neuron

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ In Situ Hybridization Data

  ▻ Sequences

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  neuron


DEFINITON:

  The basic cellular unit of nervous tissue. Each neuron consists of a body, an axon, and dendrites. Their purpose is to receive, conduct, and transmit impulses in the nervous system.


TERM DEFINITION CITATIONS:

  CL:0000540


TERM CITATIONS:


TERM ID:

  PLANA:0000099


ABOUT THIS TERM:

neuron

  ↳is a electrically signaling cell



Expand to see terms that part of neuron

  → synapse
  → synaptic cleft
  → synaptic vesicle
  → neurite


BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30022907SynaptotagminDj-sytStage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, ventral nerve cord, neuron, cephalic ganglia, nervous system, embryonic pharynx
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 ┬Ám

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30019471 ID=SMED30019471|Name=Synaptotagmin|organism=Schmidtea mediterranea sexual|type=transcript|length=1910bp
TTTGGGACTTCTCCAATCTATTAAATATATTTAGAACGAACATCGTTGTGAGAAGCTTTGTCTTGCAAATGCACACCAAC
ACATTCTCTGCCTACTCGAGACCAGCCTGAAGGACGCACCCAGTCATCTCTTATAAAAAAAAAACTCTTCTCTGATTCGG
TATTTTCTGATTAATGGAGATCAAACAATGATTGGGCAACGTCTAGTTTAGAATATTTACAACTAAATCTGCGTATTTCA
ATTTTTTTTCGATTTTGATTGTTGCAAATATTTATGAGTATATCCAATAATATAAGCAGCGCTAGTAATATGACGATAAA
AATGCAACAAAATGTTGAAAAGTCTGTATCACAGCATGTAACAGCGCAAACAAAGGAATCAACATCAAATAAACTTCATA
CAACAACAGCCGGTATCTCGGTTTTGGAGAAAACATTAAAAACATTTCACATGAGTACTGGCACTTTGATTGGAATCGGA
GTTACAGTGTCTATCGTAGTTTTATTACTTCTTTATTGTATTTGCAAACGATGCATTAAGAAACGAAAGAAAAAGAAAGA
TGGCGGCAAAAAAGGTGGAAAAGGCGTAGACATGAAAAGCGTACAACTATTAGGAAATGCTTATAAAGAAAAGGTACAGC
CGGACCTAGAAGAACTGGATGCTAACATGGAAGATAATGAAGGGGCGCAAGATAAAGAAGCAGTCAATCTTGGAAAATTA
CAGTATTCCCTTGATTACGATTTTACAAAAGGCGAGCTAACAGTCGGAGTAATTCAAGCCACAGATCTCCCAGCAATGGA
CATGTCAGGAACTTCTGATCCATATGTGAAAGTTTTTCTATTACCGGATAAAAAGAAAAAATTCGAAACCAAAGTTCATC
GAAAAATATTAAATCCAGTCTTTAATGAGACATTTGTATTCAAGATTCCTTATTCTGAGGTCGGGTCTAAAACTTTGGTA
TTTAATGTTTTCGATTTCGACAGATTTTCAAAGCATGATCAAATTGGGCAAATCCAAATTCCACTGGGTTCAGTAGATTT
ATGCAAAGTTATTGAGGAATGGAAGGAACTCGGCCCACCTGACAGTGATAATGAAAAGGAAAATCGATTAGGAGACATTT
GTTTTTCTTTGAGATATGTTCCAACGTCTGGAAAGTTGAATATCGTCATTCTGGAAGCTAAAAACCTCAAGAAAATGGAT
GTTGGAGGATTGTCGGATCCTTACGTGAAACTATCGTTGATGCTTAACGGCAAACGAGTGAAAAAGAAGAAAACCACAAT
AAAAAAATACACATTAAATCCTTATTATAATGAGTCATTTTCATTCGAAGTTCCATTCGAGCAAATACAAAAAGTTAATT
TAATAGTGACAGTAGTTGATTATGATAGAATTGGAACAAGTGAACCTATTGGAAGAGTAGTTCTTGGATGCAATGCTACA
GGAGCAGAACTTCGGCACTGGTCCGATATGCTTGCTAATCCTAGGAGACCAATTGCCCAGTGGCATACCCTTCAAGATAT
GCCGGAGAAGAGCTGATTTCATTGATTTTAATTTTAAAATCTGTCATATTTTGTGATAAATTTTGCGTATTTATACAATC
ATTCGATTCGATCTTTCCATCAAGTTTCGTAAAATCTGCAGACATTCACGAGGATGCAGAAGAAATAGAAACTTTGTAAT
AAATTAGCATTAGCTGTGATCTCCTATTGACCAAAAAACATAAACTTAATTTTTATAAAGAATTGTGGTGAAATGTTGTT
AGGTTTCAGTCATAGATAACTGTATTTGTGTAATAGTTTGTGTATTTCTCGTCCTGGCCCGATTTTGTGCATTCCACTGG
CAATACTATTTCACTAATAAATTATGTCTGATAATGTATACCAGTATAGGATTTTGTTTGAATTAATGAA
>SMED30022907 ID=SMED30022907|Name=Synaptotagmin|organism=Schmidtea mediterranea sexual|type=transcript|length=1814bp
ATTTATTGAAAATTATTTTTTCTATTATTAGGAGAAAATTGATTATTTTTTTTTGACAAAATAAGTTTTGGATATATTTC
CCATTTGTTTGTATTCGTAAACCAATGAAGAATTCGACTCACGGATCGGATCATTCGGCCAGCAAGGCCAGTATGAAAAC
GAATGTGGAAAAATTTTGGCATGATCTCGGAAAAAAATTGCACATGGATCCAAAAGCATTAATAGGAGTAACAATCGGTT
TGGGAATATTGTTTTTGTTGTTCCTTTATTGCTTATGTAAAAAATGTGTTTTCAAGCGTCGAAAAAAGAAGGAAACGGCC
AAAAAAGGAGCCAAGGGAGTAGTCGATATGAAAAGTGCCCAATTGTTGGGGAATTCATATAAAGAAAAAATTCAACCCGA
TCTTGAAGAACTTGATGCAAACATGGAAGACAATGAAGGTGTAAAAGAAAAAGAAGATGTTCATTTAGGAAAATTACAAT
ATTCTCTAGATTATGATTTTCAGAAAGGAGAATTAACTGTTGGAGTTATTCAAGCAACTGATCTTCCAGCTATGGATATG
TCAGGAACATCAGATCCATATGTCAAATTATACCTTCTCCCAGACAAGAAAAAGAAATTCGAAACAAAGGTTCATAGGAA
AATTTTAAATCCTGTATTCAATGAAACTTTTGTTTTCAAAGTTCCTTTCAATGAAGTTGCATCGAAGACTTTGATTTTCA
ACGTTTATGACTTTGACAGATTTTCCAAACACGATCAAATCGGTCAAATAAAAGTACCATTGGGAGCTATAGATTTAGGT
CGAGTTATTGAAGAATGGAAGGAACTGGAATCTCCAGAAAACGATGGGGAAAAGGAAAACAGGTTGGGAGACATTTGTTT
CTCTTTAAGATACGTACCGACATCTGGAAAGCTTACAATAGTCATTTTGGAAGCAAAGAATCTTAAAAAAATGGATGTCG
GAGGATTGTCTGATCCATATGTTAAACTTTCCTTGATGCTTAATGGTAAACGAGTGAAGAAGAAGAAAACTACCATCAAA
AAGTATACACTAAATCCTTACTACAATGAATCATTTTCCTTTGAAGTACCATTCGAACAAATACAAAAAGTGAACTTGAT
CGTCACGGTTGTTGATTATGACAGAATCGGAACCAGCGAACCGATAGGTAGAATTGTTCTGGGATGTAACGCAACTGGAG
CAGAATTGCGACATTGGTCGGATATGTTGGCAAATCCCCGGCGACCAATCGCCCAGTGGCATACCCTCCAAGAGATGCCA
GAGAACAATTGATAGTGTTCGTTTGATGCTTTAAAGCGGTTTGCATAATTCGTGAAATAAGTTATCAAAATTTGAGAAAT
GTTTTTTTTTCTGAAACAAAAATGGCATGAGACAATATACCAGAGTTCATTAGTGTGTGGTTTCGTTGAATATTTTGGTG
GTGTTGCATCTTATCGTTTGTCCTCTAATCTAATAATGTTTTATTCTTTATATAGCTGATTTATTCTCGAGCGAAACATT
TTTTATGTGTACCAAAATACTTATGTCATAGCCATTGTGATTAGTCTGTAAACTATTGCGTAATAGCCCCTCTCATTGGC
TTTTTTTAAGAGTAGTGAGTTGGAAAAAAAAATACAAAAATGACTTCAATTGTTAAACATTACTCATATTTTATCAGTAA
GTTAACTTGCATATTTGCAGTTAATTATGGCATTTTATCTCTAAATCTCTGAAGCATGGCCTCAAGTCTTTTGTTTGTTT
TAATGTAATTATGTCTAGATGAGAATATTAAAATACTTCGGTTTATATAAAAGA

 

back to top



PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in neuron. Click this link to learn more about PAGE.


PAGE Curations: 1745


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
neuronSMED30008325Fatty acid synthaseSMESG000020850.1 dd_Smed_v4_10967_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003675adenylate kinase 7-likeSMESG000075409.1 dd_Smed_v4_5880_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009556Dynein axonemal light chain 1SMESG000053050.1 dd_Smed_v4_6302_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006736colorectal mutant cancer proteinSMESG000002794.1 dd_Smed_v4_5396_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019836CCDC151SMESG000007771.1 dd_Smed_v4_4526_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015924Neur_chan_LBD domain-containing proteinSMESG000041729.1 dd_Smed_v4_20769_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017048cilia- and flagella-associated protein 206SMESG000021247.1 dd_Smed_v4_11199_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014307SMED30014307SMESG000064621.1 dd_Smed_v4_5431_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007480Protein kinase CSMESG000039865.1 SMESG000039854.1 SMESG000032749.1 SMESG000032747.1 dd_Smed_v4_4244_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001542CaveolinSMESG000063380.1 SMESG000001725.1 dd_Smed_v4_6535_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004739TNF receptor-associated factorSMESG000014725.1 SMESG000014724.1 SMESG000014706.1 SMESG000014702.1 SMESG000014700.1 dd_Smed_v4_4420_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017089SMED30017089SMESG000001468.1 dd_Smed_v4_5675_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018309Iroquois-class homeodomain protein IRX-4SMESG000061184.1 dd_Smed_v4_11500_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007047DNA_pol_B_2 domain-containing proteinSMESG000063380.1 SMESG000001725.1 dd_Smed_v4_6535_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017201SFI1SMESG000002829.1 dd_Smed_v4_12484_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019305wdr-1SMESG000045753.1 SMESG000037894.1 dd_Smed_v4_2585_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014872beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase 3SMESG000051810.1 SMESG000051787.1 SMESG000043068.1 SMESG000043067.1 SMESG000043052.1 SMESG000009027.1 SMESG000008972.1 dd_Smed_v4_6205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013159LimbinSMESG000017303.1 dd_Smed_v4_10777_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015710Glycine receptor subunit alpha-3SMESG000008993.1 dd_Smed_v4_10794_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019538SMED30019538SMESG000078196.1 dd_3823dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30015332Ciliogenesis-associated TTC17-interacting proteinSMESG000009424.1 dd_Smed_v4_5952_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001237Tubulin polymerization-promoting protein family member 3SMESG000002261.1 dd_Smed_v4_650_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001031TRAF3-interacting protein 1SMESG000006345.1 dd_Smed_v4_10562_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013744SMED30013744SMESG000001468.1 dd_Smed_v4_5675_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016517ATFl1SMESG000044121.1 dd_Smed_v4_3847_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013054Protein kinase domain-containing proteinSMESG000020466.1 dd_Smed_v4_11366_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003560Teneurin-2SMESG000016735.1 dd_Smed_v4_5439_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012546Coiled-coil domain-containing protein 65SMESG000021331.1 dd_Smed_v4_6152_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014999P21 activated kinase-1SMESG000008326.1 dd_Smed_v4_5741_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005654SMED30005654SMESG000044586.1 dd_Smed_v4_6921_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010112SMED30010112SMESG000037132.1 SMESG000037110.1 dd_Smed_v4_6499_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015172Protein kinase CSMESG000039865.1 SMESG000039854.1 SMESG000032749.1 SMESG000032747.1 dd_Smed_v4_4244_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009144CCDC66 domain-containing proteinSMESG000019367.1 dd_Smed_v4_11800_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016557AquaporinSMESG000023346.1 dd_Smed_v4_6111_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000565Dynein heavy chainSMESG000065732.1 dd_Smed_v4_6941_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018972ANK_REP_REGION domain-containing proteinSMESG000022931.1 dd_Smed_v4_11187_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004112Dynein heavy chain 5, axonemalSMESG000012967.1 dd_Smed_v4_4113_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019328Armadillo repeat-containing protein 2SMESG000077074.1 dd_Smed_v4_12684_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014820Centrosomal protein of 135 kDa (Cep135 protein) (Centrosomal protein 4), putativeSMESG000052451.1 dd_Smed_v4_11072_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017834Breast cancer anti-estrogen resistance protein 1 CRK-associated substrate p130casSMESG000028562.1 dd_Smed_v4_6476_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016654Intraflagellar transport protein 140SMESG000001316.1 dd_Smed_v4_11300_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014133EF-hand calcium-binding domain-containing protein 10-likeSMESG000023074.1 dd_Smed_v4_6477_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014149Ras-related protein Rab-3SMESG000034019.1 dd_Smed_v4_5920_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003084Cilia-and flagella-associated protein 45SMESG000016410.1 dd_Smed_v4_3732_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003831SMED30003831SMESG000071535.1 dd_Smed_v4_3895_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000448Cysteine-rich proteinSMESG000044206.1 dd_Smed_v4_1185_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033073Dynein heavy chain axonemal-likeSMESG000039073.1 dd_Smed_v4_4176_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035761GMP_PDE_delta domain-containing proteinSMESG000064785.1 dd_Smed_v4_4791_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025144Protein rolling stoneSMESG000077396.1 dd_Smed_v4_10421_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033019nou darake like-5SMESG000070953.1 dd_Smed_v4_5102_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025815SMED30025815SMESG000028784.1 SMESG000061889.1 dd_Smed_v4_3519_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020234Kinase D-interacting substrateSMESG000079991.1 dd_Smed_v4_11743_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30027240Calcium dependent protein kinase 5SMESG000057759.1 dd_15455dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30033008SMED30033008SMESG000079331.1 dd_8120dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30023111RBR-type E3 ubiquitin transferaseSMESG000054560.1 dd_Smed_v4_4845_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031553SMED30031553SMESG000023246.1 dd_Smed_v4_918_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031553SMED30031553SMESG000023246.1 dd_Smed_v4_918_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30022748ETS domain-containing proteinSMESG000078333.1 dd_Smed_v4_11113_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032285SMED30032285SMESG000037686.1 SMESG000035410.1 SMESG000013977.1 SMESG000013857.1 dd_Smed_v4_10407_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035526SMED30035526SMESG000018598.1 dd_Smed_v4_716_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029546Tektin 3SMESG000020792.1 dd_Smed_v4_3187_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020297Mediator of RNA polymerase II transcription subunit 1SMESG000023303.1 dd_Smed_v4_6432_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035611Fras1 related extracellular matrix proteinSMESG000032220.1 dd_Smed_v4_2407_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30024786Zinc finger protein castor-like protein 1SMESG000038913.1 dd_Smed_v4_6778_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021707SMED30021707SMESG000063964.1 dd_Smed_v4_11231_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025821Multiple PDZ domain crumbs cell polarity complex componentSMESG000053393.1 dd_Smed_v4_5376_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031662Acetylcholine receptor subunit alpha-likeSMESG000063816.1 SMESG000010536.1 SMESG000045280.1 SMESG000029730.1 dd_Smed_v4_4145_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30034110Dynein intermediate chain 3, ciliarySMESG000075110.1 dd_Smed_v4_2644_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020574Dynein heavy chain axonemalSMESG000017294.1 dd_Smed_v4_6790_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30024428CalmodulinSMESG000018137.1 SMESG000018135.1 dd_Smed_v4_4669_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30024729SMED30024729SMESG000037686.1 SMESG000035410.1 SMESG000013977.1 SMESG000013857.1 dd_Smed_v4_10407_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035314SMED30035314SMESG000020883.1 dd_Smed_v4_11620_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030306ABC transporter domain-containing proteinSMESG000058880.1 SMESG000039065.1 dd_Smed_v4_4225_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30034198SMED30034198SMESG000002829.1 dd_Smed_v4_12484_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031633enkurin isoform X1SMESG000076528.1 dd_Smed_v4_2868_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029642Neurensin-1SMESG000011024.1 dd_Smed_v4_4743_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031011ANK_REP_REGION domain-containing proteinSMESG000020705.1 SMESG000020698.1 dd_Smed_v4_29517_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030892Intraflagellar transport protein 172SMESG000028841.1 dd_Smed_v4_10638_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031722ANK_REP_REGION domain-containing proteinSMESG000022931.1 dd_Smed_v4_11187_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028575Serine/threonine-protein phosphatase with EF-handsSMESG000042202.1 dd_Smed_v4_11874_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021914SMED30021914SMESG000047681.1 SMESG000016277.1 dd_Smed_v4_4415_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033752Tyrosine-protein kinaseSMESG000059352.1 SMESG000059351.1 dd_Smed_v4_420_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30034016Sperm surface protein Sp17SMESG000046919.1 dd_Smed_v4_4783_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022905DihydropyrimidinaseSMESG000028784.1 SMESG000061889.1 dd_Smed_v4_3519_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033618SMED30033618SMESG000042343.1 dd_3011dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30013023CalmodulinSMESG000034095.1 SMESG000034094.1 dd_Smed_v4_414_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018203Oxysterol-binding proteinSMESG000016876.1 dd_Smed_v4_12759_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016317slc16a-25SMESG000046854.1 dd_Smed_v4_10252_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007889SMED30007889SMESG000062027.1 dd_Smed_v4_6700_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010847SMED30010847SMESG000026789.1 dd_Smed_v4_10187_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007990FH2 domain-containing proteinSMESG000034095.1 SMESG000034094.1 dd_Smed_v4_414_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007990FH2 domain-containing proteinSMESG000034094.1 dd_Smed_v4_15344_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014077SMED30014077SMESG000053808.1 dd_Smed_v4_7928_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009769Serine/threonine kinaseSMESG000074970.1 dd_Smed_v4_4160_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002742DystoninSMESG000043809.1 SMESG000043799.1 dd_Smed_v4_1205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016673Cylindromatosis (turban tumor syndrome), bSMESG000056847.1 SMESG000056843.1 SMESG000056838.1 SMESG000044770.1 SMESG000044762.1 SMESG000007140.1 dd_Smed_v4_1137_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019373Rab6-interacting protein 2/elks/erc/cast,putativeSMESG000051528.1 dd_Smed_v4_12278_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007670DystrobrevinSMESG000078318.1 dd_Smed_v4_12275_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015813slc3a-1SMESG000019192.1 SMESG000019184.1 dd_Smed_v4_2113_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015587Dual specificity protein phosphatase 14SMESG000037868.1 dd_Smed_v4_7558_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033100Dihydropteridine reductaseSMESG000060612.1 dd_Smed_v4_2408_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029825ANK_REP_REGION domain-containing proteinSMESG000020706.1 dd_Smed_v4_21003_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035013SMED30035013SMESG000077800.1 SMESG000054046.1 SMESG000052058.1 SMESG000044674.1 SMESG000066333.1 SMESG000052053.1 SMESG000052952.1 SMESG000080770.1 SMESG000065333.1 SMESG000063486.1 SMESG000059844.1 SMESG000058646.1 SMESG000055266.1 SMESG000054970.1 SMESG000052813.1 SMESG000043147.1 SMESG000037745.1 SMESG000037601.1 SMESG000036070.1 SMESG000034880.1 SMESG000034368.1 SMESG000031415.1 SMESG000019663.1 SMESG000010897.1 SMESG000009005.1 SMESG000006729.1 SMESG000005029.1 SMESG000003989.1 dd_Smed_v4_1760_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020821SMED30020821SMESG000014298.1 dd_Smed_v4_1301_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30027886SMED30027886SMESG000003427.1 dd_Smed_v4_2708_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30024935FibronectinSMESG000029259.1 dd_Smed_v4_43824_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021086TIR domain-containing proteinSMESG000008941.1 dd_Smed_v4_13404_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021143Basal body-orientation factor 1SMESG000078046.1 dd_Smed_v4_9328_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020678G-protein, gamma subunit,domain-containing proteinSMESG000066557.1 dd_Smed_v4_1237_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30036025SMED30036025SMESG000071534.1 dd_Smed_v4_3658_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020986SMED30020986SMESG000061227.1 dd_1936dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30032272FMN_red domain-containing proteinSMESG000023871.1 dd_Smed_v4_1834_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021105Tubulin alpha chainSMESG000005506.1 SMESG000005505.1 SMESG000005493.1 SMESG000005489.1 SMESG000005487.1 dd_Smed_v4_38_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031429SMED30031429SMESG000038604.1 dd_Smed_v4_1973_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020166Coiled-coil domain-containing proteinSMESG000005080.1 dd_Smed_v4_9816_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035339RIMS binding protein 2SMESG000001071.1 SMESG000001061.1 SMESG000001060.1 dd_Smed_v4_9824_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021490E3 ubiquitin protein ligase-1SMESG000066165.1 SMESG000066158.1 dd_Smed_v4_9945_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022167SMED30022167SMESG000031417.1 dd_Smed_v4_11958_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033117ANK_REP_REGION domain-containing proteinSMESG000048145.1 dd_Smed_v4_16174_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023446SMED30023446SMESG000040048.1 dd_Smed_v4_9891_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002221SMED30002221SMESG000011558.1 dd_3733dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30006489SMED30006489SMESG000011558.1 dd_3733dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30017722Kinesin-like protein KIF1ASMESG000071414.1 dd_Smed_v4_7108_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012267Kinesin-like proteinSMESG000073771.1 dd_Smed_v4_6755_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017476Intraflagellar transport protein 57SMESG000013668.1 dd_Smed_v4_7099_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009659Transcription initiation factor IIF subunit alphaSMESG000056085.1 dd_Smed_v4_6621_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000378SMED30000378SMESG000061591.1 dd_Smed_v4_512_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000539Transcriptional regulator ATRXSMESG000079240.1 dd_Smed_v4_5478_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013001SMED30013001SMESG000057336.1 dd_Smed_v4_6083_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015426SMED30015426SMESG000038532.1 SMESG000038520.1 SMESG000038497.1 SMESG000036112.1 SMESG000036067.1 dd_Smed_v4_5097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023841SMED30023841SMESG000041250.1 dd_Smed_v4_6437_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031197Microtubule-associated protein 4SMESG000068843.1 dd_Smed_v4_7133_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026686Glutamate synthaseSMESG000077776.1 dd_Smed_v4_5074_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30034870SMED30034870SMESG000047469.1 dd_Smed_v4_16220_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025205InnexinSMESG000078684.1 SMESG000060499.1 dd_Smed_v4_6114_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028734SMED30028734SMESG000038532.1 SMESG000038520.1 SMESG000038497.1 SMESG000036112.1 SMESG000036067.1 dd_Smed_v4_5097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022032SMED30022032SMESG000038532.1 SMESG000038520.1 SMESG000038497.1 SMESG000036112.1 SMESG000036067.1 dd_Smed_v4_5097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30024396Centrosomal protein 295SMESG000023095.1 dd_Smed_v4_11068_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023661Reverse transcriptase domain-containing proteinSMESG000042224.1 dd_Smed_v4_11697_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025099SMED30025099SMESG000043295.1 dd_3524dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30021539Diacylglycerol lipase betaSMESG000046500.1 dd_Smed_v4_13306_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035875Non-SMC condensin II complex subunit G2SMESG000024947.1 SMESG000024945.1 SMESG000024886.1 SMESG000024883.1 dd_15610dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30032108ProtocadherinSMESG000033639.1 dd_Smed_v4_12429_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028505G protein-coupled receptor kinaseSMESG000050449.1 dd_Smed_v4_5929_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031435SMED30031435SMESG000020814.1 dd_Smed_v4_5728_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022421RIB43A-like with coiled-coils protein 2SMESG000037028.1 dd_Smed_v4_4547_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30027901Spermatogenesis associated 1SMESG000049418.1 dd_Smed_v4_12212_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009226RILP-like protein 1SMESG000009316.1 dd_Smed_v4_4713_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006070SMED30006070SMESG000080798.1 SMESG000054735.1 SMESG000030429.1 dd_Smed_v4_6842_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001112SMED30001112SMESG000061228.1 dd_Smed_v4_8351_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006130Transmembrane proteinSMESG000009898.1 dd_Smed_v4_3881_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016693InnexinSMESG000059204.1 dd_Smed_v4_3985_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019497SH3 domain-containing proteinSMESG000039140.1 dd_Smed_v4_11051_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011297SMED30011297SMESG000019881.1 dd_Smed_v4_4454_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009863Guanylate kinaseSMESG000052587.1 SMESG000052584.1 dd_Smed_v4_4875_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001010SMED30001010SMESG000039006.1 dd_Smed_v4_13470_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011420Trinucleotide repeat containing 4-like proteinSMESG000005424.1 dd_Smed_v4_11349_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000342SMED30000342SMESG000047115.1 SMESG000004000.1 dd_Smed_v4_2558_0_2dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004158Tetratricopeptide repeat protein 25SMESG000067442.1 dd_Smed_v4_3933_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005459SMED30005459SMESG000014884.1 dd_Smed_v4_2661_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009900Copine-3SMESG000064685.1 dd_Smed_v4_15889_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014519Caspase-1SMESG000002751.1 dd_Smed_v4_2943_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008550intraflagellar transport protein 20 homologSMESG000067757.1 dd_Smed_v4_9545_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000732Leucine-rich repeat-containing protein 45SMESG000060194.1 dd_Smed_v4_9495_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000256Golgin subfamily A member 2SMESG000047115.1 SMESG000004000.1 dd_Smed_v4_2558_0_2dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013840Tektin-2SMESG000065255.1 SMESG000050057.1 dd_Smed_v4_2339_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002255Regulating synaptic membrane exocytosis protein 2SMESG000023007.1 dd_Smed_v4_10734_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017636Calsyntenin 1SMESG000068054.1 dd_Smed_v4_4147_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012935TGc domain-containing proteinSMESG000080370.1 dd_Smed_v4_4149_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008752Homeobox domain-containing proteinSMESG000016670.1 dd_Smed_v4_11150_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001357XendoU domain-containing proteinSMESG000008612.1 dd_Smed_v4_25168_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006485Beta-1-syntrophinSMESG000005336.1 dd_Smed_v4_7105_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004383SMED30004383SMESG000026569.1 dd_1955dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30004383SMED30004383SMESG000026569.1 dd_Smed_v4_1955_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30002721beta-parvinSMESG000080798.1 SMESG000054735.1 SMESG000030429.1 dd_Smed_v4_6842_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006690slc46a-1SMESG000022670.1 dd_Smed_v4_10822_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012874Adenylate cyclase type 9SMESG000037351.1 dd_Smed_v4_2998_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001465Protein kinase domain-containing proteinSMESG000069574.1 dd_Smed_v4_4202_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018152Plac8 onzin related protein 1SMESG000050208.1 dd_Smed_v4_12014_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002549SyntaxinSMESG000043412.1 SMESG000043410.1 dd_Smed_v4_8453_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017387von Willebrand factor A domain containing 3BSMESG000047774.1 dd_Smed_v4_9363_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012827SMED30012827SMESG000054420.1 dd_Smed_v4_5361_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019972Kinesin-like proteinSMESG000017021.1 dd_Smed_v4_9460_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019972Kinesin-like proteinSMESG000017021.1 dd_Smed_v4_9460_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30007189Double zinc ribbon and ankyrin repeat-containing protein 1SMESG000018145.1 SMESG000018144.1 dd_Smed_v4_9848_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012574Carboxyl-terminal PDZ ligand of neuronal nitric oxide synthase proteinSMESG000071224.1 dd_Smed_v4_13377_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010695coiled-coil domain-containing protein 170SMESG000048767.1 dd_Smed_v4_7066_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000802SMED30000802SMESG000061387.1 dd_2223dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30010086Homeobox domain-containing proteinSMESG000030375.1 dd_Smed_v4_16007_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018495ATPase_AAA_core domain-containing proteinSMESG000073596.1 dd_Smed_v4_9568_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018495ATPase_AAA_core domain-containing proteinSMESG000073596.1 dd_Smed_v4_9484_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018266Phosphatidylinositol-binding clathrin assembly proteinSMESG000020797.1 dd_Smed_v4_6650_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014124SMED30014124SMESG000024190.1 dd_Smed_v4_1790_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013013Guanine nucleotide-binding protein subunit betaSMESG000061733.1 dd_Smed_v4_3309_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011961Tensin 3SMESG000019881.1 dd_Smed_v4_4454_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013315SMED30013315SMESG000022425.1 dd_Smed_v4_3843_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016942Scratch family zinc finger 2SMESG000041786.1 dd_Smed_v4_18952_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015765SMED30015765SMESG000050352.1 dd_Smed_v4_36253_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016384Thymidylate kinaseSMESG000016181.1 dd_Smed_v4_3849_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014654Low density lipoprotein-receptor, class A,domain-containing proteinSMESG000021406.1 dd_Smed_v4_2598_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020160SMED30020160SMESG000005587.1 dd_Smed_v4_8117_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022151CaveolinSMESG000074524.1 dd_Smed_v4_8555_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021154Calmodulin, putativeSMESG000040933.1 SMESG000040932.1 dd_Smed_v4_603_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025978SMED30025978SMESG000069967.1 dd_Smed_v4_6939_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032798SMED30032798SMESG000013320.1 SMESG000013316.1 dd_Smed_v4_9011_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028061Bicaudal D proteinSMESG000060877.1 dd_Smed_v4_7219_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032372Coiled-coil domain containing 40SMESG000008312.1 dd_Smed_v4_6338_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031496Leucine zipper transcription factor like 1SMESG000020499.1 dd_Smed_v4_8415_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021908SMED30021908SMESG000010232.1 SMESG000010229.1 dd_Smed_v4_7466_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001515AnnexinSMESG000042839.1 dd_Smed_v4_1104_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016589SynapsinSMESG000063523.1 dd_Smed_v4_3135_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013424WD repeat domain 60SMESG000040271.1 dd_Smed_v4_10032_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000014slc20a-1SMESG000012546.1 dd_Smed_v4_1270_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016068SMED30016068SMESG000024947.1 SMESG000024945.1 SMESG000024886.1 SMESG000024883.1 dd_15610dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30005554SMED30005554SMESG000016237.1 SMESG000033358.1 dd_Smed_v4_507_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005554SMED30005554SMESG000016237.1 SMESG000033358.1 dd_Smed_v4_507_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30006492SMED30006492SMESG000005194.1 dd_Smed_v4_4021_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017498tyramine beta-hydroxilaseSMESG000005292.1 dd_Smed_v4_42610_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED300116841-phosphatidylinositol 4,5-bisphosphate phosphodiesteraseSMESG000049234.1 dd_Smed_v4_3221_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003011NPHP1SMESG000061008.1 dd_Smed_v4_9990_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001680SMED30001680SMESG000002033.1 dd_Smed_v4_884_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001586Spectrin alpha chainSMESG000005289.1 dd_Smed_v4_919_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007951Transcription initiation factor IIF subunit alphaSMESG000056085.1 dd_Smed_v4_6621_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012459SMED30012459SMESG000003156.1 dd_Smed_v4_2446_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001395neural proliferation differentiation and control protein 1SMESG000059206.1 dd_Smed_v4_2985_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016746SMED30016746SMESG000060159.1 dd_Smed_v4_2729_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005551Spectrin alpha chainSMESG000005289.1 dd_Smed_v4_919_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017949slc7a-6SMESG000051755.1 dd_Smed_v4_7207_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013286sn1-specific diacylglycerol lipase betaSMESG000046500.1 dd_Smed_v4_13306_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018078Glycine receptor subunit alpha-3SMESG000041885.1 dd_Smed_v4_11342_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006684Calsyntenin-1-like proteinSMESG000057121.1 dd_Smed_v4_3122_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001478Dynamin-like proteinSMESG000002033.1 dd_Smed_v4_884_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013824Unc-5 netrin receptor BSMESG000040323.1 dd_Smed_v4_10380_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011758PCIF1_WW domain-containing proteinSMESG000032335.1 SMESG000015108.1 SMESG000015275.1 dd_Smed_v4_3307_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009623SMED30009623SMESG000047804.1 SMESG000038532.1 SMESG000038520.1 SMESG000036112.1 SMESG000036060.1 dd_Smed_v4_4251_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031952SMED30031952SMESG000003398.1 dd_Smed_v4_248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30027234SMED30027234SMESG000015333.1 dd_Smed_v4_25147_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032989Cytochrome b561SMESG000028998.1 dd_Smed_v4_4017_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032314Peptidylglycine alpha-hydroxylating monooxygenaseSMESG000073851.1 dd_Smed_v4_2646_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031654SMED30031654SMESG000064362.1 dd_Smed_v4_3795_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED3002338613 kDa deflagellation-inducible proteinSMESG000050233.1 dd_Smed_v4_3576_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023344Sn1-specific diacylglycerol lipase betaSMESG000046500.1 dd_Smed_v4_13306_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026949SMED30026949SMESG000047804.1 SMESG000038532.1 SMESG000038520.1 SMESG000036112.1 SMESG000036060.1 dd_Smed_v4_4251_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026619Mitochondrial calcium uniporterSMESG000000983.1 dd_Smed_v4_4033_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025065SMED30025065SMESG000047804.1 SMESG000038532.1 SMESG000038520.1 SMESG000036112.1 SMESG000036060.1 dd_Smed_v4_4251_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025065SMED30025065SMESG000038532.1 SMESG000038520.1 SMESG000038497.1 SMESG000036112.1 SMESG000036067.1 dd_Smed_v4_5097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020343Intersectin-1SMESG000070268.1 dd_Smed_v4_3992_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023112SMED30023112SMESG000047804.1 SMESG000038532.1 SMESG000038520.1 SMESG000036112.1 SMESG000036060.1 dd_Smed_v4_4251_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED3002512114-3-3 protein epsilonSMESG000076939.1 dd_Smed_v4_251_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032448Expressed conserved proteinSMESG000064362.1 dd_Smed_v4_3795_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020991Outer dynein arm protein 1SMESG000055998.1 SMESG000055997.1 dd_Smed_v4_4191_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033873SMED30033873SMESG000003398.1 dd_Smed_v4_248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025990NPHP1SMESG000061008.1 dd_Smed_v4_9990_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020940Small G protein signaling modulator 2SMESG000032335.1 SMESG000015108.1 SMESG000015275.1 dd_Smed_v4_3307_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017036AP-2 complex subunit alphaSMESG000036030.1 dd_Smed_v4_1423_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001580Serine/threonine-protein kinase PDIK1LSMESG000059621.1 dd_Smed_v4_9834_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008882Cilia and flagella associated protein 157SMESG000036345.1 dd_Smed_v4_9862_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009438Complexin-1/2SMESG000012002.1 dd_Smed_v4_9918_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017165Succinate--CoA ligase [ADP-forming] subunit beta, mitochondrialSMESG000015204.1 dd_Smed_v4_2298_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018274Calbindin-32SMESG000055605.1 dd_Smed_v4_1230_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015563Meiosis expressed protein 1SMESG000031493.1 dd_Smed_v4_4620_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006908G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000060818.1 dd_24149dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30006932SMED30006932SMESG000080376.1 dd_Smed_v4_23203_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000511G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000064707.1 dd_Smed_v4_16018_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018588MusashiSMESG000077233.1 dd_Smed_v4_8902_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012000tyrosine hydroxylaseSMESG000034472.1 dd_Smed_v4_16581_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30012000tyrosine hydroxylaseSMESG000034472.1 dd_Smed_v4_16581_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015595InnexinSMESG000032206.1 dd_Smed_v4_3879_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000559Transposon Ty3-I Gag-Pol polyproteinSMESG000063504.1 SMESG000063503.1 SMESG000026061.1 dd_Smed_v4_3587_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011091Ski oncogeneSMESG000044463.1 dd_Smed_v4_10394_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015018SMED30015018SMESG000075952.1 dd_Smed_v4_4158_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010523SMED30010523SMESG000077800.1 SMESG000054046.1 SMESG000052058.1 SMESG000044674.1 SMESG000066333.1 SMESG000052053.1 SMESG000052952.1 SMESG000080770.1 SMESG000065333.1 SMESG000063486.1 SMESG000059844.1 SMESG000058646.1 SMESG000055266.1 SMESG000054970.1 SMESG000052813.1 SMESG000043147.1 SMESG000037745.1 SMESG000037601.1 SMESG000036070.1 SMESG000034880.1 SMESG000034368.1 SMESG000031415.1 SMESG000019663.1 SMESG000010897.1 SMESG000009005.1 SMESG000006729.1 SMESG000005029.1 SMESG000003989.1 dd_Smed_v4_1760_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007649SMED30007649SMESG000048765.1 dd_Smed_v4_14165_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006199Acetyl-coenzyme A synthetaseSMESG000022079.1 dd_Smed_v4_1817_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001361BAT2_N domain-containing proteinSMESG000038978.1 dd_Smed_v4_4611_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010620Histone acetyltransferaseSMESG000017094.1 dd_Smed_v4_12274_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017749Peptidyl-glycine alpha-amidating monooxygenaseSMESG000042480.1 dd_Smed_v4_3093_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008253Dual specificity protein phosphatase 10SMESG000063504.1 SMESG000063503.1 SMESG000026061.1 dd_Smed_v4_3587_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015867SMED30015867SMESG000024596.1 dd_Smed_v4_5001_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001032Kinesin-like proteinSMESG000024428.1 dd_Smed_v4_9952_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED300184652',3'-cyclic nucleotide 3'-phosphodiesteraseSMESG000060338.1 dd_Smed_v4_2431_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000581Centlein, centrosomal proteinSMESG000000357.1 dd_Smed_v4_9882_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003408Centrosomal protein of 89 kDaSMESG000031345.1 dd_Smed_v4_13073_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003321Kinase D-interacting substrateSMESG000080369.1 dd_Smed_v4_9630_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003275Guanine nucleotide-binding protein G(O) subunit alphaSMESG000055191.1 dd_Smed_v4_1656_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018013Protein F37C4.5SMESG000042992.1 SMESG000007398.1 dd_Smed_v4_3629_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017145Ubiquitin carboxyl-terminal hydrolaseSMESG000000839.1 dd_Smed_v4_4235_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002595SMED30002595SMESG000060338.1 dd_Smed_v4_2431_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008651Guanylate cyclaseSMESG000019264.1 dd_Smed_v4_9453_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004840Coiled-coil domain containing 88AaSMESG000012304.1 dd_Smed_v4_3591_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019754Cathepsin LSMESG000024014.1 dd_Smed_v4_3422_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004284InnexinSMESG000048827.1 dd_Smed_v4_13392_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035357follistatinSMESG000013298.1 dd_Smed_v4_9584_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30024999CTF/NF-I domain-containing proteinSMESG000010567.1 dd_Smed_v4_9508_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED3002518133 kDa inner dynein arm light chain, axonemalSMESG000067639.1 SMESG000001266.1 dd_Smed_v4_4453_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30034920G protein gamma domain-containing proteinSMESG000066557.1 dd_Smed_v4_1237_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023278Tyrosine hydroxylaseSMESG000034472.1 dd_Smed_v4_16581_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30023278Tyrosine hydroxylaseSMESG000034472.1 dd_Smed_v4_16581_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035047Sperm associated antigen 17SMESG000038878.1 dd_Smed_v4_9301_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30034249SMED30034249SMESG000042496.1 dd_Smed_v4_8345_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004414GCR087SMESG000037770.1 Contig30481newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004414GCR087SMESG000037770.1 Contig30481uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010020C2H2-type domain-containing proteinSMESG000079430.1 SMESG000076652.1 SMESG000076091.1 SMESG000076042.1 SMESG000074857.1 SMESG000070393.1 SMESG000068687.1 SMESG000065288.1 SMESG000065178.1 SMESG000062279.1 SMESG000060688.1 SMESG000059025.1 SMESG000057864.1 SMESG000057533.1 SMESG000057427.1 SMESG000053372.1 SMESG000050587.1 SMESG000050353.1 SMESG000048922.1 SMESG000048614.1 SMESG000047874.1 SMESG000046659.1 SMESG000046053.1 SMESG000043782.1 SMESG000040179.1 SMESG000037212.1 SMESG000034701.1 SMESG000031049.1 SMESG000029555.1 SMESG000029226.1 SMESG000026530.1 SMESG000024597.1 SMESG000023611.1 SMESG000021499.1 SMESG000019334.1 SMESG000017989.1 SMESG000008351.1 SMESG000006220.1 SMESG000005221.1 SMESG000060620.1 Contig20759newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010020C2H2-type domain-containing proteinSMESG000079430.1 SMESG000076652.1 SMESG000076091.1 SMESG000076042.1 SMESG000074857.1 SMESG000070393.1 SMESG000068687.1 SMESG000065288.1 SMESG000065178.1 SMESG000062279.1 SMESG000060688.1 SMESG000059025.1 SMESG000057864.1 SMESG000057533.1 SMESG000057427.1 SMESG000053372.1 SMESG000050587.1 SMESG000050353.1 SMESG000048922.1 SMESG000048614.1 SMESG000047874.1 SMESG000046659.1 SMESG000046053.1 SMESG000043782.1 SMESG000040179.1 SMESG000037212.1 SMESG000034701.1 SMESG000031049.1 SMESG000029555.1 SMESG000029226.1 SMESG000026530.1 SMESG000024597.1 SMESG000023611.1 SMESG000021499.1 SMESG000019334.1 SMESG000017989.1 SMESG000008351.1 SMESG000006220.1 SMESG000005221.1 SMESG000060620.1 Contig20759uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014011mRNA-capping enzymeSMESG000080877.1 Contig40664newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014011mRNA-capping enzymeSMESG000080877.1 Contig40664uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006021WD_REPEATS_REGION domain-containing proteinSMESG000057088.1 Contig48022newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006021WD_REPEATS_REGION domain-containing proteinSMESG000057088.1 Contig48022uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017913Fzd-5/8-3SMESG000035834.1 Contig35779newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017913Fzd-5/8-3SMESG000035834.1 Contig35779uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002497Neuronal acetylcholine receptor subunit alpha-4SMESG000005358.1 Contig36571newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002497Neuronal acetylcholine receptor subunit alpha-4SMESG000005358.1 Contig36571uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011934sp6-9SMESG000050160.1 Contig37509newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011934sp6-9SMESG000050160.1 Contig37509uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005887SMED30005887SMESG000041687.1 Contig42120newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005887SMED30005887SMESG000041687.1 Contig42120uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003855Chromo domain-containing proteinSMESG000079180.1 SMESG000076652.1 SMESG000076091.1 SMESG000066578.1 SMESG000065288.1 SMESG000059025.1 SMESG000057427.1 SMESG000052755.1 SMESG000052524.1 SMESG000050353.1 SMESG000046659.1 SMESG000037212.1 SMESG000033451.1 SMESG000031049.1 SMESG000022236.1 SMESG000019334.1 SMESG000017989.1 SMESG000026425.1 Contig11424newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003855Chromo domain-containing proteinSMESG000079180.1 SMESG000076652.1 SMESG000076091.1 SMESG000066578.1 SMESG000065288.1 SMESG000059025.1 SMESG000057427.1 SMESG000052755.1 SMESG000052524.1 SMESG000050353.1 SMESG000046659.1 SMESG000037212.1 SMESG000033451.1 SMESG000031049.1 SMESG000022236.1 SMESG000019334.1 SMESG000017989.1 SMESG000026425.1 Contig11424uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015600BED-type domain-containing proteinSMESG000080027.1 Contig33356newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015600BED-type domain-containing proteinSMESG000080027.1 Contig33356uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008869Arginine--tRNA ligaseSMESG000066154.1 Contig25886newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008869Arginine--tRNA ligaseSMESG000066154.1 Contig25886uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003769calmodulin-betaSMESG000067105.1 Contig33951newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003769calmodulin-betaSMESG000067105.1 Contig33951uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017134HemK methyltransferase family member 1SMESG000039194.1 Contig44007newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017134HemK methyltransferase family member 1SMESG000039194.1 Contig44007uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006937SMED30006937SMESG000077847.1 SMESG000072336.1 SMESG000044971.1 SMESG000033570.1 SMESG000031842.1 SMESG000026563.1 SMESG000017020.1 SMESG000014849.1 Contig13526newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006937SMED30006937SMESG000077847.1 SMESG000072336.1 SMESG000044971.1 SMESG000033570.1 SMESG000031842.1 SMESG000026563.1 SMESG000017020.1 SMESG000014849.1 Contig13526uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006125C2H2-type domain-containing proteinSMESG000020158.1 Contig29330newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006125C2H2-type domain-containing proteinSMESG000020158.1 Contig29330uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012985Protein FAM188BSMESG000064698.1 Contig38731newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012985Protein FAM188BSMESG000064698.1 Contig38731uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006087Myelin transcription factor 1SMESG000027385.1 Contig40592newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006087Myelin transcription factor 1SMESG000027385.1 Contig40592uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008504von Willebrand factor A domain containing 8SMESG000062774.1 Contig35220newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008504von Willebrand factor A domain containing 8SMESG000062774.1 Contig35220uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007308Zinc finger proteinSMESG000036361.1 Contig48085newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007308Zinc finger proteinSMESG000036361.1 Contig48085uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002355Microtubule-associated protein RP/EB family member 1SMESG000069153.1 Contig19711newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002355Microtubule-associated protein RP/EB family member 1SMESG000069153.1 Contig19711uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005638Phosphatidylinositol 4 phosphate 5 kinase type 1SMESG000017265.1 Contig33941newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005638Phosphatidylinositol 4 phosphate 5 kinase type 1SMESG000017265.1 Contig33941uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006881EF-hand calcium-binding domain-containing protein 1-likeSMESG000063996.1 Contig51427newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006881EF-hand calcium-binding domain-containing protein 1-likeSMESG000063996.1 Contig51427uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000357Transcription factor Sox-2SMESG000077970.1 Contig40500newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000357Transcription factor Sox-2SMESG000077970.1 Contig40500uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023331Transposon Ty3-I Gag-Pol polyproteinSMESG000030105.1 Contig44917newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023331Transposon Ty3-I Gag-Pol polyproteinSMESG000030105.1 Contig44917uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026445SHSP domain-containing proteinSMESG000030562.1 Contig49553newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026445SHSP domain-containing proteinSMESG000030562.1 Contig49553uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021731Multidrug resistance protein 1-like proteinSMESG000030105.1 Contig44917newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021731Multidrug resistance protein 1-like proteinSMESG000030105.1 Contig44917uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033090Hypoxia up-regulated protein 1SMESG000054253.1 Contig43017newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033090Hypoxia up-regulated protein 1SMESG000054253.1 Contig43017uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031045TBC1 domain family member 13SMESG000081952.1 Contig38309newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031045TBC1 domain family member 13SMESG000081952.1 Contig38309uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032370Beta-1,3-glucosyltransferaseSMESG000009947.1 Contig40970newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032370Beta-1,3-glucosyltransferaseSMESG000009947.1 Contig40970uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032829Chromo domain-containing proteinSMESG000079180.1 SMESG000076652.1 SMESG000076091.1 SMESG000066578.1 SMESG000065288.1 SMESG000059025.1 SMESG000057427.1 SMESG000052755.1 SMESG000052524.1 SMESG000050353.1 SMESG000046659.1 SMESG000037212.1 SMESG000033451.1 SMESG000031049.1 SMESG000022236.1 SMESG000019334.1 SMESG000017989.1 SMESG000026425.1 Contig11424newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032829Chromo domain-containing proteinSMESG000079180.1 SMESG000076652.1 SMESG000076091.1 SMESG000066578.1 SMESG000065288.1 SMESG000059025.1 SMESG000057427.1 SMESG000052755.1 SMESG000052524.1 SMESG000050353.1 SMESG000046659.1 SMESG000037212.1 SMESG000033451.1 SMESG000031049.1 SMESG000022236.1 SMESG000019334.1 SMESG000017989.1 SMESG000026425.1 Contig11424uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021257Synaptic vesicle 2-related proteinSMESG000069049.1 SMESG000069045.1 Contig47858newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021257Synaptic vesicle 2-related proteinSMESG000069049.1 SMESG000069045.1 Contig47858uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025895AP_endonuc_2 domain-containing proteinSMESG000044612.1 SMESG000044611.1 Contig38443newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025895AP_endonuc_2 domain-containing proteinSMESG000044612.1 SMESG000044611.1 Contig38443uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025406Retrovirus-related Pol polyprotein from type-1 retrotransposable element R2SMESG000061623.1 SMESG000041246.1 SMESG000014208.1 Contig29920newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025406Retrovirus-related Pol polyprotein from type-1 retrotransposable element R2SMESG000061623.1 SMESG000041246.1 SMESG000014208.1 Contig29920uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020317Heat shock protein 90SMESG000024822.1 Contig49305newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020317Heat shock protein 90SMESG000024822.1 Contig49305uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028862Zinc finger protein 333SMESG000036361.1 Contig48085newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028862Zinc finger protein 333SMESG000036361.1 Contig48085uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031920calmodulin-like protein 3SMESG000067105.1 Contig33951newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031920calmodulin-like protein 3SMESG000067105.1 Contig33951uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30027052noggin-like protein 1SMESG000032255.1 Contig49725newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30027052noggin-like protein 1SMESG000032255.1 Contig49725uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30027920Heat shock cognate 70 kDa proteinSMESG000080727.1 SMESG000080711.1 Contig31718newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30027920Heat shock cognate 70 kDa proteinSMESG000080727.1 SMESG000080711.1 Contig31718uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032366SMED30032366SMESG000076652.1 SMESG000053372.1 SMESG000050353.1 SMESG000040848.1 SMESG000034123.1 SMESG000029555.1 SMESG000023611.1 SMESG000064571.1 Contig19011newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032366SMED30032366SMESG000076652.1 SMESG000053372.1 SMESG000050353.1 SMESG000040848.1 SMESG000034123.1 SMESG000029555.1 SMESG000023611.1 SMESG000064571.1 Contig19011uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032366SMED30032366SMESG000079180.1 SMESG000076652.1 SMESG000076091.1 SMESG000066578.1 SMESG000065288.1 SMESG000059025.1 SMESG000057427.1 SMESG000052755.1 SMESG000052524.1 SMESG000050353.1 SMESG000046659.1 SMESG000037212.1 SMESG000033451.1 SMESG000031049.1 SMESG000022236.1 SMESG000019334.1 SMESG000017989.1 SMESG000026425.1 Contig11424newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032366SMED30032366SMESG000079180.1 SMESG000076652.1 SMESG000076091.1 SMESG000066578.1 SMESG000065288.1 SMESG000059025.1 SMESG000057427.1 SMESG000052755.1 SMESG000052524.1 SMESG000050353.1 SMESG000046659.1 SMESG000037212.1 SMESG000033451.1 SMESG000031049.1 SMESG000022236.1 SMESG000019334.1 SMESG000017989.1 SMESG000026425.1 Contig11424uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30027708Retrovirus-related Pol polyprotein from type-1 retrotransposable element R2SMESG000061623.1 SMESG000041246.1 SMESG000014208.1 Contig29920newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30027708Retrovirus-related Pol polyprotein from type-1 retrotransposable element R2SMESG000061623.1 SMESG000041246.1 SMESG000014208.1 Contig29920uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023483INX-13SMESG000043575.1 Contig50609newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023483INX-13SMESG000043575.1 Contig50609uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030477peptidyl prolyl cis trans isomerase FKBP-1SMESG000026331.1 Contig49356newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030477peptidyl prolyl cis trans isomerase FKBP-1SMESG000026331.1 Contig49356uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025592Xeroderma pigmentosum, complementation group CSMESG000075170.1 Contig33220newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025592Xeroderma pigmentosum, complementation group CSMESG000075170.1 Contig33220uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026134SMED30026134SMESG000023123.1 Contig37189newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026134SMED30026134SMESG000023123.1 Contig37189uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007698Zinc finger protein 28SMESG000041575.1 Contig34061newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007698Zinc finger protein 28SMESG000041575.1 Contig34061uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012666SWIM-type domain-containing proteinSMESG000003282.1 Contig18900newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012666SWIM-type domain-containing proteinSMESG000003282.1 Contig18900uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018224Adenylate kinaseSMESG000080770.1 SMESG000072841.1 SMESG000065333.1 SMESG000060686.1 SMESG000059844.1 SMESG000058646.1 SMESG000055266.1 SMESG000055265.1 SMESG000054970.1 SMESG000052813.1 SMESG000043147.1 SMESG000043019.1 SMESG000041242.1 SMESG000037745.1 SMESG000037601.1 SMESG000036070.1 SMESG000034368.1 SMESG000031415.1 SMESG000019820.1 SMESG000019663.1 SMESG000010897.1 SMESG000009005.1 SMESG000005029.1 SMESG000077800.1 SMESG000054046.1 SMESG000052058.1 Contig20343newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018224Adenylate kinaseSMESG000080770.1 SMESG000072841.1 SMESG000065333.1 SMESG000060686.1 SMESG000059844.1 SMESG000058646.1 SMESG000055266.1 SMESG000055265.1 SMESG000054970.1 SMESG000052813.1 SMESG000043147.1 SMESG000043019.1 SMESG000041242.1 SMESG000037745.1 SMESG000037601.1 SMESG000036070.1 SMESG000034368.1 SMESG000031415.1 SMESG000019820.1 SMESG000019663.1 SMESG000010897.1 SMESG000009005.1 SMESG000005029.1 SMESG000077800.1 SMESG000054046.1 SMESG000052058.1 Contig20343uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009064Protein glassSMESG000000679.1 Contig10162newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009064Protein glassSMESG000000679.1 Contig10162uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015048Cullin-3SMESG000003282.1 Contig18900newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015048Cullin-3SMESG000003282.1 Contig18900uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003094HMG box domain-containing proteinSMESG000017540.1 SMESG000070603.1 SMESG000070576.1 SMESG000017600.1 SMESG000017572.1 SMESG000017558.1 SMESG000017557.1 SMESG000017556.1 SMESG000017543.1 SMESG000017541.1 dd_Smed_v4_4601_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018275SMED30018275SMESG000039140.1 dd_Smed_v4_11051_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019364Si:ch211-193l2.10SMESG000062713.1 dd_Smed_v4_3203_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013757C2 domain-containing proteinSMESG000050479.1 dd_Smed_v4_9615_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001142CadherinSMESG000020071.1 dd_Smed_v4_11814_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005737Death-associated protein kinase 1SMESG000048879.1 dd_Smed_v4_9475_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022977SMED30022977SMESG000017540.1 SMESG000070603.1 SMESG000070576.1 SMESG000017600.1 SMESG000017572.1 SMESG000017558.1 SMESG000017557.1 SMESG000017556.1 SMESG000017543.1 SMESG000017541.1 dd_Smed_v4_4601_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021961Protocadherin alpha-11SMESG000012176.1 dd_Smed_v4_15901_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035291PikachurinSMESG000079944.1 dd_Smed_v4_10946_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020002BEN domain-containing proteinSMESG000080064.1 dd_Smed_v4_7370_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30024549Copine-3SMESG000029196.1 dd_Smed_v4_13873_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30027478SMED30027478SMESG000081245.1 dd_Smed_v4_3287_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30027594CYLD lysine 63 deubiquitinaseSMESG000015653.1 dd_Smed_v4_3043_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021280Leucine Rich repeat-containing domain proteinSMESG000006503.1 dd_Smed_v4_18031_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025164Protein NDRG4SMESG000065324.1 dd_Smed_v4_2911_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021219Retinol dehydrogenase 13SMESG000010175.1 dd_Smed_v4_10881_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30027978Calcyphosin proteinSMESG000025859.1 dd_Smed_v4_4512_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021485SMED30021485SMESG000059844.1 dd_Smed_v4_1328_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021868coiled-coil domain-containing protein 39SMESG000072035.1 SMESG000072034.1 dd_Smed_v4_5955_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028743Regulator of G-protein signaling 22SMESG000069110.1 dd_Smed_v4_11778_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030594OpsinSMESG000074489.1 dd_Smed_v4_15036_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30025232Dynamin-1SMESG000067156.1 dd_Smed_v4_6863_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022622Centrosomal protein 350SMESG000033533.1 dd_Smed_v4_5967_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026782Cilia-and flagella-associated protein 58SMESG000061980.1 dd_Smed_v4_5727_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028312Protein tyrosine phosphatase receptor type DSMESG000053906.1 dd_Smed_v4_12545_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022806Calcyphosin proteinSMESG000025859.1 dd_Smed_v4_4512_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031735E3 ubiquitin-protein ligase PDZRN3SMESG000080284.1 dd_Smed_v4_4699_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022926Lim domain only 1SMESG000028893.1 dd_Smed_v4_17422_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025786SMED30025786SMESG000009944.1 dd_16708dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30027162MDS1 and EVI1 complex locus protein EVI1SMESG000028951.1 dd_Smed_v4_22685_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026172srebp proteinSMESG000056019.1 dd_Smed_v4_3641_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022617Neuronal calcium sensor 2SMESG000027982.1 dd_Smed_v4_5266_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035723nesprin-1-likeSMESG000023320.1 dd_Smed_v4_10282_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022233SPATA6 domain-containing proteinSMESG000013811.1 dd_Smed_v4_4304_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028228Centrosomal protein 164SMESG000054195.1 SMESG000021687.1 dd_Smed_v4_12228_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30024109Non-specific serine/threonine protein kinaseSMESG000074914.1 dd_Smed_v4_11891_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020525Dynein intermediate chain 2, ciliarySMESG000001839.1 SMESG000001830.1 dd_Smed_v4_4753_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035848Tubulin beta chainSMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044888.1 SMESG000035755.1 dd_Smed_v4_83_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035848Tubulin beta chainSMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044888.1 SMESG000035755.1 dd_Smed_v4_83_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30024152CKLF-like MARVEL transmembrane domain-containing protein 7SMESG000001041.1 dd_Smed_v4_3096_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003375Striatin Pro11SMESG000072340.1 dd_Smed_v4_8286_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013138SMED30013138SMESG000004029.1 dd_Smed_v4_4798_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006818Chromodomain-helicase-DNA-binding proteinSMESG000033397.1 SMESG000033395.1 dd_Smed_v4_2597_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004118Tubulin beta chainSMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044888.1 SMESG000035755.1 dd_Smed_v4_83_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004118Tubulin beta chainSMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044888.1 SMESG000035755.1 dd_Smed_v4_83_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30014844Flotillin-1SMESG000004975.1 dd_Smed_v4_1637_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001480Serine/threonine-protein kinase ULK2SMESG000049447.1 dd_Smed_v4_1196_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015251Transmembrane protein 184CSMESG000049447.1 dd_Smed_v4_1196_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006884Protein dpy-30-likeSMESG000008786.1 dd_Smed_v4_9103_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002009Regulator of G-protein signalingSMESG000048981.1 dd_Smed_v4_8648_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011216slc1a-2SMESG000022787.1 dd_Smed_v4_7570_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002168Spondin-1SMESG000039905.1 dd_Smed_v4_8655_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015974FAST kinase domain-containing protein 1, mitochondrialSMESG000064523.1 dd_Smed_v4_8917_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002718Family with sequence similarity 227 member BSMESG000052176.1 SMESG000046302.1 dd_Smed_v4_15102_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017160sertSMESG000021044.1 dd_Smed_v4_12700_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30003269Reticulon-like proteinSMESG000007676.1 dd_Smed_v4_1796_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016231Protocadherin 11SMESG000051413.1 dd_Smed_v4_16397_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013731CentrinSMESG000040368.1 dd_Smed_v4_7903_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011898Protein F37C4.5SMESG000008044.1 dd_Smed_v4_9190_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014091Opioid-binding protein/cell adhesion moleculeSMESG000026220.1 dd_Smed_v4_5005_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014724Tetraspanin-CD63 receptorSMESG000041117.1 dd_Smed_v4_1378_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016729Glutamate receptorSMESG000073692.1 dd_Smed_v4_20242_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006402Progesterone immunomodulatory binding factor 1SMESG000046936.1 dd_Smed_v4_13444_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001681SMED30001681SMESG000049443.1 dd_Smed_v4_1193_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008035Secretory carrier-associated membrane proteinSMESG000037804.1 dd_Smed_v4_8593_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000515Nuclear receptor corepressorSMESG000052685.1 dd_Smed_v4_7709_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009251coiled-coil domain-containing protein 146SMESG000006416.1 dd_Smed_v4_6858_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015723RNA-binding protein MusashiSMESG000045507.1 SMESG000045502.1 dd_Smed_v4_13817_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018004SMED30018004SMESG000039905.1 dd_Smed_v4_8655_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003374Spectrin beta chainSMESG000039799.1 dd_Smed_v4_6202_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002366cAMP-dependent protein kinase regulatory subunitSMESG000052390.1 dd_Smed_v4_7586_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008751Liprin-alpha-2SMESG000024331.1 SMESG000024325.1 dd_Smed_v4_12307_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019896casein kinase ISMESG000013473.1 dd_Smed_v4_1225_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001408Tyrosine-protein phosphatase Lar-likeSMESG000042151.1 dd_Smed_v4_16093_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011296SMED30011296SMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044888.1 SMESG000035755.1 dd_Smed_v4_83_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011296SMED30011296SMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044888.1 SMESG000035755.1 dd_Smed_v4_83_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30013015Flotillin-1SMESG000004975.1 dd_Smed_v4_1637_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022101Down syndrome cell adhesion moleculeSMESG000048977.1 dd_Smed_v4_5856_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023988Dynamin-type G domain-containing proteinSMESG000002973.1 dd_Smed_v4_9275_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032368C2 domain-containing proteinSMESG000059632.1 dd_Smed_v4_6358_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025755DNA-binding protein RFX5SMESG000072002.1 dd_Smed_v4_6108_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031139WASH complex subunit 2CSMESG000014537.1 SMESG000014534.1 dd_Smed_v4_19560_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023308SMED30023308SMESG000063568.1 dd_Smed_v4_762_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030254SMED30030254SMESG000020648.1 dd_Smed_v4_8926_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30034629Golgi-associated plant pathogenesis-related protein 1SMESG000063568.1 dd_Smed_v4_762_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032106SMED30032106SMESG000080318.1 dd_Smed_v4_8948_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026275MFS domain-containing proteinSMESG000060693.1 dd_Smed_v4_4772_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30034947SMED30034947SMESG000077223.1 dd_Smed_v4_7005_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033164Heat shock 70 kDa proteinSMESG000041117.1 dd_Smed_v4_1378_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035681Intraflagellar transport protein 88SMESG000039906.1 dd_Smed_v4_5484_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031880Family with sequence similarity 227 member BSMESG000052176.1 SMESG000046302.1 dd_Smed_v4_15102_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031395TTF-type domain-containing proteinSMESG000065691.1 dd_Smed_v4_8970_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035315Endothelin-converting enzyme 1SMESG000025056.1 dd_Smed_v4_8276_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029555Serine/arginine-rich splicing factor 4SMESG000045507.1 SMESG000045502.1 dd_Smed_v4_13817_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30034220Flotillin-1SMESG000004975.1 dd_Smed_v4_1637_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020027SMED30020027SMESG000020648.1 dd_Smed_v4_8926_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022769Glycine receptor subunit alpha-3SMESG000061905.1 dd_Smed_v4_8110_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030803[F-actin]-monooxygenase MICAL2SMESG000021733.1 dd_Smed_v4_8586_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028806SMED30028806SMESG000065691.1 dd_Smed_v4_8970_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030360Voltage-dependent calcium channel unc-36SMESG000020648.1 dd_Smed_v4_8926_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013216Chromodomain-helicase-DNA-binding proteinSMESG000000092.1 dd_Smed_v4_12815_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009921SMED30009921SMESG000018657.1 dd_Smed_v4_15255_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008591Zinc finger MYM-type protein 1SMESG000054559.1 dd_Smed_v4_7987_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000596PeroxiredoxinSMESG000001807.1 dd_Smed_v4_7781_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008671PhosphodiesteraseSMESG000021196.1 dd_Smed_v4_8589_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011486migration and invasion-inhibitory proteinSMESG000018657.1 dd_Smed_v4_15255_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014919KIF3A-like proteinSMESG000075065.1 dd_Smed_v4_4343_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30034325Receptor-type tyrosine-protein phosphatase N2SMESG000078547.1 dd_Smed_v4_6990_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026534Rho-related GTP-binding proteinSMESG000022390.1 dd_Smed_v4_578_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026182Sodium/potassium-transporting ATPase subunit beta-2SMESG000071416.1 dd_Smed_v4_7917_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033551PhosphotransferaseSMESG000043559.1 dd_Smed_v4_4327_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028097PhosphodiesteraseSMESG000051078.1 dd_Smed_v4_6976_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025473mxi-2 proteinSMESG000060394.1 dd_Smed_v4_4048_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30036006beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase 3SMESG000051810.1 SMESG000051787.1 SMESG000043068.1 SMESG000043067.1 SMESG000043052.1 SMESG000009027.1 SMESG000008972.1 dd_Smed_v4_6205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025157SMED30025157SMESG000061841.1 dd_Smed_v4_6425_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031687TNF receptor-associated factorSMESG000014725.1 SMESG000014724.1 SMESG000014706.1 SMESG000014702.1 SMESG000014700.1 dd_Smed_v4_4420_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023179SMED30023179SMESG000024834.1 dd_Smed_v4_6904_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028057Retinal homeobox protein RaxSMESG000019089.1 dd_Smed_v4_6404_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30027268Histone H1BSMESG000071975.1 dd_Smed_v4_3898_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023059EF-hand calcium-binding domain-containing protein 6SMESG000052556.1 SMESG000052552.1 dd_Smed_v4_7065_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025736PHB domain-containing proteinSMESG000076275.1 dd_Smed_v4_5746_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021652Ras association domain family member 7aSMESG000080298.1 dd_Smed_v4_3722_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30027626SMED30027626SMESG000024732.1 dd_Smed_v4_5838_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029361KIF3B-like proteinSMESG000075065.1 dd_Smed_v4_4343_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023243SMED30023243SMESG000009320.1 dd_Smed_v4_587_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30024282Synaptosomal-associated proteinSMESG000034282.1 dd_Smed_v4_3977_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032280Histone acetyltransferaseSMESG000062900.1 dd_Smed_v4_5797_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023326Ig-like domain-containing proteinSMESG000078594.1 dd_Smed_v4_4106_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029711SMED30029711SMESG000039803.1 dd_Smed_v4_3788_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020643Chromosome 11 open reading frame 58SMESG000030362.1 dd_Smed_v4_6127_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029026Multidrug resistance-associated protein 1SMESG000014785.1 dd_Smed_v4_3077_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030621Regulator of G-protein signaling, putativeSMESG000072045.1 dd_Smed_v4_5311_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022796phosphatidylinositide phosphatase SAC2SMESG000079090.1 dd_Smed_v4_6584_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021159phosphatidylinositide phosphatase SAC2SMESG000079090.1 dd_Smed_v4_6584_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035584Stabilizer of axonemal microtubules 2SMESG000009389.1 dd_Smed_v4_3695_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035226AnnexinSMESG000023108.1 dd_Smed_v4_5798_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003545Glutamate receptor ionotropic, NMDA 3ASMESG000037019.1 dd_Smed_v4_5950_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001207Calmodulin-binding transcription activator 1SMESG000036440.1 dd_Smed_v4_8179_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011238Kinesin-like proteinSMESG000035453.1 dd_Smed_v4_10765_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011238Kinesin-like proteinSMESG000035453.1 dd_Smed_v4_13424_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014280Malignant brain tumor-like proteinSMESG000025138.1 dd_Smed_v4_11547_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001024SMED30001024SMESG000079945.1 dd_Smed_v4_9265_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017286Major facilitator superfamily domain-containing 4SMESG000038006.1 dd_Smed_v4_10372_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001510Protein unc-79 homologSMESG000053097.1 dd_Smed_v4_6600_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003426bax-2SMESG000023003.1 dd_Smed_v4_8592_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005692Cytoplasmic dynein 2 heavy chain 1SMESG000008384.1 SMESG000008382.1 dd_Smed_v4_9136_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010364SMED30010364SMESG000056847.1 SMESG000056843.1 SMESG000056838.1 SMESG000044770.1 SMESG000044762.1 SMESG000007140.1 dd_Smed_v4_1137_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005253EF-hand domain-containing family member C2SMESG000076759.1 dd_Smed_v4_6035_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017399Transmembrane protein 81SMESG000026648.1 dd_Smed_v4_10248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005033vinculinSMESG000028193.1 dd_3542dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30013306Protein NDRG4SMESG000055233.1 SMESG000055204.1 dd_Smed_v4_11017_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001191Transcription factor Sox-2SMESG000067682.1 SMESG000060099.1 dd_Smed_v4_8104_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020291Centrosomal protein 104SMESG000023549.1 dd_Smed_v4_10228_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020055Neur_chan_LBD domain-containing proteinSMESG000041829.1 dd_Smed_v4_19336_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035448Kinesin motor domain proteinSMESG000075721.1 dd_Smed_v4_11799_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30034348Calcium/calmodulin-dependent protein kinase ISMESG000078937.1 dd_Smed_v4_5783_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033894Neur_chan_LBD domain-containing proteinSMESG000041829.1 dd_Smed_v4_19336_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028311Spectrin beta chainSMESG000066485.1 dd_Smed_v4_7344_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028626C2H2-type domain-containing proteinSMESG000019280.1 SMESG000019279.1 dd_Smed_v4_10324_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032498NPHP8SMESG000076081.1 dd_Smed_v4_11425_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031309nuclear protein MDM1-like isoform X1SMESG000058479.1 dd_Smed_v4_10635_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025648InnexinSMESG000027007.1 dd_Smed_v4_12178_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023266cilia- and flagella-associated protein 43SMESG000000491.1 dd_Smed_v4_10271_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019205Neur_chan_LBD domain-containing proteinSMESG000039749.1 dd_15962dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30015096Family with sequence similarity 183 member ASMESG000024586.1 dd_Smed_v4_8725_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017314Dynein regulatory complex subunit 7SMESG000078850.1 dd_Smed_v4_12588_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017299Protein kinase C beta typeSMESG000053142.1 dd_Smed_v4_12946_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015151Phosphatidylinositol transfer protein alpha isoformSMESG000080104.1 SMESG000075783.1 dd_Smed_v4_2926_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019531NPHP6SMESG000072747.1 dd_Smed_v4_7145_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016819DnaJ like protein subfamily C member 5SMESG000007139.1 dd_Smed_v4_5990_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015721Diacylglycerol kinaseSMESG000023623.1 SMESG000017153.1 dd_Smed_v4_7792_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016218Homeobox protein cut-likeSMESG000065026.1 dd_Smed_v4_13843_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015622Small G protein signaling modulator 1SMESG000001901.1 SMESG000001889.1 SMESG000061056.1 SMESG000058180.1 SMESG000057533.1 SMESG000047874.1 SMESG000046659.1 dd_Smed_v4_12130_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009735Bardet-Biedl syndrome 5 protein homologSMESG000052420.1 dd_Smed_v4_8523_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016993Rap guanine nucleotide exchange factor 4SMESG000014113.1 dd_Smed_v4_9547_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009035Zinc finger CCCH domain-containing protein 4SMESG000038705.1 dd_Smed_v4_6243_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011696SMED30011696SMESG000053119.1 SMESG000009621.1 SMESG000003158.1 SMESG000077074.1 SMESG000055143.1 SMESG000049878.1 SMESG000003715.1 dd_Smed_v4_3004_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016951Calmodulin-like proteinSMESG000029865.1 dd_23127dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30006541SMED30006541SMESG000012332.1 SMESG000012317.1 SMESG000058954.1 dd_Smed_v4_246_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010842EF-hand domain-containing protein 1SMESG000078434.1 dd_Smed_v4_2935_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019876Regulator of G-protein signalingSMESG000012254.1 dd_Smed_v4_8463_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016015Cilia and flagella associated protein 157SMESG000020913.1 dd_Smed_v4_11523_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010664SMED30010664SMESG000053423.1 dd_Smed_v4_8209_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007517IQ domain-containing protein E-likeSMESG000013899.1 SMESG000013896.1 dd_Smed_v4_7345_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009328SMED30009328SMESG000053119.1 SMESG000009621.1 SMESG000003158.1 SMESG000077074.1 SMESG000055143.1 SMESG000049878.1 SMESG000003715.1 dd_Smed_v4_3004_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011512Radial spoke head 1 homologSMESG000014300.1 dd_Smed_v4_3321_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015955Growth arrest-specific protein 8SMESG000013356.1 dd_Smed_v4_2848_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001479G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000029294.1 SMESG000029291.1 dd_Smed_v4_2802_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001479G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000029291.1 dd_Smed_v4_6716_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006636Kinesin-like proteinSMESG000022785.1 dd_Smed_v4_6697_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016948Regulator of G-protein signaling 9-binding proteinSMESG000016932.1 dd_Smed_v4_14671_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016287Reverse transcriptase domain-containing proteinSMESG000081574.1 SMESG000081529.1 SMESG000079557.1 SMESG000079250.1 SMESG000077556.1 SMESG000075496.1 SMESG000073961.1 SMESG000073618.1 SMESG000073174.1 SMESG000071859.1 SMESG000071198.1 SMESG000071073.1 SMESG000070153.1 SMESG000068262.1 SMESG000068028.1 SMESG000067334.1 SMESG000065567.1 SMESG000061192.1 SMESG000060952.1 SMESG000060260.1 SMESG000059623.1 SMESG000050492.1 SMESG000050479.1 SMESG000050299.1 SMESG000049776.1 SMESG000048159.1 SMESG000044971.1 SMESG000043973.1 SMESG000042620.1 SMESG000040932.1 SMESG000039792.1 SMESG000039741.1 SMESG000039356.1 SMESG000034716.1 SMESG000033763.1 SMESG000029286.1 SMESG000028614.1 SMESG000027381.1 SMESG000025022.1 SMESG000021522.1 SMESG000020398.1 SMESG000019968.1 SMESG000018320.1 SMESG000015216.1 SMESG000015117.1 SMESG000015102.1 SMESG000013389.1 SMESG000012534.1 SMESG000012464.1 SMESG000011278.1 SMESG000011147.1 SMESG000007021.1 SMESG000006554.1 SMESG000001897.1 SMESG000070487.1 SMESG000068881.1 SMESG000064552.1 SMESG000063831.1 SMESG000056926.1 SMESG000050300.1 SMESG000047318.1 SMESG000047014.1 SMESG000043279.1 SMESG000030931.1 SMESG000023641.1 SMESG000018675.1 SMESG000017256.1 SMESG000013665.1 SMESG000013089.1 SMESG000011196.1 SMESG000009621.1 SMESG000008519.1 SMESG000005066.1 dd_Smed_v4_129_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019483Kinesin-like proteinSMESG000053119.1 SMESG000009621.1 SMESG000003158.1 SMESG000077074.1 SMESG000055143.1 SMESG000049878.1 SMESG000003715.1 dd_Smed_v4_3004_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019682Leukocyte receptor cluster member 8-like proteinSMESG000080104.1 SMESG000075783.1 dd_Smed_v4_2926_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014811Calcium-activated potassium channel slo-1, putativeSMESG000044594.1 dd_Smed_v4_8138_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016446Root phototropism protein 2SMESG000067415.1 dd_Smed_v4_8081_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014511Ras-related protein Rab-10SMESG000053119.1 SMESG000009621.1 SMESG000003158.1 SMESG000077074.1 SMESG000055143.1 SMESG000049878.1 SMESG000003715.1 dd_Smed_v4_3004_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008236SMED30008236SMESG000076267.1 dd_28015dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30014476SMED30014476SMESG000051996.1 dd_2723dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30006295SMED30006295SMESG000037104.1 dd_Smed_v4_3744_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013128Death domain proteinSMESG000003436.1 Contig18759newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013128Death domain proteinSMESG000003436.1 Contig18759uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003783Transcription factor 7-like 1SMESG000059443.1 Contig55186newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003783Transcription factor 7-like 1SMESG000059443.1 Contig55186uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008579ST13 Hsp70 interacting proteinSMESG000078709.1 SMESG000071677.1 SMESG000069228.1 SMESG000017570.1 SMESG000017358.1 SMESG000017347.1 SMESG000013728.1 SMESG000001430.1 Contig54963newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008579ST13 Hsp70 interacting proteinSMESG000078709.1 SMESG000071677.1 SMESG000069228.1 SMESG000017570.1 SMESG000017358.1 SMESG000017347.1 SMESG000013728.1 SMESG000001430.1 Contig54963uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000908CN hydrolase domain-containing proteinSMESG000076652.1 SMESG000053372.1 SMESG000050353.1 SMESG000040848.1 SMESG000034123.1 SMESG000029555.1 SMESG000023611.1 SMESG000064571.1 Contig19011newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000908CN hydrolase domain-containing proteinSMESG000076652.1 SMESG000053372.1 SMESG000050353.1 SMESG000040848.1 SMESG000034123.1 SMESG000029555.1 SMESG000023611.1 SMESG000064571.1 Contig19011uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008817ADAM 17-like proteaseSMESG000057956.1 Contig53831newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008817ADAM 17-like proteaseSMESG000057956.1 Contig53831uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015570SMED30015570SMESG000008795.1 Contig13050newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015570SMED30015570SMESG000008795.1 Contig13050uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029282Potassium voltage-gated channel protein Shal-like ProteinSMESG000081212.1 Contig52830newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029282Potassium voltage-gated channel protein Shal-like ProteinSMESG000081212.1 Contig52830uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026828PiggyBac transposable element-derived protein 5SMESG000081274.1 SMESG000074085.1 SMESG000071708.1 SMESG000060519.1 SMESG000033494.1 SMESG000022037.1 SMESG000019964.1 SMESG000008378.1 Contig15257newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026828PiggyBac transposable element-derived protein 5SMESG000081274.1 SMESG000074085.1 SMESG000071708.1 SMESG000060519.1 SMESG000033494.1 SMESG000022037.1 SMESG000019964.1 SMESG000008378.1 Contig15257uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022089heterogeneous nuclear ribonucleoprotein KSMESG000033971.1 Contig15533newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022089heterogeneous nuclear ribonucleoprotein KSMESG000033971.1 Contig15533uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033276SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily B member 1SMESG000018094.1 Contig51602newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033276SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily B member 1SMESG000018094.1 Contig51602uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031090Ubiquinone biosynthesis protein COQ4 homolog, mitochondrialSMESG000076821.1 SMESG000055285.1 SMESG000054243.1 SMESG000021425.1 SMESG000013482.1 Contig53275newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031090Ubiquinone biosynthesis protein COQ4 homolog, mitochondrialSMESG000076821.1 SMESG000055285.1 SMESG000054243.1 SMESG000021425.1 SMESG000013482.1 Contig53275uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026318SMED30026318SMESG000081274.1 SMESG000074085.1 SMESG000071708.1 SMESG000060519.1 SMESG000033494.1 SMESG000022037.1 SMESG000019964.1 SMESG000008378.1 Contig15257newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026318SMED30026318SMESG000081274.1 SMESG000074085.1 SMESG000071708.1 SMESG000060519.1 SMESG000033494.1 SMESG000022037.1 SMESG000019964.1 SMESG000008378.1 Contig15257uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030576Ankyrin repeat and FYVE domain containing 1SMESG000079180.1 SMESG000076652.1 SMESG000076091.1 SMESG000066578.1 SMESG000065288.1 SMESG000059025.1 SMESG000057427.1 SMESG000052755.1 SMESG000052524.1 SMESG000050353.1 SMESG000046659.1 SMESG000037212.1 SMESG000033451.1 SMESG000031049.1 SMESG000022236.1 SMESG000019334.1 SMESG000017989.1 SMESG000026425.1 Contig11424newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030576Ankyrin repeat and FYVE domain containing 1SMESG000079180.1 SMESG000076652.1 SMESG000076091.1 SMESG000066578.1 SMESG000065288.1 SMESG000059025.1 SMESG000057427.1 SMESG000052755.1 SMESG000052524.1 SMESG000050353.1 SMESG000046659.1 SMESG000037212.1 SMESG000033451.1 SMESG000031049.1 SMESG000022236.1 SMESG000019334.1 SMESG000017989.1 SMESG000026425.1 Contig11424uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031962Frizzled receptorSMESG000053774.1 Contig52925newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031962Frizzled receptorSMESG000053774.1 Contig52925uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026247stem loop binding proteinSMESG000060978.1 Contig55557newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026247stem loop binding proteinSMESG000060978.1 Contig55557uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029793SMED30029793SMESG000081274.1 SMESG000074085.1 SMESG000071708.1 SMESG000060519.1 SMESG000033494.1 SMESG000022037.1 SMESG000019964.1 SMESG000008378.1 Contig15257newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029793SMED30029793SMESG000081274.1 SMESG000074085.1 SMESG000071708.1 SMESG000060519.1 SMESG000033494.1 SMESG000022037.1 SMESG000019964.1 SMESG000008378.1 Contig15257uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025072Lrr and pyd domains-containing protein 3-like proteinSMESG000079180.1 SMESG000076652.1 SMESG000076091.1 SMESG000066578.1 SMESG000065288.1 SMESG000059025.1 SMESG000057427.1 SMESG000052755.1 SMESG000052524.1 SMESG000050353.1 SMESG000046659.1 SMESG000037212.1 SMESG000033451.1 SMESG000031049.1 SMESG000022236.1 SMESG000019334.1 SMESG000017989.1 SMESG000026425.1 Contig11424newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025072Lrr and pyd domains-containing protein 3-like proteinSMESG000079180.1 SMESG000076652.1 SMESG000076091.1 SMESG000066578.1 SMESG000065288.1 SMESG000059025.1 SMESG000057427.1 SMESG000052755.1 SMESG000052524.1 SMESG000050353.1 SMESG000046659.1 SMESG000037212.1 SMESG000033451.1 SMESG000031049.1 SMESG000022236.1 SMESG000019334.1 SMESG000017989.1 SMESG000026425.1 Contig11424uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029637WD repeat and FYVE domain-containing protein 2SMESG000029198.1 Contig54805newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029637WD repeat and FYVE domain-containing protein 2SMESG000029198.1 Contig54805uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022580runt-1SMESG000014779.1 Contig54774newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022580runt-1SMESG000014779.1 Contig54774uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025972Fzd-5/8-2SMESG000053774.1 Contig52925newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025972Fzd-5/8-2SMESG000053774.1 Contig52925uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026124Dynein heavy chain, axonemalSMESG000040510.1 Contig16071newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026124Dynein heavy chain, axonemalSMESG000040510.1 Contig16071uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030071Rho_N domain-containing proteinSMESG000076091.1 SMESG000076042.1 SMESG000074857.1 SMESG000069936.1 SMESG000068687.1 SMESG000059025.1 SMESG000057864.1 SMESG000053372.1 SMESG000048922.1 SMESG000042302.1 SMESG000040848.1 SMESG000034123.1 SMESG000026530.1 SMESG000023611.1 SMESG000022236.1 SMESG000006220.1 Contig12427newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030071Rho_N domain-containing proteinSMESG000076091.1 SMESG000076042.1 SMESG000074857.1 SMESG000069936.1 SMESG000068687.1 SMESG000059025.1 SMESG000057864.1 SMESG000053372.1 SMESG000048922.1 SMESG000042302.1 SMESG000040848.1 SMESG000034123.1 SMESG000026530.1 SMESG000023611.1 SMESG000022236.1 SMESG000006220.1 Contig12427uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026655SMED30026655SMESG000069153.1 Contig19711newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026655SMED30026655SMESG000069153.1 Contig19711uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017896Activator of 90 kDa heat shock protein ATPase-like protein 1SMESG000066442.1 Contig31172newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017896Activator of 90 kDa heat shock protein ATPase-like protein 1SMESG000066442.1 Contig31172uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017162Casein kinase II subunit betaSMESG000060292.1 Contig48515newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017162Casein kinase II subunit betaSMESG000060292.1 Contig48515uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003323Non-specific serine/threonine protein kinaseSMESG000042362.1 dd_Smed_v4_5124_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003468Phosphoenolpyruvate carboxykinase [GTP]SMESG000073058.1 SMESG000003144.1 dd_Smed_v4_536_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001640SMED30001640SMESG000007247.1 dd_Smed_v4_4472_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001489SMED30001489SMESG000022773.1 dd_5694dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30000065SMED30000065SMESG000049103.1 dd_Smed_v4_397_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000291Intersectin-1SMESG000065922.1 SMESG000066021.1 SMESG000065955.1 SMESG000065944.1 dd_Smed_v4_5505_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30027455SMED30027455SMESG000063750.1 dd_Smed_v4_17076_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30034202SMED30034202SMESG000077061.1 dd_Smed_v4_1917_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED3003573414-3-3 protein epsilonSMESG000075252.1 dd_Smed_v4_1702_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30034212SMED30034212SMESG000023080.1 dd_Smed_v4_8763_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031552SMED30031552SMESG000025950.1 dd_Smed_v4_1574_6_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030309SMED30030309SMESG000075212.1 SMESG000075211.1 SMESG000074910.1 SMESG000074908.1 SMESG000074907.1 dd_Smed_v4_1061_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028992Guanine nucleotide-binding protein subunit betaSMESG000038555.1 dd_Smed_v4_1615_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030310SMED30030310SMESG000057201.1 dd_Smed_v4_1531_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012075SMED30012075SMESG000059352.1 SMESG000059351.1 dd_Smed_v4_420_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015276SMED30015276SMESG000054104.1 SMESG000017493.1 SMESG000016095.1 SMESG000014571.1 dd_Smed_v4_3885_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013257Tektin-2SMESG000026446.1 SMESG000026445.1 SMESG000026429.1 dd_Smed_v4_2694_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003506Anaphase promoting complex subunit 4SMESG000062466.1 dd_Smed_v4_4177_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014848Dynein light chainSMESG000043518.1 dd_Smed_v4_5284_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008560Secretogranin 5SMESG000016510.1 dd_Smed_v4_3862_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010503CEP135SMESG000077870.1 dd_Smed_v4_5218_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012789Expressed conserved proteinSMESG000033789.1 SMESG000033788.1 dd_Smed_v4_3908_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014318SBF2 domain-containing proteinSMESG000078604.1 dd_Smed_v4_3628_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015650FGFR1 oncogene partnerSMESG000006505.1 dd_Smed_v4_5371_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010941dnaJ homolog subfamily B member 13SMESG000076708.1 dd_Smed_v4_4820_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011576HECT and RLD domain containing E3 ubiquitin protein ligase 2SMESG000054104.1 SMESG000017493.1 SMESG000016095.1 SMESG000014571.1 dd_Smed_v4_3885_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012826SMED30012826SMESG000017012.1 SMESG000017011.1 dd_Smed_v4_309_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED300070105-hydroxytryptamine receptor 1ASMESG000017736.1 dd_Smed_v4_5341_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009973mxi-1 proteinSMESG000047681.1 SMESG000016277.1 dd_Smed_v4_4415_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004437Si:ch211-57i17.1SMESG000017011.1 dd_Smed_v4_6037_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015589SMED30015589SMESG000063816.1 SMESG000010536.1 SMESG000045280.1 SMESG000029730.1 dd_Smed_v4_4145_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005744FGFR1 oncogene partnerSMESG000006505.1 dd_Smed_v4_5371_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017278Ig-like domain-containing proteinSMESG000001734.1 dd_Smed_v4_10042_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019393protocadherin-1SMESG000033799.1 dd_Smed_v4_16629_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019001ras-specific guanine nucleotide-releasing factor 1SMESG000056262.1 dd_Smed_v4_18313_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013225SMED30013225SMESG000018299.1 dd_Smed_v4_17045_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019915Potassium voltage-gated channel subfamily A member 2SMESG000013562.1 dd_Smed_v4_15133_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016871SMED30016871SMESG000036609.1 dd_1747dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30016004SMED30016004SMESG000018602.1 dd_1083dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30016004SMED30016004SMESG000018602.1 dd_Smed_v4_1083_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014047SMED30014047SMESG000025950.1 dd_Smed_v4_1574_6_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019425Neuronal acetylcholine receptor subunit alpha-2SMESG000015263.1 SMESG000015256.1 dd_Smed_v4_18201_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017943SMED30017943SMESG000022837.1 dd_Smed_v4_16017_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023587SMED30023587SMESG000063816.1 SMESG000010536.1 SMESG000045280.1 SMESG000029730.1 dd_Smed_v4_4145_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021821Transient receptor potential cation channel subfamily M memberSMESG000078720.1 dd_17981dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30023176SMED30023176SMESG000015263.1 SMESG000015256.1 dd_Smed_v4_18201_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021702C2H2-type domain-containing proteinSMESG000080376.1 dd_Smed_v4_15473_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021014slc38a-4SMESG000029171.1 dd_Smed_v4_16428_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020627Echinoderm microtubule associated protein like 1SMESG000017256.1 dd_Smed_v4_14226_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012043Calcium-transporting ATPaseSMESG000063816.1 SMESG000010536.1 SMESG000045280.1 SMESG000029730.1 dd_Smed_v4_4145_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012957Neuronal acetylcholine receptor subunit alpha-2SMESG000015263.1 SMESG000015256.1 dd_Smed_v4_18201_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006985WD repeat-containing protein 49SMESG000041940.1 dd_Smed_v4_13248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009188Radial spoke head 14-like proteinSMESG000077061.1 dd_Smed_v4_1917_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012522Ankyrin-2SMESG000026655.1 dd_Smed_v4_10835_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010500Fibronectin type III domain proteinSMESG000033545.1 dd_Smed_v4_15017_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009463WD repeat-containing protein 49SMESG000041940.1 dd_Smed_v4_13248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008052SMED30008052SMESG000075212.1 SMESG000075211.1 SMESG000074910.1 SMESG000074908.1 SMESG000074907.1 dd_Smed_v4_1061_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008080Transmembrane protein 45BSMESG000060226.1 SMESG000021986.1 dd_Smed_v4_1542_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007500coiled-coil domain-containing protein 170SMESG000074429.1 dd_Smed_v4_10140_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005448SMED30005448SMESG000009922.1 dd_Smed_v4_21965_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002182Neuropeptide Y prohormone-11SMESG000064810.1 dd_Smed_v4_16946_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30004083Cellular communication network factor 4SMESG000036248.1 dd_Smed_v4_18465_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006481WD repeat-containing protein 49SMESG000041940.1 dd_Smed_v4_13248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003292SMED30003292SMESG000066258.1 dd_19593dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30002828Interferon regulatory factor 2-binding protein 2SMESG000042710.1 dd_Smed_v4_18245_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002995SMED30002995SMESG000050337.1 dd_2103dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30006883SMED30006883SMESG000063750.1 dd_Smed_v4_17076_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006476NEK8-2SMESG000043305.1 SMESG000043302.1 dd_Smed_v4_10144_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001622SMED30001622SMESG000040908.1 dd_Smed_v4_10356_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020051ThioninSMESG000031412.1 dd_3063dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30019874CalmodulinSMESG000010769.1 dd_Smed_v4_255_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015453Poly [ADP-ribose] polymeraseSMESG000011115.1 dd_Smed_v4_2611_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016664SMED30016664SMESG000011618.1 dd_Smed_v4_2370_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30019565Radial spoke head protein 4-like protein ASMESG000044927.1 dd_Smed_v4_5346_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012203NGFI-A-binding protein 1SMESG000013520.1 dd_Smed_v4_3973_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016017NeuroglianSMESG000005684.1 dd_Smed_v4_4031_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031336MusashiSMESG000071202.1 dd_Smed_v4_7323_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028487Cell cycle control 50ASMESG000061468.1 dd_Smed_v4_3395_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30034903cilia- and flagella-associated protein 77SMESG000042608.1 dd_Smed_v4_5179_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020268Dynamin-type G domain-containing proteinSMESG000014756.1 SMESG000014755.1 dd_Smed_v4_2390_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30024644Importin-11SMESG000066556.1 dd_Smed_v4_4566_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025672Radial spoke head 3SMESG000067698.1 dd_Smed_v4_2287_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30027888Immunoglobulin superfamily member 10SMESG000021154.1 dd_Smed_v4_8690_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029668Adenylate kinase isoenzyme 5SMESG000020486.1 SMESG000020480.1 dd_Smed_v4_5119_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004142Calcium-dependent secretion activator 1SMESG000011756.1 dd_Smed_v4_11725_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004718SMED30004718SMESG000062855.1 dd_Smed_v4_6580_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016045Cysteine-rich proteinSMESG000044206.1 dd_Smed_v4_1185_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017175ras GTPase-activating protein nGAP isoform X8SMESG000037132.1 SMESG000037110.1 dd_Smed_v4_6499_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005424PH domain-containing proteinSMESG000061841.1 dd_Smed_v4_6425_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003780Serine/threonine-protein kinase 36SMESG000076885.1 dd_Smed_v4_11067_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002754TPR_REGION domain-containing proteinSMESG000008310.1 dd_Smed_v4_11374_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011798E3 ubiquitin-protein ligase MIB2SMESG000043477.1 SMESG000010549.1 SMESG000010347.1 SMESG000010327.1 dd_Smed_v4_593_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010852SMED30010852SMESG000063380.1 SMESG000001725.1 dd_Smed_v4_6535_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013275SMED30013275SMESG000063084.1 dd_Smed_v4_6478_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015808TNF receptor-associated factorSMESG000001468.1 dd_Smed_v4_5675_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016791Testis-expressed protein 9SMESG000007359.1 dd_Smed_v4_7007_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010668MAGUK p55 subfamily member 5SMESG000017294.1 dd_Smed_v4_6790_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005721Lysine-specific demethylase 6ASMESG000077784.1 dd_Smed_v4_5564_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019495SMED30019495SMESG000022773.1 dd_5694dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30002520slc6a-3SMESG000068398.1 dd_Smed_v4_17986_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017883Serine/threonine-protein phosphataseSMESG000067423.1 dd_Smed_v4_1407_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001095SMED30001095SMESG000003398.1 dd_Smed_v4_248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006990SMED30006990 dd_Smed_v4_9735_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013176Roc domain-containing proteinSMESG000066553.1 dd_Smed_v4_12105_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015685TNF receptor-associated factor dd_Smed_v4_14915_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30034281CCHC-type domain-containing proteinSMESG000007086.1 dd_Smed_v4_15530_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025910Microtubule-associated protein futschSMESG000044270.1 SMESG000030021.1 SMESG000025422.1 dd_Smed_v4_1999_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30027887Interferon-induced GTP-binding protein Mx1SMESG000002025.1 dd_Smed_v4_7246_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030724Protein numbSMESG000016237.1 SMESG000033358.1 dd_Smed_v4_507_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030724Protein numbSMESG000016237.1 SMESG000033358.1 dd_Smed_v4_507_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30033302RNA-binding protein MEX3BSMESG000044270.1 SMESG000030021.1 SMESG000025422.1 dd_Smed_v4_1999_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035091SMED30035091SMESG000058994.1 dd_586dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30030326SMED30030326SMESG000001071.1 SMESG000001061.1 SMESG000001060.1 dd_Smed_v4_9824_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032624cilia- and flagella-associated protein 53SMESG000004919.1 dd_Smed_v4_3219_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033646SMED30033646SMESG000022408.1 dd_Smed_v4_2191_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011268RRM domain-containing protein dd_Smed_v4_78494_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30011268RRM domain-containing protein dd_Smed_v4_53284_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30014618SMED30014618SMESG000067158.1 SMESG000079384.1 SMESG000006522.1 dd_Smed_v4_6854_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012160SMED30012160SMESG000069851.1 dd_Smed_v4_9493_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30017193Protocadherin 1SMESG000010555.1 dd_Smed_v4_12697_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30012020tphSMESG000000522.1 dd_Smed_v4_8392_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30013735Elongation factor 1-alphaSMESG000061164.1 SMESG000061099.1 dd_Smed_v4_30_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30007004SMED30007004SMESG000019033.1 dd_Smed_v4_12403_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30006229SMED30006229SMESG000019033.1 dd_Smed_v4_12403_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30016196SMED30016196SMESG000059283.1 dd_Smed_v4_62_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30015947Neuropeptide-41 dd_Smed_v4_788_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30019471SynaptotagminSMESG000055143.1 dd_Smed_v4_6730_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED3000317640S ribosomal protein S2SMESG000051503.1 dd_Smed_v4_226_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30005911SMED30005911 dd_Smed_v4_12_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30017235SMED30017235SMESG000067158.1 SMESG000079384.1 SMESG000006522.1 dd_Smed_v4_6854_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011747SMED30011747 dd_Smed_v4_494_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012747Thioredoxin domain-containing protein 3-likeSMESG000043677.1 dd_Smed_v4_8401_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016488SMED30016488SMESG000067852.1 dd_Smed_v4_62029_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30012212NADH dehydrogenase subunit 1 dd_Smed_v4_258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30016922Parkin coregulated proteinSMESG000000577.1 dd_Smed_v4_3899_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001799NADH dehydrogenase subunit 5 dd_Smed_v4_258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30014446SMEDWI-2SMESG000069984.1 SMESG000069981.1 dd_Smed_v4_756_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30008311SMED30008311SMESG000006280.1 dd_Smed_v4_9073_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012337AnoctaminSMESG000027271.1 dd_Smed_v4_43159_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30015734SMED30015734SMESG000051340.1 dd_Smed_v4_6953_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30008916SMED30008916SMESG000061077.1 dd_Smed_v4_9714_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013227WD repeat-containing proteinSMESG000042025.1 dd_Smed_v4_9187_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018236Bromodomain adjacent to zinc finger domainSMESG000068165.1 dd_Smed_v4_7394_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003997SMED30003997SMESG000059318.1 SMESG000059304.1 dd_Smed_v4_483_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30000682SMED30000682 dd_Smed_v4_1303_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010277SMED30010277SMESG000000133.1 dd_Smed_v4_8640_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001870SMED30001870 dd_Smed_v4_4311_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014928Formin-like proteinSMESG000044336.1 dd_Smed_v4_3917_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018487SMED30018487 dd_Smed_v4_1312_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006743SMED30006743SMESG000040007.1 SMESG000039999.1 dd_Smed_v4_7457_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001299SMED30001299SMESG000010387.1 dd_Smed_v4_13587_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30002808SMED30002808 dd_Smed_v4_6289_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002649SMED30002649 dd_Smed_v4_15038_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015763Bravo_FIGEY domain-containing proteinSMESG000064374.1 dd_Smed_v4_7836_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006840Sel1SMESG000003789.1 dd_Smed_v4_9387_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014138LIM homeobox 1bSMESG000022856.1 dd_Smed_v4_8252_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30018739SMED30018739SMESG000025343.1 SMESG000025332.1 dd_Smed_v4_6330_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015945Centrin-1SMESG000052182.1 SMESG000015458.1 dd_Smed_v4_3644_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017099SMED30017099SMESG000030373.1 dd_Smed_v4_595_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007547SMED30007547 dd_Smed_v4_4295_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017971ANK_REP_REGION domain-containing proteinSMESG000026132.1 dd_Smed_v4_6201_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006964SMED30006964SMESG000011995.1 dd_Smed_v4_1851_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30017180Dynein regulatory complex protein 1SMESG000072168.1 dd_Smed_v4_8761_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED3002737860S ribosomal protein L3SMESG000022732.1 dd_Smed_v4_127_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30032910Protein ANKUB1SMESG000033543.1 dd_Smed_v4_9027_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031050PHB domain-containing proteinSMESG000037334.1 dd_Smed_v4_6396_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026524Spermidine synthaseSMESG000031473.1 dd_Smed_v4_7292_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021617Neuronal acetylcholine receptor subunit alpha-2SMESG000040082.1 dd_Smed_v4_8486_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023409Glutamate-rich 3SMESG000029848.1 SMESG000029846.1 dd_Smed_v4_8627_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023570SMED30023570SMESG000056075.1 SMESG000056059.1 dd_Smed_v4_770_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032001SMED30032001SMESG000010967.1 dd_Smed_v4_8765_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029805Kinesin proteinSMESG000013633.1 SMESG000013625.1 dd_Smed_v4_13562_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025563SMED30025563 dd_Smed_v4_1312_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED3002728060S acidic ribosomal protein P0SMESG000079482.1 dd_Smed_v4_161_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30029940SMED30029940SMESG000019033.1 dd_Smed_v4_12403_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30025783NADPH--cytochrome P450 reductaseSMESG000022047.1 dd_Smed_v4_542_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023840Membrane-associated phosphatidylinositol transfer protein 1SMESG000004877.1 dd_Smed_v4_7211_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022949SMED30022949SMESG000011995.1 dd_Smed_v4_1851_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30029081CalmodulinSMESG000065184.1 dd_Smed_v4_16185_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30028919SMED30028919SMESG000067158.1 SMESG000079384.1 SMESG000006522.1 dd_Smed_v4_6854_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30027710Ras-related protein Rab-3 dd_Smed_v4_7977_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033676MAP kinase-activating death domain proteinSMESG000026842.1 dd_Smed_v4_8355_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033070SMED30033070SMESG000065665.1 dd_Smed_v4_5803_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021386Y box protein-1SMESG000058066.1 dd_Smed_v4_52_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30027086SMED30027086 dd_10213dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30033721RRM domain-containing proteinSMESG000019202.1 dd_Smed_v4_37545_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30021196SMED30021196 dd_1248dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30033407C2H2-type domain-containing proteinSMESG000059040.1 dd_Smed_v4_9365_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030766Y box protein-1SMESG000058066.1 dd_Smed_v4_52_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30025621SMED30025621SMESG000028436.1 dd_Smed_v4_3306_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30034853Zinc finger protein dd_Smed_v4_10676_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021718COesterase domain-containing proteinSMESG000027379.1 dd_Smed_v4_6180_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029899slc25a-30SMESG000044697.1 SMESG000022161.1 dd_Smed_v4_50_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30025174Selenoprotein W dd_Smed_v4_1908_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035983SMED30035983SMESG000032618.1 SMESG000032616.1 dd_Smed_v4_34828_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30009462SMED30009462SMESG000023794.1 SMESG000022518.1 dd_Smed_v4_4051_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30017499SMED30017499 dd_Smed_v4_459_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007567Lysosomal trafficking regulatorSMESG000069984.1 SMESG000069981.1 dd_Smed_v4_756_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30024009ADP-ribosylation factor-like protein 16 dd_Smed_v4_5801_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032574Reverse transcriptase domain-containing proteinSMESG000071441.1 SMESG000059599.1 SMESG000058180.1 SMESG000047025.1 SMESG000041246.1 SMESG000037745.1 SMESG000013749.1 Contig36213newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032574Reverse transcriptase domain-containing proteinSMESG000071441.1 SMESG000059599.1 SMESG000058180.1 SMESG000047025.1 SMESG000041246.1 SMESG000037745.1 SMESG000013749.1 Contig36213uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030773ATP-dependent RNA helicase DBP2SMESG000005969.1 Contig23180newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030773ATP-dependent RNA helicase DBP2SMESG000005969.1 Contig23180uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030773ATP-dependent RNA helicase DBP2SMESG000005969.1 Contig26998newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030773ATP-dependent RNA helicase DBP2SMESG000005969.1 Contig26998uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025407Ectonucleoside triphosphate diphosphohydrolase 7SMESG000080770.1 SMESG000072841.1 SMESG000065333.1 SMESG000060686.1 SMESG000059844.1 SMESG000058646.1 SMESG000055266.1 SMESG000055265.1 SMESG000054970.1 SMESG000052813.1 SMESG000043147.1 SMESG000043019.1 SMESG000041242.1 SMESG000037745.1 SMESG000037601.1 SMESG000036070.1 SMESG000034368.1 SMESG000031415.1 SMESG000019820.1 SMESG000019663.1 SMESG000010897.1 SMESG000009005.1 SMESG000005029.1 SMESG000077800.1 SMESG000054046.1 SMESG000052058.1 Contig20343newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025407Ectonucleoside triphosphate diphosphohydrolase 7SMESG000080770.1 SMESG000072841.1 SMESG000065333.1 SMESG000060686.1 SMESG000059844.1 SMESG000058646.1 SMESG000055266.1 SMESG000055265.1 SMESG000054970.1 SMESG000052813.1 SMESG000043147.1 SMESG000043019.1 SMESG000041242.1 SMESG000037745.1 SMESG000037601.1 SMESG000036070.1 SMESG000034368.1 SMESG000031415.1 SMESG000019820.1 SMESG000019663.1 SMESG000010897.1 SMESG000009005.1 SMESG000005029.1 SMESG000077800.1 SMESG000054046.1 SMESG000052058.1 Contig20343uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020865AminopeptidaseSMESG000033900.1 SMESG000033518.1 SMESG000022278.1 Contig21944newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020865AminopeptidaseSMESG000033900.1 SMESG000033518.1 SMESG000022278.1 Contig21944uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035929SWI/SNF complex subunit SMARCC2SMESG000031576.1 SMESG000013315.1 Contig17559newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035929SWI/SNF complex subunit SMARCC2SMESG000031576.1 SMESG000013315.1 Contig17559uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30034737Protocadherin-1SMESG000005378.1 Contig35337newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30034737Protocadherin-1SMESG000005378.1 Contig35337uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002931SMED30002931 Contig41672newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002931SMED30002931 Contig41672uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010313GTPase Obg Contig26599newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010313GTPase Obg Contig26599uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004458SMED30004458 Contig26599newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004458SMED30004458 Contig26599uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006249SMED30006249 Contig27489newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018753SMED30018753 Contig25228newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013983BED-type domain-containing protein Contig12801newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013983BED-type domain-containing protein Contig12801uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015762SMED30015762 Contig51263newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016823SMED30016823 Contig47745newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016823SMED30016823 Contig47745uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003880slc1a-3 Contig53337newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003880slc1a-3 Contig53337uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000765Dynactin subunit 4 Contig41672newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000765Dynactin subunit 4 Contig41672uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019081BED-type domain-containing protein Contig12801newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019081BED-type domain-containing protein Contig12801uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028300SMED30028300 Contig40705newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028300SMED30028300 Contig40705uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008060SMED30008060 Contig28354newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012523SMED30012523 Contig20460newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012523SMED30012523 Contig20460uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004979SWIM-type domain-containing protein Contig40435newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004979SWIM-type domain-containing protein Contig40435uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014856SMED30014856 Contig12801newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014856SMED30014856 Contig12801uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019333Dimer_Tnp_hAT domain-containing protein Contig21299newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019333Dimer_Tnp_hAT domain-containing protein Contig21299uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029329cdc45-like protein Contig40435newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029329cdc45-like protein Contig40435uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022945Matrin-type domain-containing protein Contig43167newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022945Matrin-type domain-containing protein Contig43167uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031833SMED30031833 Contig14600newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031833SMED30031833 Contig14600uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020992Aristaless-like homeobox transcription factorSMESG000030143.1 KX961610smed_ncbi_20200123PMID:27864883
Currie et al., 2016
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30005185Homeobox proteinSMESG000081885.1 dd_Smed_v6_13898_0_1dd_Smed_v6PMID:27864883
Currie et al., 2016
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30000065SMED30000065SMESG000049103.1 dd_Smed_v6_397_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30030309SMED30030309SMESG000075212.1 SMESG000074907.1 SMESG000075211.1 SMESG000074910.1 SMESG000074908.1 dd_Smed_v6_1061_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30008560Secretogranin 5SMESG000016510.1 dd_Smed_v6_3862_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30014318SBF2 domain-containing proteinSMESG000078604.1 dd_Smed_v6_3628_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30012826SMED30012826SMESG000017012.1 SMESG000017011.1 dd_Smed_v6_309_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30020627Echinoderm microtubule associated protein like 1SMESG000017256.1 dd_Smed_v6_14226_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30012522Ankyrin-2SMESG000026655.1 dd_Smed_v6_10835_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30008052SMED30008052SMESG000075212.1 SMESG000074907.1 SMESG000075211.1 SMESG000074910.1 SMESG000074908.1 dd_Smed_v6_1061_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30019874CalmodulinSMESG000010769.1 dd_Smed_v6_255_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30015808TNF receptor-associated factorSMESG000066529.1 SMESG000053822.1 SMESG000029555.1 SMESG000010523.1 SMESG000023758.1 SMESG000074160.1 SMESG000019863.1 SMESG000001468.1 dd_Smed_v6_5675_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30017089SMED30017089SMESG000066529.1 SMESG000053822.1 SMESG000029555.1 SMESG000010523.1 SMESG000023758.1 SMESG000074160.1 SMESG000019863.1 SMESG000001468.1 dd_Smed_v6_5675_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30013744SMED30013744SMESG000066529.1 SMESG000053822.1 SMESG000029555.1 SMESG000010523.1 SMESG000023758.1 SMESG000074160.1 SMESG000019863.1 SMESG000001468.1 dd_Smed_v6_5675_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuron