neuron

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ In Situ Hybridization Data

  ▻ Sequences

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  neuron


DEFINITON:

  The basic cellular unit of nervous tissue. Each neuron consists of a body, an axon, and dendrites. Their purpose is to receive, conduct, and transmit impulses in the nervous system.


TERM DEFINITION CITATIONS:

  CL:0000540


TERM CITATIONS:


TERM ID:

  PLANA:0000099


ABOUT THIS TERM:

neuron

  ↳is a electrically signaling cell



Expand to see terms that part of neuron

  → synapse
  → synaptic cleft
  → synaptic vesicle
  → neurite


BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30022907SynaptotagminDj-sytStage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, ventral nerve cord, neuron, cephalic ganglia, nervous system, embryonic pharynx
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 ┬Ám

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30019471 ID=SMED30019471|Name=Synaptotagmin|organism=Schmidtea mediterranea sexual|type=transcript|length=1910bp
TTTGGGACTTCTCCAATCTATTAAATATATTTAGAACGAACATCGTTGTGAGAAGCTTTGTCTTGCAAATGCACACCAAC
ACATTCTCTGCCTACTCGAGACCAGCCTGAAGGACGCACCCAGTCATCTCTTATAAAAAAAAAACTCTTCTCTGATTCGG
TATTTTCTGATTAATGGAGATCAAACAATGATTGGGCAACGTCTAGTTTAGAATATTTACAACTAAATCTGCGTATTTCA
ATTTTTTTTCGATTTTGATTGTTGCAAATATTTATGAGTATATCCAATAATATAAGCAGCGCTAGTAATATGACGATAAA
AATGCAACAAAATGTTGAAAAGTCTGTATCACAGCATGTAACAGCGCAAACAAAGGAATCAACATCAAATAAACTTCATA
CAACAACAGCCGGTATCTCGGTTTTGGAGAAAACATTAAAAACATTTCACATGAGTACTGGCACTTTGATTGGAATCGGA
GTTACAGTGTCTATCGTAGTTTTATTACTTCTTTATTGTATTTGCAAACGATGCATTAAGAAACGAAAGAAAAAGAAAGA
TGGCGGCAAAAAAGGTGGAAAAGGCGTAGACATGAAAAGCGTACAACTATTAGGAAATGCTTATAAAGAAAAGGTACAGC
CGGACCTAGAAGAACTGGATGCTAACATGGAAGATAATGAAGGGGCGCAAGATAAAGAAGCAGTCAATCTTGGAAAATTA
CAGTATTCCCTTGATTACGATTTTACAAAAGGCGAGCTAACAGTCGGAGTAATTCAAGCCACAGATCTCCCAGCAATGGA
CATGTCAGGAACTTCTGATCCATATGTGAAAGTTTTTCTATTACCGGATAAAAAGAAAAAATTCGAAACCAAAGTTCATC
GAAAAATATTAAATCCAGTCTTTAATGAGACATTTGTATTCAAGATTCCTTATTCTGAGGTCGGGTCTAAAACTTTGGTA
TTTAATGTTTTCGATTTCGACAGATTTTCAAAGCATGATCAAATTGGGCAAATCCAAATTCCACTGGGTTCAGTAGATTT
ATGCAAAGTTATTGAGGAATGGAAGGAACTCGGCCCACCTGACAGTGATAATGAAAAGGAAAATCGATTAGGAGACATTT
GTTTTTCTTTGAGATATGTTCCAACGTCTGGAAAGTTGAATATCGTCATTCTGGAAGCTAAAAACCTCAAGAAAATGGAT
GTTGGAGGATTGTCGGATCCTTACGTGAAACTATCGTTGATGCTTAACGGCAAACGAGTGAAAAAGAAGAAAACCACAAT
AAAAAAATACACATTAAATCCTTATTATAATGAGTCATTTTCATTCGAAGTTCCATTCGAGCAAATACAAAAAGTTAATT
TAATAGTGACAGTAGTTGATTATGATAGAATTGGAACAAGTGAACCTATTGGAAGAGTAGTTCTTGGATGCAATGCTACA
GGAGCAGAACTTCGGCACTGGTCCGATATGCTTGCTAATCCTAGGAGACCAATTGCCCAGTGGCATACCCTTCAAGATAT
GCCGGAGAAGAGCTGATTTCATTGATTTTAATTTTAAAATCTGTCATATTTTGTGATAAATTTTGCGTATTTATACAATC
ATTCGATTCGATCTTTCCATCAAGTTTCGTAAAATCTGCAGACATTCACGAGGATGCAGAAGAAATAGAAACTTTGTAAT
AAATTAGCATTAGCTGTGATCTCCTATTGACCAAAAAACATAAACTTAATTTTTATAAAGAATTGTGGTGAAATGTTGTT
AGGTTTCAGTCATAGATAACTGTATTTGTGTAATAGTTTGTGTATTTCTCGTCCTGGCCCGATTTTGTGCATTCCACTGG
CAATACTATTTCACTAATAAATTATGTCTGATAATGTATACCAGTATAGGATTTTGTTTGAATTAATGAA
>SMED30022907 ID=SMED30022907|Name=Synaptotagmin|organism=Schmidtea mediterranea sexual|type=transcript|length=1814bp
ATTTATTGAAAATTATTTTTTCTATTATTAGGAGAAAATTGATTATTTTTTTTTGACAAAATAAGTTTTGGATATATTTC
CCATTTGTTTGTATTCGTAAACCAATGAAGAATTCGACTCACGGATCGGATCATTCGGCCAGCAAGGCCAGTATGAAAAC
GAATGTGGAAAAATTTTGGCATGATCTCGGAAAAAAATTGCACATGGATCCAAAAGCATTAATAGGAGTAACAATCGGTT
TGGGAATATTGTTTTTGTTGTTCCTTTATTGCTTATGTAAAAAATGTGTTTTCAAGCGTCGAAAAAAGAAGGAAACGGCC
AAAAAAGGAGCCAAGGGAGTAGTCGATATGAAAAGTGCCCAATTGTTGGGGAATTCATATAAAGAAAAAATTCAACCCGA
TCTTGAAGAACTTGATGCAAACATGGAAGACAATGAAGGTGTAAAAGAAAAAGAAGATGTTCATTTAGGAAAATTACAAT
ATTCTCTAGATTATGATTTTCAGAAAGGAGAATTAACTGTTGGAGTTATTCAAGCAACTGATCTTCCAGCTATGGATATG
TCAGGAACATCAGATCCATATGTCAAATTATACCTTCTCCCAGACAAGAAAAAGAAATTCGAAACAAAGGTTCATAGGAA
AATTTTAAATCCTGTATTCAATGAAACTTTTGTTTTCAAAGTTCCTTTCAATGAAGTTGCATCGAAGACTTTGATTTTCA
ACGTTTATGACTTTGACAGATTTTCCAAACACGATCAAATCGGTCAAATAAAAGTACCATTGGGAGCTATAGATTTAGGT
CGAGTTATTGAAGAATGGAAGGAACTGGAATCTCCAGAAAACGATGGGGAAAAGGAAAACAGGTTGGGAGACATTTGTTT
CTCTTTAAGATACGTACCGACATCTGGAAAGCTTACAATAGTCATTTTGGAAGCAAAGAATCTTAAAAAAATGGATGTCG
GAGGATTGTCTGATCCATATGTTAAACTTTCCTTGATGCTTAATGGTAAACGAGTGAAGAAGAAGAAAACTACCATCAAA
AAGTATACACTAAATCCTTACTACAATGAATCATTTTCCTTTGAAGTACCATTCGAACAAATACAAAAAGTGAACTTGAT
CGTCACGGTTGTTGATTATGACAGAATCGGAACCAGCGAACCGATAGGTAGAATTGTTCTGGGATGTAACGCAACTGGAG
CAGAATTGCGACATTGGTCGGATATGTTGGCAAATCCCCGGCGACCAATCGCCCAGTGGCATACCCTCCAAGAGATGCCA
GAGAACAATTGATAGTGTTCGTTTGATGCTTTAAAGCGGTTTGCATAATTCGTGAAATAAGTTATCAAAATTTGAGAAAT
GTTTTTTTTTCTGAAACAAAAATGGCATGAGACAATATACCAGAGTTCATTAGTGTGTGGTTTCGTTGAATATTTTGGTG
GTGTTGCATCTTATCGTTTGTCCTCTAATCTAATAATGTTTTATTCTTTATATAGCTGATTTATTCTCGAGCGAAACATT
TTTTATGTGTACCAAAATACTTATGTCATAGCCATTGTGATTAGTCTGTAAACTATTGCGTAATAGCCCCTCTCATTGGC
TTTTTTTAAGAGTAGTGAGTTGGAAAAAAAAATACAAAAATGACTTCAATTGTTAAACATTACTCATATTTTATCAGTAA
GTTAACTTGCATATTTGCAGTTAATTATGGCATTTTATCTCTAAATCTCTGAAGCATGGCCTCAAGTCTTTTGTTTGTTT
TAATGTAATTATGTCTAGATGAGAATATTAAAATACTTCGGTTTATATAAAAGA

 

back to top



PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in neuron. Click this link to learn more about PAGE.


PAGE Curations: 1946


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
neuronSMED30014446piwi-like protein 1 dd_Smed_v4_756_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30012747NME/NM23 family member 8 dd_Smed_v4_8401_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006466Uncharacterized protein dd_Smed_v4_4625_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005692dynein cytoplasmic 2 heavy chain 1 dd_Smed_v4_9136_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012847RecQ like helicase dd_Smed_v4_7318_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000126centrosomal protein 95 dd_Smed_v4_8515_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017722kinesin family member 1B dd_Smed_v4_7108_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002549syntaxin 1A dd_Smed_v4_8453_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022617h1SMcT0017243.1 dd_Smed_v4_5266_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029668Adenylate kinase isoenzyme dd_Smed_v4_5119_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30036016H2A clustered histone 20 dd_Smed_v4_7383_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030319trichoplein keratin filament binding dd_Smed_v4_6634_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012160spectrin repeat containing nuclear envelope protein 1 dd_Smed_v4_9493_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30002168fat-spondin dd_Smed_v4_8655_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30034903cilia and flagella associated protein 77 dd_Smed_v4_5179_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001262MAP kinase activating death domain dd_Smed_v4_8355_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017175Ras GTPase-activating protein gap-2 dd_Smed_v4_6499_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015650Centrosomal protein 43 dd_Smed_v4_5371_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006343dynein axonemal heavy chain 5 dd_Smed_v4_4569_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035894diacylglycerol kinase theta dd_Smed_v4_9631_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008882cilia and flagella associated protein 157 dd_Smed_v4_9862_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031336musashi RNA binding protein 2 dd_Smed_v4_7323_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025071calcium/calmodulin dependent protein kinase II gamma dd_Smed_v4_7480_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017794coiled-coil domain containing 191 dd_Smed_v4_8967_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013390spectrin repeat containing nuclear envelope protein 1 dd_Smed_v4_9493_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30000708dynein axonemal heavy chain 5 dd_Smed_v4_4569_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017113sodium channel and clathrin linker 1 dd_Smed_v4_9538_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026932Noggin dd_Smed_v4_8738_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30028061BICD family like cargo adaptor 1 dd_Smed_v4_7219_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007902RecQ like helicase dd_Smed_v4_7318_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030227flotillin 2 dd_Smed_v4_927_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007581cilia and flagella associated protein 69 dd_Smed_v4_7432_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020166Coiled-coil domain-containing protein 177 dd_Smed_v4_9816_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025370RecQ like helicase dd_Smed_v4_7318_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035315EEF1AKMT4-ECE2 readthrough dd_Smed_v4_8276_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003375striatin 3 dd_Smed_v4_8286_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004739TNF receptor-associated factor dd_Smed_v4_4420_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016222calcium/calmodulin dependent protein kinase ID dd_Smed_v4_5783_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004118tubulin beta 4B class IVb dd_Smed_v4_83_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30004118tubulin beta 4B class IVb dd_Smed_v4_83_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035226Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_5798_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015912kinetochore protein nuf2 dd_Smed_v4_9349_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030845canoe; transcript_id=FBtr0334913 dd_Smed_v4_7215_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011296tubulin beta 4B class IVb dd_Smed_v4_83_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30011296tubulin beta 4B class IVb dd_Smed_v4_83_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022193spectrin repeat containing nuclear envelope protein 1 dd_Smed_v4_9493_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30026002NF-kappa-B inhibitor alpha dd_Smed_v4_587_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020977spectrin repeat containing nuclear envelope protein 1 dd_Smed_v4_9493_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30030220sodium channel and clathrin linker 1 dd_Smed_v4_9538_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026735poly(rC) binding protein 3 dd_Smed_v4_8431_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007567piwi-like protein 1 dd_Smed_v4_756_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30012136radial spoke head component 9 dd_Smed_v4_4707_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028097phosphodiesterase 2A dd_Smed_v4_6976_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005723synaptotagmin 11 dd_Smed_v4_7243_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032610Anaphase-promoting complex subunit 4 WD40 domain-containing protein dd_Smed_v4_8615_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028311spectrin beta, erythrocytic dd_Smed_v4_7344_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032280Histone acetyltransferase KAT6B dd_Smed_v4_5797_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030766RNA binding motif protein 3 dd_Smed_v4_52_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30033229coiled-coil domain containing 88A dd_Smed_v4_7457_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002346coiled-coil domain containing 96 dd_Smed_v4_9313_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022622Centrosome-associated protein 350 dd_Smed_v4_5967_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006485syntrophin beta 1 dd_Smed_v4_7105_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005721Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_5564_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031029mitogen-activated protein kinase kinase kinase kinase 4 dd_Smed_v4_6230_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035047sperm associated antigen 17 dd_Smed_v4_9301_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016819DnaJ heat shock protein family (Hsp40) member C5 dd_Smed_v4_5990_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035681intraflagellar transport 88 dd_Smed_v4_5484_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012757Tektin A; transcript_id=FBtr0080788 dd_Smed_v4_4872_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005344ArfGAP with SH3 domain, ankyrin repeat and PH domain 2 dd_Smed_v4_6590_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028659cilia and flagella associated protein 100 dd_Smed_v4_6518_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015427ATPase H transporting V0 subunit a1 dd_Smed_v4_4805_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000596peroxiredoxin 1 dd_Smed_v4_7781_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006256coiled-coil domain containing 96 dd_Smed_v4_9313_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035965Neuron navigator dd_Smed_v4_7701_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021386RNA binding motif protein 3 dd_Smed_v4_52_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30002152ArfGAP with SH3 domain, ankyrin repeat and PH domain 2 dd_Smed_v4_6590_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000644kinesin family member 21A dd_Smed_v4_7196_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026686h1SMcT0016744.1 dd_Smed_v4_5074_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031050h1SMcT0003296.1 dd_Smed_v4_6396_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014133EF-hand calcium binding domain 10 dd_Smed_v4_6477_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008816Rab interacting lysosomal protein like 1 dd_Smed_v4_4713_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029642neurensin 1 dd_Smed_v4_4743_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012777UspA domain-containing protein dd_Smed_v4_7254_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003545Glutamate receptor ionotropic, NMDA 3A dd_Smed_v4_5950_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025097Disintegrin and dd_Smed_v4_8718_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026524spermidine synthase dd_Smed_v4_7292_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013108syntaxin binding protein 1 dd_Smed_v4_7111_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002064Doublecortin domain-containing protein dd_Smed_v4_6464_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30002064Doublecortin domain-containing protein dd_Smed_v4_6464_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033479mitogen-activated protein kinase kinase kinase kinase 4 dd_Smed_v4_6230_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032372lethal (2) 41Ab; transcript_id=FBtr0114030 dd_Smed_v4_6338_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009556dynein axonemal light chain 1 dd_Smed_v4_6302_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016196CCHC-type zinc finger nucleic acid binding protein dd_Smed_v4_62_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30026524spermidine synthase dd_Smed_v4_7292_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029822Neurotransmitter-gated ion-channel ligand-binding domain-containing protein dd_Smed_v4_9503_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009226Rab interacting lysosomal protein like 1 dd_Smed_v4_4713_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022977Protein capicua homolog dd_Smed_v4_4601_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003094Protein capicua homolog dd_Smed_v4_4601_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016664 dd_Smed_v4_2370_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30032534 dd_29413dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30016993Rap guanine nucleotide exchange factor 4 dd_Smed_v4_9547_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001361proline rich coiled-coil 2C dd_Smed_v4_4611_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035040h1SMcT0009034.1 dd_Smed_v4_5894_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007943adaptor related protein complex 1 subunit beta 1 dd_Smed_v4_893_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008451ubiquitin specific peptidase 21 dd_Smed_v4_5097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006567Protein kinase dd_Smed_v4_8254_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022769gamma-aminobutyric acid type A receptor subunit pi dd_Smed_v4_8110_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014999non-specific serine/threonine protein kinase dd_Smed_v4_5741_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032885EMAP like 4 dd_Smed_v4_958_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030724Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_507_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030724Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_507_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30001478MX dynamin like GTPase 2 dd_Smed_v4_884_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032910ankyrin repeat and ubiquitin domain containing 1 dd_Smed_v4_9027_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006636kinesin family member 13A dd_Smed_v4_6697_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015295Uncharacterized protein dd_Smed_v4_5097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30024428h1SMcT0003255.1 dd_Smed_v4_4669_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025232dynamin 1 dd_Smed_v4_6863_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032167calcium/calmodulin dependent protein kinase II beta dd_Smed_v4_7858_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021222meiosis specific nuclear structural 1 dd_Smed_v4_4463_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010688Segment polarity protein dishevelled homolog DVL-3 dd_Smed_v4_4639_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028033Ubiquitin carboxyl-terminal hydrolase 2 dd_Smed_v4_5097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026872Uncharacterized protein dd_Smed_v4_6104_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032094regulatory subunit of type II PKA R-subunit dd_Smed_v4_4716_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026275major facilitator superfamily dd_Smed_v4_4772_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008104Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_5672_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013179diacylglycerol kinase theta dd_Smed_v4_9631_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006640calcium/calmodulin dependent protein kinase II beta dd_Smed_v4_7858_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014349Uncharacterized protein dd_Smed_v4_5097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008651natriuretic peptide receptor 1 dd_Smed_v4_9453_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025736Erythrocyte band 7 integral membrane protein-like dd_Smed_v4_5746_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020469LIM domain-containing protein 2 dd_Smed_v4_7989_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008276Protein piccolo (Fragment) dd_Smed_v4_9615_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016488mucin 1 cell surface associated dd_Smed_v4_62029_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30021910Histone-lysine N-methyltransferase ASH1L dd_Smed_v4_6521_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010458zinc finger protein 483 dd_Smed_v4_7664_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008671phosphodiesterase 2A dd_Smed_v4_8589_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028734early endosome antigen 1 dd_Smed_v4_5097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009735Bardet-Biedl syndrome 5 dd_Smed_v4_8523_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002801tailup dd_Smed_v4_8820_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030613Amidophosphoribosyltransferase dd_Smed_v4_5319_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013001Ankyrin-1 dd_Smed_v4_6083_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023025protein phosphatase 3 regulatory subunit B, alpha dd_Smed_v4_4924_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30027978calcyphosine like dd_Smed_v4_4512_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014552Protein piccolo (Fragment) dd_Smed_v4_9615_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035232Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_5672_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010627Homeobox protein dd_Smed_v4_8553_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30024501Regulator of nonsense transcripts UPF3 dd_Smed_v4_5309_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014412Max dimerization protein 1 dd_Smed_v4_4415_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006070Zinc finger protein dd_Smed_v4_6842_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019565radial spoke head 6 homolog A dd_Smed_v4_5346_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022806calcyphosine like dd_Smed_v4_4512_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025181dynein axonemal light intermediate chain 1 dd_Smed_v4_4453_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028033ubiquitin specific peptidase 21 dd_Smed_v4_5097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021617Gamma-aminobutyric acid dd_Smed_v4_8486_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025821multiple PDZ domain crumbs cell polarity complex component dd_Smed_v4_5376_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013757Protein piccolo (Fragment) dd_Smed_v4_9615_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019471synaptotagmin 2 dd_Smed_v4_6730_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009438complexin 2 dd_Smed_v4_9918_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025783cytochrome p450 oxidoreductase dd_Smed_v4_542_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013275synaptogyrin 2 dd_Smed_v4_6478_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032757Segment polarity protein dishevelled homolog DVL-3 dd_Smed_v4_4639_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022666Uncharacterized protein dd_Smed_v4_5097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018291Uncharacterized protein dd_Smed_v4_5097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020235Ubiquitin carboxyl-terminal hydrolase 2 dd_Smed_v4_5097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031735E3 ubiquitin-protein ligase PDZRN3-B dd_Smed_v4_4699_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033407DAZ interacting zinc finger protein 1 like dd_Smed_v4_9365_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026643Lithium-inducible SLC6 transporter dd_Smed_v4_6616_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003595Protein piccolo (Fragment) dd_Smed_v4_9615_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30024009ADP ribosylation factor like GTPase 16 dd_Smed_v4_5801_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017949h1SMcT0009656.1 dd_Smed_v4_7207_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031496leucine zipper transcription factor like 1 dd_Smed_v4_8415_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033976Steroid 17-alpha-hydroxylase/17,20 lyase dd_Smed_v4_4331_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019471synaptotagmin 2 dd_Smed_v4_6730_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023179Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_6904_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032106h1SMcT0012728.1 dd_Smed_v4_8948_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012933Max dimerization protein 1 dd_Smed_v4_4415_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017180dynein regulatory complex subunit 1 dd_Smed_v4_8761_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30034295Clusterin associated protein 1 dd_Smed_v4_8287_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009973Max dimerization protein 1 dd_Smed_v4_4415_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021872AP2-associated protein kinase 1-like dd_Smed_v4_5124_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020235early endosome antigen 1 dd_Smed_v4_5097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028734Ubiquitin carboxyl-terminal hydrolase 2 dd_Smed_v4_5097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020851band 7 dd_Smed_v4_7331_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028033early endosome antigen 1 dd_Smed_v4_5097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022421RIB43A domain with coiled-coils 2 dd_Smed_v4_4547_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010695coiled-coil domain containing 170 dd_Smed_v4_7066_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006840Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_9387_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013227dynein axonemal intermediate chain 3 dd_Smed_v4_9187_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010664EF-hand calcium binding domain 5 dd_Smed_v4_8209_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019368G/T mismatch-specific thymine DNA glycosylase dd_Smed_v4_9011_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006743coiled-coil domain containing 88A dd_Smed_v4_7457_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014077coiled-coil domain containing 150 dd_Smed_v4_7928_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030763protein kinase C and casein kinase substrate in neurons 1 dd_Smed_v4_7987_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030803[F-actin]-monooxygenase MICAL3 dd_Smed_v4_8586_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021154calmodulin like 5 dd_Smed_v4_603_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001510unc-79 homolog, NALCN channel complex subunit dd_Smed_v4_6600_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009863guanylate kinase 1 dd_Smed_v4_4875_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008591protein kinase C and casein kinase substrate in neurons 1 dd_Smed_v4_7987_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021830isoleucyl-trna synthetase dd_Smed_v4_8592_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014219cilia and flagella associated protein 99 dd_Smed_v4_8538_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012203NGFI-A binding protein 1 dd_Smed_v4_3973_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025648shaking B dd_Smed_v4_12178_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021014solute carrier family 38 member 11 dd_Smed_v4_16428_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30024152MARVEL domain-containing protein dd_Smed_v4_3096_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033551Hexokinase A; transcript_id=FBtr0071361 dd_Smed_v4_4327_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019682leukocyte receptor cluster member 8 dd_Smed_v4_2926_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016693Innexin 5 dd_Smed_v4_3985_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004112Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_4113_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30034016caldesmon 1 dd_Smed_v4_2279_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30034016caldesmon 1 dd_Smed_v4_4783_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30034635tubulin tyrosine ligase like 7 dd_Smed_v4_13600_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30034281Terminal uridylyltransferase 7 dd_Smed_v4_15530_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011576E3 ubiquitin-protein ligase HERC2 dd_Smed_v4_3885_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019497SH3 and cysteine-rich domain-containing protein dd_Smed_v4_11051_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30024587Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_129_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025231radial spoke head dd_Smed_v4_3854_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028487transmembrane protein 30A dd_Smed_v4_3395_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021105tubulin alpha 3d dd_Smed_v4_38_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015672capping actin protein, gelsolin like dd_Smed_v4_1215_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018275SH3 and cysteine-rich domain-containing protein dd_Smed_v4_11051_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021105tubulin alpha 3d dd_Smed_v4_38_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED300330730 dd_Smed_v4_4176_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023391ankyrin 1 dd_Smed_v4_3523_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026115Cyclic nucleotide-binding domain-containing protein dd_Smed_v4_12978_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014919kinesin family member 3A dd_Smed_v4_4343_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029026ATP binding cassette subfamily C member 1 dd_Smed_v4_3077_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031903Saposin B-type domain-containing protein dd_Smed_v4_2944_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012874adenylate cyclase 9 dd_Smed_v4_2998_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033894Neurotransmitter-gated ion-channel ligand-binding domain-containing protein dd_Smed_v4_19336_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035734tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon dd_Smed_v4_1702_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001465SRSF protein kinase 2 dd_Smed_v4_4202_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006820cilia and flagella associated protein 57 dd_Smed_v4_3323_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031715spectrin beta, non-erythrocytic 4 dd_Smed_v4_1684_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033309solute carrier family 35 member F3 dd_Smed_v4_13553_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021652Ras association dd_Smed_v4_3722_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001408Receptor-type tyrosine-protein phosphatase S dd_Smed_v4_16093_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018013hypothetical protein dd_Smed_v4_3629_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029491outer dense fiber of sperm tails 2 dd_Smed_v4_3609_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028761gamma-aminobutyric acid type A receptor subunit pi dd_Smed_v4_15331_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020631transient receptor potential channel dd_Smed_v4_7609_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017466EMAP like 4 dd_Smed_v4_958_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30034282FMRFamide-activated amiloride-sensitive sodium channel dd_Smed_v4_53284_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30034282FMRFamide-activated amiloride-sensitive sodium channel dd_Smed_v4_78494_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30026667adducin 1 dd_Smed_v4_1425_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006461Tubulin alpha chain dd_Smed_v4_6577_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017219natriuretic peptide receptor 2 dd_Smed_v4_7619_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010437HYDIN axonemal central pair apparatus protein dd_Smed_v4_7302_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022905Dihydropyrimidinase dd_Smed_v4_3519_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED300044405-hydroxytryptamine (serotonin) receptor 7; transcript_id=FBtr0085746 dd_Smed_v4_5341_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011216Excitatory amino acid transporter 2; transcript_id=FBtr0301316 dd_Smed_v4_7570_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016557aquaporin 2 dd_Smed_v4_6111_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003011nephrocystin 1 dd_Smed_v4_9990_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029802MKS transition zone complex subunit 1 dd_Smed_v4_14053_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30034629SCP domain-containing protein dd_Smed_v4_762_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004519Si ch211-284k5.2 dd_Smed_v4_2676_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006461Calponin-homology CH domain-containing protein dd_Smed_v4_6577_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30027162zinc finger protein 154 dd_Smed_v4_22685_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002933FMRFamide-activated amiloride-sensitive sodium channel dd_Smed_v4_53284_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30002933FMRFamide-activated amiloride-sensitive sodium channel dd_Smed_v4_78494_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED300196185-hydroxytryptamine (serotonin) receptor 7; transcript_id=FBtr0085746 dd_Smed_v4_5341_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033721Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_37545_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30022796Phosphatidylinositide phosphatase SAC2 dd_Smed_v4_6584_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014138LIM homeobox transcription factor 1 alpha dd_Smed_v4_8252_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30030286dynein light chain Tctex-type 2B dd_Smed_v4_7666_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021159Phosphatidylinositide phosphatase SAC2 dd_Smed_v4_6584_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30034066Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_13275_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018266phosphatidylinositol-binding clathrin assembly protein dd_Smed_v4_6650_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023059EF-hand calcium binding domain 6 dd_Smed_v4_7065_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032272NADPH-dependent fmn reductase dd_Smed_v4_1834_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031880family with sequence similarity 227 member A dd_Smed_v4_15102_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017476intraflagellar transport 57 dd_Smed_v4_7099_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035145syntaxin binding protein 1 dd_Smed_v4_10167_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018495IQ motif containing with AAA domain 1 dd_Smed_v4_9484_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018495IQ motif containing with AAA domain 1 dd_Smed_v4_9568_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003384zinc finger CCCH-type containing 13 dd_Smed_v4_6712_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED300070105-hydroxytryptamine (serotonin) receptor 7; transcript_id=FBtr0085746 dd_Smed_v4_5341_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031722retinoic acid induced 14 dd_Smed_v4_11187_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013549Calponin-homology CH domain-containing protein dd_Smed_v4_6577_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003374spectrin beta chain dd_Smed_v4_6202_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020297mediator complex subunit 1 dd_Smed_v4_6432_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019876Regulator of G-protein signaling 3 dd_Smed_v4_8463_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020525dynein axonemal intermediate chain 1 dd_Smed_v4_4753_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028328protocadherin gamma subfamily C, 3 dd_Smed_v4_14209_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001191Transcription factor sox-2 dd_Smed_v4_8104_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013549Tubulin alpha chain dd_Smed_v4_6577_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000639Calponin-homology CH domain-containing protein dd_Smed_v4_6577_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033489FMRFamide-activated amiloride-sensitive sodium channel dd_Smed_v4_53284_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30033489FMRFamide-activated amiloride-sensitive sodium channel dd_Smed_v4_78494_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30002009Regulator of G-protein signaling 5 dd_Smed_v4_8648_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014811calcium-activated potassium channel subunit dd_Smed_v4_8138_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028743Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_11778_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033332adducin 1 dd_Smed_v4_1425_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023176Acetylcholine receptor subunit alpha-L1 dd_Smed_v4_18201_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013286diacylglycerol lipase beta dd_Smed_v4_13306_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005148protocadherin 7 dd_Smed_v4_7807_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30034325protein tyrosine phosphatase receptor type N2 dd_Smed_v4_6990_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035495ankyrin repeat domain 42 dd_Smed_v4_10615_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023308SCP domain-containing protein dd_Smed_v4_762_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011268FMRFamide-activated amiloride-sensitive sodium channel dd_Smed_v4_53284_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30011268FMRFamide-activated amiloride-sensitive sodium channel dd_Smed_v4_78494_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30016284Forkhead box BK013030smed_ncbi_20240424PMID:33536473
Pascual-Carreras et al., 2021
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30009043Forkhead box protein J2 BK013015smed_ncbi_20240424PMID:33536473
Pascual-Carreras et al., 2021
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30033416Forkhead box BK013030smed_ncbi_20240424PMID:33536473
Pascual-Carreras et al., 2021
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30014407Forkhead box protein J1-A BK013017smed_ncbi_20240424PMID:33536473
Pascual-Carreras et al., 2021
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30031339Forkhead box BK013030smed_ncbi_20240424PMID:33536473
Pascual-Carreras et al., 2021
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30017572Silk gland factor 1 BK013028smed_ncbi_20240424PMID:33536473
Pascual-Carreras et al., 2021
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30012690Forkhead box protein J2 BK013015smed_ncbi_20240424PMID:33536473
Pascual-Carreras et al., 2021
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30014055Forkhead box protein J2 BK013015smed_ncbi_20240424PMID:33536473
Pascual-Carreras et al., 2021
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30031744forkhead box protein BK013035smed_ncbi_20240424PMID:33536473
Pascual-Carreras et al., 2021
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30035239Forkhead box BK013030smed_ncbi_20240424PMID:33536473
Pascual-Carreras et al., 2021
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30012265Forkhead box protein O4 BK013025smed_ncbi_20240424PMID:33536473
Pascual-Carreras et al., 2021
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30009316Forkhead box protein N3 BK013014smed_ncbi_20240424PMID:33536473
Pascual-Carreras et al., 2021
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30004053Forkhead box protein K1 BK013032smed_ncbi_20240424PMID:33536473
Pascual-Carreras et al., 2021
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30035307Forkhead box C1-B BK013019smed_ncbi_20240424PMID:33536473
Pascual-Carreras et al., 2021
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30010118Forkhead box protein N3 BK013016smed_ncbi_20240424PMID:33536473
Pascual-Carreras et al., 2021
whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30001553GLIPR1 like 1 dd_210dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30001553GLIPR1 like 1 dd_5744dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30002754Protein tincar dd_Smed_v4_11374_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002634GLIPR1 like 1 dd_210dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30002634GLIPR1 like 1 dd_5744dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30034853zinc finger protein 660 dd_Smed_v4_10676_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023344diacylglycerol lipase beta dd_Smed_v4_13306_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30024549copine 8 dd_Smed_v4_13873_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001473lipoxygenase homology domains 1 dd_Smed_v4_10460_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000014solute carrier family 20 member 2 dd_Smed_v4_1270_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031686capping actin protein, gelsolin like dd_31589dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30004484ribosomal protein L8 dd_Smed_v4_108_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30008752Homeobox protein aristaless dd_Smed_v4_11150_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016952frizzled class receptor 5 dd_Smed_v4_11823_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001229polycystic kidney disease protein 1-like 2 dd_Smed_v4_13975_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30001229polycystic kidney disease protein 1-like 2 dd_Smed_v4_13975_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004732polycystic kidney disease protein 1-like 2 dd_Smed_v4_13975_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30004732polycystic kidney disease protein 1-like 2 dd_Smed_v4_13975_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30027945major facilitator superfamily domain containing 6 dd_Smed_v4_10640_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008033ATPase plasma membrane Ca2 transporting 1 dd_Smed_v4_12866_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004124tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein gamma dd_Smed_v4_138_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002117Cell adhesion molecule-related/down-regulated by oncogenes dd_Smed_v4_13882_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012000tyrosine hydroxylase dd_Smed_v4_16581_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012000tyrosine hydroxylase dd_Smed_v4_16581_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30027770high mobility group box 2 dd_Smed_v4_1646_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001679ATPase plasma membrane Ca2 transporting 3 dd_Smed_v4_1721_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021098Major facilitator superfamily MFS profile domain-containing protein dd_Smed_v4_3190_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001870nuclear receptor coactivator 6 dd_Smed_v4_1312_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001870nuclear receptor coactivator 6 dd_Smed_v4_4311_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000256golgin A2 dd_Smed_v4_2558_0_2dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009279dystonin dd_Smed_v4_1205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009048dystonin dd_Smed_v4_1205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003418G protein subunit beta 4 dd_Smed_v4_1184_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001515annexin A11 dd_Smed_v4_1104_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001584synaptotagmin VIIb dd_Smed_v4_12647_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014144phytanoyl-CoA dioxygenase dd_Smed_v4_1207_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023622G-patch domain-containing protein dd_Smed_v4_1665_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025148nuclear receptor coactivator 6 dd_Smed_v4_1312_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025148nuclear receptor coactivator 6 dd_Smed_v4_4311_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30024935Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_16808_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30024935Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_43824_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013293major vault protein dd_Smed_v4_1098_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015370G protein subunit alpha o1 dd_Smed_v4_1656_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008756dynein axonemal heavy chain 6 dd_Smed_v4_14707_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008756dynein axonemal heavy chain 6 dd_Smed_v4_6538_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30027378ribosomal protein L3 dd_Smed_v4_127_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30023661Uncharacterized protein dd_Smed_v4_11697_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010086Homeobox protein ceh-31 dd_Smed_v4_16007_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028059zinc finger protein 770 dd_Smed_v4_10911_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30024788polycystic kidney disease protein 1-like 2 dd_Smed_v4_13975_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30024788polycystic kidney disease protein 1-like 2 dd_Smed_v4_13975_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035291EGF like, fibronectin type III and laminin G domains dd_Smed_v4_10946_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020654polycystic kidney disease protein 1-like 2 dd_Smed_v4_13975_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30020654polycystic kidney disease protein 1-like 2 dd_Smed_v4_13975_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015614vinculin dd_3542dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30018487nuclear receptor coactivator 6 dd_Smed_v4_1312_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018487nuclear receptor coactivator 6 dd_Smed_v4_4311_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025672radial spoke head 3 dd_Smed_v4_2287_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028343Peptidase M14 carboxypeptidase A domain-containing protein dd_Smed_v4_13454_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025563nuclear receptor coactivator 6 dd_Smed_v4_1312_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025563nuclear receptor coactivator 6 dd_Smed_v4_4311_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017079leucine rich repeat and coiled-coil centrosomal protein 1 dd_Smed_v4_10086_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016618Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_10823_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023704G-patch domain-containing protein dd_Smed_v4_1665_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025144rolling stone; transcript_id=FBtr0079782 dd_Smed_v4_10421_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016654intraflagellar transport 140 dd_Smed_v4_11300_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016870integrin subunit alpha 9 dd_Smed_v4_11948_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019393Cadherin domain-containing protein dd_Smed_v4_16629_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001421black match; transcript_id=FBtr0479874 dd_Smed_v4_18559_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016383coiled-coil domain containing 112 dd_Smed_v4_12448_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028832 dd_Smed_v4_10089_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026176 dd_3069dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30004383 dd_1955dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30004383 dd_Smed_v4_1955_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30010523 dd_Smed_v4_1760_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035013 dd_Smed_v4_1760_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30027455 dd_Smed_v4_17076_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006883 dd_Smed_v4_17076_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019914 dd_Smed_v4_7374_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016045 dd_Smed_v4_1185_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000448 dd_Smed_v4_1185_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020678 dd_Smed_v4_1237_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30034920 dd_Smed_v4_1237_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019683 dd_Smed_v4_10687_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002221 dd_3733dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30006489 dd_3733dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30025697 dd_21981dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30025099 dd_3524dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30001489 dd_5694dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30019495 dd_5694dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30032738 dd_29115dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30026072 dd_4180dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30016871 dd_1747dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30025960 dd_27863dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30016004 dd_1083dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30016004 dd_Smed_v4_1083_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002995 dd_2103dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30013744 dd_Smed_v4_5675_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028898 dd_Smed_v4_1399_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005911 dd_Smed_v4_12_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30031035 dd_Smed_v4_13889_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001010 dd_Smed_v4_13470_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010421 dd_Smed_v4_11739_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018152 dd_Smed_v4_12014_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028697 dd_Smed_v4_11239_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023872 dd_Smed_v4_11239_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001681 dd_Smed_v4_1193_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017875 dd_Smed_v4_2446_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012459 dd_Smed_v4_2446_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025786 dd_16708dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30007857 dd_28465dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30030310 dd_Smed_v4_1531_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30024436 dd_8060dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30010111 dd_Smed_v4_1015_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30010111 dd_Smed_v4_1015_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30017278 dd_Smed_v4_10042_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000802 dd_2223dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30014534 dd_Smed_v4_14062_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017296 dd_Smed_v4_14062_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004318 dd_Smed_v4_13778_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020051 dd_3063dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30003546 dd_Smed_v4_11255_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30027234 dd_Smed_v4_25147_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026493 dd_Smed_v4_14095_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30000682 dd_Smed_v4_1303_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008167 dd_4545dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30017925 dd_Smed_v4_1166_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035448 dd_Smed_v4_11799_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021707 dd_Smed_v4_11231_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30034623 dd_Smed_v4_258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30001799 dd_Smed_v4_258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30033740 dd_Smed_v4_258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30012212 dd_Smed_v4_258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30031308 dd_Smed_v4_258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30000342 dd_Smed_v4_2558_0_2dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013899 dd_Smed_v4_19073_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002649 dd_Smed_v4_15038_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011421 dd_Smed_v4_2008_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006964 dd_Smed_v4_1851_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30022949 dd_Smed_v4_1851_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30029097 dd_Smed_v4_2575_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30036025 dd_Smed_v4_3658_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013315 dd_Smed_v4_3843_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012553 dd_Smed_v4_15528_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023386 dd_Smed_v4_3576_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013257 dd_Smed_v4_2694_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015821 dd_Smed_v4_1483_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30006295 dd_Smed_v4_3744_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021485 dd_Smed_v4_1328_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005448 dd_Smed_v4_21965_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008587 dd_Smed_v4_21965_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010360 dd_Smed_v4_2769_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033873 dd_Smed_v4_248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001095 dd_Smed_v4_248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031952 dd_Smed_v4_248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031429 dd_Smed_v4_1973_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001479 dd_Smed_v4_2802_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001479 dd_Smed_v4_6716_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033008 dd_8120dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30005459 dd_Smed_v4_2661_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019538 dd_3823dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30020913 dd_Smed_v4_13484_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025473 dd_Smed_v4_4048_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001875 dd_Smed_v4_1126_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006492 dd_Smed_v4_4021_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015018 dd_Smed_v4_4158_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000919 dd_Smed_v4_11307_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002166 dd_Smed_v4_11656_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025174 dd_Smed_v4_1908_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004749 dd_Smed_v4_11984_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009090Ligand dependent nuclear receptor corepressor like Contig45195uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003589exocyst complex component 7 Contig41970newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003589exocyst complex component 7 Contig41970uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002355microtubule associated protein RP/EB family member 1 Contig19711newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002355microtubule associated protein RP/EB family member 1 Contig19711uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000357transcription factor 7 like 2 Contig40500newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000357transcription factor 7 like 2 Contig40500uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015235Protein lin-10 Contig30620uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015235Protein lin-10 Contig30620newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000765dynactin subunit 4 Contig41672uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000765dynactin subunit 4 Contig41672newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021731ATP binding cassette subfamily B member 4 Contig44917uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021731ATP binding cassette subfamily B member 4 Contig44917newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000072Uncharacterized protein Contig44727uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000072Uncharacterized protein Contig44727newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30024574Nipped-B; transcript_id=FBtr0111119 Contig24429newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017498dopamine beta-hydroxylase Contig51395newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017498dopamine beta-hydroxylase Contig51395uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011228AMMECR1 like Contig55355newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008579ST13 Hsp70 interacting protein Contig54963newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008579ST13 Hsp70 interacting protein Contig54963uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029637WD repeat and FYVE domain containing 2 Contig54805newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029637WD repeat and FYVE domain containing 2 Contig54805uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026247Histone RNA hairpin-binding protein Contig55557newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026247Histone RNA hairpin-binding protein Contig55557uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016325Protein male abnormal 3 Contig55528newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016325Protein male abnormal 3 Contig55528uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017162Suppressor of Stellate-like; transcript_id=FBtr0072351 Contig48515newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017162Suppressor of Stellate-like; transcript_id=FBtr0072351 Contig48515uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031920EF-hand domain-containing protein Contig33951newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031920EF-hand domain-containing protein Contig33951uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006881EF-hand calcium binding domain 1 Contig51427uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006881EF-hand calcium binding domain 1 Contig51427newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010287Dorsal root ganglia homeobox protein Contig41818uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010287Dorsal root ganglia homeobox protein Contig41818newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006087Suppression of tumorigenicity 18 protein Contig40592newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006087Suppression of tumorigenicity 18 protein Contig40592uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004964 Contig55055newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004964 Contig55055uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010523 Contig20343newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010523 Contig20343uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008060 Contig28354newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006249 Contig27489newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011554 Contig20759uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011554 Contig20759newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011554 Contig11424newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011554 Contig11424uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011554 Contig47630uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011554 Contig47630newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010020 Contig20759newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010020 Contig20759uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018753 Contig25228newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029793 Contig15257uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029793 Contig15257newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026828 Contig15257uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026828 Contig15257newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008702 Contig15257newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008702 Contig15257uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009278 Contig15257uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009278 Contig15257newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026318 Contig15257uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026318 Contig15257newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012523 Contig20460newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012523 Contig20460uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019914 Contig21285newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019914 Contig21285uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012666 Contig18900uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012666 Contig18900newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30027708 Contig29920uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30027708 Contig29920newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025406 Contig29920uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025406 Contig29920newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030071 Contig12427newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030071 Contig12427uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011549 Contig12427uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011549 Contig12427newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011549 Contig11828newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011549 Contig11828uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011549 Contig11413newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011549 Contig11413uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032829 Contig11424uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032829 Contig11424newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032366 Contig11424newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032366 Contig11424uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032366 Contig19011uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032366 Contig19011newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025072 Contig11424uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025072 Contig11424newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003855 Contig11424uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003855 Contig11424newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009376 Contig11424newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009376 Contig11424uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019333 Contig21299uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019333 Contig21299newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014856 Contig12801newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014856 Contig12801uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013983 Contig12801uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013983 Contig12801newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019081 Contig12801newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019081 Contig12801uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031833 Contig14600newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031833 Contig14600uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000908 Contig19011newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000908 Contig19011uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005982 Contig54684uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005982 Contig54684newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026134 Contig37189uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026134 Contig37189newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30027157 Contig39031newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30027157 Contig39031uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021117 Contig53275newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021117 Contig53275uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016525 Contig53305uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016525 Contig53305newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015762 Contig51263newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004979 Contig40435uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004979 Contig40435newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029329 Contig40435uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029329 Contig40435newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028300 Contig40705newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028300 Contig40705uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016823 Contig47745newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016823 Contig47745uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013744 Contig47745newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013744 Contig47745uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028133 Contig36213newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028133 Contig36213uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032574 Contig36213uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032574 Contig36213newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007506 Contig36213newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007506 Contig36213uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023331 Contig44917newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023331 Contig44917uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002931 Contig41672uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002931 Contig41672newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022945 Contig43167uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022945 Contig43167newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020992Homeobox protein unc-42 KX961610smed_ncbi_20240424PMID:27864883
Currie et al., 2016
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30005185hematopoietically expressed homeobox dd_Smed_v6_13898_0_1dd_Smed_v6PMID:27864883
Currie et al., 2016
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30001679ATPase plasma membrane Ca2 transporting 3 dd_Smed_v6_1721_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30009279dystonin dd_Smed_v6_655_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30010338proprotein convertase subtilisin/kexin type 2 dd_Smed_v6_1566_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30009048dystonin dd_Smed_v6_655_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30009741proprotein convertase subtilisin/kexin type 2 dd_Smed_v6_1566_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30010096proprotein convertase subtilisin/kexin type 2 dd_Smed_v6_1566_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30024935Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v6_16808_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30023993Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v6_16808_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30016491dystonin dd_Smed_v6_655_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30016564proprotein convertase subtilisin/kexin type 2 dd_Smed_v6_1566_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30008560Neuroendocrine protein 7B2 dd_Smed_v6_3862_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30019874calmodulin 2 dd_Smed_v6_255_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30019373golgin A4 dd_Smed_v6_12278_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30022907synaptotagmin 1 dd_Smed_v6_4222_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30032314high mobility group 20B dd_Smed_v6_2646_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30032314Peptidylglycine-alpha-hydroxylating monooxygenase; transcript_id=FBtr0072202 dd_Smed_v6_2646_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30021740Peptidylglycine-alpha-hydroxylating monooxygenase; transcript_id=FBtr0072202 dd_Smed_v6_2646_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30021740high mobility group 20B dd_Smed_v6_2646_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30020990Guanine nucleotide exchange protein smcr8a dd_Smed_v6_129_2dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30022039EvC ciliary complex subunit 2 dd_Smed_v6_11958_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30032823corin, serine peptidase dd_Smed_v6_129_2dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30022167EvC ciliary complex subunit 2 dd_Smed_v6_11958_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30014318KIAA0513 dd_Smed_v6_3628_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30025006golgin A4 dd_Smed_v6_12278_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30007053golgin A6 family like 4 dd_Smed_v6_1061_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30018974chromodomain helicase DNA binding protein 2 dd_Smed_v6_2597_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30006818chromodomain helicase DNA binding protein 2 dd_Smed_v6_2597_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30014507Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v6_16808_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30013023Formin-1 dd_Smed_v6_414_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30007990calmodulin 1 dd_Smed_v6_414_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30007990Formin-1 dd_Smed_v6_414_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30002742dystonin dd_Smed_v6_655_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30013125ATPase plasma membrane Ca2 transporting 3 dd_Smed_v6_1721_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30006193dystonin dd_Smed_v6_655_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30013023calmodulin 1 dd_Smed_v6_414_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30029683Inositol 1,4,5-trisphosphate receptor type 2 dd_Smed_v6_3814_1dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30008685Cylindromatosis dd_Smed_v6_1137_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30013288Cylindromatosis dd_Smed_v6_1137_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30032126androglobin dd_Smed_v6_10677_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30024284Cylindromatosis dd_Smed_v6_1137_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30007870Cylindromatosis dd_Smed_v6_1137_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30010364Cylindromatosis dd_Smed_v6_1137_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30007870Ubiquitin carboxyl-terminal hydrolase CYLD dd_Smed_v6_1137_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30030309golgin A6 family like 4 dd_Smed_v6_1061_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30016673Cylindromatosis dd_Smed_v6_1137_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30029683inositol 1,4,5-trisphosphate receptor dd_Smed_v6_3814_1dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30016673Ubiquitin carboxyl-terminal hydrolase CYLD dd_Smed_v6_1137_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30003093Cylindromatosis dd_Smed_v6_1137_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30016078Actin 5C dd_Smed_v6_285_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30016078Actin 5C dd_Smed_v6_246_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30000565dynein axonemal heavy chain 12 dd_Smed_v6_6941_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30007055dynein axonemal heavy chain 2 dd_Smed_v6_6941_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30025121tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon dd_Smed_v6_251_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30022151caveolin dd_Smed_v6_8555_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30007445RNA binding motif protein 5 dd_Smed_v6_2392_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30014194Protein stoned-B dd_Smed_v6_6859_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30004042AAA ATPase domain-containing protein dd_Smed_v6_9009_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30033924polycystin 2 like 2, transient receptor potential cation channel dd_Smed_v6_9977_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30020627Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v6_14226_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30035336LLGL scribble cell polarity complex component 1 dd_Smed_v6_2164_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30007055h1SMcT0022887.1 dd_Smed_v6_6941_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30022039EvC ciliary complex subunit 2 dd_Smed_v4_11958_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021086Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_13404_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016015cilia- and flagella-associated protein 157 dd_Smed_v4_11523_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007620ATPase plasma membrane Ca2 transporting 1 dd_Smed_v4_12866_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023621Transmembrane protein 131 dd_Smed_v4_1196_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031345pyruvate dehydrogenase E1 subunit alpha 1 dd_Smed_v4_1310_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020834syntaxin binding protein 1 dd_Smed_v4_10167_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019915domain-containing protein dd_Smed_v4_15133_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006402progesterone immunomodulatory binding factor 1 dd_Smed_v4_13444_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30034013DAZ-associated protein 2 dd_Smed_v4_2852_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028884Protocadherin-9 dd_Smed_v4_12697_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30028228Centrosomal protein of 164 kDa dd_Smed_v4_12228_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032823corin, serine peptidase dd_Smed_v4_129_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022167EvC ciliary complex subunit 2 dd_Smed_v4_11958_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017290mitofusin 2 dd_Smed_v4_16499_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015061GRIN2-like protein dd_Smed_v4_10294_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004840coiled-coil domain containing 30 dd_Smed_v4_3591_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022748DNA-binding protein D-ETS-3 dd_Smed_v4_11113_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014615NIMA related kinase 5 dd_Smed_v4_4304_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008253h1SMcT0017852.3 dd_Smed_v4_3587_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017333centrosomal protein 83 dd_Smed_v4_12969_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30021219dehydrogenase/reductase X-linked dd_Smed_v4_10881_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014318KIAA0513 dd_Smed_v4_3628_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014615spermatogenesis associated 6 dd_Smed_v4_4304_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022233NIMA related kinase 5 dd_Smed_v4_4304_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022233spermatogenesis associated 6 dd_Smed_v4_4304_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025135Protein unc-13 homolog B dd_Smed_v4_11981_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025006golgin A4 dd_Smed_v4_12278_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023253coiled-coil domain containing 18 dd_Smed_v4_4251_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023253coiled-coil domain containing 18 dd_Smed_v4_5097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023091MORN repeat containing 3 dd_Smed_v4_3784_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013176Probable serine/threonine-protein kinase pats1 dd_Smed_v4_12105_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014799Transcriptional regulator ERG homolog (Fragment) dd_Smed_v4_14611_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007053golgin A6 family like 4 dd_Smed_v4_1061_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018974chromodomain helicase DNA binding protein 2 dd_Smed_v4_2597_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010781K Homology domain-containing protein dd_Smed_v4_13063_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012238G-patch domain-containing protein dd_Smed_v4_1665_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026337Uncharacterized protein dd_Smed_v4_2072_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006199acyl-CoA synthetase short chain family member 2 dd_Smed_v4_1817_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016218Homeobox protein cut-like 1 (Fragment) dd_Smed_v4_13843_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020257h1SMcT0006001.1 dd_Smed_v4_1040_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016901Homeobox protein prospero homolog 1 dd_Smed_v4_13772_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006818chromodomain helicase DNA binding protein 2 dd_Smed_v4_2597_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015584Muscle-specific protein 300 kDa dd_Smed_v4_17767_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015584Muscle-specific protein 300 kDa dd_Smed_v4_23535_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015584Muscle-specific protein 300 kDa dd_Smed_v4_16850_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015584Muscle-specific protein 300 kDa dd_Smed_v4_23532_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002520solute carrier family 6 member 3 dd_Smed_v4_17986_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006233RRAD and GEM like GTPase 1 dd_Smed_v4_11010_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019328armadillo repeat containing 2 dd_Smed_v4_12684_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013676Muscle-specific protein 300 kDa dd_Smed_v4_17767_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013676Muscle-specific protein 300 kDa dd_Smed_v4_23535_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013676Muscle-specific protein 300 kDa dd_Smed_v4_16850_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013676Muscle-specific protein 300 kDa dd_Smed_v4_23532_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010795GLIPR1 like 1 dd_210dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30010795GLIPR1 like 1 dd_5744dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30015622Rab-GAP TBC domain-containing protein dd_Smed_v4_12130_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014507Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_16808_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014507Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_43824_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005255Homeobox protein cut-like 1 (Fragment) dd_Smed_v4_13843_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013013Guanine nucleotide-binding protein dd_Smed_v4_3309_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020007dystrobrevin alpha dd_Smed_v4_12275_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006802G protein subunit beta 4 dd_Smed_v4_1184_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017160solute carrier family 6 member 4 dd_Smed_v4_12700_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30015622small G protein signaling modulator 2 dd_Smed_v4_12130_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005033vinculin dd_3542dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30005845NPHS1 adhesion molecule, nephrin dd_Smed_v4_10689_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007543Muscle-specific protein 300 kDa dd_Smed_v4_17767_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007543Muscle-specific protein 300 kDa dd_Smed_v4_23535_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007543Muscle-specific protein 300 kDa dd_Smed_v4_16850_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007543Muscle-specific protein 300 kDa dd_Smed_v4_23532_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009733brivido-1; transcript_id=FBtr0074982 dd_Smed_v4_12955_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012139Major facilitator superfamily MFS profile domain-containing protein dd_Smed_v4_3190_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013023Formin-1 dd_Smed_v4_15344_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013023Formin-1 dd_Smed_v4_414_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007990calmodulin 1 dd_Smed_v4_15344_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007990calmodulin 1 dd_Smed_v4_414_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017042ATPase H transporting V1 subunit E1 dd_Smed_v4_1494_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018233Calmodulin dd_Smed_v4_12048_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007990Formin-1 dd_Smed_v4_15344_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007990Formin-1 dd_Smed_v4_414_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007858neogenin 1 dd_Smed_v4_11409_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015266adhesion G-protein coupled receptor dd_Smed_v4_16446_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007179polycystin 2 like 2, transient receptor potential cation channel dd_Smed_v4_13327_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020234Kinase D interacting substrate of 220 kDa dd_Smed_v4_11743_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018630HMG box domain-containing protein dd_Smed_v4_1331_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006476Protein kinase domain-containing protein dd_Smed_v4_10144_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30018203oxysterol-binding protein dd_Smed_v4_12759_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007670dystrobrevin alpha dd_Smed_v4_12275_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020987muscarinic Acetylcholine Receptor, B-type dd_Smed_v4_13962_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016723Uncharacterized protein dd_Smed_v4_2072_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003269Reticulon-4 dd_Smed_v4_1796_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002742dystonin dd_Smed_v4_1205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006690h1SMcT0009114.1 dd_Smed_v4_10822_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013125ATPase plasma membrane Ca2 transporting 3 dd_Smed_v4_1721_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006684calsyntenin 1 dd_Smed_v4_3122_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006193dystonin dd_Smed_v4_1205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016779Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_12267_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013023calmodulin 1 dd_Smed_v4_15344_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013023calmodulin 1 dd_Smed_v4_414_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020317heat shock protein 90 alpha family class A member 1 Contig49305uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020317heat shock protein 90 alpha family class A member 1 Contig49305newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033709unc-80 homolog, NALCN channel complex subunit Contig44115uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033709unc-80 homolog, NALCN channel complex subunit Contig44115newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014011mRNA-capping enzyme Contig40664newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014011mRNA-capping enzyme Contig40664uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031090coenzyme Q4 Contig53275newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031090coenzyme Q4 Contig53275uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017913frizzled class receptor 8 Contig35779uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017913frizzled class receptor 8 Contig35779newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014799Transcriptional regulator ERG homolog (Fragment) Contig33356newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014799Transcriptional regulator ERG homolog (Fragment) Contig33356uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002619probable endonuclease 4 Contig38443newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002619probable endonuclease 4 Contig38443uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008787zero population growth; transcript_id=FBtr0076983 Contig38798uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008787zero population growth; transcript_id=FBtr0076983 Contig38798newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016154SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 Contig51602newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016154SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 Contig51602uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007698SID1 transmembrane family member 2 Contig34061newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007698SID1 transmembrane family member 2 Contig34061uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30024706cysteine rich with EGF like domains 2 Contig39900newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30024706cysteine rich with EGF like domains 2 Contig39900uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002712Dynein axonemal heavy chain 7 Contig16071newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002712Dynein axonemal heavy chain 7 Contig16071uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005638phosphatidylinositol-4-phosphate 5-kinase type 1 alpha Contig33941newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005638phosphatidylinositol-4-phosphate 5-kinase type 1 alpha Contig33941uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017664anosmin 1 Contig34686newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017664anosmin 1 Contig34686uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002619Epithelial splicing regulatory protein Contig38443newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002619Epithelial splicing regulatory protein Contig38443uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015940component of oligomeric golgi complex 6 Contig29858newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015940component of oligomeric golgi complex 6 Contig29858uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002712dynein axonemal heavy chain 3 Contig16071newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002712dynein axonemal heavy chain 3 Contig16071uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011218peroxiredoxin like 2C Contig31276uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011218peroxiredoxin like 2C Contig31276newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013228ryanodine receptor 3 Contig36224uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013228ryanodine receptor 3 Contig36224newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011934Transcription factor Sp9 Contig37509uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011934Transcription factor Sp9 Contig37509newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004414dopamine receptor D2 Contig30481uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30004414dopamine receptor D2 Contig30481newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005887U1 small nuclear ribonucleoprotein C Contig42120uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005887U1 small nuclear ribonucleoprotein C Contig42120newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030773atp-dependent rna helicase Contig26998newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030773atp-dependent rna helicase Contig26998uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030773atp-dependent rna helicase Contig23180uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030773atp-dependent rna helicase Contig23180newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031962Frizzled-8 Contig52925newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031962Frizzled-8 Contig52925uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035929SWI/SNF related, matrix associated, actin dependent regulator of chromatin subfamily c member 2 Contig17559newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035929SWI/SNF related, matrix associated, actin dependent regulator of chromatin subfamily c member 2 Contig17559uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006125Zinc finger protein 142 Contig29330newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006125Zinc finger protein 142 Contig29330uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032370beta 3-glucosyltransferase Contig40970newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032370beta 3-glucosyltransferase Contig40970uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033276SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 Contig51602uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033276SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 Contig51602newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022089heterogeneous nuclear ribonucleoprotein K Contig15533newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022089heterogeneous nuclear ribonucleoprotein K Contig15533uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009064Protein glass Contig10162newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009064Protein glass Contig10162uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028543Neurotransmitter-gated ion-channel ligand-binding domain-containing protein Contig16482newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30028543Neurotransmitter-gated ion-channel ligand-binding domain-containing protein Contig16482uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003769EF-hand domain-containing protein Contig33951uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003769EF-hand domain-containing protein Contig33951newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007308Zinc finger protein 331 Contig48085newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007308Zinc finger protein 331 Contig48085uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025407ectonucleoside triphosphate diphosphohydrolase 4 Contig20343uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025407ectonucleoside triphosphate diphosphohydrolase 4 Contig20343newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30027794cullin 3 Contig18900newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30027794cullin 3 Contig18900uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030477FKBP prolyl isomerase 4 Contig49356newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030477FKBP prolyl isomerase 4 Contig49356uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005462Glucosaminyl N-acetyl transferase 3 mucin type Contig42881newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005462Glucosaminyl N-acetyl transferase 3 mucin type Contig42881uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30027052noggin Contig49725newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30027052noggin Contig49725uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011842Glucosaminyl N-acetyl transferase 3 mucin type Contig42881uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011842Glucosaminyl N-acetyl transferase 3 mucin type Contig42881newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017896activator of HSP90 ATPase activity 1 Contig31172newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017896activator of HSP90 ATPase activity 1 Contig31172uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30024329Nipped-B; transcript_id=FBtr0111119 Contig24429newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012192Ser/thr protein phosphatase family protein Contig53801uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012192Ser/thr protein phosphatase family protein Contig53801newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003880Amino acid transporter Contig53337newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003880Amino acid transporter Contig53337uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013807decarboxylase Contig51335uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013807decarboxylase Contig51335newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006021WD repeat domain 24 Contig48022newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006021WD repeat domain 24 Contig48022uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023483Innexin 5 Contig50609newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023483Innexin 5 Contig50609uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012985ubiquitin carboxyl-terminal hydrolase MINDY Contig38731uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012985ubiquitin carboxyl-terminal hydrolase MINDY Contig38731newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003783transcription factor Contig55186uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003783transcription factor Contig55186newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011678Uncharacterized protein Contig44727uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30011678Uncharacterized protein Contig44727newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009090Ligand dependent nuclear receptor corepressor like Contig45195newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017749Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v6_3093_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30016700h1SMcT0019556.1 dd_Smed_v6_3283_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30030455Tetraspanin dd_Smed_v6_3175_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30018274calbindin 1 dd_Smed_v6_1230_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30019682leukocyte receptor cluster member 8 dd_Smed_v6_2926_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30019497SH3 and cysteine-rich domain-containing protein dd_Smed_v6_11051_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30024587Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v6_129_2dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30021105tubulin alpha 3d dd_Smed_v6_38_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30018275SH3 and cysteine-rich domain-containing protein dd_Smed_v6_11051_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30021105tubulin alpha 3d dd_Smed_v6_38_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30031715spectrin beta, non-erythrocytic 4 dd_Smed_v6_1684_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30018013hypothetical protein dd_Smed_v6_3629_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30003011nephrocystin 1 dd_Smed_v6_9990_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30008052sodium channel and clathrin linker 1 dd_Smed_v6_1061_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30026601h1SMcT0022887.1 dd_Smed_v6_6941_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30003384zinc finger CCCH-type containing 13 dd_Smed_v6_6712_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30024478EvC ciliary complex subunit 2 dd_Smed_v6_11958_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30026601dynein axonemal heavy chain 2 dd_Smed_v6_6941_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30012827microtubule associated protein 7 dd_Smed_v6_5361_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30023882GRIP1 associated protein 1 dd_Smed_v6_6573_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30007972Dynamin-type G domain-containing protein dd_Smed_v6_884_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30005551spectrin alpha, non-erythrocytic 1 dd_Smed_v6_919_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30025990nephrocystin 1 dd_Smed_v6_9990_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30001680MX dynamin like GTPase 2 dd_Smed_v6_884_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30030724Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v6_507_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30001478MX dynamin like GTPase 2 dd_Smed_v6_884_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30024428h1SMcT0003255.1 dd_Smed_v6_4669_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30014649Dynamin-type G domain-containing protein dd_Smed_v6_884_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30022529Dynamin-type G domain-containing protein dd_Smed_v6_884_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30011705MX dynamin like GTPase 1 dd_Smed_v6_884_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30005146Asteroid domain-containing protein dd_Smed_v6_1671_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30019471synaptotagmin 2 dd_Smed_v6_6730_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30008655tubulin alpha chain dd_Smed_v6_508_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30000763Expressed conserved protein dd_Smed_v6_1671_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30019471synaptotagmin 2 dd_Smed_v6_6730_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30005979Dynamin-type G domain-containing protein dd_Smed_v6_884_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30009430aldolase, fructose-bisphosphate A dd_Smed_v6_591_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30028719Asteroid domain-containing protein dd_Smed_v6_1671_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30001446RNA binding motif protein 25 dd_Smed_v6_3955_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30003684Cylindromatosis dd_Smed_v6_1137_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30009033Cylindromatosis dd_Smed_v6_1137_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30008508Xin actin-binding repeat-containing protein 2 dd_Smed_v6_921_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30009033Ubiquitin carboxyl-terminal hydrolase CYLD dd_Smed_v6_1137_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30007702Cylindromatosis dd_Smed_v6_1137_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30027929tubulin beta 4B class IVb dd_Smed_v6_83_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30002133ubiquitin B dd_Smed_v6_34_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30016265tubulin beta 4B class IVb dd_Smed_v6_83_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30011381HORMA domain containing 2 dd_Smed_v6_2201_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30035848tubulin beta 4B class IVb dd_Smed_v6_83_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30000428hematopoietic prostaglandin D synthase dd_Smed_v6_816_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30031525choline O-acetyltransferase dd_Smed_v6_11968_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30007788transcription elongation regulator 1 dd_Smed_v6_1147_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30004118tubulin beta 4B class IVb dd_Smed_v6_83_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30011296tubulin beta 4B class IVb dd_Smed_v6_83_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30019934DUF4887 domain-containing protein dd_Smed_v6_815_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30034319Asteroid domain-containing protein dd_Smed_v6_1671_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30008609AHNAK nucleoprotein 2 dd_Smed_v6_474_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30031693lin-37 DREAM MuvB core complex component dd_Smed_v6_2253_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30024041HDGF like 2 dd_Smed_v6_2842_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30000771AHNAK nucleoprotein 2 dd_Smed_v6_474_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30035733Ubiquitin carboxyl-terminal hydrolase CYLD dd_Smed_v6_1137_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30026877HORMA domain containing 2 dd_Smed_v6_2201_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30035733Cylindromatosis dd_Smed_v6_1137_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30009591HDGF like 2 dd_Smed_v6_2842_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30022612DUF1907 domain-containing protein dd_Smed_v6_1733_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30001359AHNAK nucleoprotein 2 dd_Smed_v6_474_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30030702HDGF like 2 dd_Smed_v6_2842_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30010523 dd_Smed_v6_1760_1dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30035013 dd_Smed_v6_1760_1dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30020678 dd_Smed_v6_1237_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30034920 dd_Smed_v6_1237_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30013744 dd_Smed_v6_5675_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30025174 dd_Smed_v6_1908_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30012726 dd_Smed_v6_129_2dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30016287 dd_Smed_v6_129_2dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30020701 dd_Smed_v6_129_2dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30035359 dd_Smed_v6_129_2dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30034827 dd_Smed_v6_129_2dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30012522 dd_Smed_v6_5031_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30012522 dd_Smed_v6_10835_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30022777 dd_Smed_v6_5031_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30022777 dd_Smed_v6_10835_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30033809 dd_Smed_v6_5031_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30033809 dd_Smed_v6_10835_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30015685 dd_Smed_v6_9735_1dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30026678 dd_Smed_v6_3577_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30012826 dd_Smed_v6_309_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30033646 dd_Smed_v6_2191_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30027886 dd_Smed_v6_2708_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30004574 dd_Smed_v6_1440_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30001395 dd_Smed_v6_2985_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30022870 dd_Smed_v6_16102_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30035526 dd_Smed_v6_716_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30011747 dd_Smed_v6_494_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30003787 dd_Smed_v6_9735_1dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30002897 dd_Smed_v6_9735_1dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30017525 dd_Smed_v6_9735_1dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30014462 dd_Smed_v6_9735_1dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30003525 dd_Smed_v6_9735_1dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30006003 dd_Smed_v6_9735_1dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30017883 dd_Smed_v4_1407_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30027086 dd_10213dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30012726 dd_Smed_v4_129_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016287 dd_Smed_v4_129_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020701 dd_Smed_v4_129_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035359 dd_Smed_v4_129_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30034827 dd_Smed_v4_129_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001622 dd_Smed_v4_10356_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032285 dd_Smed_v4_10407_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30024729 dd_Smed_v4_10407_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012522 dd_Smed_v4_10835_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012522 dd_Smed_v4_5031_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022777 dd_Smed_v4_10835_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022777 dd_Smed_v4_5031_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033809 dd_Smed_v4_10835_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033809 dd_Smed_v4_5031_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30030985 dd_Smed_v4_10573_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30008236 dd_28015dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30013280 dd_Smed_v4_1520_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30004894 dd_17258dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30023380 dd_11040dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30031309 dd_Smed_v4_10635_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30013225 dd_Smed_v4_17045_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033618 dd_3011dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30016068 dd_15610dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30035875 dd_15610dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30035314 dd_Smed_v4_11620_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006383 dd_15602dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30019754 dd_Smed_v4_3422_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015685 dd_Smed_v4_14915_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014539 dd_Smed_v4_2902_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30034983 dd_2805dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30015765 dd_Smed_v4_36253_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014476 dd_2723dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30010847 dd_Smed_v4_10187_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033071 dd_Smed_v4_34084_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30026678 dd_Smed_v4_3577_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30012826 dd_Smed_v4_309_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035983 dd_Smed_v4_34828_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30007276 dd_Smed_v4_10073_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032615 dd_77162dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30009462 dd_Smed_v4_4051_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30007539 dd_Smed_v4_2300_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30033646 dd_Smed_v4_2191_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30003831 dd_Smed_v4_3895_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30029070 dd_Smed_v4_4054_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30032448 dd_Smed_v4_3795_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020986 dd_1936dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30035091 dd_586dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30026942 dd_Smed_v4_2487_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30027886 dd_Smed_v4_2708_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30002182 dd_Smed_v4_16946_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30035908 dd_Smed_v4_3220_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001357 dd_Smed_v4_25168_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025621 dd_Smed_v4_3306_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30004574 dd_Smed_v4_1440_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30001395 dd_Smed_v4_2985_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30031139 dd_Smed_v4_19560_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30025153 dd_Smed_v4_13914_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30022870 dd_Smed_v4_16102_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30016977 dd_Smed_v4_7409_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005654 dd_Smed_v4_6921_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017099 dd_Smed_v4_595_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30035526 dd_Smed_v4_716_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015734 dd_Smed_v4_6953_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30011747 dd_Smed_v4_494_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30014149 dd_Smed_v4_5920_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015947 dd_Smed_v4_788_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30005424 dd_Smed_v4_6425_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005609 dd_Smed_v4_9354_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017499 dd_Smed_v4_459_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006990 dd_Smed_v4_9735_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30006884 dd_Smed_v4_9103_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30017089 dd_Smed_v4_5675_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015808 dd_Smed_v4_5675_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30007547 dd_Smed_v4_4295_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000065 dd_Smed_v4_397_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30023111 dd_Smed_v4_4845_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30015867 dd_Smed_v4_5001_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30020002 dd_Smed_v4_7370_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30019678 dd_Smed_v4_541_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
neuronSMED30032304 dd_Smed_v4_8879_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30010852 dd_Smed_v4_6535_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30000524 dd_Smed_v4_9063_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005554 dd_Smed_v4_507_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30005554 dd_Smed_v4_507_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult