ventral nerve cord

The Planarian Anatomoy Ontology (PLANA) is a collection of terms curated from the literature and other organism anatomy ontologies to describe anatomical features, life cycle stages and developmental processes in the regenerative flatworm Schmidtea mediterranea. The latest version of the PLANA Ontology is available through the Open Biological and Biomedical Ontology Foundry (OBO) . PLANA Ontology terms are searchable at the EMBL-EBI Ontology Lookup Service (OLS) and the PLANA Ontology Terms Page.

Below, the Overview Section is populated with infomration from the OLS.

Additional experimental information related to PLANA Ontology terms can be found in the Additional Term Information Section.



    ▻ Planarian Anatomy Ontology Term Overview

    ▻ Additional Term Information

      ▻ In Situ Hybridization Data

      ▻ Sequences




    Planarian Anatomy Ontology Term Overview


    NAME:

      ventral nerve cord


    DEFINITON:

      The pair of closely united ventral longitudinal nerves with their segmental ganglia that is characteristic of many elongate invertebrates (as earthworms)[BTO]. A large process bundle that runs along the vental mid-line extending from the ventral region of the nerve ring[WB]. The ventral cord is one of the distinguishing traits of the central nervous system of all arthropods (such as insects, crustaceans and arachnids) as well as many other invertebrates, such as the annelid worms[GO].


    TERM CITATIONS:

      

    TERM ID:

      PLANA:0000097


    SYNONYMS:

      ventral cord


    ABOUT THIS TERM:

      ventral nerve cord "is a" organ

      ventral nerve cord "contained in" tail, posterior compartment, copulatory region, ventral compartment, parapharyngeal region, anterior compartment, neck and head

      ventral nerve cord "existence overlaps" juvenile, asexual adult, sexually mature adult, Stage 8 and Stage 7

      ventral nerve cord "part of" central nervous system


      transverse commissure, ganglion and commissural neuron "is a" ventral nerve cord


    BROWSE ONTOLOGY TREE (IN OLS):

    Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.


    Planarian Anatomy Ontology


    EXPLORE ONTOLOGY GRAPH:


    Dynamically explore this term by selecting additional relationships to display ( checkboxes on the right ) and by expanding nodes by double clicking on a node. Single click on a node to display the definition below.

     

    back to top


    Additional Term Information


    All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


    IN SITU HYBRIDIZATION DATA:


    Smed IDAccessionNameAliasEnriched during stage(s)Tissue/PatternImages
    SMED30022907Synaptotagmin-1Dj-sytStage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, ventral nerve cord, neuron, cephalic ganglia, nervous system, temporary embryonic pharynx
    Click to see image symbols and abbreviations
    Abbreviation or symbolDefinition
    Ooral hemisphere
    Aaboral hemisphere
    Ddorsal
    Vventral
    Llateral
    black arrowheadembryonic pharynx
    red arrowheaddefinitive pharynx
    black arrowsprimitive gut
    yellow arrowsprimitive ectoderm cells
    cyan arrowsbrain
    cyan arrowheadsnerve cords
    blue arrowheadseye progenitors (trail cells)
    purple arrowheadseyes
    scale bar100 µm

     

    back to top


    SEQUENCES:

    smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

    >SMED30022586 ID=SMED30022586|Name=Synaptotagmin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1214bp
    TCACCATCTTGTCTTTGATGGGATAGTTTGACTAATTTTTGGTTTTGATTGGTTCTCTTAATTGGGAATGCAAATTTTAC
    GGTGCTTGCACTTATGACATGGCATTATTTGCAGAATGAGTTTTCAGAGGCTGTGTGGAGATATTATAATAAAACTTTTG
    GAAACTTGTTGTTTTTGTTTTCATTCAGAAACTGAAGAAAAAGGGAAACTATACATCCACGATAGAACATCTCCAATGAT
    TTTAAACCAAAAACCTTCAATTATGAATCAGGAAATAGAGATAAAAAATATTTCATTGAATCTGCAGACGGAAAATACAT
    TAAATCCAAGAAAACAATCTCTTGGAGGCAATTTTCTTGTTCCAAATGCAGGGTTAAATGAAAAACTTCCTTCAGTAATT
    AAAGTAAAACGACATTCGGAATCGGATTTGGGGGACATGAATTACAATTTTCCTGTTGAAATTAACCATAACCACATTTT
    GAACGTTTTGTCTATTAAAGTTTTTCCAAACGAAAAAATTCCTGATAAATTTGATATTTCTGTGAAAACTAATGACAAAA
    TCACCAAGAAAATAAGCTACTTTTACAAAGTTATTACATTTGACAATATAAGTGAAGATGATTTAAATACATCTTTCCTG
    AGCTTGACATTTTATAAGAGAAAAACGCCAGATGATAAAAAAAGTTTCGGAGAAATAAAATTTCCTCTAAAGTTAATATT
    GAAGAAAAAAATTCAAAATTCAATTAGATTTTACAATACAGATTTCAATTTATTTCAAAACAATGTGAAATTATCCAACG
    GAACGCTTGAAATCGGTTTACGTTTTGATCATAAAAACACTCAATTAACGGTAAATGTTTACGAAGGACAGAATTTTTCA
    AACCAAAATCAAACCCCTTTAAATACTTTCTGTGTCGTTGAATTATTTAAAACACATACCCTCTATATGACCTACAAAAC
    CAGTGTCAAATTCAATTCGAATTGTCCGATTTGGAATGAAACTTTCATCTTTCCAATTAAGCTTGCCGAATTGGCTAATC
    ATATCAAACTGATTATAACAGTCTACAATGAAAATGAAACGGCAAATCTACCAATTGGAAAATTGTTTTTCCCGTCTTCT
    GAAATGGCATTGGAAACTCGTCATTGGAATGAAATTCATACAAATTCCAACCTACAAATCAGAATGTTGCATAGCTTAAA
    ATGACATTTAAATA
    >SMED30028676 ID=SMED30028676|Name=Synaptotagmin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1385bp
    AAATCAGAAAAATCAAAAAGAAATTTCACAGAATTACGGAACTTATGAAACAGTGAGCAAAGCGCCGCTGGAAATCACAA
    TTACAAAAGCAGAGGATAACGAAGGGGTTTCAAATAAAAAAATAATCCTTCAAGATGACCGTCGATGTACTATGCCATGC
    ATTTTACCATCGAGCAACAATTCTTCAGATGGATACTCGGAAAGCAATCTAAGTGTAAATGAAAGTTCTGTATTCTCTCT
    TAATTCCAATAATCTTTTGCTTTCCGGTCTGATTTCTCCTGCTCGACGATACAGCGACAATTCAAATACGCAAAATTTCG
    TTGAGTTACGAAAGAAAAGTGTCCGACCCGATAGATCAAAACGAACTTTCTTCATATGAGATACTGAATTTATACGGACA
    AGGTAAACTATGTTTTTCAATAGTTTACAATGAACATATTTCTCGACTCTACGTGACAATAAACAAAGCAGTTTATTTAA
    ACAGTTCCAAAACTAACAATCTGGCCGGATTCTATGTGAAAGTGTATTTATTAAATACAGAAAATGATATGAAATTGCAA
    ATGCATAAATCGGAAATTGTAACTGCAAATAAAAATCCAATGTTCGAGCAAACATTTTCGTTTCTTTTAACAAAATCCTC
    TTTAGTCAGCATAAAATTACAGTTCAAAGTCAAACAAGCACATATAAAAGTAAAAAAAAATGAATATCTCGGAGGATTCA
    TGTTTCATCTTGATAATAATGAAATAATTAACAACCCGGAACTCTTTCAAGAATTATGGCGAGATCTGCGGGGCGACTTG
    AGGAAAGACACCAGACGTGGAGAAATCCTCATTTCCCTGATGTACAGCGAACACCAATCTTCAGCTTTTCTATCAGTTAA
    TCTGCATCGAGCTAAAAATCTACAAATTCGACAACATGACAATTCTGTTTTTGCCAGATGTACAATGTTGGTTGGAAACA
    AACCGATCAAAACAAAGCGATCAATTACAGTAAAACAAGACATCTCTGCGCCCTATGTTGATCTTGAAAGTGTTTTCAAT
    GTCGACAAATTGAACATCATGGAAGTCGGCGTTGTTATTCATATATGTAGCCGCAGCAAAATAGGTTTCAGTCACCTGCT
    GGGCAAGCTGATCCTGGGATCTGTGATGTATACGGACGATAAGTCAGTCCTAATACACTGGAAGGACATGATCAGTTATC
    AGAACAGAACCGTCACTAAGTGGCATACGATTATGTGAACATAAAATAACTTTAGACAATTTGTTGGCATGGATGAATGT
    TTACAAATCTCATGAAATTAGCCGTTCATAAAAATGTGTTCACAGACTAATGGTAATTTTTAGGCATAATTCGACCATTC
    ATTTAAAATTTCGATTAAATCATAG
    >SMED30028321 ID=SMED30028321|Name=Synaptotagmin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1303bp
    TTTAATTGTGAGTGTATAATTAATTCATTAATAAATGTGCAAAATATGTTCAGACAAGTATAAAGATATATTCATTATTA
    ACCATTCAACCATAACAATAGATTCTGTAAGGCCTCTAAATTCTCTGATTGTCATGTATAACAATGTAACAATTCGAAAT
    GTAAACCAAACATCAGTTCTTGGAACTTATTTCAATAACCTATTAAAGTTATGGAACATAAGTCCATTACAAGGAATGTT
    CATATCCGTCGGACTTTTGCTTGCTGTCGTTCTGACAGTGGCTATCATTATATATTGTGTTAGAAAATCAGTCGAGGGTG
    AAGATACCAAAAGGAGTCGACTTTCAAATCTTAAGAAACATCTTCCAGTGAACAGTTCGTCATCAGAGATTGATACTCCA
    CATGGGTATATTGAAGCATCAGTCAAGTATAAAAAAAAGCAGAAAGAGATTGAAATTCAAGACATTCAAATTTACAAATT
    AGAATTTAACTCAATGAAAAAGCCGGATTGTTATTTAGTAATGTTTGTAAGGCATGGGAAATCTCAGTTGTATCCTTCCC
    AAAGAACGAAAACTGCTTTGAATGATTTGTATCCAAATTTCAATGAACACTTTAAGTTTAAAATAAGAAATATGAACAAC
    AATATTCTCCAATTTGAACTTTACGACGAAAATCTATCGGGAAATGACATTCTCATTCGTCAGGGAGAAATGATGTTGAA
    AGATATCAGCGAAAAGAAATTCCAGGATTATTTTCAGAATTTTGTAATCCACTTGGACAAGCCTTCAGAATTAAAAGGTC
    TCGGTGATGTCGCTGTGATTCTGACTGGAAATCCACCAATTTTGAGAATAACAATTCTTGAAGCAAAAGGATTGGCACAA
    AAAGAAAATCTTAACTCCAATTCTTTGTACAGTTTTCACGCAGAAGTTAAAGTTTTCGTCAATAAACATTTAGTAAAACA
    TTTCAAAACGAAAAAAATTCGTCATATTTCCAATCCGTATTTCCAGGAAACATTTTCATTAAAAGTTTTGTCAAAAATGT
    GGGATAAAATTTTAATAAAAATTGAATTATTCCGATCGGGATTTCGTAGAATCGGAAAGGCTTATATCGGTTACAAAGAG
    TCCAATTCGAAAGTTAATTATTTGGGGAACTTGCATTGGGAGAATACTTGCAATGACCGTAAAATGTCGAAAGCGATTTG
    GCATACGTTGGTCAAATAGGTTGCATATTTCCCTTTGCGGTCTGATTCTTGATGACCCTCACTCTATTCTGACTATAATC
    AAAATCTTGTTCAATCTTATTAT
    >SMED30022362 ID=SMED30022362|Name=Synaptotagmin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1443bp
    CTCTTCCGATCTCAAACATTTCAGTCGCAAAGCAGGTCGCCACGAAATACATAAATCCGAACTCAACTGCTATTTGCATT
    AAGCATTTCAATGGCCTTCACGAACATACCAAGCACACACCGACCTTTTGCATAGCAAAATAATTTATTATCATTAAAAC
    AACCTTTGTGACTCTATTTTATCGATTTGAACGAAATTCACCACGATGGCACCATAAACAATCAGATCTCACAAATGTCT
    GCGACTCTAAGCACAATGTCAACACTGAAGTTCACAAGGCCAACAAATGTAACCTCAAACCTCTACAAAGACATAATCAA
    ATATCTTGATCTCCCGGAACCGTTGATTGTAGCAATCTTTGCCGCTGCTGGTTTGTTAATATTCGTTATTTTCATATTGT
    TTTGTTCGAGATGCTGCTGCAGAAAATGCTGCAAGCAAACTGCCGATAAAGACAAATACAAAAGACGGAAGCTAGAAACA
    AAAGAAATTGACAAAATTTTCAGAGACGAGTTGAATCTTGGATTTAATGAGAGTTTTGGAAAGATATATTTTGCGCTCAA
    ATATCTCCTCGTAAAAGAATTGTTAATTGTAAAGGTTATTAAGGTGGAAAACCTACCGACACCAATTGACGACTGTCTTG
    ATCCATACGTTGTCGTACAAGTGAAATCAAAAAGTTTGACTGAGGAAAAGAAAACCAAAATTAAATACAAACATATAGAT
    CCGGTATTCAATGAAAAGTTTACTTTCAAAATTCTCCATCCAGAACTTAATGATTCGGAAATTTTTTTTAAGGTTTTTGA
    CTATGATAAATTTGGAGCCGACTCATTGCTAGGTCAACTTGCACTAAATTTTAAAGACCTCAATCCCAGTAGCATCATAA
    ACATGTTGTCAGAGTTTTCCAAAGATTTAAAAGAAGGTGAAGATACATCGGAAGGCATGGGACAGGTATGCATAATTCTG
    AATTCAAATGGACAGGCAGGATTACTAGTCACTATACTAGAAGCTAAAAATCTTCGAGTTAAAGAAAACATGAGTTATTC
    TCACATTTTTGTCACAGTTAAAATCAAGTCTCGGAAACACGGGAACAAATTTAAAACTCACTCGAAAAAAAGAACCAAAG
    ACGCTCATTGTGGACCTTTTCCGTATTTCAATGAAACATTTCTTTTCCCGAAACCTCATGGAACGATATCAGACTGTTTA
    GTATCAGTTAAAATTTGGATCAGTAGAATGTTTAAAATGCCAATCTGCATCGGGTACGTCTCATTAGGTTCTGAAATGAA
    TATGACTTCCGGCGCCATTCATTGGCAAAGCATGCTTGACAGTCCCCGACACCCGGTTGCAAAATGGCATGTCCTAACCA
    ATCCTAATGTGAAAGAATAAAGATTTAATATTTAGTCCTTCAACATATCTTTTTAATAATTAAAATAATAATTATTTGTC
    GGT
    >SMED30020209 ID=SMED30020209|Name=Synaptotagmin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1588bp
    TGCTTGAACGCTGTTGGGCAATTTCATACTGGTTGAATGACTCTCCCAGCTGTATTCTGACCTATGAAAGTTAAATTAAT
    ATAGTTATTTGTATGAGATTGTTATATATGGAATTTCCCAGTGAATTGCGCCCAATAATTGGTATCTTGATGGGCCGATC
    TCGGTTTGTGGAATAATTCATTTGATTACAAGCTAAATTACCTTGAAATGACAGAAACAAAAATGAAATTTCATGCCAAT
    TTCACTGCTTCAACGACCTCCGGTAAAACCTCAACAAATGCTGCAAAAGAAAAATTCCAGGAAATAATTACATATTTGTC
    GAAAAAAATGAAAGTACCCCCATGGGCAGTTTACGCAATTGGAGTAGCAATCATACTTGTTATCCTCATAATTTTCTTTT
    GTCTCATAAAGATTTGTTGCTGCAAACGACGCAAAAAATCAAAAGGTGGAGGCAAAAAAGGAAAAAATGCAACAAAGAAT
    ATGAAAATCATTGGTGGAGCTGTAGATAATAAGACCCAATCAGATGAAGAAGATTTGGTTCTAGATAAAGATGACGATAA
    TGAAAAGAAAGAAGAGGAAAAAGAATATTTGGGAAAATTAGAATACAAATTAGATTACGATTTTACAAAAGGAGAGCTTA
    CAGTTGGAATTTTGCAAGCTCAAGAACTACCAGCACTCGATATGAATGGGACGTCAGACCCATACGTCAAAGTCTTTTTA
    AAACCAGATAAAAAGAAAAAATTTGAAACAAAAGTTCATCGAAAAACTTTAAATCCGGTCTTTGATGAAGTTTTTCTTTT
    TAAAGTACCATTTTCAGAAATAACTTCCAAAACTCTTTGTCTTCATATTTACGATTTTGATAGATTCTCAAAGCATGATC
    AAATTGGTCAGTTGGAAATTCCATTGGGTTCAATAGATTTGTGTCAAGTTGTGCAGGAATGGAAGGAACTTGAACCAAGT
    AAAGATAGTGCTGAAAAAGAAAATAAACTTGGTGACATTTGTTTTTCGTTGAGATACGTTCCAACAAATGGAAAACTGAC
    CGTTGTCGTTTTGGAAGCAAAGAACCTCAAAAAAATGGATGTTGGGGGATTATCTGATCCTTACGTCAAAATTTCGTTAA
    TGATGAATGGAAAACGAATAAAAAAGAAGAAAACAACAATCAAAAAATGTACTTTAAATCCATATTACAATGAATCGTTT
    TCGTTTGAGGTGCCATTCGAGCAGATACAGAGGATTAATCTAATAGTAACGGTTGTTGATTATGATAGAATCGGAACCTC
    GGAGCCGATTGGAAGGGTCGTGTTAGGTTGTAATGCTTCAGGGACTGCTCTTCGTCAATGGTCTGACATGCTTGCTAATC
    CTAGAAGACCAATTGCGCAATGGCAAACTTTACAAGAAATGCCAGAAAAATAACTTTTCCTATTTTTCCTATTATATGCT
    GATAAAAATTTAAATCTAGTCATTCGTTATGTGATTTCTTATTTTTAGACGACAATTTTAATATTTTCATCGTTTAATGT
    AATTTTTTCTTAACTTTAAGGCTAGTTTTGGTTTTTAGCAGTCTGTATCAAGTGAATGTGAAAATCTG
    >SMED30019471 ID=SMED30019471|Name=Synaptotagmin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1910bp
    TTTGGGACTTCTCCAATCTATTAAATATATTTAGAACGAACATCGTTGTGAGAAGCTTTGTCTTGCAAATGCACACCAAC
    ACATTCTCTGCCTACTCGAGACCAGCCTGAAGGACGCACCCAGTCATCTCTTATAAAAAAAAAACTCTTCTCTGATTCGG
    TATTTTCTGATTAATGGAGATCAAACAATGATTGGGCAACGTCTAGTTTAGAATATTTACAACTAAATCTGCGTATTTCA
    ATTTTTTTTCGATTTTGATTGTTGCAAATATTTATGAGTATATCCAATAATATAAGCAGCGCTAGTAATATGACGATAAA
    AATGCAACAAAATGTTGAAAAGTCTGTATCACAGCATGTAACAGCGCAAACAAAGGAATCAACATCAAATAAACTTCATA
    CAACAACAGCCGGTATCTCGGTTTTGGAGAAAACATTAAAAACATTTCACATGAGTACTGGCACTTTGATTGGAATCGGA
    GTTACAGTGTCTATCGTAGTTTTATTACTTCTTTATTGTATTTGCAAACGATGCATTAAGAAACGAAAGAAAAAGAAAGA
    TGGCGGCAAAAAAGGTGGAAAAGGCGTAGACATGAAAAGCGTACAACTATTAGGAAATGCTTATAAAGAAAAGGTACAGC
    CGGACCTAGAAGAACTGGATGCTAACATGGAAGATAATGAAGGGGCGCAAGATAAAGAAGCAGTCAATCTTGGAAAATTA
    CAGTATTCCCTTGATTACGATTTTACAAAAGGCGAGCTAACAGTCGGAGTAATTCAAGCCACAGATCTCCCAGCAATGGA
    CATGTCAGGAACTTCTGATCCATATGTGAAAGTTTTTCTATTACCGGATAAAAAGAAAAAATTCGAAACCAAAGTTCATC
    GAAAAATATTAAATCCAGTCTTTAATGAGACATTTGTATTCAAGATTCCTTATTCTGAGGTCGGGTCTAAAACTTTGGTA
    TTTAATGTTTTCGATTTCGACAGATTTTCAAAGCATGATCAAATTGGGCAAATCCAAATTCCACTGGGTTCAGTAGATTT
    ATGCAAAGTTATTGAGGAATGGAAGGAACTCGGCCCACCTGACAGTGATAATGAAAAGGAAAATCGATTAGGAGACATTT
    GTTTTTCTTTGAGATATGTTCCAACGTCTGGAAAGTTGAATATCGTCATTCTGGAAGCTAAAAACCTCAAGAAAATGGAT
    GTTGGAGGATTGTCGGATCCTTACGTGAAACTATCGTTGATGCTTAACGGCAAACGAGTGAAAAAGAAGAAAACCACAAT
    AAAAAAATACACATTAAATCCTTATTATAATGAGTCATTTTCATTCGAAGTTCCATTCGAGCAAATACAAAAAGTTAATT
    TAATAGTGACAGTAGTTGATTATGATAGAATTGGAACAAGTGAACCTATTGGAAGAGTAGTTCTTGGATGCAATGCTACA
    GGAGCAGAACTTCGGCACTGGTCCGATATGCTTGCTAATCCTAGGAGACCAATTGCCCAGTGGCATACCCTTCAAGATAT
    GCCGGAGAAGAGCTGATTTCATTGATTTTAATTTTAAAATCTGTCATATTTTGTGATAAATTTTGCGTATTTATACAATC
    ATTCGATTCGATCTTTCCATCAAGTTTCGTAAAATCTGCAGACATTCACGAGGATGCAGAAGAAATAGAAACTTTGTAAT
    AAATTAGCATTAGCTGTGATCTCCTATTGACCAAAAAACATAAACTTAATTTTTATAAAGAATTGTGGTGAAATGTTGTT
    AGGTTTCAGTCATAGATAACTGTATTTGTGTAATAGTTTGTGTATTTCTCGTCCTGGCCCGATTTTGTGCATTCCACTGG
    CAATACTATTTCACTAATAAATTATGTCTGATAATGTATACCAGTATAGGATTTTGTTTGAATTAATGAA
    >SMED30022907 ID=SMED30022907|Name=Synaptotagmin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1814bp
    ATTTATTGAAAATTATTTTTTCTATTATTAGGAGAAAATTGATTATTTTTTTTTGACAAAATAAGTTTTGGATATATTTC
    CCATTTGTTTGTATTCGTAAACCAATGAAGAATTCGACTCACGGATCGGATCATTCGGCCAGCAAGGCCAGTATGAAAAC
    GAATGTGGAAAAATTTTGGCATGATCTCGGAAAAAAATTGCACATGGATCCAAAAGCATTAATAGGAGTAACAATCGGTT
    TGGGAATATTGTTTTTGTTGTTCCTTTATTGCTTATGTAAAAAATGTGTTTTCAAGCGTCGAAAAAAGAAGGAAACGGCC
    AAAAAAGGAGCCAAGGGAGTAGTCGATATGAAAAGTGCCCAATTGTTGGGGAATTCATATAAAGAAAAAATTCAACCCGA
    TCTTGAAGAACTTGATGCAAACATGGAAGACAATGAAGGTGTAAAAGAAAAAGAAGATGTTCATTTAGGAAAATTACAAT
    ATTCTCTAGATTATGATTTTCAGAAAGGAGAATTAACTGTTGGAGTTATTCAAGCAACTGATCTTCCAGCTATGGATATG
    TCAGGAACATCAGATCCATATGTCAAATTATACCTTCTCCCAGACAAGAAAAAGAAATTCGAAACAAAGGTTCATAGGAA
    AATTTTAAATCCTGTATTCAATGAAACTTTTGTTTTCAAAGTTCCTTTCAATGAAGTTGCATCGAAGACTTTGATTTTCA
    ACGTTTATGACTTTGACAGATTTTCCAAACACGATCAAATCGGTCAAATAAAAGTACCATTGGGAGCTATAGATTTAGGT
    CGAGTTATTGAAGAATGGAAGGAACTGGAATCTCCAGAAAACGATGGGGAAAAGGAAAACAGGTTGGGAGACATTTGTTT
    CTCTTTAAGATACGTACCGACATCTGGAAAGCTTACAATAGTCATTTTGGAAGCAAAGAATCTTAAAAAAATGGATGTCG
    GAGGATTGTCTGATCCATATGTTAAACTTTCCTTGATGCTTAATGGTAAACGAGTGAAGAAGAAGAAAACTACCATCAAA
    AAGTATACACTAAATCCTTACTACAATGAATCATTTTCCTTTGAAGTACCATTCGAACAAATACAAAAAGTGAACTTGAT
    CGTCACGGTTGTTGATTATGACAGAATCGGAACCAGCGAACCGATAGGTAGAATTGTTCTGGGATGTAACGCAACTGGAG
    CAGAATTGCGACATTGGTCGGATATGTTGGCAAATCCCCGGCGACCAATCGCCCAGTGGCATACCCTCCAAGAGATGCCA
    GAGAACAATTGATAGTGTTCGTTTGATGCTTTAAAGCGGTTTGCATAATTCGTGAAATAAGTTATCAAAATTTGAGAAAT
    GTTTTTTTTTCTGAAACAAAAATGGCATGAGACAATATACCAGAGTTCATTAGTGTGTGGTTTCGTTGAATATTTTGGTG
    GTGTTGCATCTTATCGTTTGTCCTCTAATCTAATAATGTTTTATTCTTTATATAGCTGATTTATTCTCGAGCGAAACATT
    TTTTATGTGTACCAAAATACTTATGTCATAGCCATTGTGATTAGTCTGTAAACTATTGCGTAATAGCCCCTCTCATTGGC
    TTTTTTTAAGAGTAGTGAGTTGGAAAAAAAAATACAAAAATGACTTCAATTGTTAAACATTACTCATATTTTATCAGTAA
    GTTAACTTGCATATTTGCAGTTAATTATGGCATTTTATCTCTAAATCTCTGAAGCATGGCCTCAAGTCTTTTGTTTGTTT
    TAATGTAATTATGTCTAGATGAGAATATTAAAATACTTCGGTTTATATAAAAGA

     

    back to top