCATTCCACAAGGATTTGTTGAAGGCAAACAGGTCACTGA
TAAAATCCTCACAGCCATTCAACTGGACACAAATCTTTATCGCTTAGGAAATACCAAAGTATTTTTTAAAGCTGGAACAT
TGGCTCAACTTGAAGATATAAGAGACGAGAAACTTTCGTCGTTGATATCGTTGTTTCAAGCTCAAATTAGGGGATATTTA
ATGAGACGGCAATACAAAAAACTTCAAGATCAAAGAGTTGCTCTGTCTTTGATTCAAAGAAATATTAGAAAATATTTGGT
TTTGAGAACATGGACCTGGTGGAAATTGTTCACTAAAGTAAAGCCTATGCTTAATATTGCTCGCCAAGAAGAAGAAATGA
AAAAGGCAGCCGAAGAATTAGAAAAGCTGAAAGAGGAATTTGAAAAAACTGAAAAATATAAGAAAGAACTTGAAGAACAA
AATGTTACTTTACTTCAAGCAAAGAACGATTTATTCTTGCAGTTGCAAACTGAACAAGATAGTTTAGCTGACGCTGAAGA
GAAAGTATCTAAATTAGTTCTACAAAAGGCTGACATGGAAGGAAGAATTAAAGAACTTGAGGACTCACTTTCAGAAGAAG
AAAATTCAGCTTCAACATTAGAAGAAGCAAAAAAGAAACTCAATGCTGACATCGATGAATTGAAGAAAGATGTTGAAGAT
TTGGAATCATCTTTACAAAAAGCAGAACAAGAAAAAGTTGCAAAGGATCAGCAGATTAAATCCCTCAACGACAATGTTCG
TGAAAAAGAAGAACAATTAGCCAAAATGCAAAAGGAAAAGAAAGCTGCTGATGAATTACAAAAAAAAACAGAAGAATCAT
TGAAAGCCGAAGAAGAGAAAGTCAGTAACCTCAATAAAGCTAAAGCTAAATTAGAACAAGCCCTGGATGAAATGGAAGAA
AATCTTGGTCGAGAACAAAAAATTAGAGCAGATGTTGAAAAAGCAAAACGAAAAGTTGAAGGTGAACTTAAACAGAATCA
AGAGTTATTAAATGACTTGGAGCGCATAAAATCCGAACTTGAGGAACAATTAAAACGAAAAGAAATTGAATTGAATGGTG
CTAACTCTAAAATCGAAGATGAATCTAATTTAGTTGCAACACTTCAACGGAAGATCAAAGAACTTCAAGCCAGAATCCAA
GAATTAGAAGAAGACCTTGAGGCGGAAAGACAAGCAAGGGCAAAAGCTGAGAAAGCTAAACATCAATTGGAAGCGGAACT
TGAGGAAATCAGTGAAAGACTAGAAGAACAAGGAGGTGCAACTCAAGCCCAAACAGATTTAAATAAAAAACGAGAAGCTG
AACTCATAAAATTAAAGCGAGACTTGGAAGAGGCTAATATGCAACACGAACAAGCCTTGGTGCAAATGAGAAAGAAACAA
CAAGATACTAGCAATGAATTCGCAGATCAGTTAGATCAATTGCAAAAATCAAAATCAAAGATTGAAAGAGAAAAGAGTGA
ACTTAGAGCAGACATTGAAGATTTATCAAGTCAGCTGGAATCACTGAATAAGACCAAGGGAAATCTTGAAAAGTCAAATA
AAGCATTAGAAACCACAGTTTCAGATCTTCAAAACAAACTCGATGAATTAAGCAGACAATTGACAGAAGCAGGAAACGTC
AACAATCGAAATCAACATGAAAATAGTGAAATGCACAAAACCTTAGAAGACGCCGAATCACAAATAAACCAACTCGGAAA
GGCTAAACAACAACTCCAAGCGCAGCTAGAAGAGGCTAAACAAAATTTGGAAGATGAATCACGCGCAAAAGCAAAACTTA
ATGGAGATTTAAGAAATGCGATGAGTGATTTAGATGCATTACGGGAATCATTGGAAGAAGAACAAGAAGGCAAAAGCGAT
GTTCAAAGACAGCTTGTGAAAGTCCAAAATGAATTACAGCAACTTAAAGCAAATTCTCAAGGTACTGGAGGAGTGAGAAC
AGAAGAAATGGAAGAATTCAGACGAAAGATGAATGCCAGAATCCAAGAACTAGAAGAAGAATCGGAATCAAATAAATCTA
AATGCAGTCAATTAGAAAAAATGAAATCCAGACTTCAAGGAGAAATTGAAGATTTAGTGATAGATGTTGAAAGAGCCAAT
GGATTAGCATCGCAACTGGAAAAGAAACAGAAAAATGTTGACAAATTAATAGGCGAATGGCAAAAAAAATATTCAGAAAG
TCAACAGGAACTAGAAGTATCACTGAGAGAATCAAGAACAGTTTCCGCTGAAGTTTTCAAATTGAAATCACAATTAGAAA
ATTCTCAAGATCAAATCGAAAGTTTAAGAAGAGAAAATAAAAATCTATCTGATGAAATTCATGACTTAACTGAACAATTG
GGAGAAGGAGGACGAAATGTACATGAAATTGAAAAGACTCGAAAAAGAATTGAAATTGAAAGAGATGAATTACAACATGC
ATTAGAAGAAGCTGAATCAGCTTTGGAACAAGAAGAAGCTAAAAGCCAAAGAGCTCAGTTAGAAATAAGTCAAGCCCGTC
AAGAATCTGAAAGAAGACTTGCAGAAAAAGAAGAAGAATTTGAAGGTACACGAAAAAATCATCAACGAACACTCGAATCC
ATGCAAGCATCTCTTGAAGCTGAAGTTAGAGGACGAACTGAAGCAATGAAAATGAAAAAGAAGCTGGAGCATGATATTAA
TGAGCTTGAAGTTGGGTTAGACACGGCTAATAGACTGAAATCTGAACAAGAGAAAAATGCTAAGAAATATCAGCAACAAT
TAGCAGAAATGCAAGCTCAAGTTGAAGAACAGCATCATCAACGAGAGCAAGTTAGTGAACAGCTTGCGTTAACAGAACGA
AAATTAGGTATGATGCACGGAGAGCTGGAGGAAATGAAAAATATGTGTGATCATGCTGAAAAAAATAGAAAAGTCGCTGA
ATCTGAAAAGAATGAAGCCATTGATAAACTAAATGAGTTTTCAATTCAAAATTCTTCATTCATGGCAACTAAAAGAAAGA
TGGAAGCAGATTTAGCAGCAATGCAAGCTGACTTAGAAGAATCTACAAATGCAGCTAGACAAGCTAATGAACAATTGAAA
AAGGCAATATTTGATAATACTCGACTTTTCGATGAAATTAAACAAGAACAAGAACATGCTCAACAAGCTGAAAAAGCAAG
AAAGAATTTGGAGAGCCAGTTGAAAGAATTGCAATCAAAACTTGAAGAAGCAGAAGCAAATGTACTTAAAGGAGGCAAAA
AGGCTTTGAGTAAATTAGAGCAAAGAATAAGGGAATTGGAAGGCGAACTAGATGGTGAACAAAAACGACATGTTGAAACT
CAAAAGAATGCTAGAAAGTCAGATAGGCGACTGAAAGAAATTTCGTACCAGATCGACGAGGATAAAAAGAATCAAGATCG
AATGCAACAACTTATTGAAAGTTTACAAGCAAAAATAAAGACTTATAAACGACAAGTAGAAGAAGCTGAAGAAATCGCTG
CTGTGAATTTGGCAAAATATCGCAAAATTCAACAAGAGATTGAAGATTCTGAAGAGCGAGCTGATCAAGCTGAACAAGCT
TTACAAAAATTAAGAGCAAAGAATAGAAGCTCGGTATCTGTTAGTCGAGGAGCAAGTTCTGGACCTGGAACCAAAATTTC
TATAACTGCGACATCAATCCGCAGTGAGGACTAATCTGACAGAAAAAATTCATCATTAGGAAATATGCAATTAGTTAGCC
AATATTTCCCTTAGACTAGATTTTAAACCTTTAAGACATTTTTTTCAAATTAATAAAACGTTTTGA
>SMED30024552 ID=SMED30024552|Name=Myosin heavy chain|organism=Schmidtea mediterranea sexual|type=transcript|length=2149bp
TCACTGGAGTTAATAAACGACAAATTAAGGAAAAATGAACATGAACGATCCAGAAATGCAATACTTGGCCATTGACCGCA
AAGAATTGCTGAAAAGTTTAGATGTTGGGACTTTTGACAGTAAGAAAAATTGCTGGGTCCCCGATGAGAAGGAAATGTTT
GTGGCGGCGGAAATTAAATCCTCCTTAGGAGGTATTTTAAAAGTTCAAACGAAAAATGGAGAAAATCGTGAAGTTAAAGA
AGACGATATTCAACAAATGAATCCACCGAAATTCGAAATGATTGATGATATGGCTAATCTCACTTTTCTAAACGATGCTA
GTGTGTTACATAACCTAAAATCCCGTTATTACCGTGATTTGATATATACTTATTCTGGTCTGTTTTGTGTGGCTATAAAC
CCATATAAAAGAATTCCCATTTACACCCCAAGTATCATGCAGAAATTCAAGGGTAAACGAAAGACTGAAATGCCCCCCCA
TGTGTTCTCGGTATCCGACAACGCATATAATAACATGTTGAGAGATCGGGAAAATCAGTCCATTCTTATTACCGGTGAGA
GTGGTGCTGGTAAAACAGAAAACACTAAAAAAGTCATTTCCTATTTTGCTCAGGTGGCAGCCAATTCAAAAGATGAAGAT
AAAAGCAAAGGATCCCTTGAAGATCAAATTGTACAAGCTAATCCGGTTTTAGAAGCATATGGTAATGCAAAAACAAATAG
AAATAACAATTCCTCAAGATTTGGTAAATTCGTTAGAATTCATTTTGGATAACGGCAAAATTGCCGGAGCTGACATTGAA
TACTATCTTTTGGAAAAATCAAGAGTTGTCTCACAACAAAAAGGAGAAAGAAATTATCATATTTTCTACCAAATATTGTC
TAACAGTGCCAAAAACCTCCATGAAAAATTATTGATAGAACCAAATGCCAGCATTTATTCATTTATTAATCAAGGTGAAC
TAACAATTGACGGGGTGAATGATTCAGATGAATTCGCTTTGACTGATGAAGCGTTCGATGTTTTGGGTTTCACCACTGAA
GAAAAAATGGGACTTTTTAGATGCACAACTGCTATCATGAATATGGGTGAAATGAAATTTAAACAGCGTCCTCGTGAGGA
GCAAGCAGAAGCTGATGGTACTTCAGAAGCTGAAAAAGTTGCATTCTTACTCGGAGTAAATGCTAAAGATTTACTACAAG
CATTTTTGAAGCCAAAAGTAAAAGTTGGTACTGAATATGTTACTAAAGGACAAACTAAAGACCAGGTCTTGTTTGCTCAA
GGAGCGTTAGCTAAATCCATATATAGTCGTATGTTTTCTTGGTTGGTGACCAGAGTTAATAAAACTCTTGATACGAAAGT
GAAAAGGCAATGCTTTATTGGTGTGTTGGATATTGCCGGTTTTGAAATCTTTGAATATAACGGATTTGAACAACTGTGCA
TTAACTACACAAATGAAAGACTCCAACAATTTTTCAATCATCATATGTTCGTATTGGAACAAGAAGAGTATAAGAAAGAA
GCGATTGACTGGGAGTTTATAGACTTCGGATTAGATTTACAAGCTTGCATTGAACTTATTGAAAGACCAATGGGTATTCT
GTCAATTCTTGAGGAAGAGTGTATGTTTCCTAAAGCAACCGATGAGACTTTTGTTGCAAAATTGTATGAAAATCATCTGG
GTAAAAGTCCTAACTTTGGAAAACCAAAACCAAATGGTCAAGCAACTGCCCATTTTGAGTTACATCATTACGCTGGCTCT
GTTGGATATTCAATTACTGGATGGTTGATAAAAAATAAAGATCCAGTCAATGACAGTGTTCTTCAAACTTTAGGAGCTAG
TAAAGAAGCTCTTGTTGCTCAACTTTTTGCTCCTGCGGATGATGATGCTACTGGAAAGAAAAGGAAAGGAGGCAGCTTCT
TAACAGTATCGTTTGTTCACAGAGAATCTTTGAATAAACTTATGAAGAATTTACAAAGCACTAGTCCACATTTCATTAGA
TGTATTATTCCCAATGAATTAAAACAATCTGGATTCATTGACTCCCACTTAGTCCTACATCAACTTCATTGTAATGGTGT
GTTAGAAGGTATAAGAATATGTAGAAAAGGATTTCCAAATAGACTTATTTATTCTGAATTTAAACAAAG
>SMED30025388 ID=SMED30025388|Name=Myosin heavy chain|organism=Schmidtea mediterranea sexual|type=transcript|length=6089bp
TTTTTTTTCGAGTTTGTGCTAGAAATTAATTTCAGTTTGAAATTTTTTGCCTATTTCGAGTTCTTTGAAAACAATCTGAA
AACATGAACCCATCTGATCCCGATTTTCAATATCTCGGTGTCGACCGAAAAGCTTTAATGAAGCAGTATGGGGATTCCTT
TGACAGCAAGAAAAACTGTTGGATTCCTGACGAGAAAGAAGCCTTCATTGCGGCGACAATTGAAGATGCGTCTGGAGATG
TCTATACGGTCAAAACCGATAAAAGTGAAACCAAGACTGTTAAAAAGGACGAAATCGAACAAATGAATCCACCGAAATTT
TTGATGATTGAAGACATGGCAAATTTAACCTTTCTAAACGATGCCAGCGTTCTTGATAATTTAAGACAAAGATATTACAA
GAATCTGATTTATACCTACTCTGGACTGTTTTGTGTGACAATAAATCCATACAAAAGATTTCCAATTTACACCCCGCAGG
TGATTTCAAAATACAAAGGTAAACGACGAACTGAAATGCCTCCACATATTTTCTCGATATCCGACAATGCTTACACCAAC
ATGTTGGCGGACCGAGATAATCAATCTGTCTTAATTACTGGTGAAAGTGGAGCTGGGAAAACTGAAAATACAAAAAAAGT
TATCACTTATTTTGCACACGTTGCAGCTGCTACTAAAAAAGAAGAGGATGATACTGGAACTGGTCAAAAGAGAAAGGGAA
CATTGGAAGACCAAATCGTGCAAGCAAATCCTGTTTTAGAAGCATACGGTAACGCAAAAACTGTGCGAAACAACAATTCA
TCCAGATTTGGTAAATTCATTCGTATTCATTTCGGTACAAGTGGAAAAATAGCTGGAGCTGATATTGAATTTTACTTACT
CGAAAAATCGAGAGTAAATTCTCAACAGAAAGGTGAAAGAAACTATCACATTTTCTATCAAATTTTATCGAACGGAGGAA
AACCATTTCATGAAAAATTACTCATCTCTCCTGATCCAGCTTTGTATTCCTTCATTAATCAAGGTGAATTAACAATCGAT
GGAGTCGACGATGAAGAAGAAATGAAAATAACTGATGAAGCTTTCGACATTTTGGGATTTTCTGCCGAAGAAAAAATGAG
CTTGTTCAAGTGTACTTGCTCAATTTTAAACATGGGCGAAATGAAATTTAAACAAAGGCCAAGAGAAGAACAAGCCGAAG
CCGACGGTACTGCTGAAGCTGAGAAAGTGGCTTTTCTGTTGGGTGTCAATGCAAAAGATTTAATGCAATCGATTCTGAAA
CCGAAAGTTAAAGTTGGTAATGAATATGTCACAAAGGGGCAGAATAAAGATCAAGTTCTTTATTCGGTTGGTGCGCTAGC
AAAATCTCTTTACAACAGAATGTTTGCGTGGTTGGTTTTGAGAGTTAACAAAACCCTCGACACTAAAGTCAAGCGACAAT
TTTTCATCGGTGTTTTGGATATTGCCGGTTTCGAAATTTTCAATTTCAATGGATTTGAACAAATTTGTATTAATTACACC
AATGAAAGATTGCAGCAATTTTTTAACCATCACATGTTCGTGTTGGAACAGGAAGAGTACAAGAAGGAAGCGATCGATTG
GGAGTTCATTGATTTTGGAATGGATCTTCAAGCGTGCATTGAGCTCATTGAAAAGCCAATGGGTATTCTGTCAATCTTAG
AAGAAGAGTGCATGTTTCCGAAAGCATCTGATATGACATTTAAAGCAAAATTGTATGATAATCATCTCGGAAAAAGTCCC
AATTTTGGAAAGCCAAAACCTCCAAAACCCGGACAGGCTGAAGCTCACTTCGAATTGCATCACTATGCTGGCAGTGTGCC
ATACAATGTTACTGGTTGGCTGGAAAAGAATAAAGATCCTCTCAACGAAACTGTGATAAATCTACTTGCGGCAAGTAAAG
AGGCATTAGTTTCGAGTTTGTTTGCTCCGGCTGAAGATCCAAATAATACGGGTAAACGGAAAAAGGGTGGGGCCATGCAG
ACCATTTCTTCAACTCATAGGGAATCCTTGAATAAATTGATGAAAAATTTACAAAGTACCAGTCCACATTTTATCCGATG
CATTGTTCCAAACGAATTCAAACAACCTGGTGTAATCGACGCTCATTTGGTATTACATCAATTGCATTGTAACGGTGTCC
TTGAAGGCATCAGAATCTGTCGAAAGGGTTTCCCAAACAGAATGATTTATTCTGAATTTAAACAAAGATATTCTATCTTG
GCTCCAAATGCAATTCCACAGGGATTTGTTGAAGGCAAACAAGTAACGAGCAAAATTCTGGAAGCTGTTCAATTGGACAC
CAATCTTTACCGCCTGGGAAATACTAAGGTATTTTTCAAAGCTGGAACTTTGGCTGATTTAGAAGACATGCGTGATGAAA
AATTATCTTCACTGATTTCATTGTTTCAAGCTCAAATACGCGGATATTTGATGCGAAGACAATATAAAAAATTACAAGAT
CAGAGAGTTGCTCTATCTATCATTCAAAGAAATATTCGTAAATATCTTCTTCTGAGAACATGGCCATGGTGGAAATTGTA
TACCAAAGTTAAGCCACTTTTGAACATTGCTCGTCAAGAGGAAGAAATGAAAAAGGCCGCTGAAGAATTGACAAAATTAA
AGGAAGAATTCGAAAAAGTTGACAAATTCAAAAAAGAACTTGAAGAACAAAACGTCAAATTGTTGGAAGCTAAAAACGAT
TTGTTCTTACAATTACAAACCGAACAAGACAGTTTAGCCGATGCCGAGGAAAAGGTTTCAAAATTGGTTATGCAAAAAGC
CGATATGGAAGGAAGAATTAAAGAATTGGAAGATCACCTTCTAGAAGAAGAAGATAATGCTGCTGGACTGGAAGATATCA
AGAAGAAAATGCAGGGTGAGATTGAAGAGTTGAAAAAAGATGTTGTCGATTTGGAATCTTCATTACAAAAGGCTGAACAA
GAGAAAACCGCGAAAGATCAACAGATAAAATCGTTACAAGATCAAATGGCAAAACAAGAAGAAGAGATGAACAAATTGAA
AAAGGAGAAAAAGGCCGCCGATGAAGTGCAAAAGAAAACCGAAGAATCTCTACTAGCGGAAGAAGAGAAAGTCAAAAATC
TAAACAAAGCTAAAGCCAAATTGGAACAGACCATTGATGAGATGGAAGAAAACCTCTCGCGAGAACAGAAAATCCGAGCT
GACGTAGAAAAAGTTAAACGAAAAATCGAAACTGAACTGAAACAAACTCAAGAGACCGTAGACGATTTGGAAAGAGTAAA
ACGAGAATTAGAGGAACAATTGAAGCGCAAGGAAATGGAATTAGTCAATGCTTCATCGAAAATTGAAGACGAATCGGGAT
TAGTTGCCCAGCTTCAGAGGAAAATCAAAGAACTTCAAGCTCGAATTCAAGAATTGGAAGAAGATCTGGAAGCAGAAAGA
CAAGCCCGTGCAAAAGCAGAGAAAAGCCGACATCAACTCGAAGGCGAGTTGGAAGAATTGAGTGATCGACTGGAAGAACA
AGGAGGCGCAACCTCAGCTCAAATGGATCTCAATAAGAAGCGAGAGGCAGAATTAATGAAATTAAAGAGAGATTTAGAAG
AATCGAATATGCAACACGATCAGGTTATCGCACAAGCTCGAAAGAAGCAACAGGATGTTGTCAATGAATTCTCAGAACAG
CTCGATCAACTGCAGAAAGTCAAAGCTAAAGTTGAAAAAGAAAAGAATGAGATGAAAGAAGATTTAAATGACCTACAAGG
ACAGCTGGAATCATTAAATAAAGCCAAGGCTAACAGCGACAAACGAATCAAAGAAATCGAAGCTCAAAATTCCGAATTAC
AGGGCAAATTGGAAGAGGCAAATAGACATATCAATGATGCCAACAATACATCTGGAAAGAATCAACAAACCAATGCGGAA
CTCCAAGCACGTTTAGAAGAAGCCGAATCGCAAATCAATCAGCTGGGTAAAGTCAAGCAACAAATGCAGACTCAACTCGA
AGAAGCCAGGCAAATCGCTGAGGAAGAGTCGAGAGCAAAGGCTAAATTGAGTTCTGATGTTCGCAATCTCAATGCCGATT
TAGACAATCTCAGGGAGGCACTGGAAGAGGAAAATGAGAACAAAAGTGACATACAGAGACAGCTAGTTAAAGCTCAGGGA
GAAATGCAACAATTGAAGGCTAAATTCGAAGGCTCGGGATCCATTCGTTCAGAAGAGTTGGATGAAGCCAAGCGAAAGTT
TATGACACGAATCCATGAGCTGGAAGAGGAAGCTGAAACCGCCAAATCGAAAGCCGGACAACTAGAAAAAGTTAAAGCTC
GACTCCAAGGAGAAATCGAAGATATGCTGGTCGACGTTGACAGAGCGAATACACTCGCATCTCAGTTGGAAAAGAAGCAG
AAAACATTCGATAAAGTCGTGTCAGAATGGCAGCAGAAATATGCTGAATCTCAGGCGGAATTGGAAGCATCCCAGAGAGA
AAGCAGGACGATTTCAGCTGAGGTGTTTCGAATGAAAGCACAAATCGAAGAAAGTCAAGAGCAGTTGGAAAGCGTTAAAC
GGGAAAACAAAAATCTAGCAGATGAAATCCACGATTTGACAGAGCAAATCGGAGAAGGAGGTCGCAGTGTTCACGAAATC
GACAAAGCAAGGAAACGATTGGAAATGGAAAAGGAAGAATTGCAACATGCGTTAGAAGAAGCCGAACAAGCTTTGGAACA
GGAAGAAGCCAAGTCTCAACGATCACAACTGGAAATGAGCCAGATCAGACAAGAAATCGACAGGCGATTGGCTGAGAAGG
AAGAGGAATTCGAGGCCACTCGAGTCAATCATCAAAGAGCAATGGAGTCAATGGAAGCCTCACTTGAAGCCGAATCCAGA
GGCAGGGCTGAAGCAACGAAGATGAAAAAGAAACTGGAGCACGATATCGGTGAACTGGAAGTTGCAGTGGATACCGCCAA
CAGAATCCGATCGGAGCAAGAAAAGAACGCAAAGAAATTCCAGCAGCAAGTTCAAGAATTGCTATCAATGGTGGAGGATG
AGAAACACCAGAAGGATCAGATACGAGAGCAAACGACGATGACAGAAAGGAAATTGACAATGGTCCTGGCAGAGCTTGAG
GAGGTTCGTGGCTCATTGGAAAATTCCGAGAGAAACAGGAAAAATACCGAGAATGAGAAAATGGAAATAACTGATCGATT
GAATGAGTTGAGTGTCCAGAGCTCCGGTTTCATGGCTACCAAGCGGAAATTGGAAGCTGATTTGGCTGCTATGCAGTCCG
ATTTAGAGGAGGCCGCTACTGAAGCCCGACAAGCCAATGAACAAGCCAAGAAGGCTGTTGCTGACAGTGCGAGATTGTTT
GATGAAATCCGGCAAGAGCAGGAACACGCACAGCAAATCGATAAGATCAAGAAACAACTCGAGGCCCAAAATAAAGAATT
GCAAGCCAAATTAGATGAATCGGAGAATAATGCTTTGAAAGGTGGCAAAAAAGCCTTGAGCAAACTAGAGCAACGCGTTC
GTGAACTTGAAGCCGAATTAGACGGAGAACAAAAAAGACACGTTGAAAGTCAAAAGAACTCCAGAAAAGTTGAAAGACGG
CTTAAGGAGCTTGGATTACAAACCGACGAAGATAAGAAGAACCAAGAAAGATTGCAAGATCTGGTGGAGAAGCTTCAAGG
TAAAATCAAAACCTACAAACGCCAGGTGGAAGAGGCGGAAGAAATTGCTGCTGTAAACTTAGCAAAATACAGAAAGATCC
AACAGGAAATCGAAGATTCCGAAGAAAGAGCTGATCAAGCTGAACAAGCGTTGCAGAAGCTGAGGACCAAAAACCGCAGC
TCCGTTTCGACAGCGAGAGGCGGTAGCATGGCTCCCGGCATGACCACAGTGAAATCGACATCACTCTCTGTTTCGGCTTC
GAGCCGACGACAAGGTTCTAGTGTTTCCAGAGAGAGCTAAGTCAGAAATTCTAGTAACACAACGATAAATTATTAGGATT
TACTTAATTGACATTATTTGCATGTTATCAATTATTGGACACAATTTAGTGATGCTTTTATTTAATAAAATTTACATTTT
GAAAAAAAA

 

back to top



PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in muscle cell. Click this link to learn more about PAGE.


PAGE Curations: 2323


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
muscle cellSMED30014747Pdz domain containing proteinSMESG000051965.1 dd_Smed_v4_8867_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012874Adenylate cyclase type 9SMESG000037351.1 dd_Smed_v4_2998_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012572Leucine--tRNA ligaseSMESG000071689.1 dd_Smed_v4_9705_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018897Phorbol-ester/DAG-type domain-containing proteinSMESG000056465.1 dd_Smed_v4_2451_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016206Kazal-type serine protease inhibitor domain-containing protein 1SMESG000033854.1 dd_Smed_v4_4437_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015567Slc42a-1SMESG000048173.1 dd_Smed_v4_3286_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015111Guanylate cyclaseSMESG000005445.1 dd_Smed_v4_9955_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED300163635'-nucleotidase proteinSMESG000032250.1 dd_Smed_v4_3474_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012307G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000023846.1 dd_Smed_v4_477_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015694Histone H2ASMESG000067932.1 SMESG000067933.1 dd_Smed_v4_5156_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020213tensin isoform X3SMESG000033851.1 dd_Smed_v4_5620_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30023132Carbonic anhydraseSMESG000035019.1 dd_Smed_v4_5411_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30000714Activated cdc42 kinase 1SMESG000060583.1 dd_Smed_v4_6522_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30000112glutathione hydrolase 1 proenzyme isoform X2SMESG000047031.1 dd_Smed_v4_4591_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005039Serine/threonine kinaseSMESG000022977.1 dd_Smed_v4_7371_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30002129Pyruvate dehydrogenase E1 component subunit betaSMESG000068622.1 dd_Smed_v4_3374_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED300041844Fe-4S ferredoxin-type domain-containing proteinSMESG000061535.1 dd_Smed_v4_4418_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30003852SMED30003852SMESG000068031.1 dd_Smed_v4_8885_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30008926ATP-dependent DNA helicaseSMESG000023939.1 dd_Smed_v4_6024_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001195da proteinSMESG000032044.1 dd_Smed_v4_5579_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30008964SMED30008964SMESG000010167.1 dd_Smed_v4_8925_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30007850SMED30007850SMESG000001248.1 dd_Smed_v4_3418_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30008007Discoidin domain-containing receptor 2SMESG000066441.1 dd_Smed_v4_6578_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED3000844110-formyltetrahydrofolate dehydrogenaseSMESG000005275.1 dd_Smed_v4_5787_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30006777Collagen alpha-1(XV) chainSMESG000081921.1 dd_Smed_v4_3516_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005178Alkaline ceramidaseSMESG000043974.1 dd_Smed_v4_9570_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30033291SMED30033291SMESG000030545.1 dd_Smed_v4_11177_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30036005Calcium-transporting ATPaseSMESG000050554.1 dd_Smed_v4_1772_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032979slc6a-8SMESG000079327.1 SMESG000079326.1 dd_Smed_v4_2109_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30033879SMED30033879SMESG000023632.1 dd_Smed_v4_10785_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30013942DENN domain-containing protein 5BSMESG000072343.1 dd_Smed_v4_7039_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015813slc3a-1SMESG000019192.1 SMESG000019184.1 dd_Smed_v4_2113_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30014794SMED30014794SMESG000075514.1 dd_Smed_v4_1900_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED3000905260S ribosomal protein L18SMESG000017166.1 dd_Smed_v4_128_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30014371SMED30014371SMESG000077296.1 dd_Smed_v4_1778_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED300184664Fe-4S ferredoxin-type domain-containing proteinSMESG000061535.1 dd_Smed_v4_4418_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30008934Partitioning defective 3-like proteinSMESG000042842.1 dd_Smed_v4_11905_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30013342SMED30013342SMESG000068114.1 dd_Smed_v4_10914_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016666SMED30016666SMESG000016698.1 dd_Smed_v4_13460_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018722AT rich interactive domain containing proteinSMESG000013107.1 dd_Smed_v4_13474_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30017051EGF-like domain-containing proteinSMESG000016698.1 dd_Smed_v4_13460_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30017770Zinc finger MYM-type protein 1SMESG000042368.1 SMESG000042366.1 dd_Smed_v4_14779_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018355SMED30018355SMESG000022833.1 dd_Smed_v4_10379_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015172Protein kinase CSMESG000039865.1 SMESG000039854.1 SMESG000032749.1 SMESG000032747.1 dd_Smed_v4_4244_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016156Alpha-1-antiproteinase 2SMESG000078713.1 SMESG000078711.1 SMESG000078710.1 dd_Smed_v4_1853_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018174Alpha-catulinSMESG000073827.1 SMESG000073816.1 dd_Smed_v4_10625_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018210SMED30018210SMESG000003612.1 SMESG000002162.1 dd_Smed_v4_16259_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30010856CCR4-NOT transcription complex subunit 6SMESG000023679.1 dd_Smed_v4_5045_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015252Mitochondrial inner membrane protein OXA1LSMESG000039158.1 dd_Smed_v4_4072_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30000096son of sevenless-1SMESG000004512.1 dd_Smed_v4_5081_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30011974Protein SCAISMESG000039882.1 dd_Smed_v4_12456_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30008756SMED30008756SMESG000007049.1 dd_Smed_v4_14707_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30000248Ras-related protein Rab-11ASMESG000016036.1 dd_Smed_v4_4964_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30031005A disintegrin and metalloproteinase with thrombospondin motifs 2SMESG000051172.1 dd_Smed_v4_16551_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30031546Chromosome 19 open reading frame 10SMESG000021061.1 dd_Smed_v4_5539_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029805Kinesin proteinSMESG000013633.1 SMESG000013625.1 dd_Smed_v4_13562_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025825Sterile alpha and TIR motif-containing protein 1SMESG000065432.1 SMESG000065280.1 SMESG000037938.1 SMESG000037936.1 dd_Smed_v4_8112_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022804slc12a-1SMESG000043221.1 SMESG000043220.1 dd_Smed_v4_4047_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020678G-protein, gamma subunit,domain-containing proteinSMESG000066557.1 dd_Smed_v4_1237_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30027368Isoleucine--tRNA ligaseSMESG000044877.1 dd_Smed_v4_2156_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30023657Cleavage stimulation factor subunit 2SMESG000009931.1 dd_Smed_v4_3081_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30024207Evolutionarily conserved signaling intermediate in Toll pathway, mitochondrialSMESG000031438.1 dd_Smed_v4_5679_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035965Neuron navigator 2SMESG000036210.1 dd_Smed_v4_7701_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30024618SMED30024618SMESG000024253.1 dd_Smed_v4_12294_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020046AmidophosphoribosyltransferaseSMESG000000843.1 dd_Smed_v4_10667_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029159SMED30029159SMESG000029594.1 SMESG000029589.1 dd_Smed_v4_315_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035681Intraflagellar transport protein 88SMESG000039906.1 dd_Smed_v4_5484_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30027218DNA-directed RNA polymerase subunit betaSMESG000032705.1 dd_Smed_v4_5517_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025272Laminin subunit gamma-1SMESG000019909.1 dd_Smed_v4_7359_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022398C2H2-type domain-containing proteinSMESG000032119.1 dd_Smed_v4_8661_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30023727Fatty acid hydroxylase domain-containing proteinSMESG000019318.1 dd_Smed_v4_2938_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30033676MAP kinase-activating death domain proteinSMESG000026842.1 dd_Smed_v4_8355_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032631Smed-AlbinoSMESG000068148.1 dd_Smed_v4_6316_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020015ABC transporter domain-containing proteinSMESG000015153.1 dd_Smed_v4_4142_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30024406Omega-amidase NIT2SMESG000071423.1 dd_Smed_v4_1734_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30024657Serine-threonine-protein phosphatase 6 regulatory subunit 3SMESG000006995.1 dd_Smed_v4_2815_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020665E3 ubiquitin-ligase RNF185-likeSMESG000060298.1 dd_Smed_v4_5004_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029202SMED30029202SMESG000045255.1 dd_Smed_v4_8531_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025399Toll-interacting proteinSMESG000056009.1 dd_Smed_v4_1937_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032193ATP-dependent RNA helicase DDX24SMESG000016093.1 dd_Smed_v4_7310_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30030265Stork_head domain-containing proteinSMESG000040264.1 dd_Smed_v4_8576_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025596Ca(2 )/calmodulin-responsive adenylate cyclaseSMESG000023584.1 dd_Smed_v4_4439_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032120SMED30032120SMESG000021415.1 dd_Smed_v4_5753_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30021696Transducin-like enhancer protein 3SMESG000073091.1 dd_Smed_v4_5131_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025367V-type proton ATPase catalytic subunit ASMESG000028157.1 dd_Smed_v4_959_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029772ATP synthase subunit s-like proteinSMESG000001388.1 dd_Smed_v4_4736_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30033533Protein kinaseSMESG000004166.1 dd_Smed_v4_5742_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025270SMED30025270SMESG000077813.1 dd_Smed_v4_3498_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020430Very-long-chain (3R)-3-hydroxyacyl-CoA dehydrataseSMESG000034959.1 dd_Smed_v4_3998_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30033426SMED30033426SMESG000028228.1 dd_Smed_v4_7872_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020462Protein archeaseSMESG000051205.1 dd_Smed_v4_4680_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30002609Liprin-alpha-4SMESG000048911.1 dd_Smed_v4_5468_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30014748Ptk7SMESG000072430.1 dd_Smed_v4_6999_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005657Malic enzymeSMESG000045895.1 dd_Smed_v4_2140_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30002753X1.A5.1SMESG000062836.1 dd_Smed_v4_585_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30007107SMED30007107SMESG000050890.1 dd_Smed_v4_1847_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30017516Collagen alpha-2(IV) chainSMESG000021729.1 dd_Smed_v4_2197_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30013408Sarcoplasmic calcium-binding proteinSMESG000020808.1 dd_Smed_v4_1010_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30004485Fibrillar collagenSMESG000038928.1 dd_Smed_v4_1070_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30007091Vacuolar ATPase assembly integral membrane protein VMA21 homologSMESG000059638.1 dd_Smed_v4_2976_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30011728Disks large-like protein 5SMESG000059889.1 dd_Smed_v4_2209_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005845NPHS1-6SMESG000028689.1 dd_Smed_v4_10689_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30004930Irregular chiasm C-roughest-like isoform X2SMESG000077979.1 dd_Smed_v4_12549_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30003409admp-1aSMESG000059598.1 SMESG000059596.1 SMESG000059595.1 dd_Smed_v4_12939_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30011055Evi/WlsSMESG000068488.1 dd_Smed_v4_9546_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30002972Ubiquitin-like modifier-activating enzyme 5SMESG000020505.1 dd_Smed_v4_2151_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012386Alpha-1,4 glucan phosphorylaseSMESG000061417.1 dd_Smed_v4_1532_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30013666Acetyltransferase component of pyruvate dehydrogenase complexSMESG000002956.1 dd_Smed_v4_1069_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30017539Anti dorsalizing morphogenetic protein 1aSMESG000059598.1 SMESG000059596.1 SMESG000059595.1 dd_Smed_v4_12939_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018418Serine/threonine-protein phosphatase 2A regulatory subunit BSMESG000015273.1 dd_Smed_v4_14696_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005782Ubiquitin-like proteinSMESG000036610.1 dd_Smed_v4_5328_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015069ANK_REP_REGION domain-containing proteinSMESG000063648.1 dd_Smed_v4_10764_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009115Polypyrimidine tract-binding protein 1SMESG000033951.1 dd_Smed_v4_14748_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005367SMED30005367SMESG000062485.1 SMESG000062480.1 dd_Smed_v4_8816_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30008402G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000075377.1 SMESG000003543.1 dd_Smed_v4_12494_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30000705Serine/threonine-protein kinase OSR1SMESG000066296.1 dd_Smed_v4_1366_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001137SMED30001137SMESG000050459.1 dd_Smed_v4_28401_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001137SMED30001137SMESG000050459.1 dd_Smed_v4_23030_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016193Septin-5SMESG000076922.1 dd_Smed_v4_1717_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015584Nesprin-1SMESG000016745.1 dd_Smed_v4_16850_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009076ActinSMESG000066035.1 SMESG000066029.1 SMESG000066027.1 SMESG000066020.1 dd_Smed_v4_90_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009076ActinSMESG000066035.1 SMESG000066029.1 SMESG000066027.1 SMESG000066020.1 dd_Smed_v4_37_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30008927TwistSMESG000026385.1 dd_Smed_v4_17951_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001056AcetylCoA_hyd_C domain-containing proteinSMESG000063866.1 dd_Smed_v4_1775_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30000245Zinc finger protein 112-likeSMESG000072474.1 SMESG000072473.1 dd_Smed_v4_2635_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30003276Protein atonal like protein 8SMESG000056587.1 dd_Smed_v4_9899_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30002655Ig-like domain-containing proteinSMESG000079770.1 dd_Smed_v4_1914_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30011180Kinesin-like protein KIF26ASMESG000051203.1 dd_Smed_v4_8860_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30019864Neur_chan_LBD domain-containing proteinSMESG000008589.1 dd_Smed_v4_10171_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30008973SMED30008973SMESG000017122.1 dd_Smed_v4_13867_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30013260SAM domain-containing proteinSMESG000054431.1 dd_Smed_v4_7610_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30013260SAM domain-containing proteinSMESG000010456.1 SMESG000002915.1 dd_Smed_v4_1968_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30008751Liprin-alpha-2SMESG000024331.1 SMESG000024325.1 dd_Smed_v4_12307_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30010117SMED30010117SMESG000030021.1 SMESG000000893.1 dd_Smed_v4_2033_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30007206Ribonuclease P protein component 4SMESG000059598.1 SMESG000059596.1 SMESG000059595.1 dd_Smed_v4_12939_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30013435MERSMESG000016263.1 dd_Smed_v4_2243_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30004698Small conductance calcium-activated potassium channel proteinSMESG000076156.1 dd_Smed_v4_14006_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009204FGFR4SMESG000054557.1 dd_Smed_v4_11024_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005717BAR domain-containing proteinSMESG000000639.1 dd_Smed_v4_1387_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009491DNA polymerase alpha subunit BSMESG000051237.1 SMESG000051238.1 dd_Smed_v4_1195_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015061G protein regulated inducer of neurite outgrowthSMESG000062691.1 dd_Smed_v4_10294_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009797Clathrin light chainSMESG000012224.1 dd_Smed_v4_1361_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30000291Intersectin-1SMESG000065922.1 SMESG000066021.1 SMESG000065955.1 SMESG000065944.1 dd_Smed_v4_5505_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018224Adenylate kinaseSMESG000077377.1 SMESG000076900.1 SMESG000063429.1 SMESG000060686.1 SMESG000043019.1 SMESG000031308.1 SMESG000028811.1 SMESG000023833.1 SMESG000023573.1 SMESG000019820.1 SMESG000011532.1 SMESG000052813.1 dd_Smed_v4_1229_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30002880Tetratricopeptide repeat domain 17SMESG000036512.1 dd_Smed_v4_11405_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30006792Argonaute 1SMESG000050994.1 dd_Smed_v4_2478_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30008553Phosphoenolpyruvate carboxykinase [GTP]SMESG000062868.1 dd_Smed_v4_196_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30002036Anamorsin homologSMESG000067341.1 dd_Smed_v4_3204_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30006363Ubiquitin-like protein 3SMESG000036610.1 dd_Smed_v4_5328_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035357follistatinSMESG000013298.1 dd_Smed_v4_9584_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029822Neuronal acetylcholine receptor subunit alpha-4SMESG000021568.1 dd_Smed_v4_9503_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035970transcription initiation factor TFIID subunit 2SMESG000037189.1 dd_Smed_v4_15494_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30023819BZIP domain-containing proteinSMESG000057821.1 dd_Smed_v4_8835_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30027132Calcineurin subunit B typeSMESG000081409.1 dd_Smed_v4_5589_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026859PlsC domain-containing proteinSMESG000028760.1 dd_Smed_v4_8757_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30027460Troponin iSMESG000002071.1 dd_Smed_v4_323_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30021328SMED30021328SMESG000028190.1 dd_Smed_v4_17722_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30028104Nou-darake-like-2SMESG000027359.1 dd_Smed_v4_8340_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022468secreted frizzled-related protein 1SMESG000075831.1 SMESG000029446.1 dd_Smed_v4_13985_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022433SMED30022433SMESG000036199.1 dd_Smed_v4_11599_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30030415AminopeptidaseSMESG000026219.1 dd_Smed_v4_15623_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035597SMED30035597SMESG000029469.1 dd_Smed_v4_1765_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025705Transient receptor potential ion channel M bSMESG000017090.1 dd_Smed_v4_6825_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026932noggin-like protein 8SMESG000008387.1 dd_Smed_v4_8738_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30027816Histone-binding protein RBBP4SMESG000043499.1 dd_Smed_v4_5104_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029434SMED30029434SMESG000045809.1 dd_Smed_v4_6870_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30024457Guanine nucleotide exchange factorSMESG000044434.1 dd_Smed_v4_6608_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035848Tubulin beta chainSMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044888.1 SMESG000035755.1 dd_Smed_v4_83_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022786Splicing factor 3b subunit 4SMESG000005564.1 dd_Smed_v4_3556_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30010138COP9 signalosome complex subunit 1SMESG000027211.1 dd_Smed_v4_2705_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30014474Tumor susceptibility gene 101 proteinSMESG000004871.1 dd_Smed_v4_1686_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30004928phosphatidylinositol 4-kinase betaSMESG000061430.1 dd_Smed_v4_6071_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30013751SMED30013751SMESG000019957.1 dd_Smed_v4_3938_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30007199IlvB (bacterial acetolactate synthase)-likeSMESG000026596.1 dd_Smed_v4_1784_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005141Zinc finger, NFX1-type containing 1SMESG000081218.1 dd_Smed_v4_11824_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30004039Fibrillin-2SMESG000081571.1 SMESG000081561.1 SMESG000081557.1 SMESG000081553.1 dd_Smed_v4_10142_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30008246Pre-mRNA-splicing factor CWC22 homologSMESG000049553.1 dd_Smed_v4_5597_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001010SMED30001010SMESG000039006.1 dd_Smed_v4_13470_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005741Actin-related protein 2/3 complex subunitSMESG000015778.1 dd_Smed_v4_978_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30007982Protein Tob1SMESG000080545.1 dd_Smed_v4_13216_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30019535Protein lifeguard 2SMESG000057144.1 dd_Smed_v4_1586_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30014930DIS3-like exonuclease 2SMESG000077915.1 dd_Smed_v4_7044_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012192Metallophosphoesterase MPPED2SMESG000074768.1 dd_Smed_v4_9610_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30003887c-Myc-binding proteinSMESG000001466.1 dd_Smed_v4_891_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009541NADH-cytochrome b5 reductaseSMESG000061572.1 SMESG000061559.1 dd_Smed_v4_1468_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED300118365-hydroxytryptamine receptorSMESG000004643.1 dd_Smed_v4_21082_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30007024G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000078415.1 dd_Smed_v4_24316_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30011874PhosphodiesteraseSMESG000028250.1 dd_Smed_v4_6513_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30014562DNA mismatch repair protein PMS2SMESG000004803.1 dd_Smed_v4_16760_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30003956SMED30003956SMESG000031083.1 dd_Smed_v4_9586_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30004455DUF2428 domain-containing proteinSMESG000032327.1 dd_Smed_v4_12316_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015515Mannose-binding protein CSMESG000046618.1 SMESG000031111.1 dd_Smed_v4_3266_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30008025Protein FAM98ASMESG000032274.1 dd_Smed_v4_5345_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30013200PH and SEC7 domain-containing proteinSMESG000041617.1 dd_Smed_v4_9018_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30013124Aldehyde dehydrogenase family proteinSMESG000049241.1 dd_Smed_v4_1493_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018648SMED30018648SMESG000041679.1 dd_Smed_v4_5618_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016395Small subunit ribosomal protein S27SMESG000021355.1 dd_Smed_v4_6708_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30008259Progesterone receptor membrane component 1SMESG000069126.1 SMESG000069122.1 dd_Smed_v4_2076_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30003589Exocyst complex component 7SMESG000028363.1 dd_Smed_v4_7926_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012095SMED30012095SMESG000030693.1 dd_Smed_v4_15045_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30011014acetolactate synthase-like proteinSMESG000026596.1 dd_Smed_v4_1784_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30007075Fibrillin-2SMESG000081571.1 SMESG000081561.1 SMESG000081557.1 SMESG000081553.1 dd_Smed_v4_10142_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30007124EF-hand domain-containing proteinSMESG000062171.1 dd_Smed_v4_3568_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30013637UPF0546 membrane protein AGAP012180SMESG000012908.1 dd_Smed_v4_10533_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30000458CREB-binding proteinSMESG000071698.1 dd_Smed_v4_5674_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018825rhomboid-like proteinSMESG000053833.1 dd_Smed_v4_13835_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30013733Cleavage and polyadenylation specificity factor subunit 6SMESG000077480.1 dd_Smed_v4_4839_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30007995SJCHGC04139 proteinSMESG000078527.1 dd_Smed_v4_2739_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009054Dynamin-like protein, mitochondrialSMESG000022388.1 dd_Smed_v4_8357_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30010394Transmembrane 9 superfamily memberSMESG000016907.1 dd_Smed_v4_2737_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30003560Teneurin-2SMESG000016735.1 dd_Smed_v4_5439_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30000994SMED30000994SMESG000023987.1 SMESG000017232.1 SMESG000080953.1 SMESG000080618.1 SMESG000072700.1 SMESG000069163.1 SMESG000065358.1 SMESG000064426.1 SMESG000062577.1 SMESG000062150.1 SMESG000060043.1 SMESG000057576.1 SMESG000056292.1 SMESG000054362.1 SMESG000052870.1 SMESG000051517.1 SMESG000050768.1 SMESG000050005.1 SMESG000049698.1 SMESG000045813.1 SMESG000041318.1 SMESG000040743.1 SMESG000039279.1 SMESG000038973.1 SMESG000038321.1 SMESG000029893.1 SMESG000028198.1 SMESG000023025.1 SMESG000021897.1 SMESG000018432.1 SMESG000018410.1 SMESG000017430.1 SMESG000006729.1 SMESG000005334.1 dd_Smed_v4_1692_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015697N chimaerinSMESG000057671.1 dd_Smed_v4_1990_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30007365TPA_inf: Pax-beta2 paired domain proteinSMESG000066574.1 dd_Smed_v4_14362_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30011438F-box domain-containing proteinSMESG000009226.1 dd_Smed_v4_10134_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001299SMED30001299SMESG000010387.1 dd_Smed_v4_13587_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30008167SMED30008167SMESG000033046.1 dd_Smed_v4_4545_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30002371SMED30002371SMESG000009747.1 dd_Smed_v4_6698_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED3000565950S ribosomal protein L3, putativeSMESG000077764.1 dd_Smed_v4_2057_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018288TNF receptor associated factor-2SMESG000014897.1 dd_Smed_v4_5329_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30013737SMED30013737SMESG000017032.1 dd_Smed_v4_11755_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30007465Coiled coil domain containing protein 58SMESG000014824.1 dd_Smed_v4_1983_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30007946Chaperone protein DnaJSMESG000023241.1 dd_Smed_v4_7630_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30000905Ribonuclease P protein subunit p29SMESG000071391.1 dd_Smed_v4_10916_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30000475Bestrophin homologSMESG000016298.1 dd_Smed_v4_10097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005315Transient receptor potential cation channel, subfamily A, member 1aSMESG000014208.1 dd_Smed_v4_86413_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005226Phosphorylase b kinase regulatory subunitSMESG000070125.1 dd_Smed_v4_6919_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016846Ubiquitin specific peptidase 48SMESG000044971.1 SMESG000031842.1 dd_Smed_v4_12464_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005154SMED30005154SMESG000049720.1 SMESG000049718.1 dd_Smed_v4_2225_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30004660Son of sevenless homolog 1SMESG000047367.1 dd_Smed_v4_5212_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30000275SMED30000275SMESG000054298.1 SMESG000054297.1 dd_Smed_v4_5777_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016091Ubiquitin-conjugating enzyme E2 J2SMESG000064580.1 dd_Smed_v4_2733_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30003584Amyloid beta (A4) precursor protein bSMESG000057580.1 dd_Smed_v4_5336_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30028574Cytochrome P450 2K1-like proteinSMESG000078092.1 SMESG000078091.1 dd_Smed_v4_2351_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025566PlasminogenSMESG000045562.1 dd_Smed_v4_6014_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020379DNA methyltransferase 1-associated proteinSMESG000023267.1 dd_Smed_v4_6218_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30031288Protein SMG7-like ProteinSMESG000071698.1 dd_Smed_v4_5674_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032249Eukaryotic translation initiation factor 2-alpha kinase 4SMESG000023579.1 dd_Smed_v4_8210_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30033043RNA polymerase II-associated factor 1SMESG000006276.1 dd_Smed_v4_5560_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022256Eukaryotic elongation factor 2 kinaseSMESG000014704.1 dd_Smed_v4_2226_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032600SMED30032600SMESG000002929.1 dd_Smed_v4_6253_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30034357FYVE, RhoGEF and PH domain containing 6SMESG000070146.1 dd_Smed_v4_9886_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020022ETS homologous factor isoform X2SMESG000069597.1 dd_Smed_v4_7247_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30027675Kinase-like proteinSMESG000017215.1 dd_Smed_v4_6983_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30027774SMED30027774SMESG000064580.1 dd_Smed_v4_2733_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30034809SMED30034809SMESG000019881.1 dd_Smed_v4_8696_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30023567Proteasome subunit alpha typeSMESG000074161.1 dd_Smed_v4_3387_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025431Glutamate receptor ionotropic, NMDA 3ASMESG000071734.1 dd_Smed_v4_14623_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30027362DnaJ-like proteinSMESG000077692.1 dd_Smed_v4_3460_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30034652DUF3715 domain-containing proteinSMESG000026149.1 dd_Smed_v4_9954_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025907c-SKI_SMAD_bind domain-containing proteinSMESG000075612.1 SMESG000026079.1 SMESG000018825.1 SMESG000002232.1 dd_Smed_v4_6759_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026226Voltage-dependent anion channel 2SMESG000081676.1 dd_Smed_v4_7081_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022220Ankyrin repeat domain-containing protein 27SMESG000058588.1 dd_Smed_v4_12122_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035558Alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferaseSMESG000015150.1 dd_Smed_v4_7841_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015494SMED30015494SMESG000071114.1 dd_Smed_v4_10579_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012700SMED30012700SMESG000073126.1 dd_Smed_v4_13668_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022458Disintegrin and metalloproteinase domain-containing protein 15SMESG000076089.1 SMESG000056400.1 dd_Smed_v4_5143_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30031058Galanin receptor type 2SMESG000043375.1 SMESG000043376.1 dd_Smed_v4_18897_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30028035Cytoplasmic dynein 1 intermediate chainSMESG000045332.1 dd_Smed_v4_10472_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30031715Spectrin beta chainSMESG000035098.1 dd_Smed_v4_1684_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30027961SMED30027961SMESG000007561.1 dd_Smed_v4_4658_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032384C4b binding protein beta chainSMESG000011729.1 dd_Smed_v4_13071_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020986SMED30020986SMESG000061227.1 dd_Smed_v4_1936_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30023408Protein RER1SMESG000033447.1 dd_Smed_v4_1498_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30031500UDP-N-acetylhexosamine pyrophosphorylaseSMESG000055005.1 dd_Smed_v4_2150_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009248GPI-anchor transamidaseSMESG000038907.1 dd_Smed_v4_6456_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30007830SMED30007830SMESG000047325.1 dd_Smed_v4_4889_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30011348Katanin p60 ATPase-containing subunit A1SMESG000069747.1 dd_Smed_v4_5163_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30006820cilia- and flagella-associated protein 57SMESG000072029.1 dd_Smed_v4_3323_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30006356slc21a-1SMESG000025236.1 dd_Smed_v4_8289_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30006784ras-related protein Rab-7aSMESG000014290.1 dd_Smed_v4_419_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30008869Arginine--tRNA ligaseSMESG000066154.1 dd_Smed_v4_5334_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30006931SMED30006931SMESG000040565.1 dd_Smed_v4_4660_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30010958mitochondrial calcium uniporter regulator 1SMESG000000112.1 dd_Smed_v4_6195_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009557methionine synthase reductaseSMESG000061482.1 dd_Smed_v4_3947_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30008750Origin recognition complex subunit 1SMESG000072187.1 dd_Smed_v4_8215_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30006039endoplasmic reticulum junction formation protein lunaparkSMESG000071636.1 dd_Smed_v4_6045_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009483transmembrane protein 115SMESG000016952.1 dd_Smed_v4_2967_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30010468RBR-type E3 ubiquitin transferaseSMESG000062644.1 dd_Smed_v4_3281_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30006044SMED30006044SMESG000034607.1 dd_Smed_v4_6645_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005183slc30a-6SMESG000069701.1 SMESG000069698.1 dd_Smed_v4_6098_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30011405Epimerase family proteinSMESG000024137.1 dd_Smed_v4_3863_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005207Si:dkey-153k10.9SMESG000055380.1 dd_Smed_v4_5144_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30008813TNF receptor associated factor-2SMESG000070095.1 SMESG000070079.1 dd_Smed_v4_5665_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005737Death-associated protein kinase 1SMESG000048879.1 dd_Smed_v4_9475_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009429inhibin-1SMESG000062806.1 dd_Smed_v4_7607_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30004404SMED30004404SMESG000001945.1 dd_Smed_v4_4828_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009134SMED30009134SMESG000022478.1 dd_Smed_v4_4419_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30002690HEAT repeat-containing protein 5B-like ProteinSMESG000028228.1 dd_Smed_v4_7872_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009863Guanylate kinaseSMESG000052587.1 SMESG000052584.1 dd_Smed_v4_4875_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30019526Membrane protein insertase YidCSMESG000039158.1 dd_Smed_v4_4072_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012501Solute carrier family 4 member 1 adaptor proteinSMESG000074111.1 dd_Smed_v4_8435_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30011622DNA-directed RNA polymerase II subunit RPB11SMESG000055029.1 dd_Smed_v4_4232_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30000664Protein kinaseSMESG000026488.1 dd_Smed_v4_6431_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30014211MATH domain-containing proteinSMESG000075612.1 SMESG000026079.1 SMESG000018825.1 SMESG000002232.1 dd_Smed_v4_6759_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30006182Peptidyl-prolyl cis-trans isomeraseSMESG000057818.1 dd_Smed_v4_4606_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30000033VASt domain-containing proteinSMESG000033356.1 dd_Smed_v4_9149_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015721Diacylglycerol kinaseSMESG000023623.1 SMESG000017153.1 dd_Smed_v4_7792_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30013497Ribosome assembly factor mrt4SMESG000020510.1 dd_Smed_v4_1609_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30007809SMED30007809SMESG000020598.1 SMESG000020597.1 dd_Smed_v4_5190_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001369DNA-binding protein SMUBP-2-like proteinSMESG000013780.1 dd_Smed_v4_7758_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30017966Protein bark beetleSMESG000041025.1 dd_Smed_v4_8448_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016120Phosphoribosyl pyrophosphate synthase-associated protein 2SMESG000007561.1 dd_Smed_v4_4658_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012265Forkhead box proteinSMESG000037782.1 SMESG000037781.1 dd_Smed_v4_3040_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005162Alpha-1,3-mannosyl-glycoprotein 2-beta-N-acetylglucosaminyltransferaseSMESG000034058.1 dd_Smed_v4_39007_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30011146Malectin domain-containing proteinSMESG000010440.1 dd_Smed_v4_1880_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30011091Ski oncogeneSMESG000044463.1 dd_Smed_v4_10394_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018309Iroquois-class homeodomain protein IRX-4SMESG000061184.1 dd_Smed_v4_11500_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30019100FAD synthaseSMESG000076936.1 dd_Smed_v4_8204_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009440Dicer-like protein 1SMESG000016950.1 dd_Smed_v4_5587_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30010729TIA-1-related RNA binding proteinSMESG000055085.1 dd_Smed_v4_2434_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30010927Superkiller viralicidic activity 2-like 2SMESG000063270.1 dd_Smed_v4_10108_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30008516SMED30008516SMESG000066250.1 dd_Smed_v4_8729_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30019996SMED30019996SMESG000023112.1 dd_Smed_v4_16124_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30008233Serine/threonine-protein phosphataseSMESG000023415.1 dd_Smed_v4_581_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015723RNA-binding protein MusashiSMESG000045507.1 SMESG000045502.1 dd_Smed_v4_13817_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30019786Cyclin-dependent kinase 12SMESG000046067.1 dd_Smed_v4_7045_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30013021SMED30013021SMESG000025420.1 dd_Smed_v4_2995_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30017032slc2a-11SMESG000025420.1 dd_Smed_v4_2995_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016314SMED30016314SMESG000011577.1 dd_Smed_v4_7855_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012617Glucosamine-6-phosphate isomeraseSMESG000010404.1 dd_Smed_v4_5404_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005784Translocation protein sec62SMESG000036836.1 dd_Smed_v4_6673_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30003139Cell division cycle protein 27SMESG000032470.1 dd_Smed_v4_7556_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001678Succinate dehydrogenase [ubiquinone] iron-sulfur subunit, mitochondrialSMESG000020764.1 dd_Smed_v4_925_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30004112Dynein heavy chain 5, axonemalSMESG000012967.1 dd_Smed_v4_4113_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30007163CCR4-NOT transcription complex subunit 2SMESG000016354.1 dd_Smed_v4_6679_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009652HEAT repeat-containing protein 5BSMESG000028228.1 dd_Smed_v4_7872_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30006799DEAH-box helicase 8SMESG000052927.1 SMESG000001919.1 dd_Smed_v4_6138_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012799slc39a-3SMESG000027903.1 dd_Smed_v4_10160_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30011980G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000060945.1 dd_Smed_v4_14651_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015122ATP-dependent RNA helicase DHX8SMESG000038861.1 dd_Smed_v4_7940_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30011218CSON008187 proteinSMESG000048355.1 dd_Smed_v4_4413_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30011663slc1a-5SMESG000064126.1 dd_Smed_v4_1106_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30023872Zinc finger MYM-type protein 5SMESG000055398.1 dd_Smed_v4_11239_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30030897Ubox domain containing proteinSMESG000054668.1 dd_Smed_v4_2397_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30031131RhoGAP-domain-containing proteinSMESG000074052.1 dd_Smed_v4_7153_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032274SMED30032274SMESG000074052.1 dd_Smed_v4_7153_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022566TM2 domain-containing protein 2SMESG000063274.1 dd_Smed_v4_5982_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025175Ethanolamine kinase 1SMESG000039287.1 SMESG000039275.1 dd_Smed_v4_10949_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30034412E3 ubiquitin-protein ligase CBLSMESG000056433.1 dd_Smed_v4_6780_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035407ANK_REP_REGION domain-containing proteinSMESG000037862.1 dd_Smed_v4_9936_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30034920G protein gamma domain-containing proteinSMESG000066557.1 dd_Smed_v4_1237_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30031216Oxysterol-binding proteinSMESG000023068.1 dd_Smed_v4_3268_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022812Receptor-type tyrosine-protein phosphatase SSMESG000068618.1 dd_Smed_v4_12771_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30033774CatalaseSMESG000055572.1 dd_Smed_v4_859_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022104Phosphoribosyl pyrophosphate synthase-associated protein 2SMESG000007561.1 dd_Smed_v4_4658_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032957Diacylglycerol kinaseSMESG000023623.1 SMESG000017153.1 dd_Smed_v4_7792_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005322SMED30005322SMESG000078208.1 dd_Smed_v4_2727_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005173Neuronal acetylcholine receptor subunit alpha 4SMESG000073518.1 dd_Smed_v4_10322_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30019962Protein phosphatase 1 regulatory subunitSMESG000061419.1 dd_Smed_v4_8791_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30030198Lamin-B receptorSMESG000042131.1 dd_Smed_v4_2016_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035836Procollagen galactosyltransferase 1SMESG000064760.1 dd_Smed_v4_11681_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30021684Fibrillar collagen NC1 domain-containing proteinSMESG000041598.1 dd_Smed_v4_8075_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025017SMED30025017SMESG000026705.1 dd_Smed_v4_5525_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026417SMED30026417SMESG000006455.1 dd_Smed_v4_11785_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30028777Protein unc-79 homologSMESG000053097.1 dd_Smed_v4_6600_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025757JUNLI-1SMESG000067959.1 dd_Smed_v4_4878_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30031902SMED30031902SMESG000055070.1 dd_Smed_v4_1410_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026112Sorting nexin-27SMESG000081127.1 dd_Smed_v4_2513_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30033583SMED30033583SMESG000060313.1 SMESG000049383.1 dd_Smed_v4_158_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020900SMED30020900SMESG000022827.1 dd_Smed_v4_2123_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020821SMED30020821SMESG000014298.1 dd_Smed_v4_1301_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30027268Histone H1BSMESG000071975.1 dd_Smed_v4_3898_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30021600Pyridine nucleotide-disulfide oxidoreductase domain-containing protein 1SMESG000020914.1 dd_Smed_v4_7078_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30023399NFX1-type zinc finger-containing protein 1-likeSMESG000057303.1 dd_Smed_v4_10696_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30021992SMED30021992SMESG000037107.1 dd_Smed_v4_6031_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026729PaxillinSMESG000022586.1 SMESG000022579.1 SMESG000022578.1 dd_Smed_v4_9298_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30027745molybdate-anion transporter isoform X2SMESG000027072.1 dd_Smed_v4_3699_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026564Ubiquitin carboxyl-terminal hydrolase family proteinSMESG000040007.1 SMESG000039999.1 dd_Smed_v4_2299_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED300296502-oxoisovalerate dehydrogenase subunit beta, mitochondrialSMESG000043691.1 dd_Smed_v4_2949_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30021707SMED30021707SMESG000063964.1 dd_Smed_v4_11231_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30024702SMED30024702SMESG000051373.1 dd_Smed_v4_7070_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025202SMED30025202SMESG000047662.1 dd_Smed_v4_6132_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30031183SMB domain-containing proteinSMESG000079236.1 dd_Smed_v4_11622_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30021693Nicotinic acetylcholine receptor alpha 6 subunitSMESG000000214.1 SMESG000000209.1 dd_Smed_v4_9864_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025723LadybirdSMESG000063219.1 dd_Smed_v4_31435_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025014Vacuolar protein sorting 25 homologSMESG000018311.1 dd_Smed_v4_5009_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022769Glycine receptor subunit alpha-3SMESG000061905.1 dd_Smed_v4_8110_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30030412SCA7 domain-containing proteinSMESG000037107.1 dd_Smed_v4_6031_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022325SMED30022325SMESG000022410.1 SMESG000022409.1 dd_Smed_v4_1683_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30031990SMED30031990SMESG000025001.1 dd_Smed_v4_213_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30024840LactadherinSMESG000001686.1 dd_Smed_v4_5463_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001255IAP domain containing-1SMESG000031926.1 dd_Smed_v4_4082_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001234Transportin-1SMESG000043829.1 dd_Smed_v4_4883_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30002783TNF receptor-associated factorSMESG000049199.1 SMESG000039087.1 dd_Smed_v4_8933_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005140SMED30005140SMESG000081443.1 dd_Smed_v4_2846_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30002952Conserved oligomeric Golgi complex subunit 4SMESG000014264.1 dd_Smed_v4_4093_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30000494Ubiquitin thioesteraseSMESG000043359.1 dd_Smed_v4_5846_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30000557SMED30000557SMESG000037685.1 dd_Smed_v4_6614_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30004578SMED30004578SMESG000066093.1 SMESG000066079.1 dd_Smed_v4_3986_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30000445Protocadherin 2 gamma c6 sCP1SMESG000053174.1 dd_Smed_v4_7871_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30003297Zinc finger, C2H2 typeSMESG000054710.1 SMESG000038394.1 dd_Smed_v4_8871_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032941TNF receptor associated factor 4SMESG000025998.1 SMESG000025982.1 SMESG000025980.1 SMESG000025963.1 SMESG000025934.1 SMESG000025901.1 SMESG000025797.1 SMESG000025794.1 SMESG000025517.1 dd_Smed_v4_1139_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029142Sorting nexin-25-like proteinSMESG000002020.1 dd_Smed_v4_1891_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020825Protein I'm not dead yetSMESG000041335.1 dd_Smed_v4_12964_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035118leucine rich repeat and fibronectin type III domain containing-1SMESG000045027.1 dd_Smed_v4_10393_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026987TNF receptor-associated factorSMESG000025998.1 SMESG000025982.1 SMESG000025980.1 SMESG000025963.1 SMESG000025934.1 SMESG000025901.1 SMESG000025797.1 SMESG000025794.1 SMESG000025517.1 dd_Smed_v4_1139_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30028787TNF receptor-associated factorSMESG000015087.1 dd_Smed_v4_2354_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30031820B-cell lymphoma/leukemiaSMESG000011176.1 dd_Smed_v4_13341_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30021539Diacylglycerol lipase betaSMESG000046500.1 dd_Smed_v4_13306_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30030310SMED30030310SMESG000057201.1 dd_Smed_v4_1531_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30031375Vacuolar protein sorting-associated protein VTA1 homologSMESG000017746.1 dd_Smed_v4_1832_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020216U6 snRNA-associated Sm-like protein LSm3SMESG000072617.1 dd_Smed_v4_1641_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022844NEPH-3SMESG000022777.1 dd_Smed_v4_11280_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30021387Glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase 1SMESG000061842.1 dd_Smed_v4_14708_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30033252Cell adhesion molecule-related/down-regulated by oncogenesSMESG000010456.1 SMESG000002915.1 dd_Smed_v4_1968_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30003613Calcium-binding protein, putativeSMESG000011029.1 dd_Smed_v4_660_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30004253HexosyltransferaseSMESG000042545.1 dd_Smed_v4_6589_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016357SMED30016357SMESG000061508.1 SMESG000027427.1 dd_Smed_v4_5483_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30010755Ig-like domain-containing proteinSMESG000068292.1 dd_Smed_v4_3852_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30010740FERM and pleckstrin domain containing proteinSMESG000038155.1 dd_Smed_v4_14700_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30000038Ribosome-binding protein 1SMESG000031975.1 dd_Smed_v4_1111_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30002062Ras-like protein family member 12SMESG000057124.1 dd_Smed_v4_15106_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012426SMED30012426SMESG000081547.1 dd_Smed_v4_12193_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30017378Aldose 1-epimeraseSMESG000011518.1 dd_Smed_v4_1947_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30011701Filamin-ASMESG000017288.1 dd_Smed_v4_5496_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016140methylmalonyl-CoA mutase, mitochondrialSMESG000014335.1 dd_Smed_v4_2255_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009119Ankyrin-2SMESG000058557.1 dd_Smed_v4_1432_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30000977PhosphomannomutaseSMESG000079671.1 SMESG000079384.1 dd_Smed_v4_1964_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30006095Aspartate aminotransferaseSMESG000022764.1 dd_Smed_v4_2004_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30019594Lipoma-preferred partnerSMESG000031084.1 dd_Smed_v4_12584_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30002616NK homeobox 4SMESG000018735.1 dd_Smed_v4_9259_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30003769calmodulin-betaSMESG000067105.1 dd_Smed_v4_4944_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30019288Reticulocalbin 3SMESG000012033.1 dd_Smed_v4_1417_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30004084SMED30004084SMESG000011029.1 dd_Smed_v4_660_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012379SMED30012379SMESG000058557.1 dd_Smed_v4_1432_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30014501collagen alpha-1(I) chain isoform X4SMESG000071152.1 SMESG000071150.1 dd_Smed_v4_9030_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30014501collagen alpha-1(I) chain isoform X4SMESG000071150.1 dd_Smed_v4_13610_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30002903Cyclic AMP-responsive element-binding protein 3-like proteinSMESG000065680.1 dd_Smed_v4_4539_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016327Ras GTPase-activating protein SynGAPSMESG000060891.1 SMESG000060888.1 SMESG000060447.1 dd_Smed_v4_11115_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30004487SMED30004487SMESG000012170.1 SMESG000012168.1 dd_Smed_v4_1367_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED3001096960S ribosomal protein L6SMESG000019835.1 dd_Smed_v4_839_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30008655Tubulin alpha chainSMESG000054547.1 dd_Smed_v4_508_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30013416Reticulocalbin-1SMESG000007225.1 dd_Smed_v4_990_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012056Protocadherin-9SMESG000079318.1 dd_Smed_v4_5383_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30017065Cytochrome P450SMESG000063883.1 dd_Smed_v4_45815_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005807BasiginSMESG000039120.1 dd_Smed_v4_3356_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30011594Peripheral plasma membrane protein CASKSMESG000062837.1 dd_Smed_v4_5730_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009975Rho-GAP domain-containing proteinSMESG000078332.1 dd_Smed_v4_5208_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009975Rho-GAP domain-containing proteinSMESG000078332.1 dd_Smed_v4_7670_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30011869X1.A2.3SMESG000031290.1 dd_Smed_v4_4279_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009274SMED30009274SMESG000007225.1 dd_Smed_v4_990_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30019756Low-density lipoprotein receptor-related proteinSMESG000010458.1 dd_Smed_v4_10112_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30004524cGMP-dependent protein kinaseSMESG000020772.1 dd_Smed_v4_9039_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30004524cGMP-dependent protein kinaseSMESG000020772.1 dd_Smed_v4_8296_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30002902Triple functional domain proteinSMESG000061508.1 SMESG000027427.1 dd_Smed_v4_5483_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30019102SMED30019102SMESG000031415.1 SMESG000019663.1 dd_Smed_v4_15058_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032484ProtocadherinSMESG000072088.1 dd_Smed_v4_13570_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025831slc28a-3SMESG000057286.1 dd_Smed_v4_6348_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032921SMED30032921SMESG000014996.1 dd_Smed_v4_14458_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022797Striatin-interacting protein 1SMESG000044508.1 dd_Smed_v4_2332_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032731Ribose-phosphate pyrophosphokinaseSMESG000062796.1 dd_Smed_v4_12495_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035414Contactin rig-6SMESG000001429.1 dd_Smed_v4_14150_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020942Transcription intermediary factor 1 ASMESG000065316.1 SMESG000065309.1 dd_Smed_v4_7122_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032433Neuron navigator 2SMESG000058374.1 dd_Smed_v4_2618_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032229WH1 domain-containing proteinSMESG000069908.1 dd_Smed_v4_7714_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30033663SMED30033663SMESG000054684.1 SMESG000054674.1 dd_Smed_v4_13582_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30031778SMED30031778SMESG000007978.1 dd_Smed_v4_8009_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020851PHB domain-containing proteinSMESG000059569.1 dd_Smed_v4_7331_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026908BTB domain-containing proteinSMESG000017037.1 dd_Smed_v4_8654_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED300276035'-AMP-activated protein kinase subunit gamma-2SMESG000078418.1 dd_Smed_v4_8677_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30034055U5 small nuclear ribonucleoprotein 200 kDa helicaseSMESG000004936.1 dd_Smed_v4_7728_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025294rRNA 2'-O-methyltransferase fibrillarinSMESG000051648.1 dd_Smed_v4_2811_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026035SMED30026035SMESG000024811.1 SMESG000024808.1 dd_Smed_v4_9935_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029869Polypeptide N-acetylgalactosaminyltransferaseSMESG000011837.1 dd_Smed_v4_6094_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30024809Ubiquitin carboxyl-terminal hydrolaseSMESG000039982.1 dd_Smed_v4_3085_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30031905SMED30031905SMESG000004351.1 dd_Smed_v4_6343_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30033983Carbonic anhydrase 15SMESG000017182.1 dd_Smed_v4_11683_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029643Polypeptide N-acetylgalactosaminyltransferaseSMESG000011837.1 dd_Smed_v4_6094_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029746NFX1-type zinc finger-containing protein 1-likeSMESG000034905.1 dd_Smed_v4_2581_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30028307Peptidase M20 domain-containing protein 2SMESG000037374.1 SMESG000037372.1 SMESG000037364.1 dd_Smed_v4_5148_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30008674SMED30008674 dd_Smed_v4_2720_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018750SMED30018750SMESG000032765.1 SMESG000032764.1 dd_Smed_v4_9225_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015531Nuclear envelope phosphatase-regulatory subunit 1SMESG000076783.1 dd_Smed_v4_7741_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001048CSP domain-containing protein dd_Smed_v4_3631_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30019959NADH dehydrogenase subunit 4 dd_Smed_v4_344_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018509Glutamate receptor interacting protein 1SMESG000009125.1 dd_Smed_v4_7659_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30014645HP domain-containing proteinSMESG000075965.1 dd_Smed_v4_4193_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30011050hypothetical proteinSMESG000044135.1 dd_Smed_v4_8839_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016204cyclinG-like proteinSMESG000077612.1 dd_Smed_v4_6866_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012710SMED30012710SMESG000066979.1 dd_Smed_v4_4593_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30014863PiggyBac transposable element-derived protein 4 dd_Smed_v4_13954_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015595InnexinSMESG000032206.1 dd_Smed_v4_3879_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012212NADH dehydrogenase subunit 1 dd_Smed_v4_258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30014636Ribose-phosphate pyrophosphokinase dd_Smed_v4_8338_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001799NADH dehydrogenase subunit 5 dd_Smed_v4_258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30013571NADH dehydrogenase subunit 4L dd_Smed_v4_344_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30000702cytochrome b dd_Smed_v4_344_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30006696DNA-directed RNA polymerases I, II, and III subunit RPABC3 dd_Smed_v4_3675_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005334SMED30005334 dd_Smed_v4_344_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30002084Phosphatidylinositol-glycan biosynthesis class f protein dd_Smed_v4_6693_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009730SMED30009730 dd_Smed_v4_2410_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30013320Collagen alpha-2(IV) chainSMESG000002557.1 dd_Smed_v4_7811_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016430SMED30016430 dd_Smed_v4_275_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30003554DDE_3 domain-containing protein dd_Smed_v4_5882_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30014131RPTOR independent companion of MTOR, complex 2 aSMESG000024212.1 SMESG000033570.1 dd_Smed_v4_9324_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016351SMED30016351 dd_Smed_v4_2295_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30004833SMED30004833 dd_Smed_v4_33060_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30017596Metallo-beta-lactamase domain-containing protein 1 dd_Smed_v4_4672_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009734Iron-sulfur cluster assembly 1 dd_Smed_v4_4788_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009616Actin-related protein 2/3 complex subunit 3 dd_Smed_v4_4649_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30010443Death-associated protein 1 dd_Smed_v4_946_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30004246SMED30004246 dd_Smed_v4_344_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30011310SMED30011310 dd_Smed_v4_2712_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30007387SMED30007387 dd_Smed_v4_23086_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001327DNA-directed RNA polymerases I, II, and III subunit RPABC4 dd_Smed_v4_2720_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015381Transmembrane GTPase MarfSMESG000003246.1 dd_Smed_v4_5932_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30010499SMED30010499SMESG000055070.1 dd_Smed_v4_6915_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30019200Cytochrome b561/ferric reductase transmembrane,domain-containing proteinSMESG000021389.1 dd_Smed_v4_4028_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30003686NADH dehydrogenase subunit 2 dd_Smed_v4_505_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30021204SMED30021204SMESG000002557.1 dd_Smed_v4_7811_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED300298901-phosphatidylinositol 4,5-bisphosphate phosphodiesteraseSMESG000024212.1 SMESG000033570.1 dd_Smed_v4_9324_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30028097PhosphodiesteraseSMESG000051078.1 dd_Smed_v4_6976_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30028106SMED30028106 dd_Smed_v4_5761_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032552SMED30032552 dd_Smed_v4_19956_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022519p2X purinoceptor 4SMESG000020579.1 dd_Smed_v4_9166_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30023135Exonuclease 3'-5' domain-containing protein 1SMESG000053185.1 dd_Smed_v4_6723_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30030005Vesicle transport protein dd_Smed_v4_6215_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30031731Macrophage mannose receptor 1SMESG000078439.1 dd_Smed_v4_8262_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30034681cAMP-dependent protein kinase catalytic subunitSMESG000016651.1 dd_Smed_v4_911_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30033602Protein N-lysine methyltransferase METTL21ASMESG000033082.1 dd_Smed_v4_7520_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30028005Fermitin family member 1SMESG000005290.1 dd_Smed_v4_30299_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035631SMED30035631 dd_Smed_v4_339_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30031503SMED30031503 dd_Smed_v4_15845_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30028199Placenta specific protein 8 dd_Smed_v4_865_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30028849One cut domain family memberSMESG000007728.1 dd_Smed_v4_7877_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30034823SMED30034823SMESG000024340.1 dd_Smed_v4_822_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026678SMED30026678 dd_Smed_v4_3577_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026863SLIT-ROBO Rho GTPase activating proteinSMESG000028956.1 dd_Smed_v4_8708_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30024072Protein argonaute-3SMESG000051000.1 dd_Smed_v4_7594_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025683Transcription factor 7-like 1SMESG000017328.1 dd_Smed_v4_9140_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30023147SMED30023147SMESG000032765.1 SMESG000032764.1 dd_Smed_v4_9225_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30031308ATP synthase F0 subunit 6 dd_Smed_v4_258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30034623cytochrome c oxidase subunit III dd_Smed_v4_258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30028449High density lipoprotein binding protein (Vigilin)SMESG000016436.1 dd_Smed_v4_553_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30021982Troponin ISMESG000036684.1 dd_Smed_v4_7974_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025597SMED30025597SMESG000013105.1 dd_Smed_v4_9427_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022260Protein transport protein Sec31A-like ProteinSMESG000039324.1 dd_Smed_v4_4230_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029695patched-like proteinSMESG000003567.1 dd_Smed_v4_7063_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30034308Integrase catalytic domain-containing protein dd_Smed_v4_12778_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029437SMED30029437SMESG000033809.1 SMESG000033801.1 dd_Smed_v4_8849_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020043SJCHGC04876 proteinSMESG000058578.1 dd_Smed_v4_7237_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026531cytochrome c oxidase subunit II dd_Smed_v4_297_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30033740SMED30033740 dd_Smed_v4_258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30033478Dis3 exonuclease 1SMESG000057169.1 dd_Smed_v4_6527_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30027574Non-specific serine/threonine protein kinase dd_Smed_v4_25001_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026477SMED30026477 dd_Smed_v4_275_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30023158Frizzled-4SMESG000037982.1 SMESG000037981.1 dd_Smed_v4_13356_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30034119SPRY domain-containing SOCS box protein 3SMESG000069126.1 SMESG000069122.1 dd_Smed_v4_2076_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30023659Acid-sensing ion channel 1SMESG000016710.1 dd_Smed_v4_12878_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30023885PDZ domain-containing proteinSMESG000012918.1 dd_Smed_v4_11887_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30028328Protocadherin alpha-2SMESG000069340.1 dd_Smed_v4_14209_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30034820transferrin-1SMESG000027225.1 dd_Smed_v4_14478_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30031741slc16a-17SMESG000035197.1 dd_Smed_v4_11626_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30033302RNA-binding protein MEX3BSMESG000044270.1 SMESG000030021.1 SMESG000025422.1 dd_Smed_v4_1999_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029183Calcium:calmodulin dependent protein kinase typeSMESG000027403.1 SMESG000027402.1 dd_Smed_v4_11876_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035302Glycine receptor subunit alpha-2SMESG000077704.1 dd_Smed_v4_14666_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035873Mitochondrial 28S ribosomal protein S21SMESG000059504.1 dd_Smed_v4_1993_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED3003258926S proteasome regulatory subunit 6A homologSMESG000005152.1 dd_Smed_v4_1855_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020038Actinin alphaSMESG000040562.1 dd_Smed_v4_10174_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022346SMED30022346SMESG000062604.1 dd_Smed_v4_12574_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30021820Guanylate cyclaseSMESG000056411.1 dd_Smed_v4_11767_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30013533Dolichol-phosphate mannosyltransferase subunit 1SMESG000008665.1 dd_Smed_v4_5598_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012932RapunzelSMESG000037569.1 dd_Smed_v4_811_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30019835Peptidylprolyl isomerase domain and WD repeat-containing protein 1SMESG000004636.1 dd_Smed_v4_7620_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30017824SMED30017824SMESG000029435.1 dd_Smed_v4_8467_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012777Usp domain-containing proteinSMESG000035960.1 dd_Smed_v4_7254_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016491SMED30016491SMESG000043799.1 dd_Smed_v4_3767_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30014569SMED30014569SMESG000021079.1 dd_Smed_v4_5027_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30011674PapilinSMESG000003930.1 SMESG000003917.1 dd_Smed_v4_8833_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30017555Lipopolysaccharide cholinephosphotransferaseSMESG000043355.1 dd_Smed_v4_2367_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018603Receptor expression-enhancing proteinSMESG000043862.1 dd_Smed_v4_838_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015763Bravo_FIGEY domain-containing proteinSMESG000064374.1 dd_Smed_v4_7836_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016172RING finger protein 17SMESG000044364.1 dd_Smed_v4_4594_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012646SMED30012646SMESG000047460.1 dd_Smed_v4_5132_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015211SMED30015211SMESG000026762.1 dd_Smed_v4_3134_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015352ANK_REP_REGION domain-containing proteinSMESG000078716.1 dd_Smed_v4_9826_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020485Serine/threonine-protein phosphataseSMESG000019044.1 dd_Smed_v4_3429_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020180U4/U6.U5 small nuclear ribonucleoprotein 27 kDa protein-like proteinSMESG000029048.1 dd_Smed_v4_6062_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020359Smed-NDK-3SMESG000046244.1 SMESG000046208.1 dd_Smed_v4_6604_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015290Neur_chan_LBD domain-containing proteinSMESG000012532.1 dd_Smed_v4_13861_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30004876Nuclear receptor subfamily 4 group ASMESG000063104.1 dd_Smed_v4_12229_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30019771Ammonium transporter Rh type BSMESG000048384.1 dd_Smed_v4_1882_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30017913Fzd-5/8-3SMESG000035834.1 dd_Smed_v4_16571_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012817Methionine synthaseSMESG000054393.1 dd_Smed_v4_10302_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018464DNA replication complex GINS protein PSF1SMESG000057051.1 SMESG000057052.1 dd_Smed_v4_4317_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30014626CCHC-type domain-containing proteinSMESG000041616.1 dd_Smed_v4_13815_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30000524SMED30000524SMESG000004865.1 dd_Smed_v4_9063_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001359SMED30001359SMESG000059918.1 SMESG000052306.1 SMESG000022407.1 dd_Smed_v4_1996_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30011742smad4SMESG000013170.1 SMESG000013169.1 dd_Smed_v4_1923_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30004307HTH CENPB-type domain-containing proteinSMESG000014996.1 dd_Smed_v4_14458_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016132Nuclear receptor subfamily 4 group A member 1-like proteinSMESG000023455.1 SMESG000018675.1 dd_Smed_v4_15865_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30019831FerritinSMESG000003695.1 dd_Smed_v4_3974_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012792Netrin 1SMESG000069610.1 dd_Smed_v4_18181_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30019320Stromal interaction molecule 2SMESG000052167.1 SMESG000045892.1 SMESG000045881.1 dd_Smed_v4_7756_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30024336E3 ubiquitin-protein ligase RNF13SMESG000013170.1 SMESG000013169.1 dd_Smed_v4_1923_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029821RING-type domain-containing proteinSMESG000028227.1 dd_Smed_v4_7396_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029724SMED30029724SMESG000074766.1 dd_Smed_v4_3876_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30021348Alanine aminotransferaseSMESG000007253.1 SMESG000007248.1 dd_Smed_v4_2988_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30034364Platelet-activating factor acetylhydrolase IB subunit gammaSMESG000016097.1 dd_Smed_v4_4977_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30027303Methylcrotonoyl-CoA carboxylase 2 (beta)SMESG000035087.1 dd_Smed_v4_5574_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026445SHSP domain-containing proteinSMESG000030562.1 dd_Smed_v4_5406_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30033339Phospholipid phosphatase 5SMESG000054830.1 dd_Smed_v4_3897_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032950Integrator complex subunit 3-like proteinSMESG000033343.1 dd_Smed_v4_4426_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022579SMED30022579SMESG000001429.1 dd_Smed_v4_14150_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032841HEAT repeat-containing protein 6-likeSMESG000057619.1 dd_Smed_v4_8372_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025313Thioredoxin glutathione reductaseSMESG000020047.1 dd_Smed_v4_960_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025753SMED30025753SMESG000016791.1 dd_Smed_v4_10_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30033284Down syndrome cell adhesion moleculeSMESG000024214.1 dd_Smed_v4_3024_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025215Fzd-1/2/7SMESG000040115.1 dd_Smed_v4_6353_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30030113Exocyst complex component 4SMESG000070793.1 dd_Smed_v4_8308_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30023411slc42a-1SMESG000048384.1 dd_Smed_v4_1882_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30023025Calcineurin subunit B typeSMESG000019278.1 dd_Smed_v4_4924_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025197Telomere length and silencing protein 1 homologSMESG000047511.1 dd_Smed_v4_8171_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30034248SMED30034248SMESG000005941.1 dd_Smed_v4_3832_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020656SMED30020656SMESG000003588.1 dd_Smed_v4_17155_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035174SMED30035174 dd_Smed_v4_6013_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30034324Tubulin alpha chainSMESG000005035.1 dd_Smed_v4_1623_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026346CCHC-type domain-containing protein dd_Smed_v4_17809_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30028609rho GTPase-activating protein 39SMESG000029199.1 dd_Smed_v4_5836_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30036035SMED30036035 dd_Smed_v4_11595_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30031123RING-type domain-containing proteinSMESG000064076.1 dd_Smed_v4_4338_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30023707Retrovirus-related Pol polyprotein from transposon dd_Smed_v4_12993_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30030716RibonucleaseSMESG000022763.1 dd_Smed_v4_10404_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022463SMED30022463 dd_Smed_v4_1325_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30034636Tyrosine-protein phosphatase non-receptor type 9SMESG000027354.1 dd_Smed_v4_2827_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026581Otopetrin-2-like isoform X1 isoform 2 dd_Smed_v4_7349_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30034101SMED30034101 dd_Smed_v4_3534_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30021481Metaxin 1SMESG000013267.1 dd_Smed_v4_5152_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032895Survival of motor neuron-related-splicing factor 30SMESG000050984.1 dd_Smed_v4_5356_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30034012SMED30034012SMESG000057380.1 dd_Smed_v4_2856_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025154SMED30025154 dd_Smed_v4_9589_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026231SMED30026231 dd_Smed_v4_10853_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035828SMED30035828 dd_Smed_v4_1325_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020634SMED30020634SMESG000081436.1 dd_Smed_v4_9784_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025335Mediator of RNA polymerase II transcription subunit 13SMESG000034328.1 dd_Smed_v4_5628_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022087TNFR CD27 30 40 95 cysteine rich regionSMESG000065173.1 dd_Smed_v4_3783_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005523Alpha-actininSMESG000026000.1 dd_Smed_v4_1951_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015074RNA-binding protein 34SMESG000041747.1 dd_Smed_v4_5246_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015546Cyclic AMP-responsive element-binding protein 3SMESG000059546.1 dd_Smed_v4_1032_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30019649Translocator proteinSMESG000002991.1 dd_Smed_v4_2256_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30007889SMED30007889SMESG000062027.1 dd_Smed_v4_6700_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001038antichymotrypsin-2-like isoform X2SMESG000078707.1 dd_Smed_v4_5315_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016397Transforming acidic coiled-coil-containing protein 3SMESG000056367.1 dd_Smed_v4_8744_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30017880Alpha-int-1SMESG000022733.1 dd_Smed_v4_11655_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30011984partitioning defective 3 homolog isoform X2SMESG000071209.1 dd_Smed_v4_5548_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30019130Junctophilin-1SMESG000001306.1 dd_Smed_v4_4752_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015204ProtocadherinSMESG000029673.1 dd_Smed_v4_9677_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30007389Peripheral plasma membrane protein CASKSMESG000060582.1 dd_Smed_v4_7723_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30007733SMED30007733SMESG000033682.1 dd_Smed_v4_19588_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30013108Syntaxin-binding protein 1SMESG000013817.1 dd_Smed_v4_7111_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30003218SMED30003218SMESG000027728.1 dd_Smed_v4_9752_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED300119385'-AMP-activated protein kinase subunit gamma-1SMESG000078418.1 dd_Smed_v4_8677_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005459SMED30005459SMESG000014884.1 dd_Smed_v4_2661_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30019702SMED30019702SMESG000016033.1 SMESG000000571.1 dd_Smed_v4_661_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016830slc39a-5SMESG000015061.1 dd_Smed_v4_11586_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018588MusashiSMESG000077233.1 dd_Smed_v4_8902_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30008639MyoD-like proteinSMESG000034317.1 dd_Smed_v4_12634_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018848SMED30018848SMESG000030069.1 dd_Smed_v4_8359_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30004946Zona pellucida-like domain proteinSMESG000052888.1 SMESG000001180.1 dd_Smed_v4_17259_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30003142SMED30003142SMESG000029028.1 dd_Smed_v4_10003_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009302SMED30009302SMESG000025000.1 dd_Smed_v4_363_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30019192SMED30019192SMESG000072463.1 dd_Smed_v4_12173_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30017146Zinc finger homeobox protein 3SMESG000064905.1 dd_Smed_v4_7033_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016398Piezo-type mechanosensitive ion channel componentSMESG000051188.1 SMESG000002890.1 dd_Smed_v4_1447_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30019538SMED30019538SMESG000078196.1 dd_Smed_v4_3823_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012368Prominin (Prom) protein, putativeSMESG000025078.1 dd_Smed_v4_6506_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001793UDP-N-acetylglucosamine--peptide N-acetylglucosaminyltransferase subunitSMESG000002813.1 dd_Smed_v4_2939_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30004705SMED30004705SMESG000001306.1 dd_Smed_v4_4752_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016583SMED30016583SMESG000020949.1 dd_Smed_v4_13527_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30006782Pecanex_C domain-containing proteinSMESG000057835.1 dd_Smed_v4_4696_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001395neural proliferation differentiation and control protein 1SMESG000059206.1 dd_Smed_v4_2985_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018542slc4a-1SMESG000024335.1 dd_Smed_v4_3003_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30000996Protein CASPSMESG000025654.1 dd_Smed_v4_5685_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005212SMED30005212SMESG000042005.1 dd_Smed_v4_3333_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30002374phytanoyl-CoA dioxygenase domain-containing protein 1 homologSMESG000077696.1 SMESG000077694.1 dd_Smed_v4_1292_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30003064SMED30003064SMESG000046622.1 dd_Smed_v4_17337_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30008486SMED30008486SMESG000014085.1 SMESG000014086.1 SMESG000014087.1 dd_Smed_v4_10249_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30010890Y box binding protein 1SMESG000008704.1 dd_Smed_v4_347_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30014246Ras-related protein Rab-5ASMESG000064914.1 dd_Smed_v4_796_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009225Pyridoxal kinaseSMESG000011589.1 dd_Smed_v4_6613_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009820ATP-dependent RNA helicase DHX8SMESG000038843.1 dd_Smed_v4_5357_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30014351Nuclear receptor subfamily 1-like proteinSMESG000033954.1 dd_Smed_v4_9282_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001060Dipeptidyl-peptidase 9SMESG000036809.1 dd_Smed_v4_8398_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30006989Eukaryotic translation initiation factor 2-alpha kinase 3SMESG000032681.1 SMESG000032678.1 SMESG000032676.1 dd_Smed_v4_5111_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30004897Beta-1,4-galactosyltransferase 4SMESG000002057.1 dd_Smed_v4_13813_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005117SMED30005117SMESG000049162.1 dd_Smed_v4_2620_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001455SMED30001455SMESG000012934.1 dd_Smed_v4_103_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED300070105-hydroxytryptamine receptor 1ASMESG000017736.1 dd_Smed_v4_5341_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015261bax-1SMESG000037989.1 SMESG000037406.1 dd_Smed_v4_9696_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30007718Flotillin-1SMESG000063612.1 dd_Smed_v4_1887_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009362Inositol-pentakisphosphate 2-kinaseSMESG000069691.1 dd_Smed_v4_7143_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30010978nuclear pore complex protein Nup155SMESG000035494.1 dd_Smed_v4_7844_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30014498SMED30014498SMESG000026106.1 dd_Smed_v4_6193_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30004708Calcium-binding protein, putativeSMESG000024341.1 dd_Smed_v4_1627_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30010386Protein kinase domain-containing proteinSMESG000024811.1 SMESG000024808.1 dd_Smed_v4_9935_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30017971ANK_REP_REGION domain-containing proteinSMESG000026132.1 dd_Smed_v4_6201_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30014504Fer-1-relatedSMESG000075933.1 dd_Smed_v4_6816_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009388Heparan sulfate 2-O-sulfotransferase 1SMESG000065597.1 dd_Smed_v4_6699_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022101Down syndrome cell adhesion moleculeSMESG000048977.1 dd_Smed_v4_5856_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032106SMED30032106SMESG000080318.1 dd_Smed_v4_8948_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30033585Elongation of very long chain fatty acids proteinSMESG000021565.1 dd_Smed_v4_523_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022869Cyclin-YSMESG000031613.1 dd_Smed_v4_8226_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30033595Lipase_GDSL domain-containing proteinSMESG000081136.1 dd_Smed_v4_6241_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029215Mitogen-activated protein kinaseSMESG000012868.1 dd_Smed_v4_6042_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30028242AlkB homolog 3, alpha-ketoglutaratedependent dioxygenaseSMESG000044993.1 dd_Smed_v4_7441_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026996ATP-dependent rRNA helicase RRP3SMESG000067540.1 SMESG000060310.1 dd_Smed_v4_8047_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30027361Adenylate kinaseSMESG000039607.1 SMESG000006671.1 dd_Smed_v4_9001_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025232Dynamin-1SMESG000067156.1 dd_Smed_v4_6863_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022819SMED30022819SMESG000017227.1 dd_Smed_v4_8264_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025736PHB domain-containing proteinSMESG000076275.1 dd_Smed_v4_5746_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30023664Tr-type G domain-containing proteinSMESG000040079.1 dd_Smed_v4_9327_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30031931Phosphatidate phosphatase LPIN2SMESG000013641.1 dd_Smed_v4_8002_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30000517Mitogen activated protein kinase kinase kinaseSMESG000017706.1 dd_Smed_v4_4486_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30006736colorectal mutant cancer proteinSMESG000002794.1 dd_Smed_v4_5396_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED300116841-phosphatidylinositol 4,5-bisphosphate phosphodiesteraseSMESG000049234.1 dd_Smed_v4_3221_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30007879SMED30007879SMESG000014356.1 dd_Smed_v4_4641_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30011970Colobus proteinSMESG000005049.1 dd_Smed_v4_4427_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30007927C2H2-type domain-containing proteinSMESG000032739.1 dd_Smed_v4_3827_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018507Calcium-transporting ATPaseSMESG000038461.1 dd_Smed_v4_4559_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018507Calcium-transporting ATPaseSMESG000038461.1 dd_Smed_v4_3170_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30006455Forkhead box protein N3SMESG000032627.1 SMESG000033244.1 dd_Smed_v4_4078_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016950DystrophinSMESG000020523.1 dd_Smed_v4_5325_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30019039MetalloendopeptidaseSMESG000005882.1 dd_Smed_v4_5652_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001663Expressed conserved proteinSMESG000057766.1 dd_Smed_v4_4288_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001663Expressed conserved proteinSMESG000057766.1 dd_Smed_v4_6533_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001196Myosin headSMESG000049494.1 dd_Smed_v4_2912_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30002721beta-parvinSMESG000080798.1 SMESG000054735.1 SMESG000030429.1 dd_Smed_v4_6842_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30002721beta-parvinSMESG000080798.1 SMESG000054735.1 dd_Smed_v4_9524_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30017209DIX domain containing 1SMESG000033276.1 SMESG000003898.1 dd_Smed_v4_3834_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30019232SMED30019232SMESG000050994.1 dd_Smed_v4_2478_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30010941dnaJ homolog subfamily B member 13SMESG000076708.1 dd_Smed_v4_4820_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001254SMED30001254SMESG000025206.1 dd_Smed_v4_4615_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009816Ral GTPase-activating protein subunit betaSMESG000028929.1 dd_Smed_v4_8678_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012419Non-specific serine/threonine protein kinaseSMESG000069962.1 SMESG000069953.1 SMESG000069952.1 dd_Smed_v4_3244_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015468SMED30015468SMESG000050994.1 dd_Smed_v4_2478_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018604Neuronal calcium sensor 2SMESG000081434.1 SMESG000029869.1 dd_Smed_v4_6534_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30000311RING-type domain-containing proteinSMESG000081132.1 dd_Smed_v4_6290_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012139slc2a-2SMESG000081673.1 dd_Smed_v4_3190_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30013633Arf-GAP with GTPase, ANK repeat and PH domain-containing protein 3SMESG000075717.1 dd_Smed_v4_4301_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30000108Glycerol-3-phosphate dehydrogenase [NAD( )]SMESG000008767.1 dd_Smed_v4_4661_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30002983Tropomyosin-2SMESG000000190.1 dd_Smed_v4_436_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009873SMED30009873SMESG000016812.1 SMESG000016788.1 SMESG000016785.1 SMESG000016784.1 SMESG000016778.1 SMESG000016777.1 SMESG000016774.1 SMESG000016773.1 SMESG000016772.1 dd_Smed_v4_422_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30002064Doublecortin domain-containing protein 2SMESG000040482.1 SMESG000040481.1 SMESG000040480.1 SMESG000038137.1 dd_Smed_v4_6464_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30010360Leucine Rich repeat-containing domain proteinSMESG000047911.1 SMESG000045664.1 dd_Smed_v4_2769_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018576Protein phosphatase methylesterase 1SMESG000035884.1 dd_Smed_v4_5813_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30003484SMED30003484SMESG000049494.1 dd_Smed_v4_2912_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012605FERM domain-containing proteinSMESG000034888.1 dd_Smed_v4_4999_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026131SMED30026131SMESG000027311.1 dd_Smed_v4_1401_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035317Phosphoglycerate kinaseSMESG000039090.1 dd_Smed_v4_972_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022929WntASMESG000051375.1 SMESG000037126.1 dd_Smed_v4_4877_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30033019nou darake like-5SMESG000070953.1 dd_Smed_v4_5102_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30028571PellinoSMESG000081434.1 SMESG000029869.1 dd_Smed_v4_6534_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30021485SMED30021485SMESG000059844.1 dd_Smed_v4_1328_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30034143SMED30034143SMESG000060913.1 dd_Smed_v4_12123_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035448Kinesin motor domain proteinSMESG000075721.1 dd_Smed_v4_11799_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035241Protein phosphatase 1 regulatory subunit 3ASMESG000078349.1 dd_Smed_v4_1526_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029487Smed-NDKSMESG000062038.1 dd_Smed_v4_11285_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30028387F-box and leucine rich repeat protein 16SMESG000006324.1 dd_Smed_v4_12738_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30024775TransgelinSMESG000000987.1 dd_Smed_v4_1512_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025910Microtubule-associated protein futschSMESG000030021.1 SMESG000000893.1 dd_Smed_v4_2033_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025910Microtubule-associated protein futschSMESG000044270.1 SMESG000030021.1 SMESG000025422.1 dd_Smed_v4_1999_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30034967Myosin headSMESG000049494.1 dd_Smed_v4_2912_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025821Multiple PDZ domain crumbs cell polarity complex componentSMESG000053393.1 dd_Smed_v4_5376_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30030785Arf-GAP with GTPase ANK repeat and PH domain-containing protein 1/3SMESG000075717.1 dd_Smed_v4_4301_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30027842Speckle-type POZ proteinSMESG000075717.1 dd_Smed_v4_4301_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30024185slc10a-5SMESG000064830.1 dd_Smed_v4_11330_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30034303Exportin-4SMESG000055190.1 dd_Smed_v4_10330_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025363SMED30025363SMESG000014711.1 dd_Smed_v4_1754_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30028311Spectrin beta chainSMESG000066485.1 dd_Smed_v4_12996_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30028311Spectrin beta chainSMESG000066485.1 dd_Smed_v4_7344_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035963SMED30035963SMESG000071278.1 dd_Smed_v4_1649_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029555Serine/arginine-rich splicing factor 4SMESG000045507.1 SMESG000045502.1 dd_Smed_v4_13817_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30034464Ig-like domain-containing proteinSMESG000012091.1 dd_Smed_v4_2864_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30028839hemicentin-1 isoform X2SMESG000003113.1 dd_Smed_v4_13903_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026043UTP--glucose-1-phosphate uridylyltransferaseSMESG000043519.1 dd_Smed_v4_3057_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30030980S-phase kinase-associated protein 1SMESG000054815.1 dd_Smed_v4_1337_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020388Glycerol-3-phosphate dehydrogenaseSMESG000076995.1 SMESG000076994.1 SMESG000076983.1 SMESG000076982.1 dd_Smed_v4_4928_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30030025SynaptogyrinSMESG000051237.1 SMESG000051238.1 dd_Smed_v4_1195_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30033982Terminal uridylyltransferase 7SMESG000007068.1 dd_Smed_v4_10161_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30033153Partitioning defective 3-likeSMESG000050856.1 dd_Smed_v4_11296_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032373Centrosomal protein of 135 kDaSMESG000079518.1 SMESG000070566.1 dd_Smed_v4_6933_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025882Protein FAM13ASMESG000052108.1 dd_Smed_v4_12046_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30027983Glypican-1SMESG000032627.1 SMESG000033244.1 dd_Smed_v4_4078_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032915Alkaline phosphataseSMESG000061191.1 dd_Smed_v4_8942_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029603SMED30029603SMESG000071278.1 dd_Smed_v4_1649_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30034467Protein tyrosine phosphatase type IVASMESG000078978.1 SMESG000078867.1 SMESG000010171.1 dd_Smed_v4_2239_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032105Polypeptide N-acetylgalactosaminyltransferaseSMESG000025206.1 dd_Smed_v4_4615_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30024929Rap guanine nucleotide exchange factor 2SMESG000033489.1 SMESG000033486.1 dd_Smed_v4_4950_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30028575Serine/threonine-protein phosphatase with EF-handsSMESG000042202.1 dd_Smed_v4_11874_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30030459SMED30030459SMESG000041220.1 dd_Smed_v4_14151_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30027830Protein regulator of cytokinesis 1SMESG000059381.1 dd_Smed_v4_1852_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30033804TransporterSMESG000003011.1 dd_Smed_v4_5713_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30031352SMED30031352SMESG000006235.1 dd_Smed_v4_6275_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025783NADPH--cytochrome P450 reductaseSMESG000022047.1 dd_Smed_v4_542_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30031270E3 UFM1-protein ligase 1SMESG000023187.1 dd_Smed_v4_5571_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025205InnexinSMESG000078684.1 SMESG000060499.1 dd_Smed_v4_6114_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30027550tRNA (adenine(58)-N(1))-methyltransferase non-catalytic subunit TRM6SMESG000072786.1 dd_Smed_v4_3327_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30031029Protein kinaseSMESG000025153.1 SMESG000025152.1 dd_Smed_v4_6230_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30024416Potassium channel tetramerization domain containing 1SMESG000067417.1 dd_Smed_v4_3793_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30033622Protocadherin-1SMESG000059440.1 dd_Smed_v4_6251_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035262Wilms tumor protein 1-interacting protein homologSMESG000031934.1 dd_Smed_v4_7984_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020989Glycine-rich domain-containing protein 1SMESG000047460.1 dd_Smed_v4_5132_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30030871Dual specificity tyrosine-phosphorylation-regulated kinase 1BSMESG000064415.1 dd_Smed_v4_3773_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30021129Sorting and assembly machinery component 50 homologSMESG000079491.1 dd_Smed_v4_4146_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025561SMED30025561SMESG000023796.1 SMESG000022519.1 dd_Smed_v4_4282_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30024011low-density lipoprotein receptor-related protein 2-likeSMESG000017299.1 dd_Smed_v4_6585_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029432SMED30029432SMESG000057599.1 dd_Smed_v4_450_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029432SMED30029432SMESG000057599.1 dd_Smed_v4_533_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029432SMED30029432SMESG000057599.1 dd_Smed_v4_635_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30034893glypican-1SMESG000052359.1 dd_Smed_v4_4154_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30024755Cationic amino acid transporterSMESG000081276.1 SMESG000081275.1 dd_Smed_v4_5465_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30027069Tensin 1SMESG000060707.1 dd_Smed_v4_4494_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020643Chromosome 11 open reading frame 58SMESG000030362.1 dd_Smed_v4_6127_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30031159Neuronal acetylcholine receptor subunit alpha-4SMESG000069967.1 dd_Smed_v4_6939_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029104ProtocadherinSMESG000002712.1 dd_Smed_v4_9106_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025978SMED30025978SMESG000069967.1 dd_Smed_v4_6939_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30024611Terminal nucleotidyltransferase 5CSMESG000052359.1 dd_Smed_v4_4154_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30024611Terminal nucleotidyltransferase 5CSMESG000016756.1 dd_Smed_v4_3449_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30023280TitinSMESG000041478.1 dd_Smed_v4_2928_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026185Si:ch211-210c8.6SMESG000081276.1 SMESG000081275.1 dd_Smed_v4_5465_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30031444Fasciclin-2SMESG000038431.1 dd_Smed_v4_7422_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30014655Ubiquitin-conjugating enzyme E2 ZSMESG000055888.1 dd_Smed_v4_2349_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30007876Myosin regulatory light chain, putativeSMESG000026825.1 dd_Smed_v4_803_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED3000170160S ribosomal protein L7aSMESG000020535.1 dd_Smed_v4_296_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30011844Very-long-chain 3-oxoacyl-CoA reductaseSMESG000075064.1 dd_Smed_v4_3371_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30013932SMED30013932SMESG000055456.1 dd_Smed_v4_8147_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30011670DerlinSMESG000024268.1 dd_Smed_v4_2882_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015768adenomatous polyposis coli-like proteinSMESG000045688.1 SMESG000005328.1 dd_Smed_v4_6966_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30014535SMED30014535SMESG000004048.1 dd_Smed_v4_5948_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30010466Ribosomal protein S2SMESG000028845.1 dd_Smed_v4_3836_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30000147Inhibitor of growth proteinSMESG000056794.1 dd_Smed_v4_2936_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30003138Adenosine deaminaseSMESG000068461.1 SMESG000068458.1 dd_Smed_v4_6236_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30006209polyadenylate-binding protein 2SMESG000011330.1 dd_Smed_v4_2924_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30004289nuclear protein localization protein 4 homologSMESG000025775.1 dd_Smed_v4_5277_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016522DDE_3 domain-containing proteinSMESG000003593.1 dd_Smed_v4_9148_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015957Transcription elongation factor A protein 1SMESG000027575.1 dd_Smed_v4_3176_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30003403SMED30003403SMESG000074733.1 dd_Smed_v4_9825_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001326Eukaryotic translation initiation factor 3 subunit GSMESG000016857.1 dd_Smed_v4_5500_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30000256Golgin subfamily A member 2SMESG000047115.1 SMESG000004000.1 dd_Smed_v4_6515_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30002895ThioredoxinSMESG000023197.1 dd_Smed_v4_6702_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005895Protein YIPFSMESG000020934.1 dd_Smed_v4_2945_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30007895Protein kinase domain-containing proteinSMESG000080647.1 SMESG000010878.1 SMESG000010854.1 dd_Smed_v4_2866_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016592PPIP5K2_N domain-containing proteinSMESG000064337.1 dd_Smed_v4_6469_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED300068585'-AMP-activated protein kinase subunit gamma-1SMESG000001939.1 dd_Smed_v4_9052_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30013222Calcium-activated potassium channel slo-1, putativeSMESG000050831.1 dd_Smed_v4_5509_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005882SMED30005882SMESG000056627.1 SMESG000056607.1 dd_Smed_v4_7436_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED3001647139S ribosomal protein L21 mitochondrialSMESG000072214.1 SMESG000024477.1 dd_Smed_v4_2553_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012841InnexinSMESG000070656.1 dd_Smed_v4_8019_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30004019SMED30004019SMESG000075505.1 dd_Smed_v4_8346_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30007607SMED30007607SMESG000050535.1 SMESG000050533.1 dd_Smed_v4_5107_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30019735InnexinSMESG000070656.1 dd_Smed_v4_8019_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30004743Fibronectin type-III domain-containing protein 3aSMESG000010713.1 dd_Smed_v4_4612_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30004868NeuroD-2 proteinSMESG000081091.1 dd_Smed_v4_9906_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED3001771026S proteasome non-ATPase regulatory subunit 7SMESG000004091.1 SMESG000004074.1 dd_Smed_v4_2665_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED3000667239S ribosomal protein L18SMESG000028266.1 dd_Smed_v4_2647_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015682Thioredoxin domain-containing proteinSMESG000063824.1 dd_Smed_v4_6362_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30010543La-domain-containing proteinSMESG000069155.1 SMESG000016232.1 dd_Smed_v4_4517_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012499Transcription initiation factor TFIID subunit 10SMESG000080497.1 dd_Smed_v4_7424_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED3000680826S proteasome non-ATPase regulatory subunit 8SMESG000035221.1 dd_Smed_v4_3245_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30003662Serine/threonine-protein phosphatase 2A 55 kDa regulatory subunit BSMESG000074250.1 dd_Smed_v4_5857_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30017243Protein-glucosylgalactosylhydroxylysine glucosidaseSMESG000009911.1 SMESG000009910.1 dd_Smed_v4_606_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30008707F-box domain-containing proteinSMESG000026800.1 dd_Smed_v4_3719_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30014279Rna/rnp complex 1 interacting phosphataseSMESG000010123.1 SMESG000001476.1 dd_Smed_v4_4501_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30007075Fibrillin-2SMESG000081571.1 SMESG000081561.1 SMESG000081557.1 SMESG000081553.1 dd_Smed_v4_10142_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025566PlasminogenSMESG000045562.1 dd_Smed_v4_6014_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30010666Prolyl 4-hydroxylase subunit alpha-1-like proteinSMESG000005668.1 dd_Smed_v4_2877_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009776Collagen IV NC1 domain-containing proteinSMESG000066546.1 dd_Smed_v4_2500_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009776Collagen IV NC1 domain-containing proteinSMESG000066546.1 dd_Smed_v4_3747_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30006180Fibrillar collagen NC1 domain-containing proteinSMESG000031448.1 dd_Smed_v4_702_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30034400Procollagen-lysine 2-oxoglutarate 5-dioxygenaseSMESG000016065.1 dd_Smed_v4_4942_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018812protein kinase C-binding protein NELL1-likeSMESG000066109.1 dd_Smed_v4_11653_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30017714Basement membrane-specific heparan sulfate proteoglycan core proteinSMESG000075928.1 dd_Smed_v4_8356_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022127MIP20649pSMESG000075164.1 dd_Smed_v4_6811_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult fluorescence in situ hybridization evidence
muscle cellSMED30022127MIP20649pSMESG000075164.1 dd_Smed_v4_6811_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025379matrix metalloproteinaseSMESG000049445.1 dd_Smed_v4_3902_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025497secreted frizzled related protein 2SMESG000050379.1 dd_Smed_v4_8832_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30031256wntP-2SMESG000066476.1 dd_Smed_v4_7326_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015470SparcSMESG000024280.1 dd_Smed_v4_1021_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015575Collagen alpha-1(IV) chainSMESG000016766.1 dd_Smed_v4_2337_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018643Fibrillar collagen NC1 domain-containing proteinSMESG000028920.1 dd_Smed_v4_832_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult fluorescence in situ hybridization evidence
muscle cellSMED30018643Fibrillar collagen NC1 domain-containing proteinSMESG000028920.1 dd_Smed_v4_832_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30023928Netrin-1SMESG000076695.1 dd_Smed_v4_8504_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30024011low-density lipoprotein receptor-related protein 2-likeSMESG000017299.1 dd_Smed_v4_6585_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30034893glypican-1SMESG000052359.1 dd_Smed_v4_4154_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30024611Terminal nucleotidyltransferase 5CSMESG000052359.1 dd_Smed_v4_4154_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026322matrix metalloproteinaseSMESG000049445.1 dd_Smed_v4_2972_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022402Neurogenic locus Notch proteinSMESG000077889.1 dd_Smed_v4_10716_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026602Wnt2-1SMESG000002069.1 dd_Smed_v4_13487_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30023930slit1SMESG000068721.1 dd_Smed_v4_12111_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30014427Procollagen-lysine 2-oxoglutarate 5-dioxygenase dd_Smed_v4_3457_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30013320Collagen alpha-2(IV) chainSMESG000002557.1 dd_Smed_v4_7811_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30010499SMED30010499SMESG000055070.1 dd_Smed_v4_6915_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30021204SMED30021204SMESG000002557.1 dd_Smed_v4_7811_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020950SMED30020950SMESG000055070.1 dd_Smed_v4_6915_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035878Collagen alpha-1(XXVII) chain BSMESG000026651.1 SMESG000026649.1 dd_Smed_v4_649_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30027813A disintegrin and metalloproteinase with thrombospondin motifsSMESG000038885.1 dd_Smed_v4_10259_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30034403Prolyl 4-hydroxylase subunit alpha-2SMESG000060999.1 dd_Smed_v4_6625_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30027246SMED30027246SMESG000047430.1 dd_Smed_v4_20269_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30000153Netrin 1SMESG000006779.1 dd_Smed_v4_9737_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035881noggin-like protein 7SMESG000016086.1 dd_Smed_v4_10469_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025680Anosmin-1SMESG000033070.1 dd_Smed_v4_13188_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30003562Collagen type IV alpha 2 chainSMESG000077782.1 dd_Smed_v4_701_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30019722secreted frizzled related protein 3SMESG000058717.1 dd_Smed_v4_11070_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009858Polyadenylate-binding proteinSMESG000044671.1 SMED30009858smed_20140614PMID:28807897
Bansal et al., 2017
whole organism asexual adult fluorescence in situ hybridization evidence
muscle cellSMED30028040Cysteine and glycine-rich proteinSMESG000049512.1 dd_Smed_v4_373_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025384hypothetical proteinSMESG000077040.1 dd_Smed_v4_7293_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035995p53 induced proteinSMESG000037354.1 dd_Smed_v4_9539_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30027578SMED30027578SMESG000072474.1 SMESG000072473.1 dd_Smed_v4_2635_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30033946SMED30033946SMESG000009259.1 dd_Smed_v4_4484_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30021652Ras association domain family member 7aSMESG000080298.1 dd_Smed_v4_3722_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025404tRNA-splicing endonuclease subunit Sen34SMESG000049881.1 dd_Smed_v4_4610_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30028728GTP-binding protein rhoASMESG000076727.1 dd_Smed_v4_2784_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30027388SMED30027388SMESG000037904.1 dd_Smed_v4_6832_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30021559SMED30021559SMESG000079496.1 dd_Smed_v4_6860_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025008SMED30025008SMESG000051756.1 dd_Smed_v4_9692_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026614DDE_Tnp_IS1595 domain-containing proteinSMESG000080852.1 dd_Smed_v4_7818_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30029009SMED30029009SMESG000066935.1 dd_Smed_v4_4765_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026735Poly(RC)-binding protein 3SMESG000028069.1 dd_Smed_v4_8431_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30024442Serine/threonine kinaseSMESG000079489.1 SMESG000049701.1 dd_Smed_v4_2586_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30023860ParamyosinSMESG000058328.1 dd_Smed_v4_711_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30022247p53 induced proteinSMESG000037354.1 dd_Smed_v4_9539_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30031920calmodulin-like protein 3SMESG000067105.1 dd_Smed_v4_4944_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30026334Nucleolar protein isoform 2SMESG000007822.1 dd_Smed_v4_7593_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30023994SMED30023994SMESG000076399.1 dd_Smed_v4_5426_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30023344Sn1-specific diacylglycerol lipase betaSMESG000046500.1 dd_Smed_v4_13306_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30023110FilaminSMESG000011386.1 dd_Smed_v4_810_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032093Protein kinase domain-containing proteinSMESG000024489.1 dd_Smed_v4_4401_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032093Protein kinase domain-containing proteinSMESG000024489.1 SMESG000024487.1 dd_Smed_v4_5789_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30032093Protein kinase domain-containing proteinSMESG000024489.1 dd_Smed_v4_5366_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035773SMED30035773SMESG000017090.1 dd_Smed_v4_6825_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30031158Cytospin-ASMESG000025886.1 dd_Smed_v4_5788_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30025553Cell polarity proteinSMESG000027800.1 dd_Smed_v4_4789_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30033672slc25a-24SMESG000016412.1 dd_Smed_v4_8945_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30030062SMED30030062SMESG000049230.1 dd_Smed_v4_3251_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30020478negative regulator of reactive oxygen species-likeSMESG000080200.1 dd_Smed_v4_9875_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30030788SMED30030788SMESG000079496.1 dd_Smed_v4_6860_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30031435SMED30031435SMESG000020814.1 dd_Smed_v4_5728_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30002297PhosphodiesteraseSMESG000023094.1 dd_Smed_v4_6991_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001768SMED30001768SMESG000031130.1 dd_Smed_v4_5251_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30014066Mitochondrial inner membrane protein OXA1-likeSMESG000037478.1 dd_Smed_v4_4254_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30007858netrin receptor-like proteinSMESG000042475.1 dd_Smed_v4_11409_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009207musculinSMESG000018258.1 dd_Smed_v4_16070_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30002350Ig-like domain-containing proteinSMESG000006317.1 dd_Smed_v4_13555_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30010877Calcium load-activated calcium channelSMESG000016852.1 dd_Smed_v4_2854_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30002742DystoninSMESG000043809.1 SMESG000043799.1 dd_Smed_v4_1205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30005596SMED30005596SMESG000064097.1 dd_Smed_v4_9867_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001036Receptor-type tyrosine-protein phosphatase betaSMESG000050003.1 SMESG000005247.1 dd_Smed_v4_5794_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30000093Quinone oxidoreductaseSMESG000006168.1 dd_Smed_v4_2717_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30017327X-linked retinitis pigmentosa GTPase regulator-like proteinSMESG000005762.1 dd_Smed_v4_7506_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015808TNF receptor-associated factorSMESG000006455.1 dd_Smed_v4_11785_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30007894Exportin 1 (CRM1 homolog, yeast) bSMESG000025559.1 dd_Smed_v4_3264_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30018389SMED30018389SMESG000054821.1 dd_Smed_v4_3684_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30009218Receptor expression-enhancing proteinSMESG000036637.1 dd_Smed_v4_1995_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30011666SMED30011666SMESG000058269.1 dd_Smed_v4_7993_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30002665CREB-binding proteinSMESG000048249.1 dd_Smed_v4_9154_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001446RNA-binding protein 25SMESG000074806.1 dd_Smed_v4_3955_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015805SMED30015805SMESG000061114.1 dd_Smed_v4_8475_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001679Calcium-transporting ATPaseSMESG000014734.1 dd_Smed_v4_1721_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30014051TetraspaninSMESG000019444.1 dd_Smed_v4_11375_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015704Hox class homeodomain protein DjAbd-BaSMESG000062714.1 dd_Smed_v4_12317_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30006583frizzled receptor-like proteinSMESG000004519.1 dd_Smed_v4_11650_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30004761Polypeptide N-acetylgalactosaminyltransferaseSMESG000076075.1 dd_Smed_v4_10587_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30013334Glutathione peroxidaseSMESG000077750.1 dd_Smed_v4_662_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001510Protein unc-79 homologSMESG000053097.1 dd_Smed_v4_6600_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30003750Vang-3SMESG000046198.1 SMESG000046194.1 dd_Smed_v4_15787_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012935TGc domain-containing proteinSMESG000080370.1 dd_Smed_v4_4149_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30006252SMED30006252SMESG000022827.1 dd_Smed_v4_2123_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016973Protein FRA10AC1 homologSMESG000029054.1 dd_Smed_v4_7308_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30019036SMED30019036SMESG000023295.1 dd_Smed_v4_10859_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016647Pyridine nucleotide-disulfide oxidoreductase domain-containing 1SMESG000020914.1 dd_Smed_v4_7078_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30012686Protein tincarSMESG000005995.1 dd_Smed_v4_6103_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30007097Rho guanine nucleotide exchange factor 28SMESG000021797.1 dd_Smed_v4_5252_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016623Potassium channel subfamily T member 1SMESG000042482.1 dd_Smed_v4_9739_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30010044Rho GTPase-activating protein 7SMESG000056012.1 dd_Smed_v4_9530_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001160SMED30001160SMESG000000384.1 dd_Smed_v4_10941_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30013503Tpd52 like 1SMESG000013104.1 dd_Smed_v4_2467_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30002449SMED30002449SMESG000051066.1 dd_Smed_v4_20805_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30001376Collagen IV NC1 domain-containing proteinSMESG000071508.1 dd_Smed_v4_1579_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30008035Secretory carrier-associated membrane proteinSMESG000037804.1 dd_Smed_v4_8593_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30006773Calpain-BSMESG000039299.1 dd_Smed_v4_1752_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30004335TBC1 domain family member 2BSMESG000012909.1 dd_Smed_v4_2925_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30019132ATP-binding cassette subfamily B member 8SMESG000038762.1 dd_Smed_v4_9641_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30002349GATA456-2SMESG000022702.1 dd_Smed_v4_9910_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30002377DNA-binding proteinSMESG000062714.1 dd_Smed_v4_12317_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30013006MetalloproteaseSMESG000000125.1 dd_Smed_v4_9683_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30019973Sm domain-containing proteinSMESG000010119.1 SMESG000001288.1 dd_Smed_v4_10184_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30019973Sm domain-containing protein dd_Smed_v4_3610_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30006663SMED30006663SMESG000029399.1 dd_Smed_v4_1499_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED3000412414-3-3 protein beta/alphaSMESG000055903.1 dd_Smed_v4_138_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30010561SMED30010561SMESG000076582.1 SMESG000066271.1 dd_Smed_v4_2649_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30015365Lysophosphatidic acid phosphatase type 6SMESG000000025.1 dd_Smed_v4_13744_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30019884Four and a half LIM domains 5SMESG000036525.1 dd_Smed_v4_3385_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30016879hypothetical proteinSMESG000058269.1 dd_Smed_v4_7993_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30000193Transposon Ty3-I Gag-Pol polyproteinSMESG000037107.1 dd_Smed_v4_6031_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult