neuron

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ In Situ Hybridization Data

  ▻ Sequences

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  neuron


DEFINITON:

  The basic cellular unit of nervous tissue. Each neuron consists of a body, an axon, and dendrites. Their purpose is to receive, conduct, and transmit impulses in the nervous system.


TERM DEFINITION CITATIONS:

  CL:0000540


TERM CITATIONS:


TERM ID:

  PLANA:0000099


ABOUT THIS TERM:

neuron

  ↳is a electrically signaling cell



Expand to see terms that part of neuron

  → synapse
  → synaptic cleft
  → synaptic vesicle
  → neurite


BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30022907SynaptotagminDj-sytStage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, ventral nerve cord, neuron, cephalic ganglia, nervous system, embryonic pharynx
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 ┬Ám

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30019471 ID=SMED30019471|Name=Synaptotagmin|organism=Schmidtea mediterranea sexual|type=transcript|length=1910bp
TTTGGGACTTCTCCAATCTATTAAATATATTTAGAACGAACATCGTTGTGAGAAGCTTTGTCTTGCAAATGCACACCAAC
ACATTCTCTGCCTACTCGAGACCAGCCTGAAGGACGCACCCAGTCATCTCTTATAAAAAAAAAACTCTTCTCTGATTCGG
TATTTTCTGATTAATGGAGATCAAACAATGATTGGGCAACGTCTAGTTTAGAATATTTACAACTAAATCTGCGTATTTCA
ATTTTTTTTCGATTTTGATTGTTGCAAATATTTATGAGTATATCCAATAATATAAGCAGCGCTAGTAATATGACGATAAA
AATGCAACAAAATGTTGAAAAGTCTGTATCACAGCATGTAACAGCGCAAACAAAGGAATCAACATCAAATAAACTTCATA
CAACAACAGCCGGTATCTCGGTTTTGGAGAAAACATTAAAAACATTTCACATGAGTACTGGCACTTTGATTGGAATCGGA
GTTACAGTGTCTATCGTAGTTTTATTACTTCTTTATTGTATTTGCAAACGATGCATTAAGAAACGAAAGAAAAAGAAAGA
TGGCGGCAAAAAAGGTGGAAAAGGCGTAGACATGAAAAGCGTACAACTATTAGGAAATGCTTATAAAGAAAAGGTACAGC
CGGACCTAGAAGAACTGGATGCTAACATGGAAGATAATGAAGGGGCGCAAGATAAAGAAGCAGTCAATCTTGGAAAATTA
CAGTATTCCCTTGATTACGATTTTACAAAAGGCGAGCTAACAGTCGGAGTAATTCAAGCCACAGATCTCCCAGCAATGGA
CATGTCAGGAACTTCTGATCCATATGTGAAAGTTTTTCTATTACCGGATAAAAAGAAAAAATTCGAAACCAAAGTTCATC
GAAAAATATTAAATCCAGTCTTTAATGAGACATTTGTATTCAAGATTCCTTATTCTGAGGTCGGGTCTAAAACTTTGGTA
TTTAATGTTTTCGATTTCGACAGATTTTCAAAGCATGATCAAATTGGGCAAATCCAAATTCCACTGGGTTCAGTAGATTT
ATGCAAAGTTATTGAGGAATGGAAGGAACTCGGCCCACCTGACAGTGATAATGAAAAGGAAAATCGATTAGGAGACATTT
GTTTTTCTTTGAGATATGTTCCAACGTCTGGAAAGTTGAATATCGTCATTCTGGAAGCTAAAAACCTCAAGAAAATGGAT
GTTGGAGGATTGTCGGATCCTTACGTGAAACTATCGTTGATGCTTAACGGCAAACGAGTGAAAAAGAAGAAAACCACAAT
AAAAAAATACACATTAAATCCTTATTATAATGAGTCATTTTCATTCGAAGTTCCATTCGAGCAAATACAAAAAGTTAATT
TAATAGTGACAGTAGTTGATTATGATAGAATTGGAACAAGTGAACCTATTGGAAGAGTAGTTCTTGGATGCAATGCTACA
GGAGCAGAACTTCGGCACTGGTCCGATATGCTTGCTAATCCTAGGAGACCAATTGCCCAGTGGCATACCCTTCAAGATAT
GCCGGAGAAGAGCTGATTTCATTGATTTTAATTTTAAAATCTGTCATATTTTGTGATAAATTTTGCGTATTTATACAATC
ATTCGATTCGATCTTTCCATCAAGTTTCGTAAAATCTGCAGACATTCACGAGGATGCAGAAGAAATAGAAACTTTGTAAT
AAATTAGCATTAGCTGTGATCTCCTATTGACCAAAAAACATAAACTTAATTTTTATAAAGAATTGTGGTGAAATGTTGTT
AGGTTTCAGTCATAGATAACTGTATTTGTGTAATAGTTTGTGTATTTCTCGTCCTGGCCCGATTTTGTGCATTCCACTGG
CAATACTATTTCACTAATAAATTATGTCTGATAATGTATACCAGTATAGGATTTTGTTTGAATTAATGAA
>SMED30022907 ID=SMED30022907|Name=Synaptotagmin|organism=Schmidtea mediterranea sexual|type=transcript|length=1814bp
ATTTATTGAAAATTATTTTTTCTATTATTAGGAGAAAATTGATTATTTTTTTTTGACAAAATAAGTTTTGGATATATTTC
CCATTTGTTTGTATTCGTAAACCAATGAAGAATTCGACTCACGGATCGGATCATTCGGCCAGCAAGGCCAGTATGAAAAC
GAATGTGGAAAAATTTTGGCATGATCTCGGAAAAAAATTGCACATGGATCCAAAAGCATTAATAGGAGTAACAATCGGTT
TGGGAATATTGTTTTTGTTGTTCCTTTATTGCTTATGTAAAAAATGTGTTTTCAAGCGTCGAAAAAAGAAGGAAACGGCC
AAAAAAGGAGCCAAGGGAGTAGTCGATATGAAAAGTGCCCAATTGTTGGGGAATTCATATAAAGAAAAAATTCAACCCGA
TCTTGAAGAACTTGATGCAAACATGGAAGACAATGAAGGTGTAAAAGAAAAAGAAGATGTTCATTTAGGAAAATTACAAT
ATTCTCTAGATTATGATTTTCAGAAAGGAGAATTAACTGTTGGAGTTATTCAAGCAACTGATCTTCCAGCTATGGATATG
TCAGGAACATCAGATCCATATGTCAAATTATACCTTCTCCCAGACAAGAAAAAGAAATTCGAAACAAAGGTTCATAGGAA
AATTTTAAATCCTGTATTCAATGAAACTTTTGTTTTCAAAGTTCCTTTCAATGAAGTTGCATCGAAGACTTTGATTTTCA
ACGTTTATGACTTTGACAGATTTTCCAAACACGATCAAATCGGTCAAATAAAAGTACCATTGGGAGCTATAGATTTAGGT
CGAGTTATTGAAGAATGGAAGGAACTGGAATCTCCAGAAAACGATGGGGAAAAGGAAAACAGGTTGGGAGACATTTGTTT
CTCTTTAAGATACGTACCGACATCTGGAAAGCTTACAATAGTCATTTTGGAAGCAAAGAATCTTAAAAAAATGGATGTCG
GAGGATTGTCTGATCCATATGTTAAACTTTCCTTGATGCTTAATGGTAAACGAGTGAAGAAGAAGAAAACTACCATCAAA
AAGTATACACTAAATCCTTACTACAATGAATCATTTTCCTTTGAAGTACCATTCGAACAAATACAAAAAGTGAACTTGAT
CGTCACGGTTGTTGATTATGACAGAATCGGAACCAGCGAACCGATAGGTAGAATTGTTCTGGGATGTAACGCAACTGGAG
CAGAATTGCGACATTGGTCGGATATGTTGGCAAATCCCCGGCGACCAATCGCCCAGTGGCATACCCTCCAAGAGATGCCA
GAGAACAATTGATAGTGTTCGTTTGATGCTTTAAAGCGGTTTGCATAATTCGTGAAATAAGTTATCAAAATTTGAGAAAT
GTTTTTTTTTCTGAAACAAAAATGGCATGAGACAATATACCAGAGTTCATTAGTGTGTGGTTTCGTTGAATATTTTGGTG
GTGTTGCATCTTATCGTTTGTCCTCTAATCTAATAATGTTTTATTCTTTATATAGCTGATTTATTCTCGAGCGAAACATT
TTTTATGTGTACCAAAATACTTATGTCATAGCCATTGTGATTAGTCTGTAAACTATTGCGTAATAGCCCCTCTCATTGGC
TTTTTTTAAGAGTAGTGAGTTGGAAAAAAAAATACAAAAATGACTTCAATTGTTAAACATTACTCATATTTTATCAGTAA
GTTAACTTGCATATTTGCAGTTAATTATGGCATTTTATCTCTAAATCTCTGAAGCATGGCCTCAAGTCTTTTGTTTGTTT
TAATGTAATTATGTCTAGATGAGAATATTAAAATACTTCGGTTTATATAAAAGA

 

back to top



PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in neuron. Click this link to learn more about PAGE.


PAGE Curations: 1745


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
neuronSMED30023059EF-hand calcium-binding domain-containing protein 6SMESG000052556.1 SMESG000052552.1 dd_Smed_v4_7065_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032897Signal recognition particle receptor subunit alphaSMESG000012673.1 dd_Smed_v4_1375_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026863SLIT-ROBO Rho GTPase activating proteinSMESG000028956.1 dd_Smed_v4_8708_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021652Ras association domain family member 7aSMESG000080298.1 dd_Smed_v4_3722_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030309SMED30030309SMESG000075212.1 SMESG000075211.1 SMESG000074910.1 SMESG000074908.1 SMESG000074907.1 dd_Smed_v4_1061_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020007Dystrobrevin betaSMESG000078318.1 dd_Smed_v4_12275_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025597SMED30025597SMESG000013105.1 dd_Smed_v4_9427_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029711SMED30029711SMESG000039803.1 dd_Smed_v4_3788_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031159Neuronal acetylcholine receptor subunit alpha-4SMESG000069967.1 dd_Smed_v4_6939_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30034827Histone-lysine N-methyltransferase SETMARSMESG000081574.1 SMESG000081529.1 SMESG000079557.1 SMESG000079250.1 SMESG000077556.1 SMESG000075496.1 SMESG000073961.1 SMESG000073618.1 SMESG000073174.1 SMESG000071859.1 SMESG000071198.1 SMESG000071073.1 SMESG000070153.1 SMESG000068262.1 SMESG000068028.1 SMESG000067334.1 SMESG000065567.1 SMESG000061192.1 SMESG000060952.1 SMESG000060260.1 SMESG000059623.1 SMESG000050492.1 SMESG000050479.1 SMESG000050299.1 SMESG000049776.1 SMESG000048159.1 SMESG000044971.1 SMESG000043973.1 SMESG000042620.1 SMESG000040932.1 SMESG000039792.1 SMESG000039741.1 SMESG000039356.1 SMESG000034716.1 SMESG000033763.1 SMESG000029286.1 SMESG000028614.1 SMESG000027381.1 SMESG000025022.1 SMESG000021522.1 SMESG000020398.1 SMESG000019968.1 SMESG000018320.1 SMESG000015216.1 SMESG000015117.1 SMESG000015102.1 SMESG000013389.1 SMESG000012534.1 SMESG000012464.1 SMESG000011278.1 SMESG000011147.1 SMESG000007021.1 SMESG000006554.1 SMESG000001897.1 SMESG000070487.1 SMESG000068881.1 SMESG000064552.1 SMESG000063831.1 SMESG000056926.1 SMESG000050300.1 SMESG000047318.1 SMESG000047014.1 SMESG000043279.1 SMESG000030931.1 SMESG000023641.1 SMESG000018675.1 SMESG000017256.1 SMESG000013665.1 SMESG000013089.1 SMESG000011196.1 SMESG000009621.1 SMESG000008519.1 SMESG000005066.1 dd_Smed_v4_129_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030980S-phase kinase-associated protein 1SMESG000054815.1 dd_Smed_v4_1337_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033309slc35f-3SMESG000077937.1 SMESG000077930.1 dd_Smed_v4_13553_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30034635Tubulin tyrosine ligase-like family, member 7SMESG000055128.1 dd_Smed_v4_13600_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033791cilia- and flagella-associated protein 161SMESG000028972.1 dd_Smed_v4_8229_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022796phosphatidylinositide phosphatase SAC2SMESG000079090.1 dd_Smed_v4_6584_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021910ASH1 like histone lysine methyltransferaseSMESG000051410.1 dd_Smed_v4_6521_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30024383Transmembrane protein 26SMESG000079787.1 dd_Smed_v4_15637_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025978SMED30025978SMESG000069967.1 dd_Smed_v4_6939_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032798SMED30032798SMESG000013320.1 SMESG000013316.1 dd_Smed_v4_9011_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035258transient receptor potential cation channel subfamily A member-1SMESG000035379.1 dd_Smed_v4_14207_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30028061Bicaudal D proteinSMESG000060877.1 dd_Smed_v4_7219_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021159phosphatidylinositide phosphatase SAC2SMESG000079090.1 dd_Smed_v4_6584_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035584Stabilizer of axonemal microtubules 2SMESG000009389.1 dd_Smed_v4_3695_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026115Potassium voltage-gated channel subfamily H member 7SMESG000000377.1 dd_Smed_v4_12978_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020209Synaptotagmin, putativeSMESG000021478.1 dd_Smed_v4_6920_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028343Cytosolic carboxypeptidase 2SMESG000006325.1 dd_Smed_v4_13454_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011798E3 ubiquitin-protein ligase MIB2SMESG000043477.1 SMESG000010549.1 SMESG000010347.1 SMESG000010327.1 dd_Smed_v4_593_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005554SMED30005554SMESG000016237.1 SMESG000033358.1 dd_Smed_v4_507_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005554SMED30005554SMESG000016237.1 SMESG000033358.1 dd_Smed_v4_507_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30009556Dynein axonemal light chain 1SMESG000053050.1 dd_Smed_v4_6302_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010503CEP135SMESG000077870.1 dd_Smed_v4_5218_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012459SMED30012459SMESG000003156.1 dd_Smed_v4_2446_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014980LaminSMESG000009886.1 dd_Smed_v4_850_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015332Ciliogenesis-associated TTC17-interacting proteinSMESG000009424.1 dd_Smed_v4_5952_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015650FGFR1 oncogene partnerSMESG000006505.1 dd_Smed_v4_5371_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012546Coiled-coil domain-containing protein 65SMESG000021331.1 dd_Smed_v4_6152_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014999P21 activated kinase-1SMESG000008326.1 dd_Smed_v4_5741_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005609SMED30005609SMESG000001793.1 dd_Smed_v4_9354_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014149Ras-related protein Rab-3SMESG000034019.1 dd_Smed_v4_5920_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005744FGFR1 oncogene partnerSMESG000006505.1 dd_Smed_v4_5371_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004319Coiled-coil domain containing 88CSMESG000066575.1 SMESG000066583.1 dd_Smed_v4_5291_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000316Interferon-induced GTP-binding protein Mx1SMESG000002219.1 SMESG000002216.1 SMESG000002004.1 dd_Smed_v4_3169_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006498Histone-lysine N-methyltransferase SETMARSMESG000075151.1 SMESG000074964.1 dd_Smed_v4_10186_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007276SMED30007276SMESG000014766.1 dd_Smed_v4_10073_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011134SMED30011134SMESG000063657.1 dd_Smed_v4_10132_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002754TPR_REGION domain-containing proteinSMESG000008310.1 dd_Smed_v4_11374_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008024NFX1-type zinc finger-containing protein 1-likeSMESG000034891.1 SMESG000034868.1 SMESG000034856.1 dd_Smed_v4_10633_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005448SMED30005448SMESG000009922.1 dd_Smed_v4_21965_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010012Neur_chan_LBD domain-containing proteinSMESG000064442.1 dd_21541dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30017565Ephrin type-B receptor 2SMESG000008191.1 dd_Smed_v4_16928_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005469slc17a-1SMESG000080078.1 SMESG000052932.1 dd_Smed_v4_10192_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004894SMED30004894SMESG000003469.1 dd_17258dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30010111TPA_inf: neuropeptide precursor-2SMESG000072719.1 dd_Smed_v4_1015_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30010111TPA_inf: neuropeptide precursor-2SMESG000072719.1 dd_Smed_v4_1015_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30011550Neuropeptide-18SMESG000034720.1 dd_Smed_v4_1117_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30018309Iroquois-class homeodomain protein IRX-4SMESG000061184.1 dd_Smed_v4_11500_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015584Nesprin-1SMESG000016745.1 dd_Smed_v4_23532_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015584Nesprin-1SMESG000016745.1 dd_Smed_v4_17767_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015584Nesprin-1SMESG000016745.1 dd_Smed_v4_16850_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015584Nesprin-1SMESG000016745.1 dd_Smed_v4_23535_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006383SMED30006383SMESG000008503.1 dd_15602dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30017079LRRCC1SMESG000016752.1 dd_Smed_v4_10086_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002828Interferon regulatory factor 2-binding protein 2SMESG000042710.1 dd_Smed_v4_18245_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017265Protocadherin gammaSMESG000046654.1 dd_Smed_v4_11223_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011421SMED30011421SMESG000034948.1 SMESG000034947.1 dd_Smed_v4_2008_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003546SMED30003546SMESG000072344.1 dd_Smed_v4_11255_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016078Actin, cytoplasmicSMESG000012332.1 SMESG000012317.1 dd_Smed_v4_285_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016078Actin, cytoplasmicSMESG000012332.1 SMESG000012317.1 SMESG000058954.1 dd_Smed_v4_246_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012483SMED30012483SMESG000044609.1 dd_Smed_v4_1665_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003540FAS-associated factor 2SMESG000048881.1 dd_Smed_v4_10511_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003177Bardet-Biedl syndrome 2 protein homologSMESG000075151.1 SMESG000074964.1 dd_Smed_v4_10186_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018972ANK_REP_REGION domain-containing proteinSMESG000022931.1 dd_Smed_v4_11187_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012238SMED30012238SMESG000044609.1 dd_Smed_v4_1665_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016654Intraflagellar transport protein 140SMESG000001316.1 dd_Smed_v4_11300_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000370ANK_REP_REGION domain-containing proteinSMESG000013802.1 dd_Smed_v4_11317_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000370ANK_REP_REGION domain-containing proteinSMESG000013802.1 dd_Smed_v4_7813_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009733PKD2-1SMESG000005014.1 dd_Smed_v4_12955_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001875Dynein light chain roadblockSMESG000072361.1 dd_Smed_v4_1126_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033073Dynein heavy chain axonemal-likeSMESG000039073.1 dd_Smed_v4_4176_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035468DNAHb-1SMESG000072114.1 SMESG000072113.1 SMESG000072112.1 dd_Smed_v4_3670_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033551PhosphotransferaseSMESG000043559.1 dd_Smed_v4_4327_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026237Coiled-coil and C2 domain containing 2ASMESG000048372.1 dd_Smed_v4_11189_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025697SMED30025697SMESG000046246.1 SMESG000046206.1 dd_21981dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30033019nou darake like-5SMESG000070953.1 dd_Smed_v4_5102_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031687TNF receptor-associated factorSMESG000014725.1 SMESG000014724.1 SMESG000014706.1 SMESG000014702.1 SMESG000014700.1 dd_Smed_v4_4420_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033008SMED30033008SMESG000079331.1 dd_8120dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED3003573414-3-3 protein epsilonSMESG000075252.1 dd_Smed_v4_1702_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035526SMED30035526SMESG000018598.1 dd_Smed_v4_716_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023622SMED30023622SMESG000044609.1 dd_Smed_v4_1665_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30027021RUN domain-containing proteinSMESG000080383.1 dd_Smed_v4_10989_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031980Neuropeptide-18SMESG000034720.1 dd_Smed_v4_1117_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30023347Kinesin motor domain-containing proteinSMESG000069689.1 dd_Smed_v4_10482_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021707SMED30021707SMESG000063964.1 dd_Smed_v4_11231_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023704SMED30023704SMESG000044609.1 dd_Smed_v4_1665_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033487cilia- and flagella-associated protein 70SMESG000009189.1 dd_Smed_v4_10893_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031662Acetylcholine receptor subunit alpha-likeSMESG000063816.1 SMESG000010536.1 SMESG000045280.1 SMESG000029730.1 dd_Smed_v4_4145_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030286Tctex1 domain containing 2SMESG000027829.1 dd_Smed_v4_7666_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30034761SMP-LTD domain-containing proteinSMESG000034948.1 SMESG000034947.1 dd_Smed_v4_2008_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029026Multidrug resistance-associated protein 1SMESG000014785.1 dd_Smed_v4_3077_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028681Zinc finger and BTB domain containing 41SMESG000022366.1 dd_Smed_v4_10911_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017053SMED30017053SMESG000004885.1 dd_Smed_v4_5297_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015955Growth arrest-specific protein 8SMESG000013356.1 dd_Smed_v4_2848_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019483Kinesin-like proteinSMESG000053119.1 SMESG000009621.1 SMESG000003158.1 SMESG000077074.1 SMESG000055143.1 SMESG000049878.1 SMESG000003715.1 dd_Smed_v4_3004_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019678SMED30019678SMESG000040636.1 dd_Smed_v4_541_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30019305wdr-1SMESG000045753.1 SMESG000037894.1 dd_Smed_v4_2585_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014511Ras-related protein Rab-10SMESG000053119.1 SMESG000009621.1 SMESG000003158.1 SMESG000077074.1 SMESG000055143.1 SMESG000049878.1 SMESG000003715.1 dd_Smed_v4_3004_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012921Ras GTPase-activating protein gap-2SMESG000003718.1 SMESG000018818.1 dd_Smed_v4_2872_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014539cAMP-dependent protein kinase type II regulatory subunitSMESG000019065.1 dd_Smed_v4_2902_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012826SMED30012826SMESG000017012.1 SMESG000017011.1 dd_Smed_v4_309_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019324Clathrin light chainSMESG000019387.1 dd_Smed_v4_2973_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016338Alpha-adducinSMESG000051636.1 dd_Smed_v4_2345_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004142Calcium-dependent secretion activator 1SMESG000011756.1 dd_Smed_v4_11725_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012075SMED30012075SMESG000059352.1 SMESG000059351.1 dd_Smed_v4_420_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015276SMED30015276SMESG000054104.1 SMESG000017493.1 SMESG000016095.1 SMESG000014571.1 dd_Smed_v4_3885_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019205Neur_chan_LBD domain-containing proteinSMESG000039749.1 dd_15962dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30012043Calcium-transporting ATPaseSMESG000063816.1 SMESG000010536.1 SMESG000045280.1 SMESG000029730.1 dd_Smed_v4_4145_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003780Serine/threonine-protein kinase 36SMESG000076885.1 dd_Smed_v4_11067_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009438Complexin-1/2SMESG000012002.1 dd_Smed_v4_9918_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014077SMED30014077SMESG000053808.1 dd_Smed_v4_7928_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017278Ig-like domain-containing proteinSMESG000001734.1 dd_Smed_v4_10042_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005845NPHS1-6SMESG000028689.1 dd_Smed_v4_10689_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013935Eukaryotic translation initiation factor 5BSMESG000012316.1 dd_1274dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30019495SMED30019495SMESG000022773.1 dd_5694dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30003506Anaphase promoting complex subunit 4SMESG000062466.1 dd_Smed_v4_4177_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016951Calmodulin-like proteinSMESG000029865.1 dd_23127dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30001640SMED30001640SMESG000007247.1 dd_Smed_v4_4472_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007480Protein kinase CSMESG000039865.1 SMESG000039854.1 SMESG000032749.1 SMESG000032747.1 dd_Smed_v4_4244_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014144Phytanoyl-CoA dioxygenase domain-containing protein 1-likeSMESG000023010.1 dd_Smed_v4_1207_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004739TNF receptor-associated factorSMESG000014725.1 SMESG000014724.1 SMESG000014706.1 SMESG000014702.1 SMESG000014700.1 dd_Smed_v4_4420_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001489SMED30001489SMESG000022773.1 dd_5694dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30004749SMED30004749SMESG000046853.1 dd_Smed_v4_11984_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012789Expressed conserved proteinSMESG000033789.1 SMESG000033788.1 dd_Smed_v4_3908_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000919Bravo_FIGEY domain-containing proteinSMESG000026407.1 dd_Smed_v4_11307_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014507FibronectinSMESG000029226.1 SMESG000029259.1 dd_Smed_v4_16808_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014507FibronectinSMESG000029259.1 dd_Smed_v4_43824_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006233GTP-binding protein GEMSMESG000032890.1 dd_Smed_v4_11010_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015710Glycine receptor subunit alpha-3SMESG000008993.1 dd_Smed_v4_10794_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000524SMED30000524SMESG000004865.1 dd_Smed_v4_9063_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000596PeroxiredoxinSMESG000001807.1 dd_Smed_v4_7781_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013293Major vault proteinSMESG000037707.1 dd_Smed_v4_1098_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004732PKD1L-2SMESG000014725.1 SMESG000014723.1 dd_Smed_v4_13975_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004732PKD1L-2SMESG000014725.1 SMESG000014723.1 dd_Smed_v4_13975_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30001473Lipoxygenase homology domain-containing protein 1SMESG000059926.1 SMESG000059927.1 dd_Smed_v4_10460_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010941dnaJ homolog subfamily B member 13SMESG000076708.1 dd_Smed_v4_4820_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016517ATFl1SMESG000044121.1 dd_Smed_v4_3847_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001229PKD1L-2SMESG000014725.1 SMESG000014723.1 dd_Smed_v4_13975_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001229PKD1L-2SMESG000014725.1 SMESG000014723.1 dd_Smed_v4_13975_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30016871SMED30016871SMESG000036609.1 dd_1747dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30012522Ankyrin-2SMESG000026655.1 dd_Smed_v4_10835_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008167SMED30008167SMESG000033046.1 dd_4545dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30011576HECT and RLD domain containing E3 ubiquitin protein ligase 2SMESG000054104.1 SMESG000017493.1 SMESG000016095.1 SMESG000014571.1 dd_Smed_v4_3885_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002634SCP domain-containing proteinSMESG000036363.1 dd_210dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30016234General transcription factor II-I repeat domain-containing protein 2ASMESG000039749.1 dd_15962dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30014951SMED30014951SMESG000058720.1 dd_Smed_v4_7931_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015172Protein kinase CSMESG000039865.1 SMESG000039854.1 SMESG000032749.1 SMESG000032747.1 dd_Smed_v4_4244_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009973mxi-1 proteinSMESG000047681.1 SMESG000016277.1 dd_Smed_v4_4415_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004112Dynein heavy chain 5, axonemalSMESG000012967.1 dd_Smed_v4_4113_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007500coiled-coil domain-containing protein 170SMESG000074429.1 dd_Smed_v4_10140_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015589SMED30015589SMESG000063816.1 SMESG000010536.1 SMESG000045280.1 SMESG000029730.1 dd_Smed_v4_4145_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014919KIF3A-like proteinSMESG000075065.1 dd_Smed_v4_4343_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008695SMED30008695SMESG000053808.1 dd_Smed_v4_7928_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014820Centrosomal protein of 135 kDa (Cep135 protein) (Centrosomal protein 4), putativeSMESG000052451.1 dd_Smed_v4_11072_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007857SMED30007857SMESG000022810.1 dd_28465dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30008651Guanylate cyclaseSMESG000019264.1 dd_Smed_v4_9453_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016779JmjC domain-containing proteinSMESG000053108.1 dd_Smed_v4_12267_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007179PKD2-4SMESG000018492.1 dd_Smed_v4_13327_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008221FTS and Hook-interacting proteinSMESG000025657.1 dd_Smed_v4_9831_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008883Protein CEPU-1SMESG000040207.1 dd_Smed_v4_11326_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001622SMED30001622SMESG000040908.1 dd_Smed_v4_10356_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023733Sodium/potassium-transporting ATPase subunit beta-2SMESG000071416.1 dd_Smed_v4_7917_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30024999CTF/NF-I domain-containing proteinSMESG000010567.1 dd_Smed_v4_9508_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026182Sodium/potassium-transporting ATPase subunit beta-2SMESG000071416.1 dd_Smed_v4_7917_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025473mxi-2 proteinSMESG000060394.1 dd_Smed_v4_4048_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035761GMP_PDE_delta domain-containing proteinSMESG000064785.1 dd_Smed_v4_4791_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30034888Dynein heavy chain 5, axonemalSMESG000049144.1 dd_Smed_v4_4569_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026072SMED30026072SMESG000050943.1 dd_4180dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30029683SMED30029683SMESG000027342.1 SMESG000023213.1 SMESG000023211.1 dd_3814dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30029683SMED30029683SMESG000023213.1 SMESG000023211.1 dd_Smed_v4_3814_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035908Serine-rich adhesin for platelets (Staphylococcus aureus surface protein A)SMESG000025158.1 dd_Smed_v4_3220_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023587SMED30023587SMESG000063816.1 SMESG000010536.1 SMESG000045280.1 SMESG000029730.1 dd_Smed_v4_4145_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30027268Histone H1BSMESG000071975.1 dd_Smed_v4_3898_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025960SMED30025960SMESG000027347.1 dd_27863dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30021821Transient receptor potential cation channel subfamily M memberSMESG000078720.1 dd_17981dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30024436SMED30024436SMESG000043617.1 dd_8060dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30029361KIF3B-like proteinSMESG000075065.1 dd_Smed_v4_4343_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30024725Protein lin-7 homologSMESG000057909.1 dd_Smed_v4_1009_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30024282Synaptosomal-associated proteinSMESG000034282.1 dd_Smed_v4_3977_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023380SMED30023380SMESG000058140.1 dd_11040dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30023326Ig-like domain-containing proteinSMESG000078594.1 dd_Smed_v4_4106_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023993SMED30023993SMESG000029226.1 SMESG000029259.1 dd_Smed_v4_16808_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30027162MDS1 and EVI1 complex locus protein EVI1SMESG000028951.1 dd_Smed_v4_22685_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026735Poly(RC)-binding protein 3SMESG000028069.1 dd_Smed_v4_8431_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020851PHB domain-containing proteinSMESG000059569.1 dd_Smed_v4_7331_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028626C2H2-type domain-containing proteinSMESG000019280.1 SMESG000019279.1 dd_Smed_v4_10324_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032498NPHP8SMESG000076081.1 dd_Smed_v4_11425_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020986SMED30020986SMESG000061227.1 dd_1936dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30032272FMN_red domain-containing proteinSMESG000023871.1 dd_Smed_v4_1834_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031429SMED30031429SMESG000038604.1 dd_Smed_v4_1973_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031309nuclear protein MDM1-like isoform X1SMESG000058479.1 dd_Smed_v4_10635_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025648InnexinSMESG000027007.1 dd_Smed_v4_12178_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028417Bardet-Biedl syndrome 1 protein homologSMESG000009880.1 dd_Smed_v4_7298_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033117ANK_REP_REGION domain-containing proteinSMESG000048145.1 dd_Smed_v4_16174_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023266cilia- and flagella-associated protein 43SMESG000000491.1 dd_Smed_v4_10271_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001515AnnexinSMESG000042839.1 dd_Smed_v4_1104_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013424WD repeat domain 60SMESG000040271.1 dd_Smed_v4_10032_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000014slc20a-1SMESG000012546.1 dd_Smed_v4_1270_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002520slc6a-3SMESG000068398.1 dd_Smed_v4_17986_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017048cilia- and flagella-associated protein 206SMESG000021247.1 dd_Smed_v4_11199_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006652dynein heavy chain 6, axonemalSMESG000004477.1 SMESG000004475.1 dd_Smed_v4_10969_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017949slc7a-6SMESG000051755.1 dd_Smed_v4_7207_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013286sn1-specific diacylglycerol lipase betaSMESG000046500.1 dd_Smed_v4_13306_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006476NEK8-2SMESG000043305.1 SMESG000043302.1 dd_Smed_v4_10144_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013824Unc-5 netrin receptor BSMESG000040323.1 dd_Smed_v4_10380_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031952SMED30031952SMESG000003398.1 dd_Smed_v4_248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30036006beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase 3SMESG000051810.1 SMESG000051787.1 SMESG000043068.1 SMESG000043067.1 SMESG000043052.1 SMESG000009027.1 SMESG000008972.1 dd_Smed_v4_6205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031553SMED30031553SMESG000023246.1 dd_Smed_v4_918_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031553SMED30031553SMESG000023246.1 dd_Smed_v4_918_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30031903ProsaposinSMESG000019973.1 dd_Smed_v4_2944_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30034903cilia- and flagella-associated protein 77SMESG000042608.1 dd_Smed_v4_5179_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023344Sn1-specific diacylglycerol lipase betaSMESG000046500.1 dd_Smed_v4_13306_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021105Tubulin alpha chainSMESG000005506.1 SMESG000005505.1 SMESG000005493.1 SMESG000005489.1 SMESG000005487.1 dd_Smed_v4_38_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020051ThioninSMESG000031412.1 dd_3063dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30033873SMED30033873SMESG000003398.1 dd_Smed_v4_248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025990NPHP1SMESG000061008.1 dd_Smed_v4_9990_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019497SH3 domain-containing proteinSMESG000039140.1 dd_Smed_v4_11051_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006818Chromodomain-helicase-DNA-binding proteinSMESG000033397.1 SMESG000033395.1 dd_Smed_v4_2597_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017165Succinate--CoA ligase [ADP-forming] subunit beta, mitochondrialSMESG000015204.1 dd_Smed_v4_2298_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014844Flotillin-1SMESG000004975.1 dd_Smed_v4_1637_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011420Trinucleotide repeat containing 4-like proteinSMESG000005424.1 dd_Smed_v4_11349_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001480Serine/threonine-protein kinase ULK2SMESG000049447.1 dd_Smed_v4_1196_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017722Kinesin-like protein KIF1ASMESG000071414.1 dd_Smed_v4_7108_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015563Meiosis expressed protein 1SMESG000031493.1 dd_Smed_v4_4620_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015251Transmembrane protein 184CSMESG000049447.1 dd_Smed_v4_1196_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006884Protein dpy-30-likeSMESG000008786.1 dd_Smed_v4_9103_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017498tyramine beta-hydroxilaseSMESG000005292.1 dd_Smed_v4_42610_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30005459SMED30005459SMESG000014884.1 dd_Smed_v4_2661_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017160sertSMESG000021044.1 dd_Smed_v4_12700_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30014519Caspase-1SMESG000002751.1 dd_Smed_v4_2943_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008550intraflagellar transport protein 20 homologSMESG000067757.1 dd_Smed_v4_9545_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015595InnexinSMESG000032206.1 dd_Smed_v4_3879_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000559Transposon Ty3-I Gag-Pol polyproteinSMESG000063504.1 SMESG000063503.1 SMESG000026061.1 dd_Smed_v4_3587_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015018SMED30015018SMESG000075952.1 dd_Smed_v4_4158_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014724Tetraspanin-CD63 receptorSMESG000041117.1 dd_Smed_v4_1378_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007951Transcription initiation factor IIF subunit alphaSMESG000056085.1 dd_Smed_v4_6621_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011962ATP-binding cassette sub-family A member 1SMESG000056983.1 dd_Smed_v4_10304_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008752Homeobox domain-containing proteinSMESG000016670.1 dd_Smed_v4_11150_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019683SMED30019683SMESG000031186.1 dd_Smed_v4_10687_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006690slc46a-1SMESG000022670.1 dd_Smed_v4_10822_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001681SMED30001681SMESG000049443.1 dd_Smed_v4_1193_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002549SyntaxinSMESG000043412.1 SMESG000043410.1 dd_Smed_v4_8453_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016746SMED30016746SMESG000060159.1 dd_Smed_v4_2729_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000378SMED30000378SMESG000061591.1 dd_Smed_v4_512_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002366cAMP-dependent protein kinase regulatory subunitSMESG000052390.1 dd_Smed_v4_7586_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001361BAT2_N domain-containing proteinSMESG000038978.1 dd_Smed_v4_4611_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008751Liprin-alpha-2SMESG000024331.1 SMESG000024325.1 dd_Smed_v4_12307_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012574Carboxyl-terminal PDZ ligand of neuronal nitric oxide synthase proteinSMESG000071224.1 dd_Smed_v4_13377_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008253Dual specificity protein phosphatase 10SMESG000063504.1 SMESG000063503.1 SMESG000026061.1 dd_Smed_v4_3587_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000802SMED30000802SMESG000061387.1 dd_2223dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30019896casein kinase ISMESG000013473.1 dd_Smed_v4_1225_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001408Tyrosine-protein phosphatase Lar-likeSMESG000042151.1 dd_Smed_v4_16093_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010086Homeobox domain-containing proteinSMESG000030375.1 dd_Smed_v4_16007_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED300184652',3'-cyclic nucleotide 3'-phosphodiesteraseSMESG000060338.1 dd_Smed_v4_2431_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005517Receptor type tyrosine protein phosphataseSMESG000041927.1 dd_Smed_v4_10176_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013015Flotillin-1SMESG000004975.1 dd_Smed_v4_1637_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004840Coiled-coil domain containing 88AaSMESG000012304.1 dd_Smed_v4_3591_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018275SMED30018275SMESG000039140.1 dd_Smed_v4_11051_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007518PIH1 domain-containing protein 1SMESG000041927.1 dd_Smed_v4_10176_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005737Death-associated protein kinase 1SMESG000048879.1 dd_Smed_v4_9475_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022101Down syndrome cell adhesion moleculeSMESG000048977.1 dd_Smed_v4_5856_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035291PikachurinSMESG000079944.1 dd_Smed_v4_10946_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30024549Copine-3SMESG000029196.1 dd_Smed_v4_13873_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028832SMED30028832SMESG000029027.1 dd_Smed_v4_10089_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025755DNA-binding protein RFX5SMESG000072002.1 dd_Smed_v4_6108_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023308SMED30023308SMESG000063568.1 dd_Smed_v4_762_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021219Retinol dehydrogenase 13SMESG000010175.1 dd_Smed_v4_10881_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021485SMED30021485SMESG000059844.1 dd_Smed_v4_1328_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026686Glutamate synthaseSMESG000077776.1 dd_Smed_v4_5074_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026275MFS domain-containing proteinSMESG000060693.1 dd_Smed_v4_4772_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032989Cytochrome b561SMESG000028998.1 dd_Smed_v4_4017_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028743Regulator of G-protein signaling 22SMESG000069110.1 dd_Smed_v4_11778_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030594OpsinSMESG000074489.1 dd_Smed_v4_15036_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30034947SMED30034947SMESG000077223.1 dd_Smed_v4_7005_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028312Protein tyrosine phosphatase receptor type DSMESG000053906.1 dd_Smed_v4_12545_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033164Heat shock 70 kDa proteinSMESG000041117.1 dd_Smed_v4_1378_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035681Intraflagellar transport protein 88SMESG000039906.1 dd_Smed_v4_5484_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028734SMED30028734SMESG000038532.1 SMESG000038520.1 SMESG000038497.1 SMESG000036112.1 SMESG000036067.1 dd_Smed_v4_5097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022032SMED30022032SMESG000038532.1 SMESG000038520.1 SMESG000038497.1 SMESG000036112.1 SMESG000036067.1 dd_Smed_v4_5097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032074ATP binding cassette subfamily A member 1SMESG000056983.1 dd_Smed_v4_10304_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031654SMED30031654SMESG000064362.1 dd_Smed_v4_3795_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025786SMED30025786SMESG000009944.1 dd_16708dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30025821Multiple PDZ domain crumbs cell polarity complex componentSMESG000053393.1 dd_Smed_v4_5376_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032280Histone acetyltransferaseSMESG000062900.1 dd_Smed_v4_5797_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030220Helicase for meiosis 1SMESG000065404.1 dd_Smed_v4_9538_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033302RNA-binding protein MEX3BSMESG000044270.1 SMESG000030021.1 SMESG000025422.1 dd_Smed_v4_1999_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020166Coiled-coil domain-containing proteinSMESG000005080.1 dd_Smed_v4_9816_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025902Calponin-homology (CH) domain-containing proteinSMESG000078209.1 dd_Smed_v4_9419_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022681Dynein heavy chain 7 axonemalSMESG000012956.1 dd_Smed_v4_5350_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030326SMED30030326SMESG000001071.1 SMESG000001061.1 SMESG000001060.1 dd_Smed_v4_9824_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032108ProtocadherinSMESG000033639.1 dd_Smed_v4_12429_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023446SMED30023446SMESG000040048.1 dd_Smed_v4_9891_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004118Tubulin beta chainSMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044888.1 SMESG000035755.1 dd_Smed_v4_83_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004118Tubulin beta chainSMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044888.1 SMESG000035755.1 dd_Smed_v4_83_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30015587Dual specificity protein phosphatase 14SMESG000037868.1 dd_Smed_v4_7558_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017127Tektin 3SMESG000062615.1 dd_Smed_v4_6883_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011216slc1a-2SMESG000022787.1 dd_Smed_v4_7570_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001024SMED30001024SMESG000079945.1 dd_Smed_v4_9265_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001680SMED30001680SMESG000002033.1 dd_Smed_v4_884_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002896SMED30002896SMESG000065225.1 SMESG000065211.1 SMESG000065210.1 dd_Smed_v4_7442_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018991ATP-dependent DNA helicaseSMESG000064966.1 dd_Smed_v4_7318_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012267Kinesin-like proteinSMESG000073771.1 dd_Smed_v4_6755_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006256SMED30006256SMESG000034101.1 dd_Smed_v4_9313_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009782Outer dense fiber protein 3SMESG000038718.1 dd_Smed_v4_2658_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017476Intraflagellar transport protein 57SMESG000013668.1 dd_Smed_v4_7099_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004519Novel proteinSMESG000039682.1 dd_Smed_v4_2676_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000581Centlein, centrosomal proteinSMESG000000357.1 dd_Smed_v4_9882_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011296SMED30011296SMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044888.1 SMESG000035755.1 dd_Smed_v4_83_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011296SMED30011296SMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044888.1 SMESG000035755.1 dd_Smed_v4_83_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30001116cilia- and flagella-associated protein 44-likeSMESG000022927.1 dd_Smed_v4_8760_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000565Dynein heavy chainSMESG000065732.1 dd_Smed_v4_6941_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017219Guanylate cyclaseSMESG000039747.1 dd_Smed_v4_7619_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014219cilia- and flagella-associated protein 99SMESG000025927.1 dd_Smed_v4_8538_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001478Dynamin-like proteinSMESG000002033.1 dd_Smed_v4_884_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002286formimidoyltransferase-cyclodeaminaseSMESG000070969.1 dd_Smed_v4_7815_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30034870SMED30034870SMESG000047469.1 dd_Smed_v4_16220_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30024396Centrosomal protein 295SMESG000023095.1 dd_Smed_v4_11068_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023661Reverse transcriptase domain-containing proteinSMESG000042224.1 dd_Smed_v4_11697_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30027887Interferon-induced GTP-binding protein Mx1SMESG000002025.1 dd_Smed_v4_7246_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020268Dynamin-type G domain-containing proteinSMESG000014756.1 SMESG000014755.1 dd_Smed_v4_2390_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30024368chromodomain helicase DNA-binding protein 4SMESG000068192.1 dd_Smed_v4_2331_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021539Diacylglycerol lipase betaSMESG000046500.1 dd_Smed_v4_13306_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30027901Spermatogenesis associated 1SMESG000049418.1 dd_Smed_v4_12212_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017036AP-2 complex subunit alphaSMESG000036030.1 dd_Smed_v4_1423_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001112SMED30001112SMESG000061228.1 dd_Smed_v4_8351_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016317slc16a-25SMESG000046854.1 dd_Smed_v4_10252_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010847SMED30010847SMESG000026789.1 dd_Smed_v4_10187_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013138SMED30013138SMESG000004029.1 dd_Smed_v4_4798_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016589SynapsinSMESG000063523.1 dd_Smed_v4_3135_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016673Cylindromatosis (turban tumor syndrome), bSMESG000056847.1 SMESG000056843.1 SMESG000056838.1 SMESG000044770.1 SMESG000044762.1 SMESG000007140.1 dd_Smed_v4_1137_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007588SMED30007588SMESG000034112.1 dd_Smed_v4_10100_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018274Calbindin-32SMESG000055605.1 dd_Smed_v4_1230_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015672Gelsolin-like proteinSMESG000015928.1 dd_Smed_v4_1215_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006908G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000060818.1 dd_24149dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30007943AP complex subunit betaSMESG000029143.1 SMESG000029126.1 dd_Smed_v4_893_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009735Bardet-Biedl syndrome 5 protein homologSMESG000052420.1 dd_Smed_v4_8523_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006492SMED30006492SMESG000005194.1 dd_Smed_v4_4021_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006932SMED30006932SMESG000080376.1 dd_Smed_v4_23203_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000511G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000064707.1 dd_Smed_v4_16018_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014280Malignant brain tumor-like proteinSMESG000025138.1 dd_Smed_v4_11547_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED300116841-phosphatidylinositol 4,5-bisphosphate phosphodiesteraseSMESG000049234.1 dd_Smed_v4_3221_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003269Reticulon-like proteinSMESG000007676.1 dd_Smed_v4_1796_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016231Protocadherin 11SMESG000051413.1 dd_Smed_v4_16397_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017286Major facilitator superfamily domain-containing 4SMESG000038006.1 dd_Smed_v4_10372_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011898Protein F37C4.5SMESG000008044.1 dd_Smed_v4_9190_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007371nuclear mitotic apparatus protein 1 isoform X2SMESG000071994.1 dd_Smed_v4_10823_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003093SMED30003093SMESG000056847.1 SMESG000056843.1 SMESG000056838.1 SMESG000044770.1 SMESG000044762.1 SMESG000007140.1 dd_Smed_v4_1137_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014091Opioid-binding protein/cell adhesion moleculeSMESG000026220.1 dd_Smed_v4_5005_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016729Glutamate receptorSMESG000073692.1 dd_Smed_v4_20242_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008461nuclear mitotic apparatus protein 1 isoform X2SMESG000071994.1 dd_Smed_v4_10823_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010364SMED30010364SMESG000056847.1 SMESG000056843.1 SMESG000056838.1 SMESG000044770.1 SMESG000044762.1 SMESG000007140.1 dd_Smed_v4_1137_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007649SMED30007649SMESG000048765.1 dd_Smed_v4_14165_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000515Nuclear receptor corepressorSMESG000052685.1 dd_Smed_v4_7709_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003374Spectrin beta chainSMESG000039799.1 dd_Smed_v4_6202_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006199Acetyl-coenzyme A synthetaseSMESG000022079.1 dd_Smed_v4_1817_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010620Histone acetyltransferaseSMESG000017094.1 dd_Smed_v4_12274_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000539Transcriptional regulator ATRXSMESG000079240.1 dd_Smed_v4_5478_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015867SMED30015867SMESG000024596.1 dd_Smed_v4_5001_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017399Transmembrane protein 81SMESG000026648.1 dd_Smed_v4_10248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013306Protein NDRG4SMESG000055233.1 SMESG000055204.1 dd_Smed_v4_11017_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015426SMED30015426SMESG000038532.1 SMESG000038520.1 SMESG000038497.1 SMESG000036112.1 SMESG000036067.1 dd_Smed_v4_5097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003408Centrosomal protein of 89 kDaSMESG000031345.1 dd_Smed_v4_13073_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003275Guanine nucleotide-binding protein G(O) subunit alphaSMESG000055191.1 dd_Smed_v4_1656_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006684Calsyntenin-1-like proteinSMESG000057121.1 dd_Smed_v4_3122_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010360Leucine Rich repeat-containing domain proteinSMESG000047911.1 SMESG000045664.1 dd_Smed_v4_2769_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002595SMED30002595SMESG000060338.1 dd_Smed_v4_2431_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011758PCIF1_WW domain-containing proteinSMESG000032335.1 SMESG000015108.1 SMESG000015275.1 dd_Smed_v4_3307_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004284InnexinSMESG000048827.1 dd_Smed_v4_13392_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013757C2 domain-containing proteinSMESG000050479.1 dd_Smed_v4_9615_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009623SMED30009623SMESG000047804.1 SMESG000038532.1 SMESG000038520.1 SMESG000036112.1 SMESG000036060.1 dd_Smed_v4_4251_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032368C2 domain-containing proteinSMESG000059632.1 dd_Smed_v4_6358_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020291Centrosomal protein 104SMESG000023549.1 dd_Smed_v4_10228_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30034629Golgi-associated plant pathogenesis-related protein 1SMESG000063568.1 dd_Smed_v4_762_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025097Disintegrin and metalloproteinase domain-containing protein 19SMESG000036142.1 dd_Smed_v4_8718_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029825ANK_REP_REGION domain-containing proteinSMESG000020706.1 dd_Smed_v4_21003_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025071Calcium/calmodulin-dependent protein kinase type IISMESG000008997.1 dd_Smed_v4_7480_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030227flotillin-2SMESG000024114.1 dd_Smed_v4_927_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021086TIR domain-containing proteinSMESG000008941.1 dd_Smed_v4_13404_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028023adenylate kinase 7SMESG000075900.1 dd_Smed_v4_7959_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035448Kinesin motor domain proteinSMESG000075721.1 dd_Smed_v4_11799_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035965Neuron navigator 2SMESG000036210.1 dd_Smed_v4_7701_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022926Lim domain only 1SMESG000028893.1 dd_Smed_v4_17422_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED3002338613 kDa deflagellation-inducible proteinSMESG000050233.1 dd_Smed_v4_3576_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035315Endothelin-converting enzyme 1SMESG000025056.1 dd_Smed_v4_8276_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026949SMED30026949SMESG000047804.1 SMESG000038532.1 SMESG000038520.1 SMESG000036112.1 SMESG000036060.1 dd_Smed_v4_4251_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035723nesprin-1-likeSMESG000023320.1 dd_Smed_v4_10282_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30034220Flotillin-1SMESG000004975.1 dd_Smed_v4_1637_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028228Centrosomal protein 164SMESG000054195.1 SMESG000021687.1 dd_Smed_v4_12228_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026619Mitochondrial calcium uniporterSMESG000000983.1 dd_Smed_v4_4033_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031496Leucine zipper transcription factor like 1SMESG000020499.1 dd_Smed_v4_8415_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025065SMED30025065SMESG000047804.1 SMESG000038532.1 SMESG000038520.1 SMESG000036112.1 SMESG000036060.1 dd_Smed_v4_4251_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025065SMED30025065SMESG000038532.1 SMESG000038520.1 SMESG000038497.1 SMESG000036112.1 SMESG000036067.1 dd_Smed_v4_5097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035091SMED30035091SMESG000058994.1 dd_586dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30024109Non-specific serine/threonine protein kinaseSMESG000074914.1 dd_Smed_v4_11891_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020343Intersectin-1SMESG000070268.1 dd_Smed_v4_3992_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023112SMED30023112SMESG000047804.1 SMESG000038532.1 SMESG000038520.1 SMESG000036112.1 SMESG000036060.1 dd_Smed_v4_4251_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035848Tubulin beta chainSMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044888.1 SMESG000035755.1 dd_Smed_v4_83_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035848Tubulin beta chainSMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044888.1 SMESG000035755.1 dd_Smed_v4_83_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30032448Expressed conserved proteinSMESG000064362.1 dd_Smed_v4_3795_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031435SMED30031435SMESG000020814.1 dd_Smed_v4_5728_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022421RIB43A-like with coiled-coils protein 2SMESG000037028.1 dd_Smed_v4_4547_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020991Outer dynein arm protein 1SMESG000055998.1 SMESG000055997.1 dd_Smed_v4_4191_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020940Small G protein signaling modulator 2SMESG000032335.1 SMESG000015108.1 SMESG000015275.1 dd_Smed_v4_3307_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012252G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000063789.1 dd_Smed_v4_14726_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002221SMED30002221SMESG000011558.1 dd_3733dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30006070SMED30006070SMESG000080798.1 SMESG000054735.1 SMESG000030429.1 dd_Smed_v4_6842_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014618SMED30014618SMESG000067158.1 SMESG000079384.1 SMESG000006522.1 dd_Smed_v4_6854_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007858netrin receptor-like proteinSMESG000042475.1 dd_Smed_v4_11409_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003375Striatin Pro11SMESG000072340.1 dd_Smed_v4_8286_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016693InnexinSMESG000059204.1 dd_Smed_v4_3985_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009863Guanylate kinaseSMESG000052587.1 SMESG000052584.1 dd_Smed_v4_4875_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006489SMED30006489SMESG000011558.1 dd_3733dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30001010SMED30001010SMESG000039006.1 dd_Smed_v4_13470_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016068SMED30016068SMESG000024947.1 SMESG000024945.1 SMESG000024886.1 SMESG000024883.1 dd_15610dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30004158Tetratricopeptide repeat protein 25SMESG000067442.1 dd_Smed_v4_3933_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002009Regulator of G-protein signalingSMESG000048981.1 dd_Smed_v4_8648_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002168Spondin-1SMESG000039905.1 dd_Smed_v4_8655_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015974FAST kinase domain-containing protein 1, mitochondrialSMESG000064523.1 dd_Smed_v4_8917_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016041SMED30016041SMESG000067158.1 SMESG000079384.1 SMESG000006522.1 dd_Smed_v4_6854_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017235SMED30017235SMESG000067158.1 SMESG000079384.1 SMESG000006522.1 dd_Smed_v4_6854_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000732Leucine-rich repeat-containing protein 45SMESG000060194.1 dd_Smed_v4_9495_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012747Thioredoxin domain-containing protein 3-likeSMESG000043677.1 dd_Smed_v4_8401_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002152Arf-GAP with SH3 domain ANK repeat and PH domain-containing proteinSMESG000068882.1 dd_Smed_v4_6590_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013731CentrinSMESG000040368.1 dd_Smed_v4_7903_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017636Calsyntenin 1SMESG000068054.1 dd_Smed_v4_4147_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006485Beta-1-syntrophinSMESG000005336.1 dd_Smed_v4_7105_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004383SMED30004383SMESG000026569.1 dd_1955dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30004383SMED30004383SMESG000026569.1 dd_Smed_v4_1955_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30002721beta-parvinSMESG000080798.1 SMESG000054735.1 SMESG000030429.1 dd_Smed_v4_6842_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001465Protein kinase domain-containing proteinSMESG000069574.1 dd_Smed_v4_4202_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004448Thioredoxin domain-containing protein 3-likeSMESG000043677.1 dd_Smed_v4_8401_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008035Secretory carrier-associated membrane proteinSMESG000037804.1 dd_Smed_v4_8593_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010277SMED30010277SMESG000000133.1 dd_Smed_v4_8640_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018004SMED30018004SMESG000039905.1 dd_Smed_v4_8655_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012827SMED30012827SMESG000054420.1 dd_Smed_v4_5361_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007189Double zinc ribbon and ankyrin repeat-containing protein 1SMESG000018145.1 SMESG000018144.1 dd_Smed_v4_9848_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010695coiled-coil domain-containing protein 170SMESG000048767.1 dd_Smed_v4_7066_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015021Calcium/calmodulin-dependent protein kinase type II subunit deltaSMESG000062800.1 dd_Smed_v4_7858_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018495ATPase_AAA_core domain-containing proteinSMESG000073596.1 dd_Smed_v4_9568_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018495ATPase_AAA_core domain-containing proteinSMESG000073596.1 dd_Smed_v4_9484_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015763Bravo_FIGEY domain-containing proteinSMESG000064374.1 dd_Smed_v4_7836_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018739SMED30018739SMESG000025343.1 SMESG000025332.1 dd_Smed_v4_6330_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017099SMED30017099SMESG000030373.1 dd_Smed_v4_595_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005553Thioredoxin domain-containing protein 3-likeSMESG000043677.1 dd_Smed_v4_8401_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006640Calcium/calmodulin-dependent protein kinase type IISMESG000062800.1 dd_Smed_v4_7858_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003094HMG box domain-containing proteinSMESG000017540.1 SMESG000070603.1 SMESG000070576.1 SMESG000017600.1 SMESG000017572.1 SMESG000017558.1 SMESG000017557.1 SMESG000017556.1 SMESG000017543.1 SMESG000017541.1 dd_Smed_v4_4601_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017971ANK_REP_REGION domain-containing proteinSMESG000026132.1 dd_Smed_v4_6201_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001142CadherinSMESG000020071.1 dd_Smed_v4_11814_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017180Dynein regulatory complex protein 1SMESG000072168.1 dd_Smed_v4_8761_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023988Dynamin-type G domain-containing proteinSMESG000002973.1 dd_Smed_v4_9275_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022977SMED30022977SMESG000017540.1 SMESG000070603.1 SMESG000070576.1 SMESG000017600.1 SMESG000017572.1 SMESG000017558.1 SMESG000017557.1 SMESG000017556.1 SMESG000017543.1 SMESG000017541.1 dd_Smed_v4_4601_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020002BEN domain-containing proteinSMESG000080064.1 dd_Smed_v4_7370_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30027594CYLD lysine 63 deubiquitinaseSMESG000015653.1 dd_Smed_v4_3043_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030254SMED30030254SMESG000020648.1 dd_Smed_v4_8926_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021280Leucine Rich repeat-containing domain proteinSMESG000006503.1 dd_Smed_v4_18031_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026524Spermidine synthaseSMESG000031473.1 dd_Smed_v4_7292_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032106SMED30032106SMESG000080318.1 dd_Smed_v4_8948_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021617Neuronal acetylcholine receptor subunit alpha-2SMESG000040082.1 dd_Smed_v4_8486_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031197Microtubule-associated protein 4SMESG000068843.1 dd_Smed_v4_7133_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023409Glutamate-rich 3SMESG000029848.1 SMESG000029846.1 dd_Smed_v4_8627_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023570SMED30023570SMESG000056075.1 SMESG000056059.1 dd_Smed_v4_770_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022070SMED30022070SMESG000067158.1 SMESG000079384.1 SMESG000006522.1 dd_Smed_v4_6854_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021868coiled-coil domain-containing protein 39SMESG000072035.1 SMESG000072034.1 dd_Smed_v4_5955_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022622Centrosomal protein 350SMESG000033533.1 dd_Smed_v4_5967_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026782Cilia-and flagella-associated protein 58SMESG000061980.1 dd_Smed_v4_5727_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028919SMED30028919SMESG000067158.1 SMESG000079384.1 SMESG000006522.1 dd_Smed_v4_6854_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031735E3 ubiquitin-protein ligase PDZRN3SMESG000080284.1 dd_Smed_v4_4699_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031395TTF-type domain-containing proteinSMESG000065691.1 dd_Smed_v4_8970_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026172srebp proteinSMESG000056019.1 dd_Smed_v4_3641_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022617Neuronal calcium sensor 2SMESG000027982.1 dd_Smed_v4_5266_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033676MAP kinase-activating death domain proteinSMESG000026842.1 dd_Smed_v4_8355_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025099SMED30025099SMESG000043295.1 dd_3524dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30028659Cilia-and flagella-associated protein 100SMESG000033127.1 dd_Smed_v4_6518_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032094RIIa domain-containing protein 1SMESG000079320.1 dd_Smed_v4_4716_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030803[F-actin]-monooxygenase MICAL2SMESG000021733.1 dd_Smed_v4_8586_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021404ALMS_motif domain-containing proteinSMESG000077136.1 dd_Smed_v4_5064_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022233SPATA6 domain-containing proteinSMESG000013811.1 dd_Smed_v4_4304_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028806SMED30028806SMESG000065691.1 dd_Smed_v4_8970_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030360Voltage-dependent calcium channel unc-36SMESG000020648.1 dd_Smed_v4_8926_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020027SMED30020027SMESG000020648.1 dd_Smed_v4_8926_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029434SMED30029434SMESG000045809.1 dd_Smed_v4_6870_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022769Glycine receptor subunit alpha-3SMESG000061905.1 dd_Smed_v4_8110_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020865AminopeptidaseSMESG000033900.1 SMESG000033518.1 SMESG000022278.1 Contig21944uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30024329SMED30024329SMESG000051020.1 Contig24429newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023483INX-13SMESG000043575.1 Contig50609newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023483INX-13SMESG000043575.1 Contig50609uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30034737Protocadherin-1SMESG000005378.1 Contig35337newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30034737Protocadherin-1SMESG000005378.1 Contig35337uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014257Oxysterol-binding proteinSMESG000008795.1 Contig13050newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014257Oxysterol-binding proteinSMESG000008795.1 Contig13050uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011554SMED30011554SMESG000079180.1 SMESG000076652.1 SMESG000076091.1 SMESG000066578.1 SMESG000065288.1 SMESG000059025.1 SMESG000057427.1 SMESG000052755.1 SMESG000052524.1 SMESG000050353.1 SMESG000046659.1 SMESG000037212.1 SMESG000033451.1 SMESG000031049.1 SMESG000022236.1 SMESG000019334.1 SMESG000017989.1 SMESG000026425.1 Contig11424newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011554SMED30011554SMESG000079180.1 SMESG000076652.1 SMESG000076091.1 SMESG000066578.1 SMESG000065288.1 SMESG000059025.1 SMESG000057427.1 SMESG000052755.1 SMESG000052524.1 SMESG000050353.1 SMESG000046659.1 SMESG000037212.1 SMESG000033451.1 SMESG000031049.1 SMESG000022236.1 SMESG000019334.1 SMESG000017989.1 SMESG000026425.1 Contig11424uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011554SMED30011554SMESG000038292.1 Contig47630newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011554SMED30011554SMESG000038292.1 Contig47630uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011554SMED30011554SMESG000079430.1 SMESG000076652.1 SMESG000076091.1 SMESG000076042.1 SMESG000074857.1 SMESG000070393.1 SMESG000068687.1 SMESG000065288.1 SMESG000065178.1 SMESG000062279.1 SMESG000060688.1 SMESG000059025.1 SMESG000057864.1 SMESG000057533.1 SMESG000057427.1 SMESG000053372.1 SMESG000050587.1 SMESG000050353.1 SMESG000048922.1 SMESG000048614.1 SMESG000047874.1 SMESG000046659.1 SMESG000046053.1 SMESG000043782.1 SMESG000040179.1 SMESG000037212.1 SMESG000034701.1 SMESG000031049.1 SMESG000029555.1 SMESG000029226.1 SMESG000026530.1 SMESG000024597.1 SMESG000023611.1 SMESG000021499.1 SMESG000019334.1 SMESG000017989.1 SMESG000008351.1 SMESG000006220.1 SMESG000005221.1 SMESG000060620.1 Contig20759newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011554SMED30011554SMESG000079430.1 SMESG000076652.1 SMESG000076091.1 SMESG000076042.1 SMESG000074857.1 SMESG000070393.1 SMESG000068687.1 SMESG000065288.1 SMESG000065178.1 SMESG000062279.1 SMESG000060688.1 SMESG000059025.1 SMESG000057864.1 SMESG000057533.1 SMESG000057427.1 SMESG000053372.1 SMESG000050587.1 SMESG000050353.1 SMESG000048922.1 SMESG000048614.1 SMESG000047874.1 SMESG000046659.1 SMESG000046053.1 SMESG000043782.1 SMESG000040179.1 SMESG000037212.1 SMESG000034701.1 SMESG000031049.1 SMESG000029555.1 SMESG000029226.1 SMESG000026530.1 SMESG000024597.1 SMESG000023611.1 SMESG000021499.1 SMESG000019334.1 SMESG000017989.1 SMESG000008351.1 SMESG000006220.1 SMESG000005221.1 SMESG000060620.1 Contig20759uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013128Death domain proteinSMESG000003436.1 Contig18759newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013128Death domain proteinSMESG000003436.1 Contig18759uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000908CN hydrolase domain-containing proteinSMESG000076652.1 SMESG000053372.1 SMESG000050353.1 SMESG000040848.1 SMESG000034123.1 SMESG000029555.1 SMESG000023611.1 SMESG000064571.1 Contig19011newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000908CN hydrolase domain-containing proteinSMESG000076652.1 SMESG000053372.1 SMESG000050353.1 SMESG000040848.1 SMESG000034123.1 SMESG000029555.1 SMESG000023611.1 SMESG000064571.1 Contig19011uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008817ADAM 17-like proteaseSMESG000057956.1 Contig53831newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008817ADAM 17-like proteaseSMESG000057956.1 Contig53831uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015570SMED30015570SMESG000008795.1 Contig13050newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015570SMED30015570SMESG000008795.1 Contig13050uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026828PiggyBac transposable element-derived protein 5SMESG000081274.1 SMESG000074085.1 SMESG000071708.1 SMESG000060519.1 SMESG000033494.1 SMESG000022037.1 SMESG000019964.1 SMESG000008378.1 Contig15257newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026828PiggyBac transposable element-derived protein 5SMESG000081274.1 SMESG000074085.1 SMESG000071708.1 SMESG000060519.1 SMESG000033494.1 SMESG000022037.1 SMESG000019964.1 SMESG000008378.1 Contig15257uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022089heterogeneous nuclear ribonucleoprotein KSMESG000033971.1 Contig15533newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022089heterogeneous nuclear ribonucleoprotein KSMESG000033971.1 Contig15533uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033276SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily B member 1SMESG000018094.1 Contig51602newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033276SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily B member 1SMESG000018094.1 Contig51602uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020317Heat shock protein 90SMESG000024822.1 Contig49305newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020317Heat shock protein 90SMESG000024822.1 Contig49305uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026318SMED30026318SMESG000081274.1 SMESG000074085.1 SMESG000071708.1 SMESG000060519.1 SMESG000033494.1 SMESG000022037.1 SMESG000019964.1 SMESG000008378.1 Contig15257newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026318SMED30026318SMESG000081274.1 SMESG000074085.1 SMESG000071708.1 SMESG000060519.1 SMESG000033494.1 SMESG000022037.1 SMESG000019964.1 SMESG000008378.1 Contig15257uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030576Ankyrin repeat and FYVE domain containing 1SMESG000079180.1 SMESG000076652.1 SMESG000076091.1 SMESG000066578.1 SMESG000065288.1 SMESG000059025.1 SMESG000057427.1 SMESG000052755.1 SMESG000052524.1 SMESG000050353.1 SMESG000046659.1 SMESG000037212.1 SMESG000033451.1 SMESG000031049.1 SMESG000022236.1 SMESG000019334.1 SMESG000017989.1 SMESG000026425.1 Contig11424newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030576Ankyrin repeat and FYVE domain containing 1SMESG000079180.1 SMESG000076652.1 SMESG000076091.1 SMESG000066578.1 SMESG000065288.1 SMESG000059025.1 SMESG000057427.1 SMESG000052755.1 SMESG000052524.1 SMESG000050353.1 SMESG000046659.1 SMESG000037212.1 SMESG000033451.1 SMESG000031049.1 SMESG000022236.1 SMESG000019334.1 SMESG000017989.1 SMESG000026425.1 Contig11424uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30027052noggin-like protein 1SMESG000032255.1 Contig49725newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30027052noggin-like protein 1SMESG000032255.1 Contig49725uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029793SMED30029793SMESG000081274.1 SMESG000074085.1 SMESG000071708.1 SMESG000060519.1 SMESG000033494.1 SMESG000022037.1 SMESG000019964.1 SMESG000008378.1 Contig15257newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029793SMED30029793SMESG000081274.1 SMESG000074085.1 SMESG000071708.1 SMESG000060519.1 SMESG000033494.1 SMESG000022037.1 SMESG000019964.1 SMESG000008378.1 Contig15257uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025072Lrr and pyd domains-containing protein 3-like proteinSMESG000079180.1 SMESG000076652.1 SMESG000076091.1 SMESG000066578.1 SMESG000065288.1 SMESG000059025.1 SMESG000057427.1 SMESG000052755.1 SMESG000052524.1 SMESG000050353.1 SMESG000046659.1 SMESG000037212.1 SMESG000033451.1 SMESG000031049.1 SMESG000022236.1 SMESG000019334.1 SMESG000017989.1 SMESG000026425.1 Contig11424newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025072Lrr and pyd domains-containing protein 3-like proteinSMESG000079180.1 SMESG000076652.1 SMESG000076091.1 SMESG000066578.1 SMESG000065288.1 SMESG000059025.1 SMESG000057427.1 SMESG000052755.1 SMESG000052524.1 SMESG000050353.1 SMESG000046659.1 SMESG000037212.1 SMESG000033451.1 SMESG000031049.1 SMESG000022236.1 SMESG000019334.1 SMESG000017989.1 SMESG000026425.1 Contig11424uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022580runt-1SMESG000014779.1 Contig54774newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022580runt-1SMESG000014779.1 Contig54774uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026124Dynein heavy chain, axonemalSMESG000040510.1 Contig16071newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026124Dynein heavy chain, axonemalSMESG000040510.1 Contig16071uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030071Rho_N domain-containing proteinSMESG000076091.1 SMESG000076042.1 SMESG000074857.1 SMESG000069936.1 SMESG000068687.1 SMESG000059025.1 SMESG000057864.1 SMESG000053372.1 SMESG000048922.1 SMESG000042302.1 SMESG000040848.1 SMESG000034123.1 SMESG000026530.1 SMESG000023611.1 SMESG000022236.1 SMESG000006220.1 Contig12427newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030071Rho_N domain-containing proteinSMESG000076091.1 SMESG000076042.1 SMESG000074857.1 SMESG000069936.1 SMESG000068687.1 SMESG000059025.1 SMESG000057864.1 SMESG000053372.1 SMESG000048922.1 SMESG000042302.1 SMESG000040848.1 SMESG000034123.1 SMESG000026530.1 SMESG000023611.1 SMESG000022236.1 SMESG000006220.1 Contig12427uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030477peptidyl prolyl cis trans isomerase FKBP-1SMESG000026331.1 Contig49356newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030477peptidyl prolyl cis trans isomerase FKBP-1SMESG000026331.1 Contig49356uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003855Chromo domain-containing proteinSMESG000079180.1 SMESG000076652.1 SMESG000076091.1 SMESG000066578.1 SMESG000065288.1 SMESG000059025.1 SMESG000057427.1 SMESG000052755.1 SMESG000052524.1 SMESG000050353.1 SMESG000046659.1 SMESG000037212.1 SMESG000033451.1 SMESG000031049.1 SMESG000022236.1 SMESG000019334.1 SMESG000017989.1 SMESG000026425.1 Contig11424newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003855Chromo domain-containing proteinSMESG000079180.1 SMESG000076652.1 SMESG000076091.1 SMESG000066578.1 SMESG000065288.1 SMESG000059025.1 SMESG000057427.1 SMESG000052755.1 SMESG000052524.1 SMESG000050353.1 SMESG000046659.1 SMESG000037212.1 SMESG000033451.1 SMESG000031049.1 SMESG000022236.1 SMESG000019334.1 SMESG000017989.1 SMESG000026425.1 Contig11424uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035875Non-SMC condensin II complex subunit G2SMESG000024947.1 SMESG000024945.1 SMESG000024886.1 SMESG000024883.1 dd_15610dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30021718COesterase domain-containing proteinSMESG000027379.1 dd_Smed_v4_6180_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035040Protein FAM92A1SMESG000072750.1 dd_Smed_v4_5894_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019471SynaptotagminSMESG000055143.1 dd_Smed_v4_6730_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012874Adenylate cyclase type 9SMESG000037351.1 dd_Smed_v4_2998_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006221PHB domain-containing proteinSMESG000037334.1 dd_Smed_v4_6396_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009659Transcription initiation factor IIF subunit alphaSMESG000056085.1 dd_Smed_v4_6621_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017387von Willebrand factor A domain containing 3BSMESG000047774.1 dd_Smed_v4_9363_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009251coiled-coil domain-containing protein 146SMESG000006416.1 dd_Smed_v4_6858_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019972Kinesin-like proteinSMESG000017021.1 dd_Smed_v4_9460_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019972Kinesin-like proteinSMESG000017021.1 dd_Smed_v4_9460_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30017749Peptidyl-glycine alpha-amidating monooxygenaseSMESG000042480.1 dd_Smed_v4_3093_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018266Phosphatidylinositol-binding clathrin assembly proteinSMESG000020797.1 dd_Smed_v4_6650_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013001SMED30013001SMESG000057336.1 dd_Smed_v4_6083_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013013Guanine nucleotide-binding protein subunit betaSMESG000061733.1 dd_Smed_v4_3309_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014654Low density lipoprotein-receptor, class A,domain-containing proteinSMESG000021406.1 dd_Smed_v4_2598_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018013Protein F37C4.5SMESG000042992.1 SMESG000007398.1 dd_Smed_v4_3629_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017145Ubiquitin carboxyl-terminal hydrolaseSMESG000000839.1 dd_Smed_v4_4235_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019754Cathepsin LSMESG000024014.1 dd_Smed_v4_3422_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019364Si:ch211-193l2.10SMESG000062713.1 dd_Smed_v4_3203_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED3002518133 kDa inner dynein arm light chain, axonemalSMESG000067639.1 SMESG000001266.1 dd_Smed_v4_4453_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30027478SMED30027478SMESG000081245.1 dd_Smed_v4_3287_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023841SMED30023841SMESG000041250.1 dd_Smed_v4_6437_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025164Protein NDRG4SMESG000065324.1 dd_Smed_v4_2911_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30024935FibronectinSMESG000029259.1 dd_Smed_v4_43824_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025232Dynamin-1SMESG000067156.1 dd_Smed_v4_6863_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025205InnexinSMESG000078684.1 SMESG000060499.1 dd_Smed_v4_6114_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032624cilia- and flagella-associated protein 53SMESG000004919.1 dd_Smed_v4_3219_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028505G protein-coupled receptor kinaseSMESG000050449.1 dd_Smed_v4_5929_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026176SMED30026176SMESG000062603.1 dd_3069dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30024152CKLF-like MARVEL transmembrane domain-containing protein 7SMESG000001041.1 dd_Smed_v4_3096_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011268RRM domain-containing protein dd_Smed_v4_78494_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30011268RRM domain-containing protein dd_Smed_v4_53284_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30009226RILP-like protein 1SMESG000009316.1 dd_Smed_v4_4713_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011297SMED30011297SMESG000019881.1 dd_Smed_v4_4454_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012160SMED30012160SMESG000069851.1 dd_Smed_v4_9493_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30012020tphSMESG000000522.1 dd_Smed_v4_8392_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30013735Elongation factor 1-alphaSMESG000061164.1 SMESG000061099.1 dd_Smed_v4_30_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30016196SMED30016196SMESG000059283.1 dd_Smed_v4_62_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30015947Neuropeptide-41 dd_Smed_v4_788_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED3000317640S ribosomal protein S2SMESG000051503.1 dd_Smed_v4_226_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30005911SMED30005911 dd_Smed_v4_12_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30011747SMED30011747 dd_Smed_v4_494_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016488SMED30016488SMESG000067852.1 dd_Smed_v4_62029_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30013840Tektin-2SMESG000065255.1 SMESG000050057.1 dd_Smed_v4_2339_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012212NADH dehydrogenase subunit 1 dd_Smed_v4_258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30016922Parkin coregulated proteinSMESG000000577.1 dd_Smed_v4_3899_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001799NADH dehydrogenase subunit 5 dd_Smed_v4_258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30014446SMEDWI-2SMESG000069984.1 SMESG000069981.1 dd_Smed_v4_756_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30008311SMED30008311SMESG000006280.1 dd_Smed_v4_9073_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012337AnoctaminSMESG000027271.1 dd_Smed_v4_43159_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30012935TGc domain-containing proteinSMESG000080370.1 dd_Smed_v4_4149_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015734SMED30015734SMESG000051340.1 dd_Smed_v4_6953_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30008916SMED30008916SMESG000061077.1 dd_Smed_v4_9714_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013227WD repeat-containing proteinSMESG000042025.1 dd_Smed_v4_9187_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018236Bromodomain adjacent to zinc finger domainSMESG000068165.1 dd_Smed_v4_7394_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013280Pedal peptide prohormone like-2SMESG000059588.1 dd_Smed_v4_1520_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30000682SMED30000682 dd_Smed_v4_1303_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001870SMED30001870 dd_Smed_v4_4311_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014928Formin-like proteinSMESG000044336.1 dd_Smed_v4_3917_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018487SMED30018487 dd_Smed_v4_1312_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006743SMED30006743SMESG000040007.1 SMESG000039999.1 dd_Smed_v4_7457_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009462SMED30009462SMESG000023794.1 SMESG000022518.1 dd_Smed_v4_4051_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30002808SMED30002808 dd_Smed_v4_6289_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002649SMED30002649 dd_Smed_v4_15038_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006840Sel1SMESG000003789.1 dd_Smed_v4_9387_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011961Tensin 3SMESG000019881.1 dd_Smed_v4_4454_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014138LIM homeobox 1bSMESG000022856.1 dd_Smed_v4_8252_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30013315SMED30013315SMESG000022425.1 dd_Smed_v4_3843_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015945Centrin-1SMESG000052182.1 SMESG000015458.1 dd_Smed_v4_3644_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015765SMED30015765SMESG000050352.1 dd_Smed_v4_36253_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007547SMED30007547 dd_Smed_v4_4295_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017499SMED30017499 dd_Smed_v4_459_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006964SMED30006964SMESG000011995.1 dd_Smed_v4_1851_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30007567Lysosomal trafficking regulatorSMESG000069984.1 SMESG000069981.1 dd_Smed_v4_756_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30024009ADP-ribosylation factor-like protein 16 dd_Smed_v4_5801_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED3002737860S ribosomal protein L3SMESG000022732.1 dd_Smed_v4_127_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30032910Protein ANKUB1SMESG000033543.1 dd_Smed_v4_9027_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031050PHB domain-containing proteinSMESG000037334.1 dd_Smed_v4_6396_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020977SMED30020977SMESG000069851.1 dd_Smed_v4_9493_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30022193SMED30022193SMESG000069851.1 dd_Smed_v4_9493_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30032001SMED30032001SMESG000010967.1 dd_Smed_v4_8765_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023917SMED30023917SMESG000058631.1 dd_Smed_v4_4624_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30027978Calcyphosin proteinSMESG000025859.1 dd_Smed_v4_4512_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025563SMED30025563 dd_Smed_v4_1312_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED3002728060S acidic ribosomal protein P0SMESG000079482.1 dd_Smed_v4_161_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30024538Beta-amyloid-like proteinSMESG000025222.1 SMESG000025214.1 SMESG000025213.1 dd_Smed_v4_2561_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025783NADPH--cytochrome P450 reductaseSMESG000022047.1 dd_Smed_v4_542_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023840Membrane-associated phosphatidylinositol transfer protein 1SMESG000004877.1 dd_Smed_v4_7211_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022949SMED30022949SMESG000011995.1 dd_Smed_v4_1851_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30029081CalmodulinSMESG000065184.1 dd_Smed_v4_16185_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30022806Calcyphosin proteinSMESG000025859.1 dd_Smed_v4_4512_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030055Protocadherin-9SMESG000033582.1 dd_Smed_v4_5930_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022406Non-SMC condensin II complex subunit G2 dd_83746dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30026564Ubiquitin carboxyl-terminal hydrolase family proteinSMESG000040007.1 SMESG000039999.1 dd_Smed_v4_7457_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30027710Ras-related protein Rab-3 dd_Smed_v4_7977_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033070SMED30033070SMESG000065665.1 dd_Smed_v4_5803_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30027086SMED30027086 dd_10213dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30033721RRM domain-containing proteinSMESG000019202.1 dd_Smed_v4_37545_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30029070SMED30029070SMESG000038252.1 dd_Smed_v4_4054_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006125C2H2-type domain-containing proteinSMESG000020158.1 Contig29330newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006125C2H2-type domain-containing proteinSMESG000020158.1 Contig29330uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007308Zinc finger proteinSMESG000036361.1 Contig48085newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007308Zinc finger proteinSMESG000036361.1 Contig48085uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000357Transcription factor Sox-2SMESG000077970.1 Contig40500newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000357Transcription factor Sox-2SMESG000077970.1 Contig40500uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033090Hypoxia up-regulated protein 1SMESG000054253.1 Contig43017newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033090Hypoxia up-regulated protein 1SMESG000054253.1 Contig43017uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032370Beta-1,3-glucosyltransferaseSMESG000009947.1 Contig40970newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032370Beta-1,3-glucosyltransferaseSMESG000009947.1 Contig40970uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026655SMED30026655SMESG000069153.1 Contig19711newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026655SMED30026655SMESG000069153.1 Contig19711uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031920calmodulin-like protein 3SMESG000067105.1 Contig33951newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031920calmodulin-like protein 3SMESG000067105.1 Contig33951uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002931SMED30002931 Contig41672newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002931SMED30002931 Contig41672uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010313GTPase Obg Contig26599newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010313GTPase Obg Contig26599uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004458SMED30004458 Contig26599newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004458SMED30004458 Contig26599uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006249SMED30006249 Contig27489newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018753SMED30018753 Contig25228newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013983BED-type domain-containing protein Contig12801newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013983BED-type domain-containing protein Contig12801uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015762SMED30015762 Contig51263newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019333Dimer_Tnp_hAT domain-containing protein Contig21299newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019333Dimer_Tnp_hAT domain-containing protein Contig21299uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016823SMED30016823 Contig47745newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016823SMED30016823 Contig47745uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003880slc1a-3 Contig53337newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003880slc1a-3 Contig53337uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000765Dynactin subunit 4 Contig41672newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000765Dynactin subunit 4 Contig41672uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019081BED-type domain-containing protein Contig12801newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019081BED-type domain-containing protein Contig12801uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028300SMED30028300 Contig40705newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028300SMED30028300 Contig40705uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008060SMED30008060 Contig28354newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012523SMED30012523 Contig20460newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012523SMED30012523 Contig20460uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004979SWIM-type domain-containing protein Contig40435newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004979SWIM-type domain-containing protein Contig40435uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014856SMED30014856 Contig12801newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014856SMED30014856 Contig12801uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029329cdc45-like protein Contig40435newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029329cdc45-like protein Contig40435uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022945Matrin-type domain-containing protein Contig43167newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022945Matrin-type domain-containing protein Contig43167uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031833SMED30031833 Contig14600newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031833SMED30031833 Contig14600uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020992Aristaless-like homeobox transcription factorSMESG000030143.1 KX961610smed_ncbi_20200123PMID:27864883
Currie et al., 2016
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30005185Homeobox proteinSMESG000081885.1 dd_Smed_v6_13898_0_1dd_Smed_v6PMID:27864883
Currie et al., 2016
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30001679Calcium-transporting ATPaseSMESG000014734.1 dd_Smed_v6_1721_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30004574SMED30004574SMESG000004485.1 dd_Smed_v6_1440_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30010096TPA_inf: prohormone convertase 2SMESG000008070.1 dd_Smed_v6_1566_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30022907SynaptotagminSMESG000025329.1 dd_Smed_v6_4222_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30027886SMED30027886SMESG000003427.1 dd_Smed_v6_2708_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30020678G-protein, gamma subunit,domain-containing proteinSMESG000066557.1 dd_Smed_v6_1237_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30000065SMED30000065SMESG000049103.1 dd_Smed_v6_397_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30029426Baculoviral IAP repeat-containing protein 7SMESG000067789.1 dd_Smed_v6_1187_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30034920G protein gamma domain-containing proteinSMESG000066557.1 dd_Smed_v6_1237_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30031693Antolefinin (Antolefinine)SMESG000019220.1 dd_Smed_v6_2253_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30020821SMED30020821SMESG000014298.1 dd_Smed_v6_1301_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30031715Spectrin beta chainSMESG000035098.1 dd_Smed_v6_1684_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30022870SMED30022870SMESG000079579.1 dd_Smed_v6_16102_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30020627Echinoderm microtubule associated protein like 1SMESG000017256.1 dd_Smed_v6_14226_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30022167SMED30022167SMESG000031417.1 dd_Smed_v6_11958_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30019682Leukocyte receptor cluster member 8-like proteinSMESG000080104.1 SMESG000075783.1 dd_Smed_v6_2926_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30024428CalmodulinSMESG000018137.1 SMESG000018135.1 dd_Smed_v6_4669_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED3002512114-3-3 protein epsilonSMESG000076939.1 dd_Smed_v6_251_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30019373Rab6-interacting protein 2/elks/erc/cast,putativeSMESG000051528.1 dd_Smed_v6_12278_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30015151Phosphatidylinositol transfer protein alpha isoformSMESG000080104.1 SMESG000075783.1 dd_Smed_v6_2926_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30004042dynein heavy chain 3, axonemalSMESG000013738.1 SMESG000013737.1 dd_Smed_v6_9009_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30006541SMED30006541SMESG000012332.1 SMESG000012317.1 SMESG000058958.1 SMESG000058954.1 dd_Smed_v6_246_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30008718SMED30008718SMESG000012332.1 SMESG000012317.1 SMESG000058958.1 SMESG000058954.1 dd_Smed_v6_246_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30002133PolyubiquitinSMESG000039444.1 SMESG000014081.1 dd_Smed_v6_34_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30014194Stonin-1/2SMESG000017305.1 dd_Smed_v6_6859_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30003384Doublecortin domain-containing proteinSMESG000033740.1 dd_Smed_v6_6712_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30019874CalmodulinSMESG000010769.1 dd_Smed_v6_255_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30021196SMED30021196 dd_1248dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30033407C2H2-type domain-containing proteinSMESG000059040.1 dd_Smed_v4_9365_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30034853Zinc finger protein dd_Smed_v4_10676_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020525Dynein intermediate chain 2, ciliarySMESG000001839.1 SMESG000001830.1 dd_Smed_v4_4753_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033976Steroid 17-alpha-hydroxylase/17,20 lyaseSMESG000080703.1 dd_Smed_v4_4331_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021145SMED30021145SMESG000023086.1 dd_Smed_v4_6287_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30025174Selenoprotein W dd_Smed_v4_1908_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035983SMED30035983SMESG000032618.1 SMESG000032616.1 dd_Smed_v4_34828_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30032615SMED30032615 dd_77162dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30034140Myb-like domain-containing proteinSMESG000019869.1 dd_Smed_v4_8671_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026932noggin-like protein 8SMESG000008387.1 dd_Smed_v4_8738_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30026678SMED30026678 dd_Smed_v4_3577_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026615Neuropeptide Y prohormone-6 dd_Smed_v4_7141_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30032738SMED30032738 dd_29115dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30031308ATP synthase F0 subunit 6 dd_Smed_v4_258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30034623cytochrome c oxidase subunit III dd_Smed_v4_258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30029638SMED30029638SMESG000044534.1 dd_Smed_v4_9407_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021386Y box protein-1SMESG000058066.1 dd_Smed_v4_52_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30032304Hypotheticial protein dd_Smed_v4_8879_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033740SMED30033740 dd_Smed_v4_258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30030766Y box protein-1SMESG000058066.1 dd_Smed_v4_52_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30025621SMED30025621SMESG000028436.1 dd_Smed_v4_3306_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30025844SMED30025844 dd_Smed_v4_4311_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029899slc25a-30SMESG000044697.1 SMESG000022161.1 dd_Smed_v4_50_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30006130Transmembrane proteinSMESG000009898.1 dd_Smed_v4_3881_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017193Protocadherin 1SMESG000010555.1 dd_Smed_v4_12697_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30016257WD_REPEATS_REGION domain-containing proteinSMESG000001039.1 dd_Smed_v4_19827_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015887DUF4550 domain-containing proteinSMESG000000883.1 dd_Smed_v4_10058_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007004SMED30007004SMESG000019033.1 dd_Smed_v4_12403_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30000342SMED30000342SMESG000047115.1 SMESG000004000.1 dd_Smed_v4_2558_0_2dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006229SMED30006229SMESG000019033.1 dd_Smed_v4_12403_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30007557DUF4515 domain-containing proteinSMESG000013289.1 dd_Smed_v4_13384_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015821Neuropeptide-22SMESG000043852.1 dd_Smed_v4_1483_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30002718Family with sequence similarity 227 member BSMESG000052176.1 SMESG000046302.1 dd_Smed_v4_15102_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009900Copine-3SMESG000064685.1 dd_Smed_v4_15889_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000256Golgin subfamily A member 2SMESG000047115.1 SMESG000004000.1 dd_Smed_v4_2558_0_2dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002255Regulating synaptic membrane exocytosis protein 2SMESG000023007.1 dd_Smed_v4_10734_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005127Voltage-dependent L-type calcium channel subunit alphaSMESG000000524.1 dd_Smed_v4_8899_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005734FMRFamide-activated amiloride-sensitive sodium channelSMESG000079502.1 dd_Smed_v4_30612_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED3000109640S ribosomal protein S23SMESG000017264.1 dd_Smed_v4_290_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30000126Centrosomal protein 95SMESG000002923.1 dd_Smed_v4_8515_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001357XendoU domain-containing proteinSMESG000008612.1 dd_Smed_v4_25168_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006402Progesterone immunomodulatory binding factor 1SMESG000046936.1 dd_Smed_v4_13444_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018233Troponin C, skeletal muscleSMESG000005066.1 dd_Smed_v4_12048_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018152Plac8 onzin related protein 1SMESG000050208.1 dd_Smed_v4_12014_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003997SMED30003997SMESG000059318.1 SMESG000059304.1 dd_Smed_v4_483_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30015723RNA-binding protein MusashiSMESG000045507.1 SMESG000045502.1 dd_Smed_v4_13817_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001648Phosphatase and actin regulatorSMESG000040085.1 dd_Smed_v4_5826_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007660Degenerin unc-8SMESG000073267.1 dd_22386dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30001553SCP domain-containing proteinSMESG000036385.1 dd_5744dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30001299SMED30001299SMESG000010387.1 dd_Smed_v4_13587_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30014124SMED30014124SMESG000024190.1 dd_Smed_v4_1790_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017333centrosomal protein of 83 kDa-likeSMESG000033227.1 SMESG000033225.1 dd_Smed_v4_12969_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED3000448460S ribosomal protein L8SMESG000017087.1 dd_Smed_v4_108_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30016942Scratch family zinc finger 2SMESG000041786.1 dd_Smed_v4_18952_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016384Thymidylate kinaseSMESG000016181.1 dd_Smed_v4_3849_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000887Ribosome biogenesis protein WDR12 homologSMESG000068152.1 dd_Smed_v4_8737_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30023872Zinc finger MYM-type protein 5SMESG000055398.1 dd_Smed_v4_11239_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021961Protocadherin alpha-11SMESG000012176.1 dd_Smed_v4_15901_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033718SMED30033718SMESG000061174.1 dd_Smed_v4_12214_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031139WASH complex subunit 2CSMESG000014537.1 SMESG000014534.1 dd_Smed_v4_19560_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031345Pyruvate dehydrogenase E1 component subunit alphaSMESG000073271.1 dd_Smed_v4_1310_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029127Glutamate receptor ionotropicSMESG000022851.1 dd_Smed_v4_14655_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020257DUF3421 domain-containing proteinSMESG000046742.1 dd_Smed_v4_1040_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029805Kinesin proteinSMESG000013633.1 SMESG000013625.1 dd_Smed_v4_13562_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029940SMED30029940SMESG000019033.1 dd_Smed_v4_12403_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30030985SMED30030985SMESG000003465.1 dd_Smed_v4_10573_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031880Family with sequence similarity 227 member BSMESG000052176.1 SMESG000046302.1 dd_Smed_v4_15102_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035145Syntaxin binding proteinSMESG000060160.1 dd_Smed_v4_10167_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30034180Alpha-int-4SMESG000018926.1 dd_Smed_v4_11948_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029555Serine/arginine-rich splicing factor 4SMESG000045507.1 SMESG000045502.1 dd_Smed_v4_13817_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028328Protocadherin alpha-2SMESG000069340.1 dd_Smed_v4_14209_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031741slc16a-17SMESG000035197.1 dd_Smed_v4_11626_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020834SMED30020834SMESG000060160.1 dd_Smed_v4_10167_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032126AndroglobinSMESG000053594.1 SMESG000047986.1 dd_Smed_v4_10677_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030833SMED30030833SMESG000032988.1 dd_Smed_v4_10864_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023116Glycine receptor subunit alpha-3SMESG000037124.1 dd_Smed_v4_15331_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031035SMED30031035SMESG000069327.1 dd_Smed_v4_13889_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004547Protein FAM149ASMESG000009635.1 dd_Smed_v6_13092_0_1dd_Smed_v6PMID:30399335
Ross et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001191Transcription factor Sox-2SMESG000067682.1 SMESG000060099.1 dd_Smed_v6_8104_0_1dd_Smed_v6PMID:30399335
Ross et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033894Neur_chan_LBD domain-containing proteinSMESG000041829.1 DN298606ncbi_smed_estsPMID:30399335
Ross et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020627Echinoderm microtubule associated protein like 1SMESG000017256.1 dd_Smed_v6_14226_0_1dd_Smed_v6PMID:30399335
Ross et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018173Sodium/potassium-transporting ATPase subunit beta-1 isoform 2SMESG000064592.1 DN290772ncbi_smed_estsPMID:30399335
Ross et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED3002901916 kDa calcium-binding proteinSMESG000066843.1 DN289738ncbi_smed_estsPMID:30399335
Ross et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019347G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000040059.1 SMESG000040051.1 dd_Smed_v6_16286_0_2dd_Smed_v6PMID:30399335
Ross et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020055Neur_chan_LBD domain-containing proteinSMESG000041829.1 DN298606ncbi_smed_estsPMID:30399335
Ross et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020055Neur_chan_LBD domain-containing proteinSMESG000064433.1 DN290586ncbi_smed_estsPMID:30399335
Ross et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004042dynein heavy chain 3, axonemalSMESG000013737.1 SMESG000013731.1 dd_Smed_v6_23484_0_1dd_Smed_v6PMID:30399335
Ross et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008112Mitogen-activated protein kinaseSMESG000081061.1 DN309332ncbi_smed_estsPMID:30399335
Ross et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004363cAMP-dependent protein kinase catalytic subunit alphaSMESG000063155.1 dd_Smed_v6_5162_0_1dd_Smed_v6PMID:30399335
Ross et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001575EF-hand calcium-binding domain-containing protein 6SMESG000009107.1 dd_Smed_v6_7631_0_1dd_Smed_v6PMID:30399335
Ross et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014978PKD2L-1SMESG000018514.1 SMESG000018510.1 dd_Smed_v6_15626_0_1dd_Smed_v6PMID:30399335
Ross et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002478death domain-containing protein 1SMESG000048822.1 dd_Smed_v6_15379_0_1dd_Smed_v6PMID:30399335
Ross et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004813SMED30004813SMESG000048822.1 dd_Smed_v6_15379_0_1dd_Smed_v6PMID:30399335
Ross et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002976Integrase_H2C2 domain-containing proteinSMESG000031440.1 dd_Smed_v6_9924_0_1dd_Smed_v6PMID:30399335
Ross et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014505kcnkaSMESG000016405.1 dd_Smed_v6_19825_0_1dd_Smed_v6PMID:30399335
Ross et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014507FibronectinSMESG000029226.1 SMESG000029259.1 dd_Smed_v6_16808_0_1dd_Smed_v6PMID:30399335
Ross et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004732PKD1L-2SMESG000014725.1 SMESG000014723.1 dd_Smed_v6_13975_0_1dd_Smed_v6PMID:30399335
Ross et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003563Neur_chan_LBD domain-containing proteinSMESG000041914.1 dd_Smed_v6_14474_0_1dd_Smed_v6PMID:30399335
Ross et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001229PKD1L-2SMESG000014725.1 SMESG000014723.1 dd_Smed_v6_13975_0_1dd_Smed_v6PMID:30399335
Ross et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012826SMED30012826SMESG000017012.1 SMESG000017011.1 dd_Smed_v6_309_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30000763SMED30000763SMESG000001486.1 SMESG000068156.1 SMESG000064685.1 SMESG000011804.1 SMESG000010609.1 SMESG000062429.1 SMESG000053533.1 SMESG000015751.1 dd_Smed_v6_1671_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30014507FibronectinSMESG000029226.1 SMESG000029259.1 dd_Smed_v6_16808_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30012522Ankyrin-2SMESG000026655.1 dd_Smed_v6_10835_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30029683SMED30029683SMESG000023213.1 SMESG000023211.1 dd_Smed_v6_3814_1dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30023993SMED30023993SMESG000029226.1 SMESG000029259.1 dd_Smed_v6_16808_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30030724Protein numbSMESG000016237.1 SMESG000033358.1 dd_Smed_v6_507_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30033646SMED30033646SMESG000022408.1 dd_Smed_v6_2191_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30013023CalmodulinSMESG000034095.1 SMESG000034094.1 dd_Smed_v6_414_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30007990FH2 domain-containing proteinSMESG000034095.1 SMESG000034094.1 dd_Smed_v6_414_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30014318SBF2 domain-containing proteinSMESG000078604.1 dd_Smed_v6_3628_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30000428Glutathione S-transferaseSMESG000016836.1 dd_Smed_v6_816_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30033594Microtubule-associated protein 1ASMESG000014298.1 dd_Smed_v6_3654_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30033594Microtubule-associated protein 1ASMESG000014298.1 dd_Smed_v6_1301_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30022151CaveolinSMESG000074524.1 dd_Smed_v6_8555_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30015808TNF receptor-associated factorSMESG000066529.1 SMESG000053822.1 SMESG000029555.1 SMESG000010523.1 SMESG000023758.1 SMESG000074160.1 SMESG000019863.1 SMESG000001468.1 dd_Smed_v6_5675_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30008560Secretogranin 5SMESG000016510.1 dd_Smed_v6_3862_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30017089SMED30017089SMESG000066529.1 SMESG000053822.1 SMESG000029555.1 SMESG000010523.1 SMESG000023758.1 SMESG000074160.1 SMESG000019863.1 SMESG000001468.1 dd_Smed_v6_5675_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30016700Neuronal calcium sensor 2SMESG000015070.1 dd_Smed_v6_3283_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30013744SMED30013744SMESG000066529.1 SMESG000053822.1 SMESG000029555.1 SMESG000010523.1 SMESG000023758.1 SMESG000074160.1 SMESG000019863.1 SMESG000001468.1 dd_Smed_v6_5675_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30010333SMED30010333SMESG000061908.1 dd_Smed_v6_2392_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30007445RNA-binding protein 5SMESG000061908.1 dd_Smed_v6_2392_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30032314Peptidylglycine alpha-hydroxylating monooxygenaseSMESG000073851.1 dd_Smed_v6_2646_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30033924PKD2L-2SMESG000018504.1 dd_Smed_v6_9977_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30023882Rootletin-2SMESG000081227.1 dd_Smed_v6_6573_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30022777SMED30022777SMESG000026662.1 dd_Smed_v6_5031_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30032823NeurotrypsinSMESG000081574.1 SMESG000081529.1 SMESG000079557.1 SMESG000079250.1 SMESG000077556.1 SMESG000075496.1 SMESG000073961.1 SMESG000073618.1 SMESG000073174.1 SMESG000071859.1 SMESG000071198.1 SMESG000071073.1 SMESG000070153.1 SMESG000068262.1 SMESG000068028.1 SMESG000067334.1 SMESG000065567.1 SMESG000061192.1 SMESG000060952.1 SMESG000060260.1 SMESG000059623.1 SMESG000050479.1 SMESG000050299.1 SMESG000049776.1 SMESG000048159.1 SMESG000044971.1 SMESG000043973.1 SMESG000042620.1 SMESG000040932.1 SMESG000039792.1 SMESG000039741.1 SMESG000039356.1 SMESG000034716.1 SMESG000033763.1 SMESG000029286.1 SMESG000028614.1 SMESG000027381.1 SMESG000025022.1 SMESG000021522.1 SMESG000020398.1 SMESG000019968.1 SMESG000018320.1 SMESG000015216.1 SMESG000015117.1 SMESG000015102.1 SMESG000013389.1 SMESG000012534.1 SMESG000012464.1 SMESG000011278.1 SMESG000011147.1 SMESG000007021.1 SMESG000001897.1 SMESG000068881.1 SMESG000064552.1 SMESG000056926.1 SMESG000050300.1 SMESG000043279.1 SMESG000018675.1 SMESG000017256.1 SMESG000013089.1 SMESG000011196.1 SMESG000009621.1 SMESG000006554.1 SMESG000005066.1 SMESG000050492.1 SMESG000070487.1 SMESG000063831.1 SMESG000047318.1 SMESG000047014.1 SMESG000030931.1 SMESG000023641.1 SMESG000013665.1 SMESG000008519.1 dd_Smed_v6_129_2dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30030455TetraspaninSMESG000056558.1 dd_Smed_v6_3175_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30008508SMED30008508SMESG000055230.1 SMESG000044487.1 dd_Smed_v6_921_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30001395neural proliferation differentiation and control protein 1SMESG000059206.1 dd_Smed_v6_2985_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30035013SMED30035013SMESG000077800.1 SMESG000054046.1 SMESG000052058.1 SMESG000044674.1 SMESG000066333.1 SMESG000052053.1 SMESG000052952.1 SMESG000080770.1 SMESG000065333.1 SMESG000063486.1 SMESG000059844.1 SMESG000058646.1 SMESG000055266.1 SMESG000054970.1 SMESG000052813.1 SMESG000043147.1 SMESG000037745.1 SMESG000037601.1 SMESG000036070.1 SMESG000034880.1 SMESG000034368.1 SMESG000031415.1 SMESG000019663.1 SMESG000010897.1 SMESG000009005.1 SMESG000006729.1 SMESG000005029.1 SMESG000003989.1 dd_Smed_v6_1760_1dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30035359SMED30035359SMESG000081574.1 SMESG000081529.1 SMESG000079557.1 SMESG000079250.1 SMESG000077556.1 SMESG000075496.1 SMESG000073961.1 SMESG000073618.1 SMESG000073174.1 SMESG000071859.1 SMESG000071198.1 SMESG000071073.1 SMESG000070153.1 SMESG000068262.1 SMESG000068028.1 SMESG000067334.1 SMESG000065567.1 SMESG000061192.1 SMESG000060952.1 SMESG000060260.1 SMESG000059623.1 SMESG000050479.1 SMESG000050299.1 SMESG000049776.1 SMESG000048159.1 SMESG000044971.1 SMESG000043973.1 SMESG000042620.1 SMESG000040932.1 SMESG000039792.1 SMESG000039741.1 SMESG000039356.1 SMESG000034716.1 SMESG000033763.1 SMESG000029286.1 SMESG000028614.1 SMESG000027381.1 SMESG000025022.1 SMESG000021522.1 SMESG000020398.1 SMESG000019968.1 SMESG000018320.1 SMESG000015216.1 SMESG000015117.1 SMESG000015102.1 SMESG000013389.1 SMESG000012534.1 SMESG000012464.1 SMESG000011278.1 SMESG000011147.1 SMESG000007021.1 SMESG000001897.1 SMESG000068881.1 SMESG000064552.1 SMESG000056926.1 SMESG000050300.1 SMESG000043279.1 SMESG000018675.1 SMESG000017256.1 SMESG000013089.1 SMESG000011196.1 SMESG000009621.1 SMESG000006554.1 SMESG000005066.1 SMESG000050492.1 SMESG000070487.1 SMESG000063831.1 SMESG000047318.1 SMESG000047014.1 SMESG000030931.1 SMESG000023641.1 SMESG000013665.1 SMESG000008519.1 dd_Smed_v6_129_2dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30034319SMED30034319SMESG000001486.1 SMESG000068156.1 SMESG000064685.1 SMESG000011804.1 SMESG000010609.1 SMESG000062429.1 SMESG000053533.1 SMESG000015751.1 dd_Smed_v6_1671_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30031525Choline O-acetyltransferaseSMESG000051357.1 dd_Smed_v6_11968_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30030309SMED30030309SMESG000075212.1 SMESG000074907.1 SMESG000075211.1 SMESG000074910.1 SMESG000074908.1 dd_Smed_v6_1061_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30032354EOG090X01A3SMESG000001486.1 SMESG000068156.1 SMESG000064685.1 SMESG000011804.1 SMESG000010609.1 SMESG000062429.1 SMESG000053533.1 SMESG000015751.1 dd_Smed_v6_1671_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30034827Histone-lysine N-methyltransferase SETMARSMESG000081574.1 SMESG000081529.1 SMESG000079557.1 SMESG000079250.1 SMESG000077556.1 SMESG000075496.1 SMESG000073961.1 SMESG000073618.1 SMESG000073174.1 SMESG000071859.1 SMESG000071198.1 SMESG000071073.1 SMESG000070153.1 SMESG000068262.1 SMESG000068028.1 SMESG000067334.1 SMESG000065567.1 SMESG000061192.1 SMESG000060952.1 SMESG000060260.1 SMESG000059623.1 SMESG000050479.1 SMESG000050299.1 SMESG000049776.1 SMESG000048159.1 SMESG000044971.1 SMESG000043973.1 SMESG000042620.1 SMESG000040932.1 SMESG000039792.1 SMESG000039741.1 SMESG000039356.1 SMESG000034716.1 SMESG000033763.1 SMESG000029286.1 SMESG000028614.1 SMESG000027381.1 SMESG000025022.1 SMESG000021522.1 SMESG000020398.1 SMESG000019968.1 SMESG000018320.1 SMESG000015216.1 SMESG000015117.1 SMESG000015102.1 SMESG000013389.1 SMESG000012534.1 SMESG000012464.1 SMESG000011278.1 SMESG000011147.1 SMESG000007021.1 SMESG000001897.1 SMESG000068881.1 SMESG000064552.1 SMESG000056926.1 SMESG000050300.1 SMESG000043279.1 SMESG000018675.1 SMESG000017256.1 SMESG000013089.1 SMESG000011196.1 SMESG000009621.1 SMESG000006554.1 SMESG000005066.1 SMESG000050492.1 SMESG000070487.1 SMESG000063831.1 SMESG000047318.1 SMESG000047014.1 SMESG000030931.1 SMESG000023641.1 SMESG000013665.1 SMESG000008519.1 dd_Smed_v6_129_2dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30028719SMED30028719SMESG000001486.1 SMESG000068156.1 SMESG000064685.1 SMESG000011804.1 SMESG000010609.1 SMESG000062429.1 SMESG000053533.1 SMESG000015751.1 dd_Smed_v6_1671_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30005554SMED30005554SMESG000016237.1 SMESG000033358.1 dd_Smed_v6_507_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30000316Interferon-induced GTP-binding protein Mx1SMESG000002216.1 SMESG000002124.1 SMESG000002025.1 SMESG000002023.1 SMESG000002011.1 SMESG000002004.1 SMESG000002219.1 SMESG000002211.1 SMESG000002032.1 SMESG000002033.1 dd_Smed_v6_884_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30016078Actin, cytoplasmicSMESG000012332.1 SMESG000012317.1 SMESG000058958.1 SMESG000058954.1 dd_Smed_v6_246_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30016078Actin, cytoplasmicSMESG000012332.1 SMESG000012317.1 dd_Smed_v6_285_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30035526SMED30035526SMESG000018598.1 dd_Smed_v6_716_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30008609SMED30008609SMESG000059918.1 SMESG000052306.1 SMESG000022407.1 dd_Smed_v6_474_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30005146SMED30005146SMESG000001486.1 SMESG000068156.1 SMESG000064685.1 SMESG000011804.1 SMESG000010609.1 SMESG000062429.1 SMESG000053533.1 SMESG000015751.1 dd_Smed_v6_1671_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30007788Transcription elongation regulator 1SMESG000011919.1 dd_Smed_v6_1147_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30000771SMED30000771SMESG000059918.1 SMESG000052306.1 SMESG000022407.1 dd_Smed_v6_474_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30016287Reverse transcriptase domain-containing proteinSMESG000081574.1 SMESG000081529.1 SMESG000079557.1 SMESG000079250.1 SMESG000077556.1 SMESG000075496.1 SMESG000073961.1 SMESG000073618.1 SMESG000073174.1 SMESG000071859.1 SMESG000071198.1 SMESG000071073.1 SMESG000070153.1 SMESG000068262.1 SMESG000068028.1 SMESG000067334.1 SMESG000065567.1 SMESG000061192.1 SMESG000060952.1 SMESG000060260.1 SMESG000059623.1 SMESG000050479.1 SMESG000050299.1 SMESG000049776.1 SMESG000048159.1 SMESG000044971.1 SMESG000043973.1 SMESG000042620.1 SMESG000040932.1 SMESG000039792.1 SMESG000039741.1 SMESG000039356.1 SMESG000034716.1 SMESG000033763.1 SMESG000029286.1 SMESG000028614.1 SMESG000027381.1 SMESG000025022.1 SMESG000021522.1 SMESG000020398.1 SMESG000019968.1 SMESG000018320.1 SMESG000015216.1 SMESG000015117.1 SMESG000015102.1 SMESG000013389.1 SMESG000012534.1 SMESG000012464.1 SMESG000011278.1 SMESG000011147.1 SMESG000007021.1 SMESG000001897.1 SMESG000068881.1 SMESG000064552.1 SMESG000056926.1 SMESG000050300.1 SMESG000043279.1 SMESG000018675.1 SMESG000017256.1 SMESG000013089.1 SMESG000011196.1 SMESG000009621.1 SMESG000006554.1 SMESG000005066.1 SMESG000050492.1 SMESG000070487.1 SMESG000063831.1 SMESG000047318.1 SMESG000047014.1 SMESG000030931.1 SMESG000023641.1 SMESG000013665.1 SMESG000008519.1 dd_Smed_v6_129_2dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30010523SMED30010523SMESG000077800.1 SMESG000054046.1 SMESG000052058.1 SMESG000044674.1 SMESG000066333.1 SMESG000052053.1 SMESG000052952.1 SMESG000080770.1 SMESG000065333.1 SMESG000063486.1 SMESG000059844.1 SMESG000058646.1 SMESG000055266.1 SMESG000054970.1 SMESG000052813.1 SMESG000043147.1 SMESG000037745.1 SMESG000037601.1 SMESG000036070.1 SMESG000034880.1 SMESG000034368.1 SMESG000031415.1 SMESG000019663.1 SMESG000010897.1 SMESG000009005.1 SMESG000006729.1 SMESG000005029.1 SMESG000003989.1 dd_Smed_v6_1760_1dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30001359SMED30001359SMESG000059918.1 SMESG000052306.1 SMESG000022407.1 dd_Smed_v6_474_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30012726SMED30012726SMESG000081574.1 SMESG000081529.1 SMESG000079557.1 SMESG000079250.1 SMESG000077556.1 SMESG000075496.1 SMESG000073961.1 SMESG000073618.1 SMESG000073174.1 SMESG000071859.1 SMESG000071198.1 SMESG000071073.1 SMESG000070153.1 SMESG000068262.1 SMESG000068028.1 SMESG000067334.1 SMESG000065567.1 SMESG000061192.1 SMESG000060952.1 SMESG000060260.1 SMESG000059623.1 SMESG000050479.1 SMESG000050299.1 SMESG000049776.1 SMESG000048159.1 SMESG000044971.1 SMESG000043973.1 SMESG000042620.1 SMESG000040932.1 SMESG000039792.1 SMESG000039741.1 SMESG000039356.1 SMESG000034716.1 SMESG000033763.1 SMESG000029286.1 SMESG000028614.1 SMESG000027381.1 SMESG000025022.1 SMESG000021522.1 SMESG000020398.1 SMESG000019968.1 SMESG000018320.1 SMESG000015216.1 SMESG000015117.1 SMESG000015102.1 SMESG000013389.1 SMESG000012534.1 SMESG000012464.1 SMESG000011278.1 SMESG000011147.1 SMESG000007021.1 SMESG000001897.1 SMESG000068881.1 SMESG000064552.1 SMESG000056926.1 SMESG000050300.1 SMESG000043279.1 SMESG000018675.1 SMESG000017256.1 SMESG000013089.1 SMESG000011196.1 SMESG000009621.1 SMESG000006554.1 SMESG000005066.1 SMESG000050492.1 SMESG000070487.1 SMESG000063831.1 SMESG000047318.1 SMESG000047014.1 SMESG000030931.1 SMESG000023641.1 SMESG000013665.1 SMESG000008519.1 dd_Smed_v6_129_2dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30008052SMED30008052SMESG000075212.1 SMESG000074907.1 SMESG000075211.1 SMESG000074910.1 SMESG000074908.1 dd_Smed_v6_1061_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30020402SMED30020402SMESG000011919.1 dd_Smed_v6_1147_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30024587TNF receptor-associated factorSMESG000081574.1 SMESG000081529.1 SMESG000079557.1 SMESG000079250.1 SMESG000077556.1 SMESG000075496.1 SMESG000073961.1 SMESG000073618.1 SMESG000073174.1 SMESG000071859.1 SMESG000071198.1 SMESG000071073.1 SMESG000070153.1 SMESG000068262.1 SMESG000068028.1 SMESG000067334.1 SMESG000065567.1 SMESG000061192.1 SMESG000060952.1 SMESG000060260.1 SMESG000059623.1 SMESG000050479.1 SMESG000050299.1 SMESG000049776.1 SMESG000048159.1 SMESG000044971.1 SMESG000043973.1 SMESG000042620.1 SMESG000040932.1 SMESG000039792.1 SMESG000039741.1 SMESG000039356.1 SMESG000034716.1 SMESG000033763.1 SMESG000029286.1 SMESG000028614.1 SMESG000027381.1 SMESG000025022.1 SMESG000021522.1 SMESG000020398.1 SMESG000019968.1 SMESG000018320.1 SMESG000015216.1 SMESG000015117.1 SMESG000015102.1 SMESG000013389.1 SMESG000012534.1 SMESG000012464.1 SMESG000011278.1 SMESG000011147.1 SMESG000007021.1 SMESG000001897.1 SMESG000068881.1 SMESG000064552.1 SMESG000056926.1 SMESG000050300.1 SMESG000043279.1 SMESG000018675.1 SMESG000017256.1 SMESG000013089.1 SMESG000011196.1 SMESG000009621.1 SMESG000006554.1 SMESG000005066.1 SMESG000050492.1 SMESG000070487.1 SMESG000063831.1 SMESG000047318.1 SMESG000047014.1 SMESG000030931.1 SMESG000023641.1 SMESG000013665.1 SMESG000008519.1 dd_Smed_v6_129_2dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30020990Eukaryotic translation initiation factor 2 subunit 2SMESG000081574.1 SMESG000081529.1 SMESG000079557.1 SMESG000079250.1 SMESG000077556.1 SMESG000075496.1 SMESG000073961.1 SMESG000073618.1 SMESG000073174.1 SMESG000071859.1 SMESG000071198.1 SMESG000071073.1 SMESG000070153.1 SMESG000068262.1 SMESG000068028.1 SMESG000067334.1 SMESG000065567.1 SMESG000061192.1 SMESG000060952.1 SMESG000060260.1 SMESG000059623.1 SMESG000050479.1 SMESG000050299.1 SMESG000049776.1 SMESG000048159.1 SMESG000044971.1 SMESG000043973.1 SMESG000042620.1 SMESG000040932.1 SMESG000039792.1 SMESG000039741.1 SMESG000039356.1 SMESG000034716.1 SMESG000033763.1 SMESG000029286.1 SMESG000028614.1 SMESG000027381.1 SMESG000025022.1 SMESG000021522.1 SMESG000020398.1 SMESG000019968.1 SMESG000018320.1 SMESG000015216.1 SMESG000015117.1 SMESG000015102.1 SMESG000013389.1 SMESG000012534.1