proximal tubule

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ In Situ Hybridization Data

  ▻ Sequences

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  proximal tubule


DEFINITON:

  Ciliated epithelial cells form tubules, generating coiled, branching units terminating in flame bulbs. Tubules are formed via intercellular junctions between two epithelial cells. Proximal tubules are connected to non-ciliated distal tubules within the parenchyma.


TERM DEFINITION CITATIONS:

  PMID:21828097


TERM CITATIONS:


TERM ID:

  PLANA:0000087


ABOUT THIS TERM:

proximal tubule

  ↳is a material entity and tissue

  ↳adjacent to flame cell and distal tubule

  ↳contained in tail, copulatory region, posterior region of the whole animal, parapharyngeal region, prepharyngeal region, head, dorsal region of the whole animal and anterior region of the whole animal

  ↳develops from protonephridial progenitor cell

  ↳existence overlaps Stage 6, juvenile, asexual adult, adult hermaphrodite, Stage 8 and Stage 7

  ↳existence starts during or after Stage 6

  ↳part of protonephridia


  → flame cell adjacent to proximal tubule


  → proximal tubule epithelial cell part of proximal tubule



DEPICTED BY:


BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30030007RootletinH.2.8b, croccStage 5, Stage 6, Stage 7, Stage 8protonephridia, renal system, integumental system, Category 5 cell, proximal tubule
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30030007 ID=SMED30030007|Name=Rootletin|organism=Schmidtea mediterranea sexual|type=transcript|length=6612bp
GTTGTTTTTAAATCACTATTTTTTTTATTTCATCTGATTATAATTTTTTTTTATTGAAATTTGTATTTTGAAATTGGTGA
ACAATGAGTGAGATAGATTATTCCGCTATTGTTCGGAGACGCATTGGAGATATCGATGGGGATTCAAGTGAAGATTCCAG
TTCAAAGGGTTTGCTTCAAGTTAACTTGGAACTGAGAAAGCGCTTAGAGGAAGAACACAATGAGTATCGTAGAAAGCTGA
TAGTTTTCCAAGACAGCCAACAGAAACAAGCGCAATTGGTTCAAAGATTGCAGAAAAAGGTATTGCAATACAAAGAAAAA
TGCACGGAACTTGAATCTAAAATGCAATTTGGCGATTATGAGACTCGAAAAACGAAGTATGGAAGTCCAACGAATAACGG
CTATGGGTCGCGTAGTGAGAATCCCTACGACAATCTGGATTTGGAGAGCACACTCATTAAGTTAGAAGAGGAACAAAAAA
AAACAAATTATCTAACGGAGTTCAATGAACGGCTTCAAGAACAATTAACTCAAGCAACTCAATCAAACCAGAATTTGACG
AGAGACATCAGTAAGCTTTCCGAAGAATGGCAGAGATCAAGGGAGGAGCTTGAACAGAGAGAAAAAATTTGGCGAAATGA
AGAAATGTCATTTAATGACTATTTAGCATCTGAGCATTCGAATCTGCAAAATTTGCAACGCAATACGATAAATTTCCGCC
GTCAATTTATAGAATTGAAAGCTTCAACTGAACGGGAAATAAATAATTTGAAAAATGAATTCAACCGACAGGCACGCTGT
TTGCAAACTGCTTGTTCCAATCTTTCGTGCAACATGAAATCTGCAGAATCTAAACAACAATTGAGTACTGAACGAGAAAG
TCGGGACAAGTTGAATCTCGAAAATCAACTGCGAGAAAAAAACAGAGAATTAACTGATTACCAAACTCGGTATGAATGTG
AAATGACAGAATTGCAACACCGAGTGAAAGAATTAACAGTTCTCAGTGACAAACTGAAAATTCAAAACCTGGAAAAGGAT
CGAGCATTGACAGCTTTGCAAAGAATTAAGAATGGAGATACCGCAGGAGAAATAAATATGGAAGACAAAGCTACAAGAGT
TCTTATTGAAGACACAGAAAGTATGCATCAAGCACTTCGAAATATTTCTCAAGTAGTACTAAATGATTCTGACTATTTCG
ATGCAGAAGACACAGGATTTGAAACAGTTCGAAAGAATAATCGTTCGCCAAGTCCAAGGAGAAATCGTAGCGTCAGTCCT
AACTCAAGATCAGCTAAAACACCGCCATTTGCCGATGCAACGTATGCGGCGGTTCAGTCGGCTATAAATAAAAAATCTCT
ACAGATTCAAGAGCTTAAATCAAAATTAAACAGTTCTAAAGAGAGTTGTACAAACTTCAAAAGACAAATTGATGACAATG
AAAATGAACGTCGACGATTAGAGAATCAAGTTCTCGCCATGAGAGATGAAATTGAAAGTTTACGACGAGATAAAGATGAT
AGTTTTAGAGAAGCGGATCGGTTTAAAAATGCTCTGAACATCACTTCAAATGAACGAAGCCAATTGGAAAAGATTCGATC
ATCACTAAACGATCAAATTGAGCAGCAACTCACAGAAATTGAACGACTTAAGTCAGCCAATCACGAATTACAACGATTGA
GAGAGGCATTGGAAGATGAGCAAGAAGATACTAAAAAAGACTTAGAAAGACAAATTAAAGAAAGTGAAAGATGCCAACGA
TCGATTGATGTTTTGGAAGATAAAATAAGTCGATTTAAAGAAGACGTAGTTAATTACAAAGAGGCAATTAATAAATACCA
ATTAGAAAAAGAAGTATTGGTGCAAGAAAAGGATGAGATTGGTGATGCTTTAAGTCGTTGTGAAATTTCTAAAGCCGAAT
TAGAAATCGAGGTGAATAAACGGCAAACTATTGAAGTAAATTTGGAAGAAAACATTTCAAAATTATCCTCAGAAATCGAA
GAATTGAATGATAAGCGAGCTGAAAACCACAGAACTATTAAACAGCTGGAACATGAAAGAAGTTCTCTTTTGAATGAAAA
ACGATTTTTGGAACAAGAAAAAAGTGGTTTGAAAGATGAGCTTGTTCGATCTGAACAAGAGGCTCTTGGTTTGTCAAATG
AGAAAGCCATTCAACGTCAAAGAATCGAACAACTTGAAATTAATACAGAAAGATTAGAAGAAGAGTTATCGGAACTCAAT
CGAGAAAAGCTAGATCTTACTGAACAAATAGGCTGTTTGCAGAGGCAGAAATCGGCTCTTGCAGAAGAATTGTTGCAATG
TCGTAGAGAATTAGAACGATCTAATAACAGTGTCAACAACTTATCAAAAGAAAAGGAATATCTTACCAAAGAGAAAGGAG
AACTCGTCGTTCAAGTTACAGCTTGCGAAAGGGAAAATCGTCAACAGTCAGAAGTTATTGCTTCTTTGAATTCCGATAGA
GAACAACTGGAAGCTACTCTTTATGATGCTCAACAATTAATCATTCAGTTGGAAACTCGAAAAGAGCAATTAGAAGGCGA
AAACCAAGAGTTGATTGTGAAAAAAGAAAATCTAAATGGAGAACTAGTCAGATTACGACAAGAGTTTCAACTAGAATACG
AGAAGGTTGTTAATTCACGAGAACAATTAAATTGCAGATATCAACAAATGGATAAAGAATATAAGATGGCAATTCAACAA
GAGCGAGATTCTCATGCTGAAGATGTAGAAAGACTAACTAAGATAAACGAAAGCAATCGTCATGGATCTGAAAACGAACG
AGAAGAGCTTATTCATCGATTCAATATGGAGCGTGACGACATGATTCAAAATTACGAACAAGAGAAACAAGAAATGGCCC
AGGAAATCATGACGATCCAACGAGAACGAGATGACTCATTATTAATGGCGGAAAATGAAAAGCAGCAATCATTGAGTTTA
TTAGAACAAGAAAAATGTGCAATCAATGAAAAGCTTATCAAAACGCAATTTGAACTGCAATCGGTTGAGTCGGAATTGGA
TCGCATTAAAAAGGAGTCGTCCAATCGTCAGGAGCAAGACAAACAGAACATTGCCGGCTTGTCGAGTGAACTCAAATCAT
TTAGATCTCAATTTGAGGATAAATGCCAAAATCACGAAATGGAAGTTAAAAGCCTAAATAGTGGAATCAAGGATCTAACA
TTAATGAAAGATCAAGCTCTCAAAGAAGTCCATGATTTGCATACCGGATTAAAAATAGCTGAAGAAACCCGTGATAATTT
GCGTCGGGAAATCATGGAAATGAATCGGAAATTGAAAGAAGCTGAGGAAGCCAAAGAGCACTTAAAGCGTGAAATTAATG
AATTGAAACGTGGATTATGCGAAGAACAAAGGGAAAAAGAAAATGTTATTAACTCAAATGAGAATTTGAGAAAGAAAATT
AAAGATGTTGAAACAGAAAGAATTGATTTGCACAGACAAGTAACGGATTCCAAACAAAAGGTTGCAGTACAAGATGAACA
ATTGGTCAATTCCAAACAAGAGGTCAATGAGTTAAGAAACAATCTTAAAGACGTAGAAAAAGCTCGATTAGATGTCAAAA
GAGAGTTACAAGAACTCAGACGCCATATCAAAGAGCTAGATACGGAAAGGGGCAAATTGACTAAAGAAGTCAATGATTTG
CAAACTCGTGTTGCTAGAGATGAAGAAAAAGAGGATGAAGCTCGTCGGGAAAATTTCGGTCTCAAACAAAAAGTTGTTGA
AACGGAAGCTTCAAGAGAAGCCGTTCGTAAAGATCTTGCTAATGCTCAACGACATATTGTTGATTTGGAAAATGTTCTGC
AGAGCAAAGACAGAGATTTCAGTTCCATGGTGGAATCGAGCCGCCGGGATTATAGGAAACTTGCTGATGCGAGAAATAGC
CTGCAACAAGTATATGATACGATGGTGGCCGATAATAATGAGCTGAGAATTGCTCTCAGTGGAGCAGAAGGTCGGGTCAG
TGCTCTGGAGTCACACATCGCACGAGTTGAAGGAGCTAAGAAAGAAATTGAATTCAAATTGGCTTCTATCCATAGCTCAT
TGCGAAGGCTGATAGGATTCCGACAGGAGAATGTAGTTACTATTCGGTCGAGAAACAACTCCAAATCTCCAGTTAGAGGT
CGATCAGTTAGTCCTCTTAGAAGTAGGCCGGTGTCGCCAACCAAAGGATTTGACAATACCTATGCTACTACAACTGATGG
AAAAGGTAGCCCTATCCCGCGCACAGGGTCTCCGAGTTCTAAACGAAGGCAATTATCAAGATCTCCGTCTAATTGCGATT
TCAATCCAGTCGATATAAATCCAGAAGCAGTTCGTCTGGCCTTGCGAGAATTCGTACAGCAGTTGGTTGATGCTGAACGA
GATAGAGATGACGCTTTTGCTCAAGCTCGCAGCCTAGAATCTCGATTGAAAGAACAAGAAGAACAAAATGAATATGCTGA
AAACCGTTTACAACAACTACAACAAGCTCTGTGTGATGCAGAAGAAGACAAAAAAGGCATTGATGGAAGATTGTCATCAG
CCCAAACTGCCTTAATGATGCAAGAAGAGACTATTCGGCGCAATGAGAGAGATAGAAAAGCAATGGCGGAAAAGTTGAGT
AATTACGATAGAACATTTGCATCCATGGAATCAGAAAAACGACAATTGGAAGATCGGTTGAATAAATTCCGTCATCATGA
TGCCCGATTGGAAGAAGAACATAAGCAGAGCAAAAAAGCTATTGAAAATGCTGAAAATAGAATAACTCAGCTTCAGCTTG
CCAAGCGATCGTTAGAAGGAGATCTTCAAAGAATGAAAATGGCGTTGACAGATAAAGAAACAGAAACCGAAGTTTTGGAT
GACCGCGTAAATAGTTTACTCAAACAAATACAAGATCTCGAGGGAAAATCTCAATCACTTCAACTAACGATTGACAGAAT
GAGTGTCGCCCTTGCAAAAACTGAGGAAGAAGGCAGTTTTCATAAGGACAAAATGCAACAGTTGAATATGAGTTTGAGCA
CTCATTCACAACAACTGGAACAATTACAGAATAAGATTTCTCAATTACAAAAAGCACTCGGCAGTTCAGAACAAGATCGT
CGGCTCTTAGAGGAACGATTAGAAAGCTCTAAAGGAGCATTGCATGAGGCAAAACATCAAAATAATTTGTTGATGGAAAG
AATACAAATAATTCAATCCGATTTAAATGATTCGGAAAATCGTCGATCAGAATTGGAAGGATTAAATCGACAGAGTAACA
CTTTGATTGTACAAAGACAAGAAGCTGAACAAGAACTCAATCAAAAATATCAGAAATTGAACTCGGAGAAAAACACATTA
CAAGAGCGAGTGAATAGCATGCAACGAAATTTGGCTTTGGCAGAAGCAGAAAAACAAGAAATAATAAAAAACCACGGAAA
ATTGGAAAAGGATAGATCTGCCTTGAAAAAGAGTCTTGGAAAAGTTGAACGTCAGAAATTGAAAACCGAAGAAATTGCTA
GCAAAACTGTTTTTGAACGTTCAGAATTAGATCAAATTTTAAGGAGACTTGAAGATGAAAATTGTGAATTACAGAGACAA
GTTGGAATTCTTCAAAATCAATTAGCAGAAGCTGAGCAAGCTCACTGCCACCATTTGATGGAAATCAATTCCCGCCATCG
CCAGGAAATGTCCATGGAAATGGAGCATTTGAGAGCATCGAATGTTCAAATAGAACGAACTCTAGAAGGCAGAGAACGAG
CCCACAGACAAAGAGTTAAGGGTCTGGAAGAACAGATCTCCACCCTCAAAGACCAGCTGACTCATGAAATGCAGAGGCGG
ATGGATAGTGGATATTACGAGTCTACCAGAAAGTCTAATCAATACGATTCAACTGGTGACTTGCGACATGTTCTGGATTC
CAGTTTAACTCGAGTTGCAAAAGACCCTCAACTGGACGCAATGCTACTGGAAACCGAAGCCAGGCGACTCGATGAGTCGA
TATTCATGTGTGGCAGTCGTGATCAGTCTCCGACCCGGCAGAAGCGAATCGAAATGTCAAAGAAGTCCGCAGCCCCTAAC
AATTCCAATCGGCGATTAACTGCCGGCCGTCGCAAATGAACTCGGCCTGTTCCAGTCCGTCCAGAGATGTTATGAAGCCA
CTTTTTAGATGCGTGAGTGTGAGTTCGTGTTGGTGACTGATTCATTTTTAGTAAACAGATTCTGGATTTTTGTTTTTATT
GATAGTGTAATTTCCTAATGCAGATCTGATAGTTGACTTGTTGTTCTTACGTATTCGGTATTTGTGATTCACATAGTCTG
TCATTGTTACTGTGATTTATCCTCTGTGTGACTTTTGTGATTTACTTACTTTATTGCCCCTATAATCAATAAATGGATTT
ATCGATAGTTCAGCCCTCCCCTCCAGCCCTCGTTTTGGGATCCGTAAATTTTGTTTCAATTGAGATCATTATAGTGATTT
TATTCCTTCGAAACCAAACCTTTGGGAGGGACATAAAATTAAATTATTGATTTTTTATTATCTTAGAAGTGAAAGATGTT
TATTTCCCAAATTAACTAATATCAATAATAACTTTAATTTATATCTTCATTA

 

back to top



PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in proximal tubule. Click this link to learn more about PAGE.


PAGE Curations: 38


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
proximal tubuleSMED30000014slc20a-1SMESG000012546.1 dd_Smed_v4_1270_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
proximal tubuleSMED30030379POU domain proteinSMESG000076173.1 SMED30030379smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
proximal tubuleSMED30030379POU domain proteinSMESG000076173.1 SMED30030379smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
proximal tubuleSMED30030379POU domain proteinSMESG000076173.1 SMED30030379smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
proximal tubuleSMED30030379POU domain proteinSMESG000076173.1 POU2/3smed_ncbi_20200123PMID:21937596
Scimone et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
proximal tubuleSMED30011282slc43a-7SMESG000075262.1 Smed-slc43a-7smed_ncbi_20200123PMID:21828097
Rink et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
proximal tubuleSMED30007332slc6a-17SMESG000054997.1 Smed-slc6a-17smed_ncbi_20200123PMID:21828097
Rink et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
proximal tubuleSMED30018526slc25a-22SMESG000074801.1 Smed-slc25a-22smed_ncbi_20200123PMID:21828097
Rink et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
proximal tubuleSMED30000014slc20a-1SMESG000012546.1 Smed-slc20a-1smed_ncbi_20200123PMID:21828097
Rink et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
proximal tubuleSMED30002205slc13a-7SMESG000041354.1 Smed-slc13a-7smed_ncbi_20200123PMID:21828097
Rink et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
proximal tubuleSMED30009145slc20a-2SMESG000029269.1 Smed-slc20a-2smed_ncbi_20200123PMID:21828097
Rink et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
proximal tubuleSMED30000756EGFR-5SMESG000044603.1 EGFR-5smed_ncbi_20200123PMID:21828097
Rink et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
proximal tubuleSMED30018104slc5a-4SMESG000034669.1 Smed-slc5a-4smed_ncbi_20200123PMID:21828097
Rink et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
proximal tubuleSMED30008385Solute carrier family 13 member 2SMESG000041335.1 Smed-slc13a-2smed_ncbi_20200123PMID:21828097
Rink et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
proximal tubuleSMED30028480slc22a-3SMESG000031472.1 Smed-slc22a-3smed_ncbi_20200123PMID:21828097
Rink et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
proximal tubuleSMED30020825Protein I'm not dead yetSMESG000041335.1 Smed-slc13a-2smed_ncbi_20200123PMID:21828097
Rink et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
proximal tubuleSMED30029757slc26a-5SMESG000052053.1 SMESG000052030.1 Smed-slc26a-5smed_ncbi_20200123PMID:21828097
Rink et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
proximal tubuleSMED30024134slc22a-5SMESG000064528.1 Smed-slc22a-5smed_ncbi_20200123PMID:21828097
Rink et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
proximal tubuleSMED30020778slc22a-6SMESG000020910.1 Smed-slc22a-6smed_ncbi_20200123PMID:21828097
Rink et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
proximal tubuleSMED30033245InnexinSMESG000061679.1 SMED30033245smed_20140614PMID:21828097
Rink et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
proximal tubuleSMED30033245InnexinSMESG000061679.1 SMED30033245smed_20140614PMID:21828097
Rink et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
proximal tubuleSMED30013493slc5a-2SMESG000013622.1 Smed-slc5a-2smed_ncbi_20200123PMID:21828097
Rink et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
proximal tubuleSMED30001319slc24a-8SMESG000030115.1 Smed-slc24a-8smed_ncbi_20200123PMID:21828097
Rink et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
proximal tubuleSMED30013800slc15a-3SMESG000042203.1 Smed-slc15a-3smed_ncbi_20200123PMID:21828097
Rink et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
proximal tubuleSMED30014181slc23a-2SMESG000066926.1 SMESG000066923.1 SMESG000066912.1 SMESG000066905.1 Smed-slc23a-2smed_ncbi_20200123PMID:21828097
Rink et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
proximal tubuleSMED30000950slc16a-22SMESG000077590.1 Smed-slc16a-22smed_ncbi_20200123PMID:21828097
Rink et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
proximal tubuleSMED30007967slc30a-3SMESG000022672.1 Smed-slc30a-3smed_ncbi_20200123PMID:21828097
Rink et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
proximal tubuleSMED30003880slc1a-3SMESG000046414.1 Smed-slc1a-3smed_ncbi_20200123PMID:21828097
Rink et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
proximal tubuleSMED30032055slc23a-1SMESG000066904.1 Smed-slc23a-1smed_ncbi_20200123PMID:21828097
Rink et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
proximal tubuleSMED30024279slc44a-3SMESG000065604.1 SMESG000015886.1 Smed-slc44a-3smed_ncbi_20200123PMID:21828097
Rink et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
proximal tubuleSMED30029849slc24a-5SMESG000022809.1 Smed-slc24a-5smed_ncbi_20200123PMID:21828097
Rink et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
proximal tubuleSMED30028793slc28a-1SMESG000057282.1 Smed-slc28a-1smed_ncbi_20200123PMID:21828097
Rink et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
proximal tubuleSMED30025831slc28a-3SMESG000057286.1 Smed-slc28a-3smed_ncbi_20200123PMID:21828097
Rink et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
proximal tubuleSMED30024930slc15a-2SMESG000011953.1 Smed-slc15a-2smed_ncbi_20200123PMID:21828097
Rink et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
proximal tubuleSMED30029814slc17a-3SMESG000066847.1 Smed-slc17a-3smed_ncbi_20200123PMID:21828097
Rink et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
proximal tubuleSMED30022974slc17a-5SMESG000060615.1 Smed-slc17a-5smed_ncbi_20200123PMID:21828097
Rink et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
proximal tubuleSMED30031015slc6a-13SMESG000079286.1 SMESG000079280.1 SMESG000042086.1 SMESG000017839.1 Smed-slc6a-13smed_ncbi_20200123PMID:21828097
Rink et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
proximal tubuleSMED30034376slc6a-5SMESG000042091.1 Smed-slc6a-5smed_ncbi_20200123PMID:21828097
Rink et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
Note: Hover over icons to view figure legend

 

 

back to top