neuron

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ In Situ Hybridization Data

  ▻ Sequences

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  neuron


DEFINITON:

  The basic cellular unit of nervous tissue. Each neuron consists of a body, an axon, and dendrites. Their purpose is to receive, conduct, and transmit impulses in the nervous system.


TERM DEFINITION CITATIONS:

  CL:0000540


TERM CITATIONS:


TERM ID:

  PLANA:0000099


ABOUT THIS TERM:

neuron

  ↳is a electrically signaling cell



Expand to see terms that part of neuron

  → synapse
  → synaptic cleft
  → synaptic vesicle
  → neurite


BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30022907SynaptotagminDj-sytStage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, ventral nerve cord, neuron, cephalic ganglia, nervous system, embryonic pharynx
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 ┬Ám

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30019471 ID=SMED30019471|Name=Synaptotagmin|organism=Schmidtea mediterranea sexual|type=transcript|length=1910bp
TTTGGGACTTCTCCAATCTATTAAATATATTTAGAACGAACATCGTTGTGAGAAGCTTTGTCTTGCAAATGCACACCAAC
ACATTCTCTGCCTACTCGAGACCAGCCTGAAGGACGCACCCAGTCATCTCTTATAAAAAAAAAACTCTTCTCTGATTCGG
TATTTTCTGATTAATGGAGATCAAACAATGATTGGGCAACGTCTAGTTTAGAATATTTACAACTAAATCTGCGTATTTCA
ATTTTTTTTCGATTTTGATTGTTGCAAATATTTATGAGTATATCCAATAATATAAGCAGCGCTAGTAATATGACGATAAA
AATGCAACAAAATGTTGAAAAGTCTGTATCACAGCATGTAACAGCGCAAACAAAGGAATCAACATCAAATAAACTTCATA
CAACAACAGCCGGTATCTCGGTTTTGGAGAAAACATTAAAAACATTTCACATGAGTACTGGCACTTTGATTGGAATCGGA
GTTACAGTGTCTATCGTAGTTTTATTACTTCTTTATTGTATTTGCAAACGATGCATTAAGAAACGAAAGAAAAAGAAAGA
TGGCGGCAAAAAAGGTGGAAAAGGCGTAGACATGAAAAGCGTACAACTATTAGGAAATGCTTATAAAGAAAAGGTACAGC
CGGACCTAGAAGAACTGGATGCTAACATGGAAGATAATGAAGGGGCGCAAGATAAAGAAGCAGTCAATCTTGGAAAATTA
CAGTATTCCCTTGATTACGATTTTACAAAAGGCGAGCTAACAGTCGGAGTAATTCAAGCCACAGATCTCCCAGCAATGGA
CATGTCAGGAACTTCTGATCCATATGTGAAAGTTTTTCTATTACCGGATAAAAAGAAAAAATTCGAAACCAAAGTTCATC
GAAAAATATTAAATCCAGTCTTTAATGAGACATTTGTATTCAAGATTCCTTATTCTGAGGTCGGGTCTAAAACTTTGGTA
TTTAATGTTTTCGATTTCGACAGATTTTCAAAGCATGATCAAATTGGGCAAATCCAAATTCCACTGGGTTCAGTAGATTT
ATGCAAAGTTATTGAGGAATGGAAGGAACTCGGCCCACCTGACAGTGATAATGAAAAGGAAAATCGATTAGGAGACATTT
GTTTTTCTTTGAGATATGTTCCAACGTCTGGAAAGTTGAATATCGTCATTCTGGAAGCTAAAAACCTCAAGAAAATGGAT
GTTGGAGGATTGTCGGATCCTTACGTGAAACTATCGTTGATGCTTAACGGCAAACGAGTGAAAAAGAAGAAAACCACAAT
AAAAAAATACACATTAAATCCTTATTATAATGAGTCATTTTCATTCGAAGTTCCATTCGAGCAAATACAAAAAGTTAATT
TAATAGTGACAGTAGTTGATTATGATAGAATTGGAACAAGTGAACCTATTGGAAGAGTAGTTCTTGGATGCAATGCTACA
GGAGCAGAACTTCGGCACTGGTCCGATATGCTTGCTAATCCTAGGAGACCAATTGCCCAGTGGCATACCCTTCAAGATAT
GCCGGAGAAGAGCTGATTTCATTGATTTTAATTTTAAAATCTGTCATATTTTGTGATAAATTTTGCGTATTTATACAATC
ATTCGATTCGATCTTTCCATCAAGTTTCGTAAAATCTGCAGACATTCACGAGGATGCAGAAGAAATAGAAACTTTGTAAT
AAATTAGCATTAGCTGTGATCTCCTATTGACCAAAAAACATAAACTTAATTTTTATAAAGAATTGTGGTGAAATGTTGTT
AGGTTTCAGTCATAGATAACTGTATTTGTGTAATAGTTTGTGTATTTCTCGTCCTGGCCCGATTTTGTGCATTCCACTGG
CAATACTATTTCACTAATAAATTATGTCTGATAATGTATACCAGTATAGGATTTTGTTTGAATTAATGAA
>SMED30022907 ID=SMED30022907|Name=Synaptotagmin|organism=Schmidtea mediterranea sexual|type=transcript|length=1814bp
ATTTATTGAAAATTATTTTTTCTATTATTAGGAGAAAATTGATTATTTTTTTTTGACAAAATAAGTTTTGGATATATTTC
CCATTTGTTTGTATTCGTAAACCAATGAAGAATTCGACTCACGGATCGGATCATTCGGCCAGCAAGGCCAGTATGAAAAC
GAATGTGGAAAAATTTTGGCATGATCTCGGAAAAAAATTGCACATGGATCCAAAAGCATTAATAGGAGTAACAATCGGTT
TGGGAATATTGTTTTTGTTGTTCCTTTATTGCTTATGTAAAAAATGTGTTTTCAAGCGTCGAAAAAAGAAGGAAACGGCC
AAAAAAGGAGCCAAGGGAGTAGTCGATATGAAAAGTGCCCAATTGTTGGGGAATTCATATAAAGAAAAAATTCAACCCGA
TCTTGAAGAACTTGATGCAAACATGGAAGACAATGAAGGTGTAAAAGAAAAAGAAGATGTTCATTTAGGAAAATTACAAT
ATTCTCTAGATTATGATTTTCAGAAAGGAGAATTAACTGTTGGAGTTATTCAAGCAACTGATCTTCCAGCTATGGATATG
TCAGGAACATCAGATCCATATGTCAAATTATACCTTCTCCCAGACAAGAAAAAGAAATTCGAAACAAAGGTTCATAGGAA
AATTTTAAATCCTGTATTCAATGAAACTTTTGTTTTCAAAGTTCCTTTCAATGAAGTTGCATCGAAGACTTTGATTTTCA
ACGTTTATGACTTTGACAGATTTTCCAAACACGATCAAATCGGTCAAATAAAAGTACCATTGGGAGCTATAGATTTAGGT
CGAGTTATTGAAGAATGGAAGGAACTGGAATCTCCAGAAAACGATGGGGAAAAGGAAAACAGGTTGGGAGACATTTGTTT
CTCTTTAAGATACGTACCGACATCTGGAAAGCTTACAATAGTCATTTTGGAAGCAAAGAATCTTAAAAAAATGGATGTCG
GAGGATTGTCTGATCCATATGTTAAACTTTCCTTGATGCTTAATGGTAAACGAGTGAAGAAGAAGAAAACTACCATCAAA
AAGTATACACTAAATCCTTACTACAATGAATCATTTTCCTTTGAAGTACCATTCGAACAAATACAAAAAGTGAACTTGAT
CGTCACGGTTGTTGATTATGACAGAATCGGAACCAGCGAACCGATAGGTAGAATTGTTCTGGGATGTAACGCAACTGGAG
CAGAATTGCGACATTGGTCGGATATGTTGGCAAATCCCCGGCGACCAATCGCCCAGTGGCATACCCTCCAAGAGATGCCA
GAGAACAATTGATAGTGTTCGTTTGATGCTTTAAAGCGGTTTGCATAATTCGTGAAATAAGTTATCAAAATTTGAGAAAT
GTTTTTTTTTCTGAAACAAAAATGGCATGAGACAATATACCAGAGTTCATTAGTGTGTGGTTTCGTTGAATATTTTGGTG
GTGTTGCATCTTATCGTTTGTCCTCTAATCTAATAATGTTTTATTCTTTATATAGCTGATTTATTCTCGAGCGAAACATT
TTTTATGTGTACCAAAATACTTATGTCATAGCCATTGTGATTAGTCTGTAAACTATTGCGTAATAGCCCCTCTCATTGGC
TTTTTTTAAGAGTAGTGAGTTGGAAAAAAAAATACAAAAATGACTTCAATTGTTAAACATTACTCATATTTTATCAGTAA
GTTAACTTGCATATTTGCAGTTAATTATGGCATTTTATCTCTAAATCTCTGAAGCATGGCCTCAAGTCTTTTGTTTGTTT
TAATGTAATTATGTCTAGATGAGAATATTAAAATACTTCGGTTTATATAAAAGA

 

back to top



PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in neuron. Click this link to learn more about PAGE.


PAGE Curations: 5741


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
neuronSMED300116841-phosphatidylinositol 4,5-bisphosphate phosphodiesteraseSMESG000049234.1 dd_Smed_v4_3221_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED300116841-phosphatidylinositol 4,5-bisphosphate phosphodiesteraseSMESG000049234.1 dd_Smed_v4_3221_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015029Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-1SMESG000003718.1 SMESG000018818.1 dd_Smed_v4_2872_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30015029Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-1SMESG000003718.1 SMESG000018818.1 dd_Smed_v4_2872_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015427V-type proton ATPase subunit aSMESG000006351.1 dd_Smed_v4_4805_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30015427V-type proton ATPase subunit aSMESG000006351.1 dd_Smed_v4_4805_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010664SMED30010664SMESG000053423.1 dd_Smed_v4_8209_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30010664SMED30010664SMESG000053423.1 dd_Smed_v4_8209_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002428Gamma-aminobutyric acid receptor-associated proteinSMESG000026465.1 dd_Smed_v4_600_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30003899SMP-LTD domain-containing proteinSMESG000022335.1 dd_Smed_v4_4286_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30001680SMED30001680SMESG000002033.1 dd_Smed_v4_884_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30001680SMED30001680SMESG000002033.1 dd_Smed_v4_884_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001586Spectrin alpha chainSMESG000005289.1 dd_Smed_v4_919_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30001586Spectrin alpha chainSMESG000005289.1 dd_Smed_v4_919_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006749CLUMA_CG020736, isoform ASMESG000018175.1 dd_Smed_v4_4810_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30014866Low density lipoprotein-receptor, class A,domain-containing proteinSMESG000033681.1 dd_Smed_v4_5576_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30011898Protein F37C4.5SMESG000008044.1 dd_Smed_v4_9190_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30011898Protein F37C4.5SMESG000008044.1 dd_Smed_v4_9190_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012267Kinesin-like proteinSMESG000073771.1 dd_Smed_v4_6755_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30012267Kinesin-like proteinSMESG000073771.1 dd_Smed_v4_6755_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008311SMED30008311SMESG000006280.1 dd_Smed_v4_9073_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30008311SMED30008311SMESG000006280.1 dd_Smed_v4_9073_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019484Vesicle-fusing ATPaseSMESG000019983.1 dd_Smed_v4_3364_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30019484Vesicle-fusing ATPaseSMESG000019983.1 dd_Smed_v4_3364_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016950DystrophinSMESG000020523.1 dd_Smed_v4_5325_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30001980Protein phosphatase 1KSMESG000008048.1 dd_Smed_v4_3067_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30012777Usp domain-containing proteinSMESG000035960.1 dd_Smed_v4_7254_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30012777Usp domain-containing proteinSMESG000035960.1 dd_Smed_v4_7254_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019538SMED30019538SMESG000078196.1 dd_3823dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30019538SMED30019538SMESG000078196.1 dd_3823dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30019538SMED30019538SMESG000078196.1 dd_Smed_v4_3823_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30016045Cysteine-rich proteinSMESG000044206.1 dd_Smed_v4_1185_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000054Rab-GAP TBC domain-containing proteinSMESG000003946.1 dd_Smed_v4_10066_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30010847SMED30010847SMESG000026789.1 dd_Smed_v4_10187_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30010847SMED30010847SMESG000026789.1 dd_Smed_v4_10187_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009210Protein kinase domain-containing proteinSMESG000039711.1 dd_Smed_v4_13767_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30007858netrin receptor-like proteinSMESG000042475.1 dd_Smed_v4_11409_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30007858netrin receptor-like proteinSMESG000042475.1 dd_Smed_v4_11409_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002154Cytosolic endo-beta-N-acetylglucosaminidaseSMESG000048818.1 dd_Smed_v4_12165_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30017299Protein kinase C beta typeSMESG000053142.1 dd_Smed_v4_12946_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30017299Protein kinase C beta typeSMESG000053142.1 dd_Smed_v4_12946_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007276SMED30007276SMESG000014766.1 dd_Smed_v4_10073_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007276SMED30007276SMESG000014766.1 dd_Smed_v4_10073_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30006230Sperm surface protein Sp17SMESG000046919.1 dd_Smed_v4_2279_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30006230Sperm surface protein Sp17SMESG000046919.1 dd_Smed_v4_2279_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006230Sperm surface protein Sp17SMESG000046919.1 dd_Smed_v4_4783_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30006230Sperm surface protein Sp17SMESG000046919.1 dd_Smed_v4_4783_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008024NFX1-type zinc finger-containing protein 1-likeSMESG000034891.1 SMESG000034868.1 SMESG000034856.1 dd_Smed_v4_10633_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30008024NFX1-type zinc finger-containing protein 1-likeSMESG000034891.1 SMESG000034868.1 SMESG000034856.1 dd_Smed_v4_10633_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016903SMED30016903SMESG000060736.1 dd_Smed_v4_15960_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30010740FERM and pleckstrin domain containing proteinSMESG000038155.1 dd_Smed_v4_14700_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30008903ProfilinSMESG000020082.1 SMESG000020071.1 dd_Smed_v4_2107_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30009189KinaseSMESG000003375.1 dd_Smed_v4_1630_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30011717SMED30011717SMESG000078112.1 dd_Smed_v4_16420_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30000014slc20a-1SMESG000012546.1 dd_Smed_v4_1270_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30000014slc20a-1SMESG000012546.1 dd_Smed_v4_1270_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007788Transcription elongation regulator 1SMESG000011919.1 dd_Smed_v4_1147_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30005448SMED30005448SMESG000009922.1 dd_Smed_v4_21965_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30005448SMED30005448SMESG000009922.1 dd_Smed_v4_21965_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015622Small G protein signaling modulator 1SMESG000001901.1 SMESG000001889.1 SMESG000061056.1 SMESG000058180.1 SMESG000057533.1 SMESG000047874.1 SMESG000046659.1 dd_Smed_v4_12130_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30015622Small G protein signaling modulator 1SMESG000001901.1 SMESG000001889.1 SMESG000061056.1 SMESG000058180.1 SMESG000057533.1 SMESG000047874.1 SMESG000046659.1 dd_Smed_v4_12130_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016710SMED30016710SMESG000075557.1 dd_Smed_v4_10583_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30010012Neur_chan_LBD domain-containing proteinSMESG000064442.1 dd_21541dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30010012Neur_chan_LBD domain-containing proteinSMESG000064442.1 dd_21541dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30001365KH domain containing RNA binding signalSMESG000057199.1 dd_Smed_v4_10211_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30002182Neuropeptide Y prohormone-11SMESG000064810.1 dd_Smed_v4_16946_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30002182Neuropeptide Y prohormone-11SMESG000064810.1 dd_Smed_v4_16946_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30009887Macrophage erythroblast attacherSMESG000048410.1 dd_Smed_v4_1168_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30010217RNA-binding protein 4BSMESG000059552.1 dd_Smed_v4_1566_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30014348Four and a half LIM domains protein 1SMESG000006322.1 dd_Smed_v4_10293_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30002938SH3 and multiple ankyrin repeat domains protein 2SMESG000078048.1 dd_Smed_v4_10116_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30009316Fork head domain proteinSMESG000048193.1 dd_Smed_v4_11337_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30015942Threonine--tRNA ligase, cytoplasmicSMESG000061707.1 dd_Smed_v4_1476_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30001421SMED30001421SMESG000078112.1 dd_Smed_v4_16420_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30015071Eyes absent homologSMESG000001561.1 dd_Smed_v4_11372_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30016728Protocadherin-1SMESG000074162.1 dd_Smed_v4_14117_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30016728Protocadherin-1SMESG000074162.1 dd_Smed_v4_14117_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004449B-cell lymphoma/leukemia 11BSMESG000029867.1 dd_Smed_v4_10320_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30004449B-cell lymphoma/leukemia 11BSMESG000029867.1 dd_Smed_v4_16598_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30000919Bravo_FIGEY domain-containing proteinSMESG000026407.1 dd_Smed_v4_11307_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30000919Bravo_FIGEY domain-containing proteinSMESG000026407.1 dd_Smed_v4_11307_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011550Neuropeptide-18SMESG000034720.1 dd_Smed_v4_1117_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30011550Neuropeptide-18SMESG000034720.1 dd_Smed_v4_1117_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30015584Nesprin-1SMESG000016745.1 dd_Smed_v4_23532_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30015584Nesprin-1SMESG000016745.1 dd_Smed_v4_23532_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015584Nesprin-1SMESG000016745.1 dd_Smed_v4_13561_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30015584Nesprin-1SMESG000016745.1 dd_Smed_v4_17767_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30015584Nesprin-1SMESG000016745.1 dd_Smed_v4_17767_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015584Nesprin-1SMESG000016745.1 dd_Smed_v4_16850_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30015584Nesprin-1SMESG000016745.1 dd_Smed_v4_16850_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015584Nesprin-1SMESG000016745.1 dd_Smed_v4_34184_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30015584Nesprin-1SMESG000016745.1 dd_Smed_v4_23535_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30015584Nesprin-1SMESG000016745.1 dd_Smed_v4_23535_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016948Regulator of G-protein signaling 9-binding proteinSMESG000016932.1 dd_Smed_v4_14671_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30016948Regulator of G-protein signaling 9-binding proteinSMESG000016932.1 dd_Smed_v4_14671_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010855Receptor-type tyrosine-protein phosphatase FSMESG000038449.1 SMESG000038447.1 SMESG000035516.1 dd_Smed_v4_8199_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30016144SMED30016144SMESG000048818.1 dd_Smed_v4_12165_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30006383SMED30006383SMESG000008503.1 dd_15602dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30006383SMED30006383SMESG000008503.1 dd_15602dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30017201SFI1SMESG000002829.1 dd_Smed_v4_12484_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30017201SFI1SMESG000002829.1 dd_Smed_v4_12484_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006252SMED30006252SMESG000022827.1 dd_Smed_v4_2123_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30005978Cyclic nucleotide gated channel alpha 3SMESG000044898.1 SMESG000035733.1 dd_Smed_v4_12825_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30013159LimbinSMESG000017303.1 dd_Smed_v4_10777_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30013159LimbinSMESG000017303.1 dd_Smed_v4_10777_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013091SMED30013091SMESG000070818.1 dd_Smed_v4_1178_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30011581AP2-associated protein kinase 1-like ProteinSMESG000041938.1 SMESG000041937.1 SMESG000051989.1 dd_Smed_v4_1179_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30008580potassium voltage-gated channel subfamily H member 8SMESG000017883.1 SMESG000017882.1 dd_Smed_v4_10983_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30007597SMED30007597SMESG000019748.1 dd_Smed_v4_2028_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30006402Progesterone immunomodulatory binding factor 1SMESG000046936.1 dd_Smed_v4_13444_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30006402Progesterone immunomodulatory binding factor 1SMESG000046936.1 dd_Smed_v4_13444_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004732PKD1L-2SMESG000014725.1 SMESG000014723.1 dd_Smed_v4_13975_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30004732PKD1L-2SMESG000014725.1 SMESG000014723.1 dd_Smed_v4_13975_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30004732PKD1L-2SMESG000014725.1 SMESG000014723.1 dd_Smed_v4_13975_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009336PID domain-containing proteinSMESG000078082.1 dd_Smed_v4_12194_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30013109Heterogeneous nuclear ribonucleoprotein QSMESG000071117.1 dd_Smed_v4_10996_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30007649SMED30007649SMESG000048765.1 dd_Smed_v4_14165_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30007649SMED30007649SMESG000048765.1 dd_Smed_v4_14165_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015125SMED30015125SMESG000061766.1 dd_Smed_v4_12632_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30008486SMED30008486SMESG000014085.1 SMESG000014086.1 SMESG000014087.1 dd_Smed_v4_10249_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30013054Protein kinase domain-containing proteinSMESG000020466.1 dd_Smed_v4_11366_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30013054Protein kinase domain-containing proteinSMESG000020466.1 dd_Smed_v4_11366_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013390Nesprin-1SMESG000069851.1 dd_Smed_v4_10646_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30007660Degenerin unc-8SMESG000073267.1 dd_22386dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30007660Degenerin unc-8SMESG000073267.1 dd_22386dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30015004SMED30015004SMESG000042350.1 dd_Smed_v4_13840_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30015864SMED30015864SMESG000069250.1 dd_Smed_v4_3525_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30012483SMED30012483SMESG000044609.1 dd_Smed_v4_1665_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30012483SMED30012483SMESG000044609.1 dd_Smed_v4_1665_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002166SMED30002166SMESG000039065.1 dd_Smed_v4_11656_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30002166SMED30002166SMESG000039065.1 dd_Smed_v4_11656_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033594Microtubule-associated protein 1ASMESG000014298.1 dd_Smed_v4_1301_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30033594Microtubule-associated protein 1ASMESG000014298.1 dd_Smed_v4_1301_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029570GCR304SMESG000016325.1 dd_Smed_v4_10325_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30020747SMED30020747SMESG000037087.1 dd_Smed_v4_10194_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30025791B box-type domain-containing proteinSMESG000078465.1 dd_Smed_v4_11048_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30023902Mitogen-activated protein kinase kinase kinase kinase 4SMESG000031711.1 dd_Smed_v4_1029_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30031485Lipoxygenase homology domain-containing protein 1SMESG000001054.1 dd_Smed_v4_10315_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30020402SMED30020402SMESG000011919.1 dd_Smed_v4_1147_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30025806Metabotropic glutamate receptorSMESG000033752.1 SMESG000033749.1 dd_Smed_v4_15419_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30021120Ras-related protein Rap-1bSMESG000015251.1 dd_Smed_v4_12929_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30021120Ras-related protein Rap-1bSMESG000015251.1 dd_Smed_v4_12929_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029672Nucleolysin TIA-1 isoform p40SMESG000073709.1 dd_Smed_v4_10924_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30020900SMED30020900SMESG000022827.1 dd_Smed_v4_2123_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30024373Rho_N domain-containing proteinSMESG000001901.1 SMESG000001889.1 SMESG000061056.1 SMESG000058180.1 SMESG000057533.1 SMESG000047874.1 SMESG000046659.1 dd_Smed_v4_12130_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30024373Rho_N domain-containing proteinSMESG000001901.1 SMESG000001889.1 SMESG000061056.1 SMESG000058180.1 SMESG000057533.1 SMESG000047874.1 SMESG000046659.1 dd_Smed_v4_12130_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021645SMED30021645SMESG000014085.1 SMESG000014086.1 SMESG000014087.1 dd_Smed_v4_10249_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30020257DUF3421 domain-containing proteinSMESG000046742.1 dd_Smed_v4_1040_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30020257DUF3421 domain-containing proteinSMESG000046742.1 dd_Smed_v4_1040_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30024576SMED30024576SMESG000057199.1 dd_Smed_v4_10211_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30021485SMED30021485SMESG000059844.1 dd_Smed_v4_1328_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30021485SMED30021485SMESG000059844.1 dd_Smed_v4_1328_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033909UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 4SMESG000066601.1 dd_Smed_v4_12354_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30034618von Willebrand factor A domain-containing protein 3ASMESG000022334.1 SMESG000022332.1 dd_Smed_v4_10972_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30027376SMED30027376SMESG000007018.1 SMESG000007017.1 dd_Smed_v4_1969_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30032285SMED30032285SMESG000037686.1 SMESG000035410.1 SMESG000013977.1 SMESG000013857.1 dd_Smed_v4_10407_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30032285SMED30032285SMESG000037686.1 SMESG000035410.1 SMESG000013977.1 SMESG000013857.1 dd_Smed_v4_10407_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025753SMED30025753SMESG000016791.1 dd_Smed_v4_10_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30035336LLGL scribble cell polarity complex component 2SMESG000018172.1 dd_Smed_v4_2164_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30035336LLGL scribble cell polarity complex component 2SMESG000018172.1 dd_Smed_v4_2164_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010096TPA_inf: prohormone convertase 2SMESG000008070.1 dd_Smed_v4_1566_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30032823NeurotrypsinSMESG000081574.1 SMESG000081529.1 SMESG000079557.1 SMESG000079250.1 SMESG000077556.1 SMESG000075496.1 SMESG000073961.1 SMESG000073618.1 SMESG000073174.1 SMESG000071859.1 SMESG000071198.1 SMESG000071073.1 SMESG000070153.1 SMESG000068262.1 SMESG000068028.1 SMESG000067334.1 SMESG000065567.1 SMESG000061192.1 SMESG000060952.1 SMESG000060260.1 SMESG000059623.1 SMESG000050492.1 SMESG000050479.1 SMESG000050299.1 SMESG000049776.1 SMESG000048159.1 SMESG000044971.1 SMESG000043973.1 SMESG000042620.1 SMESG000040932.1 SMESG000039792.1 SMESG000039741.1 SMESG000039356.1 SMESG000034716.1 SMESG000033763.1 SMESG000029286.1 SMESG000028614.1 SMESG000027381.1 SMESG000025022.1 SMESG000021522.1 SMESG000020398.1 SMESG000019968.1 SMESG000018320.1 SMESG000015216.1 SMESG000015117.1 SMESG000015102.1 SMESG000013389.1 SMESG000012534.1 SMESG000012464.1 SMESG000011278.1 SMESG000011147.1 SMESG000007021.1 SMESG000006554.1 SMESG000001897.1 SMESG000070487.1 SMESG000068881.1 SMESG000064552.1 SMESG000063831.1 SMESG000056926.1 SMESG000050300.1 SMESG000047318.1 SMESG000047014.1 SMESG000043279.1 SMESG000030931.1 SMESG000023641.1 SMESG000018675.1 SMESG000017256.1 SMESG000013665.1 SMESG000013089.1 SMESG000011196.1 SMESG000009621.1 SMESG000008519.1 SMESG000005066.1 dd_Smed_v4_129_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30032823NeurotrypsinSMESG000081574.1 SMESG000081529.1 SMESG000079557.1 SMESG000079250.1 SMESG000077556.1 SMESG000075496.1 SMESG000073961.1 SMESG000073618.1 SMESG000073174.1 SMESG000071859.1 SMESG000071198.1 SMESG000071073.1 SMESG000070153.1 SMESG000068262.1 SMESG000068028.1 SMESG000067334.1 SMESG000065567.1 SMESG000061192.1 SMESG000060952.1 SMESG000060260.1 SMESG000059623.1 SMESG000050492.1 SMESG000050479.1 SMESG000050299.1 SMESG000049776.1 SMESG000048159.1 SMESG000044971.1 SMESG000043973.1 SMESG000042620.1 SMESG000040932.1 SMESG000039792.1 SMESG000039741.1 SMESG000039356.1 SMESG000034716.1 SMESG000033763.1 SMESG000029286.1 SMESG000028614.1 SMESG000027381.1 SMESG000025022.1 SMESG000021522.1 SMESG000020398.1 SMESG000019968.1 SMESG000018320.1 SMESG000015216.1 SMESG000015117.1 SMESG000015102.1 SMESG000013389.1 SMESG000012534.1 SMESG000012464.1 SMESG000011278.1 SMESG000011147.1 SMESG000007021.1 SMESG000006554.1 SMESG000001897.1 SMESG000070487.1 SMESG000068881.1 SMESG000064552.1 SMESG000063831.1 SMESG000056926.1 SMESG000050300.1 SMESG000047318.1 SMESG000047014.1 SMESG000043279.1 SMESG000030931.1 SMESG000023641.1 SMESG000018675.1 SMESG000017256.1 SMESG000013665.1 SMESG000013089.1 SMESG000011196.1 SMESG000009621.1 SMESG000008519.1 SMESG000005066.1 dd_Smed_v4_129_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032823NeurotrypsinSMESG000081078.1 SMESG000069853.1 SMESG000045007.1 SMESG000016710.1 SMESG000016305.1 SMESG000002984.1 SMESG000078601.1 SMESG000062504.1 SMESG000047126.1 SMESG000040474.1 SMESG000029537.1 dd_Smed_v4_199_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30033073Dynein heavy chain axonemal-likeSMESG000039073.1 dd_Smed_v4_4176_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30033073Dynein heavy chain axonemal-likeSMESG000039073.1 dd_Smed_v4_4176_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033551PhosphotransferaseSMESG000043559.1 dd_Smed_v4_4327_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30033551PhosphotransferaseSMESG000043559.1 dd_Smed_v4_4327_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031197Microtubule-associated protein 4SMESG000068843.1 dd_Smed_v4_7133_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30031197Microtubule-associated protein 4SMESG000068843.1 dd_Smed_v4_7133_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028023adenylate kinase 7SMESG000075900.1 dd_Smed_v4_7959_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30028023adenylate kinase 7SMESG000075900.1 dd_Smed_v4_7959_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026782Cilia-and flagella-associated protein 58SMESG000061980.1 dd_Smed_v4_5727_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30026782Cilia-and flagella-associated protein 58SMESG000061980.1 dd_Smed_v4_5727_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30027110TNF receptor-associated factorSMESG000070236.1 SMESG000070235.1 dd_Smed_v4_7291_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30034196Tyrosine-protein phosphatase non-receptor typeSMESG000023435.1 dd_Smed_v4_6928_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30027566SMED30027566SMESG000075236.1 dd_Smed_v4_7519_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30030220Helicase for meiosis 1SMESG000065404.1 dd_Smed_v4_9538_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30030220Helicase for meiosis 1SMESG000065404.1 dd_Smed_v4_9538_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028718Epsin 2SMESG000042233.1 dd_Smed_v4_4779_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30033864pim-3SMESG000014593.1 dd_Smed_v4_6420_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30030659Fer-1-relatedSMESG000075933.1 dd_Smed_v4_6816_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30030659Fer-1-relatedSMESG000070967.1 dd_Smed_v4_4648_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30025990NPHP1SMESG000061008.1 dd_Smed_v4_9990_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30025990NPHP1SMESG000061008.1 dd_Smed_v4_9990_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001580Serine/threonine-protein kinase PDIK1LSMESG000059621.1 dd_Smed_v4_9834_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30001580Serine/threonine-protein kinase PDIK1LSMESG000059621.1 dd_Smed_v4_9834_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021821Transient receptor potential cation channel subfamily M memberSMESG000078720.1 dd_Smed_v4_17981_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30021821Transient receptor potential cation channel subfamily M memberSMESG000078720.1 dd_17981dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30021821Transient receptor potential cation channel subfamily M memberSMESG000078720.1 dd_17981dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30020571Tubulin monoglycylase TTLL3SMESG000062155.1 dd_Smed_v4_12717_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30027682NAD(P)H-dependent FMN reductaseSMESG000060640.1 dd_Smed_v4_21902_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30029152SMED30029152SMESG000017036.1 dd_Smed_v4_12630_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30029152SMED30029152SMESG000017036.1 dd_Smed_v4_17066_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30024169SMED30024169SMESG000016970.1 dd_Smed_v4_2205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30025849Centrosome and spindle pole-associated protein 1SMESG000080361.1 dd_Smed_v4_13453_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025849Centrosome and spindle pole-associated protein 1SMESG000080361.1 dd_Smed_v4_13453_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30035901Abelson helper integration site 1SMESG000005183.1 SMESG000005182.1 dd_Smed_v4_11557_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30028898BZIP domain-containing proteinSMESG000067543.1 dd_Smed_v4_1399_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30028898BZIP domain-containing proteinSMESG000067543.1 dd_Smed_v4_1399_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025406Retrovirus-related Pol polyprotein from type-1 retrotransposable element R2SMESG000061623.1 SMESG000041246.1 SMESG000010825.1 dd_Smed_v4_13241_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30023622SMED30023622SMESG000044609.1 dd_Smed_v4_1665_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30023622SMED30023622SMESG000044609.1 dd_Smed_v4_1665_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023140Glutamate receptor ionotropic, NMDA 2BSMESG000021416.1 dd_Smed_v4_11481_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30020990Eukaryotic translation initiation factor 2 subunit 2SMESG000081574.1 SMESG000081529.1 SMESG000079557.1 SMESG000079250.1 SMESG000077556.1 SMESG000075496.1 SMESG000073961.1 SMESG000073618.1 SMESG000073174.1 SMESG000071859.1 SMESG000071198.1 SMESG000071073.1 SMESG000070153.1 SMESG000068262.1 SMESG000068028.1 SMESG000067334.1 SMESG000065567.1 SMESG000061192.1 SMESG000060952.1 SMESG000060260.1 SMESG000059623.1 SMESG000050492.1 SMESG000050479.1 SMESG000050299.1 SMESG000049776.1 SMESG000048159.1 SMESG000044971.1 SMESG000043973.1 SMESG000042620.1 SMESG000040932.1 SMESG000039792.1 SMESG000039741.1 SMESG000039356.1 SMESG000034716.1 SMESG000033763.1 SMESG000029286.1 SMESG000028614.1 SMESG000027381.1 SMESG000025022.1 SMESG000021522.1 SMESG000020398.1 SMESG000019968.1 SMESG000018320.1 SMESG000015216.1 SMESG000015117.1 SMESG000015102.1 SMESG000013389.1 SMESG000012534.1 SMESG000012464.1 SMESG000011278.1 SMESG000011147.1 SMESG000007021.1 SMESG000006554.1 SMESG000001897.1 SMESG000070487.1 SMESG000068881.1 SMESG000064552.1 SMESG000063831.1 SMESG000056926.1 SMESG000050300.1 SMESG000047318.1 SMESG000047014.1 SMESG000043279.1 SMESG000030931.1 SMESG000023641.1 SMESG000018675.1 SMESG000017256.1 SMESG000013665.1 SMESG000013089.1 SMESG000011196.1 SMESG000009621.1 SMESG000008519.1 SMESG000005066.1 dd_Smed_v4_129_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30020990Eukaryotic translation initiation factor 2 subunit 2SMESG000081574.1 SMESG000081529.1 SMESG000079557.1 SMESG000079250.1 SMESG000077556.1 SMESG000075496.1 SMESG000073961.1 SMESG000073618.1 SMESG000073174.1 SMESG000071859.1 SMESG000071198.1 SMESG000071073.1 SMESG000070153.1 SMESG000068262.1 SMESG000068028.1 SMESG000067334.1 SMESG000065567.1 SMESG000061192.1 SMESG000060952.1 SMESG000060260.1 SMESG000059623.1 SMESG000050492.1 SMESG000050479.1 SMESG000050299.1 SMESG000049776.1 SMESG000048159.1 SMESG000044971.1 SMESG000043973.1 SMESG000042620.1 SMESG000040932.1 SMESG000039792.1 SMESG000039741.1 SMESG000039356.1 SMESG000034716.1 SMESG000033763.1 SMESG000029286.1 SMESG000028614.1 SMESG000027381.1 SMESG000025022.1 SMESG000021522.1 SMESG000020398.1 SMESG000019968.1 SMESG000018320.1 SMESG000015216.1 SMESG000015117.1 SMESG000015102.1 SMESG000013389.1 SMESG000012534.1 SMESG000012464.1 SMESG000011278.1 SMESG000011147.1 SMESG000007021.1 SMESG000006554.1 SMESG000001897.1 SMESG000070487.1 SMESG000068881.1 SMESG000064552.1 SMESG000063831.1 SMESG000056926.1 SMESG000050300.1 SMESG000047318.1 SMESG000047014.1 SMESG000043279.1 SMESG000030931.1 SMESG000023641.1 SMESG000018675.1 SMESG000017256.1 SMESG000013665.1 SMESG000013089.1 SMESG000011196.1 SMESG000009621.1 SMESG000008519.1 SMESG000005066.1 dd_Smed_v4_129_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028431Transmembrane protein 62SMESG000026204.1 dd_Smed_v4_11926_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30023347Kinesin motor domain-containing proteinSMESG000069689.1 dd_Smed_v4_10482_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30023347Kinesin motor domain-containing proteinSMESG000069689.1 dd_Smed_v4_10482_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021807SMED30021807SMESG000030582.1 dd_Smed_v4_1124_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30024025Regulating synaptic membrane exocytosis protein 2SMESG000037636.1 SMESG000037628.1 dd_Smed_v4_15437_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30022367SMED30022367SMESG000016745.1 dd_Smed_v4_13561_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30021613Nesprin-1SMESG000077685.1 dd_Smed_v4_15904_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30021613Nesprin-1SMESG000077685.1 dd_Smed_v4_10214_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30023704SMED30023704SMESG000044609.1 dd_Smed_v4_1665_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30023704SMED30023704SMESG000044609.1 dd_Smed_v4_1665_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029200SMED30029200SMESG000033751.1 dd_Smed_v4_16827_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30034835TransporterSMESG000019713.1 dd_Smed_v4_10458_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30027887Interferon-induced GTP-binding protein Mx1SMESG000002025.1 dd_Smed_v4_7246_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30027887Interferon-induced GTP-binding protein Mx1SMESG000002025.1 dd_Smed_v4_7246_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30027887Interferon-induced GTP-binding protein Mx1SMESG000066856.1 SMESG000002221.1 SMESG000002213.1 dd_Smed_v4_5708_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30028992Guanine nucleotide-binding protein subunit betaSMESG000038555.1 dd_Smed_v4_1615_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30028992Guanine nucleotide-binding protein subunit betaSMESG000038555.1 dd_Smed_v4_1615_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028653IQ domain-containing protein HSMESG000037909.1 dd_Smed_v4_10544_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30022870SMED30022870SMESG000079579.1 dd_Smed_v4_16102_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30022870SMED30022870SMESG000079579.1 dd_Smed_v4_16102_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035963SMED30035963SMESG000071278.1 dd_Smed_v4_1649_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30023862SMED30023862SMESG000009332.1 SMESG000009320.1 dd_Smed_v4_1555_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30031183SMB domain-containing proteinSMESG000079236.1 dd_Smed_v4_11622_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30023228SMED30023228SMESG000058720.1 dd_Smed_v4_7931_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30023228SMED30023228SMESG000058720.1 dd_Smed_v4_7931_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035139TOG array regulator of axonemal microtubules 1SMESG000016691.1 dd_Smed_v4_13421_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30020701Long-chain specific acyl-CoA dehydrogenaseSMESG000081574.1 SMESG000081529.1 SMESG000079557.1 SMESG000079250.1 SMESG000077556.1 SMESG000075496.1 SMESG000073961.1 SMESG000073618.1 SMESG000073174.1 SMESG000071859.1 SMESG000071198.1 SMESG000071073.1 SMESG000070153.1 SMESG000068262.1 SMESG000068028.1 SMESG000067334.1 SMESG000065567.1 SMESG000061192.1 SMESG000060952.1 SMESG000060260.1 SMESG000059623.1 SMESG000050492.1 SMESG000050479.1 SMESG000050299.1 SMESG000049776.1 SMESG000048159.1 SMESG000044971.1 SMESG000043973.1 SMESG000042620.1 SMESG000040932.1 SMESG000039792.1 SMESG000039741.1 SMESG000039356.1 SMESG000034716.1 SMESG000033763.1 SMESG000029286.1 SMESG000028614.1 SMESG000027381.1 SMESG000025022.1 SMESG000021522.1 SMESG000020398.1 SMESG000019968.1 SMESG000018320.1 SMESG000015216.1 SMESG000015117.1 SMESG000015102.1 SMESG000013389.1 SMESG000012534.1 SMESG000012464.1 SMESG000011278.1 SMESG000011147.1 SMESG000007021.1 SMESG000006554.1 SMESG000001897.1 SMESG000070487.1 SMESG000068881.1 SMESG000064552.1 SMESG000063831.1 SMESG000056926.1 SMESG000050300.1 SMESG000047318.1 SMESG000047014.1 SMESG000043279.1 SMESG000030931.1 SMESG000023641.1 SMESG000018675.1 SMESG000017256.1 SMESG000013665.1 SMESG000013089.1 SMESG000011196.1 SMESG000009621.1 SMESG000008519.1 SMESG000005066.1 dd_Smed_v4_129_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30020701Long-chain specific acyl-CoA dehydrogenaseSMESG000081574.1 SMESG000081529.1 SMESG000079557.1 SMESG000079250.1 SMESG000077556.1 SMESG000075496.1 SMESG000073961.1 SMESG000073618.1 SMESG000073174.1 SMESG000071859.1 SMESG000071198.1 SMESG000071073.1 SMESG000070153.1 SMESG000068262.1 SMESG000068028.1 SMESG000067334.1 SMESG000065567.1 SMESG000061192.1 SMESG000060952.1 SMESG000060260.1 SMESG000059623.1 SMESG000050492.1 SMESG000050479.1 SMESG000050299.1 SMESG000049776.1 SMESG000048159.1 SMESG000044971.1 SMESG000043973.1 SMESG000042620.1 SMESG000040932.1 SMESG000039792.1 SMESG000039741.1 SMESG000039356.1 SMESG000034716.1 SMESG000033763.1 SMESG000029286.1 SMESG000028614.1 SMESG000027381.1 SMESG000025022.1 SMESG000021522.1 SMESG000020398.1 SMESG000019968.1 SMESG000018320.1 SMESG000015216.1 SMESG000015117.1 SMESG000015102.1 SMESG000013389.1 SMESG000012534.1 SMESG000012464.1 SMESG000011278.1 SMESG000011147.1 SMESG000007021.1 SMESG000006554.1 SMESG000001897.1 SMESG000070487.1 SMESG000068881.1 SMESG000064552.1 SMESG000063831.1 SMESG000056926.1 SMESG000050300.1 SMESG000047318.1 SMESG000047014.1 SMESG000043279.1 SMESG000030931.1 SMESG000023641.1 SMESG000018675.1 SMESG000017256.1 SMESG000013665.1 SMESG000013089.1 SMESG000011196.1 SMESG000009621.1 SMESG000008519.1 SMESG000005066.1 dd_Smed_v4_129_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032428Protocadherin-9SMESG000005371.1 SMESG000005372.1 dd_Smed_v4_14613_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30024527non-gastric H ,K -ATPase alpha subunitSMESG000041938.1 SMESG000041937.1 SMESG000051989.1 dd_Smed_v4_1179_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30023897Deoxynucleoside triphosphate triphosphohydrolase SAMHD1SMESG000079585.1 SMESG000079583.1 dd_Smed_v4_17810_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30022824Dual specificity phosphatase-like proteinSMESG000047740.1 dd_Smed_v4_12651_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30024368chromodomain helicase DNA-binding protein 4SMESG000068192.1 dd_Smed_v4_2331_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30024368chromodomain helicase DNA-binding protein 4SMESG000068192.1 dd_Smed_v4_2331_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30024368chromodomain helicase DNA-binding protein 4SMESG000068192.1 dd_Smed_v4_2659_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30035723nesprin-1-likeSMESG000023320.1 dd_Smed_v4_10282_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30035723nesprin-1-likeSMESG000023320.1 dd_Smed_v4_10282_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035723nesprin-1-likeSMESG000023320.1 dd_Smed_v4_43173_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30035723nesprin-1-likeSMESG000023320.1 dd_Smed_v4_20344_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30035723nesprin-1-likeSMESG000023320.1 dd_Smed_v4_51249_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30035723nesprin-1-likeSMESG000023320.1 dd_Smed_v4_20714_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30035723nesprin-1-likeSMESG000023320.1 dd_Smed_v4_39583_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30035723nesprin-1-likeSMESG000023320.1 dd_Smed_v4_26396_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30035723nesprin-1-likeSMESG000023320.1 dd_Smed_v4_64459_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30035723nesprin-1-likeSMESG000023320.1 dd_Smed_v4_44969_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30020986SMED30020986SMESG000061227.1 dd_1936dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30020986SMED30020986SMESG000061227.1 dd_1936dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30026862SMED30026862SMESG000054009.1 SMESG000054006.1 dd_Smed_v4_4922_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30028228Centrosomal protein 164SMESG000054195.1 SMESG000021687.1 dd_Smed_v4_12228_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30028228Centrosomal protein 164SMESG000054195.1 SMESG000021687.1 dd_Smed_v4_12228_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031429SMED30031429SMESG000038604.1 dd_Smed_v4_1973_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30031429SMED30031429SMESG000038604.1 dd_Smed_v4_1973_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022961V-type proton ATPase subunitSMESG000057004.1 dd_Smed_v4_1976_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30027092SMED30027092SMESG000078236.1 SMESG000032651.1 dd_Smed_v4_4949_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30027092SMED30027092SMESG000078236.1 SMESG000032651.1 dd_Smed_v4_4949_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30034275Zinc finger MIZ domain-containing protein 1SMESG000033291.1 dd_Smed_v4_10016_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30026901SMED30026901SMESG000013006.1 dd_Smed_v4_6779_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30022408Post-GPI attachment to proteins factor 2-like proteinSMESG000044614.1 dd_Smed_v4_10182_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30026493TPA_inf: pyrokinin prohormone like-1SMESG000013290.1 dd_Smed_v4_14095_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30026493TPA_inf: pyrokinin prohormone like-1SMESG000013290.1 dd_Smed_v4_14095_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30024109Non-specific serine/threonine protein kinaseSMESG000074914.1 dd_Smed_v4_11891_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30024109Non-specific serine/threonine protein kinaseSMESG000074914.1 dd_Smed_v4_11891_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025648InnexinSMESG000027007.1 dd_Smed_v4_12178_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30025648InnexinSMESG000027007.1 dd_Smed_v4_12178_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028058SMED30028058SMESG000056175.1 SMESG000056172.1 dd_Smed_v4_13931_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30021366Glutamate receptorSMESG000069665.1 dd_Smed_v4_13399_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30021366Glutamate receptorSMESG000069665.1 dd_Smed_v4_13399_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026738Centriolar coiled-coil protein of 110 kDaSMESG000008964.1 dd_Smed_v4_13022_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30026994SMED30026994SMESG000009315.1 dd_Smed_v4_22779_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30026115Potassium voltage-gated channel subfamily H member 7SMESG000000377.1 dd_Smed_v4_12978_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30026115Potassium voltage-gated channel subfamily H member 7SMESG000000377.1 dd_Smed_v4_12978_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026123SMED30026123SMESG000061517.1 dd_Smed_v4_14659_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30025152cilia- and flagella-associated protein 91SMESG000056200.1 dd_Smed_v4_10405_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30025152cilia- and flagella-associated protein 91SMESG000056200.1 dd_Smed_v4_10405_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025152cilia- and flagella-associated protein 91SMESG000056200.1 dd_Smed_v4_9724_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30025152cilia- and flagella-associated protein 91SMESG000056200.1 dd_Smed_v4_9724_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022167SMED30022167SMESG000031417.1 dd_Smed_v4_11958_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30022167SMED30022167SMESG000031417.1 dd_Smed_v4_11958_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001515AnnexinSMESG000042839.1 dd_Smed_v4_1104_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30001515AnnexinSMESG000042839.1 dd_Smed_v4_1104_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016045Cysteine-rich proteinSMESG000044206.1 dd_Smed_v4_1185_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30002166SMED30002166SMESG000058880.1 SMESG000039065.1 dd_Smed_v4_4225_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30002166SMED30002166SMESG000058880.1 SMESG000039065.1 dd_Smed_v4_4225_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008756SMED30008756SMESG000007049.1 dd_Smed_v4_14707_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008756SMED30008756SMESG000007049.1 dd_Smed_v4_14707_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30008756SMED30008756SMESG000007049.1 dd_Smed_v4_6538_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30008756SMED30008756SMESG000007049.1 dd_Smed_v4_6538_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012656NPHS1-6SMESG000056135.1 dd_Smed_v4_16187_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30019896casein kinase ISMESG000013473.1 dd_Smed_v4_1225_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30019896casein kinase ISMESG000013473.1 dd_Smed_v4_1225_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013779Tubulin monoglycylase TTLL3SMESG000029205.1 dd_Smed_v4_10244_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30015021Calcium/calmodulin-dependent protein kinase type II subunit deltaSMESG000062800.1 dd_Smed_v4_7858_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30015021Calcium/calmodulin-dependent protein kinase type II subunit deltaSMESG000062800.1 dd_Smed_v4_7858_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006145slc18a-6SMESG000051356.1 dd_Smed_v4_11630_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30014534SMED30014534SMESG000047985.1 SMESG000035720.1 SMESG000035719.1 dd_Smed_v4_14062_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30014534SMED30014534SMESG000047985.1 SMESG000035720.1 SMESG000035719.1 dd_Smed_v4_14062_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015172Protein kinase CSMESG000039865.1 SMESG000039854.1 SMESG000032749.1 SMESG000032747.1 dd_Smed_v4_4244_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30015172Protein kinase CSMESG000039865.1 SMESG000039854.1 SMESG000032749.1 SMESG000032747.1 dd_Smed_v4_4244_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015365Lysophosphatidic acid phosphatase type 6SMESG000000025.1 dd_Smed_v4_13744_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30013306Protein NDRG4SMESG000055233.1 SMESG000055204.1 dd_Smed_v4_11017_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30013306Protein NDRG4SMESG000055233.1 SMESG000055204.1 dd_Smed_v4_11017_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016804neurexin-1 isoform X19SMESG000058569.1 dd_Smed_v4_13697_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30016804neurexin-1 isoform X19SMESG000058569.1 dd_Smed_v4_13697_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013182Rho GTPase-activating proteinSMESG000017186.1 dd_Smed_v4_12363_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30017759neurofilament heavy polypeptide isoform X5SMESG000068550.1 dd_Smed_v4_10236_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30008080Transmembrane protein 45BSMESG000060226.1 SMESG000021986.1 dd_Smed_v4_1542_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30008080Transmembrane protein 45BSMESG000060226.1 SMESG000021986.1 dd_Smed_v4_1542_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003845Serine/threonine-protein kinase B-rafSMESG000003163.1 dd_Smed_v4_18341_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30005517Receptor type tyrosine protein phosphataseSMESG000041927.1 dd_Smed_v4_10176_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30005517Receptor type tyrosine protein phosphataseSMESG000041927.1 dd_Smed_v4_10176_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004024SMED30004024SMESG000022827.1 dd_Smed_v4_2123_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30006259DNA repair protein complementing XP-G cells-like proteinSMESG000019370.1 dd_Smed_v4_10808_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30009090Mushroom body large-type Kenyon-related proteinSMESG000070784.1 dd_Smed_v4_17498_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30011825RING-type domain-containing proteinSMESG000069649.1 dd_Smed_v4_12211_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30001414UPF0728 protein C10orf53 homologSMESG000073355.1 dd_Smed_v4_10501_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30012238SMED30012238SMESG000044609.1 dd_Smed_v4_1665_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30012238SMED30012238SMESG000044609.1 dd_Smed_v4_1665_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007152Rab11 family-interacting protein 4SMESG000059669.1 dd_Smed_v4_11969_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30000370ANK_REP_REGION domain-containing proteinSMESG000013802.1 dd_Smed_v4_7813_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30000370ANK_REP_REGION domain-containing proteinSMESG000013802.1 dd_Smed_v4_7813_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000370ANK_REP_REGION domain-containing proteinSMESG000013802.1 dd_Smed_v4_11317_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30000370ANK_REP_REGION domain-containing proteinSMESG000013802.1 dd_Smed_v4_11317_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016779JmjC domain-containing proteinSMESG000053108.1 dd_Smed_v4_12267_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30016779JmjC domain-containing proteinSMESG000053108.1 dd_Smed_v4_12267_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004666ATP-dependent zinc metalloprotease FtsHSMESG000006322.1 dd_Smed_v4_10293_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30013824Unc-5 netrin receptor BSMESG000040323.1 dd_Smed_v4_10380_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30013824Unc-5 netrin receptor BSMESG000040323.1 dd_Smed_v4_10380_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018184Bestrophin homologSMESG000016291.1 dd_Smed_v4_1844_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30018184Bestrophin homologSMESG000016291.1 dd_Smed_v4_1844_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005421CAP-Gly domain-containing proteinSMESG000006189.1 dd_Smed_v4_12985_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30005421CAP-Gly domain-containing proteinSMESG000006189.1 dd_Smed_v4_14698_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30007518PIH1 domain-containing protein 1SMESG000041927.1 dd_Smed_v4_10176_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30007518PIH1 domain-containing protein 1SMESG000041927.1 dd_Smed_v4_10176_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001148SMED30001148SMESG000041540.1 SMESG000041529.1 dd_Smed_v4_13075_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30007142Sperm surface protein Sp17SMESG000046919.1 dd_Smed_v4_2279_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30007142Sperm surface protein Sp17SMESG000046919.1 dd_Smed_v4_2279_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007142Sperm surface protein Sp17SMESG000046919.1 dd_Smed_v4_4783_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30007142Sperm surface protein Sp17SMESG000046919.1 dd_Smed_v4_4783_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008294SMED30008294SMESG000016970.1 dd_Smed_v4_2205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30001142CadherinSMESG000020082.1 SMESG000020071.1 dd_Smed_v4_2107_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30001142CadherinSMESG000020071.1 dd_Smed_v4_11814_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30001142CadherinSMESG000020071.1 dd_Smed_v4_11814_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001622SMED30001622SMESG000040908.1 dd_Smed_v4_10356_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30001622SMED30001622SMESG000040908.1 dd_Smed_v4_10356_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020683V-type proton ATPase proteolipid subunitSMESG000042238.1 dd_Smed_v4_1622_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30020654PKD1L-2SMESG000014725.1 SMESG000014723.1 dd_Smed_v4_13975_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30020654PKD1L-2SMESG000014725.1 SMESG000014723.1 dd_Smed_v4_13975_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30020654PKD1L-2SMESG000014725.1 SMESG000014723.1 dd_Smed_v4_13975_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012075SMED30012075SMESG000059352.1 SMESG000059351.1 dd_Smed_v4_420_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30012075SMED30012075SMESG000059352.1 SMESG000059351.1 dd_Smed_v4_420_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018142SMED30018142SMESG000081436.1 dd_Smed_v4_9784_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30009226RILP-like protein 1SMESG000009316.1 dd_Smed_v4_4713_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30009226RILP-like protein 1SMESG000009316.1 dd_Smed_v4_4713_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006130Transmembrane proteinSMESG000009898.1 dd_Smed_v4_3881_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30006130Transmembrane proteinSMESG000009898.1 dd_Smed_v4_3881_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011111coiled-coil domain-containing protein 170SMESG000051384.1 dd_Smed_v4_7992_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30006533ADP-ribosylation factorSMESG000052764.1 SMESG000052762.1 SMESG000052759.1 SMESG000052750.1 SMESG000052741.1 SMESG000052739.1 dd_Smed_v4_3383_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30019874CalmodulinSMESG000010769.1 dd_Smed_v4_255_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30019874CalmodulinSMESG000010769.1 dd_Smed_v4_255_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012020tphSMESG000000522.1 dd_Smed_v4_8392_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30012020tphSMESG000000522.1 dd_Smed_v4_8392_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30014170Luc7-like protein 3SMESG000047550.1 SMESG000047494.1 dd_Smed_v4_3724_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30001797SMED30001797SMESG000055722.1 SMESG000043901.1 SMESG000034363.1 SMESG000034362.1 dd_Smed_v4_3685_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30003095Protein regulator of cytokinesis 1SMESG000016705.1 dd_Smed_v4_5754_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30014717WD repeat and FYVE domain-containing protein 3SMESG000039846.1 dd_Smed_v4_3398_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30016991Vesicle associated membrane protein 1SMESG000054009.1 SMESG000054006.1 dd_Smed_v4_4922_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30017722Kinesin-like protein KIF1ASMESG000071414.1 dd_Smed_v4_7108_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30017722Kinesin-like protein KIF1ASMESG000071414.1 dd_Smed_v4_7108_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006908G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000060818.1 dd_24149dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30006908G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000060818.1 dd_24149dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30007579SMED30007579SMESG000038305.1 SMESG000038298.1 SMESG000038313.1 SMESG000035859.1 dd_Smed_v4_9798_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30000510SMED30000510SMESG000010788.1 SMESG000042308.1 dd_Smed_v4_4800_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30010144SMED30010144SMESG000038665.1 dd_Smed_v4_6969_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30015974FAST kinase domain-containing protein 1, mitochondrialSMESG000064523.1 dd_Smed_v4_8917_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30015974FAST kinase domain-containing protein 1, mitochondrialSMESG000064523.1 dd_Smed_v4_8917_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016951Calmodulin-like proteinSMESG000029865.1 dd_23127dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30016951Calmodulin-like proteinSMESG000029865.1 dd_23127dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30019471SynaptotagminSMESG000055143.1 dd_Smed_v4_6730_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30019471SynaptotagminSMESG000055143.1 dd_Smed_v4_6730_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013475SWI:SNF matrix associatedSMESG000013560.1 dd_Smed_v4_3355_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30011267SMED30011267SMESG000064891.1 dd_Smed_v4_3911_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30025757JUNLI-1SMESG000067959.1 dd_Smed_v4_4878_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30024342Neuropeptide Y receptor, invertebrateSMESG000059151.1 dd_Smed_v4_10020_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30027886SMED30027886SMESG000003427.1 dd_Smed_v4_2708_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30027886SMED30027886SMESG000003427.1 dd_Smed_v4_2708_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021279Retinal-binding proteinSMESG000035531.1 dd_Smed_v4_11513_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30022232Glutathione s-transferaseSMESG000016846.1 dd_Smed_v4_1206_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30007389Peripheral plasma membrane protein CASKSMESG000060582.1 dd_Smed_v4_7723_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30007389Peripheral plasma membrane protein CASKSMESG000060582.1 dd_Smed_v4_7723_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000129EGF-like domain-containing proteinSMESG000009899.1 dd_Smed_v4_10627_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30000129EGF-like domain-containing proteinSMESG000009899.1 dd_Smed_v4_15631_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30001900Bruno-like proteinSMESG000046617.1 dd_Smed_v4_17226_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30008033Plasma membrane calcium-transporting ATPase 3SMESG000006504.1 dd_Smed_v4_12866_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30008033Plasma membrane calcium-transporting ATPase 3SMESG000006504.1 dd_Smed_v4_12866_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017949slc7a-6SMESG000051755.1 dd_Smed_v4_7207_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30017949slc7a-6SMESG000051755.1 dd_Smed_v4_7207_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022812Receptor-type tyrosine-protein phosphatase SSMESG000068618.1 dd_Smed_v4_12771_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30022812Receptor-type tyrosine-protein phosphatase SSMESG000068618.1 dd_Smed_v4_12771_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022812Receptor-type tyrosine-protein phosphatase SSMESG000068618.1 dd_Smed_v4_9734_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30022812Receptor-type tyrosine-protein phosphatase SSMESG000068618.1 dd_Smed_v4_9734_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023840Membrane-associated phosphatidylinositol transfer protein 1SMESG000004877.1 dd_Smed_v4_7211_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30023840Membrane-associated phosphatidylinositol transfer protein 1SMESG000004877.1 dd_Smed_v4_7211_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025647Ig-like domain-containing proteinSMESG000079961.1 dd_Smed_v4_12974_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30021266Uncoordinated 5SMESG000073898.1 dd_Smed_v4_10585_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30024729SMED30024729SMESG000037686.1 SMESG000035410.1 SMESG000013977.1 SMESG000013857.1 dd_Smed_v4_10407_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30024729SMED30024729SMESG000037686.1 SMESG000035410.1 SMESG000013977.1 SMESG000013857.1 dd_Smed_v4_10407_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002753X1.A5.1SMESG000062836.1 dd_Smed_v4_585_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30002718Family with sequence similarity 227 member BSMESG000052176.1 SMESG000046302.1 dd_Smed_v4_15102_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30002718Family with sequence similarity 227 member BSMESG000052176.1 SMESG000046302.1 dd_Smed_v4_15102_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003764N-alpha-acetyltransferase 40SMESG000077166.1 dd_Smed_v4_5816_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30006225Cyclin dependent kinase like 1SMESG000038932.1 dd_Smed_v4_13082_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30000881CaveolinSMESG000063381.1 dd_Smed_v4_13481_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30011936slc29a-2SMESG000078543.1 dd_Smed_v4_15290_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30001808Calcium-transporting ATPaseSMESG000056345.1 dd_Smed_v4_13223_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30001808Calcium-transporting ATPaseSMESG000056345.1 dd_Smed_v4_9557_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30010852SMED30010852SMESG000063380.1 SMESG000001725.1 dd_Smed_v4_6535_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010635WD repeat-containing protein 13SMESG000049468.1 dd_Smed_v4_5274_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30002783TNF receptor-associated factorSMESG000049199.1 SMESG000039087.1 dd_Smed_v4_8933_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30018509Glutamate receptor interacting protein 1SMESG000009125.1 dd_Smed_v4_7659_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30003826Tetratricopeptide repeat domain 14SMESG000074716.1 dd_Smed_v4_5265_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30013232UBA domain-containing proteinSMESG000072159.1 dd_Smed_v4_2330_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30019495SMED30019495SMESG000022773.1 dd_5694dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30019495SMED30019495SMESG000022773.1 dd_5694dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30017498tyramine beta-hydroxilaseSMESG000005292.1 dd_Smed_v4_42610_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30017498tyramine beta-hydroxilaseSMESG000005292.1 dd_Smed_v4_42610_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30012091transmembrane protein 107SMESG000016814.1 dd_Smed_v4_9492_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30003568Chromo domain-containing proteinSMESG000080004.1 SMESG000079430.1 SMESG000076652.1 SMESG000076091.1 SMESG000076042.1 SMESG000074857.1 SMESG000070393.1 SMESG000069936.1 SMESG000068687.1 SMESG000065866.1 SMESG000065288.1 SMESG000065178.1 SMESG000062279.1 SMESG000061056.1 SMESG000059025.1 SMESG000058180.1 SMESG000057864.1 SMESG000057533.1 SMESG000057427.1 SMESG000055140.1 SMESG000053372.1 SMESG000053240.1 SMESG000050587.1 SMESG000050353.1 SMESG000048922.1 SMESG000047874.1 SMESG000046659.1 SMESG000046053.1 SMESG000043782.1 SMESG000042816.1 SMESG000042302.1 SMESG000040179.1 SMESG000038292.1 SMESG000037212.1 SMESG000034701.1 SMESG000033592.1 SMESG000031049.1 SMESG000029555.1 SMESG000029226.1 SMESG000026530.1 SMESG000024597.1 SMESG000023611.1 SMESG000022236.1 SMESG000021499.1 SMESG000019334.1 SMESG000017989.1 SMESG000013698.1 SMESG000013635.1 SMESG000009102.1 SMESG000008351.1 SMESG000006220.1 SMESG000005221.1 SMESG000001234.1 SMESG000026425.1 dd_Smed_v4_9908_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30019399GTPase-activating Rap/Ran-GAP domain protein 3SMESG000013620.1 dd_Smed_v4_7514_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30011750Phosphoinositide phospholipase CSMESG000070741.1 SMESG000070728.1 dd_Smed_v4_9716_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30011750Phosphoinositide phospholipase CSMESG000070728.1 dd_Smed_v4_39585_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30002152Arf-GAP with SH3 domain ANK repeat and PH domain-containing proteinSMESG000068882.1 dd_Smed_v4_6590_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30002152Arf-GAP with SH3 domain ANK repeat and PH domain-containing proteinSMESG000068882.1 dd_Smed_v4_6590_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001542CaveolinSMESG000063380.1 SMESG000001725.1 dd_Smed_v4_6535_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30001542CaveolinSMESG000063380.1 SMESG000001725.1 dd_Smed_v4_6535_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001489SMED30001489SMESG000022773.1 dd_5694dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30001489SMED30001489SMESG000022773.1 dd_5694dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30013731CentrinSMESG000040368.1 dd_Smed_v4_7903_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30013731CentrinSMESG000040368.1 dd_Smed_v4_7903_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008757Piezo-type mechanosensitive ion channel componentSMESG000051188.1 dd_Smed_v4_7182_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30003680RanBP-type and C3HC4-type zinc finger-containing protein 1SMESG000004467.1 SMESG000004465.1 SMESG000069298.1 dd_Smed_v4_2819_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30009430Fructose-bisphosphate aldolaseSMESG000006056.1 dd_Smed_v4_591_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30003589Exocyst complex component 7SMESG000028363.1 dd_Smed_v4_7926_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30001933Heterogeneous nuclear ribonucleoproteinSMESG000055008.1 dd_Smed_v4_2383_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30005492FHA domain-containing proteinSMESG000051866.1 dd_Smed_v4_8216_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30006636Kinesin-like proteinSMESG000022785.1 dd_Smed_v4_7089_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30006636Kinesin-like proteinSMESG000022785.1 dd_Smed_v4_6697_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30006636Kinesin-like proteinSMESG000022785.1 dd_Smed_v4_6697_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010777Lysosomal-associated transmembrane protein 4ASMESG000042736.1 SMESG000032757.1 SMESG000017350.1 SMESG000010536.1 SMESG000042735.1 SMESG000012070.1 dd_Smed_v4_495_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30008655Tubulin alpha chainSMESG000054547.1 dd_Smed_v4_508_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30006154TNF receptor-associated factorSMESG000026092.1 dd_Smed_v4_9494_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30010458SMED30010458SMESG000026243.1 dd_Smed_v4_7664_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30010458SMED30010458SMESG000026243.1 dd_Smed_v4_7664_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006371E3 ubiquitin-protein ligase RGLG1SMESG000001281.1 dd_Smed_v4_5911_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30002549SyntaxinSMESG000043412.1 SMESG000043410.1 dd_Smed_v4_8453_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30002549SyntaxinSMESG000043412.1 SMESG000043410.1 dd_Smed_v4_8453_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014131RPTOR independent companion of MTOR, complex 2 aSMESG000024212.1 SMESG000033570.1 dd_Smed_v4_9324_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30005253EF-hand domain-containing family member C2SMESG000076759.1 dd_Smed_v4_6035_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30005253EF-hand domain-containing family member C2SMESG000076759.1 dd_Smed_v4_6035_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001970GNAT family N-acetyltransferaseSMESG000028726.1 dd_Smed_v4_4903_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30010540Gln-synt_C domain-containing proteinSMESG000064881.1 dd_Smed_v4_9076_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30000378SMED30000378SMESG000061591.1 dd_Smed_v4_512_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30000378SMED30000378SMESG000061591.1 dd_Smed_v4_512_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003374Spectrin beta chainSMESG000039799.1 dd_Smed_v4_6202_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30003374Spectrin beta chainSMESG000039799.1 dd_Smed_v4_6202_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015134Protein kinase domain-containing proteinSMESG000002855.1 dd_Smed_v4_5244_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30007189Double zinc ribbon and ankyrin repeat-containing protein 1SMESG000018145.1 SMESG000018144.1 dd_Smed_v4_9848_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30007189Double zinc ribbon and ankyrin repeat-containing protein 1SMESG000018145.1 SMESG000018144.1 dd_Smed_v4_9848_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013812SMED30013812SMESG000026093.1 dd_Smed_v4_6839_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30009727SMED30009727SMESG000039240.1 SMESG000013236.1 dd_Smed_v4_9635_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30006962SMED30006962SMESG000064896.1 dd_Smed_v4_4637_0_2dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30003816GM18668SMESG000032629.1 dd_Smed_v4_2860_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30000627JmjC domain-containing histone demethylation 1SMESG000053144.1 dd_Smed_v4_8433_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30007496C-type lectin domain-containing proteinSMESG000016262.1 dd_Smed_v4_5187_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30018495ATPase_AAA_core domain-containing proteinSMESG000073596.1 dd_Smed_v4_9484_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30018495ATPase_AAA_core domain-containing proteinSMESG000073596.1 dd_Smed_v4_9484_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018495ATPase_AAA_core domain-containing proteinSMESG000073596.1 dd_Smed_v4_9568_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30018495ATPase_AAA_core domain-containing proteinSMESG000073596.1 dd_Smed_v4_9568_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012136radial spoke head protein 9 homologSMESG000046857.1 dd_Smed_v4_4707_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30012136radial spoke head protein 9 homologSMESG000046857.1 dd_Smed_v4_4707_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006840Sel1SMESG000003789.1 dd_Smed_v4_9387_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30006840Sel1SMESG000003789.1 dd_Smed_v4_9387_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001116cilia- and flagella-associated protein 44-likeSMESG000022927.1 dd_Smed_v4_8760_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30001116cilia- and flagella-associated protein 44-likeSMESG000022927.1 dd_Smed_v4_8760_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009873SMED30009873SMESG000016812.1 SMESG000016788.1 SMESG000016785.1 SMESG000016784.1 SMESG000016778.1 SMESG000016777.1 SMESG000016774.1 SMESG000016773.1 SMESG000016772.1 dd_Smed_v4_422_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30009664MacoilinSMESG000002059.1 dd_Smed_v4_2700_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30013757C2 domain-containing proteinSMESG000050479.1 dd_Smed_v4_9615_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30013757C2 domain-containing proteinSMESG000050479.1 dd_Smed_v4_9615_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029282Potassium voltage-gated channel protein Shal-like ProteinSMESG000081216.1 SMESG000081212.1 dd_Smed_v4_15876_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30032941TNF receptor associated factor 4SMESG000025998.1 SMESG000025982.1 SMESG000025980.1 SMESG000025963.1 SMESG000025934.1 SMESG000025901.1 SMESG000025797.1 SMESG000025794.1 SMESG000025517.1 dd_Smed_v4_1139_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30031139WASH complex subunit 2CSMESG000014537.1 SMESG000014534.1 dd_Smed_v4_19560_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30031139WASH complex subunit 2CSMESG000014537.1 SMESG000014534.1 dd_Smed_v4_19560_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023409Glutamate-rich 3SMESG000029848.1 SMESG000029846.1 dd_Smed_v4_8627_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30023409Glutamate-rich 3SMESG000029848.1 SMESG000029846.1 dd_Smed_v4_8627_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029825ANK_REP_REGION domain-containing proteinSMESG000020706.1 dd_Smed_v4_21003_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30029825ANK_REP_REGION domain-containing proteinSMESG000020706.1 dd_Smed_v4_21003_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029127Glutamate receptor ionotropicSMESG000022851.1 dd_Smed_v4_14655_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30029127Glutamate receptor ionotropicSMESG000022851.1 dd_Smed_v4_14655_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021868coiled-coil domain-containing protein 39SMESG000072035.1 SMESG000072034.1 dd_Smed_v4_5955_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30021868coiled-coil domain-containing protein 39SMESG000072035.1 SMESG000072034.1 dd_Smed_v4_5955_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED3003573414-3-3 protein epsilonSMESG000075252.1 dd_Smed_v4_1702_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED3003573414-3-3 protein epsilonSMESG000075252.1 dd_Smed_v4_1702_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026987TNF receptor-associated factorSMESG000025998.1 SMESG000025982.1 SMESG000025980.1 SMESG000025963.1 SMESG000025934.1 SMESG000025901.1 SMESG000025797.1 SMESG000025794.1 SMESG000025517.1 dd_Smed_v4_1139_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30022585SMED30022585SMESG000021277.1 dd_Smed_v4_16056_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30033276SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily B member 1SMESG000018094.1 dd_Smed_v4_1963_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30034870SMED30034870SMESG000047469.1 dd_Smed_v4_16220_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30034870SMED30034870SMESG000047469.1 dd_Smed_v4_16220_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031715Spectrin beta chainSMESG000035098.1 dd_Smed_v4_1684_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30031715Spectrin beta chainSMESG000035098.1 dd_Smed_v4_1684_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029604EF-hand calcium binding domain 11SMESG000054424.1 dd_Smed_v4_12628_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30031491Armadillo repeat containing 4SMESG000057827.1 dd_Smed_v4_5065_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30033164Heat shock 70 kDa proteinSMESG000041117.1 dd_Smed_v4_1378_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30033164Heat shock 70 kDa proteinSMESG000041117.1 dd_Smed_v4_1378_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028083SMED30028083SMESG000002410.1 dd_Smed_v4_21480_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30030309SMED30030309SMESG000075212.1 SMESG000075211.1 SMESG000074910.1 SMESG000074908.1 SMESG000074907.1 dd_Smed_v4_1061_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30030309SMED30030309SMESG000075212.1 SMESG000075211.1 SMESG000074910.1 SMESG000074908.1 SMESG000074907.1 dd_Smed_v4_1061_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002902Triple functional domain proteinSMESG000061508.1 SMESG000027427.1 dd_Smed_v4_5483_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30009973mxi-1 proteinSMESG000047681.1 SMESG000016277.1 dd_Smed_v4_4415_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30009973mxi-1 proteinSMESG000047681.1 SMESG000016277.1 dd_Smed_v4_4415_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017333centrosomal protein of 83 kDa-likeSMESG000033227.1 SMESG000033225.1 dd_Smed_v4_12969_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30017333centrosomal protein of 83 kDa-likeSMESG000033227.1 SMESG000033225.1 dd_Smed_v4_12969_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006476NEK8-2SMESG000043305.1 SMESG000043302.1 dd_Smed_v4_10144_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30006476NEK8-2SMESG000043305.1 SMESG000043302.1 dd_Smed_v4_10144_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003321Kinase D-interacting substrateSMESG000080369.1 dd_Smed_v4_9630_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30003321Kinase D-interacting substrateSMESG000080369.1 dd_Smed_v4_9630_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009869fas-binding factor 1 homologSMESG000037546.1 dd_Smed_v4_12735_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30009869fas-binding factor 1 homologSMESG000037546.1 dd_Smed_v4_12422_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30002002GRAM domain-containing proteinSMESG000004908.1 dd_Smed_v4_8544_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30013474SMED30013474SMESG000069967.1 dd_Smed_v4_6939_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30013474SMED30013474SMESG000069967.1 dd_Smed_v4_6939_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008682Caspase-6SMESG000048748.1 dd_Smed_v4_9038_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30016427Serine/threonine kinaseSMESG000004953.1 dd_Smed_v4_2251_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30004319Coiled-coil domain containing 88CSMESG000066575.1 SMESG000066583.1 dd_Smed_v4_5291_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30004319Coiled-coil domain containing 88CSMESG000066575.1 SMESG000066583.1 dd_Smed_v4_5291_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011922Tubulin-specific chaperone cofactor E-like proteinSMESG000068159.1 dd_Smed_v4_5186_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30001197SMED30001197SMESG000004996.1 dd_Smed_v4_4124_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30005713SMED30005713SMESG000081828.1 dd_Smed_v4_6475_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30005723Synaptotagmin, putativeSMESG000040037.1 dd_Smed_v4_7243_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30005723Synaptotagmin, putativeSMESG000040037.1 dd_Smed_v4_7243_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033718SMED30033718SMESG000061174.1 dd_Smed_v4_12214_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30033718SMED30033718SMESG000061174.1 dd_Smed_v4_12214_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021731Multidrug resistance protein 1-like proteinSMESG000004996.1 dd_Smed_v4_4124_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30026519SMED30026519SMESG000064314.1 dd_Smed_v4_16650_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30000708Dynein heavy chain 5, axonemalSMESG000049144.1 dd_Smed_v4_4569_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30013108Syntaxin-binding protein 1SMESG000013817.1 dd_Smed_v4_7111_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30013108Syntaxin-binding protein 1SMESG000013817.1 dd_Smed_v4_7111_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011058SMED30011058SMESG000042000.1 dd_Smed_v4_3000_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30013386netrin 1SMESG000006806.1 dd_Smed_v4_9795_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30017264SMED30017264SMESG000055031.1 dd_Smed_v4_2419_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30017264SMED30017264SMESG000055031.1 dd_Smed_v4_2419_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014549Prominin (Prom) protein, putativeSMESG000013192.1 dd_Smed_v4_1386_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30014549Prominin (Prom) protein, putativeSMESG000013192.1 dd_Smed_v4_1386_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014869Netrin receptor DCCSMESG000056891.1 dd_Smed_v4_7195_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30014869Netrin receptor DCCSMESG000056891.1 dd_Smed_v4_7195_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014307SMED30014307SMESG000064621.1 dd_Smed_v4_5431_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30014307SMED30014307SMESG000064621.1 dd_Smed_v4_5431_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009301Aamy domain-containing proteinSMESG000055799.1 dd_Smed_v4_7278_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30009301Aamy domain-containing proteinSMESG000055799.1 dd_Smed_v4_7278_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013128Death domain proteinSMESG000003436.1 dd_Smed_v4_7532_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30000852cGMP-dependent protein kinaseSMESG000008788.1 dd_Smed_v4_8259_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30014550Intraflagellar transport protein 43SMESG000067883.1 dd_Smed_v4_5237_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30005209Ankyrin repeat domain 50SMESG000028414.1 dd_Smed_v4_12936_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30006221PHB domain-containing proteinSMESG000037334.1 dd_Smed_v4_6396_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30006221PHB domain-containing proteinSMESG000037334.1 dd_Smed_v4_6396_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008035Secretory carrier-associated membrane proteinSMESG000037804.1 dd_Smed_v4_8593_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30008035Secretory carrier-associated membrane proteinSMESG000037804.1 dd_Smed_v4_8593_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016230SMED30016230SMESG000017162.1 dd_Smed_v4_11625_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30013850SMED30013850SMESG000051170.1 dd_Smed_v4_10305_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30013850SMED30013850SMESG000081995.1 SMESG000080328.1 SMESG000080048.1 SMESG000078665.1 SMESG000077025.1 SMESG000076395.1 SMESG000075858.1 SMESG000066691.1 SMESG000062442.1 SMESG000060496.1 SMESG000054975.1 SMESG000054276.1 SMESG000051957.1 SMESG000049162.1 SMESG000046165.1 SMESG000036894.1 SMESG000035648.1 SMESG000034762.1 SMESG000030928.1 SMESG000030475.1 SMESG000030445.1 SMESG000030069.1 SMESG000029693.1 SMESG000029692.1 SMESG000029599.1 SMESG000029355.1 SMESG000027993.1 SMESG000027217.1 SMESG000022058.1 SMESG000020046.1 SMESG000014020.1 SMESG000012961.1 SMESG000010709.1 SMESG000007675.1 SMESG000006952.1 SMESG000004166.1 SMESG000003706.1 SMESG000002779.1 SMESG000002239.1 SMESG000001845.1 SMESG000080313.1 SMESG000066842.1 SMESG000050392.1 SMESG000048356.1 SMESG000042931.1 SMESG000033095.1 SMESG000018900.1 SMESG000017493.1 SMESG000015917.1 SMESG000004121.1 dd_Smed_v4_3574_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30014928Formin-like proteinSMESG000044336.1 dd_Smed_v4_3917_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30014928Formin-like proteinSMESG000044336.1 dd_Smed_v4_3917_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018441CUGBP, Elav-like family member 4SMESG000026947.1 dd_Smed_v4_14010_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30015079Dynein heavy chain 5, axonemalSMESG000049144.1 dd_Smed_v4_4569_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015079Dynein heavy chain 5, axonemalSMESG000049144.1 dd_Smed_v4_4569_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30002690HEAT repeat-containing protein 5B-like ProteinSMESG000028228.1 dd_Smed_v4_7872_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30001272NCOA5SMESG000010804.1 dd_Smed_v4_2395_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30000179MFS domain-containing proteinSMESG000060699.1 dd_Smed_v4_5351_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30019373Rab6-interacting protein 2/elks/erc/cast,putativeSMESG000051528.1 dd_Smed_v4_12278_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30019373Rab6-interacting protein 2/elks/erc/cast,putativeSMESG000051528.1 dd_Smed_v4_12278_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000033VASt domain-containing proteinSMESG000033356.1 dd_Smed_v4_9149_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30003887c-Myc-binding proteinSMESG000001466.1 dd_Smed_v4_891_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30003887c-Myc-binding proteinSMESG000001466.1 dd_Smed_v4_891_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002502Choline-phosphate cytidylyltransferaseSMESG000081359.1 dd_Smed_v4_5385_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30001207Calmodulin-binding transcription activator 1SMESG000036440.1 dd_Smed_v4_8179_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30001207Calmodulin-binding transcription activator 1SMESG000036440.1 dd_Smed_v4_8179_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003011NPHP1SMESG000061008.1 dd_Smed_v4_9990_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30003011NPHP1SMESG000061008.1 dd_Smed_v4_9990_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002896SMED30002896SMESG000065225.1 SMESG000065211.1 SMESG000065210.1 dd_Smed_v4_7442_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30002896SMED30002896SMESG000065225.1 SMESG000065211.1 SMESG000065210.1 dd_Smed_v4_7442_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002598Histone-lysine N-methyltransferaseSMESG000039925.1 dd_Smed_v4_4755_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30003730NCOA5SMESG000010804.1 dd_Smed_v4_2395_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30002366cAMP-dependent protein kinase regulatory subunitSMESG000052390.1 dd_Smed_v4_7586_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30002366cAMP-dependent protein kinase regulatory subunitSMESG000052390.1 dd_Smed_v4_7586_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000644Kinesin proteinSMESG000060958.1 dd_Smed_v4_7196_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30000644Kinesin proteinSMESG000060958.1 dd_Smed_v4_7196_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017885Ubiquitin-like proteinSMESG000054551.1 dd_Smed_v4_10574_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30002597CalmodulinSMESG000008981.1 dd_Smed_v4_3441_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30000376dynein heavy chain domain-containing protein 1-likeSMESG000076398.1 dd_Smed_v4_8984_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30000921RNA-binding protein Nova-1SMESG000066554.1 dd_Smed_v4_679_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30019485SMED30019485SMESG000075557.1 dd_Smed_v4_10583_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30017943SMED30017943SMESG000022837.1 dd_Smed_v4_16017_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30017943SMED30017943SMESG000022837.1 dd_Smed_v4_16017_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033594Microtubule-associated protein 1ASMESG000014298.1 dd_Smed_v4_3654_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30033594Microtubule-associated protein 1ASMESG000014298.1 dd_Smed_v4_3654_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020343Intersectin-1SMESG000070268.1 dd_Smed_v4_3992_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30020343Intersectin-1SMESG000070268.1 dd_Smed_v4_3992_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021718COesterase domain-containing proteinSMESG000027379.1 dd_Smed_v4_6180_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30021718COesterase domain-containing proteinSMESG000027379.1 dd_Smed_v4_6180_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021828Baculoviral IAP repeat-containing protein 7SMESG000067788.1 dd_Smed_v4_8447_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30008301Synaptotagmin-14, putativeSMESG000024484.1 dd_Smed_v4_9548_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30003981Tctex1 domain containing 1SMESG000021852.1 dd_Smed_v4_12108_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30003981Tctex1 domain containing 1SMESG000021852.1 dd_Smed_v4_12108_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002908Cyclin-dependent kinase 12SMESG000057162.1 dd_Smed_v4_4866_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30001112SMED30001112SMESG000061228.1 dd_Smed_v4_8351_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30001112SMED30001112SMESG000061228.1 dd_Smed_v4_8351_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001112SMED30001112SMESG000061228.1 dd_Smed_v4_13515_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30016317slc16a-25SMESG000046854.1 dd_Smed_v4_10252_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30016317slc16a-25SMESG000046854.1 dd_Smed_v4_10252_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001341Carbonic anhydrase-relatedSMESG000054330.1 dd_Smed_v4_10750_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30016546SMED30016546SMESG000051921.1 SMESG000051913.1 dd_Smed_v4_1175_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30014799Friend leukemia integration 1SMESG000080027.1 dd_Smed_v4_14611_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30014799Friend leukemia integration 1SMESG000080027.1 dd_Smed_v4_14611_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001362SMEDWI-3SMESG000081970.1 dd_Smed_v4_1258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30019908PKD1L-3SMESG000066980.1 dd_Smed_v4_10962_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30014211MATH domain-containing proteinSMESG000075612.1 SMESG000026079.1 SMESG000018825.1 SMESG000002232.1 dd_Smed_v4_6759_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30014211MATH domain-containing proteinSMESG000026079.1 dd_Smed_v4_12140_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30015808TNF receptor-associated factorSMESG000001468.1 dd_Smed_v4_5675_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015808TNF receptor-associated factorSMESG000001468.1 dd_Smed_v4_5675_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30007971Rho GTPase-activating proteinSMESG000066536.1 dd_Smed_v4_10828_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30010437Copper homeostasis protein CutCSMESG000016228.1 dd_Smed_v4_7302_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30010437Copper homeostasis protein CutCSMESG000016228.1 dd_Smed_v4_7302_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012386Alpha-1,4 glucan phosphorylaseSMESG000061417.1 dd_Smed_v4_1532_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30013721Sterol O-acyltransferase 1SMESG000039900.1 dd_Smed_v4_17219_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30008015slc25a-14SMESG000066536.1 dd_Smed_v4_10828_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30000808Zinc finger MYM-type protein 1SMESG000038481.1 dd_Smed_v4_6644_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30003506Anaphase promoting complex subunit 4SMESG000062466.1 dd_Smed_v4_4177_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30003506Anaphase promoting complex subunit 4SMESG000062466.1 dd_Smed_v4_4177_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011094G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000007702.1 dd_Smed_v4_19671_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30000514SMED30000514SMESG000036214.1 dd_Smed_v4_10854_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30000566Ropporin-1-like proteinSMESG000079804.1 dd_Smed_v4_4888_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30000566Ropporin-1-like proteinSMESG000079804.1 dd_Smed_v4_4888_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031903ProsaposinSMESG000019973.1 dd_Smed_v4_2944_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028670Eukaryotic translation initiation factor 1ASMESG000077643.1 dd_Smed_v4_334_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30031366JunctophilinSMESG000065993.1 dd_Smed_v4_6259_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30025193Centrosomal protein of 170 kDa protein BSMESG000036418.1 dd_Smed_v4_9728_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30034893glypican-1SMESG000052359.1 dd_Smed_v4_4154_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30021616Rho GTPase-activating proteinSMESG000060252.1 dd_Smed_v4_3376_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30026956LaminSMESG000018461.1 dd_Smed_v4_3707_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30024282Synaptosomal-associated proteinSMESG000034282.1 dd_Smed_v4_3977_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30024282Synaptosomal-associated proteinSMESG000034282.1 dd_Smed_v4_3977_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30024860SMED30024860SMESG000001317.1 dd_Smed_v4_520_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30025821Multiple PDZ domain crumbs cell polarity complex componentSMESG000053393.1 dd_Smed_v4_5376_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30025821Multiple PDZ domain crumbs cell polarity complex componentSMESG000053393.1 dd_Smed_v4_5376_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30036025SMED30036025SMESG000071534.1 dd_Smed_v4_3658_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30036025SMED30036025SMESG000071534.1 dd_Smed_v4_3658_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023326Ig-like domain-containing proteinSMESG000078594.1 dd_Smed_v4_4106_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30023326Ig-like domain-containing proteinSMESG000078594.1 dd_Smed_v4_4106_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020989Glycine-rich domain-containing protein 1SMESG000047460.1 dd_Smed_v4_5132_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30035436SMED30035436SMESG000022942.1 dd_Smed_v4_2773_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30024713Pyruvate carboxylaseSMESG000077941.1 dd_Smed_v4_2393_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30030803[F-actin]-monooxygenase MICAL2SMESG000021733.1 dd_Smed_v4_8586_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30030803[F-actin]-monooxygenase MICAL2SMESG000021733.1 dd_Smed_v4_8586_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020526PalmitoyltransferaseSMESG000071926.1 dd_Smed_v4_6233_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30021910ASH1 like histone lysine methyltransferaseSMESG000051410.1 dd_Smed_v4_6521_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30021910ASH1 like histone lysine methyltransferaseSMESG000051410.1 dd_Smed_v4_6521_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023086U1 small nuclear ribonucleoprotein CSMESG000010972.1 dd_Smed_v4_3772_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30020634SMED30020634SMESG000081436.1 dd_Smed_v4_9784_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30024742Transient receptor potential cation channel subfamily V member 6SMESG000039339.1 dd_Smed_v4_29474_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30035871SMED30035871SMESG000055722.1 SMESG000043901.1 SMESG000034363.1 SMESG000034362.1 dd_Smed_v4_3685_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30035549Transmembrane 9 superfamily memberSMESG000066444.1 SMESG000060705.1 dd_Smed_v4_876_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30033752Tyrosine-protein kinaseSMESG000059352.1 SMESG000059351.1 dd_Smed_v4_420_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30033752Tyrosine-protein kinaseSMESG000059352.1 SMESG000059351.1 dd_Smed_v4_420_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028650Vesicle-fusing ATPaseSMESG000019983.1 dd_Smed_v4_3364_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30028650Vesicle-fusing ATPaseSMESG000019983.1 dd_Smed_v4_3364_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022905DihydropyrimidinaseSMESG000028784.1 SMESG000061889.1 dd_Smed_v4_3519_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30022905DihydropyrimidinaseSMESG000028784.1 SMESG000061889.1 dd_Smed_v4_3519_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013001SMED30013001SMESG000057336.1 dd_Smed_v4_6083_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30013001SMED30013001SMESG000057336.1 dd_Smed_v4_6083_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015763Bravo_FIGEY domain-containing proteinSMESG000064374.1 dd_Smed_v4_7836_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30015763Bravo_FIGEY domain-containing proteinSMESG000064374.1 dd_Smed_v4_7836_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015235Amyloid-beta A4 precursor protein-binding family A member 2SMESG000028901.1 dd_Smed_v4_2836_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30012139slc2a-2SMESG000081673.1 dd_Smed_v4_3190_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30012139slc2a-2SMESG000081673.1 dd_Smed_v4_3190_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006777Collagen alpha-1(XV) chainSMESG000081921.1 dd_Smed_v4_3516_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30004311Chromobox proteinSMESG000065471.1 SMESG000047257.1 dd_Smed_v4_8167_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30016557AquaporinSMESG000023346.1 dd_Smed_v4_6111_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30016557AquaporinSMESG000023346.1 dd_Smed_v4_6111_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014194Stonin-1/2SMESG000017305.1 dd_Smed_v4_6859_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30014194Stonin-1/2SMESG000017305.1 dd_Smed_v4_6859_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019887SMED30019887SMESG000011341.1 dd_Smed_v4_2941_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED300120465'-AMP-activated protein kinase subunit beta-1SMESG000037698.1 dd_Smed_v4_6112_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30003384Doublecortin domain-containing proteinSMESG000033740.1 dd_Smed_v4_6712_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30003384Doublecortin domain-containing proteinSMESG000033740.1 dd_Smed_v4_6712_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002875SMED30002875SMESG000044438.1 dd_Smed_v4_8258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30009652HEAT repeat-containing protein 5BSMESG000028228.1 dd_Smed_v4_7872_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30014219cilia- and flagella-associated protein 99SMESG000025927.1 dd_Smed_v4_8538_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30014219cilia- and flagella-associated protein 99SMESG000025927.1 dd_Smed_v4_8538_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018888Sequestosome 1 likeSMESG000058620.1 dd_Smed_v4_2812_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30019449cilia- and flagella-associated protein 54-likeSMESG000072637.1 dd_Smed_v4_9860_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30006546tRNA 2'-phosphotransferase 1SMESG000068824.1 dd_Smed_v4_5292_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30005207Si:dkey-153k10.9SMESG000055380.1 dd_Smed_v4_5144_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED300163635'-nucleotidase proteinSMESG000032250.1 dd_Smed_v4_3474_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30012642RNA-binding protein Luc7-like 2SMESG000005886.1 dd_Smed_v4_4536_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30006640Calcium/calmodulin-dependent protein kinase type IISMESG000062800.1 dd_Smed_v4_7858_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30006640Calcium/calmodulin-dependent protein kinase type IISMESG000062800.1 dd_Smed_v4_7858_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016338Alpha-adducinSMESG000051636.1 dd_Smed_v4_2345_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30016338Alpha-adducinSMESG000051636.1 dd_Smed_v4_2345_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001478Dynamin-like proteinSMESG000002033.1 dd_Smed_v4_884_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30001478Dynamin-like proteinSMESG000002033.1 dd_Smed_v4_884_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015694Histone H2ASMESG000067932.1 SMESG000067933.1 dd_Smed_v4_5156_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30017300SMED30017300SMESG000001317.1 dd_Smed_v4_520_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30008431Calcium uptake protein 1, mitochondrialSMESG000065412.1 dd_Smed_v4_3581_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30007558SMED30007558SMESG000071865.1 dd_Smed_v4_4209_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30004756Small nuclear ribonucleoprotein Sm D2SMESG000032344.1 dd_Smed_v4_2994_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30017878RING finger protein unkempt homologSMESG000054185.1 dd_Smed_v4_3128_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30005737Death-associated protein kinase 1SMESG000048879.1 dd_Smed_v4_9475_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30005737Death-associated protein kinase 1SMESG000048879.1 dd_Smed_v4_9475_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035359SMED30035359SMESG000081574.1 SMESG000081529.1 SMESG000079557.1 SMESG000079250.1 SMESG000077556.1 SMESG000075496.1 SMESG000073961.1 SMESG000073618.1 SMESG000073174.1 SMESG000071859.1 SMESG000071198.1 SMESG000071073.1 SMESG000070153.1 SMESG000068262.1 SMESG000068028.1 SMESG000067334.1 SMESG000065567.1 SMESG000061192.1 SMESG000060952.1 SMESG000060260.1 SMESG000059623.1 SMESG000050492.1 SMESG000050479.1 SMESG000050299.1 SMESG000049776.1 SMESG000048159.1 SMESG000044971.1 SMESG000043973.1 SMESG000042620.1 SMESG000040932.1 SMESG000039792.1 SMESG000039741.1 SMESG000039356.1 SMESG000034716.1 SMESG000033763.1 SMESG000029286.1 SMESG000028614.1 SMESG000027381.1 SMESG000025022.1 SMESG000021522.1 SMESG000020398.1 SMESG000019968.1 SMESG000018320.1 SMESG000015216.1 SMESG000015117.1 SMESG000015102.1 SMESG000013389.1 SMESG000012534.1 SMESG000012464.1 SMESG000011278.1 SMESG000011147.1 SMESG000007021.1 SMESG000006554.1 SMESG000001897.1 SMESG000070487.1 SMESG000068881.1 SMESG000064552.1 SMESG000063831.1 SMESG000056926.1 SMESG000050300.1 SMESG000047318.1 SMESG000047014.1 SMESG000043279.1 SMESG000030931.1 SMESG000023641.1 SMESG000018675.1 SMESG000017256.1 SMESG000013665.1 SMESG000013089.1 SMESG000011196.1 SMESG000009621.1 SMESG000008519.1 SMESG000005066.1 dd_Smed_v4_129_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30035359SMED30035359SMESG000081574.1 SMESG000081529.1 SMESG000079557.1 SMESG000079250.1 SMESG000077556.1 SMESG000075496.1 SMESG000073961.1 SMESG000073618.1 SMESG000073174.1 SMESG000071859.1 SMESG000071198.1 SMESG000071073.1 SMESG000070153.1 SMESG000068262.1 SMESG000068028.1 SMESG000067334.1 SMESG000065567.1 SMESG000061192.1 SMESG000060952.1 SMESG000060260.1 SMESG000059623.1 SMESG000050492.1 SMESG000050479.1 SMESG000050299.1 SMESG000049776.1 SMESG000048159.1 SMESG000044971.1 SMESG000043973.1 SMESG000042620.1 SMESG000040932.1 SMESG000039792.1 SMESG000039741.1 SMESG000039356.1 SMESG000034716.1 SMESG000033763.1 SMESG000029286.1 SMESG000028614.1 SMESG000027381.1 SMESG000025022.1 SMESG000021522.1 SMESG000020398.1 SMESG000019968.1 SMESG000018320.1 SMESG000015216.1 SMESG000015117.1 SMESG000015102.1 SMESG000013389.1 SMESG000012534.1 SMESG000012464.1 SMESG000011278.1 SMESG000011147.1 SMESG000007021.1 SMESG000006554.1 SMESG000001897.1 SMESG000070487.1 SMESG000068881.1 SMESG000064552.1 SMESG000063831.1 SMESG000056926.1 SMESG000050300.1 SMESG000047318.1 SMESG000047014.1 SMESG000043279.1 SMESG000030931.1 SMESG000023641.1 SMESG000018675.1 SMESG000017256.1 SMESG000013665.1 SMESG000013089.1 SMESG000011196.1 SMESG000009621.1 SMESG000008519.1 SMESG000005066.1 dd_Smed_v4_129_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30034590Post-GPI attachment to proteins factor 2-likeSMESG000044614.1 dd_Smed_v4_10182_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30024436SMED30024436SMESG000043617.1 dd_8060dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30024436SMED30024436SMESG000043617.1 dd_8060dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30035769Four and a half LIM domains proteinSMESG000023063.1 dd_Smed_v4_1251_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30020268Dynamin-type G domain-containing proteinSMESG000014756.1 SMESG000014755.1 dd_Smed_v4_2390_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30020268Dynamin-type G domain-containing proteinSMESG000014756.1 SMESG000014755.1 dd_Smed_v4_2390_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020268Dynamin-type G domain-containing proteinSMESG000014761.1 SMESG000014754.1 dd_Smed_v4_2777_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30034198SMED30034198SMESG000002829.1 dd_Smed_v4_12484_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30034198SMED30034198SMESG000002829.1 dd_Smed_v4_12484_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30024611Terminal nucleotidyltransferase 5CSMESG000016756.1 dd_Smed_v4_3449_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30024611Terminal nucleotidyltransferase 5CSMESG000052359.1 dd_Smed_v4_4154_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30012874Adenylate cyclase type 9SMESG000037351.1 dd_Smed_v4_2998_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30012874Adenylate cyclase type 9SMESG000037351.1 dd_Smed_v4_2998_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005160Kinesin light chainSMESG000018116.1 dd_Smed_v4_8136_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30008314IMD domain-containing proteinSMESG000038660.1 dd_Smed_v4_3500_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30008314IMD domain-containing proteinSMESG000038660.1 dd_Smed_v4_3500_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019871MTSS I-BAR domain containing 2SMESG000069250.1 dd_Smed_v4_3525_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30019871MTSS I-BAR domain containing 2SMESG000028682.1 dd_Smed_v4_6612_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30014476SMED30014476SMESG000051996.1 dd_2723dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30014476SMED30014476SMESG000051996.1 dd_2723dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30005212SMED30005212SMESG000042005.1 dd_Smed_v4_3333_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30012921Ras GTPase-activating protein gap-2SMESG000003718.1 SMESG000018818.1 dd_Smed_v4_2872_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30012921Ras GTPase-activating protein gap-2SMESG000003718.1 SMESG000018818.1 dd_Smed_v4_2872_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003560Teneurin-2SMESG000016735.1 dd_Smed_v4_5439_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30003560Teneurin-2SMESG000016735.1 dd_Smed_v4_5439_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019972Kinesin-like proteinSMESG000017021.1 dd_Smed_v4_9460_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30019972Kinesin-like proteinSMESG000017021.1 dd_Smed_v4_9460_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004519Novel proteinSMESG000039682.1 dd_Smed_v4_2676_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30004519Novel proteinSMESG000039682.1 dd_Smed_v4_2676_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017749Peptidyl-glycine alpha-amidating monooxygenaseSMESG000042480.1 dd_Smed_v4_3093_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30017749Peptidyl-glycine alpha-amidating monooxygenaseSMESG000042480.1 dd_Smed_v4_3093_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006047EF-hand calcium-binding domain-containing protein 5SMESG000053423.1 dd_Smed_v4_8209_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30006047EF-hand calcium-binding domain-containing protein 5SMESG000053423.1 dd_Smed_v4_8209_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001497Rho guanine nucleotide exchange factor 17SMESG000018133.1 dd_Smed_v4_2922_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30012546Coiled-coil domain-containing protein 65SMESG000021331.1 dd_Smed_v4_6152_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30012546Coiled-coil domain-containing protein 65SMESG000021331.1 dd_Smed_v4_6152_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008167SMED30008167SMESG000033046.1 dd_4545dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30008167SMED30008167SMESG000033046.1 dd_4545dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30005551Spectrin alpha chainSMESG000005289.1 dd_Smed_v4_919_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30005551Spectrin alpha chainSMESG000005289.1 dd_Smed_v4_919_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005654SMED30005654SMESG000044586.1 dd_Smed_v4_6921_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30005654SMED30005654SMESG000044586.1 dd_Smed_v4_6921_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018571U1-type domain-containing proteinSMESG000050161.1 dd_Smed_v4_6635_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30018571U1-type domain-containing proteinSMESG000050161.1 dd_Smed_v4_6635_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014507FibronectinSMESG000029259.1 dd_Smed_v4_43824_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015252Mitochondrial inner membrane protein OXA1LSMESG000039158.1 dd_Smed_v4_4072_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30010504SMED30010504SMESG000010514.1 dd_Smed_v4_4965_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30001663Expressed conserved proteinSMESG000057766.1 dd_Smed_v4_6533_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30001663Expressed conserved proteinSMESG000057766.1 dd_Smed_v4_4288_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30006525E3 ubiquitin-protein ligase RNF31SMESG000015148.1 SMESG000015146.1 dd_Smed_v4_4025_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30012475PPFIA binding protein 1bSMESG000054431.1 dd_Smed_v4_7610_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30001583Protocadherin delta 1SMESG000022902.1 dd_Smed_v4_8478_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30016746SMED30016746SMESG000060159.1 dd_Smed_v4_2729_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30016746SMED30016746SMESG000060159.1 dd_Smed_v4_2729_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015424Retrovirus-related Pol polyprotein from type-1 retrotransposable element R2SMESG000062936.1 SMESG000024338.1 SMESG000024319.1 SMESG000024308.1 dd_Smed_v4_18000_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30008451SMED30008451SMESG000036070.1 SMESG000036047.1 SMESG000036045.1 dd_Smed_v4_2238_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30013758Protein CLP1 homologSMESG000047440.1 SMESG000028257.1 dd_Smed_v4_5796_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30019097SOXP-1SMESG000010063.1 dd_Smed_v4_7227_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30013260SAM domain-containing proteinSMESG000054431.1 dd_Smed_v4_7610_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30018268SMED30018268SMESG000022826.1 dd_Smed_v4_4366_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30003540FAS-associated factor 2SMESG000048881.1 dd_Smed_v4_10511_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30003540FAS-associated factor 2SMESG000048881.1 dd_Smed_v4_10511_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004731FMRFamide-activated amiloride-sensitive sodium channelSMESG000039581.1 dd_Smed_v4_18385_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30010944SMED30010944SMESG000062936.1 SMESG000024338.1 SMESG000024319.1 SMESG000024308.1 dd_Smed_v4_18000_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30010874slc18a-7SMESG000009088.1 dd_Smed_v4_19744_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30008873SMED30008873SMESG000009341.1 dd_Smed_v4_337_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30014378Protein MON2 homologSMESG000051667.1 dd_Smed_v4_3806_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30003463slc30a-8SMESG000013136.1 dd_Smed_v4_5529_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30010473DEP domain-containing proteinSMESG000029435.1 dd_Smed_v4_8467_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30019562SMED30019562SMESG000016070.1 dd_Smed_v4_12252_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30008651Guanylate cyclaseSMESG000019264.1 dd_Smed_v4_9453_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30008651Guanylate cyclaseSMESG000019264.1 dd_Smed_v4_9453_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014095NucleaseSMESG000013712.1 dd_Smed_v4_3312_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30012448Type II pantothenate kinaseSMESG000031677.1 dd_Smed_v4_6121_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30003094HMG box domain-containing proteinSMESG000017540.1 SMESG000070603.1 SMESG000070576.1 SMESG000017600.1 SMESG000017572.1 SMESG000017558.1 SMESG000017557.1 SMESG000017556.1 SMESG000017543.1 SMESG000017541.1 dd_Smed_v4_4601_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003094HMG box domain-containing proteinSMESG000017540.1 SMESG000070603.1 SMESG000070576.1 SMESG000017600.1 SMESG000017572.1 SMESG000017558.1 SMESG000017557.1 SMESG000017556.1 SMESG000017543.1 SMESG000017541.1 dd_Smed_v4_4601_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30014788SMED30014788SMESG000081995.1 SMESG000080328.1 SMESG000080048.1 SMESG000078665.1 SMESG000077025.1 SMESG000076395.1 SMESG000075858.1 SMESG000066691.1 SMESG000062442.1 SMESG000060496.1 SMESG000054975.1 SMESG000054276.1 SMESG000051957.1 SMESG000049162.1 SMESG000046165.1 SMESG000036894.1 SMESG000035648.1 SMESG000034762.1 SMESG000030928.1 SMESG000030475.1 SMESG000030445.1 SMESG000030069.1 SMESG000029693.1 SMESG000029692.1 SMESG000029599.1 SMESG000029355.1 SMESG000027993.1 SMESG000027217.1 SMESG000022058.1 SMESG000020046.1 SMESG000014020.1 SMESG000012961.1 SMESG000010709.1 SMESG000007675.1 SMESG000006952.1 SMESG000004166.1 SMESG000003706.1 SMESG000002779.1 SMESG000002239.1 SMESG000001845.1 SMESG000080313.1 SMESG000066842.1 SMESG000050392.1 SMESG000048356.1 SMESG000042931.1 SMESG000033095.1 SMESG000018900.1 SMESG000017493.1 SMESG000015917.1 SMESG000004121.1 dd_Smed_v4_3574_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30001852CD109 antigenSMESG000016163.1 dd_Smed_v4_3070_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30014167Kinesin-like proteinSMESG000050139.1 SMESG000050123.1 dd_Smed_v4_20223_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30019487PhosphodiesteraseSMESG000054903.1 SMESG000054901.1 SMESG000054878.1 SMESG000044092.1 dd_Smed_v4_10593_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30009905SMED30009905SMESG000000384.1 dd_Smed_v4_10941_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30023988Dynamin-type G domain-containing proteinSMESG000002973.1 dd_Smed_v4_9275_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023988Dynamin-type G domain-containing proteinSMESG000002973.1 dd_Smed_v4_9275_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30022977SMED30022977SMESG000017540.1 SMESG000070603.1 SMESG000070576.1 SMESG000017600.1 SMESG000017572.1 SMESG000017558.1 SMESG000017557.1 SMESG000017556.1 SMESG000017543.1 SMESG000017541.1 dd_Smed_v4_4601_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022977SMED30022977SMESG000017540.1 SMESG000070603.1 SMESG000070576.1 SMESG000017600.1 SMESG000017572.1 SMESG000017558.1 SMESG000017557.1 SMESG000017556.1 SMESG000017543.1 SMESG000017541.1 dd_Smed_v4_4601_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30032843SMED30032843SMESG000062936.1 SMESG000024338.1 SMESG000024319.1 SMESG000024308.1 dd_Smed_v4_18000_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30023331Transposon Ty3-I Gag-Pol polyproteinSMESG000054198.1 dd_Smed_v4_6563_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30021589Agrin, putativeSMESG000028865.1 SMESG000028859.1 dd_Smed_v4_3649_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30034763c-Jun N-terminal kinasesSMESG000043618.1 dd_Smed_v4_5924_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30023114slc39a-11SMESG000016934.1 dd_Smed_v4_6246_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30020321Cilia and flagella associated protein 126SMESG000048804.1 dd_Smed_v4_2157_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30031800Mth938 domain-containing proteinSMESG000003215.1 dd_Smed_v4_2203_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30033340DUF4476 domain-containing proteinSMESG000055714.1 dd_Smed_v4_3608_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30023399NFX1-type zinc finger-containing protein 1-likeSMESG000057303.1 dd_Smed_v4_10696_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30035542SMED30035542SMESG000062936.1 SMESG000024338.1 SMESG000024319.1 SMESG000024308.1 dd_Smed_v4_18000_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30035684SMED30035684SMESG000016739.1 dd_Smed_v4_12479_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30035517SMED30035517SMESG000023186.1 dd_Smed_v4_5809_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30033835synaptotagmin-14 isoform X1SMESG000070077.1 dd_Smed_v4_8785_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30030183SMED30030183SMESG000020128.1 dd_Smed_v4_12353_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30031150Zinc finger FYVE domain-containing protein 26SMESG000019696.1 dd_Smed_v4_7794_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30029080Rhodanese-like proteinSMESG000079774.1 dd_Smed_v4_7388_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30034380SMED30034380SMESG000020144.1 dd_Smed_v4_677_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30028884SMED30028884SMESG000010555.1 dd_Smed_v4_9828_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30032051serine/arginine repetitive matrix protein 1 isoform X3SMESG000018884.1 dd_Smed_v4_9404_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30035090SMED30035090SMESG000005437.1 dd_Smed_v4_10052_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30022162SMED30022162SMESG000046043.1 dd_Smed_v4_5762_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30027416Protein split endsSMESG000016300.1 dd_Smed_v4_6458_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30035398Carboxypeptidase DSMESG000073392.1 SMESG000073389.1 dd_Smed_v4_5718_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30027029SMED30027029SMESG000036070.1 SMESG000036047.1 SMESG000036045.1 dd_Smed_v4_2238_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30025613SMED30025613SMESG000039185.1 dd_Smed_v4_8556_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30024939ADP-ribosylation factor interacting protein 2aSMESG000005123.1 dd_Smed_v4_3420_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30028033SMED30028033SMESG000036070.1 SMESG000036047.1 SMESG000036045.1 dd_Smed_v4_2238_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30028994Protein kinase domain-containing proteinSMESG000033598.1 dd_Smed_v4_13819_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30020218Ubiquitin carboxyl-terminal hydrolaseSMESG000036070.1 SMESG000036047.1 SMESG000036045.1 dd_Smed_v4_2238_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30032948FMRFamide-activated amiloride-sensitive sodium channelSMESG000053390.1 dd_Smed_v4_16764_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30026746SMED30026746SMESG000061917.1 dd_Smed_v4_588_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30024232SMED30024232SMESG000047490.1 dd_Smed_v4_707_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30022947Transient receptor potential cation channel subfamily A member 1SMESG000078036.1 dd_Smed_v4_37397_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30022947Transient receptor potential cation channel subfamily A member 1SMESG000078036.1 dd_Smed_v4_18706_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30030459SMED30030459SMESG000041220.1 dd_Smed_v4_14151_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30014989AGAP013516-RBSMESG000056770.1 dd_Smed_v4_2589_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30014606Copine-3SMESG000007275.1 dd_Smed_v4_17867_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30014606Copine-3SMESG000007275.1 dd_Smed_v4_14045_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30004747Cytochrome P450SMESG000013786.1 SMESG000013783.1 SMESG000011362.1 dd_Smed_v4_2257_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30002324SMED30002324SMESG000020128.1 dd_Smed_v4_12353_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30004174Holocarboxylase synthetaseSMESG000020128.1 dd_Smed_v4_12353_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30004487SMED30004487SMESG000012170.1 SMESG000012168.1 dd_Smed_v4_1367_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30001160SMED30001160SMESG000000384.1 dd_Smed_v4_10941_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30001715SMED30001715SMESG000047488.1 dd_Smed_v4_1497_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30001056AcetylCoA_hyd_C domain-containing proteinSMESG000063866.1 dd_Smed_v4_1775_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30003066NEK8-1SMESG000053193.1 dd_Smed_v4_8692_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30002606Cilia-and flagella-associated protein 74SMESG000043377.1 dd_Smed_v4_18628_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30001003Glutamate decarboxylase 1SMESG000050934.1 SMESG000050924.1 dd_Smed_v4_12653_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30001003Glutamate decarboxylase 1SMESG000050934.1 SMESG000050924.1 dd_Smed_v4_12653_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30002092Sodium/potassium-transporting ATPase subunit betaSMESG000061673.1 dd_Smed_v4_2230_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30001647SMED30001647SMESG000005004.1 dd_Smed_v4_2246_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30003876SMED30003876SMESG000079921.1 SMESG000079899.1 SMESG000079877.1 SMESG000000911.1 SMESG000000908.1 dd_Smed_v4_13944_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30006883SMED30006883SMESG000063750.1 dd_Smed_v4_17076_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30006883SMED30006883SMESG000063750.1 dd_Smed_v4_17076_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022907SynaptotagminSMESG000025329.1 dd_Smed_v4_4222_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30022907SynaptotagminSMESG000025329.1 dd_Smed_v4_4222_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30024786Zinc finger protein castor-like protein 1SMESG000038913.1 dd_Smed_v4_6778_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuron