optic cup

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ In Situ Hybridization Data

  ▻ Sequences

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  optic cup


DEFINITON:

  A portion of the eye containing pigment cells and dendritic projections from photoreceptor neurons.


TERM DEFINITION CITATIONS:

  PMID:21852957, PMID:22884275


TERM CITATIONS:


TERM ID:

  PLANA:0000075


ABOUT THIS TERM:

optic cup

  ↳is a material entity and tissue

  ↳contained in head, dorsal region of the whole animal and anterior region of the whole animal

  ↳existence overlaps juvenile, asexual adult, adult hermaphrodite, Stage 8 and Stage 7

  ↳existence starts during or after Stage 7

  ↳part of eye


  → pigment cup primordium and optic cup progenitor cell develops into optic cup


  → pigment cup cell part of optic cup



BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30018592AFP48372.1ovoovoStage 6, Stage 7, Stage 8trail cell, photoreceptor neuron, optic cup, pigment cup cell, visual system, eye
SMED30006796AFC87780.1tyrosinasetyrosinaseStage 7, Stage 8optic cup, pigment cup cell, visual system, eye
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30006796 ID=SMED30006796|Name=tyrosinase|organism=Schmidtea mediterranea sexual|type=transcript|length=1755bp
TGTCAGTTTAGTCATGCTCGTAATCACAATAGGCATAGTCTTTGCATCTTTCTTACCTTTGAGTGACTGCCTAATCCCAA
GGATTTGCAGTAGGAATGTCACTCTTTCTAATTCAACATGTTGTCCAATTTATAATGATTTTGTTTGCGGTGGTCCTTTT
CGTGGATCTTGTGAAGTCTCCATTCTTTTTCAAAATCACACTGAGCACTCGGATGTTATCACCGGAAAATTGGAAAATGA
CGACAGACTCAACTGGCCATCAAGATTTTTTAAATTTCTTTGCAGTTGCAAGTCAAACTATGATGGAATAGCCTGTGACA
AGTGTAAATCAGGGTGGCAAGGGGAAAACTGTGAGGTGGTCTCCCCGAGAAAGATTAGACAAAATATTCTTAACATGAGA
TCATACGATGTTTTTATTTTTTTATCGATACTGAACATCAGCAAATATCAGTTGGCCGATTTCCTGATCACAAATTCGTC
CTCAAACCTTCACTGTGACCCTGTCAATGAAGACAACATTCAATTGGTCAATGCTTCCATTTATGATACAATGGTTTACT
TACATTTCTATGCGTCCAGGAGTACAATGTCTAAAGAACTTATGGAATCCTGCACAGACAAGGATAACAAATTAGACTTC
GCTCATAAAGGTCCAGCTTTTTTTACATGGCACCGACATTATTTACTGATGTTTGAAGACTTATTAAGGAGTATTGCAGT
CGAACAATTTGGATATTATAATTTCACATTACCATATTGGGACTGGACGAATCAAATAACTTGTAATATATGTACAAATG
ACTTACTTGGCGATATTCCCACTGAAGATCAAGAATCTAACAGCACATTTTTTAAATGGAAACCGATTTGCCCTCAGAAA
CCTAACGATTTTGATTGTCATATTTGCGATCCAAGCCAGGAAGAACCTTTTTTATGGAGAAAATACTCATCAACGGTAGA
CAGACTTCCTAATCAGAACGAAATTGATGAGTTATTCTCAATCAACCAATATGATTCGGAGCCCTTCAATTCCAGCTCAT
TTAGTAGGAAAAGCTTTCGGAATTTTGCAGAGGGATATTATCGAGTTCATCCAAACTCAGATGATATGAAAATGAAAGAC
ATTGGGAAGGGACTCCCCCATCAAAATATCATGATGCATAATATGTTTTATCAATGGAACTTGGATGGATTTCACAACGA
GTCCCAATGATCCATTATTTCTACTACATCATACGTTTATGGACAAAATCTTTGAAATTTGGCTATTAAGAAATAGACGA
TCTACATACCCTGGGAAATCTTCAACACCAATCGGGCAGCATGCTGACGATTTTATTGTGCCTTTCCTTCCACTAATCAG
AAACAGGAATTTGTTTACTTCAGCAAATGAATTTGGCTACGCCTACGATAACAATATTGTTGGAAATAAATTGTTCACAA
ATCATCAACTAGATTTCGAAAAGAGCTCATCGGAAATTTACTACATCCTAACGGCAGTTGCCTTTGTAGTACTAGTTGCG
ATCGTCGTCGGATTGTACTGCTTCAGACCCAGTCAAATCAGTCACACGGCTTATGAATTCATTGAAGACCAGGAGCAGGA
GGAAAAGACAAATTACTTTAACAACAATGAAAAAATGCCTCTACTGAAATGACAAGCCATTTCTGATGACTATTATAATA
TTGTCACCTTAAATTTTCTTTGAAACAACTTTATTATTGACAAATTTTGAAGAATCCTTTTAAGCAAAATAAAGT
>SMED30018592 ID=SMED30018592|Name=ovo|organism=Schmidtea mediterranea sexual|type=transcript|length=1211bp
GTCATATTGAACACTGAGACTAGCTATCAATAGCTGACAATTAGACGTATAAAATGTTAGGGTACGCCTTTTTGGCCATT
ATTTCACACCAAAATTTCCATGAGTATTTTTCTAATAAGCACTCTACTCGCAAACGATGACGAAATGCCCACAGATTTGT
CATCGAAAACTGAAAAGATTGAAAACCATGAAAAATCTGAAAGGAATCTCTGCAAGTATTCCAGTCAGTTTCTTTCCTGT
TTTTATTCACAGGAAATGTTGACACTACTTATGAGAAAAAATTTCATCAATCAATATTCATTTTATTTAAAGATTTTCTC
GGGGTTTCCACAATTCGTCGATAACTTCAACTTAGTAAATCCAACAGATTTCACCGTCAATTCAAATTCAACAACAATTT
TGCCCTCATTCAACTTCCATAAAACGTCATTGAATATCGAAATGAACACCTCACTGGCCAATTCTTCAAGCACTGGTAGG
TCGTCTCCAACTGAAACTGTGTCTGAAAATCTTTGGTTAGAAAAAGTAAAGGTGGAAAAATATTTCCATTTAATTGAAAA
TCTATCACAATCCCAAGAGAACATTGAAGACATTGTCAAAACGATCAAAGTCAAACGAAGAAATTTTGCTGAATATATTA
AGAAACTTTACCTAAGTGATCCAGCCAAATTTAAGTTGACAAATGGTGGAGATGGAATAGTAAATCCATTTAGAAAACAA
TTCAAAGAAGAACGAGATAAATCTATGGACAAATTTTGCATCGAAGTTAATCACAATTATCAATGTAAGATATGTAACAA
GGTGTTTCCTTCCAAAAAGCACATGCAACGTCATATACGTTCACACGGTGTAAATTTTGATTGGTTGTGTAAATATTGTT
TTAAACCGTTTATTGATTCCTACGATTTAAAACGACATACGAGAGTCCATACAGGAGTTCAACCATACAAATGTCAAAGT
TGCACAAGAAAATTCAGTCAACGATGCTCATTGGAAAGTCATCAGGTGAAAATCCATGGAGTAGCACTGAATTATCTATA
CAAAGAAAGAAGGAACAAGTTGTATCCGTGTGAAATCTGCAGTTATAGTACGTCTTGTAAAGCAACTTGGTTGAGTCACA
TCATTCAGGAGCACCCGAATTCACTTTATGCAAAAGAAGAAGCACTCAAAGGAAAATACAACTGACTTTGAAAAATATTG
ATTTTTCAAGC

 

back to top



PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in optic cup. Click this link to learn more about PAGE.


PAGE Curations: 5


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
optic cupSMED30012020tphSMESG000000522.1 SMESG000000520.1 tphsmed_ncbi_20200123PMID:25725068
Owen et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
optic cupSMED30012020tphSMESG000000522.1 SMESG000000520.1 tphsmed_ncbi_20200123PMID:28976975
Su et al., 2017
whole organism asexual adult fluorescence in situ hybridization evidence
optic cupSMED30015071Eyes absent homologSMESG000001561.1 SMED30015071smed_20140614PMID:21852957
Lapan et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
optic cupSMED30023736sine oculis-1/2SMESG000001687.1 JN983827.1smed_ncbi_20200123PMID:21852957
Lapan et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
optic cupSMED30012020tphSMESG000000522.1 SMESG000000520.1 tphsmed_ncbi_20200123PMID:26017970
Lambrus et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
Note: Hover over icons to view figure legend

 

 

back to top