ventral nerve cord

▻ Planarian Anatomy Ontology Class Overview

▻ Additional Class Information

  ▻ In Situ Hybridization Data

  ▻ Sequences




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  ventral nerve cord


DEFINITON:

  The pair of closely united ventral longitudinal nerves with their segmental ganglia that is characteristic of many elongate invertebrates (as earthworms)[BTO]. A large process bundle that runs along the vental mid-line extending from the ventral region of the nerve ring[WB]. The ventral cord is one of the distinguishing traits of the central nervous system of all arthropods (such as insects, crustaceans and arachnids) as well as many other invertebrates, such as the annelid worms[GO].


TERM CITATIONS:


TERM ID:

  PLANA:0000097


ABOUT THIS TERM:

ventral nerve cord

  ↳is a material entity and organ

  ↳contained in tail, copulatory region, ventral region of the whole animal, posterior compartment of the whole animal, parapharyngeal region, prepharyngeal region, head and anterior region of the whole animal

  ↳existence overlaps juvenile, asexual adult, adult hermaphrodite, Stage 8 and Stage 7

  ↳part of central nervous system


  → transverse commissure and serotonergic neuron part of ventral nerve cord



COMMENTS:


BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Additional Class Information


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasEnriched during stage(s)Tissue/PatternImages
SMED30022907Synaptotagmin-1Dj-sytStage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, ventral nerve cord, neuron, cephalic ganglia, nervous system, embryonic pharynx
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30022586 ID=SMED30022586|Name=Synaptotagmin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1214bp
TCACCATCTTGTCTTTGATGGGATAGTTTGACTAATTTTTGGTTTTGATTGGTTCTCTTAATTGGGAATGCAAATTTTAC
GGTGCTTGCACTTATGACATGGCATTATTTGCAGAATGAGTTTTCAGAGGCTGTGTGGAGATATTATAATAAAACTTTTG
GAAACTTGTTGTTTTTGTTTTCATTCAGAAACTGAAGAAAAAGGGAAACTATACATCCACGATAGAACATCTCCAATGAT
TTTAAACCAAAAACCTTCAATTATGAATCAGGAAATAGAGATAAAAAATATTTCATTGAATCTGCAGACGGAAAATACAT
TAAATCCAAGAAAACAATCTCTTGGAGGCAATTTTCTTGTTCCAAATGCAGGGTTAAATGAAAAACTTCCTTCAGTAATT
AAAGTAAAACGACATTCGGAATCGGATTTGGGGGACATGAATTACAATTTTCCTGTTGAAATTAACCATAACCACATTTT
GAACGTTTTGTCTATTAAAGTTTTTCCAAACGAAAAAATTCCTGATAAATTTGATATTTCTGTGAAAACTAATGACAAAA
TCACCAAGAAAATAAGCTACTTTTACAAAGTTATTACATTTGACAATATAAGTGAAGATGATTTAAATACATCTTTCCTG
AGCTTGACATTTTATAAGAGAAAAACGCCAGATGATAAAAAAAGTTTCGGAGAAATAAAATTTCCTCTAAAGTTAATATT
GAAGAAAAAAATTCAAAATTCAATTAGATTTTACAATACAGATTTCAATTTATTTCAAAACAATGTGAAATTATCCAACG
GAACGCTTGAAATCGGTTTACGTTTTGATCATAAAAACACTCAATTAACGGTAAATGTTTACGAAGGACAGAATTTTTCA
AACCAAAATCAAACCCCTTTAAATACTTTCTGTGTCGTTGAATTATTTAAAACACATACCCTCTATATGACCTACAAAAC
CAGTGTCAAATTCAATTCGAATTGTCCGATTTGGAATGAAACTTTCATCTTTCCAATTAAGCTTGCCGAATTGGCTAATC
ATATCAAACTGATTATAACAGTCTACAATGAAAATGAAACGGCAAATCTACCAATTGGAAAATTGTTTTTCCCGTCTTCT
GAAATGGCATTGGAAACTCGTCATTGGAATGAAATTCATACAAATTCCAACCTACAAATCAGAATGTTGCATAGCTTAAA
ATGACATTTAAATA
>SMED30020209 ID=SMED30020209|Name=Synaptotagmin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1588bp
TGCTTGAACGCTGTTGGGCAATTTCATACTGGTTGAATGACTCTCCCAGCTGTATTCTGACCTATGAAAGTTAAATTAAT
ATAGTTATTTGTATGAGATTGTTATATATGGAATTTCCCAGTGAATTGCGCCCAATAATTGGTATCTTGATGGGCCGATC
TCGGTTTGTGGAATAATTCATTTGATTACAAGCTAAATTACCTTGAAATGACAGAAACAAAAATGAAATTTCATGCCAAT
TTCACTGCTTCAACGACCTCCGGTAAAACCTCAACAAATGCTGCAAAAGAAAAATTCCAGGAAATAATTACATATTTGTC
GAAAAAAATGAAAGTACCCCCATGGGCAGTTTACGCAATTGGAGTAGCAATCATACTTGTTATCCTCATAATTTTCTTTT
GTCTCATAAAGATTTGTTGCTGCAAACGACGCAAAAAATCAAAAGGTGGAGGCAAAAAAGGAAAAAATGCAACAAAGAAT
ATGAAAATCATTGGTGGAGCTGTAGATAATAAGACCCAATCAGATGAAGAAGATTTGGTTCTAGATAAAGATGACGATAA
TGAAAAGAAAGAAGAGGAAAAAGAATATTTGGGAAAATTAGAATACAAATTAGATTACGATTTTACAAAAGGAGAGCTTA
CAGTTGGAATTTTGCAAGCTCAAGAACTACCAGCACTCGATATGAATGGGACGTCAGACCCATACGTCAAAGTCTTTTTA
AAACCAGATAAAAAGAAAAAATTTGAAACAAAAGTTCATCGAAAAACTTTAAATCCGGTCTTTGATGAAGTTTTTCTTTT
TAAAGTACCATTTTCAGAAATAACTTCCAAAACTCTTTGTCTTCATATTTACGATTTTGATAGATTCTCAAAGCATGATC
AAATTGGTCAGTTGGAAATTCCATTGGGTTCAATAGATTTGTGTCAAGTTGTGCAGGAATGGAAGGAACTTGAACCAAGT
AAAGATAGTGCTGAAAAAGAAAATAAACTTGGTGACATTTGTTTTTCGTTGAGATACGTTCCAACAAATGGAAAACTGAC
CGTTGTCGTTTTGGAAGCAAAGAACCTCAAAAAAATGGATGTTGGGGGATTATCTGATCCTTACGTCAAAATTTCGTTAA
TGATGAATGGAAAACGAATAAAAAAGAAGAAAACAACAATCAAAAAATGTACTTTAAATCCATATTACAATGAATCGTTT
TCGTTTGAGGTGCCATTCGAGCAGATACAGAGGATTAATCTAATAGTAACGGTTGTTGATTATGATAGAATCGGAACCTC
GGAGCCGATTGGAAGGGTCGTGTTAGGTTGTAATGCTTCAGGGACTGCTCTTCGTCAATGGTCTGACATGCTTGCTAATC
CTAGAAGACCAATTGCGCAATGGCAAACTTTACAAGAAATGCCAGAAAAATAACTTTTCCTATTTTTCCTATTATATGCT
GATAAAAATTTAAATCTAGTCATTCGTTATGTGATTTCTTATTTTTAGACGACAATTTTAATATTTTCATCGTTTAATGT
AATTTTTTCTTAACTTTAAGGCTAGTTTTGGTTTTTAGCAGTCTGTATCAAGTGAATGTGAAAATCTG
>SMED30022362 ID=SMED30022362|Name=Synaptotagmin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1443bp
CTCTTCCGATCTCAAACATTTCAGTCGCAAAGCAGGTCGCCACGAAATACATAAATCCGAACTCAACTGCTATTTGCATT
AAGCATTTCAATGGCCTTCACGAACATACCAAGCACACACCGACCTTTTGCATAGCAAAATAATTTATTATCATTAAAAC
AACCTTTGTGACTCTATTTTATCGATTTGAACGAAATTCACCACGATGGCACCATAAACAATCAGATCTCACAAATGTCT
GCGACTCTAAGCACAATGTCAACACTGAAGTTCACAAGGCCAACAAATGTAACCTCAAACCTCTACAAAGACATAATCAA
ATATCTTGATCTCCCGGAACCGTTGATTGTAGCAATCTTTGCCGCTGCTGGTTTGTTAATATTCGTTATTTTCATATTGT
TTTGTTCGAGATGCTGCTGCAGAAAATGCTGCAAGCAAACTGCCGATAAAGACAAATACAAAAGACGGAAGCTAGAAACA
AAAGAAATTGACAAAATTTTCAGAGACGAGTTGAATCTTGGATTTAATGAGAGTTTTGGAAAGATATATTTTGCGCTCAA
ATATCTCCTCGTAAAAGAATTGTTAATTGTAAAGGTTATTAAGGTGGAAAACCTACCGACACCAATTGACGACTGTCTTG
ATCCATACGTTGTCGTACAAGTGAAATCAAAAAGTTTGACTGAGGAAAAGAAAACCAAAATTAAATACAAACATATAGAT
CCGGTATTCAATGAAAAGTTTACTTTCAAAATTCTCCATCCAGAACTTAATGATTCGGAAATTTTTTTTAAGGTTTTTGA
CTATGATAAATTTGGAGCCGACTCATTGCTAGGTCAACTTGCACTAAATTTTAAAGACCTCAATCCCAGTAGCATCATAA
ACATGTTGTCAGAGTTTTCCAAAGATTTAAAAGAAGGTGAAGATACATCGGAAGGCATGGGACAGGTATGCATAATTCTG
AATTCAAATGGACAGGCAGGATTACTAGTCACTATACTAGAAGCTAAAAATCTTCGAGTTAAAGAAAACATGAGTTATTC
TCACATTTTTGTCACAGTTAAAATCAAGTCTCGGAAACACGGGAACAAATTTAAAACTCACTCGAAAAAAAGAACCAAAG
ACGCTCATTGTGGACCTTTTCCGTATTTCAATGAAACATTTCTTTTCCCGAAACCTCATGGAACGATATCAGACTGTTTA
GTATCAGTTAAAATTTGGATCAGTAGAATGTTTAAAATGCCAATCTGCATCGGGTACGTCTCATTAGGTTCTGAAATGAA
TATGACTTCCGGCGCCATTCATTGGCAAAGCATGCTTGACAGTCCCCGACACCCGGTTGCAAAATGGCATGTCCTAACCA
ATCCTAATGTGAAAGAATAAAGATTTAATATTTAGTCCTTCAACATATCTTTTTAATAATTAAAATAATAATTATTTGTC
GGT
>SMED30028321 ID=SMED30028321|Name=Synaptotagmin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1303bp
TTTAATTGTGAGTGTATAATTAATTCATTAATAAATGTGCAAAATATGTTCAGACAAGTATAAAGATATATTCATTATTA
ACCATTCAACCATAACAATAGATTCTGTAAGGCCTCTAAATTCTCTGATTGTCATGTATAACAATGTAACAATTCGAAAT
GTAAACCAAACATCAGTTCTTGGAACTTATTTCAATAACCTATTAAAGTTATGGAACATAAGTCCATTACAAGGAATGTT
CATATCCGTCGGACTTTTGCTTGCTGTCGTTCTGACAGTGGCTATCATTATATATTGTGTTAGAAAATCAGTCGAGGGTG
AAGATACCAAAAGGAGTCGACTTTCAAATCTTAAGAAACATCTTCCAGTGAACAGTTCGTCATCAGAGATTGATACTCCA
CATGGGTATATTGAAGCATCAGTCAAGTATAAAAAAAAGCAGAAAGAGATTGAAATTCAAGACATTCAAATTTACAAATT
AGAATTTAACTCAATGAAAAAGCCGGATTGTTATTTAGTAATGTTTGTAAGGCATGGGAAATCTCAGTTGTATCCTTCCC
AAAGAACGAAAACTGCTTTGAATGATTTGTATCCAAATTTCAATGAACACTTTAAGTTTAAAATAAGAAATATGAACAAC
AATATTCTCCAATTTGAACTTTACGACGAAAATCTATCGGGAAATGACATTCTCATTCGTCAGGGAGAAATGATGTTGAA
AGATATCAGCGAAAAGAAATTCCAGGATTATTTTCAGAATTTTGTAATCCACTTGGACAAGCCTTCAGAATTAAAAGGTC
TCGGTGATGTCGCTGTGATTCTGACTGGAAATCCACCAATTTTGAGAATAACAATTCTTGAAGCAAAAGGATTGGCACAA
AAAGAAAATCTTAACTCCAATTCTTTGTACAGTTTTCACGCAGAAGTTAAAGTTTTCGTCAATAAACATTTAGTAAAACA
TTTCAAAACGAAAAAAATTCGTCATATTTCCAATCCGTATTTCCAGGAAACATTTTCATTAAAAGTTTTGTCAAAAATGT
GGGATAAAATTTTAATAAAAATTGAATTATTCCGATCGGGATTTCGTAGAATCGGAAAGGCTTATATCGGTTACAAAGAG
TCCAATTCGAAAGTTAATTATTTGGGGAACTTGCATTGGGAGAATACTTGCAATGACCGTAAAATGTCGAAAGCGATTTG
GCATACGTTGGTCAAATAGGTTGCATATTTCCCTTTGCGGTCTGATTCTTGATGACCCTCACTCTATTCTGACTATAATC
AAAATCTTGTTCAATCTTATTAT
>SMED30028676 ID=SMED30028676|Name=Synaptotagmin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1385bp
AAATCAGAAAAATCAAAAAGAAATTTCACAGAATTACGGAACTTATGAAACAGTGAGCAAAGCGCCGCTGGAAATCACAA
TTACAAAAGCAGAGGATAACGAAGGGGTTTCAAATAAAAAAATAATCCTTCAAGATGACCGTCGATGTACTATGCCATGC
ATTTTACCATCGAGCAACAATTCTTCAGATGGATACTCGGAAAGCAATCTAAGTGTAAATGAAAGTTCTGTATTCTCTCT
TAATTCCAATAATCTTTTGCTTTCCGGTCTGATTTCTCCTGCTCGACGATACAGCGACAATTCAAATACGCAAAATTTCG
TTGAGTTACGAAAGAAAAGTGTCCGACCCGATAGATCAAAACGAACTTTCTTCATATGAGATACTGAATTTATACGGACA
AGGTAAACTATGTTTTTCAATAGTTTACAATGAACATATTTCTCGACTCTACGTGACAATAAACAAAGCAGTTTATTTAA
ACAGTTCCAAAACTAACAATCTGGCCGGATTCTATGTGAAAGTGTATTTATTAAATACAGAAAATGATATGAAATTGCAA
ATGCATAAATCGGAAATTGTAACTGCAAATAAAAATCCAATGTTCGAGCAAACATTTTCGTTTCTTTTAACAAAATCCTC
TTTAGTCAGCATAAAATTACAGTTCAAAGTCAAACAAGCACATATAAAAGTAAAAAAAAATGAATATCTCGGAGGATTCA
TGTTTCATCTTGATAATAATGAAATAATTAACAACCCGGAACTCTTTCAAGAATTATGGCGAGATCTGCGGGGCGACTTG
AGGAAAGACACCAGACGTGGAGAAATCCTCATTTCCCTGATGTACAGCGAACACCAATCTTCAGCTTTTCTATCAGTTAA
TCTGCATCGAGCTAAAAATCTACAAATTCGACAACATGACAATTCTGTTTTTGCCAGATGTACAATGTTGGTTGGAAACA
AACCGATCAAAACAAAGCGATCAATTACAGTAAAACAAGACATCTCTGCGCCCTATGTTGATCTTGAAAGTGTTTTCAAT
GTCGACAAATTGAACATCATGGAAGTCGGCGTTGTTATTCATATATGTAGCCGCAGCAAAATAGGTTTCAGTCACCTGCT
GGGCAAGCTGATCCTGGGATCTGTGATGTATACGGACGATAAGTCAGTCCTAATACACTGGAAGGACATGATCAGTTATC
AGAACAGAACCGTCACTAAGTGGCATACGATTATGTGAACATAAAATAACTTTAGACAATTTGTTGGCATGGATGAATGT
TTACAAATCTCATGAAATTAGCCGTTCATAAAAATGTGTTCACAGACTAATGGTAATTTTTAGGCATAATTCGACCATTC
ATTTAAAATTTCGATTAAATCATAG
>SMED30019471 ID=SMED30019471|Name=Synaptotagmin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1910bp
TTTGGGACTTCTCCAATCTATTAAATATATTTAGAACGAACATCGTTGTGAGAAGCTTTGTCTTGCAAATGCACACCAAC
ACATTCTCTGCCTACTCGAGACCAGCCTGAAGGACGCACCCAGTCATCTCTTATAAAAAAAAAACTCTTCTCTGATTCGG
TATTTTCTGATTAATGGAGATCAAACAATGATTGGGCAACGTCTAGTTTAGAATATTTACAACTAAATCTGCGTATTTCA
ATTTTTTTTCGATTTTGATTGTTGCAAATATTTATGAGTATATCCAATAATATAAGCAGCGCTAGTAATATGACGATAAA
AATGCAACAAAATGTTGAAAAGTCTGTATCACAGCATGTAACAGCGCAAACAAAGGAATCAACATCAAATAAACTTCATA
CAACAACAGCCGGTATCTCGGTTTTGGAGAAAACATTAAAAACATTTCACATGAGTACTGGCACTTTGATTGGAATCGGA
GTTACAGTGTCTATCGTAGTTTTATTACTTCTTTATTGTATTTGCAAACGATGCATTAAGAAACGAAAGAAAAAGAAAGA
TGGCGGCAAAAAAGGTGGAAAAGGCGTAGACATGAAAAGCGTACAACTATTAGGAAATGCTTATAAAGAAAAGGTACAGC
CGGACCTAGAAGAACTGGATGCTAACATGGAAGATAATGAAGGGGCGCAAGATAAAGAAGCAGTCAATCTTGGAAAATTA
CAGTATTCCCTTGATTACGATTTTACAAAAGGCGAGCTAACAGTCGGAGTAATTCAAGCCACAGATCTCCCAGCAATGGA
CATGTCAGGAACTTCTGATCCATATGTGAAAGTTTTTCTATTACCGGATAAAAAGAAAAAATTCGAAACCAAAGTTCATC
GAAAAATATTAAATCCAGTCTTTAATGAGACATTTGTATTCAAGATTCCTTATTCTGAGGTCGGGTCTAAAACTTTGGTA
TTTAATGTTTTCGATTTCGACAGATTTTCAAAGCATGATCAAATTGGGCAAATCCAAATTCCACTGGGTTCAGTAGATTT
ATGCAAAGTTATTGAGGAATGGAAGGAACTCGGCCCACCTGACAGTGATAATGAAAAGGAAAATCGATTAGGAGACATTT
GTTTTTCTTTGAGATATGTTCCAACGTCTGGAAAGTTGAATATCGTCATTCTGGAAGCTAAAAACCTCAAGAAAATGGAT
GTTGGAGGATTGTCGGATCCTTACGTGAAACTATCGTTGATGCTTAACGGCAAACGAGTGAAAAAGAAGAAAACCACAAT
AAAAAAATACACATTAAATCCTTATTATAATGAGTCATTTTCATTCGAAGTTCCATTCGAGCAAATACAAAAAGTTAATT
TAATAGTGACAGTAGTTGATTATGATAGAATTGGAACAAGTGAACCTATTGGAAGAGTAGTTCTTGGATGCAATGCTACA
GGAGCAGAACTTCGGCACTGGTCCGATATGCTTGCTAATCCTAGGAGACCAATTGCCCAGTGGCATACCCTTCAAGATAT
GCCGGAGAAGAGCTGATTTCATTGATTTTAATTTTAAAATCTGTCATATTTTGTGATAAATTTTGCGTATTTATACAATC
ATTCGATTCGATCTTTCCATCAAGTTTCGTAAAATCTGCAGACATTCACGAGGATGCAGAAGAAATAGAAACTTTGTAAT
AAATTAGCATTAGCTGTGATCTCCTATTGACCAAAAAACATAAACTTAATTTTTATAAAGAATTGTGGTGAAATGTTGTT
AGGTTTCAGTCATAGATAACTGTATTTGTGTAATAGTTTGTGTATTTCTCGTCCTGGCCCGATTTTGTGCATTCCACTGG
CAATACTATTTCACTAATAAATTATGTCTGATAATGTATACCAGTATAGGATTTTGTTTGAATTAATGAA
>SMED30022907 ID=SMED30022907|Name=Synaptotagmin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1814bp
ATTTATTGAAAATTATTTTTTCTATTATTAGGAGAAAATTGATTATTTTTTTTTGACAAAATAAGTTTTGGATATATTTC
CCATTTGTTTGTATTCGTAAACCAATGAAGAATTCGACTCACGGATCGGATCATTCGGCCAGCAAGGCCAGTATGAAAAC
GAATGTGGAAAAATTTTGGCATGATCTCGGAAAAAAATTGCACATGGATCCAAAAGCATTAATAGGAGTAACAATCGGTT
TGGGAATATTGTTTTTGTTGTTCCTTTATTGCTTATGTAAAAAATGTGTTTTCAAGCGTCGAAAAAAGAAGGAAACGGCC
AAAAAAGGAGCCAAGGGAGTAGTCGATATGAAAAGTGCCCAATTGTTGGGGAATTCATATAAAGAAAAAATTCAACCCGA
TCTTGAAGAACTTGATGCAAACATGGAAGACAATGAAGGTGTAAAAGAAAAAGAAGATGTTCATTTAGGAAAATTACAAT
ATTCTCTAGATTATGATTTTCAGAAAGGAGAATTAACTGTTGGAGTTATTCAAGCAACTGATCTTCCAGCTATGGATATG
TCAGGAACATCAGATCCATATGTCAAATTATACCTTCTCCCAGACAAGAAAAAGAAATTCGAAACAAAGGTTCATAGGAA
AATTTTAAATCCTGTATTCAATGAAACTTTTGTTTTCAAAGTTCCTTTCAATGAAGTTGCATCGAAGACTTTGATTTTCA
ACGTTTATGACTTTGACAGATTTTCCAAACACGATCAAATCGGTCAAATAAAAGTACCATTGGGAGCTATAGATTTAGGT
CGAGTTATTGAAGAATGGAAGGAACTGGAATCTCCAGAAAACGATGGGGAAAAGGAAAACAGGTTGGGAGACATTTGTTT
CTCTTTAAGATACGTACCGACATCTGGAAAGCTTACAATAGTCATTTTGGAAGCAAAGAATCTTAAAAAAATGGATGTCG
GAGGATTGTCTGATCCATATGTTAAACTTTCCTTGATGCTTAATGGTAAACGAGTGAAGAAGAAGAAAACTACCATCAAA
AAGTATACACTAAATCCTTACTACAATGAATCATTTTCCTTTGAAGTACCATTCGAACAAATACAAAAAGTGAACTTGAT
CGTCACGGTTGTTGATTATGACAGAATCGGAACCAGCGAACCGATAGGTAGAATTGTTCTGGGATGTAACGCAACTGGAG
CAGAATTGCGACATTGGTCGGATATGTTGGCAAATCCCCGGCGACCAATCGCCCAGTGGCATACCCTCCAAGAGATGCCA
GAGAACAATTGATAGTGTTCGTTTGATGCTTTAAAGCGGTTTGCATAATTCGTGAAATAAGTTATCAAAATTTGAGAAAT
GTTTTTTTTTCTGAAACAAAAATGGCATGAGACAATATACCAGAGTTCATTAGTGTGTGGTTTCGTTGAATATTTTGGTG
GTGTTGCATCTTATCGTTTGTCCTCTAATCTAATAATGTTTTATTCTTTATATAGCTGATTTATTCTCGAGCGAAACATT
TTTTATGTGTACCAAAATACTTATGTCATAGCCATTGTGATTAGTCTGTAAACTATTGCGTAATAGCCCCTCTCATTGGC
TTTTTTTAAGAGTAGTGAGTTGGAAAAAAAAATACAAAAATGACTTCAATTGTTAAACATTACTCATATTTTATCAGTAA
GTTAACTTGCATATTTGCAGTTAATTATGGCATTTTATCTCTAAATCTCTGAAGCATGGCCTCAAGTCTTTTGTTTGTTT
TAATGTAATTATGTCTAGATGAGAATATTAAAATACTTCGGTTTATATAAAAGA

 

back to top