ventral nerve cord

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ In Situ Hybridization Data

  ▻ Sequences

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  ventral nerve cord


DEFINITON:

  The pair of closely united ventral longitudinal nerves with their segmental ganglia that is characteristic of many elongate invertebrates (as earthworms)[BTO]. A large process bundle that runs along the vental mid-line extending from the ventral region of the nerve ring[WB]. The ventral cord is one of the distinguishing traits of the central nervous system of all arthropods (such as insects, crustaceans and arachnids) as well as many other invertebrates, such as the annelid worms[GO].


TERM DEFINITION CITATIONS:

  UBERON:0000934


TERM CITATIONS:


TERM ID:

  PLANA:0000097


ABOUT THIS TERM:

ventral nerve cord

  ↳is a material entity and organ

  ↳contained in tail region, copulatory region, ventral region of the whole animal, posterior region of the whole animal, parapharyngeal region, prepharyngeal region, head region and anterior region of the whole animal

  ↳existence overlaps juvenile stage, asexual adult, adult hermaphrodite, Stage 8 and Stage 7

  ↳part of central nervous system


  → transverse commissure and serotonergic neuron part of ventral nerve cord



BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30022907SynaptotagminDj-sytStage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, ventral nerve cord, neuron, cephalic ganglia, nervous system, embryonic pharynx
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30019471 ID=SMED30019471|Name=Synaptotagmin|organism=Schmidtea mediterranea sexual|type=transcript|length=1910bp
TTTGGGACTTCTCCAATCTATTAAATATATTTAGAACGAACATCGTTGTGAGAAGCTTTGTCTTGCAAATGCACACCAAC
ACATTCTCTGCCTACTCGAGACCAGCCTGAAGGACGCACCCAGTCATCTCTTATAAAAAAAAAACTCTTCTCTGATTCGG
TATTTTCTGATTAATGGAGATCAAACAATGATTGGGCAACGTCTAGTTTAGAATATTTACAACTAAATCTGCGTATTTCA
ATTTTTTTTCGATTTTGATTGTTGCAAATATTTATGAGTATATCCAATAATATAAGCAGCGCTAGTAATATGACGATAAA
AATGCAACAAAATGTTGAAAAGTCTGTATCACAGCATGTAACAGCGCAAACAAAGGAATCAACATCAAATAAACTTCATA
CAACAACAGCCGGTATCTCGGTTTTGGAGAAAACATTAAAAACATTTCACATGAGTACTGGCACTTTGATTGGAATCGGA
GTTACAGTGTCTATCGTAGTTTTATTACTTCTTTATTGTATTTGCAAACGATGCATTAAGAAACGAAAGAAAAAGAAAGA
TGGCGGCAAAAAAGGTGGAAAAGGCGTAGACATGAAAAGCGTACAACTATTAGGAAATGCTTATAAAGAAAAGGTACAGC
CGGACCTAGAAGAACTGGATGCTAACATGGAAGATAATGAAGGGGCGCAAGATAAAGAAGCAGTCAATCTTGGAAAATTA
CAGTATTCCCTTGATTACGATTTTACAAAAGGCGAGCTAACAGTCGGAGTAATTCAAGCCACAGATCTCCCAGCAATGGA
CATGTCAGGAACTTCTGATCCATATGTGAAAGTTTTTCTATTACCGGATAAAAAGAAAAAATTCGAAACCAAAGTTCATC
GAAAAATATTAAATCCAGTCTTTAATGAGACATTTGTATTCAAGATTCCTTATTCTGAGGTCGGGTCTAAAACTTTGGTA
TTTAATGTTTTCGATTTCGACAGATTTTCAAAGCATGATCAAATTGGGCAAATCCAAATTCCACTGGGTTCAGTAGATTT
ATGCAAAGTTATTGAGGAATGGAAGGAACTCGGCCCACCTGACAGTGATAATGAAAAGGAAAATCGATTAGGAGACATTT
GTTTTTCTTTGAGATATGTTCCAACGTCTGGAAAGTTGAATATCGTCATTCTGGAAGCTAAAAACCTCAAGAAAATGGAT
GTTGGAGGATTGTCGGATCCTTACGTGAAACTATCGTTGATGCTTAACGGCAAACGAGTGAAAAAGAAGAAAACCACAAT
AAAAAAATACACATTAAATCCTTATTATAATGAGTCATTTTCATTCGAAGTTCCATTCGAGCAAATACAAAAAGTTAATT
TAATAGTGACAGTAGTTGATTATGATAGAATTGGAACAAGTGAACCTATTGGAAGAGTAGTTCTTGGATGCAATGCTACA
GGAGCAGAACTTCGGCACTGGTCCGATATGCTTGCTAATCCTAGGAGACCAATTGCCCAGTGGCATACCCTTCAAGATAT
GCCGGAGAAGAGCTGATTTCATTGATTTTAATTTTAAAATCTGTCATATTTTGTGATAAATTTTGCGTATTTATACAATC
ATTCGATTCGATCTTTCCATCAAGTTTCGTAAAATCTGCAGACATTCACGAGGATGCAGAAGAAATAGAAACTTTGTAAT
AAATTAGCATTAGCTGTGATCTCCTATTGACCAAAAAACATAAACTTAATTTTTATAAAGAATTGTGGTGAAATGTTGTT
AGGTTTCAGTCATAGATAACTGTATTTGTGTAATAGTTTGTGTATTTCTCGTCCTGGCCCGATTTTGTGCATTCCACTGG
CAATACTATTTCACTAATAAATTATGTCTGATAATGTATACCAGTATAGGATTTTGTTTGAATTAATGAA
>SMED30022907 ID=SMED30022907|Name=Synaptotagmin|organism=Schmidtea mediterranea sexual|type=transcript|length=1814bp
ATTTATTGAAAATTATTTTTTCTATTATTAGGAGAAAATTGATTATTTTTTTTTGACAAAATAAGTTTTGGATATATTTC
CCATTTGTTTGTATTCGTAAACCAATGAAGAATTCGACTCACGGATCGGATCATTCGGCCAGCAAGGCCAGTATGAAAAC
GAATGTGGAAAAATTTTGGCATGATCTCGGAAAAAAATTGCACATGGATCCAAAAGCATTAATAGGAGTAACAATCGGTT
TGGGAATATTGTTTTTGTTGTTCCTTTATTGCTTATGTAAAAAATGTGTTTTCAAGCGTCGAAAAAAGAAGGAAACGGCC
AAAAAAGGAGCCAAGGGAGTAGTCGATATGAAAAGTGCCCAATTGTTGGGGAATTCATATAAAGAAAAAATTCAACCCGA
TCTTGAAGAACTTGATGCAAACATGGAAGACAATGAAGGTGTAAAAGAAAAAGAAGATGTTCATTTAGGAAAATTACAAT
ATTCTCTAGATTATGATTTTCAGAAAGGAGAATTAACTGTTGGAGTTATTCAAGCAACTGATCTTCCAGCTATGGATATG
TCAGGAACATCAGATCCATATGTCAAATTATACCTTCTCCCAGACAAGAAAAAGAAATTCGAAACAAAGGTTCATAGGAA
AATTTTAAATCCTGTATTCAATGAAACTTTTGTTTTCAAAGTTCCTTTCAATGAAGTTGCATCGAAGACTTTGATTTTCA
ACGTTTATGACTTTGACAGATTTTCCAAACACGATCAAATCGGTCAAATAAAAGTACCATTGGGAGCTATAGATTTAGGT
CGAGTTATTGAAGAATGGAAGGAACTGGAATCTCCAGAAAACGATGGGGAAAAGGAAAACAGGTTGGGAGACATTTGTTT
CTCTTTAAGATACGTACCGACATCTGGAAAGCTTACAATAGTCATTTTGGAAGCAAAGAATCTTAAAAAAATGGATGTCG
GAGGATTGTCTGATCCATATGTTAAACTTTCCTTGATGCTTAATGGTAAACGAGTGAAGAAGAAGAAAACTACCATCAAA
AAGTATACACTAAATCCTTACTACAATGAATCATTTTCCTTTGAAGTACCATTCGAACAAATACAAAAAGTGAACTTGAT
CGTCACGGTTGTTGATTATGACAGAATCGGAACCAGCGAACCGATAGGTAGAATTGTTCTGGGATGTAACGCAACTGGAG
CAGAATTGCGACATTGGTCGGATATGTTGGCAAATCCCCGGCGACCAATCGCCCAGTGGCATACCCTCCAAGAGATGCCA
GAGAACAATTGATAGTGTTCGTTTGATGCTTTAAAGCGGTTTGCATAATTCGTGAAATAAGTTATCAAAATTTGAGAAAT
GTTTTTTTTTCTGAAACAAAAATGGCATGAGACAATATACCAGAGTTCATTAGTGTGTGGTTTCGTTGAATATTTTGGTG
GTGTTGCATCTTATCGTTTGTCCTCTAATCTAATAATGTTTTATTCTTTATATAGCTGATTTATTCTCGAGCGAAACATT
TTTTATGTGTACCAAAATACTTATGTCATAGCCATTGTGATTAGTCTGTAAACTATTGCGTAATAGCCCCTCTCATTGGC
TTTTTTTAAGAGTAGTGAGTTGGAAAAAAAAATACAAAAATGACTTCAATTGTTAAACATTACTCATATTTTATCAGTAA
GTTAACTTGCATATTTGCAGTTAATTATGGCATTTTATCTCTAAATCTCTGAAGCATGGCCTCAAGTCTTTTGTTTGTTT
TAATGTAATTATGTCTAGATGAGAATATTAAAATACTTCGGTTTATATAAAAGA

 

back to top



PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in ventral nerve cord. Click this link to learn more about PAGE.


PAGE Curations: 174


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
ventral nerve cordSMED30031525choline O-acetyltransferase FG310880smed_ncbi_20240424PMID:23318641
Chen et al., 2013
whole organism asexual adult fluorescence in situ hybridization evidence
ventral nerve cordSMED30016207Wnt family member 5B FJ463749.1smed_ncbi_20240424PMID:20707997
Gurley et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30016207Wnt family member 5B FJ463749.1smed_ncbi_20240424PMID:20707997
Gurley et al., 2010
whole organism asexual adult fluorescence in situ hybridization evidence
ventral nerve cordSMED30016207Wnt family member 5B FJ463749smed_ncbi_20240424PMID:20707997
Gurley et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30016207Wnt family member 5B FJ463749smed_ncbi_20240424PMID:20707997
Gurley et al., 2010
whole organism asexual adult fluorescence in situ hybridization evidence
ventral nerve cordSMED30016207Wnt family member 5B ACJ64864.1smed_ncbi_20240424PMID:20707997
Gurley et al., 2010
whole organism asexual adult fluorescence in situ hybridization evidence
ventral nerve cordSMED30016207Wnt family member 5B ACJ64864.1smed_ncbi_20240424PMID:20707997
Gurley et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30016207Wnt family member 5B SMED30016207smed_20140614PMID:20707997
Gurley et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30010096proprotein convertase subtilisin/kexin type 2 BK007043.1smed_ncbi_20240424PMID:20707997
Gurley et al., 2010
whole organism asexual adult fluorescence in situ hybridization evidence
ventral nerve cordSMED30010338proprotein convertase subtilisin/kexin type 2 BK007043.1smed_ncbi_20240424PMID:20707997
Gurley et al., 2010
whole organism asexual adult fluorescence in situ hybridization evidence
ventral nerve cordSMED30009741proprotein convertase subtilisin/kexin type 2 BK007043.1smed_ncbi_20240424PMID:20707997
Gurley et al., 2010
whole organism asexual adult fluorescence in situ hybridization evidence
ventral nerve cordSMED30016564proprotein convertase subtilisin/kexin type 2 BK007043.1smed_ncbi_20240424PMID:20707997
Gurley et al., 2010
whole organism asexual adult fluorescence in situ hybridization evidence
ventral nerve cordSMED30027106proprotein convertase subtilisin/kexin type 2 BK007043.1smed_ncbi_20240424PMID:20707997
Gurley et al., 2010
whole organism asexual adult fluorescence in situ hybridization evidence
ventral nerve cordSMED30008848 BK007034smed_ncbi_20240424PMID:22252538
Miller et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30008848 BK007034smed_ncbi_20240424PMID:22252538
Miller et al., 2012
whole organism adult hermaphrodite fluorescence in situ hybridization evidence
ventral nerve cordSMED30008848 BK007034smed_ncbi_20240424PMID:22252538
Miller et al., 2012
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
ventral nerve cordSMED30020522transcription factor AP-2-alpha JX010470.1smed_ncbi_20240424PMID:24992682
Vásquez-Doorman et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30015916Homeobox protein Hox-D3a SmedASXL_008435SmedAsxl_ww_GCZZ01PMID:27034770
Currie et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30015704Homeobox protein php-3 SmedASXL_012639SmedAsxl_ww_GCZZ01PMID:27034770
Currie et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30013674motor neuron and pancreas homeobox 1 SmedASXL_008593SmedAsxl_ww_GCZZ01PMID:27034770
Currie et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30007227Homeobox protein Hox-A4 (Fragment) SmedASXL_007160SmedAsxl_ww_GCZZ01PMID:27034770
Currie et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30032613homeobox protein SmedASXL_008878SmedAsxl_ww_GCZZ01PMID:27034770
Currie et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30001670homeobox protein SmedASXL_008878SmedAsxl_ww_GCZZ01PMID:27034770
Currie et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30023971Homeobox protein Hox-A1 SmedASXL_003878SmedAsxl_ww_GCZZ01PMID:27034770
Currie et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30019744 JQ278720.1smed_ncbi_20240424PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30019744 JQ278720smed_ncbi_20240424PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30005458Nucleolar complex protein tr5_11049mu_Smed_v1PMID:25558068
Reuter et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30013810Protein tiptop KP003815.1smed_ncbi_20240424PMID:25725068
Owen et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30031525choline O-acetyltransferase FG310880smed_ncbi_20240424PMID:21566185
Wagner et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
ventral nerve cordSMED30014446piwi-like protein 1 DQ186986.1smed_ncbi_20240424PMID:21806978
Iglesias et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30007567piwi-like protein 1 DQ186986.1smed_ncbi_20240424PMID:21806978
Iglesias et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30035066axin 2 ADW27178.1smed_ncbi_20240424PMID:21806978
Iglesias et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30035066axin 2 SMED30035066smed_20140614PMID:21806978
Iglesias et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30035066axin 2 GU808529.1smed_ncbi_20240424PMID:21806978
Iglesias et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30033656axin 2 GU808528.1smed_ncbi_20240424PMID:21806978
Iglesias et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30033656axin 2 ADW27177.1smed_ncbi_20240424PMID:21806978
Iglesias et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30033656axin 2 SMED30033656smed_20140614PMID:21806978
Iglesias et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30024824armadillo segment polarity protein Smed-beta-catenin-1smed_ncbi_20240424PMID:21806978
Iglesias et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30034479 BK007033.1smed_ncbi_20240424PMID:21806978
Iglesias et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30036018Titin SMED30036018smed_20140614PMID:24131630
März et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30022907synaptotagmin 1 SMED30022907smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
ventral nerve cordSMED30022907synaptotagmin 1 SMED30022907smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
ventral nerve cordSMED30022907synaptotagmin 1 SMED30022907smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
ventral nerve cordSMED30008639Transcription factor SUM-1 SMED30008639smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
ventral nerve cordSMED30008639Transcription factor SUM-1 SMED30008639smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
ventral nerve cordSMED30008639Transcription factor SUM-1 SMED30008639smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
ventral nerve cordSMED30008639Transcription factor SUM-1 KF487099.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
ventral nerve cordSMED30008639Transcription factor SUM-1 KF487099.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
ventral nerve cordSMED30008639Transcription factor SUM-1 KF487099.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
ventral nerve cordSMED30008639Transcription factor SUM-1 myoDsmed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
ventral nerve cordSMED30008639Transcription factor SUM-1 myoDsmed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
ventral nerve cordSMED30008639Transcription factor SUM-1 myoDsmed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
ventral nerve cordSMED30024586Paired box protein 6 homolog JX010503.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
ventral nerve cordSMED30024586Paired box protein 6 homolog JX010503.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
ventral nerve cordSMED30024586Paired box protein 6 homolog AFJ24746.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
ventral nerve cordSMED30024586Paired box protein 6 homolog AFJ24746.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
ventral nerve cordSMED30024586Paired box protein 6 homolog SMED30024586smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
ventral nerve cordSMED30024586Paired box protein 6 homolog SMED30024586smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
ventral nerve cordSMED30021687glycogen synthase kinase 3 alpha ABD62975smed_ncbi_20240424PMID:18202849
Adell et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30029226non-specific serine/threonine protein kinase ABD72512smed_ncbi_20240424PMID:18202849
Adell et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30010688Segment polarity protein dishevelled homolog DVL-3 EU130787.1smed_ncbi_20240424PMID:21282632
Almuedo-Castillo et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30000196vang-like protein HQ141794.1smed_ncbi_20240424PMID:21282632
Almuedo-Castillo et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30000196vang-like protein HQ141794smed_ncbi_20240424PMID:21282632
Almuedo-Castillo et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30015069synuclein alpha interacting protein HQ141793.1smed_ncbi_20240424PMID:21282632
Almuedo-Castillo et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30015069synuclein alpha interacting protein HQ141793smed_ncbi_20240424PMID:21282632
Almuedo-Castillo et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30023352VANGL planar cell polarity protein 1 HQ141797smed_ncbi_20240424PMID:21282632
Almuedo-Castillo et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30023352VANGL planar cell polarity protein 1 Smed-vang-1smed_ncbi_20240424PMID:21282632
Almuedo-Castillo et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30032757Segment polarity protein dishevelled homolog DVL-3 EU130787.1smed_ncbi_20240424PMID:21282632
Almuedo-Castillo et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30033103dishevelled segment polarity protein 3 EU130788.1smed_ncbi_20240424PMID:21282632
Almuedo-Castillo et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30014712Protein pangolin, isoforms A/H/I/S KY196228.1smed_ncbi_20240424PMID:28976975
Su et al., 2017
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30014712Protein pangolin, isoforms A/H/I/S KY196228smed_ncbi_20240424PMID:28976975
Su et al., 2017
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30024824armadillo segment polarity protein Smed-beta-catenin-1smed_ncbi_20240424PMID:18287199
Iglesias et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30024824armadillo segment polarity protein EU082826smed_ncbi_20240424PMID:18287199
Iglesias et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30034479 BK007033.1smed_ncbi_20240424PMID:18287199
Iglesias et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30010096proprotein convertase subtilisin/kexin type 2 BK007043smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
ventral nerve cordSMED30010338proprotein convertase subtilisin/kexin type 2 BK007043smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
ventral nerve cordSMED30009741proprotein convertase subtilisin/kexin type 2 BK007043smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
ventral nerve cordSMED30016564proprotein convertase subtilisin/kexin type 2 BK007043smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
ventral nerve cordSMED30027106proprotein convertase subtilisin/kexin type 2 BK007043smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
ventral nerve cordSMED30034905 GU295185smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30020806 GU295182smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30019678 GU295176smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30000854 BK007013smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30029602 BK007013smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30034847 BK007014smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30026493 BK007007smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010
whole organism juvenile stagecolorimetric in situ hybridization evidence
ventral nerve cordSMED30026493 BK007007smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
ventral nerve cordSMED30026493 BK007007smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30016664 BK007009smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30002545 BK007016smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30032184 BK007011smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30035859 BK007008smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30012851 BK007030smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30018450 BK007020smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30001665 BK007029smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30011515 BK007029smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30013280 BK007018smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30016225 BK007023smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30009117 BK007022smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30034479 BK007033smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30023917 BK007024smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30025223 BK007019smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30011959 BK007017smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30031540 BK007025smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30026615 BK007031smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30002469 BK007041smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30015821 BK007038smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
ventral nerve cordSMED30015821 BK007038smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30008848 BK007034smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30008848 BK007034smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
ventral nerve cordSMED30001301 BK007042smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30010111 BK007035smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30010111 BK007035smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
ventral nerve cordSMED30016731 BK007040smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30031317 GU295186smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30033797 GU295180smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30009456 GU295180smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30009105 GU295189smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30009462 GU295188smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30008210 GU295183smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30014397 GU295187smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30026988 GU295175smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30013386netrin 3 AY945304smed_ncbi_20240424PMID:16033796
Cebrià et al., 2005
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30015232netrin 1 AY945305smed_ncbi_20240424PMID:16033796
Cebrià et al., 2005
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30022921netrin 1 AY945305smed_ncbi_20240424PMID:16033796
Cebrià et al., 2005
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30019916Catenin beta-1 KT983970.1smed_ncbi_20240424PMID:18063757
Gurley et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30003443membrane bound O-acyltransferase domain containing 1 SMED30003443smed_20140614PMID:18063757
Gurley et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30010688Segment polarity protein dishevelled homolog DVL-3 EU130787.1smed_ncbi_20240424PMID:18063757
Gurley et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30033656axin 2 GU808528.1smed_ncbi_20240424PMID:18063757
Gurley et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30019727junction plakoglobin EU082825.1smed_ncbi_20240424PMID:18063757
Gurley et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30015768Adenomatous polyposis coli protein EU130785.1smed_ncbi_20240424PMID:18063757
Gurley et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30015768Adenomatous polyposis coli protein EU130785smed_ncbi_20240424PMID:18063757
Gurley et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30032757Segment polarity protein dishevelled homolog DVL-3 EU130787.1smed_ncbi_20240424PMID:18063757
Gurley et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30033103dishevelled segment polarity protein 3 EU130788.1smed_ncbi_20240424PMID:18063757
Gurley et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30024824armadillo segment polarity protein EU130786.1smed_ncbi_20240424PMID:18063757
Gurley et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30024368 GU980571.1smed_ncbi_20240424PMID:26457503
Tu et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
ventral nerve cordSMED30020992Homeobox protein unc-42 KX961610smed_ncbi_20240424PMID:27864883
Currie et al., 2016
whole organism asexual adult fluorescence in situ hybridization evidence
ventral nerve cordSMED30016207Wnt family member 5B FJ463749.1smed_ncbi_20240424PMID:21295483
Gaviño et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30017196noggin EF633690.1smed_ncbi_20240424PMID:21295483
Gaviño et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30034479 BK007033.1smed_ncbi_20240424PMID:21295483
Gaviño et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30017196noggin EF633690.1smed_ncbi_20240424PMID:19174194
Molina et al., 2009
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30005164knot; transcript_id=FBtr0329882 KF487109smed_ncbi_20240424PMID:25356635
Cowles et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30005164knot; transcript_id=FBtr0329882 KF487109smed_ncbi_20240424PMID:25356635
Cowles et al., 2014
whole organism asexual adult fluorescence in situ hybridization evidence
ventral nerve cordSMED30016207Wnt family member 5B FJ463749.1smed_ncbi_20240424PMID:19211673
Adell et al., 2009
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30016207Wnt family member 5B FJ463749smed_ncbi_20240424PMID:19211673
Adell et al., 2009
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30011055Wnt ligand secretion mediator FJ463748smed_ncbi_20240424PMID:19211673
Adell et al., 2009
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30011055Wnt ligand secretion mediator FJ463748.1smed_ncbi_20240424PMID:19211673
Adell et al., 2009
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30014743Wnt family member 2B FJ463750smed_ncbi_20240424PMID:19211673
Adell et al., 2009
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30014743Wnt family member 2B FJ463750.1smed_ncbi_20240424PMID:19211673
Adell et al., 2009
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30010430PAX interacting protein 1 HO008340smed_ncbi_20240424PMID:23235145
Hubert et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30010430PAX interacting protein 1 DN315791smed_ncbi_20240424PMID:23235145
Hubert et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30010430PAX interacting protein 1 KC262340smed_ncbi_20240424PMID:23235145
Hubert et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30020895PAX interacting protein 1 HO008340smed_ncbi_20240424PMID:23235145
Hubert et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30020895PAX interacting protein 1 DN315791smed_ncbi_20240424PMID:23235145
Hubert et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30020895PAX interacting protein 1 KC262340smed_ncbi_20240424PMID:23235145
Hubert et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30028594PAX interacting protein 1 HO008340smed_ncbi_20240424PMID:23235145
Hubert et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30028594PAX interacting protein 1 DN315791smed_ncbi_20240424PMID:23235145
Hubert et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30028594PAX interacting protein 1 KC262340smed_ncbi_20240424PMID:23235145
Hubert et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30028101menin 1 KC262339smed_ncbi_20240424PMID:23235145
Hubert et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30022027host cell factor C2 KC262343smed_ncbi_20240424PMID:23235145
Hubert et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30032882lysine demethylase 6A KC262341smed_ncbi_20240424PMID:23235145
Hubert et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30031525choline O-acetyltransferase FG310880smed_ncbi_20240424PMID:27074666
Lander et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30035066axin 2 ADW27178.1smed_ncbi_20240424PMID:27074666
Lander et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30013810Protein tiptop KP003815.1smed_ncbi_20240424PMID:27074666
Lander et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30034479 BK007033.1smed_ncbi_20240424PMID:17905225
Molina et al., 2007
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30031525choline O-acetyltransferase FG310880smed_ncbi_20240424PMID:28245923
LoCascio et al., 2017
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30023062CUGBP Elav-like family member DQ344977smed_ncbi_20240424PMID:16890156
Guo et al., 2006
whole organism asexual adult fluorescence in situ hybridization evidence
ventral nerve cordSMED30008012ubiquitin protein ligase E3B SMED30008012smed_20140614PMID:25956527
Henderson et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30013730itchy E3 ubiquitin protein ligase HO006936.1smed_ncbi_20240424PMID:25956527
Henderson et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30010017circadian trip HO008121.1smed_ncbi_20240424PMID:25956527
Henderson et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30013617HECT-type E3 ubiquitin transferase DN307143smed_ncbi_20240424PMID:25956527
Henderson et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30006629HECT, UBA and WWE domain containing E3 ubiquitin protein ligase 1 KP954682smed_ncbi_20240424PMID:25956527
Henderson et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30022675E3 ubiquitin-protein ligase KP954687smed_ncbi_20240424PMID:25956527
Henderson et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
ventral nerve cordSMED30008783ubiquitin protein ligase E3 component n-recognin 5 KP954686smed_ncbi_20240424PMID:25956527
Henderson et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
Note: Hover over icons to view figure legend

 

 

back to top