renal system

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ Description

  ▻ Figures

  ▻ In Situ Hybridization Data

  ▻ Sequences

  ▻ References

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  renal system


DEFINITON:

  The renal system is an anatomical system that maintains fluid balance and contributes to electrolyte balance, acid/base balance, and disposal of nitrogenous waste products.


TERM DEFINITION CITATIONS:

  UBERON:0001008


TERM CITATIONS:


TERM ID:

  PLANA:0000088


ABOUT THIS TERM:

renal system

  ↳is a anatomical system

  ↳part of asexual organism and sexual organism


Expand to see terms that part of renal system


BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


DESCRIPTION:   

The transcription factors pou2/3, six1/2-2, eya, sal1, all of which were required for protonephridia specification during regeneration, as well as osr, a transcription factor expressed in protonephridial progenitors, showed enriched expression during S5 (Figure 1 – figure supplement 18 A, Figure 1 – source data 5) (Scimone et al., 2011). Scattered pou2/3+ cells were detected by WISH in S5 embryos (Figure 1 – figure supplement 18 B), and preferential accumulation of pou2/3+ cells around the presumptive D/V margin of the embryo was observed as tubules began to form during S6. Branching morphogenesis of the tubules proceeded during S6-S8, with a noted dorsolateral bias in positioning of the developing filtration units (Figure 1 – figure supplement 18 D). Transcripts with enriched expression in adult protonephridial cell type(s) were frequently expressed at low to undetectable levels prior to S5, and were upregulated during S5-S8 (Figure 1 – figure supplement 18 C) (Scimone et al., 2011; Vu, 2015; Wurtzel et al., 2015). crocc (rootletin), a marker of ciliated epithelial cells (Scimone et al., 2011), was expressed in the developing protonephridia during S6-S8 (Figure 1 – figure supplement 15 I).


 

back to top


FIGURES:


Figure 1 - figure supplement 18: Molecular markers for the developing excretory system

A, C: Average RPKM per embryo for transcripts expressed in protonephridia progenitors (pou2/3, six1/2-2, sal1, eya, osr) (Scimone et al., 2011) (A) or differentiated protonephridia (Rink et al., 2011; Scimone et al., 2011; Wurtzel et al., 2015) (C).  Transcripts shown were enriched during S5, S6, S7 and/or S8 and are flagged in excel tables for S5-S8 enriched transcripts (Figure 1 – source data 5, Figure 1 – source data 6, Figure 1 – source data 7, Figure 1 – source data 8).

B, D: WISH developmental time course with riboprobes complementary to the protonephridial progenitor and tubule cell marker pou2/3 (B) or the non-ciliated tubule marker CAVII-1 (D) (blue), S2-S8. Anterior: top (S6-S8). D: dorsal. L: lateral. Red arrowheads: definitive pharynx. Scale bars: 100 µm.

 

 

back to top


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30021661Carbonic anhydrase 7CAVII-1Stage 6, Stage 7, Stage 8distal tubule, protonephridia, renal system
SMED30030379POU domain proteinpou2/3Stage 5, Stage 6, Stage 7, Stage 8protonephridia, renal system, protonephridial progenitor cell
SMED30030007RootletinH.2.8b, croccStage 5, Stage 6, Stage 7, Stage 8protonephridia, renal system, integumental system, Category 5 cell, proximal tubule
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30030007 ID=SMED30030007|Name=Rootletin|organism=Schmidtea mediterranea sexual|type=transcript|length=6612bp
GTTGTTTTTAAATCACTATTTTTTTTATTTCATCTGATTATAATTTTTTTTTATTGAAATTTGTATTTTGAAATTGGTGA
ACAATGAGTGAGATAGATTATTCCGCTATTGTTCGGAGACGCATTGGAGATATCGATGGGGATTCAAGTGAAGATTCCAG
TTCAAAGGGTTTGCTTCAAGTTAACTTGGAACTGAGAAAGCGCTTAGAGGAAGAACACAATGAGTATCGTAGAAAGCTGA
TAGTTTTCCAAGACAGCCAACAGAAACAAGCGCAATTGGTTCAAAGATTGCAGAAAAAGGTATTGCAATACAAAGAAAAA
TGCACGGAACTTGAATCTAAAATGCAATTTGGCGATTATGAGACTCGAAAAACGAAGTATGGAAGTCCAACGAATAACGG
CTATGGGTCGCGTAGTGAGAATCCCTACGACAATCTGGATTTGGAGAGCACACTCATTAAGTTAGAAGAGGAACAAAAAA
AAACAAATTATCTAACGGAGTTCAATGAACGGCTTCAAGAACAATTAACTCAAGCAACTCAATCAAACCAGAATTTGACG
AGAGACATCAGTAAGCTTTCCGAAGAATGGCAGAGATCAAGGGAGGAGCTTGAACAGAGAGAAAAAATTTGGCGAAATGA
AGAAATGTCATTTAATGACTATTTAGCATCTGAGCATTCGAATCTGCAAAATTTGCAACGCAATACGATAAATTTCCGCC
GTCAATTTATAGAATTGAAAGCTTCAACTGAACGGGAAATAAATAATTTGAAAAATGAATTCAACCGACAGGCACGCTGT
TTGCAAACTGCTTGTTCCAATCTTTCGTGCAACATGAAATCTGCAGAATCTAAACAACAATTGAGTACTGAACGAGAAAG
TCGGGACAAGTTGAATCTCGAAAATCAACTGCGAGAAAAAAACAGAGAATTAACTGATTACCAAACTCGGTATGAATGTG
AAATGACAGAATTGCAACACCGAGTGAAAGAATTAACAGTTCTCAGTGACAAACTGAAAATTCAAAACCTGGAAAAGGAT
CGAGCATTGACAGCTTTGCAAAGAATTAAGAATGGAGATACCGCAGGAGAAATAAATATGGAAGACAAAGCTACAAGAGT
TCTTATTGAAGACACAGAAAGTATGCATCAAGCACTTCGAAATATTTCTCAAGTAGTACTAAATGATTCTGACTATTTCG
ATGCAGAAGACACAGGATTTGAAACAGTTCGAAAGAATAATCGTTCGCCAAGTCCAAGGAGAAATCGTAGCGTCAGTCCT
AACTCAAGATCAGCTAAAACACCGCCATTTGCCGATGCAACGTATGCGGCGGTTCAGTCGGCTATAAATAAAAAATCTCT
ACAGATTCAAGAGCTTAAATCAAAATTAAACAGTTCTAAAGAGAGTTGTACAAACTTCAAAAGACAAATTGATGACAATG
AAAATGAACGTCGACGATTAGAGAATCAAGTTCTCGCCATGAGAGATGAAATTGAAAGTTTACGACGAGATAAAGATGAT
AGTTTTAGAGAAGCGGATCGGTTTAAAAATGCTCTGAACATCACTTCAAATGAACGAAGCCAATTGGAAAAGATTCGATC
ATCACTAAACGATCAAATTGAGCAGCAACTCACAGAAATTGAACGACTTAAGTCAGCCAATCACGAATTACAACGATTGA
GAGAGGCATTGGAAGATGAGCAAGAAGATACTAAAAAAGACTTAGAAAGACAAATTAAAGAAAGTGAAAGATGCCAACGA
TCGATTGATGTTTTGGAAGATAAAATAAGTCGATTTAAAGAAGACGTAGTTAATTACAAAGAGGCAATTAATAAATACCA
ATTAGAAAAAGAAGTATTGGTGCAAGAAAAGGATGAGATTGGTGATGCTTTAAGTCGTTGTGAAATTTCTAAAGCCGAAT
TAGAAATCGAGGTGAATAAACGGCAAACTATTGAAGTAAATTTGGAAGAAAACATTTCAAAATTATCCTCAGAAATCGAA
GAATTGAATGATAAGCGAGCTGAAAACCACAGAACTATTAAACAGCTGGAACATGAAAGAAGTTCTCTTTTGAATGAAAA
ACGATTTTTGGAACAAGAAAAAAGTGGTTTGAAAGATGAGCTTGTTCGATCTGAACAAGAGGCTCTTGGTTTGTCAAATG
AGAAAGCCATTCAACGTCAAAGAATCGAACAACTTGAAATTAATACAGAAAGATTAGAAGAAGAGTTATCGGAACTCAAT
CGAGAAAAGCTAGATCTTACTGAACAAATAGGCTGTTTGCAGAGGCAGAAATCGGCTCTTGCAGAAGAATTGTTGCAATG
TCGTAGAGAATTAGAACGATCTAATAACAGTGTCAACAACTTATCAAAAGAAAAGGAATATCTTACCAAAGAGAAAGGAG
AACTCGTCGTTCAAGTTACAGCTTGCGAAAGGGAAAATCGTCAACAGTCAGAAGTTATTGCTTCTTTGAATTCCGATAGA
GAACAACTGGAAGCTACTCTTTATGATGCTCAACAATTAATCATTCAGTTGGAAACTCGAAAAGAGCAATTAGAAGGCGA
AAACCAAGAGTTGATTGTGAAAAAAGAAAATCTAAATGGAGAACTAGTCAGATTACGACAAGAGTTTCAACTAGAATACG
AGAAGGTTGTTAATTCACGAGAACAATTAAATTGCAGATATCAACAAATGGATAAAGAATATAAGATGGCAATTCAACAA
GAGCGAGATTCTCATGCTGAAGATGTAGAAAGACTAACTAAGATAAACGAAAGCAATCGTCATGGATCTGAAAACGAACG
AGAAGAGCTTATTCATCGATTCAATATGGAGCGTGACGACATGATTCAAAATTACGAACAAGAGAAACAAGAAATGGCCC
AGGAAATCATGACGATCCAACGAGAACGAGATGACTCATTATTAATGGCGGAAAATGAAAAGCAGCAATCATTGAGTTTA
TTAGAACAAGAAAAATGTGCAATCAATGAAAAGCTTATCAAAACGCAATTTGAACTGCAATCGGTTGAGTCGGAATTGGA
TCGCATTAAAAAGGAGTCGTCCAATCGTCAGGAGCAAGACAAACAGAACATTGCCGGCTTGTCGAGTGAACTCAAATCAT
TTAGATCTCAATTTGAGGATAAATGCCAAAATCACGAAATGGAAGTTAAAAGCCTAAATAGTGGAATCAAGGATCTAACA
TTAATGAAAGATCAAGCTCTCAAAGAAGTCCATGATTTGCATACCGGATTAAAAATAGCTGAAGAAACCCGTGATAATTT
GCGTCGGGAAATCATGGAAATGAATCGGAAATTGAAAGAAGCTGAGGAAGCCAAAGAGCACTTAAAGCGTGAAATTAATG
AATTGAAACGTGGATTATGCGAAGAACAAAGGGAAAAAGAAAATGTTATTAACTCAAATGAGAATTTGAGAAAGAAAATT
AAAGATGTTGAAACAGAAAGAATTGATTTGCACAGACAAGTAACGGATTCCAAACAAAAGGTTGCAGTACAAGATGAACA
ATTGGTCAATTCCAAACAAGAGGTCAATGAGTTAAGAAACAATCTTAAAGACGTAGAAAAAGCTCGATTAGATGTCAAAA
GAGAGTTACAAGAACTCAGACGCCATATCAAAGAGCTAGATACGGAAAGGGGCAAATTGACTAAAGAAGTCAATGATTTG
CAAACTCGTGTTGCTAGAGATGAAGAAAAAGAGGATGAAGCTCGTCGGGAAAATTTCGGTCTCAAACAAAAAGTTGTTGA
AACGGAAGCTTCAAGAGAAGCCGTTCGTAAAGATCTTGCTAATGCTCAACGACATATTGTTGATTTGGAAAATGTTCTGC
AGAGCAAAGACAGAGATTTCAGTTCCATGGTGGAATCGAGCCGCCGGGATTATAGGAAACTTGCTGATGCGAGAAATAGC
CTGCAACAAGTATATGATACGATGGTGGCCGATAATAATGAGCTGAGAATTGCTCTCAGTGGAGCAGAAGGTCGGGTCAG
TGCTCTGGAGTCACACATCGCACGAGTTGAAGGAGCTAAGAAAGAAATTGAATTCAAATTGGCTTCTATCCATAGCTCAT
TGCGAAGGCTGATAGGATTCCGACAGGAGAATGTAGTTACTATTCGGTCGAGAAACAACTCCAAATCTCCAGTTAGAGGT
CGATCAGTTAGTCCTCTTAGAAGTAGGCCGGTGTCGCCAACCAAAGGATTTGACAATACCTATGCTACTACAACTGATGG
AAAAGGTAGCCCTATCCCGCGCACAGGGTCTCCGAGTTCTAAACGAAGGCAATTATCAAGATCTCCGTCTAATTGCGATT
TCAATCCAGTCGATATAAATCCAGAAGCAGTTCGTCTGGCCTTGCGAGAATTCGTACAGCAGTTGGTTGATGCTGAACGA
GATAGAGATGACGCTTTTGCTCAAGCTCGCAGCCTAGAATCTCGATTGAAAGAACAAGAAGAACAAAATGAATATGCTGA
AAACCGTTTACAACAACTACAACAAGCTCTGTGTGATGCAGAAGAAGACAAAAAAGGCATTGATGGAAGATTGTCATCAG
CCCAAACTGCCTTAATGATGCAAGAAGAGACTATTCGGCGCAATGAGAGAGATAGAAAAGCAATGGCGGAAAAGTTGAGT
AATTACGATAGAACATTTGCATCCATGGAATCAGAAAAACGACAATTGGAAGATCGGTTGAATAAATTCCGTCATCATGA
TGCCCGATTGGAAGAAGAACATAAGCAGAGCAAAAAAGCTATTGAAAATGCTGAAAATAGAATAACTCAGCTTCAGCTTG
CCAAGCGATCGTTAGAAGGAGATCTTCAAAGAATGAAAATGGCGTTGACAGATAAAGAAACAGAAACCGAAGTTTTGGAT
GACCGCGTAAATAGTTTACTCAAACAAATACAAGATCTCGAGGGAAAATCTCAATCACTTCAACTAACGATTGACAGAAT
GAGTGTCGCCCTTGCAAAAACTGAGGAAGAAGGCAGTTTTCATAAGGACAAAATGCAACAGTTGAATATGAGTTTGAGCA
CTCATTCACAACAACTGGAACAATTACAGAATAAGATTTCTCAATTACAAAAAGCACTCGGCAGTTCAGAACAAGATCGT
CGGCTCTTAGAGGAACGATTAGAAAGCTCTAAAGGAGCATTGCATGAGGCAAAACATCAAAATAATTTGTTGATGGAAAG
AATACAAATAATTCAATCCGATTTAAATGATTCGGAAAATCGTCGATCAGAATTGGAAGGATTAAATCGACAGAGTAACA
CTTTGATTGTACAAAGACAAGAAGCTGAACAAGAACTCAATCAAAAATATCAGAAATTGAACTCGGAGAAAAACACATTA
CAAGAGCGAGTGAATAGCATGCAACGAAATTTGGCTTTGGCAGAAGCAGAAAAACAAGAAATAATAAAAAACCACGGAAA
ATTGGAAAAGGATAGATCTGCCTTGAAAAAGAGTCTTGGAAAAGTTGAACGTCAGAAATTGAAAACCGAAGAAATTGCTA
GCAAAACTGTTTTTGAACGTTCAGAATTAGATCAAATTTTAAGGAGACTTGAAGATGAAAATTGTGAATTACAGAGACAA
GTTGGAATTCTTCAAAATCAATTAGCAGAAGCTGAGCAAGCTCACTGCCACCATTTGATGGAAATCAATTCCCGCCATCG
CCAGGAAATGTCCATGGAAATGGAGCATTTGAGAGCATCGAATGTTCAAATAGAACGAACTCTAGAAGGCAGAGAACGAG
CCCACAGACAAAGAGTTAAGGGTCTGGAAGAACAGATCTCCACCCTCAAAGACCAGCTGACTCATGAAATGCAGAGGCGG
ATGGATAGTGGATATTACGAGTCTACCAGAAAGTCTAATCAATACGATTCAACTGGTGACTTGCGACATGTTCTGGATTC
CAGTTTAACTCGAGTTGCAAAAGACCCTCAACTGGACGCAATGCTACTGGAAACCGAAGCCAGGCGACTCGATGAGTCGA
TATTCATGTGTGGCAGTCGTGATCAGTCTCCGACCCGGCAGAAGCGAATCGAAATGTCAAAGAAGTCCGCAGCCCCTAAC
AATTCCAATCGGCGATTAACTGCCGGCCGTCGCAAATGAACTCGGCCTGTTCCAGTCCGTCCAGAGATGTTATGAAGCCA
CTTTTTAGATGCGTGAGTGTGAGTTCGTGTTGGTGACTGATTCATTTTTAGTAAACAGATTCTGGATTTTTGTTTTTATT
GATAGTGTAATTTCCTAATGCAGATCTGATAGTTGACTTGTTGTTCTTACGTATTCGGTATTTGTGATTCACATAGTCTG
TCATTGTTACTGTGATTTATCCTCTGTGTGACTTTTGTGATTTACTTACTTTATTGCCCCTATAATCAATAAATGGATTT
ATCGATAGTTCAGCCCTCCCCTCCAGCCCTCGTTTTGGGATCCGTAAATTTTGTTTCAATTGAGATCATTATAGTGATTT
TATTCCTTCGAAACCAAACCTTTGGGAGGGACATAAAATTAAATTATTGATTTTTTATTATCTTAGAAGTGAAAGATGTT
TATTTCCCAAATTAACTAATATCAATAATAACTTTAATTTATATCTTCATTA
>SMED30028196 ID=SMED30028196|Name=POU domain protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1170bp
GTATTTAGTAATTTAAAAATAACCTATTTATATTATTGATTAACATAATATAAATATTTAACATCTATAAGATTTCATGA
ATTATTACTACCAATAATTTTTTTAAACTTAAAACACTTGATAAGTATCATGAAATGTTTTTTATTTCCTATTGAATCTA
CAGAAAAGGATAAGTCTTGCACCTTTGTTCTGAAAGATATTAATGAAATTCGAATTTCTGTTCCTATAAAGATATCAGCA
AATAATGATTGTAATAAAACAATTAGCTTTTCTAATTCAGATTTAGAAACTTTAGCCAAAGAAATATCAGCTGCTTTTTC
TAGTAATACTATTGAAAAGAGTACAGAAATAAAAACACTGAATGATTTTATACTTAATCAAAACAAAGATCTTCAAAATT
ATATTAATCATGTTAATGATATACCTACTTTAGATGACTGTTTGCGAAGTAAAAATTTTATATTCAAAACCGAACAAGAT
TTAGAAAGTTTGCATAAAACTCCTTCGACGGCTAGCGAGCAAGAGTCATTAAATATACTATTGAATAAATCTTTGGTTTT
TGATCTGGATTTTATTAAGCAATTTACTAAAGAATTTAAACAATTTCGACAAAATTTAGGAGTAACCCAAATGGAAGTCG
GCCAGTCCATGAAATATTATTTGAAAAGTGATTTCAGTCAAACAACGATTTGTCGATTTGAGTCTATGACGCTGGCATCA
ACAAATATGTTTGAATTGATTCCATATTTCCGAAAATGGATATCCAAAGTATATAATCCCGACAGAACCAAGACAATTAA
AAATGTCATTTCTAAACTGGAATCAATTGACATTTCTCGAGCATTGGAAGACGAGTTTGCGAAAGATAAAACGGACAGCG
AGTCCAGCAATAACAGTAATGGTGATGAAATGGTAAATGTCAAAAGCAAAACTCGGAAACAACGAATCCAATTTACGAGA
TTTCAGTTGAAAAAAATGGAAAGTCTTTTTCAAACAGTCAAACATACGCAAATTACACCGCATGTTTACAAGAAATATGC
TAAAGAATTGAAATTGAGTGAGAAACAAATCCGATGTTGGTTTACTAAGCGCAGAAGGAGTGATAGAATGCACAAGAATA
AAATGAAAATGGAAAAATTTAATTTATAAATAAAATTATGAAAATTTACG
>SMED30010910 ID=SMED30010910|Name=POU domain protein|organism=Schmidtea mediterranea sexual|type=transcript|length=3203bp
TAGGGCTAAATGTAACGCTACTTATCGGTATTGCCACAATTATATTAAGGCAGTGGCACAAACTTATTTTCTCTACCAGG
CCTGCTGAATCGACAAACAAACATATTCATCGTCATTAAATGGGCAGTAGTAGTAGAAACACAGTGGTAAAGACATGGCA
AACACAGCAGCATCAGTGATAGCTGGAAGAGATAGCTACAGCATCAGCAGCAGTAACTCTCGCAGCTAATAATGAAGATA
ATGAGCTAGACTTAATTATCTTGGCTAATAATTTCAAATAAAATATCGCAACTAATTTTGTCATTCGTATTCTGTGAGGA
TAAATCACAAATTTGTTTCGATTGTTGGAAATTTAAATTTTTTTCCCTCGTATTTTCCAAATACTCCAGAGTTTGAAGAG
TATAATGAATTTGTTACCGAATCCGTTACTCACAAATGTGCTGGATATGACTAAACTTGACCAACAAAACCAAATTATCT
CGTGTGGCAATTCGACAAATTTCACCAACAAAAACACAATTGACAGCTCTTCAAATGATACCACACAAGTCAGTTCAACA
GCCAACAACATCAGTTCAATTGAACATTTCCTTTCATCCCGCAATTTAACAAATCAGCTGATAAATAATTCCGGACTCCC
ATTAGGGGCACAGATATTCACCATTCCGGCATCATTGGCGACATTCCCGAATTCGGATTTGATTCCAGTATTCATCAACA
GTTTAGGACAAATGGTTCTGGCAAATACTGGGAATATTCTGGCGAACAGTTTGGCAAGTTTGGCCACCACACTCACGTCA
ATCCAGCAGCTGTCCGTGAACCGTGAATCGAATGTCATCAACACTAATCAAACTACTAACCCAAATGCAGCTATCATAGA
GCACATGATGCAGCAATACCAACAGCTTCAGCTGCTGAAGAACTCAATGATCCATCAATCATGGCCGAATGAGTTCCAGC
AGACATCCTCAAACAACCAAACCAATTCATTTATTGCAAATAATATACCAGTAGCAACTACAAATTCTAGTACAATTAAA
CCCATAGATAAAGTTAATGGCAGTACGCAATTCCAAATTCCGTTGAATTGCAATCCTGCTCCTCTTCAAAATGAAAAATT
TACTACCAATATCATCTCCATAAATGATCGTGCTATAGATAACAAATCCCCAAGCGTCAACTCTTCGGTATCCTCTAGAT
CAGTAGGAAACAAAATTTGTCAAATGATTGACGTCAGTCATGATTACATTTTAAGTCAAGAAGATCATCTGGTGAAAGAA
AAAGCCGCAGAATTACTCCGACATTCACACAACCAAAAAAACGCTATCAAACATGCCCAATGTTCTGATAAATCAGAACC
AACAGCACATAATGTCACAGTGGATGGTGTTGATCTCGGTGAAATCAAAGAATTTGCCCGTAATTTCAAAATTAGACGTC
TCAGCATGGGGTTAACTCAAACACAAGTCGGTCAAGCGCTGACTGCAGCAGAAGGTCCGGCATACAGTCAAAGTGCAATC
TGCAGATTCGAAAAGTTGGATATCACACCGAAATCGGCTCAGAAAATTAAACCAATTCTAGAGAAATGGATCAAAGAATC
CGAAGAAAAATATCTCAGTGGATCGAACAGTGTTGATGATGGATCCGGATCTGACATCAATAAAAAACGGAAACGTCGAA
CGAGTTTTACACCACAAGCACTGGAAATTCTGAATATTCATTTTGAGAGGAAATCTCATCCGACTGGATCGGAAATGCGA
GCATTGGCTAACGACCTCAATTATGACAGAGAGGTCATTAGAGTTTGGTTTTGCAACAAAAGACAAGCGTTAAAGAATTC
TGCCAAGCGAATTAAACAATGTACACCAAACAGCGAATCAAACAACCAGCACATATCTCCCCAAGTCATGAACAGCAACA
GCAACAGCAACAACACCACCATCACCAACCGGGCAGTCACCTAGGCCAAATGCATCCATCCATGATGGACATGTATCAGC
CACACGCGTTCTCAAGACCCATTACTGCTGAATACCAACAGAGTCTCAATCGGCAACAATATCGACGCAGCGACAGCGAT
TGTGGAACTCATGAGCCTGGATATTCGTACCTGCCGACTCCTCATGGGCCAGAAGTGGTGTCATCTCGTCAACATACTCT
CAATAGTCTTCCAGAACAACCGATGGACAATAACAATCATGATCAGCATGATTCTCCAGTACCGATTATTGCCAACAGTA
GCAACAGTAACATCAACAATAACAACAGCAGTTCTGGTCGACATCATCATCGTCGCAAAACCAGATCTCGACAAACCAAT
AATCAAGAGCCGACATCACTAGAACGGAGCCAAGTAATGAAAAATCACAACGACATACCACCAATGTTAGCGCCACGGAC
AAAATTGCCGTATTCCGAGCATCAGGGAATTCATCGTCTATCCGCTCATGAAATGAATACCATTGACAGTCGTGACAATG
CTGTCAATGATTGCAATTCTGAATCCAATACCGCTGGCGCTGTCAGCGATAATTTCGACCCTCCTCTTCATACTCCGGCC
ATTACGATACCAATGAGTCGAAGTACCGCATGGATTGCAACATCGATATGAATGAAAATGAAGCAACTCCCAGTAATTCT
CTGTTGATTGAGAACCTTCCCAGAGTTAGAGATGTTTCCGAGTATGGAATACCTATAAACAATAACAATCACAACATGAA
ACAAGCTCCCGTGCCTCCTCTTAAATCGAATAGTCGACATAATCCTGTGCCTAACAACAGTTACGGTCTCGAGTGCAATC
CTGATTATTATTCATCTGCCACATCTAGTGACAGATCCGGTCCCAGTCCTCCCCCTAAATATGCGCCAGGAGTAGTTCTT
CCTGCCCGTGCTGATGAAATATATATGCGCGATCAAAGAGAAGGAATGTACTATCACGGAGATACTCATTGTTGATAATT
GTATTTCACAATTTCGTTTCATCGGGTGTTCTCGATTGCTGATACTCTATCTCATACCTTTCGATGAATTTCTGATCCCA
ACTGACAGTTGTACAATTCTTATCATCATCATCATCTTCCTCATCTTTTCATATTTTATCTAGTCCTACTTGCAATCTTC
TCCGTGTGCTCTCCACAGTGCGATTATTATTATAATAATAAATTATTGCTATTGATTATTATAATTATTGTTATTGATAA
TAA
>SMED30001958 ID=SMED30001958|Name=POU domain protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1820bp
GAAGATTTCAACCAATTTCATTGTTAAAATTTTCATAAAATCGCCGTAATTGGCTGTCCGTTGCGGCAGTGGCAGTCAGG
CAACTCCGTTCACTCAGCAGCCAATAAACTCGTTTGGAAATATTCCTACTCAAATCAAATTGATTTCTCATAAAAAAATT
TGCATATCTTCTCACTTTTTCTATATGCATTTCATTGTTACTTGGTGAAAACTGAATGCCATGACCCAAGTTAGTCACAT
AGGTTCCTCTCATTTCAATATTAATTCTTCAATCAAAACTGCTCTTCCTTTAATTAATTCTCAATACAATTCATTGGTAA
CCGAAACATCTATTGGTTCCAACATCAACCTACCGTTTCGACTCGATGCTCCATCTCTATTCAATGGGCTACCGGAAGAA
TGGGGTCCCACTGACAGCGAGTTAACTCAAGCGGTCAATCATGTAAATTACGCCGGATTATCCGAGTCGAGCATTGATTA
CAAGTTTTGCAGCACTCTCAATTCTTATTTTGACTCAAATCAAAGATTTGGAAATGTACCAAACGACACGTATTTAATGG
CAAATTCCATGGCAGCCAACATTGAGAACAATAGCTGGCATAACAGCCGATATTACTTCGACAGTAATCATCCTCTCAGC
CAATGGCTCCCGGTGCCCGTTAACTGTTGGTCCAATAACAATTACATTCGCGATGACTTTTACGAGAAATCTCTCCAGGA
AGATGAGTTCAAATCCCGCTCGGTAATACAAGCAACTGAGAAGAATTCCAATCCGGTAAATCCCGACCTGAATCCTTACA
AATCTATCATTTCCGATGAATCAGAAAGCATGAAAATGGCTAAAACCTCCCACAACCTTATAAATAATGACTCGATGAAT
ATGTGTAGATTTCCTCAAAATGATATTATTATGCCAGATTTAATAAATGCCCCAAGTCCATCACTGACAAATAATAATAA
TAATAATAAAGTAATAAATAATTATTATATAATGAAAATTAATATATTAATAAAAAATATTTATGCACGGTCTCAATTTA
CATCTAAATGCCATCAAATTTGGCAGGGATACTTCTAATATAAAACCTAGATCAGCTGAAAGACTTTTATATTAGATAAA
TAATCGTTAATAAATAAAACCCAATTTGCGATAAATTATGTGTGGCCTCCAGGCGGTTCCTATCAAATAAACATATGTAA
TTATACGTGTAAACACGTGCATTAAATATCTTCACAAAGTCAAATGAGTTGATTGGACAGAAAAATTAGAATCGGAACTA
ATTCTGCAATCATTCAAAAATTTGAGCTAATCTTTATTCTTTAAAAAGCAGAGAATCAGCGGTTCTTTACATTCATGCCA
GTAATGAAAAAAGTAAACCGCAAATGACTTTTATTACTGTTCTAGTAAATGCATCCCCATAAGGAGAGTAATTCACATAA
AACTTTAATTGTCAATAAAATTATTACTGGGACATCAGCGCATCCTGGCATGCACCGCAGCAATGAAAAAGTAGACCGAG
AAACTCTGAGATTATTGAGCCATCAAACGTATCACTCATTTTCTTATGTTTGAATAAAATATTTACAAATTTTAATACAG
AGATAATCGATGGAGGAGGAACACTACTATTTTTGCTATCTATAGCAATCAATAATTATGTGAAAATATAGCTGATCAAA
ACAAGATGCATTAAAACAATTTTACTTCCTATTATATACGTTTTTGAATCCTGAGTGAAGCCAGTCGGGTTAACGAATAT
TATTAAAATGAAAATAACTATAAATCAATAACTATACCTCATCACATGATGAATGGTCCA
>SMED30015552 ID=SMED30015552|Name=POU domain protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1696bp
TTATTTTTAAAGTGTATCTTAATATTTCAAGAAACTGTATTATAAATTTCACAAATTAAAATATTTGGGATATTTGTAAA
TTGTTAATAACTCTTCATAAATGTCTCAATCAGATGGAAATTTCAACTCCTTTAAAAATATTCACATTGAACAGTTATTT
AAAATTATTCAACACCAAGCAGAACAAATTGAAGCACAAAAAGTTCAAATAAACGCTTTAATAAAGTCACAGCAAACGAT
ACTAGAAAGTATGAGACCTCAAAATGATGCAAGCGTCAATTTAAATCCTTTGTCAATGAATTACCTTAATCACAATATCC
GACAATCTTTGTTGAATTCTTCCTTAATGCCTTCAAAAAATATTTTAAACAATCCCTCATTAAATTGTGCTAGCAACAGC
AACAGTAACAGCAGCAACGTCATCATCAACAACAACAACAGCAATATTGATGTTTCAGACCATTTTCTTCAAGACTACAA
TAGTCGATTAACACAACAAATTCTTCTTCAGCCTTCCTTGAATATTCCTCGCTCAAATCCCACAATAAAATCCCCTCATT
TGCCAACGAATATTGGAGGCTCAGGAAATCTAACTCCCACAACTTGTCTTAGCAACGAAACATCTGAATTGAGACCCATG
GAAAATTGGTCCAATTTTAAGTTGCAAGCTCATTCCGATACTCAAAACGTAATCAAAAAAGAAGTAGCAGATCAATCAGA
CAATTGTAACAATTCTGAAATTCCAATTATCGAAAATGATCCAAATGAAGATGAAGGAGAAATGGATTTGTCATCTCTCC
AAGAGTTCGCCGCAAAATTTAAAATGAGTCGTATTGAAATGGGATTCACGCAAAGAGATGTCGGTGTTTGTTTGGGTTTG
ATGCAGGGCAACGATTTTAGCCAGACCACACTGAGTCGGTTTGAAGCTTTAAATCTGAGTTATAGGAATATGAAGAAACT
GCAACCGTTGCTACAAAGGTGGCTGGATGATATTCAACGAGAAGGTCGTGATGCCGTTATGAGTCGCATAACGGCTTTTT
ATCAACAACAAAAAGCGATGGTGGAGGAAGACTGTGATAACAATGACCTCCAAATAGTCAGTGGCTCAAGTAGGAAAAGA
ATTGCAAATGAAGGATTGCTAATATCCGACGAGTTACCCGAAGAACGACATTCAGTCAATGCAGATTCGACTACTATGAA
TTCCAAATTATCACAAAATCAATTACTTCGCACTTGTATAGGAAATATATCGAATAGTCTTTCACCTAGTCTGCTCGGCA
ATTTGACTAATGGGTTTTCTACAAGTCTTTCCACCTCGCTCCCAACTAACCTCACTCACAGTTTTCCGAATATTCAGTTT
CAATCTTCATTACTCCACGACCAAATCGCCAACGGATTCAACAGAAATCTTTCTTCCCAACCAAAAAAACGACGTAAACG
ACCTCTAATATTGGAAGAAGGCAAATCAAGATCGGAATTGTTTCCCGATATTTTGAGACCGTAATCAGACCGGTGGAAAA
GAATCAAAAAAACAACACAAGTTCTACGGCTATTTTATTTATTTTCGCCATTTCTCGCATTGTAATATTTTGTAATTATT
AATATCCTATCTATTGTTTTATAAAATCATATTTTTTTCAAATTGAATTTTTTATTATTTTTCATTTTTATTGACCTGGT
TTGTGAGTGTTCGGAA
>SMED30002016 ID=SMED30002016|Name=POU domain protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1339bp
GTTGAATTTTTCAAAAACCAAATTTACTTATTTTGAATTGCCATAATGGAAAATGGAGTTGCAACAAGCTGTTCACTTCT
AGCTAATGGTGGATATCATAACTCTGCCTCCGTCGGTTGGAGGTTTCCGCAGAACAATTCAGCCAGCGATTCCGTTGAGA
ACGAATTTATATCAAATGCAAATCTCAAAATTACCTCTTCGAATATTCCAAACTTTTTTTACCAATGTCCGGAAAACAGT
CAATCAACGAGCAATTCTAACGGATTTTATTCAGTGGATACGAATTGCTCGGCTGGATTCCAAGACATGAATACTTACTA
TTCAAGGGTTGCAGCAGGCTTCAATCAATCCTTCGACTTGATACCTCAACACCAGTCTTTTGTGAGGCTCAATTCAACTG
GGCTATCGGAAACTGACCAAATGACTTATATAAATCCAAATCTTCATAGTTCATTTCATCGAAATATTTCATATCCGAAT
TACGGTAGTAACTGTCCTCCTAATGTTAACATAGGAGGAGTTTCCATGGTTCAAGGGTCTTCGTCATCCTTTTTAGGCTC
CAATTATTCAGGCATGCAACAACCAATTCAAGCCGTGAATCAAGGTGACATTGAATATGAAACCCGAGAATTAGAAGCTT
TTGCTGAATGGTTTAAACAAAGAAGAATAAAACTGAGAGTGACTCAGGCGGATGTTGGCCGAGCTCTCGGGAATTTAAAA
TTAGCCGGTGTTGGATCATTGAGTCAATCAACAATTTGTCGGTTTGAATCACTAACTCTCAGTCATAACAATATGATTGC
TCTTAAGCCAGTTTTGCAAACCTGGCTCGAAGACGCTGAAACCGAAGCTAAGGAAAGATTAAATGGCTCTGATGCTTTCT
CTGACATAGATGAAAGAAAACGCAAACGAACTTCAATCACAGATTCAGAAAAACGATCACTGGAAGCATTTTTTACGATT
CAACCACGCCCATCAAGCGAGAAAATTATCCAAATTGCGGAGAAATTGAATTTGAAGAAAAACGTTGTTCGAGTATGGTT
TTGTAATCAGCGCCAAAAACAGAAACGAATGAAGTTTTCCACTCTCGGTTTTCAGCACAACTCGTCAAACATGTGAAATC
CTATTTCTGTACAGGACAAATACCAAGCATTGACCCCTCTGTCTTATTACAAAAAGTGGTATGATTAAAAGTAGAATAAA
AATGATTTTTATTATTTCTTGACCGTAGCTTTTGTTTAAATTGTTTGACTTCATTTTTACGAAACTGTTATTTTTCCCAC
TGGACTGAGTCTTAGGTTCAAATGTGAGATTTGAGGTTGAGCTTTTGCTGAGAATGACA
>SMED30030379 ID=SMED30030379|Name=POU domain protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1625bp
AATTAGCTATGCGAGCTGCTTTATCAGGCATGACTGTGATAAAACTGTCATTATTTATGCGCATAATTTGCCGTTAGTAT
TTGCTCAACCAATTTGACGTTCAACAACAACAGCAACAACATCCACCACCTCCACCAACATCCTCATTATCATTATTATT
ATTGTCATGTTAACAAGCGGACTTAATCAGGAACAATCATCGCCTTTAACAATCGTAGGCATGAGTGAGTCTCAGTTTTT
CAACGAATCTATCAGATATTTGCCTCCGGAAACCGTGGAGAGACAAAGCCAATTTTATGCAAATAATAATTATCCCCTTG
GTGAGTTTTGGAATCCACAATCCGAATATGCACAATACTTGCAAAATACCCAGCCAGTCTCGGGGCCTCAATTCATTACT
TCGCCGGCGGTTGGAGAGGCATTCTATCCATCTCTTTATATCAATACTATCCATGAAAATGTATTACTACCTTCGGTTGA
TTCCTTCAATCCTCCCAGTGGATTTATGATTTCGGGATATTCACAGCAAGACCAAACCTTTCCCACGGTCAATGAACCGA
CGTATGACAATATCCCAAACAATTGGAATTATGTTGATCATTGGGTTGATTCCAAGCCAACAACAGTGAATTCTCAGCTG
TTGCCAACCTCGTCAATTTCCGCCGTCCCCATTCAGAATTCGTTTTGGGACTGCGAGTCGATTGACCAATCAGAATATTG
TCCCACAAATGTTGATACCGAGCTCCAAGATCAAATTGATTCCAACGGAGAAATCAGTAGACTCAATCAAAAGATTTCTA
CTGACGAGTTGGAGCAGTTTGCGAAAATTTTCAAACAGCGAAGAATCAAACTCGGATTTACACAAGCCGACGTCGGGTTA
GCCCTCGGTAATTTATACGGCAGCGTGTTCAGTCAAACAACAATTTGCCGGTTTGAGGCACTGCAGCTCAGTTTTAAAAA
CATGTGCAAACTTCGACCTCTGTTAGGGAAGTGGTTGCAAGAAGCCGACTCAACCGGATGTGCTCCGTCCGGTATTGACA
AAGTCACAGCTGCTGGACGAAAACGAAAAAAGCGAACCAGCATTGAGGTTGGAGTGAAAAATGCACTGGAATCTCACTTT
TCTCGACAAAGCAAACCGACAGCCCAAATCATTACACAGCTTGCAGACAGTCTCGGATTGGAAAAAGAAGTTGTCAGGGT
ATGGTTCTGTAATCGGCGACAGAAGGAAAAACGAATGACGCCTCCGCCACTGAATGGAACAAGCTCAGATTTATTTCCAC
ATCCTGGTTTAACTGTCGGAACTGATAGTTCTCCTCATTCCTCATCTCACAGTAATCATGATTCATTCTCGTCCATTGGT
AACCAGTCAAGCTTCAATCGAATAGGTGATCCCTCCTCGACTCATCCCGGAGTCATTGTCACATCTTGCGGTTATTACTA
TGGTCATGTTCCAAATGAATCACTTCTCAATTGTGGGCCTTACCCTCACAACATCATCAACAATTACGAATTCAGACAGT
CCAATGATCCCAATATCCTCAATGTCAAATCCGAGTGCATCAGCTGACTCATGTCGAACTCACCGAAAAGAAAGCTAATA
ATATTCTATTTCAATAATAATAAAA
>SMED30008552 ID=SMED30008552|Name=Carbonic anhydrase 7|organism=Schmidtea mediterranea sexual|type=transcript|length=911bp
CCGATCTAAATAATTTAATTCAATAAATAATTTCAACTAAAGTTTTTATGATTTCTGAAGATTGGGGATATGGACCTGAG
AACGGTCCACATTTATGGCACAAATCGTATTCCAGTGCGGGAGGATGTTCCCAATCTCCTATCAATATAGATCTTTCACA
GACAAAATACGATATGACTTTAAATTTACATCCTTTAAAAATATGCATTGATAGTTCGAGGACATCAAGTCAGACTTTGG
TATTTACAGGACATAATTTCCGAATCGACTGTGAAGGAGCACTATGCGCATCGGGAGGCCCAATTCCCTATGGTCAAATG
TACAAAATTTCCCAAATTGTGTTTCATTGGGGCAGTACAATTTATGGAGGATCTGAACATTTGATAAATTGTTTTCAATT
CCCATGTGAATGCCAAATGACCTGCTACAATGCCACTCGTTATAGGTGCTTCAATGAGGCGGTAAATAAAAGAGATGGGC
TAATTATCCTATCTACAATGATATTGGGAACAAAAATAAAACCCTCGATCGTTTATTGGGTCCTTTGACGTCGATTCACT
TTTTCAAACACCATGACTTCCGGCAAGAAACCGAACTGTTAGATTTGAAATGTCTTTTACCAGATTGCATCAATCGATAC
TTCACCTACACTGGGTCATTGACTACCCCACCTTGCTATGAAACTGTTACGTGGATCATATTCGAAGGATCCAACACAAT
CAGTGAGGATCAACTAAATCTCATGCAGAAAGTTCACGTAGCCGACGGCTGTAATGGCTTTGACAACTTCAGACCGGTTT
GCTCACTCGGCCAAAGAATCATTACCAGAAATTTTGTTTGAGCCTTTTTTGAACTTGATTTATTTAAATTTTATTTTTTT
AATTGCTACTGTAGTGGATGTTATGGGGAAT
>SMED30021661 ID=SMED30021661|Name=Carbonic anhydrase 7|organism=Schmidtea mediterranea sexual|type=transcript|length=1073bp
CATACATATATATATATATATATTGAGACTATTCATTTTTTTCCATACAAAATTCAAACAAAATGAAACCATTTCTATTT
CTATTTTTATTTCTTGTCTCATCTCTTGATCTGAAGATCACCGAGGCTTCAGGCACCGGAAATTGGGGCTATACGTCAAC
CAGTGACATCAAAGGCCCCTCGGACTGGAAAGACATTAATCCAACTTGCGACGGAGCTCGGCAATCACCGATTGATATCG
TGACAAGAAGTGCGGTTTATTTGAAAGATTTACAAAGGATTGAAATTAAAAAAATTGACAACTTTGCTAACTTTTCCACT
CTCGAAAGACATGAAACCTCTATTTACTTAAAGCTTAATAACAGTTGGGGAATCACTTTCGGAGGAAATCAATGCCTAAG
ACCTGACTCCATTCATTGGCATTGGGGATCCAAGGGTACTTTAGGATCGGAACACTCTCTAGATGGGAAGCATTATCCAA
TAGAAGGCCATCTGTTGTCATATAATTGTATGAAATACAGTTCTTTGAATGAAGCAAAATCGAGTCCGGAAGGTCTTTAT
GTAATTGGTATTTTTTATAAAATCGGAAAAAAAAATATGTTAATTGACAAAATTATCCCGGCAATGCAAAGTCTGATTTC
CAGTAGTGATATCTCGAGCGTGATCATTAACGAGATTTCGGTGGAGGAAATTCTACCGAAAAATTTGGACAAGTATTATC
AATATGACGGCTCATTGACGACCCCTCCATGTACAGAAAACGTCAGGTGGACAGTGCTAAATGAAGAGCTAACTATAGAT
GAATCTCAATTGGAAGTTTTTCGCCAATTCGACTTCGAATCTCCCAATTCTGGGGAAATGGAGAACAATTTCCGACCAAT
CTTATCAAAGTTCAATGAAAAACGAACAATATATTCCTCATTCAAAACGGGGTCCAGTTAGACAATCTTATTATGGGTGC
TTTGTGCAATCTTCATGTGCCTGAATAGTCGATAATATGATGTTCATAACACTCAAATAGCACATTTAATTCATTTTGAT
TAACACTATTTTTCATTTCATTTATGTCAATTA
>SMED30021108 ID=SMED30021108|Name=POU domain protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1667bp
TTCTGGATTACGAATAGCCTATTGCAATTAATAACCGAGTTTTTTTCAAGATTGTCCTACAATGATCATTAAATAAAAAT
AATCCACATGAGTATATCAGAAAATAATAAAGAAAAAGATATTATTTACGGCTTGGAAGCAAAGCATATTGTAGATTTCA
ATGTTGCATCTCATTTAGATGAAGAACAAGACGCAATTTCAAAATCTATTGGGCGCAACCAAAAAACTGATAAACACTCT
CAGTCGTTAAATGGGAAAACTCCCAATGAACCACTGGATCACAATTCATATATCAAAGCCTATAACGATGCGCTGTTTGA
ACAGCGGACTAATTTCAATGGTTTGAATTCAGATTTAAGCTATTCATTTTTATCTCAGTATGGCTATAATAATGATGAAA
GAATGGATTTTACACCGTATTCTTTGCCAATTGATATGATTGAACAATCTTATAATTCCTGGTCTAAATCTAACGCATGC
ACATTTACAGAGGCGCATCTAAATTCACCTTGGTACAATCATTATCCGTATCCAGGATATGCATCATATAATTCTTATAT
GTGTAATATTCCACCGGTTGCAACTTCATCTATCAATGATCAATCTAATATGAGTTTTCCTAATCATCCAGCATTCTCAG
ATCTGGAAGAGTATGAACAATTAAAACAATTCCAAGCAAGTAATTATTCTGTATTTCCACAAGATTCTTTTTTAAATCAT
TCAATATCAACTCTAATGCCTCCGTTAAGGAATTCTCAAAGCACCACCCCTTTCAACTCAATCAATCCATCATCTCATTG
GTTGGATGTTAAAAATTGGCCGAAATCTGCCTCTCAATCAGATCAATTCGATCAAAATTCATTGAAACGTCAAATTGATC
ATTTTCCTTTGAATATCCCAACGGCGTTTTCTTATCAATCATCCAACTCAATGTCCCTACTCGGCTCTCAACAGCCAGAA
ATCAGTAAAGATCTCTTTTTGTCCGATTCCATAATTGAAAATTCAAAACTAAGCACGATGGACTGTCGAGAATTGGAACA
ATTTGCCAAGACTTTCAAACAAAGACGAATCAAGCTAGGATTTACTCAGGCTGATGTCGGTCTGGCGTTGGGTACGTTAT
ACGGGAACGTATTCAGTCAAACCACAATTTGCCGATTTGAAGCATTACAGTTAAGCTTTAAGAACATGAACAAGTTGCGA
CCGTTATTAAGCAAATGGTTAGAAGAGGCTGATTTGTCCTTGTCAAACACAGTCGTGAATGTAGAGAAATTAGCGAACCA
AAATCGACAAAGAAAGAAAAGAACAAATATAGAAATGAATACCAAAGATATATTGGAATCAAGTTTCAATAAAGATCCAA
AACCAACTGCTGCTCATATTATATCATTGTCAGAGAGAATTTTAATGGATAAAGAAGTAGTTCGGGTTTGGTTTTGTAAT
AGAAGACAGAAAGAAAAAAAATCCAGTTTAACCAAATCTATTTCCAGTAGTTAATACAATCTTTCCAAAAAGAAATTCTT
TTACAGATTCGACGTTTTATTATGGAAATGGTGTGAATAAATAATTTCTTCCCATAAATTTTGCCGGTTTTCTAGCTTGT
ACAGATAAAGAAAAATACCCGTTTTTACATTTTCCTAAACTTAAAATATTCAACATTAATTTTGAAC

 

back to top


ADDITIONAL REFERENCES:


Scimone, M.L., Srivastava, M., Bell, G.W., and Reddien, P.W. (2011). A regulatory program for excretory system regeneration in planarians. Development 138, 4387-4398. 

Vu, H.T.-K., Jochen C Rink, Sean A McKinney, Melainia McClain, Naharajan Lakshmanaperumal, Richard Alexander, Alejandro Sánchez Alvarado (2015). Stem cells and fluid flow drive cyst formation in an invertebrate excretory organ. Elife 4, e07405.

Wurtzel, O., Cote, L.E., Poirier, A., Satija, R., Regev, A., and Reddien, P.W. (2015). A Generic and Cell-Type-Specific Wound Response Precedes Regeneration in Planarians. Dev Cell 35, 632-645.

 

back to top





PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in renal system. Click this link to learn more about PAGE.


PAGE Curations: 1


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
renal systemSMED30033245InnexinSMESG000061679.1 AY068260smed_ncbi_20200123PMID:17670787

 

 

back to top