ventral nerve cord

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ In Situ Hybridization Data

  ▻ Sequences

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  ventral nerve cord


DEFINITON:

  The pair of closely united ventral longitudinal nerves with their segmental ganglia that is characteristic of many elongate invertebrates (as earthworms)[BTO]. A large process bundle that runs along the vental mid-line extending from the ventral region of the nerve ring[WB]. The ventral cord is one of the distinguishing traits of the central nervous system of all arthropods (such as insects, crustaceans and arachnids) as well as many other invertebrates, such as the annelid worms[GO].


TERM DEFINITION CITATIONS:

  UBERON:0000934


TERM CITATIONS:


TERM ID:

  PLANA:0000097


ABOUT THIS TERM:

ventral nerve cord

  ↳is a material entity and organ

  ↳contained in tail, copulatory region, ventral region of the whole animal, posterior region of the whole animal, parapharyngeal region, prepharyngeal region, head and anterior region of the whole animal

  ↳existence overlaps juvenile, asexual adult, adult hermaphrodite, Stage 8 and Stage 7

  ↳part of central nervous system


  → transverse commissure and serotonergic neuron part of ventral nerve cord



BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30022907SynaptotagminDj-sytStage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, ventral nerve cord, neuron, cephalic ganglia, nervous system, embryonic pharynx
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30019471 ID=SMED30019471|Name=Synaptotagmin|organism=Schmidtea mediterranea sexual|type=transcript|length=1910bp
TTTGGGACTTCTCCAATCTATTAAATATATTTAGAACGAACATCGTTGTGAGAAGCTTTGTCTTGCAAATGCACACCAAC
ACATTCTCTGCCTACTCGAGACCAGCCTGAAGGACGCACCCAGTCATCTCTTATAAAAAAAAAACTCTTCTCTGATTCGG
TATTTTCTGATTAATGGAGATCAAACAATGATTGGGCAACGTCTAGTTTAGAATATTTACAACTAAATCTGCGTATTTCA
ATTTTTTTTCGATTTTGATTGTTGCAAATATTTATGAGTATATCCAATAATATAAGCAGCGCTAGTAATATGACGATAAA
AATGCAACAAAATGTTGAAAAGTCTGTATCACAGCATGTAACAGCGCAAACAAAGGAATCAACATCAAATAAACTTCATA
CAACAACAGCCGGTATCTCGGTTTTGGAGAAAACATTAAAAACATTTCACATGAGTACTGGCACTTTGATTGGAATCGGA
GTTACAGTGTCTATCGTAGTTTTATTACTTCTTTATTGTATTTGCAAACGATGCATTAAGAAACGAAAGAAAAAGAAAGA
TGGCGGCAAAAAAGGTGGAAAAGGCGTAGACATGAAAAGCGTACAACTATTAGGAAATGCTTATAAAGAAAAGGTACAGC
CGGACCTAGAAGAACTGGATGCTAACATGGAAGATAATGAAGGGGCGCAAGATAAAGAAGCAGTCAATCTTGGAAAATTA
CAGTATTCCCTTGATTACGATTTTACAAAAGGCGAGCTAACAGTCGGAGTAATTCAAGCCACAGATCTCCCAGCAATGGA
CATGTCAGGAACTTCTGATCCATATGTGAAAGTTTTTCTATTACCGGATAAAAAGAAAAAATTCGAAACCAAAGTTCATC
GAAAAATATTAAATCCAGTCTTTAATGAGACATTTGTATTCAAGATTCCTTATTCTGAGGTCGGGTCTAAAACTTTGGTA
TTTAATGTTTTCGATTTCGACAGATTTTCAAAGCATGATCAAATTGGGCAAATCCAAATTCCACTGGGTTCAGTAGATTT
ATGCAAAGTTATTGAGGAATGGAAGGAACTCGGCCCACCTGACAGTGATAATGAAAAGGAAAATCGATTAGGAGACATTT
GTTTTTCTTTGAGATATGTTCCAACGTCTGGAAAGTTGAATATCGTCATTCTGGAAGCTAAAAACCTCAAGAAAATGGAT
GTTGGAGGATTGTCGGATCCTTACGTGAAACTATCGTTGATGCTTAACGGCAAACGAGTGAAAAAGAAGAAAACCACAAT
AAAAAAATACACATTAAATCCTTATTATAATGAGTCATTTTCATTCGAAGTTCCATTCGAGCAAATACAAAAAGTTAATT
TAATAGTGACAGTAGTTGATTATGATAGAATTGGAACAAGTGAACCTATTGGAAGAGTAGTTCTTGGATGCAATGCTACA
GGAGCAGAACTTCGGCACTGGTCCGATATGCTTGCTAATCCTAGGAGACCAATTGCCCAGTGGCATACCCTTCAAGATAT
GCCGGAGAAGAGCTGATTTCATTGATTTTAATTTTAAAATCTGTCATATTTTGTGATAAATTTTGCGTATTTATACAATC
ATTCGATTCGATCTTTCCATCAAGTTTCGTAAAATCTGCAGACATTCACGAGGATGCAGAAGAAATAGAAACTTTGTAAT
AAATTAGCATTAGCTGTGATCTCCTATTGACCAAAAAACATAAACTTAATTTTTATAAAGAATTGTGGTGAAATGTTGTT
AGGTTTCAGTCATAGATAACTGTATTTGTGTAATAGTTTGTGTATTTCTCGTCCTGGCCCGATTTTGTGCATTCCACTGG
CAATACTATTTCACTAATAAATTATGTCTGATAATGTATACCAGTATAGGATTTTGTTTGAATTAATGAA
>SMED30022907 ID=SMED30022907|Name=Synaptotagmin|organism=Schmidtea mediterranea sexual|type=transcript|length=1814bp
ATTTATTGAAAATTATTTTTTCTATTATTAGGAGAAAATTGATTATTTTTTTTTGACAAAATAAGTTTTGGATATATTTC
CCATTTGTTTGTATTCGTAAACCAATGAAGAATTCGACTCACGGATCGGATCATTCGGCCAGCAAGGCCAGTATGAAAAC
GAATGTGGAAAAATTTTGGCATGATCTCGGAAAAAAATTGCACATGGATCCAAAAGCATTAATAGGAGTAACAATCGGTT
TGGGAATATTGTTTTTGTTGTTCCTTTATTGCTTATGTAAAAAATGTGTTTTCAAGCGTCGAAAAAAGAAGGAAACGGCC
AAAAAAGGAGCCAAGGGAGTAGTCGATATGAAAAGTGCCCAATTGTTGGGGAATTCATATAAAGAAAAAATTCAACCCGA
TCTTGAAGAACTTGATGCAAACATGGAAGACAATGAAGGTGTAAAAGAAAAAGAAGATGTTCATTTAGGAAAATTACAAT
ATTCTCTAGATTATGATTTTCAGAAAGGAGAATTAACTGTTGGAGTTATTCAAGCAACTGATCTTCCAGCTATGGATATG
TCAGGAACATCAGATCCATATGTCAAATTATACCTTCTCCCAGACAAGAAAAAGAAATTCGAAACAAAGGTTCATAGGAA
AATTTTAAATCCTGTATTCAATGAAACTTTTGTTTTCAAAGTTCCTTTCAATGAAGTTGCATCGAAGACTTTGATTTTCA
ACGTTTATGACTTTGACAGATTTTCCAAACACGATCAAATCGGTCAAATAAAAGTACCATTGGGAGCTATAGATTTAGGT
CGAGTTATTGAAGAATGGAAGGAACTGGAATCTCCAGAAAACGATGGGGAAAAGGAAAACAGGTTGGGAGACATTTGTTT
CTCTTTAAGATACGTACCGACATCTGGAAAGCTTACAATAGTCATTTTGGAAGCAAAGAATCTTAAAAAAATGGATGTCG
GAGGATTGTCTGATCCATATGTTAAACTTTCCTTGATGCTTAATGGTAAACGAGTGAAGAAGAAGAAAACTACCATCAAA
AAGTATACACTAAATCCTTACTACAATGAATCATTTTCCTTTGAAGTACCATTCGAACAAATACAAAAAGTGAACTTGAT
CGTCACGGTTGTTGATTATGACAGAATCGGAACCAGCGAACCGATAGGTAGAATTGTTCTGGGATGTAACGCAACTGGAG
CAGAATTGCGACATTGGTCGGATATGTTGGCAAATCCCCGGCGACCAATCGCCCAGTGGCATACCCTCCAAGAGATGCCA
GAGAACAATTGATAGTGTTCGTTTGATGCTTTAAAGCGGTTTGCATAATTCGTGAAATAAGTTATCAAAATTTGAGAAAT
GTTTTTTTTTCTGAAACAAAAATGGCATGAGACAATATACCAGAGTTCATTAGTGTGTGGTTTCGTTGAATATTTTGGTG
GTGTTGCATCTTATCGTTTGTCCTCTAATCTAATAATGTTTTATTCTTTATATAGCTGATTTATTCTCGAGCGAAACATT
TTTTATGTGTACCAAAATACTTATGTCATAGCCATTGTGATTAGTCTGTAAACTATTGCGTAATAGCCCCTCTCATTGGC
TTTTTTTAAGAGTAGTGAGTTGGAAAAAAAAATACAAAAATGACTTCAATTGTTAAACATTACTCATATTTTATCAGTAA
GTTAACTTGCATATTTGCAGTTAATTATGGCATTTTATCTCTAAATCTCTGAAGCATGGCCTCAAGTCTTTTGTTTGTTT
TAATGTAATTATGTCTAGATGAGAATATTAAAATACTTCGGTTTATATAAAAGA

 

back to top



PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in ventral nerve cord. Click this link to learn more about PAGE.


PAGE Curations: 130


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
ventral nerve cordSMED30031540Neuropeptide-3SMESG000014460.1 BK007025smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30010096TPA_inf: prohormone convertase 2SMESG000008070.1 SMESG000008069.1 BK007043smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
ventral nerve cordSMED30015232Netrin-1SMESG000050895.1 AY945305smed_ncbi_20200123PMID:16033796
Cebrià et al., 2005
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30022921Netrin 1SMESG000050895.1 AY945305smed_ncbi_20200123PMID:16033796
Cebrià et al., 2005
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30013386netrin 1SMESG000006806.1 AY945304smed_ncbi_20200123PMID:16033796
Cebrià et al., 2005
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30015768adenomatous polyposis coli-like proteinSMESG000045688.1 SMESG000005328.1 EU130785.1smed_ncbi_20200123PMID:18063757
Gurley et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30015768adenomatous polyposis coli-like proteinSMESG000045688.1 SMESG000005328.1 EU130785smed_ncbi_20200123PMID:18063757
Gurley et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30019916Beta-cateninSMESG000022923.1 KT983970.1smed_ncbi_20200123PMID:18063757
Gurley et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30019727beta-catenin-like protein 2SMESG000002541.1 EU082825.1smed_ncbi_20200123PMID:18063757
Gurley et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30024824beta-catenin-1SMESG000039528.1 EU130786.1smed_ncbi_20200123PMID:18063757
Gurley et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30033103Dvl-2SMESG000010246.1 EU130788.1smed_ncbi_20200123PMID:18063757
Gurley et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30032757DishevelledSMESG000049876.1 EU130787.1smed_ncbi_20200123PMID:18063757
Gurley et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30003443Membrane-bound O-acyltransferase domain-containing protein 2SMESG000075570.1 SMED30003443smed_20140614PMID:18063757
Gurley et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30033656axis inhibition protein ASMESG000039725.1 GU808528.1smed_ncbi_20200123PMID:18063757
Gurley et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30024368chromodomain helicase DNA-binding protein 4SMESG000068192.1 GU980571.1smed_ncbi_20200123PMID:26457503
Tu et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
ventral nerve cordSMED30020992Aristaless-like homeobox transcription factorSMESG000030143.1 KX961610smed_ncbi_20200123PMID:27864883
Currie et al., 2016
whole organism asexual adult fluorescence in situ hybridization evidence
ventral nerve cordSMED30017196noggin 1SMESG000032158.1 EF633690.1smed_ncbi_20200123PMID:21295483
Gaviño et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30016207Wnt5SMESG000055035.1 FJ463749.1smed_ncbi_20200123PMID:21295483
Gaviño et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30034479EYE53-1 BK007033.1smed_ncbi_20200123PMID:21295483
Gaviño et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30017196noggin 1SMESG000032158.1 EF633690.1smed_ncbi_20200123PMID:19174194
Molina et al., 2009
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30005164coe proteinSMESG000069088.1 KF487109smed_ncbi_20200123PMID:25356635
Cowles et al., 2014
whole organism asexual adult fluorescence in situ hybridization evidence
ventral nerve cordSMED30005164coe proteinSMESG000069088.1 KF487109smed_ncbi_20200123PMID:25356635
Cowles et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30011055Evi/WlsSMESG000068488.1 FJ463748.1smed_ncbi_20200123PMID:19211673
Adell et al., 2009
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30011055Evi/WlsSMESG000068488.1 FJ463748smed_ncbi_20200123PMID:19211673
Adell et al., 2009
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30016207Wnt5SMESG000055035.1 FJ463749.1smed_ncbi_20200123PMID:19211673
Adell et al., 2009
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30016207Wnt5SMESG000055035.1 FJ463749smed_ncbi_20200123PMID:19211673
Adell et al., 2009
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30022929WntASMESG000051375.1 FJ463750.1smed_ncbi_20200123PMID:19211673
Adell et al., 2009
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30022929WntASMESG000051375.1 FJ463750smed_ncbi_20200123PMID:19211673
Adell et al., 2009
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30034479EYE53-1 BK007033.1smed_ncbi_20200123PMID:17905225
Molina et al., 2007
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30023062bruno-likeSMESG000021009.1 DQ344977smed_ncbi_20200123PMID:16890156
Guo et al., 2006
whole organism asexual adult fluorescence in situ hybridization evidence
ventral nerve cordSMED30031525Choline O-acetyltransferaseSMESG000051357.1 FG310880ncbi_smed_estsPMID:23318641
Chen et al., 2013
whole organism asexual adult fluorescence in situ hybridization evidence
ventral nerve cordSMED30016207Wnt5SMESG000055035.1 FJ463749.1smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult fluorescence in situ hybridization evidence
ventral nerve cordSMED30016207Wnt5SMESG000055035.1 FJ463749.1smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30016207Wnt5SMESG000055035.1 FJ463749smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30016207Wnt5SMESG000055035.1 FJ463749smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult fluorescence in situ hybridization evidence
ventral nerve cordSMED30016207Wnt5SMESG000055035.1 ACJ64864.1smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30016207Wnt5SMESG000055035.1 ACJ64864.1smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult fluorescence in situ hybridization evidence
ventral nerve cordSMED30027106SMED30027106SMESG000008070.1 SMESG000008069.1 BK007043.1smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult fluorescence in situ hybridization evidence
ventral nerve cordSMED30010096TPA_inf: prohormone convertase 2SMESG000008070.1 SMESG000008069.1 BK007043.1smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult fluorescence in situ hybridization evidence
ventral nerve cordSMED30008848TPA_inf: insulin-like prohormone-1SMESG000080685.1 BK007034smed_ncbi_20200123PMID:22252538
Miller et al., 2012
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
ventral nerve cordSMED30008848TPA_inf: insulin-like prohormone-1SMESG000080685.1 BK007034smed_ncbi_20200123PMID:22252538
Miller et al., 2012
whole organism adult hermaphrodite fluorescence in situ hybridization evidence
ventral nerve cordSMED30008848TPA_inf: insulin-like prohormone-1SMESG000080685.1 BK007034smed_ncbi_20200123PMID:22252538
Miller et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30020522ap2SMESG000022356.1 JX010470.1smed_ncbi_20200123PMID:24992682
Vásquez-Doorman et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30019744SMED-SMAD6/7-2SMESG000021574.1 JQ278720.1smed_ncbi_20200123PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30019744SMED-SMAD6/7-2SMESG000021574.1 JQ278720smed_ncbi_20200123PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30005458Phosphatidylinositol 4-kinase type 2-betaSMESG000074718.1 tr5_11049mu_Smed_v1PMID:25558068
Reuter et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30013810TeashirtSMESG000008973.1 KP003815.1smed_ncbi_20200123PMID:25725068
Owen et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30031525Choline O-acetyltransferaseSMESG000051357.1 FG310880ncbi_smed_estsPMID:21566185
Wagner et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
ventral nerve cordSMED30007567Lysosomal trafficking regulatorSMESG000069984.1 SMESG000069981.1 DQ186986.1smed_ncbi_20200123PMID:21806978
Iglesias et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30034479EYE53-1 BK007033.1smed_ncbi_20200123PMID:21806978
Iglesias et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30024824beta-catenin-1SMESG000039528.1 Smed-beta-catenin-1smed_ncbi_20200123PMID:21806978
Iglesias et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30014446SMEDWI-2SMESG000069984.1 SMESG000069981.1 DQ186986.1smed_ncbi_20200123PMID:21806978
Iglesias et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30033656axis inhibition protein ASMESG000039725.1 ADW27177.1smed_ncbi_20200123PMID:21806978
Iglesias et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30033656axis inhibition protein ASMESG000039725.1 SMED30033656smed_20140614PMID:21806978
Iglesias et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30033656axis inhibition protein ASMESG000039725.1 GU808528.1smed_ncbi_20200123PMID:21806978
Iglesias et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30035066axis inhibition protein BSMESG000025925.1 ADW27178.1smed_ncbi_20200123PMID:21806978
Iglesias et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30035066axis inhibition protein BSMESG000025925.1 GU808529.1smed_ncbi_20200123PMID:21806978
Iglesias et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30035066axis inhibition protein BSMESG000025925.1 SMED30035066smed_20140614PMID:21806978
Iglesias et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30022907SynaptotagminSMESG000025329.1 SMED30022907smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
ventral nerve cordSMED30022907SynaptotagminSMESG000025329.1 SMED30022907smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
ventral nerve cordSMED30022907SynaptotagminSMESG000025329.1 SMED30022907smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
ventral nerve cordSMED30024586Pax6ASMESG000039056.1 JX010503.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
ventral nerve cordSMED30024586Pax6ASMESG000039056.1 JX010503.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
ventral nerve cordSMED30024586Pax6ASMESG000039056.1 SMED30024586smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
ventral nerve cordSMED30024586Pax6ASMESG000039056.1 SMED30024586smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
ventral nerve cordSMED30024586Pax6ASMESG000039056.1 AFJ24746.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
ventral nerve cordSMED30024586Pax6ASMESG000039056.1 AFJ24746.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
ventral nerve cordSMED30008639MyoD-like proteinSMESG000034317.1 SMED30008639smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
ventral nerve cordSMED30008639MyoD-like proteinSMESG000034317.1 SMED30008639smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
ventral nerve cordSMED30008639MyoD-like proteinSMESG000034317.1 SMED30008639smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
ventral nerve cordSMED30008639MyoD-like proteinSMESG000034317.1 KF487099.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
ventral nerve cordSMED30008639MyoD-like proteinSMESG000034317.1 KF487099.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
ventral nerve cordSMED30008639MyoD-like proteinSMESG000034317.1 KF487099.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
ventral nerve cordSMED30008639MyoD-like proteinSMESG000034317.1 myoDsmed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
ventral nerve cordSMED30008639MyoD-like proteinSMESG000034317.1 myoDsmed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
ventral nerve cordSMED30008639MyoD-like proteinSMESG000034317.1 myoDsmed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
ventral nerve cordSMED30021687glycogen synthase kinase 3SMESG000023764.1 ABD62975smed_ncbi_20200123PMID:18202849
Adell et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30029226glycogen synthase kinase 3SMESG000019899.1 ABD72512smed_ncbi_20200123PMID:18202849
Adell et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30015069ANK_REP_REGION domain-containing proteinSMESG000063648.1 HQ141793.1smed_ncbi_20200123PMID:21282632
Almuedo-Castillo et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30000196Vang-2SMESG000053210.1 HQ141794.1smed_ncbi_20200123PMID:21282632
Almuedo-Castillo et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30023352Vang-1SMESG000029281.1 Smed-vang-1smed_ncbi_20200123PMID:21282632
Almuedo-Castillo et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30033103Dvl-2SMESG000010246.1 EU130788.1smed_ncbi_20200123PMID:21282632
Almuedo-Castillo et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30032757DishevelledSMESG000049876.1 EU130787.1smed_ncbi_20200123PMID:21282632
Almuedo-Castillo et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30014712Transcription factor 7-like 1SMESG000038786.1 KY196228.1smed_ncbi_20200123PMID:28976975
Su et al., 2017
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30014712Transcription factor 7-like 1SMESG000038786.1 KY196228smed_ncbi_20200123PMID:28976975
Su et al., 2017
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30034479EYE53-1 BK007033.1smed_ncbi_20200123PMID:18287199
Iglesias et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30024824beta-catenin-1SMESG000039528.1 EU082826smed_ncbi_20200123PMID:18287199
Iglesias et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30024824beta-catenin-1SMESG000039528.1 Smed-beta-catenin-1smed_ncbi_20200123PMID:18287199
Iglesias et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30009117Secreted peptide prohormone-3 BK007022smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30016225Neuropeptide-49SMESG000003228.1 BK007023smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30000854Secreted peptide prohormone-15 BK007013smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30008210Secreted peptide prohormone 17 GU295183smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30020806Neuropeptide 12SMESG000038586.1 GU295182smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30034905Gonadotropin-releasing hormone like-1SMESG000061019.1 GU295185smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30029602Secreted peptide prohormone-15 BK007013smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30035859Neuropeptide Y prohormone-5SMESG000048959.1 BK007008smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30001665Secreted peptide prohormone-13SMESG000009971.1 BK007029smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30015821Neuropeptide-22SMESG000043852.1 BK007038smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
ventral nerve cordSMED30015821Neuropeptide-22SMESG000043852.1 BK007038smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30010111TPA_inf: neuropeptide precursor-2SMESG000072719.1 BK007035smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
ventral nerve cordSMED30010111TPA_inf: neuropeptide precursor-2SMESG000072719.1 BK007035smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30001301TPA_inf: secreted peptide prohormone-16SMESG000079890.1 BK007042smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30018450Neuropeptide Y prohormone-7SMESG000002722.1 BK007020smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30013280Pedal peptide prohormone like-2SMESG000059588.1 BK007018smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30008848TPA_inf: insulin-like prohormone-1SMESG000080685.1 BK007034smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
ventral nerve cordSMED30008848TPA_inf: insulin-like prohormone-1SMESG000080685.1 BK007034smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30011515Secreted peptide prohormone-13SMESG000009971.1 BK007029smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30014397Neuropeptide 3 GU295187smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30011959Myomodulin prohormone like-1SMESG000078202.1 BK007017smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30009105Neuropeptide 8SMESG000069019.1 GU295189smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30009456SMED30009456SMESG000039758.1 GU295180smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30002545Myomodulin prohormone like-2SMESG000036321.1 BK007016smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30002469TPA_inf: pedal peptide prohormone like-1SMESG000035027.1 BK007041smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30009462SMED30009462SMESG000023794.1 SMESG000022518.1 GU295188smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30012851Secreted peptide prohormone-14SMESG000051526.1 BK007030smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30031317Secreted peptide prohormone 19SMESG000053016.1 SMESG000053015.1 GU295186smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30027106SMED30027106SMESG000008070.1 SMESG000008069.1 BK007043smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
ventral nerve cordSMED30032184Neuropeptide Y prohormone-10SMESG000058298.1 BK007011smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30025223Neuropeptide Y prohormone-2SMESG000050248.1 BK007019smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30026493TPA_inf: pyrokinin prohormone like-1SMESG000013290.1 BK007007smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism juvenile colorimetric in situ hybridization evidence
ventral nerve cordSMED30026493TPA_inf: pyrokinin prohormone like-1SMESG000013290.1 BK007007smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30026493TPA_inf: pyrokinin prohormone like-1SMESG000013290.1 BK007007smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
ventral nerve cordSMED30034847Secreted peptide prohormone-11SMESG000069589.1 BK007014smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30016664SMED30016664SMESG000011618.1 BK007009smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30019678SMED30019678SMESG000040636.1 GU295176smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30016731Neuropeptide Y prohormone-9 BK007040smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30023917SMED30023917SMESG000058631.1 BK007024smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30034479EYE53-1 BK007033smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30026615Neuropeptide Y prohormone-6 BK007031smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30026988Neuropeptide Y prohormone 1SMESG000069090.1 GU295175smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
Note: Hover over icons to view figure legend

 

 

back to top