neuron

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ In Situ Hybridization Data

  ▻ Sequences

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  neuron


DEFINITON:

  The basic cellular unit of nervous tissue. Each neuron consists of a body, an axon, and dendrites. Their purpose is to receive, conduct, and transmit impulses in the nervous system.


TERM DEFINITION CITATIONS:

  CL:0000540


TERM CITATIONS:


TERM ID:

  PLANA:0000099


ABOUT THIS TERM:

neuron

  ↳is a electrically signaling cell



Expand to see terms that part of neuron

  → synapse
  → synaptic cleft
  → synaptic vesicle
  → neurite


BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30022907SynaptotagminDj-sytStage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, ventral nerve cord, neuron, cephalic ganglia, nervous system, embryonic pharynx
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 ┬Ám

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30019471 ID=SMED30019471|Name=Synaptotagmin|organism=Schmidtea mediterranea sexual|type=transcript|length=1910bp
TTTGGGACTTCTCCAATCTATTAAATATATTTAGAACGAACATCGTTGTGAGAAGCTTTGTCTTGCAAATGCACACCAAC
ACATTCTCTGCCTACTCGAGACCAGCCTGAAGGACGCACCCAGTCATCTCTTATAAAAAAAAAACTCTTCTCTGATTCGG
TATTTTCTGATTAATGGAGATCAAACAATGATTGGGCAACGTCTAGTTTAGAATATTTACAACTAAATCTGCGTATTTCA
ATTTTTTTTCGATTTTGATTGTTGCAAATATTTATGAGTATATCCAATAATATAAGCAGCGCTAGTAATATGACGATAAA
AATGCAACAAAATGTTGAAAAGTCTGTATCACAGCATGTAACAGCGCAAACAAAGGAATCAACATCAAATAAACTTCATA
CAACAACAGCCGGTATCTCGGTTTTGGAGAAAACATTAAAAACATTTCACATGAGTACTGGCACTTTGATTGGAATCGGA
GTTACAGTGTCTATCGTAGTTTTATTACTTCTTTATTGTATTTGCAAACGATGCATTAAGAAACGAAAGAAAAAGAAAGA
TGGCGGCAAAAAAGGTGGAAAAGGCGTAGACATGAAAAGCGTACAACTATTAGGAAATGCTTATAAAGAAAAGGTACAGC
CGGACCTAGAAGAACTGGATGCTAACATGGAAGATAATGAAGGGGCGCAAGATAAAGAAGCAGTCAATCTTGGAAAATTA
CAGTATTCCCTTGATTACGATTTTACAAAAGGCGAGCTAACAGTCGGAGTAATTCAAGCCACAGATCTCCCAGCAATGGA
CATGTCAGGAACTTCTGATCCATATGTGAAAGTTTTTCTATTACCGGATAAAAAGAAAAAATTCGAAACCAAAGTTCATC
GAAAAATATTAAATCCAGTCTTTAATGAGACATTTGTATTCAAGATTCCTTATTCTGAGGTCGGGTCTAAAACTTTGGTA
TTTAATGTTTTCGATTTCGACAGATTTTCAAAGCATGATCAAATTGGGCAAATCCAAATTCCACTGGGTTCAGTAGATTT
ATGCAAAGTTATTGAGGAATGGAAGGAACTCGGCCCACCTGACAGTGATAATGAAAAGGAAAATCGATTAGGAGACATTT
GTTTTTCTTTGAGATATGTTCCAACGTCTGGAAAGTTGAATATCGTCATTCTGGAAGCTAAAAACCTCAAGAAAATGGAT
GTTGGAGGATTGTCGGATCCTTACGTGAAACTATCGTTGATGCTTAACGGCAAACGAGTGAAAAAGAAGAAAACCACAAT
AAAAAAATACACATTAAATCCTTATTATAATGAGTCATTTTCATTCGAAGTTCCATTCGAGCAAATACAAAAAGTTAATT
TAATAGTGACAGTAGTTGATTATGATAGAATTGGAACAAGTGAACCTATTGGAAGAGTAGTTCTTGGATGCAATGCTACA
GGAGCAGAACTTCGGCACTGGTCCGATATGCTTGCTAATCCTAGGAGACCAATTGCCCAGTGGCATACCCTTCAAGATAT
GCCGGAGAAGAGCTGATTTCATTGATTTTAATTTTAAAATCTGTCATATTTTGTGATAAATTTTGCGTATTTATACAATC
ATTCGATTCGATCTTTCCATCAAGTTTCGTAAAATCTGCAGACATTCACGAGGATGCAGAAGAAATAGAAACTTTGTAAT
AAATTAGCATTAGCTGTGATCTCCTATTGACCAAAAAACATAAACTTAATTTTTATAAAGAATTGTGGTGAAATGTTGTT
AGGTTTCAGTCATAGATAACTGTATTTGTGTAATAGTTTGTGTATTTCTCGTCCTGGCCCGATTTTGTGCATTCCACTGG
CAATACTATTTCACTAATAAATTATGTCTGATAATGTATACCAGTATAGGATTTTGTTTGAATTAATGAA
>SMED30022907 ID=SMED30022907|Name=Synaptotagmin|organism=Schmidtea mediterranea sexual|type=transcript|length=1814bp
ATTTATTGAAAATTATTTTTTCTATTATTAGGAGAAAATTGATTATTTTTTTTTGACAAAATAAGTTTTGGATATATTTC
CCATTTGTTTGTATTCGTAAACCAATGAAGAATTCGACTCACGGATCGGATCATTCGGCCAGCAAGGCCAGTATGAAAAC
GAATGTGGAAAAATTTTGGCATGATCTCGGAAAAAAATTGCACATGGATCCAAAAGCATTAATAGGAGTAACAATCGGTT
TGGGAATATTGTTTTTGTTGTTCCTTTATTGCTTATGTAAAAAATGTGTTTTCAAGCGTCGAAAAAAGAAGGAAACGGCC
AAAAAAGGAGCCAAGGGAGTAGTCGATATGAAAAGTGCCCAATTGTTGGGGAATTCATATAAAGAAAAAATTCAACCCGA
TCTTGAAGAACTTGATGCAAACATGGAAGACAATGAAGGTGTAAAAGAAAAAGAAGATGTTCATTTAGGAAAATTACAAT
ATTCTCTAGATTATGATTTTCAGAAAGGAGAATTAACTGTTGGAGTTATTCAAGCAACTGATCTTCCAGCTATGGATATG
TCAGGAACATCAGATCCATATGTCAAATTATACCTTCTCCCAGACAAGAAAAAGAAATTCGAAACAAAGGTTCATAGGAA
AATTTTAAATCCTGTATTCAATGAAACTTTTGTTTTCAAAGTTCCTTTCAATGAAGTTGCATCGAAGACTTTGATTTTCA
ACGTTTATGACTTTGACAGATTTTCCAAACACGATCAAATCGGTCAAATAAAAGTACCATTGGGAGCTATAGATTTAGGT
CGAGTTATTGAAGAATGGAAGGAACTGGAATCTCCAGAAAACGATGGGGAAAAGGAAAACAGGTTGGGAGACATTTGTTT
CTCTTTAAGATACGTACCGACATCTGGAAAGCTTACAATAGTCATTTTGGAAGCAAAGAATCTTAAAAAAATGGATGTCG
GAGGATTGTCTGATCCATATGTTAAACTTTCCTTGATGCTTAATGGTAAACGAGTGAAGAAGAAGAAAACTACCATCAAA
AAGTATACACTAAATCCTTACTACAATGAATCATTTTCCTTTGAAGTACCATTCGAACAAATACAAAAAGTGAACTTGAT
CGTCACGGTTGTTGATTATGACAGAATCGGAACCAGCGAACCGATAGGTAGAATTGTTCTGGGATGTAACGCAACTGGAG
CAGAATTGCGACATTGGTCGGATATGTTGGCAAATCCCCGGCGACCAATCGCCCAGTGGCATACCCTCCAAGAGATGCCA
GAGAACAATTGATAGTGTTCGTTTGATGCTTTAAAGCGGTTTGCATAATTCGTGAAATAAGTTATCAAAATTTGAGAAAT
GTTTTTTTTTCTGAAACAAAAATGGCATGAGACAATATACCAGAGTTCATTAGTGTGTGGTTTCGTTGAATATTTTGGTG
GTGTTGCATCTTATCGTTTGTCCTCTAATCTAATAATGTTTTATTCTTTATATAGCTGATTTATTCTCGAGCGAAACATT
TTTTATGTGTACCAAAATACTTATGTCATAGCCATTGTGATTAGTCTGTAAACTATTGCGTAATAGCCCCTCTCATTGGC
TTTTTTTAAGAGTAGTGAGTTGGAAAAAAAAATACAAAAATGACTTCAATTGTTAAACATTACTCATATTTTATCAGTAA
GTTAACTTGCATATTTGCAGTTAATTATGGCATTTTATCTCTAAATCTCTGAAGCATGGCCTCAAGTCTTTTGTTTGTTT
TAATGTAATTATGTCTAGATGAGAATATTAAAATACTTCGGTTTATATAAAAGA

 

back to top





PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in neuron. Click this link to learn more about PAGE.


PAGE Curations: 5741


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
neuronSMED30006343dynein heavy chain 5, axonemalSMESG000049144.1 dd_Smed_v4_4569_0_1dd_Smed_v4PMID:29674431
neuronSMED30006343dynein heavy chain 5, axonemalSMESG000049144.1 dd_Smed_v4_4569_0_1dd_Smed_v4PMID:29674431
neuronSMED30009514histone H2BSMESG000067931.1 dd_Smed_v4_2520_0_1dd_Smed_v4PMID:29674431
neuronSMED30003095Protein regulator of cytokinesis 1SMESG000016705.1 dd_Smed_v4_5754_0_1dd_Smed_v4PMID:29674431
neuronSMED30002503SMED30002503SMESG000062999.1 SMESG000062995.1 dd_Smed_v4_3686_0_1dd_Smed_v4PMID:29674431
neuronSMED30001905C3H1-type domain-containing proteinSMESG000006480.1 dd_Smed_v4_2756_0_1dd_Smed_v4PMID:29674431
neuronSMED30001196Myosin headSMESG000049494.1 dd_Smed_v4_2912_0_1dd_Smed_v4PMID:29674431
neuronSMED30001196Myosin headSMESG000049494.1 dd_Smed_v4_2912_0_1dd_Smed_v4PMID:29674431
neuronSMED30008655Tubulin alpha chainSMESG000054547.1 dd_Smed_v4_508_0_1dd_Smed_v4PMID:29674431
neuronSMED30008655Tubulin alpha chainSMESG000078886.1 SMESG000078780.1 SMESG000078276.1 SMESG000077377.1 SMESG000076900.1 SMESG000070563.1 SMESG000069843.1 SMESG000067323.1 SMESG000067128.1 SMESG000066333.1 SMESG000063482.1 SMESG000063430.1 SMESG000062535.1 SMESG000055265.1 SMESG000052056.1 SMESG000051183.1 SMESG000049398.1 SMESG000047988.1 SMESG000045843.1 SMESG000043425.1 SMESG000043019.1 SMESG000041242.1 SMESG000040236.1 SMESG000039783.1 SMESG000034367.1 SMESG000031778.1 SMESG000031308.1 SMESG000028811.1 SMESG000025956.1 SMESG000023833.1 SMESG000023573.1 SMESG000023546.1 SMESG000019820.1 SMESG000018414.1 SMESG000017936.1 SMESG000015191.1 SMESG000014475.1 SMESG000009011.1 SMESG000008656.1 SMESG000005037.1 SMESG000004638.1 SMESG000003422.1 SMESG000054547.1 dd_Smed_v6_508_0dd_Smed_v6PMID:29674432
neuronSMED30008579ST13 Hsp70 interacting proteinSMESG000078709.1 SMESG000071677.1 SMESG000069228.1 SMESG000017570.1 SMESG000017358.1 SMESG000017347.1 SMESG000013728.1 SMESG000001430.1 Contig54963newmark_estsPMID:27612384
neuronSMED30008579ST13 Hsp70 interacting proteinSMESG000078709.1 SMESG000071677.1 SMESG000069228.1 SMESG000017570.1 SMESG000017358.1 SMESG000017347.1 SMESG000013728.1 SMESG000001430.1 Contig54963uc_Smed_v2PMID:27612384
neuronSMED30003490OtoferlinSMESG000037807.1 dd_Smed_v4_5915_0_1dd_Smed_v4PMID:29674431
neuronSMED30000908CN hydrolase domain-containing proteinSMESG000076652.1 SMESG000053372.1 SMESG000050353.1 SMESG000040848.1 SMESG000034123.1 SMESG000029555.1 SMESG000023611.1 SMESG000064571.1 Contig19011newmark_estsPMID:27612384
neuronSMED30000908CN hydrolase domain-containing proteinSMESG000076652.1 SMESG000053372.1 SMESG000050353.1 SMESG000040848.1 SMESG000034123.1 SMESG000029555.1 SMESG000023611.1 SMESG000064571.1 Contig19011uc_Smed_v2PMID:27612384
neuronSMED30006295SMED30006295SMESG000037104.1 dd_Smed_v4_3744_0_1dd_Smed_v4PMID:29674431
neuronSMED30006295SMED30006295SMESG000037104.1 dd_Smed_v4_3744_0_1dd_Smed_v4PMID:29674431
neuronSMED30003560Teneurin-2SMESG000016735.1 dd_Smed_v4_5439_0_1dd_Smed_v4PMID:29674431
neuronSMED30003560Teneurin-2SMESG000016735.1 dd_Smed_v4_5439_0_1dd_Smed_v4PMID:29674431
neuronSMED30008817ADAM 17-like proteaseSMESG000057956.1 Contig53831newmark_estsPMID:27612384
neuronSMED30008817ADAM 17-like proteaseSMESG000057956.1 Contig53831uc_Smed_v2PMID:27612384
neuronSMED30001342Tyrosine protein phosphatase non receptor typeSMESG000028955.1 DN305232ncbi_smed_estsPMID:25356635
neuronSMED30003484SMED30003484SMESG000049494.1 dd_Smed_v4_2912_0_1dd_Smed_v4PMID:29674431
neuronSMED30003484SMED30003484SMESG000049494.1 dd_Smed_v4_2912_0_1dd_Smed_v4PMID:29674431
neuronSMED30008431Calcium uptake protein 1, mitochondrialSMESG000065412.1 dd_Smed_v4_3581_0_1dd_Smed_v4PMID:29674431
neuronSMED30000708Dynein heavy chain 5, axonemalSMESG000049144.1 dd_Smed_v4_4569_0_1dd_Smed_v4PMID:29674431
neuronSMED30000708Dynein heavy chain 5, axonemalSMESG000049144.1 dd_Smed_v4_4569_0_1dd_Smed_v4PMID:29674431
neuronSMED30000087Voltage-dependent calcium channel subunit alpha-2/delta-2SMESG000021955.1 SMESG000021966.1 dd_Smed_v4_2470_0_1dd_Smed_v4PMID:29674431
neuronSMED30029282Potassium voltage-gated channel protein Shal-like ProteinSMESG000081212.1 Contig52830newmark_estsPMID:27612384
neuronSMED30029282Potassium voltage-gated channel protein Shal-like ProteinSMESG000081212.1 Contig52830uc_Smed_v2PMID:27612384
neuronSMED30029282Potassium voltage-gated channel protein Shal-like ProteinSMESG000081216.1 SMESG000081212.1 dd_Smed_v4_15876_0_1dd_Smed_v4PMID:29674431
neuronSMED30031317Secreted peptide prohormone 19SMESG000053016.1 SMESG000053015.1 ADC84440smed_ncbi_20200123PMID:25356635
neuronSMED30027376SMED30027376SMESG000007018.1 SMESG000007017.1 dd_Smed_v4_1969_0_1dd_Smed_v4PMID:29674431
neuronSMED30035715Sodium channel proteinSMESG000075431.1 KJ187192smed_ncbi_20200123PMID:25356635
neuronSMED30035715Sodium channel proteinSMESG000075431.1 SMESG000075430.1 dd_Smed_v4_12243_0_1dd_Smed_v4PMID:29674431
neuronSMED30035715Sodium channel proteinSMESG000075430.1 dd_Smed_v4_38612_0_1dd_Smed_v4PMID:29674431
neuronSMED30032426pou4l-1SMESG000013430.1 KJ187188smed_ncbi_20200123PMID:25356635
neuronSMED30032426pou4l-1SMESG000013430.1 dd_Smed_v4_15555_0_1dd_Smed_v4PMID:29674431
neuronSMED30003423NFX1-type zinc finger-containing protein 1SMESG000034890.1 dd_Smed_v4_10024_0_1dd_Smed_v4PMID:29674431
neuronSMED30002753X1.A5.1SMESG000062836.1 dd_Smed_v4_585_0_1dd_Smed_v4PMID:29674431
neuronSMED30002753X1.A5.1SMESG000062836.1 Contig42508newmark_estsPMID:27612384
neuronSMED30002753X1.A5.1SMESG000062836.1 Contig42508uc_Smed_v2PMID:27612384
neuronSMED30004389scna-1SMESG000017743.1 KJ187193smed_ncbi_20200123PMID:25356635
neuronSMED30004389scna-1SMESG000017743.1 SMESG000017742.1 dd_Smed_v4_13973_0_1dd_Smed_v4PMID:29674431
neuronSMED30004389scna-1SMESG000017743.1 KJ187191smed_ncbi_20200123PMID:25356635
neuronSMED30004389scna-1SMESG000017743.1 KJ187191smed_ncbi_20200123PMID:25356635
neuronSMED30004964SMED30004964SMESG000014348.1 Contig55055newmark_estsPMID:27612384
neuronSMED30004964SMED30004964SMESG000014348.1 Contig55055uc_Smed_v2PMID:27612384
neuronSMED30011091Ski oncogeneSMESG000044463.1 dd_Smed_v4_10394_0_1dd_Smed_v4PMID:29674431
neuronSMED30011091Ski oncogeneSMESG000044463.1 dd_Smed_v4_10394_0_1dd_Smed_v4PMID:29674431
neuronSMED30001548RING-type domain-containing proteinSMESG000020467.1 dd_Smed_v4_2039_0_1dd_Smed_v4PMID:29674431
neuronSMED30002315kcnbSMESG000004060.1 KJ187187smed_ncbi_20200123PMID:25356635
neuronSMED30004024SMED30004024SMESG000022827.1 dd_Smed_v4_2123_0_1dd_Smed_v4PMID:29674431
neuronSMED30004666ATP-dependent zinc metalloprotease FtsHSMESG000006322.1 dd_Smed_v4_10293_0_1dd_Smed_v4PMID:29674431
neuronSMED30001387Glutamate receptor ionotropicSMESG000049467.1 dd_Smed_v4_16476_0_1dd_Smed_v4PMID:29674431
neuronSMED30030198Lamin-B receptorSMESG000042131.1 dd_Smed_v4_2016_0_1dd_Smed_v4PMID:29674431
neuronSMED30025144Protein rolling stoneSMESG000077396.1 dd_Smed_v4_10421_0_1dd_Smed_v4PMID:29674431
neuronSMED30025144Protein rolling stoneSMESG000077396.1 dd_Smed_v4_10421_0_1dd_Smed_v4PMID:29674431
neuronSMED30026227SMED30026227SMESG000055174.1 SMESG000055172.1 dd_Smed_v4_10518_0_1dd_Smed_v4PMID:29674431
neuronSMED30027945Major facilitator superfamily domain containing proteinSMESG000010822.1 dd_Smed_v4_10640_0_1dd_Smed_v4PMID:29674431
neuronSMED30027945Major facilitator superfamily domain containing proteinSMESG000010822.1 dd_Smed_v4_10640_0_1dd_Smed_v4PMID:29674431
neuronSMED30013766Matrin-type domain-containing proteinSMESG000072403.1 dd_Smed_v4_1859_0_1dd_Smed_v4PMID:29674431
neuronSMED30008024NFX1-type zinc finger-containing protein 1-likeSMESG000034891.1 SMESG000034868.1 SMESG000034856.1 dd_Smed_v4_10633_0_1dd_Smed_v4PMID:29674431
neuronSMED30008024NFX1-type zinc finger-containing protein 1-likeSMESG000034891.1 SMESG000034868.1 SMESG000034856.1 dd_Smed_v4_10633_0_1dd_Smed_v4PMID:29674431
neuronSMED30006006SMED30006006SMESG000007018.1 SMESG000007017.1 dd_Smed_v4_1969_0_1dd_Smed_v4PMID:29674431
neuronSMED30013095DDE_Tnp_1_7 domain-containing proteinSMESG000080622.1 SMESG000068757.1 SMESG000055125.1 SMESG000038294.1 SMESG000032747.1 SMESG000023322.1 dd_Smed_v4_3830_0_1dd_Smed_v4PMID:29674431
neuronSMED30007588SMED30007588SMESG000034112.1 dd_Smed_v4_10100_0_1dd_Smed_v4PMID:29674431
neuronSMED30007588SMED30007588SMESG000034112.1 dd_Smed_v4_10100_0_1dd_Smed_v4PMID:29674431
neuronSMED30013480DihydropyrimidinaseSMESG000060188.1 dd_Smed_v4_2040_0_1dd_Smed_v4PMID:29674431
neuronSMED30015813slc3a-1SMESG000019192.1 SMESG000019184.1 dd_Smed_v4_2113_0_1dd_Smed_v4PMID:29674431
neuronSMED30015813slc3a-1SMESG000019192.1 SMESG000019184.1 dd_Smed_v4_2113_0_1dd_Smed_v4PMID:29674431
neuronSMED30014348Four and a half LIM domains protein 1SMESG000006322.1 dd_Smed_v4_10293_0_1dd_Smed_v4PMID:29674431
neuronSMED30010111TPA_inf: neuropeptide precursor-2SMESG000072719.1 dd_Smed_v4_1015_0_1dd_Smed_v4PMID:29674431
neuronSMED30010111TPA_inf: neuropeptide precursor-2SMESG000072719.1 dd_Smed_v4_1015_0_1dd_Smed_v4PMID:29674431
neuronSMED30006252SMED30006252SMESG000022827.1 dd_Smed_v4_2123_0_1dd_Smed_v4PMID:29674431
neuronSMED30016729Glutamate receptorSMESG000073692.1 dd_Smed_v4_20242_0_1dd_Smed_v4PMID:29674431
neuronSMED30016729Glutamate receptorSMESG000073692.1 dd_Smed_v4_20242_0_1dd_Smed_v4PMID:29674431
neuronSMED30016729Glutamate receptorSMESG000073692.1 dd_Smed_v4_17395_0_1dd_Smed_v4PMID:29674431
neuronSMED30017231NEPH-3SMESG000022777.1 dd_Smed_v4_11280_0_1dd_Smed_v4PMID:29674431
neuronSMED30019001ras-specific guanine nucleotide-releasing factor 1SMESG000056262.1 dd_Smed_v4_18313_0_1dd_Smed_v4PMID:29674431
neuronSMED30019001ras-specific guanine nucleotide-releasing factor 1SMESG000056262.1 dd_Smed_v4_18313_0_1dd_Smed_v4PMID:29674431
neuronSMED30018401NFX1-type zinc finger-containing protein 1SMESG000034890.1 dd_Smed_v4_10024_0_1dd_Smed_v4PMID:29674431
neuronSMED30017399Transmembrane protein 81SMESG000026648.1 dd_Smed_v4_10248_0_1dd_Smed_v4PMID:29674431
neuronSMED30017399Transmembrane protein 81SMESG000026648.1 dd_Smed_v4_10248_0_1dd_Smed_v4PMID:29674431
neuronSMED30018184Bestrophin homologSMESG000016291.1 dd_Smed_v4_1844_0_1dd_Smed_v4PMID:29674431
neuronSMED30018184Bestrophin homologSMESG000016291.1 dd_Smed_v4_1844_0_1dd_Smed_v4PMID:29674431
neuronSMED30021151Corepressor interacting with RBPJ 1SMESG000027503.1 SMESG000027499.1 dd_Smed_v4_1892_0_1dd_Smed_v4PMID:29674431
neuronSMED30020055Neur_chan_LBD domain-containing proteinSMESG000064433.1 DN303054ncbi_smed_estsPMID:25356635
neuronSMED30020055Neur_chan_LBD domain-containing proteinSMESG000041829.1 DN298606ncbi_smed_estsPMID:30399335
neuronSMED30020055Neur_chan_LBD domain-containing proteinSMESG000064433.1 DN290586ncbi_smed_estsPMID:30399335
neuronSMED30020055Neur_chan_LBD domain-containing proteinSMESG000041829.1 dd_Smed_v4_19336_0_1dd_Smed_v4PMID:29674431
neuronSMED30020055Neur_chan_LBD domain-containing proteinSMESG000041829.1 dd_Smed_v4_19336_0_1dd_Smed_v4PMID:29674431
neuronSMED30020900SMED30020900SMESG000022827.1 dd_Smed_v4_2123_0_1dd_Smed_v4PMID:29674431
neuronSMED30021613Nesprin-1SMESG000077685.1 dd_Smed_v4_10214_0_1dd_Smed_v4PMID:29674431
neuronSMED30021613Nesprin-1SMESG000077685.1 dd_Smed_v4_15904_0_1dd_Smed_v4PMID:29674431
neuronSMED30021117SMED30021117SMESG000076821.1 SMESG000055285.1 SMESG000054243.1 SMESG000021425.1 SMESG000013482.1 Contig53275newmark_estsPMID:27612384
neuronSMED30021117SMED30021117SMESG000076821.1 SMESG000055285.1 SMESG000054243.1 SMESG000021425.1 SMESG000013482.1 Contig53275uc_Smed_v2PMID:27612384
neuronSMED30021117SMED30021117SMESG000079744.1 SMESG000074656.1 SMESG000054243.1 SMESG000040345.1 SMESG000035927.1 SMESG000022375.1 SMESG000019267.1 dd_Smed_v4_12375_0_1dd_Smed_v4PMID:29674431
neuronSMED30024368chromodomain helicase DNA-binding protein 4SMESG000068192.1 dd_Smed_v4_2659_0_1dd_Smed_v4PMID:29674431
neuronSMED30024368chromodomain helicase DNA-binding protein 4SMESG000068192.1 dd_Smed_v4_2331_0_1dd_Smed_v4PMID:29674431
neuronSMED30024368chromodomain helicase DNA-binding protein 4SMESG000068192.1 dd_Smed_v4_2331_0_1dd_Smed_v4PMID:29674431
neuronSMED30022580runt-1SMESG000014779.1 Contig54774newmark_estsPMID:27612384
neuronSMED30022580runt-1SMESG000014779.1 Contig54774uc_Smed_v2PMID:27612384
neuronSMED30025141SMED30025141SMESG000076211.1 SMESG000047610.1 dd_Smed_v4_2124_0_1dd_Smed_v4PMID:29674431
neuronSMED30026124Dynein heavy chain, axonemalSMESG000040510.1 Contig16071newmark_estsPMID:27612384
neuronSMED30026124Dynein heavy chain, axonemalSMESG000040510.1 Contig16071uc_Smed_v2PMID:27612384
neuronSMED30026124Dynein heavy chain, axonemalSMESG000040511.1 dd_Smed_v4_6557_0_1dd_Smed_v4PMID:29674431
neuronSMED30022844NEPH-3SMESG000022777.1 dd_Smed_v4_11280_0_1dd_Smed_v4PMID:29674431
neuronSMED30009504Coiled-coil domain-containing protein 102ASMESG000074485.1 dd_Smed_v4_7397_0_1dd_Smed_v4PMID:29674431
neuronSMED30011798E3 ubiquitin-protein ligase MIB2SMESG000043477.1 SMESG000010549.1 SMESG000010347.1 SMESG000010327.1 dd_Smed_v4_593_1_1dd_Smed_v4PMID:29674431
neuronSMED30011798E3 ubiquitin-protein ligase MIB2SMESG000043477.1 SMESG000010549.1 SMESG000010347.1 SMESG000010327.1 dd_Smed_v4_593_1_1dd_Smed_v4PMID:29674431
neuronSMED30012326SMED30012326SMESG000079518.1 SMESG000070566.1 dd_Smed_v4_6933_0_1dd_Smed_v4PMID:29674431
neuronSMED30010668MAGUK p55 subfamily member 5SMESG000017294.1 dd_Smed_v4_6790_0_1dd_Smed_v4PMID:29674431
neuronSMED30010668MAGUK p55 subfamily member 5SMESG000017294.1 dd_Smed_v4_6790_0_1dd_Smed_v4PMID:29674431
neuronSMED30011216slc1a-2SMESG000022787.1 dd_Smed_v4_7570_0_1dd_Smed_v4PMID:29674431
neuronSMED30011216slc1a-2SMESG000022787.1 dd_Smed_v4_7570_0_1dd_Smed_v4PMID:29674431
neuronSMED30009251coiled-coil domain-containing protein 146SMESG000006416.1 dd_Smed_v4_6858_0_1dd_Smed_v4PMID:29674431
neuronSMED30009251coiled-coil domain-containing protein 146SMESG000006416.1 dd_Smed_v4_6858_0_1dd_Smed_v4PMID:29674431
neuronSMED30010540Gln-synt_C domain-containing proteinSMESG000064881.1 dd_Smed_v4_9076_0_1dd_Smed_v4PMID:29674431
neuronSMED30009048SMED30009048SMESG000043809.1 SMESG000043799.1 dd_Smed_v4_655_0_1dd_Smed_v4PMID:29674431
neuronSMED30009048SMED30009048SMESG000043809.1 SMESG000043799.1 dd_Smed_v6_655_0dd_Smed_v6PMID:29674432
neuronSMED30008916SMED30008916SMESG000061077.1 dd_Smed_v4_9714_0_1dd_Smed_v4PMID:29674431
neuronSMED30008916SMED30008916SMESG000061077.1 dd_Smed_v4_9714_0_1dd_Smed_v4PMID:29674431
neuronSMED30006485Beta-1-syntrophinSMESG000005336.1 dd_Smed_v4_7105_0_1dd_Smed_v4PMID:29674431
neuronSMED30006485Beta-1-syntrophinSMESG000005336.1 dd_Smed_v4_7105_0_1dd_Smed_v4PMID:29674431
neuronSMED30005212SMED30005212SMESG000042005.1 dd_Smed_v4_3333_0_1dd_Smed_v4PMID:29674431
neuronSMED30007561Protocadherin-hSMESG000034072.1 dd_Smed_v4_7973_0_1dd_Smed_v4PMID:29674431
neuronSMED30006962SMED30006962SMESG000064896.1 dd_Smed_v4_4637_0_2dd_Smed_v4PMID:29674431
neuronSMED30007496C-type lectin domain-containing proteinSMESG000016262.1 dd_Smed_v4_5187_0_1dd_Smed_v4PMID:29674431
neuronSMED30003094HMG box domain-containing proteinSMESG000017540.1 SMESG000070603.1 SMESG000070576.1 SMESG000017600.1 SMESG000017572.1 SMESG000017558.1 SMESG000017557.1 SMESG000017556.1 SMESG000017543.1 SMESG000017541.1 dd_Smed_v4_4601_0_1dd_Smed_v4PMID:29674431
neuronSMED30003094HMG box domain-containing proteinSMESG000017540.1 SMESG000070603.1 SMESG000070576.1 SMESG000017600.1 SMESG000017572.1 SMESG000017558.1 SMESG000017557.1 SMESG000017556.1 SMESG000017543.1 SMESG000017541.1 dd_Smed_v4_4601_0_1dd_Smed_v4PMID:29674431
neuronSMED30000559Transposon Ty3-I Gag-Pol polyproteinSMESG000063504.1 SMESG000063503.1 SMESG000026061.1 dd_Smed_v4_3587_1_1dd_Smed_v4PMID:29674431
neuronSMED30000559Transposon Ty3-I Gag-Pol polyproteinSMESG000063504.1 SMESG000063503.1 SMESG000026061.1 dd_Smed_v4_3587_1_1dd_Smed_v4PMID:29674431
neuronSMED30000559Transposon Ty3-I Gag-Pol polyproteinSMESG000013684.1 dd_Smed_v4_14881_1_1dd_Smed_v4PMID:29674431
neuronSMED30000559Transposon Ty3-I Gag-Pol polyprotein dd_Smed_v4_14472_0_1dd_Smed_v4PMID:29674431
neuronSMED30001428SMG-1SMESG000009788.1 dd_Smed_v4_4600_0_1dd_Smed_v4PMID:29674431
neuronSMED30009076ActinSMESG000066035.1 SMESG000066029.1 SMESG000066027.1 SMESG000066020.1 dd_Smed_v4_37_0_1dd_Smed_v4PMID:29674431
neuronSMED30009076ActinSMESG000066035.1 SMESG000066029.1 SMESG000066027.1 SMESG000066020.1 dd_Smed_v4_90_0_1dd_Smed_v4PMID:29674431
neuronSMED30022907SynaptotagminSMESG000025329.1 dd_Smed_v4_4222_0_1dd_Smed_v4PMID:29674431
neuronSMED30022907SynaptotagminSMESG000025329.1 dd_Smed_v4_4222_0_1dd_Smed_v4PMID:29674431
neuronSMED30022907SynaptotagminSMESG000025329.1 dd_Smed_v6_4222_0dd_Smed_v6PMID:29674432
neuronSMED30025232Dynamin-1SMESG000067156.1 dd_Smed_v4_6863_0_1dd_Smed_v4PMID:29674431
neuronSMED30025232Dynamin-1SMESG000067156.1 dd_Smed_v4_6863_0_1dd_Smed_v4PMID:29674431
neuronSMED30030724Protein numbSMESG000016237.1 SMESG000033358.1 dd_Smed_v4_507_0_1dd_Smed_v4PMID:29674431
neuronSMED30030724Protein numbSMESG000016237.1 SMESG000033358.1 dd_Smed_v4_507_0_1dd_Smed_v4PMID:29674431
neuronSMED30030724Protein numbSMESG000016237.1 SMESG000033358.1 dd_Smed_v6_507_0dd_Smed_v6PMID:29674432
neuronSMED30021949SMED30021949SMESG000025657.1 dd_Smed_v4_9831_0_1dd_Smed_v4PMID:29674431
neuronSMED30019484Vesicle-fusing ATPaseSMESG000019983.1 dd_Smed_v4_3364_0_1dd_Smed_v4PMID:29674431
neuronSMED30019484Vesicle-fusing ATPaseSMESG000019983.1 dd_Smed_v4_3364_0_1dd_Smed_v4PMID:29674431
neuronSMED30019364Si:ch211-193l2.10SMESG000062713.1 dd_Smed_v4_3203_0_1dd_Smed_v4PMID:29674431
neuronSMED30019364Si:ch211-193l2.10SMESG000062713.1 dd_Smed_v4_3203_0_1dd_Smed_v4PMID:29674431
neuronSMED30027478SMED30027478SMESG000081245.1 dd_Smed_v4_3287_0_1dd_Smed_v4PMID:29674431
neuronSMED30027478SMED30027478SMESG000081245.1 dd_Smed_v4_3287_0_1dd_Smed_v4PMID:29674431
neuronSMED30035210Ubiquitin domain-containing protein 2SMESG000059920.1 dd_Smed_v4_3009_0_1dd_Smed_v4PMID:29674431
neuronSMED30031336MusashiSMESG000071202.1 dd_Smed_v4_7323_0_1dd_Smed_v4PMID:29674431
neuronSMED30031336MusashiSMESG000071202.1 dd_Smed_v4_7323_0_1dd_Smed_v4PMID:29674431
neuronSMED30026686Glutamate synthaseSMESG000077776.1 dd_Smed_v4_5074_0_1dd_Smed_v4PMID:29674431
neuronSMED30026686Glutamate synthaseSMESG000077776.1 dd_Smed_v4_5074_0_1dd_Smed_v4PMID:29674431
neuronSMED30023820USP domain-containing proteinSMESG000041514.1 dd_Smed_v4_2963_0_1dd_Smed_v4PMID:29674431
neuronSMED30023044ATP-binding cassette sub-family A member 1SMESG000032896.1 SMESG000029537.1 SMESG000029534.1 dd_Smed_v4_2300_0_1dd_Smed_v4PMID:29674431
neuronSMED30023044ATP-binding cassette sub-family A member 1SMESG000032896.1 SMESG000029537.1 SMESG000029534.1 dd_Smed_v4_2300_0_1dd_Smed_v4PMID:29674431
neuronSMED30025193Centrosomal protein of 170 kDa protein BSMESG000036418.1 dd_Smed_v4_9728_0_1dd_Smed_v4PMID:29674431
neuronSMED30022928SMED30022928SMESG000000986.1 SMESG000000983.1 dd_Smed_v4_26967_0_1dd_Smed_v4PMID:29674431
neuronSMED30026803X1.D.D8.3SMESG000053883.1 dd_Smed_v4_8540_0_1dd_Smed_v4PMID:29674431
neuronSMED30031662Acetylcholine receptor subunit alpha-likeSMESG000063816.1 SMESG000010536.1 SMESG000045280.1 SMESG000029730.1 dd_Smed_v4_4145_0_1dd_Smed_v4PMID:29674431
neuronSMED30031662Acetylcholine receptor subunit alpha-likeSMESG000063816.1 SMESG000010536.1 SMESG000045280.1 SMESG000029730.1 dd_Smed_v4_4145_0_1dd_Smed_v4PMID:29674431
neuronSMED30031431FMRFamide-activated amiloride-sensitive sodium channelSMESG000016913.1 dd_Smed_v4_9790_0_1dd_Smed_v4PMID:29674431
neuronSMED30025055NeurobeachinSMESG000017089.1 dd_Smed_v4_3880_0_1dd_Smed_v4PMID:29674431
neuronSMED30026942Dynein light chainSMESG000052937.1 SMESG000027765.1 dd_Smed_v4_2487_0_1dd_Smed_v4PMID:29674431
neuronSMED30026942Dynein light chainSMESG000052937.1 SMESG000027765.1 dd_Smed_v4_2487_0_1dd_Smed_v4PMID:29674431
neuronSMED30030455TetraspaninSMESG000056558.1 dd_Smed_v4_3175_0_1dd_Smed_v4PMID:29674431
neuronSMED30030455TetraspaninSMESG000056558.1 dd_Smed_v4_3175_0_1dd_Smed_v4PMID:29674431
neuronSMED30030455TetraspaninSMESG000056558.1 dd_Smed_v6_3175_0dd_Smed_v6PMID:29674432
neuronSMED30030455TetraspaninSMESG000056558.1 DN310971ncbi_smed_estsPMID:30399335
neuronSMED30028650Vesicle-fusing ATPaseSMESG000019983.1 dd_Smed_v4_3364_0_1dd_Smed_v4PMID:29674431
neuronSMED30028650Vesicle-fusing ATPaseSMESG000019983.1 dd_Smed_v4_3364_0_1dd_Smed_v4PMID:29674431
neuronSMED30024152CKLF-like MARVEL transmembrane domain-containing protein 7SMESG000001041.1 dd_Smed_v4_3096_0_1dd_Smed_v4PMID:29674431
neuronSMED30024152CKLF-like MARVEL transmembrane domain-containing protein 7SMESG000001041.1 dd_Smed_v4_3096_0_1dd_Smed_v4PMID:29674431
neuronSMED30021949SMED30021949SMESG000025657.1 dd_Smed_v4_9831_0_1dd_Smed_v4PMID:29674431
neuronSMED30008221FTS and Hook-interacting proteinSMESG000025657.1 dd_Smed_v4_9831_0_1dd_Smed_v4PMID:29674431
neuronSMED30016993Rap guanine nucleotide exchange factor 4SMESG000014113.1 dd_Smed_v4_9547_0_1dd_Smed_v4PMID:29674431
neuronSMED30016993Rap guanine nucleotide exchange factor 4SMESG000014113.1 dd_Smed_v4_9547_0_1dd_Smed_v4PMID:29674431
neuronSMED30007539ATP-binding cassette sub-family A member 1SMESG000032896.1 SMESG000029537.1 SMESG000029534.1 dd_Smed_v4_2300_0_1dd_Smed_v4PMID:29674431
neuronSMED30007539ATP-binding cassette sub-family A member 1SMESG000032896.1 SMESG000029537.1 SMESG000029534.1 dd_Smed_v4_2300_0_1dd_Smed_v4PMID:29674431
neuronSMED30015955Growth arrest-specific protein 8SMESG000013356.1 dd_Smed_v4_2848_0_1dd_Smed_v4PMID:29674431
neuronSMED30015955Growth arrest-specific protein 8SMESG000013356.1 dd_Smed_v4_2848_0_1dd_Smed_v4PMID:29674431
neuronSMED3001096960S ribosomal protein L6SMESG000019835.1 dd_Smed_v4_839_0_1dd_Smed_v4PMID:29674431
neuronSMED30013179Diacylglycerol kinaseSMESG000020956.1 dd_Smed_v4_9631_0_1dd_Smed_v4PMID:29674431
neuronSMED30013179Diacylglycerol kinaseSMESG000020956.1 dd_Smed_v4_9631_0_1dd_Smed_v4PMID:29674431
neuronSMED30015650FGFR1 oncogene partnerSMESG000006505.1 dd_Smed_v4_5371_0_1dd_Smed_v4PMID:29674431
neuronSMED30015650FGFR1 oncogene partnerSMESG000006505.1 dd_Smed_v4_5371_0_1dd_Smed_v4PMID:29674431
neuronSMED30010941dnaJ homolog subfamily B member 13SMESG000076708.1 dd_Smed_v4_4820_0_1dd_Smed_v4PMID:29674431
neuronSMED30010941dnaJ homolog subfamily B member 13SMESG000076708.1 dd_Smed_v4_4820_0_1dd_Smed_v4PMID:29674431
neuronSMED30018004SMED30018004SMESG000039905.1 dd_Smed_v4_8655_0_1dd_Smed_v4PMID:29674431
neuronSMED30018004SMED30018004SMESG000039905.1 dd_Smed_v4_8655_0_1dd_Smed_v4PMID:29674431
neuronSMED30017731ADP-ribosylation factor-like protein 3SMESG000074427.1 SMESG000058739.1 SMESG000012243.1 dd_Smed_v4_3162_0_1dd_Smed_v4PMID:29674431
neuronSMED30017749Peptidyl-glycine alpha-amidating monooxygenaseSMESG000042480.1 dd_Smed_v4_3093_0_1dd_Smed_v4PMID:29674431
neuronSMED30017749Peptidyl-glycine alpha-amidating monooxygenaseSMESG000042480.1 dd_Smed_v4_3093_0_1dd_Smed_v4PMID:29674431
neuronSMED30017749Peptidyl-glycine alpha-amidating monooxygenaseSMESG000042480.1 dd_Smed_v6_3093_0dd_Smed_v6PMID:29674432
neuronSMED30006144Helicase with zinc finger domain 2SMESG000026061.1 SMESG000026055.1 dd_Smed_v4_7048_0_1dd_Smed_v4PMID:29674431
neuronSMED30013013Guanine nucleotide-binding protein subunit betaSMESG000061733.1 dd_Smed_v4_3309_0_1dd_Smed_v4PMID:29674431
neuronSMED30013013Guanine nucleotide-binding protein subunit betaSMESG000061733.1 dd_Smed_v4_3309_0_1dd_Smed_v4PMID:29674431
neuronSMED30015111Guanylate cyclaseSMESG000005445.1 dd_Smed_v4_9955_0_1dd_Smed_v4PMID:29674431
neuronSMED30015945Centrin-1SMESG000052182.1 SMESG000015458.1 dd_Smed_v4_3644_0_1dd_Smed_v4PMID:29674431
neuronSMED30015945Centrin-1SMESG000052182.1 SMESG000015458.1 dd_Smed_v4_3644_0_1dd_Smed_v4PMID:29674431
neuronSMED30015765SMED30015765SMESG000050352.1 dd_Smed_v4_36253_0_1dd_Smed_v4PMID:29674431
neuronSMED30015765SMED30015765SMESG000050352.1 dd_Smed_v4_36253_0_1dd_Smed_v4PMID:29674431
neuronSMED30019324Clathrin light chainSMESG000019387.1 dd_Smed_v4_2973_0_1dd_Smed_v4PMID:29674431
neuronSMED30019324Clathrin light chainSMESG000019387.1 dd_Smed_v4_2973_0_1dd_Smed_v4PMID:29674431
neuronSMED30015589SMED30015589SMESG000063816.1 SMESG000010536.1 SMESG000045280.1 SMESG000029730.1 dd_Smed_v4_4145_0_1dd_Smed_v4PMID:29674431
neuronSMED30015589SMED30015589SMESG000063816.1 SMESG000010536.1 SMESG000045280.1 SMESG000029730.1 dd_Smed_v4_4145_0_1dd_Smed_v4PMID:29674431
neuronSMED30016338Alpha-adducinSMESG000051636.1 dd_Smed_v4_2345_0_1dd_Smed_v4PMID:29674431
neuronSMED30016338Alpha-adducinSMESG000051636.1 dd_Smed_v4_2345_0_1dd_Smed_v4PMID:29674431
neuronSMED30008221FTS and Hook-interacting proteinSMESG000025657.1 dd_Smed_v4_9831_0_1dd_Smed_v4PMID:29674431
neuronSMED30012985Protein FAM188BSMESG000064698.1 Contig38731newmark_estsPMID:27612384
neuronSMED30012985Protein FAM188BSMESG000064698.1 Contig38731uc_Smed_v2PMID:27612384
neuronSMED30012985Protein FAM188BSMESG000064698.1 dd_Smed_v4_13105_0_1dd_Smed_v4PMID:29674431
neuronSMED30007581cilia- and flagella-associated protein 69SMESG000047535.1 dd_Smed_v4_7432_0_1dd_Smed_v4PMID:29674431
neuronSMED30007581cilia- and flagella-associated protein 69SMESG000047535.1 dd_Smed_v4_7432_0_1dd_Smed_v4PMID:29674431
neuronSMED30006233GTP-binding protein GEMSMESG000032890.1 dd_Smed_v4_11010_0_1dd_Smed_v4PMID:29674431
neuronSMED30006233GTP-binding protein GEMSMESG000032890.1 dd_Smed_v4_11010_0_1dd_Smed_v4PMID:29674431
neuronSMED30012777Usp domain-containing proteinSMESG000035960.1 dd_Smed_v4_7254_0_1dd_Smed_v4PMID:29674431
neuronSMED30012777Usp domain-containing proteinSMESG000035960.1 dd_Smed_v4_7254_0_1dd_Smed_v4PMID:29674431
neuronSMED30012459SMED30012459SMESG000003156.1 dd_Smed_v4_2446_0_1dd_Smed_v4PMID:29674431
neuronSMED30012459SMED30012459SMESG000003156.1 dd_Smed_v4_2446_0_1dd_Smed_v4PMID:29674431
neuronSMED30013159LimbinSMESG000017303.1 dd_Smed_v4_10777_0_1dd_Smed_v4PMID:29674431
neuronSMED30013159LimbinSMESG000017303.1 dd_Smed_v4_10777_0_1dd_Smed_v4PMID:29674431
neuronSMED30010523SMED30010523SMESG000080770.1 SMESG000072841.1 SMESG000065333.1 SMESG000060686.1 SMESG000059844.1 SMESG000058646.1 SMESG000055266.1 SMESG000055265.1 SMESG000054970.1 SMESG000052813.1 SMESG000043147.1 SMESG000043019.1 SMESG000041242.1 SMESG000037745.1 SMESG000037601.1 SMESG000036070.1 SMESG000034368.1 SMESG000031415.1 SMESG000019820.1 SMESG000019663.1 SMESG000010897.1 SMESG000009005.1 SMESG000005029.1 SMESG000077800.1 SMESG000054046.1 SMESG000052058.1 Contig20343newmark_estsPMID:27612384
neuronSMED30010523SMED30010523SMESG000080770.1 SMESG000072841.1 SMESG000065333.1 SMESG000060686.1 SMESG000059844.1 SMESG000058646.1 SMESG000055266.1 SMESG000055265.1 SMESG000054970.1 SMESG000052813.1 SMESG000043147.1 SMESG000043019.1 SMESG000041242.1 SMESG000037745.1 SMESG000037601.1 SMESG000036070.1 SMESG000034368.1 SMESG000031415.1 SMESG000019820.1 SMESG000019663.1 SMESG000010897.1 SMESG000009005.1 SMESG000005029.1 SMESG000077800.1 SMESG000054046.1 SMESG000052058.1 Contig20343uc_Smed_v2PMID:27612384
neuronSMED30010523SMED30010523SMESG000077800.1 SMESG000054046.1 SMESG000052058.1 SMESG000044674.1 SMESG000066333.1 SMESG000052053.1 SMESG000052952.1 SMESG000080770.1 SMESG000065333.1 SMESG000063486.1 SMESG000059844.1 SMESG000058646.1 SMESG000055266.1 SMESG000054970.1 SMESG000052813.1 SMESG000043147.1 SMESG000037745.1 SMESG000037601.1 SMESG000036070.1 SMESG000034880.1 SMESG000034368.1 SMESG000031415.1 SMESG000019663.1 SMESG000010897.1 SMESG000009005.1 SMESG000006729.1 SMESG000005029.1 SMESG000003989.1 dd_Smed_v4_1760_1_1dd_Smed_v4PMID:29674431
neuronSMED30010523SMED30010523SMESG000077800.1 SMESG000054046.1 SMESG000052058.1 SMESG000044674.1 SMESG000066333.1 SMESG000052053.1 SMESG000052952.1 SMESG000080770.1 SMESG000065333.1 SMESG000063486.1 SMESG000059844.1 SMESG000058646.1 SMESG000055266.1 SMESG000054970.1 SMESG000052813.1 SMESG000043147.1 SMESG000037745.1 SMESG000037601.1 SMESG000036070.1 SMESG000034880.1 SMESG000034368.1 SMESG000031415.1 SMESG000019663.1 SMESG000010897.1 SMESG000009005.1 SMESG000006729.1 SMESG000005029.1 SMESG000003989.1 dd_Smed_v4_1760_1_1dd_Smed_v4PMID:29674431
neuronSMED30010523SMED30010523SMESG000077800.1 SMESG000054046.1 SMESG000052058.1 SMESG000044674.1 SMESG000066333.1 SMESG000052053.1 SMESG000052952.1 SMESG000080770.1 SMESG000065333.1 SMESG000063486.1 SMESG000059844.1 SMESG000058646.1 SMESG000055266.1 SMESG000054970.1 SMESG000052813.1 SMESG000043147.1 SMESG000037745.1 SMESG000037601.1 SMESG000036070.1 SMESG000034880.1 SMESG000034368.1 SMESG000031415.1 SMESG000019663.1 SMESG000010897.1 SMESG000009005.1 SMESG000006729.1 SMESG000005029.1 SMESG000003989.1 dd_Smed_v6_1760_1dd_Smed_v6PMID:29674432
neuronSMED30013091SMED30013091SMESG000070818.1 dd_Smed_v4_1178_0_1dd_Smed_v4PMID:29674431
neuronSMED30019712Glutamate receptorSMESG000073268.1 dd_Smed_v4_7562_0_1dd_Smed_v4PMID:29674431
neuronSMED30019712Glutamate receptorSMESG000073268.1 dd_Smed_v4_7562_0_1dd_Smed_v4PMID:29674431
neuronSMED30019712Glutamate receptorSMESG000073692.1 dd_Smed_v4_17395_0_1dd_Smed_v4PMID:29674431
neuronSMED30019210SMED30019210SMESG000036067.1 dd_Smed_v4_9473_0_1dd_Smed_v4PMID:29674431
neuronSMED30017079LRRCC1SMESG000016752.1 dd_Smed_v4_10086_0_1dd_Smed_v4PMID:29674431
neuronSMED30017079LRRCC1SMESG000016752.1 dd_Smed_v4_10086_0_1dd_Smed_v4PMID:29674431
neuronSMED30010287homeobox protein aristaless-likeSMESG000080420.1 Contig41818newmark_estsPMID:27612384
neuronSMED30010287homeobox protein aristaless-likeSMESG000080420.1 Contig41818uc_Smed_v2PMID:27612384
neuronSMED30011421SMED30011421SMESG000034948.1 SMESG000034947.1 dd_Smed_v4_2008_0_1dd_Smed_v4PMID:29674431
neuronSMED30011421SMED30011421SMESG000034948.1 SMESG000034947.1 dd_Smed_v4_2008_0_1dd_Smed_v4PMID:29674431
neuronSMED30002366cAMP-dependent protein kinase regulatory subunitSMESG000052390.1 dd_Smed_v4_7586_0_1dd_Smed_v4PMID:29674431
neuronSMED30002366cAMP-dependent protein kinase regulatory subunitSMESG000052390.1 dd_Smed_v4_7586_0_1dd_Smed_v4PMID:29674431
neuronSMED30012666SWIM-type domain-containing proteinSMESG000003282.1 Contig18900newmark_estsPMID:27612384
neuronSMED30012666SWIM-type domain-containing proteinSMESG000003282.1 Contig18900uc_Smed_v2PMID:27612384
neuronSMED30013807Aromatic amino acid decarboxylaseSMESG000058665.1 Contig51335newmark_estsPMID:27612384
neuronSMED30013807Aromatic amino acid decarboxylaseSMESG000058665.1 Contig51335uc_Smed_v2PMID:27612384
neuronSMED30018250Telomerase-binding protein EST1ASMESG000014375.1 Contig44115newmark_estsPMID:27612384
neuronSMED30018250Telomerase-binding protein EST1ASMESG000014375.1 Contig44115uc_Smed_v2PMID:27612384
neuronSMED30001235Cilia and flagella associated protein 298SMESG000074029.1 dd_Smed_v4_3612_0_1dd_Smed_v4PMID:29674431
neuronSMED30001235Cilia and flagella associated protein 298SMESG000074029.1 dd_Smed_v4_3612_0_1dd_Smed_v4PMID:29674431
neuronSMED30000644Kinesin proteinSMESG000060958.1 dd_Smed_v4_7196_0_1dd_Smed_v4PMID:29674431
neuronSMED30033594Microtubule-associated protein 1ASMESG000014298.1 dd_Smed_v6_3654_0dd_Smed_v6PMID:29674432
neuronSMED30033594Microtubule-associated protein 1ASMESG000014298.1 dd_Smed_v6_1301_0dd_Smed_v6PMID:29674432
neuronSMED30035291PikachurinSMESG000079944.1 dd_Smed_v4_10946_0_1dd_Smed_v4PMID:29674431
neuronSMED30035291PikachurinSMESG000079944.1 dd_Smed_v4_10946_0_1dd_Smed_v4PMID:29674431
neuronSMED30029624Heterogeneous nuclear ribonucleoprotein KSMESG000064674.1 dd_Smed_v4_1998_0_1dd_Smed_v4PMID:29674431
neuronSMED30025287Protein unc-13SMESG000042667.1 SMESG000042664.1 SMESG000042670.1 dd_Smed_v4_11981_0_1dd_Smed_v4PMID:29674431
neuronSMED30025287Protein unc-13SMESG000042667.1 SMESG000042664.1 SMESG000042670.1 dd_Smed_v4_11981_0_1dd_Smed_v4PMID:29674431
neuronSMED30026182Sodium/potassium-transporting ATPase subunit beta-2SMESG000071416.1 dd_Smed_v4_7917_0_1dd_Smed_v4PMID:29674431
neuronSMED30026182Sodium/potassium-transporting ATPase subunit beta-2SMESG000071416.1 dd_Smed_v4_7917_0_1dd_Smed_v4PMID:29674431
neuronSMED30033332Beta-adducinSMESG000059133.1 dd_Smed_v4_1425_0_1dd_Smed_v4PMID:29674431
neuronSMED30033332Beta-adducinSMESG000059133.1 dd_Smed_v4_1425_0_1dd_Smed_v4PMID:29674431
neuronSMED30026237Coiled-coil and C2 domain containing 2ASMESG000048372.1 dd_Smed_v4_11189_0_1dd_Smed_v4PMID:29674431
neuronSMED30026237Coiled-coil and C2 domain containing 2ASMESG000048372.1 dd_Smed_v4_11189_0_1dd_Smed_v4PMID:29674431
neuronSMED30026237Coiled-coil and C2 domain containing 2ASMESG000048372.1 dd_Smed_v6_11189_0_1dd_Smed_v6PMID:30399335
neuronSMED30021589Agrin, putativeSMESG000028865.1 SMESG000028859.1 dd_Smed_v4_3649_0_1dd_Smed_v4PMID:29674431
neuronSMED30025815SMED30025815SMESG000028784.1 SMESG000061889.1 dd_Smed_v4_3519_0_1dd_Smed_v4PMID:29674431
neuronSMED30025815SMED30025815SMESG000028784.1 SMESG000061889.1 dd_Smed_v4_3519_0_1dd_Smed_v4PMID:29674431
neuronSMED30023043SMED30023043SMESG000019067.1 dd_Smed_v4_13671_0_1dd_Smed_v4PMID:29674431
neuronSMED30034137SMED30034137SMESG000045996.1 dd_Smed_v4_13741_0_1dd_Smed_v4PMID:29674431
neuronSMED30029805Kinesin proteinSMESG000013633.1 SMESG000013625.1 dd_Smed_v4_13562_0_1dd_Smed_v4PMID:29674431
neuronSMED30029805Kinesin proteinSMESG000013633.1 SMESG000013625.1 dd_Smed_v4_13562_0_1dd_Smed_v4PMID:29674431
neuronSMED30025753SMED30025753SMESG000016791.1 dd_Smed_v4_10_0_1dd_Smed_v4PMID:29674431
neuronSMED30033276SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily B member 1SMESG000018094.1 Contig51602newmark_estsPMID:27612384
neuronSMED30033276SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily B member 1SMESG000018094.1 Contig51602uc_Smed_v2PMID:27612384
neuronSMED30033276SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily B member 1SMESG000018094.1 dd_Smed_v4_1963_0_1dd_Smed_v4PMID:29674431
neuronSMED30033709Protein unc-80SMESG000014375.1 Contig44115newmark_estsPMID:27612384
neuronSMED30033709Protein unc-80SMESG000014375.1 Contig44115uc_Smed_v2PMID:27612384
neuronSMED30033709Protein unc-80SMESG000014375.1 dd_Smed_v4_11471_0_1dd_Smed_v4PMID:29674431
neuronSMED30033709Protein unc-80SMESG000014375.1 dd_Smed_v4_5118_0_1dd_Smed_v4PMID:29674431
neuronSMED30023483INX-13SMESG000043575.1 Contig50609uc_Smed_v2PMID:27612384
neuronSMED30023483INX-13SMESG000043575.1 dd_Smed_v4_11501_0_1dd_Smed_v4PMID:29674431
neuronSMED30035929SWI/SNF complex subunit SMARCC2SMESG000031576.1 SMESG000013315.1 dd_Smed_v4_1804_0_1dd_Smed_v4PMID:29674431
neuronSMED30035929SWI/SNF complex subunit SMARCC2SMESG000031576.1 SMESG000013315.1 Contig17559newmark_estsPMID:27612384
neuronSMED30035929SWI/SNF complex subunit SMARCC2SMESG000031576.1 SMESG000013315.1 Contig17559uc_Smed_v2PMID:27612384
neuronSMED30028343Cytosolic carboxypeptidase 2SMESG000006325.1 dd_Smed_v4_13454_0_1dd_Smed_v4PMID:29674431
neuronSMED30028343Cytosolic carboxypeptidase 2SMESG000006325.1 dd_Smed_v4_13454_0_1dd_Smed_v4PMID:29674431
neuronSMED30022905DihydropyrimidinaseSMESG000028784.1 SMESG000061889.1 dd_Smed_v4_3519_0_1dd_Smed_v4PMID:29674431
neuronSMED30022905DihydropyrimidinaseSMESG000028784.1 SMESG000061889.1 dd_Smed_v4_3519_0_1dd_Smed_v4PMID:29674431
neuronSMED30034737Protocadherin-1SMESG000005378.1 Contig35337newmark_estsPMID:27612384
neuronSMED30034737Protocadherin-1SMESG000005378.1 Contig35337uc_Smed_v2PMID:27612384
neuronSMED30034737Protocadherin-1SMESG000005378.1 dd_Smed_v4_10467_0_1dd_Smed_v4PMID:29674431
neuronSMED30028133SMED30028133SMESG000071441.1 SMESG000059599.1 SMESG000058180.1 SMESG000047025.1 SMESG000041246.1 SMESG000037745.1 SMESG000013749.1 Contig36213newmark_estsPMID:27612384
neuronSMED30028133SMED30028133SMESG000071441.1 SMESG000059599.1 SMESG000058180.1 SMESG000047025.1 SMESG000041246.1 SMESG000037745.1 SMESG000013749.1 Contig36213uc_Smed_v2PMID:27612384
neuronSMED30030477peptidyl prolyl cis trans isomerase FKBP-1SMESG000026331.1 Contig49356newmark_estsPMID:27612384
neuronSMED30030477peptidyl prolyl cis trans isomerase FKBP-1SMESG000026331.1 Contig49356uc_Smed_v2PMID:27612384
neuronSMED30000644Kinesin proteinSMESG000060958.1 dd_Smed_v4_7196_0_1dd_Smed_v4PMID:29674431
neuronSMED30007869ANK_REP_REGION domain-containing proteinSMESG000069889.1 dd_Smed_v4_10986_0_1dd_Smed_v4PMID:29674431
neuronSMED30013182Rho GTPase-activating proteinSMESG000017186.1 dd_Smed_v4_12363_0_1dd_Smed_v4PMID:29674431
neuronSMED30003321Kinase D-interacting substrateSMESG000080369.1 dd_Smed_v4_9630_0_1dd_Smed_v4PMID:29674431
neuronSMED30003321Kinase D-interacting substrateSMESG000080369.1 dd_Smed_v4_9630_0_1dd_Smed_v4PMID:29674431
neuronSMED30018224Adenylate kinaseSMESG000080770.1 SMESG000072841.1 SMESG000065333.1 SMESG000060686.1 SMESG000059844.1 SMESG000058646.1 SMESG000055266.1 SMESG000055265.1 SMESG000054970.1 SMESG000052813.1 SMESG000043147.1 SMESG000043019.1 SMESG000041242.1 SMESG000037745.1 SMESG000037601.1 SMESG000036070.1 SMESG000034368.1 SMESG000031415.1 SMESG000019820.1 SMESG000019663.1 SMESG000010897.1 SMESG000009005.1 SMESG000005029.1 SMESG000077800.1 SMESG000054046.1 SMESG000052058.1 Contig20343newmark_estsPMID:27612384
neuronSMED30018224Adenylate kinaseSMESG000080770.1 SMESG000072841.1 SMESG000065333.1 SMESG000060686.1 SMESG000059844.1 SMESG000058646.1 SMESG000055266.1 SMESG000055265.1 SMESG000054970.1 SMESG000052813.1 SMESG000043147.1 SMESG000043019.1 SMESG000041242.1 SMESG000037745.1 SMESG000037601.1 SMESG000036070.1 SMESG000034368.1 SMESG000031415.1 SMESG000019820.1 SMESG000019663.1 SMESG000010897.1 SMESG000009005.1 SMESG000005029.1 SMESG000077800.1 SMESG000054046.1 SMESG000052058.1 Contig20343uc_Smed_v2PMID:27612384
neuronSMED30018224Adenylate kinaseSMESG000077377.1 SMESG000076900.1 SMESG000063429.1 SMESG000060686.1 SMESG000043019.1 SMESG000031308.1 SMESG000028811.1 SMESG000023833.1 SMESG000023573.1 SMESG000019820.1 SMESG000011532.1 SMESG000052813.1 dd_Smed_v4_1229_0_1dd_Smed_v4PMID:29674431
neuronSMED30009869fas-binding factor 1 homologSMESG000037546.1 dd_Smed_v4_12735_0_1dd_Smed_v4PMID:29674431
neuronSMED30009869fas-binding factor 1 homologSMESG000037546.1 dd_Smed_v4_12422_0_1dd_Smed_v4PMID:29674431
neuronSMED30012555Ras-related protein Rab-39BSMESG000056866.1 Contig15474newmark_estsPMID:27612384
neuronSMED30012555Ras-related protein Rab-39BSMESG000056866.1 Contig15474uc_Smed_v2PMID:27612384
neuronSMED30009090Mushroom body large-type Kenyon-related proteinSMESG000070784.1 Contig45195newmark_estsPMID:27612384
neuronSMED30009090Mushroom body large-type Kenyon-related proteinSMESG000070784.1 Contig45195uc_Smed_v2PMID:27612384
neuronSMED30009090Mushroom body large-type Kenyon-related proteinSMESG000070784.1 dd_Smed_v4_17498_0_1dd_Smed_v4PMID:29674431
neuronSMED30016154SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily B member 1SMESG000018094.1 Contig51602newmark_estsPMID:27612384
neuronSMED30016154SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily B member 1SMESG000018094.1 Contig51602uc_Smed_v2PMID:27612384
neuronSMED30016154SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily B member 1SMESG000018094.1 dd_Smed_v4_1963_0_1dd_Smed_v4PMID:29674431
neuronSMED30011842beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase 3SMESG000009072.1 SMESG000009005.1 Contig42881newmark_estsPMID:27612384
neuronSMED30011842beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase 3SMESG000009072.1 SMESG000009005.1 Contig42881uc_Smed_v2PMID:27612384
neuronSMED30010360Leucine Rich repeat-containing domain proteinSMESG000047911.1 SMESG000045664.1 dd_Smed_v4_2769_0_1dd_Smed_v4PMID:29674431
neuronSMED30010360Leucine Rich repeat-containing domain proteinSMESG000047911.1 SMESG000045664.1 dd_Smed_v4_2769_0_1dd_Smed_v4PMID:29674431
neuronSMED30000072retinoblastoma binding protein-1SMESG000060842.1 SMESG000029096.1 SMESG000024644.1 SMESG000021373.1 SMESG000013977.1 SMESG000007931.1 Contig44727newmark_estsPMID:27612384
neuronSMED30000072retinoblastoma binding protein-1SMESG000060842.1 SMESG000029096.1 SMESG000024644.1 SMESG000021373.1 SMESG000013977.1 SMESG000007931.1 Contig44727uc_Smed_v2PMID:27612384
neuronSMED30013474SMED30013474SMESG000069967.1 dd_Smed_v4_6939_0_1dd_Smed_v4PMID:29674431
neuronSMED30013474SMED30013474SMESG000069967.1 dd_Smed_v4_6939_0_1dd_Smed_v4PMID:29674431
neuronSMED30015940Conserved oligomeric Golgi complex subunit 6SMESG000075200.1 Contig29858newmark_estsPMID:27612384
neuronSMED30015940Conserved oligomeric Golgi complex subunit 6SMESG000075200.1 Contig29858uc_Smed_v2PMID:27612384
neuronSMED30015048Cullin-3SMESG000003282.1 Contig18900newmark_estsPMID:27612384
neuronSMED30015048Cullin-3SMESG000003282.1 Contig18900uc_Smed_v2PMID:27612384
neuronSMED30017943SMED30017943SMESG000022837.1 dd_Smed_v4_16017_0_1dd_Smed_v4PMID:29674431
neuronSMED30017943SMED30017943SMESG000022837.1 dd_Smed_v4_16017_0_1dd_Smed_v4PMID:29674431
neuronSMED30017180Dynein regulatory complex protein 1SMESG000072168.1 dd_Smed_v4_8761_0_1dd_Smed_v4PMID:29674431
neuronSMED30017180Dynein regulatory complex protein 1SMESG000072168.1 dd_Smed_v4_8761_0_1dd_Smed_v4PMID:29674431
neuronSMED30033594Microtubule-associated protein 1ASMESG000014298.1 dd_Smed_v4_1301_0_1dd_Smed_v4PMID:29674431
neuronSMED30033594Microtubule-associated protein 1ASMESG000014298.1 dd_Smed_v4_1301_0_1dd_Smed_v4PMID:29674431
neuronSMED30033594Microtubule-associated protein 1ASMESG000014298.1 dd_Smed_v4_3654_0_1dd_Smed_v4PMID:29674431
neuronSMED30033594Microtubule-associated protein 1ASMESG000014298.1 dd_Smed_v4_3654_0_1dd_Smed_v4PMID:29674431
neuronSMED30031183SMB domain-containing proteinSMESG000079236.1 dd_Smed_v4_11622_0_1dd_Smed_v4PMID:29674431
neuronSMED30023228SMED30023228SMESG000058720.1 dd_Smed_v4_7931_0_1dd_Smed_v4PMID:29674431
neuronSMED30023228SMED30023228SMESG000058720.1 dd_Smed_v4_7931_0_1dd_Smed_v4PMID:29674431
neuronSMED30020574Dynein heavy chain axonemalSMESG000017294.1 dd_Smed_v4_6790_0_1dd_Smed_v4PMID:29674431
neuronSMED30020574Dynein heavy chain axonemalSMESG000017294.1 dd_Smed_v4_6790_0_1dd_Smed_v4PMID:29674431
neuronSMED30020574Dynein heavy chain axonemalSMESG000017294.1 Contig40083newmark_estsPMID:27612384
neuronSMED30020574Dynein heavy chain axonemalSMESG000017294.1 Contig40083uc_Smed_v2PMID:27612384
neuronSMED30020574Dynein heavy chain axonemalSMESG000017294.1 dd_Smed_v4_13058_0_1dd_Smed_v4PMID:29674431
neuronSMED30031433SMED30031433SMESG000064896.1 dd_Smed_v4_4637_0_2dd_Smed_v4PMID:29674431
neuronSMED30023344Sn1-specific diacylglycerol lipase betaSMESG000046500.1 dd_Smed_v4_13306_0_1dd_Smed_v4PMID:29674431
neuronSMED30023344Sn1-specific diacylglycerol lipase betaSMESG000046500.1 dd_Smed_v4_13306_0_1dd_Smed_v4PMID:29674431
neuronSMED30021339Potassium voltage gated channel subfamily CSMESG000038656.1 dd_Smed_v4_15912_0_1dd_Smed_v4PMID:29674431
neuronSMED30021431TTF-type domain-containing proteinSMESG000080622.1 SMESG000068757.1 SMESG000055125.1 SMESG000038294.1 SMESG000032747.1 SMESG000023322.1 dd_Smed_v4_3830_0_1dd_Smed_v4PMID:29674431
neuronSMED30021178PRKCA-binding proteinSMESG000005998.1 dd_Smed_v4_2968_0_1dd_Smed_v4PMID:29674431
neuronSMED30033153Partitioning defective 3-likeSMESG000050856.1 dd_Smed_v4_11296_0_1dd_Smed_v4PMID:29674431
neuronSMED30033879SMED30033879SMESG000023632.1 dd_Smed_v4_10785_0_1dd_Smed_v4PMID:29674431
neuronSMED30029183Calcium:calmodulin dependent protein kinase typeSMESG000027403.1 SMESG000027402.1 dd_Smed_v4_11876_0_1dd_Smed_v4PMID:29674431
neuronSMED30024943SMED30024943SMESG000064314.1 dd_Smed_v4_16650_0_1dd_Smed_v4PMID:29674431
neuronSMED30029634Kinesin family member 15SMESG000064131.1 dd_Smed_v4_11717_0_1dd_Smed_v4PMID:29674431
neuronSMED30029634Kinesin family member 15SMESG000064131.1 dd_Smed_v4_11717_0_1dd_Smed_v4PMID:29674431
neuronSMED30022232Glutathione s-transferaseSMESG000016846.1 dd_Smed_v4_1206_0_1dd_Smed_v4PMID:29674431
neuronSMED30002902Triple functional domain proteinSMESG000061508.1 SMESG000027427.1 dd_Smed_v4_5483_0_1dd_Smed_v4PMID:29674431
neuronSMED30015235Amyloid-beta A4 precursor protein-binding family A member 2SMESG000028901.1 dd_Smed_v4_2836_0_1dd_Smed_v4PMID:29674431
neuronSMED30015235Amyloid-beta A4 precursor protein-binding family A member 2SMESG000028901.1 Contig30620newmark_estsPMID:27612384
neuronSMED30015235Amyloid-beta A4 precursor protein-binding family A member 2SMESG000028901.1 Contig30620uc_Smed_v2PMID:27612384
neuronSMED30009973mxi-1 proteinSMESG000047681.1 SMESG000016277.1 dd_Smed_v4_4415_0_1dd_Smed_v4PMID:29674431
neuronSMED30009973mxi-1 proteinSMESG000047681.1 SMESG000016277.1 dd_Smed_v4_4415_0_1dd_Smed_v4PMID:29674431
neuronSMED30003733c-SKI_SMAD_bind domain-containing proteinSMESG000067290.1 dd_Smed_v4_10921_0_1dd_Smed_v4PMID:29674431
neuronSMED30017980Cyclin-dependent kinase 5 activatorSMESG000003825.1 dd_Smed_v4_13788_0_1dd_Smed_v4PMID:29674431
neuronSMED30017980Cyclin-dependent kinase 5 activatorSMESG000003825.1 dd_Smed_v4_13788_0_1dd_Smed_v4PMID:29674431
neuronSMED30000291Intersectin-1SMESG000065922.1 SMESG000066021.1 SMESG000065955.1 SMESG000065944.1 dd_Smed_v4_5505_0_1dd_Smed_v4PMID:29674431
neuronSMED30000291Intersectin-1SMESG000065922.1 SMESG000066021.1 SMESG000065955.1 SMESG000065944.1 dd_Smed_v4_5505_0_1dd_Smed_v4PMID:29674431
neuronSMED30010096TPA_inf: prohormone convertase 2SMESG000008070.1 dd_Smed_v4_1566_0_1dd_Smed_v4PMID:29674431
neuronSMED30010096TPA_inf: prohormone convertase 2SMESG000008070.1 dd_Smed_v6_1566_0dd_Smed_v6PMID:29674432
neuronSMED30003275Guanine nucleotide-binding protein G(O) subunit alphaSMESG000055191.1 dd_Smed_v4_1656_0_1dd_Smed_v4PMID:29674431
neuronSMED30003275Guanine nucleotide-binding protein G(O) subunit alphaSMESG000055191.1 dd_Smed_v4_1656_0_1dd_Smed_v4PMID:29674431
neuronSMED30006259DNA repair protein complementing XP-G cells-like proteinSMESG000019370.1 dd_Smed_v4_10808_0_1dd_Smed_v4PMID:29674431
neuronSMED30000338Pleckstrin homology domain-containing family G member 7SMESG000022039.1 dd_Smed_v4_16856_0_1dd_Smed_v4PMID:29674431
neuronSMED30005171SMED30005171SMESG000024345.1 dd_Smed_v4_629_0_1dd_Smed_v4PMID:29674431
neuronSMED30006217SMED30006217SMESG000005578.1 dd_Smed_v4_1737_0_1dd_Smed_v4PMID:29674431
neuronSMED30006217SMED30006217 dd_Smed_v4_1385_0_1dd_Smed_v4PMID:29674431
neuronSMED30001142CadherinSMESG000020071.1 dd_Smed_v4_11814_0_1dd_Smed_v4PMID:29674431
neuronSMED30001142CadherinSMESG000020071.1 dd_Smed_v4_11814_0_1dd_Smed_v4PMID:29674431
neuronSMED30001142CadherinSMESG000020082.1 SMESG000020071.1 dd_Smed_v4_2107_0_1dd_Smed_v4PMID:29674431
neuronSMED30034920G protein gamma domain-containing proteinSMESG000066557.1 dd_Smed_v4_1237_0_1dd_Smed_v4PMID:29674431
neuronSMED30034920G protein gamma domain-containing proteinSMESG000066557.1 dd_Smed_v4_1237_0_1dd_Smed_v4PMID:29674431
neuronSMED30034920G protein gamma domain-containing proteinSMESG000066557.1 dd_Smed_v6_1237_0dd_Smed_v6PMID:29674432
neuronSMED30027594CYLD lysine 63 deubiquitinaseSMESG000015653.1 dd_Smed_v4_3043_0_1dd_Smed_v4PMID:29674431
neuronSMED30027594CYLD lysine 63 deubiquitinaseSMESG000015653.1 dd_Smed_v4_3043_0_1dd_Smed_v4PMID:29674431
neuronSMED30034837Potassium voltage-gated channel proteinSMESG000029097.1 dd_Smed_v4_13710_0_1dd_Smed_v4PMID:29674431
neuronSMED30022812Receptor-type tyrosine-protein phosphatase SSMESG000068618.1 dd_Smed_v4_12771_0_1dd_Smed_v4PMID:29674431
neuronSMED30016664SMED30016664SMESG000011618.1 DAA33898smed_ncbi_20200123PMID:25356635
neuronSMED30002938SH3 and multiple ankyrin repeat domains protein 2SMESG000078048.1 dd_Smed_v4_10116_0_1dd_Smed_v4PMID:29674431
neuronSMED30001900Bruno-like proteinSMESG000046617.1 dd_Smed_v4_17226_0_1dd_Smed_v4PMID:29674431
neuronSMED30013128Death domain proteinSMESG000003436.1 Contig18759newmark_estsPMID:27612384
neuronSMED30013128Death domain proteinSMESG000003436.1 Contig18759uc_Smed_v2PMID:27612384
neuronSMED30013128Death domain proteinSMESG000003436.1 dd_Smed_v4_7532_0_1dd_Smed_v4PMID:29674431
neuronSMED30009498slc4a-3SMESG000049796.1 dd_Smed_v4_9699_0_1dd_Smed_v4PMID:29674431
neuronSMED30011750Phosphoinositide phospholipase CSMESG000070741.1 SMESG000070728.1 dd_Smed_v4_9716_1_1dd_Smed_v4PMID:29674431
neuronSMED30011750Phosphoinositide phospholipase CSMESG000070728.1 dd_Smed_v4_39585_0_1dd_Smed_v4PMID:29674431
neuronSMED30014144Phytanoyl-CoA dioxygenase domain-containing protein 1-likeSMESG000023010.1 dd_Smed_v4_1207_0_1dd_Smed_v4PMID:29674431
neuronSMED30014144Phytanoyl-CoA dioxygenase domain-containing protein 1-likeSMESG000023010.1 dd_Smed_v4_1207_0_1dd_Smed_v4PMID:29674431
neuronSMED30007512Syntaxin binding protein 5SMESG000025197.1 dd_Smed_v4_7617_0_1dd_Smed_v4PMID:29674431
neuronSMED30001421SMED30001421SMESG000078112.1 dd_Smed_v4_16420_0_1dd_Smed_v4PMID:29674431
neuronSMED30001584SMED30001584SMESG000058817.1 dd_Smed_v4_12647_0_1dd_Smed_v4PMID:29674431
neuronSMED30001584SMED30001584SMESG000058817.1 dd_Smed_v4_12647_0_1dd_Smed_v4PMID:29674431
neuronSMED30000763SMED30000763SMESG000068156.1 SMESG000064685.1 SMESG000011804.1 SMESG000010609.1 SMESG000062429.1 SMESG000053533.1 SMESG000015751.1 SMESG000001486.1 dd_Smed_v4_1671_0_1dd_Smed_v4PMID:29674431
neuronSMED30000763SMED30000763SMESG000001486.1 SMESG000068156.1 SMESG000064685.1 SMESG000011804.1 SMESG000010609.1 SMESG000062429.1 SMESG000053533.1 SMESG000015751.1 dd_Smed_v6_1671_0dd_Smed_v6PMID:29674432
neuronSMED30002255Regulating synaptic membrane exocytosis protein 2SMESG000023007.1 dd_Smed_v4_10734_0_1dd_Smed_v4PMID:29674431
neuronSMED30002255Regulating synaptic membrane exocytosis protein 2SMESG000023007.1 dd_Smed_v4_10734_0_1dd_Smed_v4PMID:29674431
neuronSMED30002255Regulating synaptic membrane exocytosis protein 2SMESG000023007.1 dd_Smed_v4_15661_0_1dd_Smed_v4PMID:29674431
neuronSMED30010766C2 domain-containing protein 3SMESG000025571.1 dd_Smed_v4_13019_0_1dd_Smed_v4PMID:29674431
neuronSMED30016950DystrophinSMESG000020523.1 dd_Smed_v4_5325_0_1dd_Smed_v4PMID:29674431
neuronSMED30002145HEAT repeat-containing protein 4SMESG000024853.1 SMESG000024852.1 dd_Smed_v4_16127_0_1dd_Smed_v4PMID:29674431
neuronSMED30016948Regulator of G-protein signaling 9-binding proteinSMESG000016932.1 dd_Smed_v4_14671_0_1dd_Smed_v4PMID:29674431
neuronSMED30016948Regulator of G-protein signaling 9-binding proteinSMESG000016932.1 dd_Smed_v4_14671_0_1dd_Smed_v4PMID:29674431
neuronSMED30014724Tetraspanin-CD63 receptorSMESG000041117.1 dd_Smed_v4_1378_0_1dd_Smed_v4PMID:29674431
neuronSMED30014724Tetraspanin-CD63 receptorSMESG000041117.1 dd_Smed_v4_1378_0_1dd_Smed_v4PMID:29674431
neuronSMED30010638DNA-binding protein inhibitor ID-2SMESG000017492.1 dd_Smed_v4_11911_0_1dd_Smed_v4PMID:29674431
neuronSMED30002969transcription factor 7-like 2 isoform X1SMESG000009225.1 dd_Smed_v4_13056_0_1dd_Smed_v4PMID:29674431
neuronSMED30008580potassium voltage-gated channel subfamily H member 8SMESG000017883.1 SMESG000017882.1 dd_Smed_v4_10983_0_1dd_Smed_v4PMID:29674431
neuronSMED30022812Receptor-type tyrosine-protein phosphatase SSMESG000068618.1 dd_Smed_v4_12771_0_1dd_Smed_v4PMID:29674431
neuronSMED30022812Receptor-type tyrosine-protein phosphatase SSMESG000068618.1 dd_Smed_v4_9734_0_1dd_Smed_v4PMID:29674431
neuronSMED30022812Receptor-type tyrosine-protein phosphatase SSMESG000068618.1 dd_Smed_v4_9734_0_1dd_Smed_v4PMID:29674431
neuronSMED30020234Kinase D-interacting substrateSMESG000079991.1 dd_Smed_v4_11743_0_1dd_Smed_v4PMID:29674431
neuronSMED30020234Kinase D-interacting substrateSMESG000079991.1 dd_Smed_v4_11743_0_1dd_Smed_v4PMID:29674431
neuronSMED30022585SMED30022585SMESG000021277.1 dd_Smed_v4_16056_0_1dd_Smed_v4PMID:29674431
neuronSMED30026519SMED30026519SMESG000064314.1 dd_Smed_v4_16650_0_1dd_Smed_v4PMID:29674431
neuronSMED30034319SMED30034319SMESG000068156.1 SMESG000064685.1 SMESG000011804.1 SMESG000010609.1 SMESG000062429.1 SMESG000053533.1 SMESG000015751.1 SMESG000001486.1 dd_Smed_v4_1671_0_1dd_Smed_v4PMID:29674431
neuronSMED30034319SMED30034319SMESG000001486.1 SMESG000068156.1 SMESG000064685.1 SMESG000011804.1 SMESG000010609.1 SMESG000062429.1 SMESG000053533.1 SMESG000015751.1 dd_Smed_v6_1671_0dd_Smed_v6PMID:29674432
neuronSMED30020678G-protein, gamma subunit,domain-containing proteinSMESG000066557.1 dd_Smed_v4_1237_0_1dd_Smed_v4PMID:29674431
neuronSMED30020678G-protein, gamma subunit,domain-containing proteinSMESG000066557.1 dd_Smed_v4_1237_0_1dd_Smed_v4PMID:29674431
neuronSMED30020678G-protein, gamma subunit,domain-containing proteinSMESG000066557.1 dd_Smed_v6_1237_0dd_Smed_v6PMID:29674432
neuronSMED30035448Kinesin motor domain proteinSMESG000075721.1 dd_Smed_v4_11799_0_1dd_Smed_v4PMID:29674431
neuronSMED30035448Kinesin motor domain proteinSMESG000075721.1 dd_Smed_v4_11799_0_1dd_Smed_v4PMID:29674431
neuronSMED30033164Heat shock 70 kDa proteinSMESG000041117.1 dd_Smed_v4_1378_0_1dd_Smed_v4PMID:29674431
neuronSMED30033164Heat shock 70 kDa proteinSMESG000041117.1 dd_Smed_v4_1378_0_1dd_Smed_v4PMID:29674431
neuronSMED30028387F-box and leucine rich repeat protein 16SMESG000006324.1 dd_Smed_v4_12738_0_1dd_Smed_v4PMID:29674431
neuronSMED30031080KH domain-containing proteinSMESG000004103.1 dd_Smed_v4_1578_0_1dd_Smed_v4PMID:29674431
neuronSMED30035610SMED30035610SMESG000021277.1 dd_Smed_v4_16056_0_1dd_Smed_v4PMID:29674431
neuronSMED30033232Retinoid isomerohydrolaseSMESG000054001.1 dd_Smed_v4_13185_0_1dd_Smed_v4PMID:29674431
neuronSMED30027887Interferon-induced GTP-binding protein Mx1SMESG000002025.1 dd_Smed_v4_7246_0_1dd_Smed_v4PMID:29674431
neuronSMED30027887Interferon-induced GTP-binding protein Mx1SMESG000002025.1 dd_Smed_v4_7246_0_1dd_Smed_v4PMID:29674431
neuronSMED30027887Interferon-induced GTP-binding protein Mx1SMESG000066856.1 SMESG000002221.1 SMESG000002213.1 dd_Smed_v4_5708_0_1dd_Smed_v4PMID:29674431
neuronSMED30027887Interferon-induced GTP-binding protein Mx1SMESG000002216.1 SMESG000002124.1 SMESG000002025.1 SMESG000002023.1 SMESG000002011.1 SMESG000002004.1 SMESG000002219.1 SMESG000002211.1 SMESG000002032.1 SMESG000002033.1 dd_Smed_v6_884_0dd_Smed_v6PMID:29674432
neuronSMED30032354EOG090X01A3SMESG000068156.1 SMESG000064685.1 SMESG000011804.1 SMESG000010609.1 SMESG000062429.1 SMESG000053533.1 SMESG000015751.1 SMESG000001486.1 dd_Smed_v4_1671_0_1dd_Smed_v4PMID:29674431
neuronSMED30032354EOG090X01A3SMESG000001486.1 SMESG000068156.1 SMESG000064685.1 SMESG000011804.1 SMESG000010609.1 SMESG000062429.1 SMESG000053533.1 SMESG000015751.1 dd_Smed_v6_1671_0dd_Smed_v6PMID:29674432
neuronSMED30028311Spectrin beta chainSMESG000066485.1 dd_Smed_v4_7344_0_1dd_Smed_v4PMID:29674431
neuronSMED30028311Spectrin beta chainSMESG000066485.1 dd_Smed_v4_7344_0_1dd_Smed_v4PMID:29674431
neuronSMED30028311Spectrin beta chainSMESG000066485.1 dd_Smed_v4_12996_0_1dd_Smed_v4PMID:29674431
neuronSMED30017162Casein kinase II subunit betaSMESG000060292.1 Contig48515newmark_estsPMID:27612384
neuronSMED30017162Casein kinase II subunit betaSMESG000060292.1 Contig48515uc_Smed_v2PMID:27612384
neuronSMED30006021WD_REPEATS_REGION domain-containing proteinSMESG000057088.1 Contig48022newmark_estsPMID:27612384
neuronSMED30006021WD_REPEATS_REGION domain-containing proteinSMESG000057088.1 Contig48022uc_Smed_v2PMID:27612384
neuronSMED30017165Succinate--CoA ligase [ADP-forming] subunit beta, mitochondrialSMESG000015204.1 dd_Smed_v4_2298_0_1dd_Smed_v4PMID:29674431
neuronSMED30017165Succinate--CoA ligase [ADP-forming] subunit beta, mitochondrialSMESG000015204.1 dd_Smed_v4_2298_0_1dd_Smed_v4PMID:29674431
neuronSMED30017913Fzd-5/8-3SMESG000035834.1 Contig35779newmark_estsPMID:27612384
neuronSMED30017913Fzd-5/8-3SMESG000035834.1 Contig35779uc_Smed_v2PMID:27612384
neuronSMED30002672Tigger transposable element-derived protein 6SMESG000075200.1 Contig29858newmark_estsPMID:27612384
neuronSMED30002672Tigger transposable element-derived protein 6SMESG000075200.1 Contig29858uc_Smed_v2PMID:27612384
neuronSMED30015887DUF4550 domain-containing proteinSMESG000000883.1 dd_Smed_v4_10058_0_1dd_Smed_v4PMID:29674431
neuronSMED30015887DUF4550 domain-containing proteinSMESG000000883.1 dd_Smed_v4_10058_0_1dd_Smed_v4PMID:29674431
neuronSMED30005891Atg13SMESG000063146.1 SMESG000053328.1 SMESG000051796.1 SMESG000041928.1 SMESG000039990.1 SMESG000039477.1 SMESG000039378.1 SMESG000029174.1 SMESG000017792.1 SMESG000001171.1 Contig36079newmark_estsPMID:27612384
neuronSMED30005891Atg13SMESG000063146.1 SMESG000053328.1 SMESG000051796.1 SMESG000041928.1 SMESG000039990.1 SMESG000039477.1 SMESG000039378.1 SMESG000029174.1 SMESG000017792.1 SMESG000001171.1 Contig36079uc_Smed_v2PMID:27612384
neuronSMED30008787innexin-1SMESG000043134.1 Contig38798newmark_estsPMID:27612384
neuronSMED30008787innexin-1SMESG000043134.1 Contig38798uc_Smed_v2PMID:27612384
neuronSMED30003556EpiphycanSMESG000057458.1 dd_Smed_v4_6669_0_1dd_Smed_v4PMID:29674431
neuronSMED30007698Zinc finger protein 28SMESG000041575.1 Contig34061newmark_estsPMID:27612384
neuronSMED30007698Zinc finger protein 28SMESG000041575.1 Contig34061uc_Smed_v2PMID:27612384
neuronSMED30003675adenylate kinase 7-likeSMESG000075409.1 dd_Smed_v4_5880_0_1dd_Smed_v4PMID:29674431
neuronSMED30003675adenylate kinase 7-likeSMESG000075409.1 dd_Smed_v4_5880_0_1dd_Smed_v4PMID:29674431
neuronSMED30003857Centrosomal protein of 162 kDaSMESG000027479.1 dd_Smed_v4_9279_0_1dd_Smed_v4PMID:29674431
neuronSMED30003857Centrosomal protein of 162 kDaSMESG000027479.1 dd_Smed_v4_9279_0_1dd_Smed_v4PMID:29674431
neuronSMED30006541SMED30006541SMESG000012332.1 SMESG000012317.1 SMESG000058954.1 dd_Smed_v4_246_0_1dd_Smed_v4PMID:29674431
neuronSMED30006541SMED30006541SMESG000012332.1 SMESG000012317.1 SMESG000058954.1 dd_Smed_v4_246_0_1dd_Smed_v4PMID:29674431
neuronSMED30006541SMED30006541SMESG000012332.1 SMESG000012317.1 SMESG000058958.1 SMESG000058954.1 dd_Smed_v6_246_0dd_Smed_v6PMID:29674432
neuronSMED30014519Caspase-1SMESG000002751.1 dd_Smed_v4_2943_0_1dd_Smed_v4PMID:29674431
neuronSMED30014519Caspase-1SMESG000002751.1 dd_Smed_v4_2943_0_1dd_Smed_v4PMID:29674431
neuronSMED30019914Disks large homolog 1SMESG000034854.1 Contig21285newmark_estsPMID:27612384
neuronSMED30019914Disks large homolog 1SMESG000034854.1 Contig21285uc_Smed_v2PMID:27612384
neuronSMED30019914Disks large homolog 1SMESG000034854.1 dd_Smed_v4_7374_0_1dd_Smed_v4PMID:29674431
neuronSMED30019914Disks large homolog 1SMESG000034854.1 dd_Smed_v4_7374_0_1dd_Smed_v4PMID:29674431
neuronSMED30011041Heat shock protein 903SMESG000041107.1 Contig49579newmark_estsPMID:27612384
neuronSMED30011041Heat shock protein 903SMESG000041107.1 Contig49579uc_Smed_v2PMID:27612384
neuronSMED30011041Heat shock protein 903SMESG000006119.1 dd_Smed_v4_1310_1_1dd_Smed_v4PMID:29674431
neuronSMED30011041Heat shock protein 903SMESG000006119.1 dd_Smed_v4_1310_1_1dd_Smed_v4PMID:29674431
neuronSMED30013228Ryanodine receptor relatedSMESG000000646.1 Contig36224newmark_estsPMID:27612384
neuronSMED30013228Ryanodine receptor relatedSMESG000000646.1 Contig36224uc_Smed_v2PMID:27612384
neuronSMED30013228Ryanodine receptor relatedSMESG000000645.1 SMESG000000646.1 dd_Smed_v4_5582_0_1dd_Smed_v4PMID:29674431
neuronSMED30011512Radial spoke head 1 homologSMESG000014300.1 dd_Smed_v4_3321_0_1dd_Smed_v4PMID:29674431
neuronSMED30011512Radial spoke head 1 homologSMESG000014300.1 dd_Smed_v4_3321_0_1dd_Smed_v4PMID:29674431
neuronSMED30003589Exocyst complex component 7SMESG000028363.1 Contig41970newmark_estsPMID:27612384
neuronSMED30003589Exocyst complex component 7SMESG000028363.1 Contig41970uc_Smed_v2PMID:27612384
neuronSMED30003589Exocyst complex component 7SMESG000028363.1 dd_Smed_v4_7926_0_1dd_Smed_v4PMID:29674431
neuronSMED30000596PeroxiredoxinSMESG000001807.1 dd_Smed_v4_7781_0_1dd_Smed_v4PMID:29674431
neuronSMED30000596PeroxiredoxinSMESG000001807.1 dd_Smed_v4_7781_0_1dd_Smed_v4PMID:29674431
neuronSMED30007426Synaptotagmin-1SMESG000048136.1 dd_Smed_v4_19328_0_1dd_Smed_v4PMID:29674431
neuronSMED30006258cGMP-dependent protein kinase,putativeSMESG000005347.1 dd_Smed_v4_16434_0_1dd_Smed_v4PMID:29674431
neuronSMED30009392NephrinSMESG000021277.1 dd_Smed_v4_16056_0_1dd_Smed_v4PMID:29674431
neuronSMED30012921Ras GTPase-activating protein gap-2SMESG000003718.1 SMESG000018818.1 dd_Smed_v4_2872_0_1dd_Smed_v4PMID:29674431
neuronSMED30012921Ras GTPase-activating protein gap-2SMESG000003718.1 SMESG000018818.1 dd_Smed_v4_2872_0_1dd_Smed_v4PMID:29674431
neuronSMED30014539cAMP-dependent protein kinase type II regulatory subunitSMESG000019065.1 dd_Smed_v4_2902_0_1dd_Smed_v4PMID:29674431
neuronSMED30014539cAMP-dependent protein kinase type II regulatory subunitSMESG000019065.1 dd_Smed_v4_2902_0_1dd_Smed_v4PMID:29674431
neuronSMED30013390Nesprin-1SMESG000069851.1 dd_Smed_v4_10646_0_1dd_Smed_v4PMID:29674431
neuronSMED30003546SMED30003546SMESG000072344.1 dd_Smed_v4_11255_0_1dd_Smed_v4PMID:29674431
neuronSMED30003546SMED30003546SMESG000072344.1 dd_Smed_v4_11255_0_1dd_Smed_v4PMID:29674431
neuronSMED30016078Actin, cytoplasmicSMESG000012332.1 SMESG000012317.1 SMESG000058954.1 dd_Smed_v4_246_0_1dd_Smed_v4PMID:29674431
neuronSMED30016078Actin, cytoplasmicSMESG000012332.1 SMESG000012317.1 SMESG000058954.1 dd_Smed_v4_246_0_1dd_Smed_v4PMID:29674431
neuronSMED30016078Actin, cytoplasmicSMESG000012332.1 SMESG000012317.1 dd_Smed_v4_285_0_1dd_Smed_v4PMID:29674431
neuronSMED30016078Actin, cytoplasmicSMESG000012332.1 SMESG000012317.1 dd_Smed_v4_285_0_1dd_Smed_v4PMID:29674431
neuronSMED30016078Actin, cytoplasmicSMESG000012332.1 SMESG000012317.1 dd_Smed_v6_285_0dd_Smed_v6PMID:29674432
neuronSMED30016078Actin, cytoplasmicSMESG000012332.1 SMESG000012317.1 SMESG000058958.1 SMESG000058954.1 dd_Smed_v6_246_0dd_Smed_v6PMID:29674432
neuronSMED30012731Heterogeneous nuclear ribonucleoprotein KSMESG000021955.1 SMESG000021966.1 dd_Smed_v4_2470_0_1dd_Smed_v4PMID:29674431
neuronSMED30008751Liprin-alpha-2SMESG000024331.1 SMESG000024325.1 dd_Smed_v4_12307_0_1dd_Smed_v4PMID:29674431
neuronSMED30008751Liprin-alpha-2SMESG000024331.1 SMESG000024325.1 dd_Smed_v4_12307_0_1dd_Smed_v4PMID:29674431
neuronSMED30018205Delta-like proteinSMESG000027403.1 SMESG000027402.1 dd_Smed_v4_11876_0_1dd_Smed_v4PMID:29674431
neuronSMED30019896casein kinase ISMESG000013473.1 dd_Smed_v4_1225_0_1dd_Smed_v4PMID:29674431
neuronSMED30019896casein kinase ISMESG000013473.1 dd_Smed_v4_1225_0_1dd_Smed_v4PMID:29674431
neuronSMED30001408Tyrosine-protein phosphatase Lar-likeSMESG000042151.1 dd_Smed_v4_16093_0_1dd_Smed_v4PMID:29674431
neuronSMED30001408Tyrosine-protein phosphatase Lar-likeSMESG000042151.1 dd_Smed_v4_16093_0_1dd_Smed_v4PMID:29674431
neuronSMED30015079Dynein heavy chain 5, axonemalSMESG000049144.1 dd_Smed_v4_4569_0_1dd_Smed_v4PMID:29674431
neuronSMED30015079Dynein heavy chain 5, axonemalSMESG000049144.1 dd_Smed_v4_4569_0_1dd_Smed_v4PMID:29674431
neuronSMED30016004SMED30016004SMESG000018602.1 dd_1083dd_Smed_v4PMID:29674431
neuronSMED30016004SMED30016004SMESG000018602.1 dd_1083dd_Smed_v4PMID:29674431
neuronSMED30016004SMED30016004SMESG000018602.1 dd_Smed_v4_1083_0_1dd_Smed_v4PMID:29674431
neuronSMED30016004SMED30016004SMESG000018602.1 dd_Smed_v4_1083_0_1dd_Smed_v4PMID:29674431
neuronSMED30000488Double C2-like domain-containing protein betaSMESG000009083.1 SMESG000009094.1 dd_Smed_v4_12977_0_1dd_Smed_v4PMID:29674431
neuronSMED30012922NPHS1-2SMESG000021277.1 dd_Smed_v4_16056_0_1dd_Smed_v4PMID:29674431
neuronSMED30016875Rho-associated kinaseSMESG000057753.1 JN100093smed_ncbi_20200123PMID:22339734
neuronSMED30016875Rho-associated kinaseSMESG000057753.1 dd_Smed_v4_2914_0_1dd_Smed_v4PMID:29674431
neuronSMED30016357SMED30016357SMESG000061508.1 SMESG000027427.1 dd_Smed_v4_5483_0_1dd_Smed_v4PMID:29674431
neuronSMED30018203Oxysterol-binding proteinSMESG000016876.1 dd_Smed_v4_12759_0_1dd_Smed_v4PMID:29674431
neuronSMED30018203Oxysterol-binding proteinSMESG000016876.1 dd_Smed_v4_12759_0_1dd_Smed_v4PMID:29674431
neuronSMED30001341Carbonic anhydrase-relatedSMESG000054330.1 dd_Smed_v4_10750_1_1dd_Smed_v4PMID:29674431
neuronSMED30005146SMED30005146SMESG000068156.1 SMESG000064685.1 SMESG000011804.1 SMESG000010609.1 SMESG000062429.1 SMESG000053533.1 SMESG000015751.1 SMESG000001486.1 dd_Smed_v4_1671_0_1dd_Smed_v4PMID:29674431
neuronSMED30005146SMED30005146SMESG000001486.1 SMESG000068156.1 SMESG000064685.1 SMESG000011804.1 SMESG000010609.1 SMESG000062429.1 SMESG000053533.1 SMESG000015751.1 dd_Smed_v6_1671_0dd_Smed_v6PMID:29674432
neuronSMED30008568Cytoplasmic dynein 1 heavy chain 1SMESG000038603.1 SMESG000038602.1 dd_Smed_v4_1140_0_1dd_Smed_v4PMID:29674431
neuronSMED30000527SMED30000527SMESG000034072.1 dd_Smed_v4_7973_0_1dd_Smed_v4PMID:29674431
neuronSMED30007670DystrobrevinSMESG000078318.1 dd_Smed_v4_12275_0_1dd_Smed_v4PMID:29674431
neuronSMED30007670DystrobrevinSMESG000078318.1 dd_Smed_v4_12275_0_1dd_Smed_v4PMID:29674431
neuronSMED30011717SMED30011717SMESG000078112.1 dd_Smed_v4_16420_0_1dd_Smed_v4PMID:29674431
neuronSMED30013216Chromodomain-helicase-DNA-binding proteinSMESG000000092.1 dd_Smed_v4_12815_0_1dd_Smed_v4PMID:29674431
neuronSMED30013216Chromodomain-helicase-DNA-binding proteinSMESG000000092.1 dd_Smed_v4_12815_0_1dd_Smed_v4PMID:29674431
neuronSMED30013216Chromodomain-helicase-DNA-binding proteinSMESG000000092.1 dd_Smed_v4_7985_0_1dd_Smed_v4PMID:29674431
neuronSMED30013216Chromodomain-helicase-DNA-binding proteinSMESG000000092.1 dd_Smed_v4_7985_0_1dd_Smed_v4PMID:29674431
neuronSMED30007389Peripheral plasma membrane protein CASKSMESG000060582.1 dd_Smed_v4_7723_0_1dd_Smed_v4PMID:29674431
neuronSMED30007389Peripheral plasma membrane protein CASKSMESG000060582.1 dd_Smed_v4_7723_0_1dd_Smed_v4PMID:29674431
neuronSMED30007155SMED30007155SMESG000021277.1 dd_Smed_v4_16056_0_1dd_Smed_v4PMID:29674431
neuronSMED30013386netrin 1SMESG000006806.1 AAY23350smed_ncbi_20200123PMID:25356635
neuronSMED30013386netrin 1SMESG000006806.1 dd_Smed_v4_9795_0_1dd_Smed_v4PMID:29674431
neuronSMED30010217RNA-binding protein 4BSMESG000059552.1 dd_Smed_v4_1566_1_1dd_Smed_v4PMID:29674431
neuronSMED30001679Calcium-transporting ATPaseSMESG000014734.1 dd_Smed_v4_1721_0_1dd_Smed_v4PMID:29674431
neuronSMED30001679Calcium-transporting ATPaseSMESG000014734.1 dd_Smed_v4_1721_0_1dd_Smed_v4PMID:29674431
neuronSMED30001679Calcium-transporting ATPaseSMESG000014734.1 dd_Smed_v6_1721_0dd_Smed_v6PMID:29674432
neuronSMED30018655Collagen type IV alpha-3-binding proteinSMESG000032017.1 SMESG000017536.1 SMESG000032019.1 dd_Smed_v4_5076_0_1dd_Smed_v4PMID:29674431
neuronSMED30015029Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-1SMESG000003718.1 SMESG000018818.1 dd_Smed_v4_2872_0_1dd_Smed_v4PMID:29674431
neuronSMED30015029Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-1SMESG000003718.1 SMESG000018818.1 dd_Smed_v4_2872_0_1dd_Smed_v4PMID:29674431
neuronSMED30016664SMED30016664SMESG000011618.1 dd_Smed_v4_2370_0_1dd_Smed_v4PMID:29674431
neuronSMED30016664SMED30016664SMESG000011618.1 dd_Smed_v4_2370_0_1dd_Smed_v4PMID:29674431
neuronSMED30031715Spectrin beta chainSMESG000035098.1 dd_Smed_v4_1684_0_1dd_Smed_v4PMID:29674431
neuronSMED30031715Spectrin beta chainSMESG000035098.1 dd_Smed_v4_1684_0_1dd_Smed_v4PMID:29674431
neuronSMED30031715Spectrin beta chainSMESG000035098.1 dd_Smed_v6_1684_0dd_Smed_v6PMID:29674432
neuronSMED30034201Delta-like proteinSMESG000036778.1 dd_Smed_v4_15985_0_1dd_Smed_v4PMID:29674431
neuronSMED30032035SMED30032035SMESG000064986.1 dd_Smed_v4_11403_0_1dd_Smed_v4PMID:29674431
neuronSMED30033766Actin binding LIM protein family member 2SMESG000037349.1 dd_Smed_v4_12268_0_1dd_Smed_v4PMID:29674431
neuronSMED30027021RUN domain-containing proteinSMESG000080383.1 dd_Smed_v4_10989_0_1dd_Smed_v4PMID:29674431
neuronSMED30027021RUN domain-containing proteinSMESG000080383.1 dd_Smed_v4_10989_0_1dd_Smed_v4PMID:29674431
neuronSMED30025407Ectonucleoside triphosphate diphosphohydrolase 7SMESG000080770.1 SMESG000072841.1 SMESG000065333.1 SMESG000060686.1 SMESG000059844.1 SMESG000058646.1 SMESG000055266.1 SMESG000055265.1 SMESG000054970.1 SMESG000052813.1 SMESG000043147.1 SMESG000043019.1 SMESG000041242.1 SMESG000037745.1 SMESG000037601.1 SMESG000036070.1 SMESG000034368.1 SMESG000031415.1 SMESG000019820.1 SMESG000019663.1 SMESG000010897.1 SMESG000009005.1 SMESG000005029.1 SMESG000077800.1 SMESG000054046.1 SMESG000052058.1 Contig20343newmark_estsPMID:27612384
neuronSMED30025407Ectonucleoside triphosphate diphosphohydrolase 7SMESG000080770.1 SMESG000072841.1 SMESG000065333.1 SMESG000060686.1 SMESG000059844.1 SMESG000058646.1 SMESG000055266.1 SMESG000055265.1 SMESG000054970.1 SMESG000052813.1 SMESG000043147.1 SMESG000043019.1 SMESG000041242.1 SMESG000037745.1 SMESG000037601.1 SMESG000036070.1 SMESG000034368.1 SMESG000031415.1 SMESG000019820.1 SMESG000019663.1 SMESG000010897.1 SMESG000009005.1 SMESG000005029.1 SMESG000077800.1 SMESG000054046.1 SMESG000052058.1 Contig20343uc_Smed_v2PMID:27612384
neuronSMED30031764ADF-H domain-containing proteinSMESG000022423.1 dd_Smed_v4_112_0_1dd_Smed_v4PMID:29674431
neuronSMED30026225SMED30026225SMESG000059698.1 dd_Smed_v4_188_0_1dd_Smed_v4PMID:29674431
neuronSMED30035963SMED30035963SMESG000071278.1 dd_Smed_v4_1649_0_1dd_Smed_v4PMID:29674431
neuronSMED30030507Glutamate receptorSMESG000013939.1 dd_Smed_v4_19602_0_1dd_Smed_v4PMID:29674431
neuronSMED30025421exonuclease 1-likeSMESG000064333.1 dd_Smed_v4_14547_0_1dd_Smed_v4PMID:29674431
neuronSMED30032428Protocadherin-9SMESG000005371.1 SMESG000005372.1 dd_Smed_v4_14613_0_1dd_Smed_v4PMID:29674431
neuronSMED30033309slc35f-3SMESG000077937.1 SMESG000077930.1 dd_Smed_v4_13553_0_1dd_Smed_v4PMID:29674431
neuronSMED30033309slc35f-3SMESG000077937.1 SMESG000077930.1 dd_Smed_v4_13553_0_1dd_Smed_v4PMID:29674431
neuronSMED30033309slc35f-3SMESG000077930.1 dd_Smed_v4_18554_0_1dd_Smed_v4PMID:29674431
neuronSMED30027052noggin-like protein 1SMESG000032255.1 Contig49725newmark_estsPMID:27612384
neuronSMED30027052noggin-like protein 1SMESG000032255.1 Contig49725uc_Smed_v2PMID:27612384
neuronSMED30027052noggin-like protein 1SMESG000032255.1 dd_Smed_v4_14068_0_1dd_Smed_v4PMID:29674431
neuronSMED30034761SMP-LTD domain-containing proteinSMESG000034948.1 SMESG000034947.1 dd_Smed_v4_2008_0_1dd_Smed_v4PMID:29674431
neuronSMED30034761SMP-LTD domain-containing proteinSMESG000034948.1 SMESG000034947.1 dd_Smed_v4_2008_0_1dd_Smed_v4PMID:29674431
neuronSMED30020865AminopeptidaseSMESG000033900.1 SMESG000033518.1 SMESG000022278.1 Contig21944newmark_estsPMID:27612384
neuronSMED30020865AminopeptidaseSMESG000033900.1 SMESG000033518.1 SMESG000022278.1 Contig21944uc_Smed_v2PMID:27612384
neuronSMED30034635Tubulin tyrosine ligase-like family, member 7SMESG000055128.1 dd_Smed_v4_13600_0_1dd_Smed_v4PMID:29674431
neuronSMED30034635Tubulin tyrosine ligase-like family, member 7SMESG000055128.1 dd_Smed_v4_13600_0_1dd_Smed_v4PMID:29674431
neuronSMED30034606slc4a-5SMESG000061700.1 dd_Smed_v4_14606_0_1dd_Smed_v4PMID:29674431
neuronSMED30027157Trig-1 proteinSMESG000049582.1 Contig39031newmark_estsPMID:27612384
neuronSMED30027157Trig-1 proteinSMESG000049582.1 Contig39031uc_Smed_v2PMID:27612384
neuronSMED30029603SMED30029603SMESG000071278.1 dd_Smed_v4_1649_0_1dd_Smed_v4PMID:29674431
neuronSMED30035495Ankyrin repeat domain-containing 42SMESG000005009.1 dd_Smed_v4_10615_0_1dd_Smed_v4PMID:29674431
neuronSMED30035495Ankyrin repeat domain-containing 42SMESG000005009.1 dd_Smed_v4_10615_0_1dd_Smed_v4PMID:29674431
neuronSMED30028058SMED30028058SMESG000056175.1 SMESG000056172.1 dd_Smed_v4_13931_0_1dd_Smed_v4PMID:29674431
neuronSMED30022997ELMO domain containing 3SMESG000008416.1 dd_Smed_v4_13608_0_1dd_Smed_v4PMID:29674431
neuronSMED30026115Potassium voltage-gated channel subfamily H member 7SMESG000000377.1 dd_Smed_v4_12978_0_1dd_Smed_v4PMID:29674431
neuronSMED30026115Potassium voltage-gated channel subfamily H member 7SMESG000000377.1 dd_Smed_v4_12978_0_1dd_Smed_v4PMID:29674431
neuronSMED30023483INX-13SMESG000043575.1 Contig50609newmark_estsPMID:27612384
neuronSMED30025821Multiple PDZ domain crumbs cell polarity complex componentSMESG000053393.1 dd_Smed_v4_5376_0_1dd_Smed_v4PMID:29674431
neuronSMED30025821Multiple PDZ domain crumbs cell polarity complex componentSMESG000053393.1 dd_Smed_v4_5376_0_1dd_Smed_v4PMID:29674431
neuronSMED30031159Neuronal acetylcholine receptor subunit alpha-4SMESG000069967.1 dd_Smed_v4_6939_0_1dd_Smed_v4PMID:29674431
neuronSMED30031159Neuronal acetylcholine receptor subunit alpha-4SMESG000069967.1 dd_Smed_v4_6939_0_1dd_Smed_v4PMID:29674431
neuronSMED30030234Tubulin alpha chainSMESG000041107.1 Contig49579newmark_estsPMID:27612384
neuronSMED30030234Tubulin alpha chainSMESG000041107.1 Contig49579uc_Smed_v2PMID:27612384
neuronSMED30030234Tubulin alpha chainSMESG000078886.1 SMESG000078780.1 SMESG000078276.1 SMESG000077377.1 SMESG000076900.1 SMESG000070563.1 SMESG000069843.1 SMESG000067323.1 SMESG000067128.1 SMESG000066333.1 SMESG000063482.1 SMESG000063430.1 SMESG000062535.1 SMESG000055265.1 SMESG000052056.1 SMESG000051183.1 SMESG000049398.1 SMESG000047988.1 SMESG000045843.1 SMESG000043425.1 SMESG000043019.1 SMESG000041242.1 SMESG000040236.1 SMESG000039783.1 SMESG000034367.1 SMESG000031778.1 SMESG000031308.1 SMESG000028811.1 SMESG000025956.1 SMESG000023833.1 SMESG000023573.1 SMESG000023546.1 SMESG000019820.1 SMESG000018414.1 SMESG000017936.1 SMESG000015191.1 SMESG000014475.1 SMESG000009011.1 SMESG000008656.1 SMESG000005037.1 SMESG000004638.1 SMESG000003422.1 SMESG000054547.1 dd_Smed_v6_508_0dd_Smed_v6PMID:29674432
neuronSMED30023429Integrin-linked protein kinaseSMESG000074124.1 SMESG000069194.1 SMESG000069193.1 SMESG000041284.1 Contig13392newmark_estsPMID:27612384
neuronSMED30023429Integrin-linked protein kinaseSMESG000074124.1 SMESG000069194.1 SMESG000069193.1 SMESG000041284.1 Contig13392uc_Smed_v2PMID:27612384
neuronSMED30023091MORN repeat-containing protein 3SMESG000011788.1 dd_Smed_v4_3784_0_1dd_Smed_v4PMID:29674431
neuronSMED30023091MORN repeat-containing protein 3SMESG000011788.1 dd_Smed_v4_3784_0_1dd_Smed_v4PMID:29674431
neuronSMED30025978SMED30025978SMESG000069967.1 dd_Smed_v4_6939_0_1dd_Smed_v4PMID:29674431
neuronSMED30025978SMED30025978SMESG000069967.1 dd_Smed_v4_6939_0_1dd_Smed_v4PMID:29674431
neuronSMED30024706Cysteine-rich with EGF-like domains 2SMESG000042342.1 Contig39900newmark_estsPMID:27612384
neuronSMED30024706Cysteine-rich with EGF-like domains 2SMESG000042342.1 Contig39900uc_Smed_v2PMID:27612384
neuronSMED30031736SMED30031736SMESG000019122.1 dd_Smed_v4_8185_0_1dd_Smed_v4PMID:29674431
neuronSMED30025592Xeroderma pigmentosum, complementation group CSMESG000075170.1 Contig33220newmark_estsPMID:27612384
neuronSMED30025592Xeroderma pigmentosum, complementation group CSMESG000075170.1 Contig33220uc_Smed_v2PMID:27612384
neuronSMED30032666Spermatogenesis associated 7SMESG000056890.1 dd_Smed_v4_8977_0_1dd_Smed_v4PMID:29674431
neuronSMED30032448Expressed conserved proteinSMESG000064362.1 dd_Smed_v4_3795_0_1dd_Smed_v4PMID:29674431
neuronSMED30032448Expressed conserved proteinSMESG000064362.1 dd_Smed_v4_3795_0_1dd_Smed_v4PMID:29674431
neuronSMED30021173SMED30021173SMESG000075200.1 Contig29858newmark_estsPMID:27612384
neuronSMED30021173SMED30021173SMESG000075200.1 Contig29858uc_Smed_v2PMID:27612384
neuronSMED30031540Neuropeptide-3SMESG000014460.1 dd_Smed_v4_798_0_1dd_Smed_v4PMID:29674431
neuronSMED30026944Phospholipid-transporting ATPaseSMESG000009974.1 Contig32844newmark_estsPMID:27612384
neuronSMED30026944Phospholipid-transporting ATPaseSMESG000009974.1 Contig32844uc_Smed_v2PMID:27612384
neuronSMED30026944Phospholipid-transporting ATPaseSMESG000009974.1 dd_Smed_v4_5042_0_1dd_Smed_v4PMID:29674431
neuronSMED30026944Phospholipid-transporting ATPaseSMESG000009974.1 dd_Smed_v4_5042_0_1dd_Smed_v4PMID:29674431
neuronSMED30030059Glutamate receptorSMESG000073268.1 dd_Smed_v4_7562_0_1dd_Smed_v4PMID:29674431
neuronSMED30030059Glutamate receptorSMESG000073268.1 dd_Smed_v4_7562_0_1dd_Smed_v4PMID:29674431
neuronSMED30007506SMED30007506SMESG000071441.1 SMESG000059599.1 SMESG000058180.1 SMESG000047025.1 SMESG000041246.1 SMESG000037745.1 SMESG000013749.1 Contig36213newmark_estsPMID:27612384
neuronSMED30007506SMED30007506SMESG000071441.1 SMESG000059599.1 SMESG000058180.1 SMESG000047025.1 SMESG000041246.1 SMESG000037745.1 SMESG000013749.1 Contig36213uc_Smed_v2PMID:27612384
neuronSMED30006881EF-hand calcium-binding domain-containing protein 1-likeSMESG000063996.1 Contig51427newmark_estsPMID:27612384
neuronSMED30006881EF-hand calcium-binding domain-containing protein 1-likeSMESG000063996.1 Contig51427uc_Smed_v2PMID:27612384
neuronSMED30011218CSON008187 proteinSMESG000048355.1 Contig31276newmark_estsPMID:27612384
neuronSMED30011218CSON008187 proteinSMESG000048355.1 Contig31276uc_Smed_v2PMID:27612384
neuronSMED30028543Neur_chan_LBD domain-containing proteinSMESG000021796.1 Contig16482newmark_estsPMID:27612384
neuronSMED30028543Neur_chan_LBD domain-containing proteinSMESG000021796.1 Contig16482uc_Smed_v2PMID:27612384
neuronSMED30023733Sodium/potassium-transporting ATPase subunit beta-2SMESG000071416.1 dd_Smed_v4_7917_0_1dd_Smed_v4PMID:29674431
neuronSMED30023733Sodium/potassium-transporting ATPase subunit beta-2SMESG000071416.1 dd_Smed_v4_7917_0_1dd_Smed_v4PMID:29674431
neuronSMED30034325Receptor-type tyrosine-protein phosphatase N2SMESG000078547.1 dd_Smed_v4_6990_0_1dd_Smed_v4PMID:29674431
neuronSMED30034325Receptor-type tyrosine-protein phosphatase N2SMESG000078547.1 dd_Smed_v4_6990_0_1dd_Smed_v4PMID:29674431
neuronSMED30026534Rho-related GTP-binding proteinSMESG000022390.1 dd_Smed_v4_578_0_1dd_Smed_v4PMID:29674431
neuronSMED30026534Rho-related GTP-binding proteinSMESG000022390.1 dd_Smed_v4_578_0_1dd_Smed_v4PMID:29674431
neuronSMED30034295Clusterin-associated protein 1SMESG000016963.1 dd_Smed_v4_8287_0_1dd_Smed_v4PMID:29674431
neuronSMED30034295Clusterin-associated protein 1SMESG000016963.1 dd_Smed_v4_8287_0_1dd_Smed_v4PMID:29674431
neuronSMED30028097PhosphodiesteraseSMESG000051078.1 dd_Smed_v4_6976_0_1dd_Smed_v4PMID:29674431
neuronSMED30028097PhosphodiesteraseSMESG000051078.1 dd_Smed_v4_6976_0_1dd_Smed_v4PMID:29674431
neuronSMED30026445SHSP domain-containing proteinSMESG000030562.1 Contig49553newmark_estsPMID:27612384
neuronSMED30026445SHSP domain-containing proteinSMESG000030562.1 Contig49553uc_Smed_v2PMID:27612384
neuronSMED30035908Serine-rich adhesin for platelets (Staphylococcus aureus surface protein A)SMESG000025158.1 dd_Smed_v4_3220_0_1dd_Smed_v4PMID:29674431
neuronSMED30035908Serine-rich adhesin for platelets (Staphylococcus aureus surface protein A)SMESG000025158.1 dd_Smed_v4_3220_0_1dd_Smed_v4PMID:29674431
neuronSMED30026278Pre-mRNA-splicing factor ISY1SMESG000047126.1 SMESG000004187.1 dd_Smed_v4_8243_0_1dd_Smed_v4PMID:29674431
neuronSMED30032574Reverse transcriptase domain-containing proteinSMESG000071441.1 SMESG000059599.1 SMESG000058180.1 SMESG000047025.1 SMESG000041246.1 SMESG000037745.1 SMESG000013749.1 Contig36213newmark_estsPMID:27612384
neuronSMED30032574Reverse transcriptase domain-containing proteinSMESG000071441.1 SMESG000059599.1 SMESG000058180.1 SMESG000047025.1 SMESG000041246.1 SMESG000037745.1 SMESG000013749.1 Contig36213uc_Smed_v2PMID:27612384
neuronSMED30033284Down syndrome cell adhesion moleculeSMESG000024214.1 dd_Smed_v4_3024_0_1dd_Smed_v4PMID:29674431
neuronSMED30028209Fli-1 proto-oncogene, ETS transcription factor bSMESG000014306.1 Contig13626newmark_estsPMID:27612384
neuronSMED30028209Fli-1 proto-oncogene, ETS transcription factor bSMESG000014306.1 Contig13626uc_Smed_v2PMID:27612384
neuronSMED30030773ATP-dependent RNA helicase DBP2SMESG000005969.1 Contig23180newmark_estsPMID:27612384
neuronSMED30030773ATP-dependent RNA helicase DBP2SMESG000005969.1 Contig23180uc_Smed_v2PMID:27612384
neuronSMED30030773ATP-dependent RNA helicase DBP2SMESG000005969.1 Contig26998newmark_estsPMID:27612384
neuronSMED30030773ATP-dependent RNA helicase DBP2SMESG000005969.1 Contig26998uc_Smed_v2PMID:27612384
neuronSMED30030773ATP-dependent RNA helicase DBP2SMESG000005969.1 dd_Smed_v4_3743_0_1dd_Smed_v4PMID:29674431
neuronSMED30031654SMED30031654SMESG000064362.1 dd_Smed_v4_3795_0_1dd_Smed_v4PMID:29674431
neuronSMED30031654SMED30031654SMESG000064362.1 dd_Smed_v4_3795_0_1dd_Smed_v4PMID:29674431
neuronSMED30020317Heat shock protein 90SMESG000024822.1 Contig49305newmark_estsPMID:27612384
neuronSMED30020317Heat shock protein 90SMESG000024822.1 Contig49305uc_Smed_v2PMID:27612384
neuronSMED30020317Heat shock protein 90SMESG000024822.1 dd_Smed_v4_678_0_1dd_Smed_v4PMID:29674431
neuronSMED30021430SID1 transmembrane family member 1SMESG000041575.1 Contig34061newmark_estsPMID:27612384
neuronSMED30021430SID1 transmembrane family member 1SMESG000041575.1 Contig34061uc_Smed_v2PMID:27612384
neuronSMED30030833SMED30030833SMESG000032988.1 dd_Smed_v4_10864_0_1dd_Smed_v4PMID:29674431
neuronSMED30026821BTB/POZ domain-containing proteinSMESG000025160.1 dd_Smed_v4_23099_0_1dd_Smed_v4PMID:29674431
neuronSMED30027901Spermatogenesis associated 1SMESG000049418.1 dd_Smed_v4_12212_0_1dd_Smed_v4PMID:29674431
neuronSMED30027901Spermatogenesis associated 1SMESG000049418.1 dd_Smed_v4_12212_0_1dd_Smed_v4PMID:29674431
neuronSMED30031461Phosphatidylinositol 4-phosphate 5-kinase 2SMESG000012434.1 dd_Smed_v4_9195_0_1dd_Smed_v4PMID:29674431
neuronSMED30035058AquaporinSMESG000023353.1 dd_Smed_v4_1103_0_1dd_Smed_v4PMID:29674431
neuronSMED30024358Protein 4.1SMESG000029732.1 dd_Smed_v4_2825_0_1dd_Smed_v4PMID:29674431
neuronSMED30024358Protein 4.1SMESG000029732.1 dd_Smed_v4_5331_0_1dd_Smed_v4PMID:29674431
neuronSMED30028410SMED30028410SMESG000067585.1 dd_Smed_v4_8334_0_1dd_Smed_v4PMID:29674431
neuronSMED30024396Centrosomal protein 295SMESG000023095.1 dd_Smed_v4_11068_0_1dd_Smed_v4PMID:29674431
neuronSMED30024396Centrosomal protein 295SMESG000023095.1 dd_Smed_v4_11068_0_1dd_Smed_v4PMID:29674431
neuronSMED30021083Monocarboxylate transporterSMESG000010271.1 dd_Smed_v4_10683_0_1dd_Smed_v4PMID:29674431
neuronSMED30028017SMED30028017SMESG000081058.1 dd_Smed_v4_1803_0_1dd_Smed_v4PMID:29674431
neuronSMED30033487cilia- and flagella-associated protein 70SMESG000009189.1 dd_Smed_v4_10893_0_1dd_Smed_v4PMID:29674431
neuronSMED30033487cilia- and flagella-associated protein 70SMESG000009189.1 dd_Smed_v4_10893_0_1dd_Smed_v4PMID:29674431
neuronSMED30034649SMED30034649SMESG000026966.1 SMESG000026953.1 dd_Smed_v4_10998_0_1dd_Smed_v4PMID:29674431
neuronSMED30025239Roundabout, axon guidance receptor, homolog 1 (Drosophila)SMESG000066973.1 dd_Smed_v4_7921_0_1dd_Smed_v4PMID:29674431
neuronSMED30025283WD repeat domain 19SMESG000052128.1 SMESG000052127.1 dd_Smed_v4_10987_0_1dd_Smed_v4PMID:29674431
neuronSMED30027466FMRFamide-activated amiloride-sensitive sodium channelSMESG000034894.1 dd_Smed_v4_15920_0_1dd_Smed_v4PMID:29674431
neuronSMED30020268Dynamin-type G domain-containing proteinSMESG000014761.1 SMESG000014754.1 dd_Smed_v4_2777_0_1dd_Smed_v4PMID:29674431
neuronSMED30020268Dynamin-type G domain-containing proteinSMESG000014756.1 SMESG000014755.1 dd_Smed_v4_2390_0_1dd_Smed_v4PMID:29674431
neuronSMED30020268Dynamin-type G domain-containing proteinSMESG000014756.1 SMESG000014755.1 dd_Smed_v4_2390_0_1dd_Smed_v4PMID:29674431
neuronSMED30023391AnkyrinSMESG000040152.1 dd_Smed_v4_3523_0_1dd_Smed_v4PMID:29674431
neuronSMED30023391AnkyrinSMESG000040152.1 dd_Smed_v4_3523_0_1dd_Smed_v4PMID:29674431
neuronSMED30028681Zinc finger and BTB domain containing 41SMESG000022366.1 dd_Smed_v4_10911_0_1dd_Smed_v4PMID:29674431
neuronSMED30028681Zinc finger and BTB domain containing 41SMESG000022366.1 dd_Smed_v4_10911_0_1dd_Smed_v4PMID:29674431
neuronSMED30020986SMED30020986SMESG000061227.1 dd_1936dd_Smed_v4PMID:29674431
neuronSMED30020986SMED30020986SMESG000061227.1 dd_1936dd_Smed_v4PMID:29674431
neuronSMED30020839MAP kinase-activating death domain proteinSMESG000048179.1 dd_Smed_v4_9300_0_1dd_Smed_v4PMID:29674431
neuronSMED30026747Metallophos domain-containing proteinSMESG000036432.1 dd_Smed_v4_3484_0_1dd_Smed_v4PMID:29674431
neuronSMED30026747Metallophos domain-containing proteinSMESG000036432.1 dd_Smed_v4_3484_0_1dd_Smed_v4PMID:29674431
neuronSMED30032372Coiled-coil domain containing 40SMESG000008312.1 dd_Smed_v4_6338_0_1dd_Smed_v4PMID:29674431
neuronSMED30032372Coiled-coil domain containing 40SMESG000008312.1 dd_Smed_v4_6338_0_1dd_Smed_v4PMID:29674431
neuronSMED30021767AMP deaminaseSMESG000018449.1 dd_Smed_v4_9436_0_1dd_Smed_v4PMID:29674431
neuronSMED30025436SMED30025436SMESG000029289.1 SMESG000029286.1 SMESG000029285.1 dd_Smed_v4_3083_0_1dd_Smed_v4PMID:29674431
neuronSMED30025648InnexinSMESG000027007.1 dd_Smed_v4_12178_0_1dd_Smed_v4PMID:29674431
neuronSMED30025648InnexinSMESG000027007.1 dd_Smed_v4_12178_0_1dd_Smed_v4PMID:29674431
neuronSMED30030278RNB domain-containing proteinSMESG000026073.1 dd_Smed_v4_8176_0_1dd_Smed_v4PMID:29674431
neuronSMED30029350Serine incorporator 3SMESG000020805.1 dd_Smed_v4_1130_0_1dd_Smed_v4PMID:29674431
neuronSMED30020168c-Jun N-terminal kinasesSMESG000043618.1 dd_Smed_v4_5924_0_1dd_Smed_v4PMID:29674431
neuronSMED30030833SMED30030833SMESG000032988.1 dd_Smed_v4_10864_0_1dd_Smed_v4PMID:29674431
neuronSMED30001286DNA polymerase nuSMESG000032684.1 dd_Smed_v4_10383_0_1dd_Smed_v4PMID:29674431
neuronSMED30017296SMED30017296SMESG000035719.1 dd_Smed_v4_26725_0_1dd_Smed_v4PMID:29674431
neuronSMED30008301Synaptotagmin-14, putativeSMESG000024484.1 dd_Smed_v4_9548_0_1dd_Smed_v4PMID:29674431
neuronSMED30018142SMED30018142SMESG000081436.1 dd_Smed_v4_9784_0_1dd_Smed_v4PMID:29674431
neuronSMED30001112SMED30001112SMESG000061228.1 dd_Smed_v4_13515_0_1dd_Smed_v4PMID:29674431
neuronSMED30001112SMED30001112SMESG000061228.1 dd_Smed_v4_8351_0_1dd_Smed_v4PMID:29674431
neuronSMED30001112SMED30001112SMESG000061228.1 dd_Smed_v4_8351_0_1dd_Smed_v4PMID:29674431
neuronSMED30000267tRNA-dihydrouridine synthaseSMESG000002913.1 dd_Smed_v4_9471_0_1dd_Smed_v4PMID:29674431
neuronSMED30009210Protein kinase domain-containing proteinSMESG000039711.1 dd_Smed_v4_13767_0_1dd_Smed_v4PMID:29674431
neuronSMED30011545E3 ubiquitin-protein ligase XIAPSMESG000081058.1 dd_Smed_v4_1803_0_1dd_Smed_v4PMID:29674431
neuronSMED30020000RNA binding motif single stranded interactingSMESG000010632.1 dd_Smed_v4_3575_0_1dd_Smed_v4PMID:29674431
neuronSMED30000918Coiled-coil domain containing 13SMESG000058204.1 dd_Smed_v4_12055_0_1dd_Smed_v4PMID:29674431
neuronSMED30005336Phtf-FEM1B_bdg domain-containing proteinSMESG000058788.1 dd_Smed_v4_8465_0_1dd_Smed_v4PMID:29674431
neuronSMED30017925Dynein light chain Tctex-type 1SMESG000026631.1 dd_Smed_v4_1166_0_1dd_Smed_v4PMID:29674431
neuronSMED30017925Dynein light chain Tctex-type 1SMESG000026631.1 dd_Smed_v4_1166_0_1dd_Smed_v4PMID:29674431
neuronSMED30014606Copine-3SMESG000007275.1 dd_Smed_v4_14045_0_1dd_Smed_v4PMID:29674431
neuronSMED30014606Copine-3SMESG000007275.1 dd_Smed_v4_17867_0_1dd_Smed_v4PMID:29674431
neuronSMED30008995SMED30008995SMESG000022730.1 dd_Smed_v4_8514_0_1dd_Smed_v4PMID:29674431
neuronSMED30019571Protein kinase domain containing proteinSMESG000024532.1 dd_Smed_v4_2822_0_1dd_Smed_v4PMID:29674431
neuronSMED30006791slc40a-1SMESG000016854.1 dd_Smed_v4_9732_0_1dd_Smed_v4PMID:29674431
neuronSMED30009119Ankyrin-2SMESG000058557.1 dd_Smed_v4_1432_0_1dd_Smed_v4PMID:29674431
neuronSMED30018158SMED30018158SMESG000029289.1 SMESG000029286.1 SMESG000029285.1 dd_Smed_v4_3083_0_1dd_Smed_v4PMID:29674431
neuronSMED30000584SMED30000584SMESG000016256.1 SMESG000016255.1 SMESG000010584.1 SMESG000009925.1 dd_Smed_v4_2090_0_1dd_Smed_v4PMID:29674431
neuronSMED30002665CREB-binding proteinSMESG000048249.1 dd_Smed_v4_9154_0_1dd_Smed_v4PMID:29674431
neuronSMED30019513ankyrin repeat and zinc finger domain-containing protein 1SMESG000009883.1 dd_Smed_v4_3789_0_1dd_Smed_v4PMID:29674431
neuronSMED30019652SMED30019652SMESG000043998.1 dd_Smed_v4_8438_0_1dd_Smed_v4PMID:29674431
neuronSMED30011238Kinesin-like proteinSMESG000035453.1 dd_Smed_v4_13424_0_1dd_Smed_v4PMID:29674431
neuronSMED30011238Kinesin-like proteinSMESG000035453.1 dd_Smed_v4_13424_0_1dd_Smed_v4PMID:29674431
neuronSMED30011238Kinesin-like proteinSMESG000035453.1 dd_Smed_v4_10765_0_1dd_Smed_v4PMID:29674431
neuronSMED30011238Kinesin-like proteinSMESG000035453.1 dd_Smed_v4_10765_0_1dd_Smed_v4PMID:29674431
neuronSMED30014791adenylate kinase 8-likeSMESG000027219.1 dd_Smed_v4_7317_0_1dd_Smed_v4PMID:29674431
neuronSMED30012379SMED30012379SMESG000058557.1 dd_Smed_v4_1432_0_1dd_Smed_v4PMID:29674431
neuronSMED30004501SMED30004501SMESG000021815.1 dd_Smed_v4_14689_0_1dd_Smed_v4PMID:29674431
neuronSMED30016917Tctex1 domain containing 1SMESG000040148.1 dd_Smed_v4_9321_0_1dd_Smed_v4PMID:29674431
neuronSMED30019877Rho GTPase activating protein 44SMESG000068429.1 dd_Smed_v4_10426_0_1dd_Smed_v4PMID:29674431
neuronSMED30010448SMED30010448SMESG000016854.1 dd_Smed_v4_9732_0_1dd_Smed_v4PMID:29674431
neuronSMED3001913633 kDa inner dynein arm light chain, axonemalSMESG000023186.1 dd_Smed_v4_5809_0_1dd_Smed_v4PMID:29674431
neuronSMED3001913633 kDa inner dynein arm light chain, axonemalSMESG000023186.1 dd_Smed_v4_58108_0_1dd_Smed_v4PMID:29674431
neuronSMED30011703Death domain-containing proteinSMESG000040750.1 dd_Smed_v4_11696_0_1dd_Smed_v4PMID:29674431
neuronSMED30004048SMED30004048SMESG000079201.1 SMESG000079199.1 SMESG000079185.1 SMESG000079182.1 SMESG000042896.1 SMESG000042895.1 SMESG000042893.1 SMESG000042870.1 SMESG000042866.1 dd_Smed_v4_5650_0_1dd_Smed_v4PMID:29674431
neuronSMED30018900Intraflagellar transport protein 56SMESG000031670.1 dd_Smed_v4_12618_0_1dd_Smed_v4PMID:29674431
neuronSMED30016849SMED30016849SMESG000016854.1 dd_Smed_v4_9732_0_1dd_Smed_v4PMID:29674431
neuronSMED30015748SMED30015748SMESG000036160.1 dd_Smed_v4_14291_0_1dd_Smed_v4PMID:29674431
neuronSMED30001715SMED30001715SMESG000047488.1 dd_Smed_v4_1497_0_1dd_Smed_v4PMID:29674431
neuronSMED30014362F-BAR domain only protein 2SMESG000078045.1 dd_Smed_v4_8587_0_1dd_Smed_v4PMID:29674431
neuronSMED30011311Protocadherin Fat 4SMESG000029841.1 dd_Smed_v4_12895_0_1dd_Smed_v4PMID:29674431
neuronSMED30013758Protein CLP1 homologSMESG000047440.1 SMESG000028257.1 dd_Smed_v4_5796_0_1dd_Smed_v4PMID:29674431
neuronSMED30013054Protein kinase domain-containing proteinSMESG000020466.1 dd_Smed_v4_11366_0_1dd_Smed_v4PMID:29674431
neuronSMED30013054Protein kinase domain-containing proteinSMESG000020466.1 dd_Smed_v4_11366_0_1dd_Smed_v4PMID:29674431
neuronSMED30010967SMED30010967SMESG000070444.1 dd_Smed_v4_10200_0_1dd_Smed_v4PMID:29674431
neuronSMED30002155SMED30002155SMESG000074740.1 SMESG000074739.1 dd_Smed_v4_8417_0_1dd_Smed_v4PMID:29674431
neuronSMED30017604Alpha-mannosidaseSMESG000018139.1 dd_Smed_v4_8703_0_1dd_Smed_v4PMID:29674431
neuronSMED30008051Malate dehydrogenase 1BSMESG000070444.1 dd_Smed_v4_10200_0_1dd_Smed_v4PMID:29674431
neuronSMED30015853SMED30015853SMESG000069882.1 dd_Smed_v4_10099_0_1dd_Smed_v4PMID:29674431
neuronSMED30017802SMED30017802SMESG000073243.1 dd_Smed_v4_5953_0_1dd_Smed_v4PMID:29674431
neuronSMED30002875SMED30002875SMESG000044438.1 dd_Smed_v4_8258_0_1dd_Smed_v4PMID:29674431
neuronSMED30000699Ig-like domain-containing proteinSMESG000035909.1 dd_Smed_v4_6345_0_1dd_Smed_v4PMID:29674431
neuronSMED30005211cilia- and flagella-associated protein 47SMESG000060264.1 dd_Smed_v4_8294_0_1dd_Smed_v4PMID:29674431
neuronSMED30003493Telomerase protein component 1SMESG000032835.1 SMESG000032829.1 SMESG000032828.1 dd_Smed_v4_4376_0_1dd_Smed_v4PMID:29674431
neuronSMED30026777Exonuclease 3'-5' domain-containing protein 1SMESG000036160.1 dd_Smed_v4_14291_0_1dd_Smed_v4PMID:29674431
neuronSMED30034247SMED30034247SMESG000005178.1 dd_Smed_v4_10371_0_1dd_Smed_v4PMID:29674431
neuronSMED30032374SMED30032374SMESG000048179.1 dd_Smed_v4_9300_0_1dd_Smed_v4PMID:29674431
neuronSMED30029780EGR-like protein 1SMESG000000960.1 dd_Smed_v4_7731_0_1dd_Smed_v4PMID:29674431
neuronSMED30022424MYND-type domain-containing proteinSMESG000066740.1 dd_Smed_v4_9973_0_1dd_Smed_v4PMID:29674431
neuronSMED30023179SMED30023179SMESG000024834.1 dd_Smed_v4_6904_0_1dd_Smed_v4PMID:29674431
neuronSMED30023179SMED30023179SMESG000024834.1 dd_Smed_v4_6904_0_1dd_Smed_v4PMID:29674431
neuronSMED30025535TNF receptor associated factor-2SMESG000049696.1 SMESG000049688.1 SMESG000049683.1 SMESG000049676.1 SMESG000049663.1 SMESG000049649.1 SMESG000049621.1 SMESG000049614.1 SMESG000049603.1 SMESG000049567.1 SMESG000049545.1 SMESG000049503.1 dd_Smed_v4_3528_0_1dd_Smed_v4PMID:29674431
neuronSMED30025057Peptidase_M3 domain-containing proteinSMESG000015557.1 SMESG000015556.1 dd_Smed_v4_7014_0_1dd_Smed_v4PMID:29674431
neuronSMED30031892MannosyltransferaseSMESG000016336.1 dd_Smed_v4_8775_0_1dd_Smed_v4PMID:29674431
neuronSMED30024411Protein kinase domain-containing proteinSMESG000024532.1 dd_Smed_v4_2822_0_1dd_Smed_v4PMID:29674431
neuronSMED30021868coiled-coil domain-containing protein 39SMESG000072035.1 SMESG000072034.1 dd_Smed_v4_5955_0_1dd_Smed_v4PMID:29674431
neuronSMED30021868coiled-coil domain-containing protein 39SMESG000072035.1 SMESG000072034.1 dd_Smed_v4_5955_0_1dd_Smed_v4PMID:29674431
neuronSMED30033662unconventional myosin-IdSMESG000051401.1 dd_Smed_v4_3957_0_1dd_Smed_v4PMID:29674431
neuronSMED30023537RING-type domain-containing proteinSMESG000069646.1 dd_Smed_v4_6465_0_1dd_Smed_v4PMID:29674431
neuronSMED30031519Tyrosine-protein kinaseSMESG000020289.1 dd_Smed_v4_9416_0_1dd_Smed_v4PMID:29674431
neuronSMED30022522Centrin-3SMESG000016538.1 dd_Smed_v4_11582_0_1dd_Smed_v4PMID:29674431
neuronSMED30023488Neuronal acetylcholine receptor subunit alpha-7SMESG000080892.1 SMESG000080891.1 dd_Smed_v4_11839_0_1dd_Smed_v4PMID:29674431
neuronSMED30031605Cyclic nucleotide-binding domain-containing proteinSMESG000076149.1 dd_Smed_v4_11972_0_1dd_Smed_v4PMID:29674431
neuronSMED30031605Cyclic nucleotide-binding domain-containing proteinSMESG000076149.1 dd_Smed_v4_11972_0_1dd_Smed_v4PMID:29674431
neuronSMED30030365Protein FAM161ASMESG000042541.1 dd_Smed_v4_15201_0_1dd_Smed_v4PMID:29674431
neuronSMED30027306semaphorin-like proteinSMESG000016256.1 SMESG000016255.1 SMESG000010584.1 SMESG000009925.1 dd_Smed_v4_2090_0_1dd_Smed_v4PMID:29674431
neuronSMED30025849Centrosome and spindle pole-associated protein 1SMESG000080361.1 dd_Smed_v4_13453_0_1dd_Smed_v4PMID:29674431
neuronSMED30025849Centrosome and spindle pole-associated protein 1SMESG000080361.1 dd_Smed_v4_13453_0_1dd_Smed_v4PMID:29674431
neuronSMED30020163SAVSMESG000015557.1 SMESG000015556.1 dd_Smed_v4_7014_0_1dd_Smed_v4PMID:29674431
neuronSMED30021824centromere protein JSMESG000028453.1 dd_Smed_v4_13670_0_1dd_Smed_v4PMID:29674431
neuronSMED30020007Dystrobrevin betaSMESG000078318.1 dd_Smed_v4_12275_0_1dd_Smed_v4PMID:29674431
neuronSMED30023347Kinesin motor domain-containing proteinSMESG000069689.1 dd_Smed_v4_10482_0_1dd_Smed_v4PMID:29674431
neuronSMED30023347Kinesin motor domain-containing proteinSMESG000069689.1 dd_Smed_v4_10482_0_1dd_Smed_v4PMID:29674431
neuronSMED30021702C2H2-type domain-containing proteinSMESG000080376.1 dd_Smed_v4_15473_0_1dd_Smed_v4PMID:29674431
neuronSMED30021702C2H2-type domain-containing proteinSMESG000080376.1 dd_Smed_v4_15473_0_1dd_Smed_v4PMID:29674431
neuronSMED30022163Tubulin polyglutamylase TTLL7SMESG000055128.1 dd_Smed_v4_13600_0_1dd_Smed_v4PMID:29674431
neuronSMED30022163Tubulin polyglutamylase TTLL7SMESG000055128.1 dd_Smed_v4_13600_0_1dd_Smed_v4PMID:29674431
neuronSMED30022717SMED30022717SMESG000005697.1 dd_Smed_v4_12813_0_1dd_Smed_v4PMID:29674431
neuronSMED30021539Diacylglycerol lipase betaSMESG000046500.1 dd_Smed_v4_13306_0_1dd_Smed_v4PMID:29674431
neuronSMED30021539Diacylglycerol lipase betaSMESG000046500.1 dd_Smed_v4_13306_0_1dd_Smed_v4PMID:29674431
neuronSMED30021820Guanylate cyclaseSMESG000056411.1 dd_Smed_v4_11767_0_1dd_Smed_v4PMID:29674431
neuronSMED30017036AP-2 complex subunit alphaSMESG000036030.1 dd_Smed_v4_1423_0_1dd_Smed_v4PMID:29674431
neuronSMED30017036AP-2 complex subunit alphaSMESG000036030.1 dd_Smed_v4_1423_0_1dd_Smed_v4PMID:29674431
neuronSMED30013355Guanylate cyclase domain-containing proteinSMESG000035922.1 dd_Smed_v4_18111_0_1dd_Smed_v4PMID:29674431
neuronSMED30018086Talin-1SMESG000019748.1 dd_Smed_v4_1233_0_1dd_Smed_v4PMID:29674431
neuronSMED30018086Talin-1SMESG000066444.1 SMESG000060705.1 dd_Smed_v4_876_0_1dd_Smed_v4PMID:29674431
neuronSMED30018086Talin-1SMESG000019748.1 dd_Smed_v4_7313_0_1dd_Smed_v4PMID:29674431
neuronSMED30018086Talin-1SMESG000019748.1 dd_Smed_v4_2028_0_1dd_Smed_v4PMID:29674431
neuronSMED30011228AMMECR1 domain-containing proteinSMESG000059071.1 dd_Smed_v4_1660_0_1dd_Smed_v4PMID:29674431
neuronSMED30011228AMMECR1 domain-containing proteinSMESG000059071.1 Contig55355newmark_estsPMID:27612384
neuronSMED30014753NACHT domain- and WD repeat-containing protein 1SMESG000074035.1 dd_Smed_v4_11085_0_1dd_Smed_v4PMID:29674431
neuronSMED30019373Rab6-interacting protein 2/elks/erc/cast,putativeSMESG000051528.1 dd_Smed_v4_12278_0_1dd_Smed_v4PMID:29674431
neuronSMED30019373Rab6-interacting protein 2/elks/erc/cast,putativeSMESG000051528.1 dd_Smed_v4_12278_0_1dd_Smed_v4PMID:29674431
neuronSMED30019373Rab6-interacting protein 2/elks/erc/cast,putativeSMESG000051528.1 dd_Smed_v6_12278_0dd_Smed_v6PMID:29674432
neuronSMED30019908PKD1L-3SMESG000066980.1 dd_Smed_v4_10962_0_1dd_Smed_v4PMID:29674431
neuronSMED30019908PKD1L-3SMESG000066980.1 dd_Smed_v6_10962_0_1dd_Smed_v6PMID:30399335
neuronSMED30011420Trinucleotide repeat containing 4-like proteinSMESG000005424.1 dd_Smed_v4_11349_0_1dd_Smed_v4PMID:29674431
neuronSMED30011420Trinucleotide repeat containing 4-like proteinSMESG000005424.1 dd_Smed_v4_11349_0_1dd_Smed_v4PMID:29674431
neuronSMED30018274Calbindin-32SMESG000055605.1 dd_Smed_v4_1230_0_1dd_Smed_v4PMID:29674431
neuronSMED30018274Calbindin-32SMESG000055605.1 dd_Smed_v4_1230_0_1dd_Smed_v4PMID:29674431
neuronSMED30018274Calbindin-32SMESG000055605.1 dd_Smed_v6_1230_0dd_Smed_v6PMID:29674432
neuronSMED30013721Sterol O-acyltransferase 1SMESG000039900.1 dd_Smed_v4_17219_0_1dd_Smed_v4PMID:29674431
neuronSMED30017565Ephrin type-B receptor 2SMESG000008191.1 dd_Smed_v4_16928_0_1dd_Smed_v4PMID:29674431
neuronSMED30017565Ephrin type-B receptor 2SMESG000008191.1 dd_Smed_v4_16928_0_1dd_Smed_v4PMID:29674431
neuronSMED30015821Neuropeptide-22SMESG000043852.1 dd_Smed_v4_1483_0_1dd_Smed_v4PMID:29674431
neuronSMED30015266adhesion G protein-coupled receptor L2-likeSMESG000058907.1 dd_Smed_v4_16446_0_1dd_Smed_v4PMID:29674431
neuronSMED30015266adhesion G protein-coupled receptor L2-likeSMESG000058907.1 dd_Smed_v4_16446_0_1dd_Smed_v4PMID:29674431
neuronSMED30015266adhesion G protein-coupled receptor L2-likeSMESG000058907.1 dd_Smed_v4_12277_0_1dd_Smed_v4PMID:29674431
neuronSMED30019744SMED-SMAD6/7-2SMESG000021574.1 dd_Smed_v4_16758_0_1dd_Smed_v4PMID:29674431
neuronSMED30016607SMED30016607SMESG000042667.1 SMESG000042664.1 SMESG000042670.1 dd_Smed_v4_11981_0_1dd_Smed_v4PMID:29674431
neuronSMED30016607SMED30016607SMESG000042667.1 SMESG000042664.1 SMESG000042670.1 dd_Smed_v4_11981_0_1dd_Smed_v4PMID:29674431
neuronSMED30006773Calpain-BSMESG000039299.1 dd_Smed_v4_1752_0_1dd_Smed_v4PMID:29674431
neuronSMED30013884SMED30013884SMESG000049207.1 SMESG000049205.1 SMESG000049063.1 dd_Smed_v4_11081_0_1dd_Smed_v4PMID:29674431
neuronSMED30006199Acetyl-coenzyme A synthetaseSMESG000022079.1 dd_Smed_v4_1817_0_1dd_Smed_v4PMID:29674431
neuronSMED30006199Acetyl-coenzyme A synthetaseSMESG000022079.1 dd_Smed_v4_1817_0_1dd_Smed_v4PMID:29674431
neuronSMED30007202Guanylate cyclaseSMESG000068881.1 dd_Smed_v4_14331_0_1dd_Smed_v4PMID:29674431
neuronSMED3000412414-3-3 protein beta/alphaSMESG000055903.1 dd_Smed_v4_138_0_1dd_Smed_v4PMID:29674431
neuronSMED3000412414-3-3 protein beta/alphaSMESG000055903.1 dd_Smed_v4_138_0_1dd_Smed_v4PMID:29674431
neuronSMED30014124SMED30014124SMESG000024190.1 dd_Smed_v4_1790_0_1dd_Smed_v4PMID:29674431
neuronSMED30014124SMED30014124SMESG000024190.1 dd_Smed_v4_1790_0_1dd_Smed_v4PMID:29674431
neuronSMED30008778SMED30008778SMESG000004626.1 dd_Smed_v4_13872_0_1dd_Smed_v4PMID:29674431
neuronSMED30013286sn1-specific diacylglycerol lipase betaSMESG000046500.1 dd_Smed_v4_13306_0_1dd_Smed_v4PMID:29674431
neuronSMED30013286sn1-specific diacylglycerol lipase betaSMESG000046500.1 dd_Smed_v4_13306_0_1dd_Smed_v4PMID:29674431
neuronSMED30003408Centrosomal protein of 89 kDaSMESG000031345.1 dd_Smed_v4_13073_0_1dd_Smed_v4PMID:29674431
neuronSMED30003408Centrosomal protein of 89 kDaSMESG000031345.1 dd_Smed_v4_13073_0_1dd_Smed_v4PMID:29674431
neuronSMED30013417Cadherin like and PC-esterase domain containing 1SMESG000016689.1 dd_Smed_v4_14757_0_1dd_Smed_v4PMID:29674431
neuronSMED30019101Inactive dipeptidyl peptidase 10SMESG000050507.1 dd_Smed_v4_12240_0_1dd_Smed_v4PMID:29674431
neuronSMED30001630Ras-related C3 botulinum toxin substrate 1SMESG000024968.1 SMESG000005612.1 dd_Smed_v4_1050_0_1dd_Smed_v4PMID:29674431
neuronSMED30019938Transcription activator BRG1SMESG000050888.1 SMESG000050880.1 dd_Smed_v4_16980_0_1dd_Smed_v4PMID:29674431
neuronSMED30019734Neur_chan_LBD domain-containing proteinSMESG000064435.1 dd_Smed_v4_17839_0_1dd_Smed_v4PMID:29674431
neuronSMED30013824Unc-5 netrin receptor BSMESG000040323.1 dd_Smed_v4_10380_0_1dd_Smed_v4PMID:29674431
neuronSMED30013824Unc-5 netrin receptor BSMESG000040323.1 dd_Smed_v4_10380_0_1dd_Smed_v4PMID:29674431
neuronSMED30020414SMED30020414SMESG000059071.1 dd_Smed_v4_1660_0_1dd_Smed_v4PMID:29674431
neuronSMED30022539SMED30022539SMESG000059071.1 dd_Smed_v4_1660_0_1dd_Smed_v4PMID:29674431
neuronSMED30025135SMED30025135SMESG000042667.1 SMESG000042664.1 SMESG000042670.1 dd_Smed_v4_11981_0_1dd_Smed_v4PMID:29674431
neuronSMED30025135SMED30025135SMESG000042667.1 SMESG000042664.1 SMESG000042670.1 dd_Smed_v4_11981_0_1dd_Smed_v4PMID:29674431
neuronSMED30020260SMED30020260SMESG000005697.1 dd_Smed_v4_12813_0_1dd_Smed_v4PMID:29674431
neuronSMED30020821SMED30020821SMESG000014298.1 dd_Smed_v4_1301_0_1dd_Smed_v4PMID:29674431
neuronSMED30020821SMED30020821SMESG000014298.1 dd_Smed_v4_1301_0_1dd_Smed_v4PMID:29674431
neuronSMED30020821SMED30020821SMESG000014298.1 dd_Smed_v6_1301_0dd_Smed_v6PMID:29674432
neuronSMED30020566SMED30020566SMESG000038603.1 SMESG000038602.1 dd_Smed_v4_1140_0_1dd_Smed_v4PMID:29674431
neuronSMED30020125U3 small nucleolar RNA associated protein 22SMESG000078232.1 dd_Smed_v4_18069_0_1dd_Smed_v4PMID:29674431
neuronSMED30020007Dystrobrevin betaSMESG000078318.1 dd_Smed_v4_12275_0_1dd_Smed_v4PMID:29674431
neuronSMED30004142Calcium-dependent secretion activator 1SMESG000011756.1 dd_Smed_v4_11725_0_1dd_Smed_v4PMID:29674431
neuronSMED30004142Calcium-dependent secretion activator 1SMESG000011756.1 dd_Smed_v4_11725_0_1dd_Smed_v4PMID:29674431
neuronSMED30000316Interferon-induced GTP-binding protein Mx1SMESG000002219.1 SMESG000002216.1 SMESG000002004.1 dd_Smed_v4_3169_0_1dd_Smed_v4PMID:29674431
neuronSMED30000316Interferon-induced GTP-binding protein Mx1SMESG000002219.1 SMESG000002216.1 SMESG000002004.1 dd_Smed_v4_3169_0_1dd_Smed_v4PMID:29674431
neuronSMED30000316Interferon-induced GTP-binding protein Mx1SMESG000066856.1 SMESG000002221.1 SMESG000002213.1 dd_Smed_v4_5708_0_1dd_Smed_v4PMID:29674431
neuronSMED30000316Interferon-induced GTP-binding protein Mx1SMESG000002216.1 SMESG000002124.1 SMESG000002025.1 SMESG000002023.1 SMESG000002011.1 SMESG000002004.1 SMESG000002219.1 SMESG000002211.1 SMESG000002032.1 SMESG000002033.1 dd_Smed_v6_884_0dd_Smed_v6PMID:29674432
neuronSMED30012043Calcium-transporting ATPaseSMESG000063816.1 SMESG000010536.1 SMESG000045280.1 SMESG000029730.1 dd_Smed_v4_4145_0_1dd_Smed_v4PMID:29674431
neuronSMED30012043Calcium-transporting ATPaseSMESG000063816.1 SMESG000010536.1 SMESG000045280.1 SMESG000029730.1 dd_Smed_v4_4145_0_1dd_Smed_v4PMID:29674431
neuronSMED30006498Histone-lysine N-methyltransferase SETMARSMESG000075151.1 SMESG000074964.1 dd_Smed_v4_10186_0_1dd_Smed_v4PMID:29674431
neuronSMED30006498Histone-lysine N-methyltransferase SETMARSMESG000075151.1 SMESG000074964.1 dd_Smed_v4_10186_0_1dd_Smed_v4PMID:29674431
neuronSMED30014748Ptk7SMESG000072430.1 dd_Smed_v4_6999_0_1dd_Smed_v4PMID:29674431
neuronSMED30006230Sperm surface protein Sp17SMESG000046919.1 dd_Smed_v4_2279_0_1dd_Smed_v4PMID:29674431
neuronSMED30006230Sperm surface protein Sp17SMESG000046919.1 dd_Smed_v4_2279_0_1dd_Smed_v4PMID:29674431
neuronSMED30006230Sperm surface protein Sp17SMESG000046919.1 dd_Smed_v4_4783_0_1dd_Smed_v4PMID:29674431
neuronSMED30006230Sperm surface protein Sp17SMESG000046919.1 dd_Smed_v4_4783_0_1dd_Smed_v4PMID:29674431
neuronSMED30016257WD_REPEATS_REGION domain-containing proteinSMESG000001039.1 dd_Smed_v4_19827_0_1dd_Smed_v4PMID:29674431
neuronSMED30016257WD_REPEATS_REGION domain-containing proteinSMESG000001039.1 dd_Smed_v4_19827_0_1dd_Smed_v4PMID:29674431
neuronSMED300051503' histone mRNA exonuclease 1SMESG000058668.1 dd_Smed_v4_1266_0_1dd_Smed_v4PMID:29674431
neuronSMED30000977PhosphomannomutaseSMESG000079671.1 SMESG000079384.1 dd_Smed_v4_1964_0_1dd_Smed_v4PMID:29674431
neuronSMED30010012Neur_chan_LBD domain-containing proteinSMESG000064442.1 dd_21541dd_Smed_v4PMID:29674431
neuronSMED30010012Neur_chan_LBD domain-containing proteinSMESG000064442.1 dd_21541dd_Smed_v4PMID:29674431
neuronSMED30002168Spondin-1SMESG000039905.1 dd_Smed_v4_8655_0_1dd_Smed_v4PMID:29674431
neuronSMED30002168Spondin-1SMESG000039905.1 dd_Smed_v4_8655_0_1dd_Smed_v4PMID:29674431
neuronSMED30005459SMED30005459SMESG000014884.1 dd_Smed_v4_2661_0_1dd_Smed_v4PMID:29674431
neuronSMED30005459SMED30005459SMESG000014884.1 dd_Smed_v4_2661_0_1dd_Smed_v4PMID:29674431
neuronSMED30019471SynaptotagminSMESG000055143.1 dd_Smed_v4_6730_0_1dd_Smed_v4PMID:29674431
neuronSMED30005737Death-associated protein kinase 1SMESG000048879.1 dd_Smed_v4_9475_0_1dd_Smed_v4PMID:29674431
neuronSMED30005737Death-associated protein kinase 1SMESG000048879.1 dd_Smed_v4_9475_0_1dd_Smed_v4PMID:29674431
neuronSMED30022977SMED30022977SMESG000017540.1 SMESG000070603.1 SMESG000070576.1 SMESG000017600.1 SMESG000017572.1 SMESG000017558.1 SMESG000017557.1 SMESG000017556.1 SMESG000017543.1 SMESG000017541.1 dd_Smed_v4_4601_0_1dd_Smed_v4PMID:29674431
neuronSMED30022977SMED30022977SMESG000017540.1 SMESG000070603.1 SMESG000070576.1 SMESG000017600.1 SMESG000017572.1 SMESG000017558.1 SMESG000017557.1 SMESG000017556.1 SMESG000017543.1 SMESG000017541.1 dd_Smed_v4_4601_0_1dd_Smed_v4PMID:29674431
neuronSMED30020002BEN domain-containing proteinSMESG000080064.1 dd_Smed_v4_7370_0_1dd_Smed_v4PMID:29674431
neuronSMED30020002BEN domain-containing proteinSMESG000080064.1 dd_Smed_v4_7370_0_1dd_Smed_v4PMID:29674431
neuronSMED30025296Voltage-dependent calcium channel subunit alpha-2/delta-2SMESG000021955.1 SMESG000021966.1 dd_Smed_v4_2470_0_1dd_Smed_v4PMID:29674431
neuronSMED30028832SMED30028832SMESG000029027.1 dd_Smed_v4_10089_0_1dd_Smed_v4PMID:29674431
neuronSMED30028832SMED30028832SMESG000029027.1 dd_Smed_v4_10089_0_1dd_Smed_v4PMID:29674431
neuronSMED30034888Dynein heavy chain 5, axonemalSMESG000049144.1 dd_Smed_v4_4569_0_1dd_Smed_v4PMID:29674431
neuronSMED30034888Dynein heavy chain 5, axonemalSMESG000049144.1 dd_Smed_v4_4569_0_1dd_Smed_v4PMID:29674431
neuronSMED30023249nuclear factor Y complex CSMESG000077821.1 dd_Smed_v4_5610_0_1dd_Smed_v4PMID:29674431
neuronSMED30029825ANK_REP_REGION domain-containing proteinSMESG000020706.1 dd_Smed_v4_21003_0_1dd_Smed_v4PMID:29674431
neuronSMED30029825ANK_REP_REGION domain-containing proteinSMESG000020706.1 dd_Smed_v4_21003_0_1dd_Smed_v4PMID:29674431
neuronSMED30023587SMED30023587SMESG000063816.1 SMESG000010536.1 SMESG000045280.1 SMESG000029730.1 dd_Smed_v4_4145_0_1dd_Smed_v4PMID:29674431
neuronSMED30023587SMED30023587SMESG000063816.1 SMESG000010536.1 SMESG000045280.1 SMESG000029730.1 dd_Smed_v4_4145_0_1dd_Smed_v4PMID:29674431
neuronSMED30020257DUF3421 domain-containing proteinSMESG000046742.1 dd_Smed_v4_1040_0_1dd_Smed_v4PMID:29674431
neuronSMED30020257DUF3421 domain-containing proteinSMESG000046742.1 dd_Smed_v4_1040_0_1dd_Smed_v4PMID:29674431
neuronSMED30026337AnkyrinSMESG000000606.1 dd_Smed_v4_2072_0_1dd_Smed_v4PMID:29674431
neuronSMED30026337AnkyrinSMESG000000606.1 dd_Smed_v4_2072_0_1dd_Smed_v4PMID:29674431
neuronSMED30025257cAMP-dependent protein kinase catalytic subunitSMESG000048614.1 dd_Smed_v4_2413_0_1dd_Smed_v4PMID:29674431
neuronSMED30030159SMED30030159SMESG000000606.1 dd_Smed_v4_2072_0_1dd_Smed_v4PMID:29674431
neuronSMED30030159SMED30030159SMESG000000606.1 dd_Smed_v4_2072_0_1dd_Smed_v4PMID:29674431
neuronSMED3003573414-3-3 protein epsilonSMESG000075252.1 dd_Smed_v4_1702_0_1dd_Smed_v4PMID:29674431
neuronSMED3003573414-3-3 protein epsilonSMESG000075252.1 dd_Smed_v4_1702_0_1dd_Smed_v4PMID:29674431
neuronSMED3002954297 kDa heat shock proteinSMESG000019478.1 dd_Smed_v4_1087_0_1dd_Smed_v4PMID:29674431
neuronSMED30021821Transient receptor potential cation channel subfamily M memberSMESG000078720.1 dd_17981dd_Smed_v4PMID:29674431
neuronSMED30021821Transient receptor potential cation channel subfamily M memberSMESG000078720.1 dd_17981dd_Smed_v4PMID:29674431
neuronSMED30021821Transient receptor potential cation channel subfamily M memberSMESG000078720.1 dd_Smed_v4_17981_0_1dd_Smed_v4PMID:29674431
neuronSMED30028658early growth response-4SMESG000028801.1 SMESG000028800.1 dd_Smed_v4_9410_0_1dd_Smed_v4PMID:29674431
neuronSMED30023352Vang-1SMESG000029281.1 JN100094smed_ncbi_20200123PMID:22339734
neuronSMED30023352Vang-1SMESG000029281.1 dd_Smed_v4_9100_0_1dd_Smed_v4PMID:29674431
neuronSMED30025084Ankyrin repeat and EF-hand domain-containing protein 1SMESG000006940.1 SMESG000006938.1 SMESG000006933.1 dd_Smed_v4_12476_0_1dd_Smed_v4PMID:29674431
neuronSMED30025852Thrombospondin-1SMESG000014733.1 DN306833ncbi_smed_estsPMID:25356635
neuronSMED30025852Thrombospondin-1SMESG000014733.1 DN299031ncbi_smed_estsPMID:30399335
neuronSMED30020297Mediator of RNA polymerase II transcription subunit 1SMESG000023303.1 dd_Smed_v4_6432_0_1dd_Smed_v4PMID:29674431
neuronSMED30020297Mediator of RNA polymerase II transcription subunit 1SMESG000023303.1 dd_Smed_v4_6432_0_1dd_Smed_v4PMID:29674431
neuronSMED30035611Fras1 related extracellular matrix proteinSMESG000032220.1 dd_Smed_v4_2407_0_1dd_Smed_v4PMID:29674431
neuronSMED30035611Fras1 related extracellular matrix proteinSMESG000032220.1 dd_Smed_v4_2407_0_1dd_Smed_v4PMID:29674431
neuronSMED30026544Mucin-19-like isoform X3SMESG000001496.1 SMESG000001495.1 dd_Smed_v4_14943_0_1dd_Smed_v4PMID:29674431
neuronSMED30031735E3 ubiquitin-protein ligase PDZRN3SMESG000080284.1 dd_Smed_v4_4699_0_1dd_Smed_v4PMID:29674431
neuronSMED30031735E3 ubiquitin-protein ligase PDZRN3SMESG000080284.1 dd_Smed_v4_4699_0_1dd_Smed_v4PMID:29674431
neuronSMED30035681Intraflagellar transport protein 88SMESG000039906.1 dd_Smed_v4_5484_0_1dd_Smed_v4PMID:29674431
neuronSMED30035681Intraflagellar transport protein 88SMESG000039906.1 dd_Smed_v4_5484_0_1dd_Smed_v4PMID:29674431
neuronSMED30030735Component of oligomeric golgi complex 5SMESG000034878.1 dd_Smed_v4_4852_0_1dd_Smed_v4PMID:29674431
neuronSMED30031090Ubiquinone biosynthesis protein COQ4 homolog, mitochondrialSMESG000076821.1 SMESG000055285.1 SMESG000054243.1 SMESG000021425.1 SMESG000013482.1 Contig53275newmark_estsPMID:27612384
neuronSMED30031090Ubiquinone biosynthesis protein COQ4 homolog, mitochondrialSMESG000076821.1 SMESG000055285.1 SMESG000054243.1 SMESG000021425.1 SMESG000013482.1 Contig53275uc_Smed_v2PMID:27612384
neuronSMED30027677Carboxylic ester hydrolaseSMESG000005630.1 dd_Smed_v4_10334_0_1dd_Smed_v4PMID:29674431
neuronSMED30034967Myosin headSMESG000049494.1 dd_Smed_v4_2912_0_1dd_Smed_v4PMID:29674431
neuronSMED30034967Myosin headSMESG000049494.1 dd_Smed_v4_2912_0_1dd_Smed_v4PMID:29674431
neuronSMED30024216neurexin-2-likeSMESG000054585.1 dd_Smed_v4_23270_0_1dd_Smed_v4PMID:29674431
neuronSMED30036025SMED30036025SMESG000071534.1 dd_Smed_v4_3658_0_1dd_Smed_v4PMID:29674431
neuronSMED30036025SMED30036025SMESG000071534.1 dd_Smed_v4_3658_0_1dd_Smed_v4PMID:29674431
neuronSMED30036025SMED30036025SMESG000071534.1 DN301993ncbi_smed_estsPMID:30399335
neuronSMED30030133RNA binding protein fox-1 homolog 1SMESG000019470.1 dd_Smed_v4_6567_0_1dd_Smed_v4PMID:29674431
neuronSMED30029026Multidrug resistance-associated protein 1SMESG000014785.1 dd_Smed_v4_3077_0_1dd_Smed_v4PMID:29674431
neuronSMED30029026Multidrug resistance-associated protein 1SMESG000014785.1 dd_Smed_v4_3077_0_1dd_Smed_v4PMID:29674431
neuronSMED30033838Secreted peptide prohormone 18SMESG000030647.1 ADC84438smed_ncbi_20200123PMID:25356635
neuronSMED30026953Pre-mRNA polyadenylation factor FIP1SMESG000023126.1 dd_Smed_v4_2560_0_1dd_Smed_v4PMID:29674431
neuronSMED30022151CaveolinSMESG000074524.1 KJ187183smed_ncbi_20200123PMID:25356635
neuronSMED30022151CaveolinSMESG000074524.1 dd_Smed_v4_8555_0_1dd_Smed_v4PMID:29674431
neuronSMED30022151CaveolinSMESG000074524.1 dd_Smed_v4_8555_0_1dd_Smed_v4PMID:29674431
neuronSMED30022151CaveolinSMESG000074524.1 dd_Smed_v6_8555_0_1dd_Smed_v6PMID:30399335
neuronSMED30022151CaveolinSMESG000074524.1 dd_Smed_v6_8555_0dd_Smed_v6PMID:29674432
neuronSMED30020526PalmitoyltransferaseSMESG000071926.1 dd_Smed_v4_6233_0_1dd_Smed_v4PMID:29674431
neuronSMED30032373Centrosomal protein of 135 kDaSMESG000079518.1 SMESG000070566.1 dd_Smed_v4_6933_0_1dd_Smed_v4PMID:29674431
neuronSMED30023475SMED30023475SMESG000047326.1 dd_Smed_v4_13864_0_1dd_Smed_v4PMID:29674431
neuronSMED30032366SMED30032366SMESG000076652.1 SMESG000053372.1 SMESG000050353.1 SMESG000040848.1 SMESG000034123.1 SMESG000029555.1 SMESG000023611.1 SMESG000064571.1 Contig19011newmark_estsPMID:27612384
neuronSMED30032366SMED30032366SMESG000076652.1 SMESG000053372.1 SMESG000050353.1 SMESG000040848.1 SMESG000034123.1 SMESG000029555.1 SMESG000023611.1 SMESG000064571.1 Contig19011uc_Smed_v2PMID:27612384
neuronSMED30032366SMED30032366SMESG000079180.1 SMESG000076652.1 SMESG000076091.1 SMESG000066578.1 SMESG000065288.1 SMESG000059025.1 SMESG000057427.1 SMESG000052755.1 SMESG000052524.1 SMESG000050353.1 SMESG000046659.1 SMESG000037212.1 SMESG000033451.1 SMESG000031049.1 SMESG000022236.1 SMESG000019334.1 SMESG000017989.1 SMESG000026425.1 Contig11424newmark_estsPMID:27612384
neuronSMED30032366SMED30032366SMESG000079180.1 SMESG000076652.1 SMESG000076091.1 SMESG000066578.1 SMESG000065288.1 SMESG000059025.1 SMESG000057427.1 SMESG000052755.1 SMESG000052524.1 SMESG000050353.1 SMESG000046659.1 SMESG000037212.1 SMESG000033451.1 SMESG000031049.1 SMESG000022236.1 SMESG000019334.1 SMESG000017989.1 SMESG000026425.1 Contig11424uc_Smed_v2PMID:27612384
neuronSMED30032366SMED30032366SMESG000080004.1 SMESG000079430.1 SMESG000076652.1 SMESG000076091.1 SMESG000076042.1 SMESG000074857.1 SMESG000070393.1 SMESG000069936.1 SMESG000068687.1 SMESG000065866.1 SMESG000065288.1 SMESG000065178.1 SMESG000062279.1 SMESG000061056.1 SMESG000059025.1 SMESG000058180.1 SMESG000057864.1 SMESG000057533.1 SMESG000057427.1 SMESG000055140.1 SMESG000053372.1 SMESG000053240.1 SMESG000050587.1 SMESG000050353.1 SMESG000048922.1 SMESG000047874.1 SMESG000046659.1 SMESG000046053.1 SMESG000043782.1 SMESG000042816.1 SMESG000042302.1 SMESG000040179.1 SMESG000038292.1 SMESG000037212.1 SMESG000034701.1 SMESG000033592.1 SMESG000031049.1 SMESG000029555.1 SMESG000029226.1 SMESG000026530.1 SMESG000024597.1 SMESG000023611.1 SMESG000022236.1 SMESG000021499.1 SMESG000019334.1 SMESG000017989.1 SMESG000013698.1 SMESG000013635.1 SMESG000009102.1 SMESG000008351.1 SMESG000006220.1 SMESG000005221.1 SMESG000001234.1 SMESG000026425.1 dd_Smed_v4_9908_0_1dd_Smed_v4PMID:29674431
neuronSMED30020236SMED30020236SMESG000021340.1 dd_Smed_v4_9741_0_1dd_Smed_v4PMID:29674431
neuronSMED30021837piggyBac transposable element-derived protein 4-likeSMESG000080622.1 SMESG000068757.1 SMESG000055125.1 SMESG000038294.1 SMESG000032747.1 SMESG000023322.1 dd_Smed_v4_3830_0_1dd_Smed_v4PMID:29674431
neuronSMED30022121SMED30022121SMESG000042798.1 dd_Smed_v4_2204_1_1dd_Smed_v4PMID:29674431
neuronSMED30030673Alpha-soluble NSF attachment proteinSMESG000061347.1 dd_Smed_v4_2480_0_1dd_Smed_v4PMID:29674431
neuronSMED30030673Alpha-soluble NSF attachment proteinSMESG000061347.1 dd_Smed_v4_2480_0_1dd_Smed_v4PMID:29674431
neuronSMED30023495V-SNARE coiled-coil homology domain-containing proteinSMESG000057424.1 DN307612ncbi_smed_estsPMID:25356635
neuronSMED30023495V-SNARE coiled-coil homology domain-containing proteinSMESG000057424.1 DN307612ncbi_smed_estsPMID:25356635
neuronSMED30023495V-SNARE coiled-coil homology domain-containing proteinSMESG000057424.1 dd_Smed_v4_6394_0_1dd_Smed_v4PMID:29674431
neuronSMED30021914SMED30021914SMESG000047681.1 SMESG000016277.1 dd_Smed_v4_4415_0_1dd_Smed_v4PMID:29674431
neuronSMED30021914SMED30021914SMESG000047681.1 SMESG000016277.1 dd_Smed_v4_4415_0_1dd_Smed_v4PMID:29674431
neuronSMED30021914SMED30021914SMESG000012307.1 dd_Smed_v4_2950_0_1dd_Smed_v4PMID:29674431
neuronSMED30028690kcnbSMESG000004060.1 KJ187187smed_ncbi_20200123PMID:25356635
neuronSMED30033646SMED30033646SMESG000022408.1 dd_Smed_v4_2191_0_1dd_Smed_v4PMID:29674431
neuronSMED30033646SMED30033646SMESG000022408.1 dd_Smed_v4_2191_0_1dd_Smed_v4PMID:29674431
neuronSMED30033646SMED30033646SMESG000022408.1 dd_Smed_v6_2191_0dd_Smed_v6PMID:29674432
neuronSMED30019871MTSS I-BAR domain containing 2SMESG000028682.1 dd_Smed_v4_6612_0_1dd_Smed_v4PMID:29674431
neuronSMED30019871MTSS I-BAR domain containing 2SMESG000069250.1 dd_Smed_v4_3525_0_1dd_Smed_v4PMID:29674431
neuronSMED30001473Lipoxygenase homology domain-containing protein 1SMESG000059926.1 SMESG000059927.1 dd_Smed_v4_10460_0_1dd_Smed_v4PMID:29674431
neuronSMED30001473Lipoxygenase homology domain-containing protein 1SMESG000059926.1 SMESG000059927.1 dd_Smed_v4_10460_0_1dd_Smed_v4PMID:29674431
neuronSMED30009968Intraflagellar transport protein 122 homologSMESG000039305.1 SMESG000039304.1 dd_Smed_v4_11912_0_1dd_Smed_v4PMID:29674431
neuronSMED30001031TRAF3-interacting protein 1SMESG000006345.1 dd_Smed_v4_10562_0_1dd_Smed_v4PMID:29674431
neuronSMED30001031TRAF3-interacting protein 1SMESG000006345.1 dd_Smed_v4_10562_0_1dd_Smed_v4PMID:29674431
neuronSMED30004695Voltage-dependent T-type calcium channel subunit alphaSMESG000000986.1 SMESG000000983.1 dd_Smed_v4_26967_0_1dd_Smed_v4PMID:29674431
neuronSMED30004695Voltage-dependent T-type calcium channel subunit alphaSMESG000000986.1 dd_Smed_v4_25868_0_1dd_Smed_v4PMID:29674431
neuronSMED30004695Voltage-dependent T-type calcium channel subunit alphaSMESG000000986.1 dd_Smed_v4_16822_0_1dd_Smed_v4PMID:29674431
neuronSMED30004695Voltage-dependent T-type calcium channel subunit alphaSMESG000000986.1 dd_Smed_v4_16822_0_1dd_Smed_v4PMID:29674431
neuronSMED30015125SMED30015125SMESG000061766.1 dd_Smed_v4_12632_0_1dd_Smed_v4PMID:29674431
neuronSMED30004519Novel proteinSMESG000039682.1 dd_Smed_v4_2676_0_1dd_Smed_v4PMID:29674431
neuronSMED30004519Novel proteinSMESG000039682.1 dd_Smed_v4_2676_0_1dd_Smed_v4PMID:29674431
neuronSMED30007610Guanine nucleotide-binding protein G(q) subunit alphaSMESG000022892.1 dd_Smed_v4_3755_0_1dd_Smed_v4PMID:29674431
neuronSMED30007610Guanine nucleotide-binding protein G(q) subunit alphaSMESG000022892.1 dd_Smed_v4_3755_0_1dd_Smed_v4PMID:29674431
neuronSMED30014951SMED30014951SMESG000058720.1 dd_Smed_v4_7931_0_1dd_Smed_v4PMID:29674431
neuronSMED30014951SMED30014951SMESG000058720.1 dd_Smed_v4_7931_0_1dd_Smed_v4PMID:29674431
neuronSMED30000065SMED30000065SMESG000049103.1 dd_Smed_v4_397_0_1dd_Smed_v4PMID:29674431
neuronSMED30000065SMED30000065SMESG000049103.1 dd_Smed_v4_397_0_1dd_Smed_v4PMID:29674431
neuronSMED30000065SMED30000065SMESG000049103.1 dd_Smed_v6_397_0dd_Smed_v6PMID:29674432
neuronSMED30003177Bardet-Biedl syndrome 2 protein homologSMESG000075151.1 SMESG000074964.1 dd_Smed_v4_10186_0_1dd_Smed_v4PMID:29674431
neuronSMED30003177Bardet-Biedl syndrome 2 protein homologSMESG000075151.1 SMESG000074964.1 dd_Smed_v4_10186_0_1dd_Smed_v4PMID:29674431
neuronSMED30018571U1-type domain-containing proteinSMESG000050161.1 dd_Smed_v4_6635_0_1dd_Smed_v4PMID:29674431
neuronSMED30018571U1-type domain-containing proteinSMESG000050161.1 dd_Smed_v4_6635_0_1dd_Smed_v4PMID:29674431
neuronSMED30014428Receptor-type tyrosine-protein phosphatase FSMESG000025325.1 dd_Smed_v4_14794_0_1dd_Smed_v4PMID:29674431
neuronSMED30014047SMED30014047SMESG000025950.1 dd_Smed_v4_1574_6_1dd_Smed_v4PMID:29674431
neuronSMED30014047SMED30014047SMESG000025950.1 dd_Smed_v4_1574_6_1dd_Smed_v4PMID:29674431
neuronSMED30014047SMED30014047SMESG000025950.1 dd_Smed_v4_12336_0_1dd_Smed_v4PMID:29674431
neuronSMED30013831SMED30013831SMESG000021340.1 dd_Smed_v4_9741_0_1dd_Smed_v4PMID:29674431
neuronSMED30016557AquaporinSMESG000023346.1 dd_Smed_v4_6111_0_1dd_Smed_v4PMID:29674431
neuronSMED30016557AquaporinSMESG000023346.1 dd_Smed_v4_6111_0_1dd_Smed_v4PMID:29674431
neuronSMED30014194Stonin-1/2SMESG000017305.1 dd_Smed_v4_6859_0_1dd_Smed_v4PMID:29674431
neuronSMED30014194Stonin-1/2SMESG000017305.1 dd_Smed_v4_6859_0_1dd_Smed_v4PMID:29674431
neuronSMED30014194Stonin-1/2SMESG000017305.1 dd_Smed_v6_6859_0dd_Smed_v6PMID:29674432
neuronSMED30017834Breast cancer anti-estrogen resistance protein 1 CRK-associated substrate p130casSMESG000028562.1 dd_Smed_v4_6476_0_1dd_Smed_v4PMID:29674431
neuronSMED30017834Breast cancer anti-estrogen resistance protein 1 CRK-associated substrate p130casSMESG000028562.1 dd_Smed_v4_6476_0_1dd_Smed_v4PMID:29674431
neuronSMED30014149Ras-related protein Rab-3SMESG000034019.1 dd_Smed_v4_5920_0_1dd_Smed_v4PMID:29674431
neuronSMED30014149Ras-related protein Rab-3SMESG000034019.1 dd_Smed_v4_5920_0_1dd_Smed_v4PMID:29674431
neuronSMED30005744FGFR1 oncogene partnerSMESG000006505.1 dd_Smed_v4_5371_0_1dd_Smed_v4PMID:29674431
neuronSMED30005744FGFR1 oncogene partnerSMESG000006505.1 dd_Smed_v4_5371_0_1dd_Smed_v4PMID:29674431
neuronSMED30001478Dynamin-like proteinSMESG000002033.1 dd_Smed_v4_884_0_1dd_Smed_v4PMID:29674431
neuronSMED30001478Dynamin-like proteinSMESG000002033.1 dd_Smed_v4_884_0_1dd_Smed_v4PMID:29674431
neuronSMED30001478Dynamin-like proteinSMESG000002216.1 SMESG000002124.1 SMESG000002025.1 SMESG000002023.1 SMESG000002011.1 SMESG000002004.1 SMESG000002219.1 SMESG000002211.1 SMESG000002032.1 SMESG000002033.1 dd_Smed_v6_884_0dd_Smed_v6PMID:29674432
neuronSMED30004317SMED30004317SMESG000032896.1 SMESG000029537.1 SMESG000029534.1 dd_Smed_v4_2300_0_1dd_Smed_v4PMID:29674431
neuronSMED30004317SMED30004317SMESG000032896.1 SMESG000029537.1 SMESG000029534.1 dd_Smed_v4_2300_0_1dd_Smed_v4PMID:29674431
neuronSMED30004840Coiled-coil domain containing 88AaSMESG000012304.1 dd_Smed_v4_3591_0_1dd_Smed_v4PMID:29674431
neuronSMED30004840Coiled-coil domain containing 88AaSMESG000012304.1 dd_Smed_v4_3591_0_1dd_Smed_v4PMID:29674431
neuronSMED30011096Centrosomal protein 131SMESG000051138.1 dd_Smed_v4_13976_0_1dd_Smed_v4PMID:29674431
neuronSMED30011096Centrosomal protein 131SMESG000051138.1 dd_Smed_v4_13976_0_1dd_Smed_v4PMID:29674431
neuronSMED30007142Sperm surface protein Sp17SMESG000046919.1 dd_Smed_v4_2279_0_1dd_Smed_v4PMID:29674431
neuronSMED30007142Sperm surface protein Sp17SMESG000046919.1 dd_Smed_v4_2279_0_1dd_Smed_v4PMID:29674431
neuronSMED30007142Sperm surface protein Sp17SMESG000046919.1 dd_Smed_v4_4783_0_1dd_Smed_v4PMID:29674431
neuronSMED30007142Sperm surface protein Sp17SMESG000046919.1 dd_Smed_v4_4783_0_1dd_Smed_v4PMID:29674431
neuronSMED30002458FerritinSMESG000076636.1 dd_Smed_v4_2638_0_1dd_Smed_v4PMID:29674431
neuronSMED30002458FerritinSMESG000076636.1 dd_Smed_v4_2638_0_1dd_Smed_v4PMID:29674431
neuronSMED30034618von Willebrand factor A domain-containing protein 3ASMESG000022334.1 SMESG000022332.1 dd_Smed_v4_10972_0_1dd_Smed_v4PMID:29674431
neuronSMED30031552SMED30031552SMESG000025950.1 dd_Smed_v4_1574_6_1dd_Smed_v4PMID:29674431
neuronSMED30031552SMED30031552SMESG000025950.1 dd_Smed_v4_1574_6_1dd_Smed_v4PMID:29674431
neuronSMED30032897Signal recognition particle receptor subunit alphaSMESG000012673.1 dd_Smed_v4_1375_0_1dd_Smed_v4PMID:29674431
neuronSMED30032897Signal recognition particle receptor subunit alphaSMESG000012673.1 dd_Smed_v4_1375_0_1dd_Smed_v4PMID:29674431
neuronSMED30034098SMED30034098SMESG000022171.1 dd_Smed_v4_4552_0_1dd_Smed_v4PMID:29674431
neuronSMED30035901Abelson helper integration site 1SMESG000005183.1 SMESG000005182.1 dd_Smed_v4_11557_0_1dd_Smed_v4PMID:29674431
neuronSMED30035723nesprin-1-likeSMESG000023320.1 dd_Smed_v4_43173_0_1dd_Smed_v4PMID:29674431
neuronSMED30035723nesprin-1-likeSMESG000023320.1 dd_Smed_v4_10282_0_1dd_Smed_v4PMID:29674431
neuronSMED30035723nesprin-1-likeSMESG000023320.1 dd_Smed_v4_10282_0_1dd_Smed_v4PMID:29674431
neuronSMED30035723nesprin-1-likeSMESG000023320.1 dd_Smed_v4_44969_0_1dd_Smed_v4PMID:29674431
neuronSMED30035723nesprin-1-likeSMESG000023320.1 dd_Smed_v4_26396_0_1dd_Smed_v4PMID:29674431
neuronSMED30035723nesprin-1-likeSMESG000023320.1 dd_Smed_v4_20344_0_1dd_Smed_v4PMID:29674431
neuronSMED30035723nesprin-1-likeSMESG000023320.1 dd_Smed_v4_39583_0_1dd_Smed_v4PMID:29674431
neuronSMED30035723nesprin-1-likeSMESG000023320.1 dd_Smed_v4_20714_0_1dd_Smed_v4PMID:29674431
neuronSMED30035723nesprin-1-likeSMESG000023320.1 dd_Smed_v4_64459_0_1dd_Smed_v4PMID:29674431
neuronSMED30035723nesprin-1-likeSMESG000023320.1 dd_Smed_v4_51249_0_1dd_Smed_v4PMID:29674431
neuronSMED30028575Serine/threonine-protein phosphatase with EF-handsSMESG000042202.1 dd_Smed_v4_11874_0_1dd_Smed_v4PMID:29674431
neuronSMED30021685Bestrophin homologSMESG000070057.1 dd_Smed_v4_8073_0_1dd_Smed_v4PMID:29674431
neuronSMED30018244UDP-N-acetylglucosamine-peptide N-acetylglucosaminyltransferaseSMESG000004467.1 SMESG000004465.1 SMESG000069298.1 dd_Smed_v4_2819_0_1dd_Smed_v4PMID:29674431
neuronSMED30018263SMED30018263SMESG000033726.1 dd_Smed_v4_19428_0_1dd_Smed_v4PMID:29674431
neuronSMED30007858netrin receptor-like proteinSMESG000042475.1 dd_Smed_v4_11409_0_1dd_Smed_v4PMID:29674431
neuronSMED30007858netrin receptor-like proteinSMESG000042475.1 dd_Smed_v4_11409_0_1dd_Smed_v4PMID:29674431
neuronSMED30008020Ubiquitin family proteinSMESG000071059.1 SMESG000071050.1 dd_Smed_v4_4930_0_1dd_Smed_v4PMID:29674431
neuronSMED30001161Protein kinase domain-containing proteinSMESG000071511.1 dd_Smed_v4_6304_0_1dd_Smed_v4PMID:29674431
neuronSMED30002754TPR_REGION domain-containing proteinSMESG000008310.1 dd_Smed_v4_11374_0_1dd_Smed_v4PMID:29674431
neuronSMED30002754TPR_REGION domain-containing proteinSMESG000008310.1 dd_Smed_v4_11374_0_1dd_Smed_v4PMID:29674431
neuronSMED30000692Protein king tubbySMESG000073925.1 dd_Smed_v4_11228_0_1dd_Smed_v4PMID:29674431
neuronSMED30002038Calsyntenin 1SMESG000002834.1 SMESG000002830.1 dd_Smed_v4_1518_0_1dd_Smed_v4PMID:29674431
neuronSMED30014199MyosinSMESG000047361.1 dd_Smed_v4_4503_0_1dd_Smed_v4PMID:29674431
neuronSMED30007042Ras-related protein Rab-4BSMESG000044157.1 dd_Smed_v4_2099_0_1dd_Smed_v4PMID:29674431
neuronSMED30009189KinaseSMESG000003375.1 dd_Smed_v4_1630_0_1dd_Smed_v4PMID:29674431
neuronSMED30018491SMED30018491SMESG000000384.1 dd_Smed_v4_10941_0_1dd_Smed_v4PMID:29674431
neuronSMED30001480Serine/threonine-protein kinase ULK2SMESG000049447.1 dd_Smed_v4_1196_0_1dd_Smed_v4PMID:29674431
neuronSMED30001480Serine/threonine-protein kinase ULK2SMESG000049447.1 dd_Smed_v4_1196_0_1dd_Smed_v4PMID:29674431
neuronSMED30002066SMED30002066SMESG000016886.1 SMESG000016875.1 dd_Smed_v4_7893_0_1dd_Smed_v4PMID:29674431
neuronSMED30005448SMED30005448SMESG000009922.1 dd_Smed_v4_21965_0_1dd_Smed_v4PMID:29674431
neuronSMED30005448SMED30005448SMESG000009922.1 dd_Smed_v4_21965_0_1dd_Smed_v4PMID:29674431
neuronSMED30015251Transmembrane protein 184CSMESG000049447.1 dd_Smed_v4_1196_0_1dd_Smed_v4PMID:29674431
neuronSMED30015251Transmembrane protein 184CSMESG000049447.1 dd_Smed_v4_1196_0_1dd_Smed_v4PMID:29674431
neuronSMED30015251Transmembrane protein 184CSMESG000048961.1 SMESG000028913.1 dd_Smed_v4_3934_0_1dd_Smed_v4PMID:29674431
neuronSMED30016710SMED30016710SMESG000075557.1 dd_Smed_v4_10583_0_1dd_Smed_v4PMID:29674431
neuronSMED30015707Muscarinic acetylcholine receptorSMESG000018810.1 dd_Smed_v4_20043_0_1dd_Smed_v4PMID:29674431
neuronSMED30002182Neuropeptide Y prohormone-11SMESG000064810.1 dd_Smed_v4_16946_0_1dd_Smed_v4PMID:29674431
neuronSMED30002182Neuropeptide Y prohormone-11SMESG000064810.1 dd_Smed_v4_16946_0_1dd_Smed_v4PMID:29674431
neuronSMED30007557DUF4515 domain-containing proteinSMESG000013289.1 dd_Smed_v4_13384_0_1dd_Smed_v4PMID:29674431
neuronSMED30007557DUF4515 domain-containing proteinSMESG000013289.1 dd_Smed_v4_13384_0_1dd_Smed_v4PMID:29674431
neuronSMED30018344COesterase domain-containing proteinSMESG000005922.1 dd_Smed_v4_15930_0_1dd_Smed_v4PMID:29674431
neuronSMED30003595FYVE_2 domain-containing proteinSMESG000050479.1 dd_Smed_v4_21937_0_1dd_Smed_v4PMID:29674431
neuronSMED30003269Reticulon-like proteinSMESG000007676.1 dd_Smed_v4_1796_0_1dd_Smed_v4PMID:29674431
neuronSMED30003269Reticulon-like proteinSMESG000007676.1 dd_Smed_v4_1796_0_1dd_Smed_v4PMID:29674431
neuronSMED30004459Cytoplasmic FMR1-interacting proteinSMESG000062092.1 dd_Smed_v4_1820_0_1dd_Smed_v4PMID:29674431
neuronSMED30012867NEPH-2SMESG000071657.1 dd_Smed_v4_12118_0_1dd_Smed_v4PMID:29674431
neuronSMED30006833SMED30006833SMESG000065971.1 dd_Smed_v4_10521_0_1dd_Smed_v4PMID:29674431
neuronSMED30006225Cyclin dependent kinase like 1SMESG000038932.1 dd_Smed_v4_13082_0_1dd_Smed_v4PMID:29674431
neuronSMED30024999CTF/NF-I domain-containing proteinSMESG000010567.1 dd_Smed_v4_9508_0_1dd_Smed_v4PMID:29674431
neuronSMED30024999CTF/NF-I domain-containing proteinSMESG000010567.1 dd_Smed_v4_9508_0_1dd_Smed_v4PMID:29674431
neuronSMED30029327slc8a-1SMESG000077236.1 dd_Smed_v4_3303_0_1dd_Smed_v4PMID:29674431
neuronSMED30029327slc8a-1SMESG000077236.1 dd_Smed_v4_3303_0_1dd_Smed_v4PMID:29674431
neuronSMED30020747SMED30020747SMESG000037087.1 dd_Smed_v4_10194_0_1dd_Smed_v4PMID:29674431
neuronSMED30034066Hemicentin-2SMESG000015102.1 dd_Smed_v4_13275_0_1dd_Smed_v4PMID:29674431
neuronSMED30034066Hemicentin-2SMESG000015102.1 dd_Smed_v4_13275_0_1dd_Smed_v4PMID:29674431
neuronSMED30023902Mitogen-activated protein kinase kinase kinase kinase 4SMESG000031711.1 dd_Smed_v4_1029_0_1dd_Smed_v4PMID:29674431
neuronSMED30021847SMED30021847SMESG000017151.1 dd_Smed_v4_16489_0_1dd_Smed_v4PMID:29674431
neuronSMED30034763c-Jun N-terminal kinasesSMESG000043618.1 dd_Smed_v4_5924_0_1dd_Smed_v4PMID:29674431
neuronSMED30022030EGR-like protein 1SMESG000000960.1 dd_Smed_v4_7731_0_1dd_Smed_v4PMID:29674431
neuronSMED30022030EGR-like protein 1SMESG000000959.1 dd_Smed_v4_12410_0_1dd_Smed_v4PMID:29674431
neuronSMED30024174Programmed cell death 6-interacting proteinSMESG000019014.1 dd_Smed_v4_1373_1_1dd_Smed_v4PMID:29674431
neuronSMED30025883Forkhead associated phosphopeptide binding domain 1SMESG000071072.1 dd_Smed_v4_14350_0_1dd_Smed_v4PMID:29674431
neuronSMED30026877HORMA domain-containing proteinSMESG000066514.1 dd_Smed_v4_2201_0_1dd_Smed_v4PMID:29674431
neuronSMED30026877HORMA domain-containing proteinSMESG000066514.1 dd_Smed_v6_2201_0dd_Smed_v6PMID:29674432
neuronSMED30021807SMED30021807SMESG000030582.1 dd_Smed_v4_1124_0_1dd_Smed_v4PMID:29674431
neuronSMED30024025Regulating synaptic membrane exocytosis protein 2SMESG000037636.1 SMESG000037628.1 dd_Smed_v4_15437_0_1dd_Smed_v4PMID:29674431
neuronSMED30028255RRM domain-containing proteinSMESG000071928.1 dd_Smed_v4_36288_0_1dd_Smed_v4PMID:29674431
neuronSMED30024663Dynein regulatory complex subunit 3SMESG000047633.1 SMESG000047632.1 dd_Smed_v4_12541_0_1dd_Smed_v4PMID:29674431
neuronSMED30021870Potassium voltage-gated channel protein ShawSMESG000039493.1 dd_Smed_v4_14595_0_1dd_Smed_v4PMID:29674431
neuronSMED30033596Bardet-Biedl syndrome 4SMESG000046074.1 dd_Smed_v4_11370_0_1dd_Smed_v4PMID:29674431
neuronSMED30033694SMED30033694SMESG000049916.1 dd_Smed_v4_8376_0_1dd_Smed_v4PMID:29674431
neuronSMED30025882Protein FAM13ASMESG000052108.1 dd_Smed_v4_12046_0_1dd_Smed_v4PMID:29674431
neuronSMED30022961V-type proton ATPase subunitSMESG000057004.1 dd_Smed_v4_1976_0_1dd_Smed_v4PMID:29674431
neuronSMED30035339RIMS binding protein 2SMESG000001071.1 SMESG000001061.1 SMESG000001060.1 dd_Smed_v4_9824_0_1dd_Smed_v4PMID:29674431
neuronSMED30035339RIMS binding protein 2SMESG000001071.1 SMESG000001061.1 SMESG000001060.1 dd_Smed_v4_9824_0_1dd_Smed_v4PMID:29674431
neuronSMED30025325Neurogenic locus notch proteinSMESG000063217.1 dd_Smed_v4_7067_0_1dd_Smed_v4PMID:29674431
neuronSMED30021490E3 ubiquitin protein ligase-1SMESG000066165.1 SMESG000066158.1 dd_Smed_v4_9945_0_1dd_Smed_v4PMID:29674431
neuronSMED30021490E3 ubiquitin protein ligase-1SMESG000066165.1 SMESG000066158.1 dd_Smed_v4_9945_0_1dd_Smed_v4PMID:29674431
neuronSMED30022681Dynein heavy chain 7 axonemalSMESG000012956.1 dd_Smed_v4_13792_0_1dd_Smed_v4PMID:29674431
neuronSMED30022681Dynein heavy chain 7 axonemalSMESG000012956.1 dd_Smed_v4_5350_0_1dd_Smed_v4PMID:29674431
neuronSMED30022681Dynein heavy chain 7 axonemalSMESG000012956.1 dd_Smed_v4_5350_0_1dd_Smed_v4PMID:29674431
neuronSMED30028575Serine/threonine-protein phosphatase with EF-handsSMESG000042202.1 dd_Smed_v4_11874_0_1dd_Smed_v4PMID:29674431
neuronSMED30008276SMED30008276SMESG000050479.1 dd_Smed_v4_21937_0_1dd_Smed_v4PMID:29674431
neuronSMED30009144CCDC66 domain-containing proteinSMESG000019367.1 dd_Smed_v4_11800_0_1dd_Smed_v4PMID:29674431
neuronSMED30009144CCDC66 domain-containing proteinSMESG000019367.1 dd_Smed_v4_11800_0_1dd_Smed_v4PMID:29674431
neuronSMED30011381HORMA domain-containing proteinSMESG000066514.1 dd_Smed_v4_2201_0_1dd_Smed_v4PMID:29674431
neuronSMED30011381HORMA domain-containing proteinSMESG000066514.1 dd_Smed_v6_2201_0dd_Smed_v6PMID:29674432
neuronSMED30015061G protein regulated inducer of neurite outgrowthSMESG000062691.1 dd_Smed_v4_10294_0_1dd_Smed_v4PMID:29674431
neuronSMED30015061G protein regulated inducer of neurite outgrowthSMESG000062691.1 dd_Smed_v4_10294_0_1dd_Smed_v4PMID:29674431
neuronSMED30006476NEK8-2SMESG000043305.1 SMESG000043302.1 dd_Smed_v4_10144_0_1dd_Smed_v4PMID:29674431
neuronSMED30006476NEK8-2SMESG000043305.1 SMESG000043302.1 dd_Smed_v4_10144_0_1dd_Smed_v4PMID:29674431
neuronSMED30010203C2H2-type domain-containing proteinSMESG000067728.1 dd_Smed_v4_1455_0_1dd_Smed_v4PMID:29674431
neuronSMED30001570Cyclin-dependent kinase 17SMESG000078466.1 SMESG000050786.1 SMESG000050790.1 dd_Smed_v4_11772_0_1dd_Smed_v4PMID:29674431
neuronSMED30001441Lysine-specific demethylaseSMESG000063374.1 dd_Smed_v4_3334_0_1dd_Smed_v4PMID:29674431
neuronSMED30006336PIH1 domain-containing 2SMESG000077578.1 dd_Smed_v4_9306_0_1dd_Smed_v4PMID:29674431
neuronSMED30000370ANK_REP_REGION domain-containing proteinSMESG000013802.1 dd_Smed_v4_11317_0_1dd_Smed_v4PMID:29674431
neuronSMED30000370ANK_REP_REGION domain-containing proteinSMESG000013802.1 dd_Smed_v4_11317_0_1dd_Smed_v4PMID:29674431
neuronSMED30000370ANK_REP_REGION domain-containing proteinSMESG000013802.1 dd_Smed_v4_7813_0_1dd_Smed_v4PMID:29674431
neuronSMED30000370ANK_REP_REGION domain-containing proteinSMESG000013802.1 dd_Smed_v4_7813_0_1dd_Smed_v4PMID:29674431
neuronSMED30008651Guanylate cyclaseSMESG000019264.1 dd_Smed_v4_9453_0_1dd_Smed_v4PMID:29674431
neuronSMED30008651Guanylate cyclaseSMESG000019264.1 dd_Smed_v4_9453_0_1dd_Smed_v4PMID:29674431
neuronSMED30019485SMED30019485SMESG000075557.1 dd_Smed_v4_10583_0_1dd_Smed_v4PMID:29674431
neuronSMED30003084Cilia-and flagella-associated protein 45SMESG000016410.1 dd_Smed_v4_3732_0_1dd_Smed_v4PMID:29674431
neuronSMED30003084Cilia-and flagella-associated protein 45SMESG000016410.1 dd_Smed_v4_3732_0_1dd_Smed_v4PMID:29674431
neuronSMED30016779JmjC domain-containing proteinSMESG000053108.1 dd_Smed_v4_12267_0_1dd_Smed_v4PMID:29674431
neuronSMED30016779JmjC domain-containing proteinSMESG000053108.1 dd_Smed_v4_12267_0_1dd_Smed_v4PMID:29674431
neuronSMED30002523RSR1 proteinSMESG000049496.1 dd_Smed_v4_15091_0_1dd_Smed_v4PMID:29674431
neuronSMED30009064Protein glassSMESG000000679.1 Contig10162newmark_estsPMID:27612384
neuronSMED30009064Protein glassSMESG000000679.1 Contig10162uc_Smed_v2PMID:27612384
neuronSMED30005762Contactin/TAG-1 cell adhesion moleculeSMESG000036495.1 dd_Smed_v4_2673_0_1dd_Smed_v4PMID:29674431
neuronSMED30001148SMED30001148SMESG000041540.1 SMESG000041529.1 dd_Smed_v4_13075_0_1dd_Smed_v4PMID:29674431
neuronSMED30001622SMED30001622SMESG000040908.1 dd_Smed_v4_10356_0_1dd_Smed_v4PMID:29674431
neuronSMED30001622SMED30001622SMESG000040908.1 dd_Smed_v4_10356_0_1dd_Smed_v4PMID:29674431
neuronSMED30009905SMED30009905SMESG000000384.1 dd_Smed_v4_10941_0_1dd_Smed_v4PMID:29674431
neuronSMED30027409SMED30027409SMESG000008580.1 dd_Smed_v4_18478_0_1dd_Smed_v4PMID:29674431
neuronSMED30019471SynaptotagminSMESG000055143.1 dd_Smed_v4_6730_0_1dd_Smed_v4PMID:29674431
neuronSMED30019471SynaptotagminSMESG000055143.1 dd_Smed_v6_6730_0dd_Smed_v6PMID:29674432
neuronSMED30016015Cilia and flagella associated protein 157SMESG000020913.1 dd_Smed_v4_11523_0_1dd_Smed_v4PMID:29674431
neuronSMED30016015Cilia and flagella associated protein 157SMESG000020913.1 dd_Smed_v4_11523_0_1dd_Smed_v4PMID:29674431
neuronSMED30011094G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000007702.1 dd_Smed_v4_19671_0_1dd_Smed_v4PMID:29674431
neuronSMED30015008SMED30015008SMESG000001496.1 SMESG000001495.1 dd_Smed_v4_14943_0_1dd_Smed_v4PMID:29674431
neuronSMED30017160sertSMESG000021044.1 dd_Smed_v4_12700_0_1dd_Smed_v4PMID:29674431
neuronSMED30017160sertSMESG000021044.1 dd_Smed_v4_12700_0_1dd_Smed_v4PMID:29674431
neuronSMED30001680SMED30001680SMESG000002033.1 dd_Smed_v4_884_0_1dd_Smed_v4PMID:29674431
neuronSMED30001680SMED30001680SMESG000002033.1 dd_Smed_v4_884_0_1dd_Smed_v4PMID:29674431
neuronSMED30001680SMED30001680SMESG000002216.1 SMESG000002124.1 SMESG000002025.1 SMESG000002023.1 SMESG000002011.1 SMESG000002004.1 SMESG000002219.1 SMESG000002211.1 SMESG000002032.1 SMESG000002033.1 dd_Smed_v6_884_0dd_Smed_v6PMID:29674432
neuronSMED30004894SMED30004894SMESG000003469.1 dd_17258dd_Smed_v4PMID:29674431
neuronSMED30004894SMED30004894SMESG000003469.1 dd_17258dd_Smed_v4PMID:29674431
neuronSMED30015595InnexinSMESG000032206.1 dd_Smed_v4_3879_0_1dd_Smed_v4PMID:29674431
neuronSMED30015595InnexinSMESG000032206.1 dd_Smed_v4_3879_0_1dd_Smed_v4PMID:29674431
neuronSMED30018991ATP-dependent DNA helicaseSMESG000064966.1 dd_Smed_v4_7318_0_1dd_Smed_v4PMID:29674431
neuronSMED30018991ATP-dependent DNA helicaseSMESG000064966.1 dd_Smed_v4_7318_0_1dd_Smed_v4PMID:29674431
neuronSMED30012873DmX-like protein 2SMESG000062402.1 dd_Smed_v4_5944_0_1dd_Smed_v4PMID:29674431
neuronSMED30015584Nesprin-1SMESG000016745.1 dd_Smed_v4_23532_0_1dd_Smed_v4PMID:29674431
neuronSMED30015584Nesprin-1SMESG000016745.1 dd_Smed_v4_23532_0_1dd_Smed_v4PMID:29674431
neuronSMED30015584Nesprin-1SMESG000016745.1 dd_Smed_v4_16850_0_1dd_Smed_v4PMID:29674431
neuronSMED30015584Nesprin-1SMESG000016745.1 dd_Smed_v4_16850_0_1dd_Smed_v4PMID:29674431
neuronSMED30015584Nesprin-1SMESG000016745.1 dd_Smed_v4_34184_0_1dd_Smed_v4PMID:29674431
neuronSMED30015584Nesprin-1SMESG000016745.1 dd_Smed_v4_17767_0_1dd_Smed_v4PMID:29674431
neuronSMED30015584Nesprin-1SMESG000016745.1 dd_Smed_v4_17767_0_1dd_Smed_v4PMID:29674431
neuronSMED30015584Nesprin-1SMESG000016745.1 dd_Smed_v4_23535_0_1dd_Smed_v4PMID:29674431
neuronSMED30015584Nesprin-1SMESG000016745.1 dd_Smed_v4_23535_0_1dd_Smed_v4PMID:29674431
neuronSMED30015584Nesprin-1SMESG000016745.1 dd_Smed_v4_13561_0_1dd_Smed_v4PMID:29674431
neuronSMED30010001ATP-binding cassette sub-family A member 1SMESG000032896.1 SMESG000029537.1 SMESG000029534.1 dd_Smed_v4_2300_0_1dd_Smed_v4PMID:29674431
neuronSMED30010001ATP-binding cassette sub-family A member 1SMESG000032896.1 SMESG000029537.1 SMESG000029534.1 dd_Smed_v4_2300_0_1dd_Smed_v4PMID:29674431
neuronSMED30013552SMED30013552SMESG000020773.1 dd_Smed_v4_6775_0_1dd_Smed_v4PMID:29674431
neuronSMED30014979Protein bicaudal DSMESG000035031.1 dd_Smed_v4_758_0_1dd_Smed_v4PMID:29674431
neuronSMED30003680RanBP-type and C3HC4-type zinc finger-containing protein 1SMESG000004467.1 SMESG000004465.1 SMESG000069298.1 dd_Smed_v4_2819_0_1dd_Smed_v4PMID:29674431
neuronSMED30005093NPHP5SMESG000005436.1 dd_Smed_v4_11329_0_1dd_Smed_v4PMID:29674431
neuronSMED30018309Iroquois-class homeodomain protein IRX-4SMESG000061184.1 dd_Smed_v4_11500_0_1dd_Smed_v4PMID:29674431
neuronSMED30018309Iroquois-class homeodomain protein IRX-4SMESG000061184.1 dd_Smed_v4_11500_0_1dd_Smed_v4PMID:29674431
neuronSMED30002272SMED30002272SMESG000071928.1 dd_Smed_v4_36288_0_1dd_Smed_v4PMID:29674431
neuronSMED30003166slc4a-4SMESG000039045.1 dd_Smed_v4_12290_0_1dd_Smed_v4PMID:29674431
neuronSMED30001306SMED30001306SMESG000060566.1 SMESG000060556.1 dd_Smed_v4_4002_0_1dd_Smed_v4PMID:29674431
neuronSMED30008752Homeobox domain-containing proteinSMESG000016670.1 dd_Smed_v4_11150_0_1dd_Smed_v4PMID:29674431
neuronSMED30008752Homeobox domain-containing proteinSMESG000016670.1 dd_Smed_v4_11150_0_1dd_Smed_v4PMID:29674431
neuronSMED30001808Calcium-transporting ATPaseSMESG000056345.1 dd_Smed_v4_13223_0_1dd_Smed_v4PMID:29674431
neuronSMED30001808Calcium-transporting ATPaseSMESG000056345.1 dd_Smed_v4_9557_0_1dd_Smed_v4PMID:29674431
neuronSMED30002421Dynamin-type G domain-containing proteinSMESG000014746.1 dd_Smed_v4_3255_0_1dd_Smed_v4PMID:29674431
neuronSMED30002421Dynamin-type G domain-containing proteinSMESG000014746.1 dd_Smed_v4_3255_0_1dd_Smed_v4PMID:29674431
neuronSMED30007209serine/threonine-protein kinase DCLK1SMESG000078466.1 SMESG000050786.1 SMESG000050790.1 dd_Smed_v4_11772_0_1dd_Smed_v4PMID:29674431
neuronSMED30003345BTB domain-containing proteinSMESG000014239.1 dd_Smed_v4_12440_0_1dd_Smed_v4PMID:29674431
neuronSMED30019616Doublesex and mab 3 transcriptionSMESG000002896.1 dd_Smed_v4_14213_0_1dd_Smed_v4PMID:29674431
neuronSMED30001160SMED30001160SMESG000000384.1 dd_Smed_v4_10941_0_1dd_Smed_v4PMID:29674431
neuronSMED30009336PID domain-containing proteinSMESG000078082.1 dd_Smed_v4_12194_0_1dd_Smed_v4PMID:29674431
neuronSMED30013109Heterogeneous nuclear ribonucleoprotein QSMESG000071117.1 dd_Smed_v4_10996_0_1dd_Smed_v4PMID:29674431
neuronSMED30007157NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 9SMESG000055157.1 dd_Smed_v4_1186_0_1dd_Smed_v4PMID:29674431
neuronSMED30011604Long-chain-fatty-acid--CoA ligaseSMESG000081754.1 dd_Smed_v4_2153_0_1dd_Smed_v4PMID:29674431
neuronSMED30003117Calmodulin-regulated spectrin-associated protein 1SMESG000062885.1 dd_Smed_v4_13111_0_1dd_Smed_v4PMID:29674431
neuronSMED30013692Small HSP proteinSMESG000059879.1 SMESG000059868.1 SMESG000059853.1 dd_Smed_v4_1039_0_1dd_Smed_v4PMID:29674431
neuronSMED30019864Neur_chan_LBD domain-containing proteinSMESG000008589.1 dd_Smed_v4_10171_0_1dd_Smed_v4PMID:29674431
neuronSMED30018442PHB domain-containing proteinSMESG000026539.1 dd_Smed_v4_15992_0_1dd_Smed_v4PMID:29674431
neuronSMED30012522Ankyrin-2SMESG000026655.1 dd_Smed_v4_10835_0_1dd_Smed_v4PMID:29674431
neuronSMED30012522Ankyrin-2SMESG000026655.1 dd_Smed_v4_10835_0_1dd_Smed_v4PMID:29674431
neuronSMED30012522Ankyrin-2SMESG000026655.1 dd_Smed_v6_10835_0dd_Smed_v6PMID:29674432
neuronSMED30002634SCP domain-containing proteinSMESG000036363.1 dd_210dd_Smed_v4PMID:29674431
neuronSMED30002634SCP domain-containing proteinSMESG000036363.1 dd_210dd_Smed_v4PMID:29674431
neuronSMED30002634SCP domain-containing proteinSMESG000036363.1 dd_Smed_v4_210_0_1dd_Smed_v4PMID:29674431
neuronSMED30002634SCP domain-containing proteinSMESG000036363.1 dd_Smed_v4_210_1_1dd_Smed_v4PMID:29674431
neuronSMED30002092Sodium/potassium-transporting ATPase subunit betaSMESG000061673.1 dd_Smed_v4_2230_0_1dd_Smed_v4PMID:29674431
neuronSMED30006731BZIP domain-containing proteinSMESG000008447.1 SMESG000008431.1 dd_Smed_v4_5875_0_1dd_Smed_v4PMID:29674431
neuronSMED30006145slc18a-6SMESG000051356.1 dd_Smed_v4_11630_0_1dd_Smed_v4PMID:29674431
neuronSMED30006549SMED30006549SMESG000016886.1 SMESG000016875.1 dd_Smed_v4_7893_0_1dd_Smed_v4PMID:29674431
neuronSMED30006425Phosphatidylinositol 5-phosphate 4-kinase type-2 betaSMESG000044519.1 dd_Smed_v4_3905_0_1dd_Smed_v4PMID:29674431
neuronSMED30010144SMED30010144SMESG000038665.1 dd_Smed_v4_6969_0_1dd_Smed_v4PMID:29674431
neuronSMED30013870SMED30013870SMESG000014746.1 dd_Smed_v4_3255_0_1dd_Smed_v4PMID:29674431
neuronSMED30013870SMED30013870SMESG000014746.1 dd_Smed_v4_3255_0_1dd_Smed_v4PMID:29674431
neuronSMED30014848Dynein light chainSMESG000043518.1 dd_Smed_v4_5284_0_1dd_Smed_v4PMID:29674431
neuronSMED30014848Dynein light chainSMESG000043518.1 dd_Smed_v4_5284_0_1dd_Smed_v4PMID:29674431
neuronSMED30007517IQ domain-containing protein E-likeSMESG000013899.1 SMESG000013896.1 dd_Smed_v4_7345_0_1dd_Smed_v4PMID:29674431
neuronSMED30007517IQ domain-containing protein E-likeSMESG000013899.1 SMESG000013896.1 dd_Smed_v4_7345_0_1dd_Smed_v4PMID:29674431
neuronSMED30011566Exonuclease 3'-5' domain-containing protein 1SMESG000028883.1 dd_Smed_v4_7434_0_1dd_Smed_v4PMID:29674431
neuronSMED30008926ATP-dependent DNA helicaseSMESG000023939.1 dd_Smed_v4_6024_0_1dd_Smed_v4PMID:29674431
neuronSMED30013731CentrinSMESG000040368.1 dd_Smed_v4_7903_0_1dd_Smed_v4PMID:29674431
neuronSMED30013731CentrinSMESG000040368.1 dd_Smed_v4_7903_0_1dd_Smed_v4PMID:29674431
neuronSMED30009700Dynein light chain roadblockSMESG000061103.1 dd_Smed_v4_7991_0_1dd_Smed_v4PMID:29674431
neuronSMED30011187SMED30011187SMESG000048845.1 SMESG000032557.1 dd_Smed_v4_9377_0_1dd_Smed_v4PMID:29674431
neuronSMED30008236SMED30008236SMESG000076267.1 dd_28015dd_Smed_v4PMID:29674431
neuronSMED30008236SMED30008236SMESG000076267.1 dd_28015dd_Smed_v4PMID:29674431
neuronSMED30016249SMED30016249SMESG000080837.1 dd_Smed_v4_3291_0_1dd_Smed_v4PMID:29674431
neuronSMED30012510Early growth response protein 1SMESG000005384.1 dd_Smed_v4_7091_0_1dd_Smed_v4PMID:29674431
neuronSMED30008957MeckelinSMESG000043913.1 dd_Smed_v4_7765_0_1dd_Smed_v4PMID:29674431
neuronSMED30012945Ubiquitin family member proteinSMESG000071059.1 SMESG000071050.1 dd_Smed_v4_4930_0_1dd_Smed_v4PMID:29674431
neuronSMED30011060SMED30011060SMESG000018625.1 dd_Smed_v4_7135_0_1dd_Smed_v4PMID:29674431
neuronSMED30016899Transcription factor ETV6SMESG000035130.1 dd_Smed_v4_5087_0_1dd_Smed_v4PMID:29674431
neuronSMED30013795FSA_C domain-containing proteinSMESG000033549.1 dd_Smed_v4_4377_0_1dd_Smed_v4PMID:29674431
neuronSMED30011922Tubulin-specific chaperone cofactor E-like proteinSMESG000068159.1 dd_Smed_v4_5186_0_1dd_Smed_v4PMID:29674431
neuronSMED30029661G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000029598.1 dd_Smed_v4_13372_0_1dd_Smed_v4PMID:29674431
neuronSMED30034281CCHC-type domain-containing proteinSMESG000007086.1 dd_Smed_v4_15530_0_1dd_Smed_v4PMID:29674431
neuronSMED30034281CCHC-type domain-containing proteinSMESG000007086.1 dd_Smed_v4_15530_0_1dd_Smed_v4PMID:29674431
neuronSMED30030895Inositol polyphosphate 5-phosphataseSMESG000008580.1 dd_Smed_v4_18478_0_1dd_Smed_v4PMID:29674431
neuronSMED30029539Protocadherin Fat 4SMESG000002878.1 dd_Smed_v4_12707_0_1dd_Smed_v4PMID:29674431
neuronSMED30034870SMED30034870SMESG000047469.1 dd_Smed_v4_16220_0_1dd_Smed_v4PMID:29674431
neuronSMED30034870SMED30034870SMESG000047469.1 dd_Smed_v4_16220_0_1dd_Smed_v4PMID:29674431
neuronSMED30034870SMED30034870SMESG000047469.1 dd_Smed_v6_16220_0_1dd_Smed_v6PMID:30399335
neuronSMED30033432Amiloride-sensitive sodium channelSMESG000000681.1 dd_Smed_v4_16546_0_1dd_Smed_v4PMID:29674431
neuronSMED30033098WD repeat-containing protein 97 isoform X2SMESG000010382.1 dd_Smed_v4_11828_0_1dd_Smed_v4PMID:29674431
neuronSMED30035314SMED30035314SMESG000020883.1 dd_Smed_v4_11620_0_1dd_Smed_v4PMID:29674431
neuronSMED30035314SMED30035314SMESG000020883.1 dd_Smed_v4_11620_0_1dd_Smed_v4PMID:29674431
neuronSMED30032108ProtocadherinSMESG000033639.1 dd_Smed_v4_12429_0_1dd_Smed_v4PMID:29674431
neuronSMED30032108ProtocadherinSMESG000033639.1 dd_Smed_v4_12429_0_1dd_Smed_v4PMID:29674431
neuronSMED30030459SMED30030459SMESG000041220.1 dd_Smed_v4_14151_0_1dd_Smed_v4PMID:29674431
neuronSMED30014430ProtocadherinSMESG000027424.1 dd_Smed_v4_11605_0_1dd_Smed_v4PMID:29674431
neuronSMED30003902Tetratricopeptide repeat protein 21BSMESG000011579.1 dd_Smed_v4_12056_0_1dd_Smed_v4PMID:29674431
neuronSMED30014354SMED30014354SMESG000077057.1 dd_Smed_v4_10013_0_1dd_Smed_v4PMID:29674431
neuronSMED30001010SMED30001010SMESG000039006.1 dd_Smed_v4_13470_0_1dd_Smed_v4PMID:29674431
neuronSMED30001010SMED30001010SMESG000039006.1 dd_Smed_v4_13470_0_1dd_Smed_v4PMID:29674431
neuronSMED30005845NPHS1-6SMESG000028689.1 dd_Smed_v4_10689_0_1dd_Smed_v4PMID:29674431
neuronSMED30005845NPHS1-6SMESG000028689.1 dd_Smed_v4_10689_0_1dd_Smed_v4PMID:29674431
neuronSMED30006112Calcium activated potassium channel subunitSMESG000053268.1 dd_Smed_v4_12880_0_1dd_Smed_v4PMID:29674431
neuronSMED30010781KH domain-containing proteinSMESG000068399.1 dd_Smed_v4_13063_0_1dd_Smed_v4PMID:29674431
neuronSMED30010781KH domain-containing proteinSMESG000068399.1 dd_Smed_v4_13063_0_1dd_Smed_v4PMID:29674431
neuronSMED30005182ptf-4 proteinSMESG000079648.1 dd_Smed_v4_13704_0_1dd_Smed_v4PMID:29674431
neuronSMED30009115Polypyrimidine tract-binding protein 1SMESG000033951.1 dd_Smed_v4_14748_0_1dd_Smed_v4PMID:29674431
neuronSMED30010372SMED30010372SMESG000079705.1 dd_Smed_v4_12668_0_1dd_Smed_v4PMID:29674431
neuronSMED30007592SMED30007592SMESG000075491.1 dd_Smed_v4_11446_0_1dd_Smed_v4PMID:29674431
neuronSMED30007456Protein CBG04106SMESG000073042.1 dd_Smed_v4_13178_0_1dd_Smed_v4PMID:29674431
neuronSMED30014813Y box protein-1SMESG000058013.1 dd_Smed_v4_35_0_1dd_Smed_v4PMID:29674431
neuronSMED30003563Neur_chan_LBD domain-containing proteinSMESG000041914.1 dd_Smed_v6_14474_0_1dd_Smed_v6PMID:30399335
neuronSMED30006743SMED30006743SMESG000040007.1 SMESG000039999.1 dd_Smed_v4_7457_0_1dd_Smed_v4PMID:29674431
neuronSMED30006743SMED30006743SMESG000040007.1 SMESG000039999.1 dd_Smed_v4_7457_0_1dd_Smed_v4PMID:29674431
neuronSMED30004532Y box protein-1SMESG000058013.1 dd_Smed_v4_35_0_1dd_Smed_v4PMID:29674431
neuronSMED30004547Protein FAM149ASMESG000009635.1 dd_Smed_v6_13092_0_1dd_Smed_v6PMID:30399335
neuronSMED30001003Glutamate decarboxylase 1SMESG000050934.1 SMESG000050924.1 dd_Smed_v4_12653_0_1dd_Smed_v4PMID:29674431
neuronSMED30001003Glutamate decarboxylase 1SMESG000050934.1 SMESG000050924.1 dd_Smed_v4_12653_0_1dd_Smed_v4PMID:29674431
neuronSMED30001230Meiotic recombination protein rec8SMESG000041612.1 dd_Smed_v4_15392_0_1dd_Smed_v4PMID:29674431
neuronSMED30008636SMED30008636SMESG000016848.1 dd_Smed_v4_14631_0_1dd_Smed_v4PMID:29674431
neuronSMED30014534SMED30014534SMESG000047985.1 SMESG000035720.1 SMESG000035719.1 dd_Smed_v4_14062_0_1dd_Smed_v4PMID:29674431
neuronSMED30014534SMED30014534SMESG000047985.1 SMESG000035720.1 SMESG000035719.1 dd_Smed_v4_14062_0_1dd_Smed_v4PMID:29674431
neuronSMED30002162Glycosyl transferaseSMESG000030921.1 dd_Smed_v4_11247_0_1dd_Smed_v4PMID:29674431
neuronSMED30009534slc40a-1SMESG000016854.1 dd_Smed_v4_9732_0_1dd_Smed_v4PMID:29674431
neuronSMED30000004ThioredoxinSMESG000039109.1 dd_Smed_v4_12784_0_1dd_Smed_v4PMID:29674431
neuronSMED30033738SMED30033738SMESG000073869.1 dd_Smed_v4_760_0_1dd_Smed_v4PMID:29674431
neuronSMED30035761GMP_PDE_delta domain-containing proteinSMESG000064785.1 dd_Smed_v4_4791_0_1dd_Smed_v4PMID:29674431
neuronSMED30035761GMP_PDE_delta domain-containing proteinSMESG000064785.1 dd_Smed_v4_4791_0_1dd_Smed_v4PMID:29674431
neuronSMED30034425SMED30034425SMESG000022730.1 dd_Smed_v4_8514_0_1dd_Smed_v4PMID:29674431
neuronSMED30025604Sortilin-related receptorSMESG000043036.1 SMESG000043031.1 SMESG000040338.1 SMESG000040332.1 dd_Smed_v4_8864_0_1dd_Smed_v4PMID:29674431
neuronSMED30024921Histone-lysine N-methyltransferase 2CSMESG000040592.1 dd_Smed_v4_5165_0_1dd_Smed_v4PMID:29674431
neuronSMED30030289Actin-1SMESG000066035.1 SMESG000066029.1 SMESG000066027.1 SMESG000066020.1 dd_Smed_v4_90_0_1dd_Smed_v4PMID:29674431
neuronSMED30029416Tetraspanning orphan receptorSMESG000041187.1 dd_Smed_v4_4535_0_1dd_Smed_v4PMID:29674431
neuronSMED30028157FMRFamide-activated amiloride-sensitive sodium channelSMESG000081715.1 dd_Smed_v4_39659_0_1dd_Smed_v4PMID:29674431
neuronSMED30021446TNF receptor associated factor-2SMESG000049696.1 SMESG000049688.1 SMESG000049683.1 SMESG000049676.1 SMESG000049663.1 SMESG000049649.1 SMESG000049621.1 SMESG000049614.1 SMESG000049603.1 SMESG000049567.1 SMESG000049545.1 SMESG000049503.1 dd_Smed_v4_3528_0_1dd_Smed_v4PMID:29674431
neuronSMED30030594OpsinSMESG000074489.1 dd_Smed_v4_15036_0_1dd_Smed_v4PMID:29674431
neuronSMED30030594OpsinSMESG000074489.1 dd_Smed_v4_15036_0_1dd_Smed_v4PMID:29674431
neuronSMED30035517SMED30035517SMESG000023186.1 dd_Smed_v4_5809_0_1dd_Smed_v4PMID:29674431
neuronSMED30027110TNF receptor-associated factorSMESG000070236.1 SMESG000070235.1 dd_Smed_v4_7291_0_1dd_Smed_v4PMID:29674431
neuronSMED30035183Chromosome 8 open reading frame 37SMESG000035388.1 dd_Smed_v4_8015_0_1dd_Smed_v4PMID:29674431
neuronSMED30034380SMED30034380SMESG000020144.1 dd_Smed_v4_677_0_1dd_Smed_v4PMID:29674431
neuronSMED30027272CREB-binding proteinSMESG000060474.1 dd_Smed_v4_6340_0_1dd_Smed_v4PMID:29674431
neuronSMED30028110SMED30028110SMESG000005260.1 dd_Smed_v4_8686_0_1dd_Smed_v4PMID:29674431
neuronSMED30030725Myotubularin-related proteinSMESG000069357.1 dd_Smed_v4_5033_0_1dd_Smed_v4PMID:29674431
neuronSMED30034139Receptor-type tyrosine-protein phosphatase betaSMESG000005260.1 dd_Smed_v4_8686_0_1dd_Smed_v4PMID:29674431
neuronSMED30032885Echinoderm microtubule-associated protein-like 4SMESG000021391.1 dd_Smed_v4_958_0_1dd_Smed_v4PMID:29674431
neuronSMED30032885Echinoderm microtubule-associated protein-like 4SMESG000021391.1 dd_Smed_v4_958_0_1dd_Smed_v4PMID:29674431
neuronSMED30035091SMED30035091SMESG000058994.1 dd_Smed_v4_586_0_1dd_Smed_v4PMID:29674431
neuronSMED30035091SMED30035091SMESG000058994.1 dd_586dd_Smed_v4PMID:29674431
neuronSMED30035091SMED30035091SMESG000058994.1 dd_586dd_Smed_v4PMID:29674431
neuronSMED30029818SMED30029818SMESG000079201.1 SMESG000079199.1 SMESG000079185.1 SMESG000079182.1 SMESG000042896.1 SMESG000042895.1 SMESG000042893.1 SMESG000042870.1 SMESG000042866.1 dd_Smed_v4_5650_0_1dd_Smed_v4PMID:29674431
neuronSMED30020634SMED30020634SMESG000081436.1 dd_Smed_v4_9784_0_1dd_Smed_v4PMID:29674431
neuronSMED30023612SMED30023612SMESG000022730.1 dd_Smed_v4_8514_0_1dd_Smed_v4PMID:29674431
neuronSMED30024243Peptidase S1 domain-containing proteinSMESG000077235.1 dd_Smed_v4_3075_0_1dd_Smed_v4PMID:29674431
neuronSMED30025685Mitogen-activated protein kinase kinase kinaseSMESG000026382.1 dd_Smed_v4_8838_0_1dd_Smed_v4PMID:29674431
neuronSMED30020478negative regulator of reactive oxygen species-likeSMESG000080200.1 dd_Smed_v4_9875_0_1dd_Smed_v4PMID:29674431
neuronSMED30031199Beta-arrestinSMESG000006894.1 dd_Smed_v4_19631_0_1dd_Smed_v4PMID:29674431
neuronSMED30025888TNF receptor associated factor-2SMESG000049696.1 SMESG000049688.1 SMESG000049683.1 SMESG000049676.1 SMESG000049663.1 SMESG000049649.1 SMESG000049621.1 SMESG000049614.1 SMESG000049603.1 SMESG000049567.1 SMESG000049545.1 SMESG000049503.1 dd_Smed_v4_3528_0_1dd_Smed_v4PMID:29674431
neuronSMED30021030slc25a-7SMESG000074820.1 dd_Smed_v4_8013_0_1dd_Smed_v4PMID:29674431
neuronSMED30022407Transient receptor potential cation channel subfamily A member 1SMESG000070631.1 dd_Smed_v4_41539_0_1dd_Smed_v4PMID:29674431
neuronSMED30022407Transient receptor potential cation channel subfamily A member 1SMESG000070631.1 dd_Smed_v4_33748_0_1dd_Smed_v4PMID:29674431
neuronSMED30026746SMED30026746SMESG000061917.1 dd_Smed_v4_588_0_1dd_Smed_v4PMID:29674431
neuronSMED30001515AnnexinSMESG000042839.1 dd_Smed_v4_1104_0_1dd_Smed_v4PMID:29674431
neuronSMED30001515AnnexinSMESG000042839.1 dd_Smed_v4_1104_0_1dd_Smed_v4PMID:29674431
neuronSMED30004380SMED30004380SMESG000007103.1 dd_Smed_v4_10719_0_1dd_Smed_v4PMID:29674431
neuronSMED30014608Peptidase M60 domain-containing proteinSMESG000026283.1 dd_Smed_v4_11830_0_1dd_Smed_v4PMID:29674431
neuronSMED30003347coiled-coil domain-containing protein 28BSMESG000006046.1 dd_Smed_v4_3111_0_1dd_Smed_v4PMID:29674431
neuronSMED30010632E3 ubiquitin-protein ligase RGLG4SMESG000076482.1 SMESG000076409.1 SMESG000076405.1 SMESG000076390.1 SMESG000076375.1 SMESG000076364.1 SMESG000076223.1 SMESG000040665.1 SMESG000019753.1 dd_Smed_v4_1097_0_1dd_Smed_v4PMID:29674431
neuronSMED30012788SMED30012788SMESG000022780.1 dd_Smed_v4_1598_0_1dd_Smed_v4PMID:29674431
neuronSMED30004697centrosomal protein of 70 kDa-like isoform X4SMESG000052033.1 dd_Smed_v4_14545_0_1dd_Smed_v4PMID:29674431
neuronSMED30017193Protocadherin 1SMESG000010555.1 dd_Smed_v4_12697_0_1dd_Smed_v4PMID:29674431
neuronSMED30002477Nucleosome-remodeling factor subunit BPTFSMESG000013525.1 dd_Smed_v4_8604_0_1dd_Smed_v4PMID:29674431
neuronSMED30002477Nucleosome-remodeling factor subunit BPTFSMESG000013525.1 dd_Smed_v4_10311_0_1dd_Smed_v4PMID:29674431
neuronSMED30019396LsmAD domain-containing proteinSMESG000036673.1 dd_Smed_v4_11128_0_1dd_Smed_v4PMID:29674431
neuronSMED30019184Protein NDRG3SMESG000005138.1 SMESG000005122.1 dd_Smed_v4_1911_0_1dd_Smed_v4PMID:29674431
neuronSMED30018893Enkurin domain-containing proteinSMESG000081414.1 dd_Smed_v4_12339_0_1dd_Smed_v4PMID:29674431
neuronSMED30015672Gelsolin-like proteinSMESG000015928.1 dd_Smed_v4_1215_0_1dd_Smed_v4PMID:29674431
neuronSMED30015672Gelsolin-like proteinSMESG000015928.1 dd_Smed_v4_1215_0_1dd_Smed_v4PMID:29674431
neuronSMED30002324SMED30002324SMESG000020128.1 dd_Smed_v4_12353_0_1dd_Smed_v4PMID:29674431
neuronSMED30001185Transmembrane protein 231SMESG000032658.1 dd_Smed_v4_16131_0_1dd_Smed_v4PMID:29674431
neuronSMED30008325Fatty acid synthaseSMESG000020850.1 dd_Smed_v4_10967_0_1dd_Smed_v4PMID:29674431
neuronSMED30008325Fatty acid synthaseSMESG000020850.1 dd_Smed_v4_10967_0_1dd_Smed_v4PMID:29674431
neuronSMED30004174Holocarboxylase synthetaseSMESG000020128.1 dd_Smed_v4_12353_0_1dd_Smed_v4PMID:29674431
neuronSMED30000184Nucleoside diphosphate kinaseSMESG000039529.1 dd_Smed_v4_3890_0_1dd_Smed_v4PMID:29674431
neuronSMED30004083Cellular communication network factor 4SMESG000036248.1 dd_Smed_v4_18465_0_1dd_Smed_v4PMID:29674431
neuronSMED30004083Cellular communication network factor 4SMESG000036248.1 dd_Smed_v4_18465_0_1dd_Smed_v4PMID:29674431
neuronSMED30012144NEPH-1SMESG000074081.1 dd_Smed_v4_11554_0_1dd_Smed_v4PMID:29674431
neuronSMED30004467Tyrosine phosphatase domain-containing protein 1SMESG000055316.1 SMESG000054364.1 dd_Smed_v4_13749_0_1dd_Smed_v4PMID:29674431
neuronSMED30000514SMED30000514SMESG000036214.1 dd_Smed_v4_10854_0_1dd_Smed_v4PMID:29674431
neuronSMED30002570SMED30002570SMESG000066647.1 dd_Smed_v4_14925_0_1dd_Smed_v4PMID:29674431
neuronSMED30015014Coiled-coil domain containing 61SMESG000028768.1 dd_Smed_v4_14065_0_1dd_Smed_v4PMID:29674431
neuronSMED30003899SMP-LTD domain-containing proteinSMESG000022335.1 dd_Smed_v4_4286_0_1dd_Smed_v4PMID:29674431
neuronSMED30017315c-SKI_SMAD_bind domain-containing proteinSMESG000070642.1 dd_Smed_v4_19617_0_1dd_Smed_v4PMID:29674431
neuronSMED30011235SMED30011235SMESG000014788.1 SMESG000014786.1 dd_Smed_v4_11758_0_1dd_Smed_v4PMID:29674431
neuronSMED30019253Immunoglobulin superfamily member 10SMESG000044503.1 dd_Smed_v4_11299_0_1dd_Smed_v4PMID:29674431
neuronSMED30000705Serine/threonine-protein kinase OSR1SMESG000066296.1 dd_Smed_v4_1366_0_1dd_Smed_v4PMID:29674431
neuronSMED30000705Serine/threonine-protein kinase OSR1SMESG000066296.1 DN295577ncbi_smed_estsPMID:30399335
neuronSMED30019258Cytosolic carboxypeptidase 2SMESG000058240.1 dd_Smed_v4_13450_0_1dd_Smed_v4PMID:29674431
neuronSMED30014075SMED30014075SMESG000022780.1 dd_Smed_v4_1598_0_1dd_Smed_v4PMID:29674431
neuronSMED30018637Heat shock cognate 70 kDa proteinSMESG000040632.1 dd_Smed_v4_15_0_1dd_Smed_v4PMID:29674431
neuronSMED30011832Enkurin domain-containing proteinSMESG000081414.1 dd_Smed_v4_12339_0_1dd_Smed_v4PMID:29674431
neuronSMED30001357XendoU domain-containing proteinSMESG000008612.1 dd_Smed_v4_25168_0_1dd_Smed_v4PMID:29674431
neuronSMED30001357XendoU domain-containing proteinSMESG000008612.1 dd_Smed_v4_25168_0_1dd_Smed_v4PMID:29674431
neuronSMED30007055Dynein heavy chain axonemalSMESG000033128.1 dd_Smed_v4_19518_0_1dd_Smed_v4PMID:29674431
neuronSMED30007055Dynein heavy chain axonemalSMESG000033128.1 SMESG000065732.1 dd_Smed_v6_6941_0dd_Smed_v6PMID:29674432
neuronSMED30013416Reticulocalbin-1SMESG000067728.1 dd_Smed_v4_5235_0_7dd_Smed_v4PMID:29674431
neuronSMED30004574SMED30004574SMESG000004485.1 dd_Smed_v4_1440_0_1dd_Smed_v4PMID:29674431
neuronSMED30004574SMED30004574SMESG000004485.1 dd_Smed_v4_1440_0_1dd_Smed_v4PMID:29674431
neuronSMED30004574SMED30004574SMESG000004485.1 dd_Smed_v6_1440_0dd_Smed_v6PMID:29674432
neuronSMED30034292SMED30034292SMESG000076603.1 dd_Smed_v4_11476_0_1dd_Smed_v4PMID:29674431
neuronSMED30020571Tubulin monoglycylase TTLL3SMESG000062155.1 dd_Smed_v4_12717_0_1dd_Smed_v4PMID:29674431
neuronSMED30035923S-adenosylmethionine decarboxylase proenzymeSMESG000011356.1 dd_Smed_v4_1099_0_1dd_Smed_v4PMID:29674431
neuronSMED30022285tr5_12233SMESG000029156.1 dd_Smed_v4_13065_0_1dd_Smed_v4PMID:29674431
neuronSMED30023158Frizzled-4SMESG000037982.1 SMESG000037981.1 dd_Smed_v4_13356_0_1dd_Smed_v4PMID:29674431
neuronSMED30033121Phosphatidylinositol 3,4,5-trisphosphate 3-phosphatase TPTE2SMESG000060206.1 dd_Smed_v4_4925_0_1dd_Smed_v4PMID:29674431
neuronSMED30025688Protein tilB homologSMESG000058220.1 dd_Smed_v4_10124_0_1dd_Smed_v4PMID:29674431
neuronSMED30024117SMED30024117SMESG000013212.1 dd_Smed_v4_16870_0_1dd_Smed_v4PMID:29674431
neuronSMED30034893glypican-1SMESG000052359.1 dd_Smed_v4_4154_0_1dd_Smed_v4PMID:29674431
neuronSMED30025143SMED30025143SMESG000053420.1 SMESG000053412.1 SMESG000053409.1 dd_Smed_v4_3142_0_1dd_Smed_v4PMID:29674431
neuronSMED30023862SMED30023862SMESG000009332.1 SMESG000009320.1 dd_Smed_v4_1555_0_1dd_Smed_v4PMID:29674431
neuronSMED30034968LysM domain-containing proteinSMESG000014261.1 dd_Smed_v4_5399_0_1dd_Smed_v4PMID:29674431
neuronSMED30035436SMED30035436SMESG000022942.1 dd_Smed_v4_2773_0_1dd_Smed_v4PMID:29674431
neuronSMED30032122DRY_EERY domain-containing proteinSMESG000011188.1 dd_Smed_v4_3095_0_1dd_Smed_v4PMID:29674431
neuronSMED30030621Regulator of G-protein signaling, putativeSMESG000072045.1 dd_Smed_v4_5311_0_1dd_Smed_v4PMID:29674431
neuronSMED30030621Regulator of G-protein signaling, putativeSMESG000072045.1 dd_Smed_v4_5311_0_1dd_Smed_v4PMID:29674431
neuronSMED30027092SMED30027092SMESG000078236.1 SMESG000032651.1 dd_Smed_v4_4949_0_1dd_Smed_v4PMID:29674431
neuronSMED30027092SMED30027092SMESG000078236.1 SMESG000032651.1 dd_Smed_v4_4949_0_1dd_Smed_v4PMID:29674431
neuronSMED30020814SMED30020814SMESG000076482.1 SMESG000076409.1 SMESG000076405.1 SMESG000076390.1 SMESG000076375.1 SMESG000076364.1 SMESG000076223.1 SMESG000040665.1 SMESG000019753.1 dd_Smed_v4_1097_0_1dd_Smed_v4PMID:29674431
neuronSMED30026263Si:ch211-194c3.5SMESG000044256.1 dd_Smed_v4_10121_0_1dd_Smed_v4PMID:29674431
neuronSMED30030326SMED30030326SMESG000001071.1 SMESG000001061.1 SMESG000001060.1 dd_Smed_v4_9824_0_1dd_Smed_v4PMID:29674431
neuronSMED30030326SMED30030326SMESG000001071.1 SMESG000001061.1 SMESG000001060.1 dd_Smed_v4_9824_0_1dd_Smed_v4PMID:29674431
neuronSMED30023486Intraflagellar transport 74SMESG000074086.1 dd_Smed_v4_12702_0_1dd_Smed_v4PMID:29674431
neuronSMED30023486Intraflagellar transport 74SMESG000074086.1 dd_Smed_v4_12702_0_1dd_Smed_v4PMID:29674431
neuronSMED30030310SMED30030310SMESG000057201.1 dd_Smed_v4_1531_0_1dd_Smed_v4PMID:29674431
neuronSMED30030310SMED30030310SMESG000057201.1 dd_Smed_v4_1531_0_1dd_Smed_v4PMID:29674431
neuronSMED30022392PKD1L-1SMESG000067002.1 dd_Smed_v4_15525_0_1dd_Smed_v4PMID:29674431
neuronSMED30031722ANK_REP_REGION domain-containing proteinSMESG000022931.1 dd_Smed_v4_11187_0_1dd_Smed_v4PMID:29674431
neuronSMED30031722ANK_REP_REGION domain-containing proteinSMESG000022931.1 dd_Smed_v4_11187_0_1dd_Smed_v4PMID:29674431
neuronSMED300333781-acyl-sn-glycerol-3-phosphate acyltransferase deltaSMESG000046088.1 dd_Smed_v4_9745_0_1dd_Smed_v4PMID:29674431
neuronSMED30035226AnnexinSMESG000023108.1 dd_Smed_v4_5798_0_1dd_Smed_v4PMID:29674431
neuronSMED30035226AnnexinSMESG000023108.1 dd_Smed_v4_5798_0_1dd_Smed_v4PMID:29674431
neuronSMED30020981Protein NDRG3SMESG000005138.1 SMESG000005122.1 dd_Smed_v4_1911_0_1dd_Smed_v4PMID:29674431
neuronSMED30005209Ankyrin repeat domain 50SMESG000028414.1 dd_Smed_v4_12936_0_1dd_Smed_v4PMID:29674431
neuronSMED30001681SMED30001681SMESG000049443.1 dd_Smed_v4_1193_0_1dd_Smed_v4PMID:29674431
neuronSMED30001681SMED30001681SMESG000049443.1 dd_Smed_v4_1193_0_1dd_Smed_v4PMID:29674431
neuronSMED30013517TetraspaninSMESG000045911.1 dd_Smed_v4_15096_0_1dd_Smed_v4PMID:29674431
neuronSMED30003519SMED30003519SMESG000018116.1 dd_Smed_v4_8136_0_1dd_Smed_v4PMID:29674431
neuronSMED30009358slc16a-3SMESG000011418.1 dd_Smed_v4_16616_0_1dd_Smed_v4PMID:29674431
neuronSMED30010258Synaptosomal-associated proteinSMESG000005619.1 dd_Smed_v4_13255_0_1dd_Smed_v4PMID:29674431
neuronSMED30012553SMED30012553SMESG000067029.1 dd_Smed_v4_15528_0_1dd_Smed_v4PMID:29674431
neuronSMED30012553SMED30012553SMESG000067029.1 dd_Smed_v4_15528_0_1dd_Smed_v4PMID:29674431
neuronSMED30002203SMED30002203SMESG000073490.1 dd_Smed_v4_8612_0_1dd_Smed_v4PMID:29674431
neuronSMED30012574Carboxyl-terminal PDZ ligand of neuronal nitric oxide synthase proteinSMESG000071224.1 dd_Smed_v4_13377_0_1dd_Smed_v4PMID:29674431
neuronSMED30012574Carboxyl-terminal PDZ ligand of neuronal nitric oxide synthase proteinSMESG000071224.1 dd_Smed_v4_13377_0_1dd_Smed_v4PMID:29674431
neuronSMED30013779Tubulin monoglycylase TTLL3SMESG000029205.1 dd_Smed_v4_10244_0_1dd_Smed_v4PMID:29674431
neuronSMED30018266Phosphatidylinositol-binding clathrin assembly proteinSMESG000020797.1 dd_Smed_v4_6650_0_1dd_Smed_v4PMID:29674431
neuronSMED30018266Phosphatidylinositol-binding clathrin assembly proteinSMESG000020797.1 dd_Smed_v4_6650_0_1dd_Smed_v4PMID:29674431
neuronSMED30017949slc7a-6SMESG000051755.1 dd_Smed_v4_7207_0_1dd_Smed_v4PMID:29674431
neuronSMED30017949slc7a-6SMESG000051755.1 dd_Smed_v4_7207_0_1dd_Smed_v4PMID:29674431
neuronSMED30011875CTF/NF-I domain-containing proteinSMESG000028598.1 dd_Smed_v4_12312_0_1dd_Smed_v4PMID:29674431
neuronSMED30013414Lysine-specific demethylase 6ASMESG000068495.1 dd_Smed_v4_12576_0_1dd_Smed_v4PMID:29674431
neuronSMED30019139CalmodulinSMESG000010244.1 dd_Smed_v4_10239_0_1dd_Smed_v4PMID:29674431
neuronSMED30018972ANK_REP_REGION domain-containing proteinSMESG000022931.1 dd_Smed_v4_11187_0_1dd_Smed_v4PMID:29674431
neuronSMED30018972ANK_REP_REGION domain-containing proteinSMESG000022931.1 dd_Smed_v4_11187_0_1dd_Smed_v4PMID:29674431
neuronSMED30005028SMED30005028SMESG000017098.1 SMESG000014979.1 SMESG000014974.1 dd_Smed_v4_7198_0_1dd_Smed_v4PMID:29674431
neuronSMED30003414SMED30003414SMESG000022780.1 dd_Smed_v4_1598_0_1dd_Smed_v4PMID:29674431
neuronSMED30015183Leucine-rich repeat-containing protein 9SMESG000021671.1 dd_Smed_v4_14851_0_1dd_Smed_v4PMID:29674431
neuronSMED30019050InnexinSMESG000051126.1 dd_Smed_v4_13435_0_1dd_Smed_v4PMID:29674431
neuronSMED30002842SMED30002842SMESG000056914.1 dd_Smed_v4_8301_0_1dd_Smed_v4PMID:29674431
neuronSMED30000921RNA-binding protein Nova-1SMESG000066554.1 dd_Smed_v4_679_0_1dd_Smed_v4PMID:29674431
neuronSMED30002946PKD1L-1SMESG000067002.1 dd_Smed_v4_15525_0_1dd_Smed_v4PMID:29674431
neuronSMED30001810Protein NDRG3SMESG000005138.1 SMESG000005122.1 dd_Smed_v4_1911_0_1dd_Smed_v4PMID:29674431
neuronSMED30008553Phosphoenolpyruvate carboxykinase [GTP]SMESG000062868.1 dd_Smed_v4_196_0_1dd_Smed_v4PMID:29674431
neuronSMED30001860Deuterosome assembly protein 1SMESG000061463.1 dd_Smed_v4_13335_0_1dd_Smed_v4PMID:29674431
neuronSMED30024549Copine-3SMESG000029196.1 dd_Smed_v4_13873_0_1dd_Smed_v4PMID:29674431
neuronSMED30024549Copine-3SMESG000029196.1 dd_Smed_v4_13873_0_1dd_Smed_v4PMID:29674431
neuronSMED30025697SMED30025697SMESG000046246.1 SMESG000046206.1 dd_21981dd_Smed_v4PMID:29674431
neuronSMED30025697SMED30025697SMESG000046246.1 SMESG000046206.1 dd_21981dd_Smed_v4PMID:29674431
neuronSMED30023905Protein NDRG3SMESG000005138.1 SMESG000005122.1 dd_Smed_v4_1911_0_1dd_Smed_v4PMID:29674431
neuronSMED30026061SMED30026061SMESG000076482.1 SMESG000076409.1 SMESG000076405.1 SMESG000076390.1 SMESG000076375.1 SMESG000076364.1 SMESG000076223.1 SMESG000040665.1 SMESG000019753.1 dd_Smed_v4_1097_0_1dd_Smed_v4PMID:29674431
neuronSMED30034629Golgi-associated plant pathogenesis-related protein 1SMESG000063568.1 dd_Smed_v4_762_0_1dd_Smed_v4PMID:29674431
neuronSMED30034629Golgi-associated plant pathogenesis-related protein 1SMESG000063568.1 dd_Smed_v4_762_0_1dd_Smed_v4PMID:29674431
neuronSMED30026385GCR008SMESG000018302.1 dd_Smed_v4_22802_0_1dd_Smed_v4PMID:29674431
neuronSMED30029127Glutamate receptor ionotropicSMESG000022851.1 dd_Smed_v4_14655_0_1dd_Smed_v4PMID:29674431
neuronSMED30029127Glutamate receptor ionotropicSMESG000022851.1 dd_Smed_v4_14655_0_1dd_Smed_v4PMID:29674431
neuronSMED30021611ElavSMESG000006390.1 dd_Smed_v4_11311_0_1dd_Smed_v4PMID:29674431
neuronSMED30031487Outer membrane autotransporter barrel domain-containing proteinSMESG000019226.1 dd_Smed_v4_10493_0_1dd_Smed_v4PMID:29674431
neuronSMED30021209Mitogen-activated protein kinaseSMESG000075533.1 dd_Smed_v4_1282_0_1dd_Smed_v4PMID:29674431
neuronSMED30021971SMED30021971SMESG000001202.1 dd_Smed_v4_14508_0_1dd_Smed_v4PMID:29674431
neuronSMED30023858PPM-type phosphatase domain-containing proteinSMESG000022854.1 dd_Smed_v4_2275_0_1dd_Smed_v4PMID:29674431
neuronSMED30028994Protein kinase domain-containing proteinSMESG000033598.1 dd_Smed_v4_13819_0_1dd_Smed_v4PMID:29674431
neuronSMED30031035SMED30031035SMESG000069327.1 dd_Smed_v4_13889_0_1dd_Smed_v4PMID:29674431
neuronSMED30031035SMED30031035SMESG000069327.1 dd_Smed_v4_13889_0_1dd_Smed_v4PMID:29674431
neuronSMED30017286Major facilitator superfamily domain-containing 4SMESG000038006.1 dd_Smed_v4_10372_0_1dd_Smed_v4PMID:29674431
neuronSMED30017286Major facilitator superfamily domain-containing 4SMESG000038006.1 dd_Smed_v4_10372_0_1dd_Smed_v4PMID:29674431
neuronSMED30016238Kinesin-like proteinSMESG000071604.1 dd_Smed_v4_12639_0_1dd_Smed_v4PMID:29674431
neuronSMED30016238Kinesin-like proteinSMESG000071604.1 dd_Smed_v4_12639_0_1dd_Smed_v4PMID:29674431
neuronSMED30001980Protein phosphatase 1KSMESG000008048.1 dd_Smed_v4_3067_0_1dd_Smed_v4PMID:29674431
neuronSMED30000946Calpain-BSMESG000067761.1 dd_Smed_v4_4020_0_1dd_Smed_v4PMID:29674431
neuronSMED30000512cilia- and flagella-associated protein 61SMESG000059955.1 dd_Smed_v4_4908_0_1dd_Smed_v4PMID:29674431
neuronSMED30004541SMED30004541SMESG000056767.1 dd_Smed_v4_13044_0_1dd_Smed_v4PMID:29674431
neuronSMED30012272ZP domain-containing proteinSMESG000039966.1 dd_Smed_v4_13456_0_1dd_Smed_v4PMID:29674431
neuronSMED30018766Centrosomal protein of 120 kDaSMESG000006990.1 dd_Smed_v4_10444_0_1dd_Smed_v4PMID:29674431
neuronSMED30019915Potassium voltage-gated channel subfamily A member 2SMESG000013562.1 dd_Smed_v4_15133_0_1dd_Smed_v4PMID:29674431
neuronSMED30019915Potassium voltage-gated channel subfamily A member 2SMESG000013562.1 dd_Smed_v4_15133_0_1dd_Smed_v4PMID:29674431
neuronSMED30005692Cytoplasmic dynein 2 heavy chain 1SMESG000008384.1 SMESG000008382.1 dd_Smed_v4_9136_0_1dd_Smed_v4PMID:29674431
neuronSMED30005692Cytoplasmic dynein 2 heavy chain 1SMESG000008384.1 SMESG000008382.1 dd_Smed_v4_9136_0_1dd_Smed_v4PMID:29674431
neuronSMED30011203SMED30011203SMESG000001624.1 dd_Smed_v4_16376_0_1dd_Smed_v4PMID:29674431
neuronSMED30009279DystoninSMESG000043809.1 SMESG000043799.1 dd_Smed_v4_1205_0_1dd_Smed_v4PMID:29674431
neuronSMED30009279DystoninSMESG000043809.1 SMESG000043799.1 dd_Smed_v4_1205_0_1dd_Smed_v4PMID:29674431
neuronSMED30018812protein kinase C-binding protein NELL1-likeSMESG000066109.1 dd_Smed_v4_11653_0_1dd_Smed_v4PMID:29674431
neuronSMED30012743BHLH domain-containing proteinSMESG000052476.1 dd_Smed_v4_12011_0_1dd_Smed_v4PMID:29674431
neuronSMED30003001SMED30003001SMESG000014122.1 dd_Smed_v4_7128_0_1dd_Smed_v4PMID:29674431
neuronSMED30015120Tissue factor pathway inhibitor-1SMESG000038000.1 SMESG000037996.1 dd_Smed_v4_2116_0_2dd_Smed_v4PMID:29674431
neuronSMED30015973myosin-11SMESG000064787.1 dd_Smed_v4_13489_0_1dd_Smed_v4PMID:29674431
neuronSMED30002801insulin gene enhancer protein isl-1SMESG000059633.1 dd_Smed_v4_8820_0_1dd_Smed_v4PMID:29674431
neuronSMED30002801insulin gene enhancer protein isl-1SMESG000059633.1 dd_Smed_v4_8820_0_1dd_Smed_v4PMID:29674431
neuronSMED30002736DNA topoisomerase ISMESG000055403.1 dd_Smed_v4_2421_0_1dd_Smed_v4PMID:29674431
neuronSMED30016880Zinc finger Ran-binding domain-containing protein 2SMESG000017096.1 dd_Smed_v4_1397_0_1dd_Smed_v4PMID:29674431
neuronSMED30019802SMED30019802SMESG000017096.1 dd_Smed_v4_1397_0_1dd_Smed_v4PMID:29674431
neuronSMED30017214SMED30017214SMESG000068350.1 dd_Smed_v4_18752_0_1dd_Smed_v4PMID:29674431
neuronSMED30015422Pleckstrin homology domain containing, family H (with MyTH4 domain) member 1SMESG000058390.1 dd_Smed_v4_13619_0_1dd_Smed_v4PMID:29674431
neuronSMED30018823ATP-dependent 6-phosphofructokinaseSMESG000029088.1 dd_Smed_v4_1604_0_1dd_Smed_v4PMID:29674431
neuronSMED30004437Si:ch211-57i17.1SMESG000017011.1 dd_Smed_v4_6037_0_1dd_Smed_v4PMID:29674431
neuronSMED30004437Si:ch211-57i17.1SMESG000017011.1 dd_Smed_v4_6037_0_1dd_Smed_v4PMID:29674431
neuronSMED30019328Armadillo repeat-containing protein 2SMESG000077074.1 dd_Smed_v4_12684_0_1dd_Smed_v4PMID:29674431
neuronSMED30019328Armadillo repeat-containing protein 2SMESG000077074.1 dd_Smed_v4_12684_0_1dd_Smed_v4PMID:29674431
neuronSMED30004183TNF receptor-associated factorSMESG000006747.1 dd_Smed_v4_17551_0_1dd_Smed_v4PMID:29674431
neuronSMED30006684Calsyntenin-1-like proteinSMESG000057121.1 dd_Smed_v4_3122_0_1dd_Smed_v4PMID:29674431
neuronSMED30006684Calsyntenin-1-like proteinSMESG000057121.1 dd_Smed_v4_3122_0_1dd_Smed_v4PMID:29674431
neuronSMED30000740ets-1SMESG000033821.1 dd_Smed_v4_9185_0_1dd_Smed_v4PMID:29674431
neuronSMED30016667Outer dense fiber of sperm tails 3BSMESG000072745.1 dd_Smed_v4_20063_0_1dd_Smed_v4PMID:29674431
neuronSMED30001575EF-hand calcium-binding domain-containing protein 6SMESG000009107.1 dd_Smed_v6_7631_0_1dd_Smed_v6PMID:30399335
neuronSMED30001575EF-hand calcium-binding domain-containing protein 6SMESG000009107.1 dd_Smed_v4_7631_0_1dd_Smed_v4PMID:29674431
neuronSMED30002537Y box protein-1SMESG000058013.1 dd_Smed_v4_35_0_1dd_Smed_v4PMID:29674431
neuronSMED30015290Neur_chan_LBD domain-containing proteinSMESG000012532.1 dd_Smed_v4_13861_0_1dd_Smed_v4PMID:29674431
neuronSMED30015276SMED30015276SMESG000054104.1 SMESG000017493.1 SMESG000016095.1 SMESG000014571.1 dd_Smed_v4_3885_0_1dd_Smed_v4PMID:29674431
neuronSMED30015276SMED30015276SMESG000054104.1 SMESG000017493.1 SMESG000016095.1 SMESG000014571.1 dd_Smed_v4_3885_0_1dd_Smed_v4PMID:29674431
neuronSMED30014752SMED30014752SMESG000000113.1 dd_Smed_v4_6876_0_1dd_Smed_v4PMID:29674431
neuronSMED30016820Serine/threonine-protein kinase Nek4SMESG000005635.1 dd_Smed_v4_11387_0_1dd_Smed_v4PMID:29674431
neuronSMED30015197SMED30015197SMESG000000489.1 dd_Smed_v4_2712_3_1dd_Smed_v4PMID:29674431
neuronSMED30002663TNF receptor-associated factorSMESG000018404.1 dd_Smed_v4_4392_0_1dd_Smed_v4PMID:29674431
neuronSMED30005424PH domain-containing proteinSMESG000061841.1 dd_Smed_v4_6425_0_1dd_Smed_v4PMID:29674431
neuronSMED30005424PH domain-containing proteinSMESG000061841.1 dd_Smed_v4_6425_0_1dd_Smed_v4PMID:29674431
neuronSMED30016883SMED30016883SMESG000013684.1 dd_Smed_v4_14881_1_1dd_Smed_v4PMID:29674431
neuronSMED30019497SH3 domain-containing proteinSMESG000039140.1 dd_Smed_v4_11051_0_1dd_Smed_v4PMID:29674431
neuronSMED30019497SH3 domain-containing proteinSMESG000039140.1 dd_Smed_v4_11051_0_1dd_Smed_v4PMID:29674431
neuronSMED30019497SH3 domain-containing proteinSMESG000039140.1 dd_Smed_v6_11051_0dd_Smed_v6PMID:29674432
neuronSMED30002742DystoninSMESG000043809.1 SMESG000043799.1 dd_Smed_v4_1205_0_1dd_Smed_v4PMID:29674431
neuronSMED30002742DystoninSMESG000043809.1 SMESG000043799.1 dd_Smed_v4_1205_0_1dd_Smed_v4PMID:29674431
neuronSMED30017080FHA domain-containing proteinSMESG000061238.1 dd_Smed_v4_11335_0_1dd_Smed_v4PMID:29674431
neuronSMED30015148SMED30015148SMESG000022832.1 SMESG000022828.1 dd_Smed_v4_3053_0_1dd_Smed_v4PMID:29674431
neuronSMED30009787Laminin subunit alpha-2SMESG000056016.1 SMESG000056013.1 dd_Smed_v4_7924_0