embryonic gut cell

The Planarian Anatomoy Ontology (PLANA) is a collection of terms curated from the literature and other organism anatomy ontologies to describe anatomical features, life cycle stages and developmental processes in the regenerative flatworm Schmidtea mediterranea. The latest version of the PLANA Ontology is available through the Open Biological and Biomedical Ontology Foundry (OBO) . PLANA Ontology terms are searchable at the EMBL-EBI Ontology Lookup Service (OLS) and the PLANA Ontology Terms Page.

Below, the Overview Section is populated with infomration from the OLS.

Additional experimental information related to PLANA Ontology terms can be found in the Additional Term Information Section.



    ▻ Planarian Anatomy Ontology Term Overview

    ▻ Additional Term Information

      ▻ Description

      ▻ Figures

      ▻ In Situ Hybridization Data

      ▻ Sequences

      ▻ References




    Planarian Anatomy Ontology Term Overview


    NAME:

      embryonic gut cell


    DEFINITON:

      Dispersed, phagocytic gut cells that appear during Stage 4 and ultimately generate a honeycomb-like lattice surrounding the central gut cavity in Stage 5 embryos. Early embryonic gut cell specific transcripts are expressed from Stage 4-6, and are downregulated during Stage 7.


    TERM DEFINITION CITATIONS:

      PMID:28072387


    TERM ID:

      PLANA:0000059


    ABOUT THIS TERM:

      embryonic gut cell "is a" extraembryonic cell

      embryonic gut cell "contained in" oral hemisphere and aboral hemisphere

      embryonic gut cell "develops from" blastomere compartment

      embryonic gut cell "existence ends at point" Stage 6

      embryonic gut cell "existence starts at point" Stage 4

      embryonic gut cell "part of" embryonic digestive system


      embryonic gut cell surface "is a" embryonic gut cell


    BROWSE ONTOLOGY TREE (IN OLS):

    Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.


    Planarian Anatomy Ontology


    EXPLORE ONTOLOGY GRAPH:


    Dynamically explore this term by selecting additional relationships to display ( checkboxes on the right ) and by expanding nodes by double clicking on a node. Single click on a node to display the definition below.

     

    back to top


    Additional Term Information


    All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


    DESCRIPTION:   

    Four yolk-laden primitive gut cells associate with the temporary embryonic pharynx (Figure 1 – figure supplement 13 B-D, black arrows), and can frequently be detected in unstained specimens. Yolk ingested through the temporary embryonic pharynx collects in the central gut cavity.

    Definitive gut development may begin as early as S4, with the production of isolated phagocytic cells that gradually form a continuous, honeycomb-like lattice beneath the embryonic wall (Figure 1 – figure supplement 13 B-D). Embryonic gut markers, identified amongst the S4-S5 enriched transcripts, were expressed in gut tissue through S6 and were subsequently downregulated as branching morphogenesis proceeded in elongated S7 embryos (Figure 1 – figure supplement 13 A-D). The progenitor population(s) for embryonic gut cell type(s) are not known.  These early intestinal cells may represent a transient population, turning over during S6-S7, or they may persist, changing their expression signature as morphogenesis proceeds.

    Expression of gamma (g) class neoblast transcripts, including gata456a and hnf4, was detected in the temporary embryonic pharynx during S2, and in scattered cells in the embryonic wall during S5 (Figure 1 – figure supplement 13 E-G, Figure 6 B); a similar expression pattern was reported for Spol gata456a (Martín-Durán and Romero, 2011). The anarchic distribution of putative gut progenitors during embryogenesis is reminiscent of the systemic distribution of gut progenitors in the adult parenchyma, as well as the uniform incorporation of neoblast progeny into the adult gut during growth and homeostasis (Forsthoefel et al., 2011). In the adult gut, neoblast progeny incorporated into both new and preexisting gut tissue during regeneration, and morphallaxis of the gut required stem cell activity (Forsthoefel et al., 2011). Branching morphogenesis begins during S6-S7, as gut cells ingress from the anterior dorsoventral margins of the embryo, forming the secondary branches (Figure 1 – figure supplement 13 F-G, I). As in the adult, branching morphogenesis may proceed locally and may be reliant upon the incorporation of differentiating progeny, and/or remodeling of differentiated gut tissue.  Separation of the two posterior gut branches also occurs during S6-S7, concomitant with the development of the definitive pharynx and a medial, muscular septum running from the pharynx pouch to the posterior pole (Figure 1 – figure supplement 13 F-G, I). Many molecular markers of adult gut tissue are expressed during S5 or later (Forsthoefel et al., 2012; Wurtzel et al., 2015), suggesting that gut maturation is a gradual process (Figure 1 – figure supplement 13 H). Newborn hatchlings are born with yolk-filled intestines, and it may take up to one week to completely digest and clear the yolk from the gut. 


     

    back to top


    FIGURES:


    Figure 1 – figure supplement 13: Molecular markers for the developing gut

    A, E, H: Average RPKM values per embryo for A) embryonic gut transcripts cathepsin L1-like (CTSL-like: SMED30023322), lysosomal alpha glucosidase-like (LYAG-like: SMED30028442, SMED30008977), macrophage-expressed gene 1 like-3 (MPEG1-like-3: SMED30015696), E) gamma (g) class neoblast transcripts (gata456a, hnf4, prox-1, nkx2.2), and H) transcripts with enriched expression in the adult gut (Forsthoefel et al., 2012; Vu, 2015; Wurtzel et al., 2015) Yolk (Y), S2-S8. Early embryonic gut transcript expression was validated by WISH on staged embryo collections. H: Adult gut-enriched transcripts with enriched expression during S5 and/or S6 (top, n=146), or S7 and/or S8 (bottom, n=292).  Adult gut enriched transcripts are flagged in lists of S5-S8 enriched transcripts (Figure 1 – source data 5, Figure 1 – source data 6, Figure 1 – source data 7, Figure 1 – source data 8).  74% (n=1112) of the intestinal phagocyte enriched transcripts reported in (Forsthoefel et al., 2012) were identified in the smed20140614 transcriptome; 129 (11%) of the cross-referenced transcripts were enriched during S5, S6, S7 and/or S8. 90% (n=425) of the gut-enriched transcripts reported in (Wurtzel et al., 2015) were identified in the smed20140614 transcriptome; 44% (n=186) of the cross-referenced transcripts were enriched during S5, S6, S7 and/or S8. 

    B-D: CTSL-like (B), LYAG-like (C) and MPEG1-like-3 (D) expression (blue) in the temporary embryonic pharynx (S2-S4), four primitive gut cells abutting the temporary embryonic pharynx (S4), and yolk-laden gut cells forming an irregular lattice beneath the embryonic wall (S5-S6). Expression of these markers was downregulated as branching morphogenesis proceeded during S7. 

    F-G: gata456a (F) and hnf4 (G) expression (blue) during embryogenesis, S2-S8.  Staining was detected in the presumptive temporary embryonic pharynx (S2), and was later detected in scattered parenchymal cells from S5 onwards. Expression of both markers became more prominent in the developing gut over time, especially after branching morphogenesis was underway during S7-S8.

    I: porcn-A expression (blue) during embryogenesis, S2-S8. Hazy, faint expression was detected in the gut during S5-S6, with increasing signal following the initiation of branching morphogenesis during S7-S8.

    B-D, F-G, I: Anterior: top (S6-S8). O: oral hemisphere. A: aboral hemisphere. D: dorsal. V: ventral. Black arrowheads: temporary embryonic pharynx.  Black arrows: primitive gut cells. Red arrowheads: definitive pharynx. Scale bars: 100 µm.

     

     

    back to top


    IN SITU HYBRIDIZATION DATA:


    Smed IDAccessionNameAliasEnriched during stage(s)Tissue/PatternImages
    SMED30023322Cathepsin LCTSL-likeStage 2, Stage 3, Stage 4, Stage 5, Stage 6embryonic digestive system, embryonic gut cell, temporary embryonic pharynx, primitive gut cell
    SMED30028442Lysosomal alpha-glucosidaseStage 2, Stage 3, Stage 4, Stage 5, Stage 6embryonic digestive system, embryonic gut cell, temporary embryonic pharynx, primitive gut cell
    SMED30015696Macrophage-expressed gene 1 proteinMPEG1-like-3Stage 2, Stage 3, Stage 4, Stage 5embryonic digestive system, embryonic gut cell, temporary embryonic pharynx, primitive gut cell
    Click to see image symbols and abbreviations
    Abbreviation or symbolDefinition
    Ooral hemisphere
    Aaboral hemisphere
    Ddorsal
    Vventral
    Llateral
    black arrowheadembryonic pharynx
    red arrowheaddefinitive pharynx
    black arrowsprimitive gut
    yellow arrowsprimitive ectoderm cells
    cyan arrowsbrain
    cyan arrowheadsnerve cords
    blue arrowheadseye progenitors (trail cells)
    purple arrowheadseyes
    scale bar100 µm

     

    back to top


    SEQUENCES:

    smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

    >SMED30028453 ID=SMED30028453|Name=Lysosomal alpha-glucosidase|organism=Schmidtea mediterranea sexual|type=transcript|length=2906bp
    AGAATTAGGTAAAGTGCTAAATTTCAAGATGATGGATAGAGAAAATGAATGACCAAAGTACAAAATATAAAGATATTTAA
    GTAATAAAATTGAATTCCGAACTTAAATTGAAATGTTGAAGTTATTGTTGATAATCTCCTTGAACTTTATAATTGTGTCC
    AATGCTCTCCAATGTTCAGTACCGAATAACAATTATAGGCTAGACTGCTTTCCTGGGTCCAATGCAAATCAGAACGATTG
    TTTGGCTAGAGGATGTTGTTGGTCACCACCGGAAACCCGGGAATATAGTCAGAATAATCCGACTATTCCATACTGCTTCT
    TTCCAATAGAATATCCAAACTACCAAATTAATTCATTCACTCCTACCGATCGAGGATTCAAAGCTCGTCTAACAAAACAA
    CAAAAATCATTTTTACGGAAGGAAATATTAAATTTGAACTTTGAAGTGATCTTTGAGACAAATACTCGATTGAGAATAAG
    AATCACCGATCCGAATGTGCAAAGATTTGAAGTTCCGATTCAGCTTGGATCTCCTGATCCGACTCCACCTTCAAATATTC
    AATATAAATTCACAATGCCCACAAATGGTTCTTTTGGATTCGAAGTCAAAAGAAATTCCGACGGATTGAGCTTGTTCAAA
    ACATTTGGTCCTCTATTGTATTCTGATCAGTTCATACAAATATCTTCTTTGATGTCAATCCAACACGTTTATGGAATCGG
    AGAACAGAATCGTCCATTTCTACATGATTTGTCTACTCAATGGGAAAGAATAGGACTGTGGGCACGCGATAATGGAATAG
    ATACATATAATAATTTATATGGTACTCACCCATTCTATATGTCACTGCCTGATTCTGGAGAAGCGTTTGGAGTTTATTAT
    TTCAATAGCAATGCACAAGAATTTGTTTTACAACCGGCTCCAGCGATTACTTACCGAACAATCGGAGGAATACTCGATAT
    TTTCATTTTTTCAGGAGGAACACCGGAAACCACCGTTAGTCAATACACTGAATTAATAGGAAGACCAATGCTTCCTCCGT
    TTTGGTCTCTTGGATTCCATCTATCAAAATACGGTTATAAAAGTATTGCAGATGTTTCTAACACTCTGTATAGAAATATT
    AATATAAGCATACCAATAGAGGTCCAGTGGTCTGACATTGATTACATGGACAAATACAAAGACTTCACATCGGATCCGAT
    AAGATACCCTAACTTTGGTTCTTTTGTCGCCCATTTGAATCAATCTTTAGGAATAAAGTATATTGTTATAATTGATCCTG
    GAATCAGTATACAAAGTCCCGGTGTATATTCTGCTTACGATGAAGGACTTGAATTGAATATATTCATTAAAGATGCGAAT
    ACTAAGAAAGATTTGATTTCAAATGTTTGGCCAGGAGAAACATGTTTTCCTGACTTTACTCATCCTAATGCTTCAAAGTA
    TTGGTCACATCAAATTCAACGATTTCATTCTCAAGTACCAATAGATGGTTTGTGGATTGATATGAATGAACCATCAAATT
    TCTACGATGGATCTAGAACCGGATGCGCTCTAAATAATCCGTACGACTATCCATTCTTTGTACCGACAATCAGAGATGGT
    TCATTAATTAAGAAAACAATATGTTCATCCTCTCTTCATTATAACAATGTCATGCATTACAACTTGCATAATTTATATGG
    TTACACCGAGGCAGTAGCCACTCATAGTGCTTTATTGAATACCATTCCAAACAAAAGACCATTTATTTTATCTCGTTCCA
    CATTCAGCGGATCTGGTAAGTACACCTTTCATTGGACCGGTGATAATTCGGCAAATTGGGATCAGTTAGCCAATTCAATC
    AGGCAAGTCCTCAATTTTAACATGTTTGGTATTCCAATGACGGGTGCGGATATTTGTGGATTCAATGGAGATAGTAATGA
    AGAACTGTGTATAAGATGGATGCAATTAGGTGCTTTCTATCCATTCATGCGAAATCATAATAGTATTGGCGCTAAAGCCC
    AAGATCCAGCTTCATGGAGTCAAGAAGCTCAAATTATTATGAAAAAAAGTATTATAATAAGATATGTTTGGTTACCTAAC
    TTTTATACATTATTGGTTAAATCATATTTGTACGGTGGCACTGTGATGCGACCATTGAGTTTCCAGTTTTACAGTGATGC
    TGAGACGCATGAAATTGAGAGGCAATTTATGATTGGTTCCTCGATGCTCGTCAATCCAGTTGTTGTCCAAGGAGCTAGAA
    ATGTTGTAGCATATTTCCCAGCTGGGATTTGGTATGATGCAACAGATTTGAGTGTTATTTATTCGGGGAAAACTGGAAAA
    TGGATTTCTTTGAATGCACCTCTTGAAAGAACTAATGTTGCATTACGTGGAGGACATGCTTTGATTTTATCAAGTTTGGT
    AAACAGTACCGAGTATTCAAGAAAGGTCATTAATTTGGTTTGTATATTATCAATGAATCAAACAGCTGCGGGAGATTTGT
    ATTGGGATGATGGAGAGAGTATGGACAGTTATTCTGGTAAGAAATTCAGTTATTTTAAATTTACTGCAACTTCCAGCAGT
    GTTCTTATCAATCCTGAAATATTAGGATATAGTGTTCTTCCGTCTTTGAATAGTATTATAATACTCGGAATTAATACCTC
    CTCAATCACTACTGTAACTATAAATGATAAACCAATACAGTTTTATAAAAAATCTAATTTGTTAGACGCCCTCCTTGGCG
    GCTTGTTTCCTATTGGTCAGAAATTAATTTTAAAATGGAAATGACGAGATTCATTATTTAGTGCATAATTATGATTTTAT
    ATTTTTTATTTTTTTATTTTTTTAATGAAGATTGATTGATTGATTGACTAATCATTAAATTGTGATTTATTGAAATTAAA
    AATTTGTTCGATTTTTATAAAAAAAA
    >SMED30035609 ID=SMED30035609|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=1185bp
    TGAGATTTAGGCTTGATGTCATATAATTGTGACCCGATCACAAGTTTTATCACAAGCTGATCATGAAATTGAACCTTGGA
    AGCAGGCCTACTATAAAAACAAAATTTACACCGACAGAATTATAAAATGAAAGCTTTCGTTTTAATATCCGTTTTCCTTG
    TGGCTATTCAAGCTAGACGTCCGACCTTCTCACTCAACAGCGAGTTGAATGAAGATTGGGAACTATACAAGACTCAGTTC
    AAAAGACAGTACGAACCCCTCACTGAAATCACGAGAAGAATCATCTGGGAACAAAACCTTGAATACATTCGACAACATAA
    CCTCGAGTATGATCTGGGAAAACATACTTACTACTTGGGATTGAATGAATACGCTGATCTAACTAATGAAGAATTTAAAG
    CCAAATTTTTGGGAAAAATATTGACTAGATCATCAACAAAAGGATCTCAATTTATGGCTCCAGAAAATATGGGAGCTTTG
    CCTACGACTGTGGACTGGAGAACTAAAGGATACGTAACTCCAGTTAAAAATCAACAACAATGCGGATCGTGTTGGGCTTT
    CTCGACTACTGGATCTCTTGAAGGTCAACATTTTAGGAAGACTGGAAGTTTAGTTAGTTTCTCAGAACAACAATTAGTTG
    ATTGCAGCGGTGCTTATGGAAATGAAGGATGTGGCGGAGGATTAATGGACAATGCATTCAATTATATAATGAAATATGGC
    TTGGAATCAGAGAGAGATTACCCATATACTGCAACTGACGGAAAATGTAAGTATGACAGGTCAAAAGTGGTTGGAACATG
    CAGTGGATTTACGGATATTAAACATGGAAACGAATCTGATTTGGCAGTTGCGGTAGCAACTGTAGGACCCGTGTCGGTAG
    CAATTGATGCCAGTCACTACAGCTTCCAATTATACAAGGGAGGAATTTACAATGAGCCCCAATGTTCTCCTGACCAATTG
    GATCACGGAGTTTTGGCAGTCGGTTATGGATCAGAGAATGGAGGCAACTATTGGCTAGTGAAAAATAGCTGGGGTATTTC
    TTGGGGCCTTTCTGGATACATCAAAATGTCAAAGGACAGAAACAATCAGTGTGGAATCTCCACCTCTGCAAGCTTTCCAT
    TAGTTTAATTTGAACTATTATATTAATTTTTCCAACTTAATTTTTATATTTAATAAACTTTGCTT
    >SMED30013843 ID=SMED30013843|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=1112bp
    ATTGTTTTAAGATTGAACTCGTCGTTAGACAATAAAGTGGCATATACTATGAAAATAAAATTACTTCCAAATGCAAAGAA
    AATGCAATGTTTTGTTTCTAATGAAAATCATTATAAACAAATTATTCAATGTGCTAAATTTGAAGCAATCGGGCATCAAT
    CTAGATATTGCAAGGCTAGAAAAGGAAAAGGGATCGATAGTATTCAGGAGTCTCACGCGGTCCCAAATAGGTTTTAAAAG
    AAAGACTGCTTCTGATAAATGATAAGTAAAACGATGCTTGATAGATACTGGCAGTTCAACAACAATTATGCGAAGAGATC
    CAATAAATTCACCGGATGTTAGAGTATGTTCAGCACATAGATATATATTATTGGTTAGTCGCAGTAAAGCTGAAATAGAA
    TTAAAAGGGAAGTATTTTATTATTGATTGTTTTGTTCCCATAAAAATGATATTCAGTTATGATGTGATATTAGGTATTAA
    TGGTATTAATGCACTAGGAGGGGAAGTTCTCAACGACGAAGTGAATCATAGTATCCTAATAGTTGCGAGCATACACAATC
    TTCAAGATAAGCTGATTGGAAGAAACAATTTCCAGGCAAGATTCGATTATGAATGGAAAGTATTGTGGAATTGGAACATC
    AATATTCCTATAGGATGTCAGAAAGATACTCCAAATTAGATCTTAACAAACCAAATACTGGCCTTGTGCCTACAATCATT
    GAGTAATGGATAGAAAAGAGTTGGTTAGTTGAATACGATGAAATCCAGTATGGAAAATCAATTGGTTCATTAGTATTATT
    CCCAGTCATACAGAAAAACAAGAGTAAATTAAGACCTGTTTTCGATTTGAGGGCATTGAATCACTATGTGAATGTATGTA
    GTGGGGAAGCAGTAAGTAAAAGTATGGCTGTTAAAATTTATGGGGATTCAAGACAAAGGATTGTATAAATAAACAGAGTG
    CGGTTGAAAAATATTTGATGTTTTCTATACACCGAAGAATTGCGAACTATTATAAGATTTCTGGTAATATACATATAGAG
    GTTCGAGAGAGAAAAATGTATAAAACCAGACTTTATGAAAAATCTTTGAAGATTTTCTATAATTAAAAAATC
    >SMED30034696 ID=SMED30034696|Name=Macrophage-expressed gene 1 protein|organism=Schmidtea mediterranea sexual|type=transcript|length=2009bp
    AGCGAAAATATGACTCGTTTTTCTGTTGCCAGTGCAACATTTATTTGGTTTTTATTTTTCGGTTCCACACTAGCGGATGA
    AGCAGTCATTGAGCCGGATAACGTAATTCAGAACTCGAATTTTCCATCCAAACGTGTTGTAAATGATTGCCACCTGACTA
    ATGATCAGTATGCATTCAATGTCTTGCCGGGGTCCGGTTGGGATAATCTTGCCAATCAAGAGTTAGGCCAGATTCTGAAA
    TTATCCTATAAAAACTGCAAATCTTCCAATGATGCCAGCTTCCTAATTCCCGATGAGGTTTCAATGTCACCAGAAATGTT
    GTCTAATGTTCAATTGGATTCCGACCTAGTCTCACATTTTTCAAAATACGATTCAATGACTTCCAAGTCTATTAACATTG
    AAGCAAACGCCGCAACGCCAAATTATCAAGTCAGTGGATCGTTTTCTTTTGAAAAGAAAGATGTTAAGAAAAATCAAATG
    AAAGAAAAATCCGAAATTTCTCATACGCAACTGAGATACGAACTTCACCACCTTGCCTTTCAGCCAGACAGTGAATTGGA
    TCCTACCTTTCTCAATAGGGTCATTGACATGGGAATAGTTTTGGAAAAAGAAAGTAAAAATACTTACTCAGAGTTTTGGC
    TGATTTGATCGTAAGAGACTACGGAACTCATGTAATACGGTCTGTTGTCGCTGGAGCTATTCTTTCTAAAACTGATGTTC
    TCAAAGGCAATTTTATGTCCAAATCCAGGGGAAATTCTATAAATGTTGCGGCCTCTGCCGCTGTAAGCATGAGAATGGCT
    GTGGGAATTAAGATTGGAGGAGGTTATGGCAATTCTGAAACCAATGCCACGGAATATGAAAAGAATTGCGCAAGTTCAAG
    AATTAACACCTTTGGTGGAGGACCATATGGTTCTAATTTCAAATTAGAAGATTGGGAAAAGACCCTTCCTACTAACCTTG
    TTACTATAGATCGTACTGGTGATCCTTTATATTACGTAATAACAAAAAGAAACGTACCGTATTTCAGTGACAAAACAATA
    TTTAACATCAACACTTTGATTAAAAATGCAATCAACAGGTATTACTCAGCTAATTCTCGCCCTGGATGCATGGATATTAA
    ATCTGATAATTTTGATGAAAATGCTAACATTGACAATGGCATATGCCAAAATCCAGACGATAATTTCAAATTCGGAGGAG
    TTTATCAATTTTGTTATGGGCTGAGTGCTAAATGTAAGGAACTGAACCAACTCAACCCAATCACTGGAACATCCTCATGT
    CCAGATGGATTTGACCCTGTTGAGCTATTTTATGTATATAGTAATGAGAATAACGATGGTATGGTCATCAACACGTTTTG
    GTGTGCTCCTAATCAAAAATCAACTCATTCAAATGGATATTTATTTGGCGGGATTTTTACCGATGCATATCCGAACCCTG
    TTACTGGATCTTCTAGTTGTCCACAATATTTTCTATCTTTGAAATTTGGACGTACCGCAAAGATTTGCGTTTCACAGGAT
    ATCGAACTTGGAATGAAAAATAGTCTGCCTTTTGGAGGGTTTTTCAGTTGTTCCATGGGGAATCCCTTGACACAGAAGAA
    GACGACTAATTCTCCCGCTGACTATTGGACCCAATCATGCGCACCCGGTTATTCTGCACATTTGGCGGTCATCGAAATTA
    ATTGTCAGATTTCATATTGTATCAAGAGTAACGCATTAAAAGGCAAAGAAGAAATTCCTCTTTATCGGCCACCATTCATT
    AATTTAGACGATGGAATTAAGTATAATTCTATAAAGAAATTTCAAACTACTTCCGGGATAGAATTGAAACTTTCCAAGGA
    CGGAATGTGGAATAAAGTGAAATATGTTCCTTTCGCAAGATCTAAATTTGGTTTAATTATTTTTTCCGAGGTTACCCTAA
    TCTTGGTAATTATTGTTGTGGTTTTAATGGTTTGTTGGTTTAAATCCCGTTAAAAGAAAAATTGTTTTAAATAAAGACAG
    ATCGGAAGA
    >SMED30025555 ID=SMED30025555|Name=Lysosomal alpha-glucosidase|organism=Schmidtea mediterranea sexual|type=transcript|length=769bp
    TGTCAAATGTCGCACGGAAGATTATTGTCTGCTTTGCCAGAATTTATAGTTCCAAGAAACAATGACAGACTTGATTGTTT
    TCCTCAGTCAAATTCTAATAGAAATGATTACATTGCAAGAGGTTGTTGCTGGTCACCCGCACTTTCGCTTAATAAAATAT
    ACGGATATAGTGAGATATCTGTTCCTTATTGTTATTTTCCAAATGATTTTCCAAATTATGAAATAAAAAATATCCAGGAA
    ACGAAAAATGGAATAAAAGATGAGTTGATAAAAAAAGCGAAAAGTCATTTATCCGATGAAATATTGAATCTATTCTTTGA
    AATAAGCTATGAAACCGATACGATAGCTAGAATTAGGATAACTGATCAAAAAGAAAAAAGATTTGAAGTTCCGATTACTT
    ATAATTTAGGTCGTTCACTGGTAAATCAAAAAAAGTATGATGTCATCATTTCATCCAGTGGATCGTTTTCTGTTGAAATT
    ACCAGAAATTCAGACAAACGCTCACTTTTCAAATCATTTGGTCCACTTTTATATTCTGATCAATTTTTACAAATATCAAC
    ATTGATGTCAACAGATCAAATTTATGGAATTAGAGAACAAAATGGACCCTTTCTTCATCAATTATCCAATGGCTGGGAAA
    TAATTGGATTGTGGGCAAGAGACAATGATTTTGATTGTTATCCACATACATGTTAATTCTATATTTATTGCGTCCTATTG
    TATATTATTTTAATCCCGTTTTCATTATTTTCCCATCTTCCAATATGAG
    >SMED30017940 ID=SMED30017940|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=1165bp
    CCTGATTGTGTGCTGTAAACAAATGCAACCTCACCGTATGTCATTATCATAATTGAAAAGATTTACGTATAAATTCAACG
    TATTTTTGTCAAATTTATTATAACAATGAAGATCGTTCTACTTGCAGTATTTTGCGTTGTCTCGATTAGTGCTGGAAAAT
    TAAAGTTTGAAGTCAACGAGGCCCTGAACGAGGAATGGAACATGTACAAGATCCAGTTCCAGAGAAAATACGAATCCATT
    ATCGAATTAACTAGACGACTAATTTGGGAAGAAAATCTCAGATTGATACAGAAACACAATATCGAATACGATCTCGGAAA
    ACATTCGTATTACCTCGGTCTGAATGAATTCGCAGACATGACCAACGAAGAATACAGAGTAAAGGTTCTCGGACTGAAAC
    CAATAAACAAAAATTACACGAGAACAATTTTCCTGGCTCCGGAAAATACTGTCGATCTCCCTAAATCAGTTGATTGGAGA
    ACAAAAGGATACGTAACTCCCGTGAAAAATCAGGCTAATTGTGGATCTTGTTGGTCGTTCTCGACTACTGGCTCACTAGA
    GGGTCAACATAAGCGTAAAACTGGTCAGTTAATTTCCTTATCCGAACAGCAACTCGTAGACTGCAGTAAACCATTTGGTA
    ATAATGGATGCAATGGTGGCCTCATGGATAACGCATTTCAGTACATTCAAAAAGACGGATTGGAATCGGAAGAAGATTAT
    TCCTACACAGCAAAAGAAGGTAACTGTAAGTATGACGCCTCAAAGGTTGTTGCTCATTGCACAGGATTTGTCGATATTAA
    AAAAGGAAACGAGAAAGACTTAGCAAAGGCTGTCGCAACAGTCGGTCCGATATCAGTGGCAATCGACGCCAGTAAACCAA
    CTTTTCAATTATATAAAGGTGGAATCTATAATGAAAAATCATGCTCCTCCCGCCAATTGGACCATGGGGTCCTTGCAGTT
    GGTTATGGGAAAGAGAACAATCAACATTTCTGGATTGTTAAAAACAGTTGGGGACCACAATGGGGACTTTCGGGGTACAT
    AAAAATGACAAAGGATCGACACAATCAATGTGGAATAGCTACGATGGCTAGCTATCCTCTTGTTTGAGACTGCAATATTT
    ATTTTGTTTTAATTTTATACATTTTATTTTATTTGTGAAAAAAAA
    >SMED30035691 ID=SMED30035691|Name=Macrophage-expressed gene 1 protein|organism=Schmidtea mediterranea sexual|type=transcript|length=2718bp
    TATATTTTAGAGATTATGATTATAAAAATTTAAAGTGCCGACAGTTAATAAAAACAATTAATGCTTACAACGTAAGGTCA
    TCATGATGATGTAATCATTCGGATGTTCTATGACGTTCGGATAACCCTTATCACGTGGATCCTAAACAAAATATATCAAT
    CAACTAGGAATTACAATATACATTTGTTTGTTCAACAGTGAAACCAGTGATACTTTGTATGTTTAATAATATAATAATAA
    TTATATTTGTCTGTGGAGTTCTATCTTTTAAATGTAAAAGCGAATCAAACAGAGACCTCCCGTCAGAGAGGCAAGTCCAT
    AAATGTAAACTTACTAACAAACAATACGCATTCGATATCCTCCCTGGATCTGGATGGGATAATCTTGAAAACAAGGAACT
    CGGTCAAGTTTTAGAAATTTCATACAAGGAATGTTTGGCTTCGAATGATGGCAGCTTTCTCATTCCTGACAACTCGGTGA
    TTATTCCGATCAAAAGGTCAACTGTCGAATTGGCATCTGACATATTTGATCATTTCTCTAATTTCACATCTGCCACGTCC
    AAATCCATAAATGCCGATGCAAGTTACGCCACACCAAGCTATCAGATTAGTGGCTCGTTTTCATGGGAAAAAAAGGATGT
    AAAAAATGACCAAATCAAAGAAAAGTCTTTGGTTTCTCGGGTACAATTGAGACACGAATTTTACACCGTTTCATTTCAGC
    CAGACTCGAAATTTGATCGTCAATTCAAGAACAGAATTCTAGATATTGGAGCGTTATTGAAAGAAGGAAAAGACACAATT
    TATCCACAATATTTAGCGGATTTAATTGTCCGTGACTTCGGCACTCACGTCATTCGGTCGGTGGATGCGGGAGCGACACT
    AATAAAGACTGATGTTTTAAAATCGAATTATGTCAAAGGTTTTAAAGGGGATACAACTAAGATTGCAGCTGCGGCATCAT
    TCAGTATGACAACAATGCTTTCAGTCAACCTCAAAGGAACCTATGTTGGTGATACCACGAGTCTCAATGAATTCAATAGT
    AATAGTGCAAGTACAAAAGTCGAAACTTTTGGTGGTATACCGTTTGGTTCGAATTTTAAGTTGGAAGATTGGGAGAAAAC
    CCTTGAAACGAATTTGGTAGCAATTGATCGCAAAGGTGAACCGTTGTCCTATGCTATTACATCAAGAACTCTTCCAGAAT
    TTGACGAGAAAATTATTTACAAAATCGCTACTCTCATCAAAGAAGCAGTCAATAGATATTATGCAGCCAACACGAGAGTG
    GGATGTATGAATATGGAGTCAGAAAATTTCAATGACGACGCAAATGTTGACGGTGGAAACTGCGAACCTCCTAATACATT
    TTACAGTTTTGGAGGAACTTTTCAAACCTGCTCAGGCCCTGATTATCAGTGTATGGATGTCGCGGCAAAAAACCCAGTGA
    CCAATAGTTATGCTTGTCCTGATAACTATGATACCATTGAATTACAAAGTGGATTGAATAAATGCATAAATTATTGCACC
    AAATACTTATTTTCCACTCAATGTCATTACGAGTGTTCCCAATATGCATTGTATTGGTGTTCTTCTACAAACAAAACGAA
    AATATCAGAAGGCGCACTTTTCGGGGGATTCTACACTAATACATTTCCGAATCCACTTACAAATTCCTATAGTTGTCCAC
    AATACTATGTAGCGACAAGATTCGGCGTAAACGCCAAGGTTTGCACTGCACTCAATAAGGCAGAGGCTATGGAACACCAT
    TTGCCGTTTGGAGGATTTTATAGTTGCAAAGTTGGAAATCCTCTACTAGATGATCCTCTCTACAACATTACACAGGATCC
    CAAATATTGGCCTCAAGGTTGTTCAACCGGATATTCATCACATGTAGCTATTGTCGACAGAGCTTGTCAAATTTCCTATT
    GCGTTAAAAATAACGCCCTTAGCATGAGAGAGCAACCGCCTCTCTACCGACCACCTTTTATTGATTTGGGATTTGGACCC
    AATATGACAGTAATTACCTCTCTGGACACTCCAATGGGGGTCCGATTATCTGTTGATGAAAACGGGAAATGGAGTCATAA
    TCACCAATACAAATTATCCAATTACAATATTATAATAATATCAGTCATTATGGCGGCAGGAGCCAGCATTGCAATTATTA
    TTATAATTCTTGGAGTTCAAAGATTCAGCAGAAACCGAAAAGGTCAAGTCTCACCGGAATCTCATGAATTTGATAGCAGA
    TATGATTCTACTAAAGATGTTGCCAATCTTGCGTTACCCGGCGAGGTTCCACCGTTTCGTGTTATAATTGACGGAGCGAA
    ATGATGCTTGGAACCTTTTATTATTTCTGTTGAATCTGATCTGTAAATGTTTTCAGAATATTTTTCTAATAAAATCGTTC
    TGAAATTTTAAAGTGATCCTTGATGCTATTAAATGATGGACTTTATTGTACCCCGAATTGGGTCACCCTTGTTCACGCAA
    ATTCGTGCTTAGGATATTTGTACGGGCTTATGCAACTTTTTAAATTTTTATTTTTCCTTATTTTTATTAGCAATCCGTTT
    TATTTATAACGACAAATGCTTGATGTTTGAATCAAATTTTTATTATGTTTCTTAATGAAACATAGTGAACAATGTGCCAC
    TAATTTCATAACCAAGGTCTAATCAAATAGTTTGGGTAGTGAAAGCAATATTACAGAGTTTAGGTTTGTCATTCATAT
    >SMED30023018 ID=SMED30023018|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=1084bp
    CCGCTCACATATTCCCGACCATGAAAGGAATGTATAAACTGAACCTTGATACCAAGCATACTATAAAACTCAAAGTAATC
    GCATCATATTTCATAACATGAAGGCATTCATAATTTTGTCGTTATTCCTTGTTGCTATTGAGGCTGGGCCAAGGAGATTC
    ACGGTCAACAGTGAGTTGAATGAAGAATGGGAATTATTCAAAACCAAATTTCATAAACAGTATGAACCGCTAACGGAGGC
    TGCGAGAAGAATCATTTGGGAAGGAAATCTCGAGTTCATTAGACAACACAATCTTGAATACGATCTCGGAAAACATTCTT
    ACACTTTGGGATTGAATGGATATTCTGATGTCACTGATGCAGAATTTAAGGCCAAACCTTTAGGAAACAGAATGAATGGA
    TCAAACCCAAAAGGATCCGAATTTATAGTGACAGAAAACATTGGAGCTTTGCCTTCATCTGTGGATTGGAGAACTAAAGG
    ATACGTAATCCTTGTGAAAGATCAACTTAATTGCGGGTCATGTTGGGCTTTCTCAGCCACCGGAGCTCTTGAAGGTCAGC
    ACCTTCGAAAAACAGGAAAATTAATTAGTTTGTCTGAACAGCAACTTGTTGACTGCAATAGACCAAATGGAAACTTCGGA
    TGTATCGGTGGTTTACCGTACCAGGCGTTTGACTATGTTGAAATCTCTGAAATGGAATTAGAGAAACATTACCGTTATTA
    CGCGGAAGCCAAGAAATGTATTTATAATAAATCAAAGGTTGTCGCAAATTTCACTTCATATACTAATATCAAAAAGGAAA
    CAATTCTGACTTGGCAGCCGCCGTGGCCACCTTGGGACCGCTGTCTGTAGCTATTGATGTCAGTAGCCGATGTTTCCGAT
    TTTATAAAAATGGTATTTACAGTGACCTCCAACGTTCACAATATAACCGTTTTAGTCGTTGGCTACGGATCACTCTTTGG
    GAGTAATTATTGGATTGTGAAGAATAGTTGGGCCCAAGTTGGGGAAACGGGCGATACATTCTCATGTCAAAAGACAACAA
    CATCCAAAGTGGAATTGCTAGTCAAGCCGTTTATCCAGTTCTCT
    >SMED30033415 ID=SMED30033415|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=703bp
    AGAACAAAAGGATACGTAACTCCAGTGAAGTATCAAAAAAAATGTAAGTCCTGTTATTCCTTTTCAACTGCAGGATCTCT
    TGAAGGTCAATATTTTCGGAAAACAGGCAAATTGGTTAATTTTTCTGCACAGCAATTAGTTGACTGCAGTAGTTCTTTTG
    GAAATGAAGGATGCCGAGGAGGATTTGTAGAAACGTCCTACAGCTATGTGATGGAATACGGCATTCAGTTAGAAAGTGAT
    TACCCGTATGAAGGAAAATTTAGACAGTGTAAATACAATAAATCTCAAGTCGTAGGAAAATGCAGTGGATTTGTTCGCAT
    AGAAGAAGGGAATGAAACTGATTTGGCCATCGCGGTTTCAACGGTTGGACCTCTGTCCGTTTCAATAAATGTTCAAAAGG
    ATTTCATGGATTACAAAAGTGGCATTTACAATAATGCGAATTGTCTGTTTTATTCATTAAATCATGCTCTTCTACTTGTC
    GGTTATGGATCAGAAAACGGAGTCAACTATTGGCTTTTGAAAAATCAATGGGGAACTGCTTGGGGTGAAGAAGGATACGC
    CAAAATGGTAAAAGACGCGAGAAATCACTGTGGAATCGCTACAGCTGCCAATTATCCCTTAATATAAAATAGACTGATAT
    TAATAAAAATGTTTTGTTATAAATTTTAGAATTAAAAAAAGTAATAATAATAATAATAAATTG
    >SMED30036022 ID=SMED30036022|Name=Lysosomal alpha-glucosidase|organism=Schmidtea mediterranea sexual|type=transcript|length=2871bp
    TTCTAGTACTTCGATCAAAGTCCAAACTACGATTTCCTATTTATGATGAAAATTATTGAATTAGCAAAACGCATTATAAT
    GAAAAGTTTCATTATTTTTCAGATCTTTTTTTATTTTTATGTTGCCCATAATTCGGCCGCGAATTCTCCTCAGTGCTTGA
    TCCAAAATAACAATGAACGTCTTGATTGCCACCCAGAACCTAATGCTAATGAACAATCGTGTAGAAGCAAAGGATGCTGT
    TGGTCTGAACCCATGCGATCATCAAATAAATTACAAGCCTTGCCAGGATCAATTCCTTATTGCTATTTTCCCACAAATTA
    TCCCAATTATGCTGTCAAAGATATAGAAGTTTCTAACAGAGGAATCAAAGCGAAACTGATCAAGCAGAAATTTAATCATC
    TACCAGAGGAAATTTTATCGTTAAATCTAGATGTCATTTATGAAACGAAATCCAGAGTTCGTATCAGAATATCTGACACT
    GAAAACAAGCGATTTGAAGTTCCAATAAAACTAAATCCTGCGGATCCTACTCCGCCAACTGATACAGATTATGATGTCTT
    CATTCCATCTGAAGGGTCGTTCTCTATTGAAATTAAAAGAAAGTCAGATGGTCGATCGCTTTTTAAAACCTTTGGTCCAC
    TTTTGTATTCCGATCAGTTTTTGCAAATATCAACATTGATGTCAACTGATCAAGTTTATGGGATTGGAGAACAAAATAGA
    CCTTTCCTTCATCAACTATCTAATGGGTGGACACGAATTGGATTATGGGCGAGAGATTATGGAATTGAAACATTCAACAA
    TTTGTACGGAACTCATCCTTTTTATATGGGAATTCCAGACGATGGAAAAGCTTTTGGTGTTTTTCATTTCAATAGTAATG
    CCCAAGAATTCTCGTTGCAGCCTGCACCCGCAATTACGTATCGTTCAATTGGAGGAATACTAGATATTTTCATATTTACC
    GGAGACACTCCTGAAGAAACCGTTAAGCAGTACGTAACTCTCATTGGTAAGCCAATGCTTCCTCCATATTGGTCTCTTGG
    ATTCCATCTGTCAAAATGGGGTTACAAAAATATTGAGCAATTGTCTGAAATATTTCAAAGAAATATTAATGCCGGTTTCC
    CAATCGGTACTCAGTGGAGTGATATAGATTATATGGAAAATTATAAAGATTTTACTGTCGACAAAGAGAAATTTAATGGA
    TTGGGAAGATTTGTCAGAGAGATTAAACAAAAATATAACTCTAGATTTGTTGCAATTGTTGATCCAGGAATAAGCTGCAC
    AAGTGGTAACGAATATCCACCTTATTATGAAGGAGTATTTATGGATATTTTCATCAAAGATTCACAGACCAATCAACCAA
    TTGTTGGCAAGGTTTGGCCCGGAGAAACAGTTTATCCAGACTTCACTCATCCGAACATTTCTATGTATTGGTATAAACAA
    ATTCAACGCTTTTATAATGATGTTCCAATTGATGGGCTTTGGATTGATATGAATGAGCCATCTAATTTCTACGATGGTTC
    CAAAAGAGGCTGTCAAGGAAATAGTAAATATGACAATCCATTTTTTGTACCGGATATTCGAGATCAGTCATTAATATCTA
    AAACTATTTGTTCTTCAGCACTCCATTACAATAACGAAAAGCATTATAATTTGCACAATCTCTACGGCTATACGGAATCA
    GTAACAACAAATAAAGCATTATTAAAAACGATACACGGAAAAAGACCTTTTATTTTATCCCGGTCAACTTTCAGTGGATC
    TGGTAAATATACCTTCCATTGGACCGGGGATAATCAAGCAAGTTGGGATCAGTTAAGAAATTCCATTAGACAAGTGCTTA
    ATTTCAACATGTTTGGTATTCCGATGACTGGTGCTGACATTTGTGGATTTAACGGTAACAGTAATGAAGAACTCTGTATT
    AGATGGATGCAATTGGGCGCTTTTTATCCATTCATGAGGAACCACAATGCAATCAACCAGAGAGATCAAGATCCAGCTTC
    ATGGAGTATTGAAGCTCAGAAAATCATGAAAATTGCAATAAACATTAGATATGCATTATTCCCTCATTTTTATACTTCTC
    TTGTTAAATCTCATTTATACGGTGGAACCGTGATGAAACCAATGAGCTTTGAGTTTTACTCTGATAGAAATACCCACGGA
    TTGGACCTACAATTCATGATTGGATCATCTATAATGGTTGTTCCTGTAGTTGATCAGGGTGCCAGAAAAGTCAATGCTTA
    TTTCCCAGCTGGTATTTGGTATGATTTCCAAAGTGGTAGTATTTTGTATTCTGATTCCAAAGGTGCCCAGGTAACCCTAG
    ATGCTCCATTAGATAAAATAAATGTTGCACTAAGAGGAGGCCATATAGTTTCATTGATATCAGATTCTATGACAAATCCT
    CAGATGTCAACAAATAAAATGATTTTATATTGTGCTTTATCGGAAGATTCACAGGCATCTGGAGATGCATATTGGGATGA
    TGGGGAAAATGTTGATTCTTATTCTGGAAATAAGTACAATTATTTGAAATTTATTGCCAACGGAAATAGGCTGGAAATTT
    CAGTAGAATTCAAGGGATATGAACTTGTCCCGGTGTTGTCAAAAGTAGTAATTTTGGGGGTAAAACAAACTGGTGTACAA
    AATGTCTCTATAAATGACAGACCAGTAGACTATCAATTCGACGCAGAAAAATCAATTTTACTGATCAGCAATATTGATCT
    TAGTATTGATTCGCACATTTTGCTTTCATGGAATTGACTGAAGCAATCTCACAAAAAATATTTTTATTAATAAAACACTA
    TTGTTTTTTAATGCTTGATTAAATTATATTTTTAAAGTTTTTAAAGGATTTATTAATAAAAGAAATGTTTG
    >SMED30016085 ID=SMED30016085|Name=Macrophage-expressed gene 1 protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1970bp
    TTACAATATAGAAAATGCTTTGCTTTCCTCTGGGAGGGTTGATTCTACTGATATCCATAGCATTTAGCTTAGCTGACATC
    AATCTACCTCAATATCAAAGAGGATCAAACACGAATTTCCCATCGAGACGAATGGCCCATGGGTGCCAGTTGACAAATAA
    TGAATATCCATTCAATGTGTTGCCAGGATCAGGTTGGGATAACCTCTCTAATCGGGAGCAAGCACAAGTGTTAAAAATAT
    CATATGACAAATGTAAAGCCTCAAATGACGGAAGATTTCTAATTCCTGATCAAACGAAATTAGTGCCAAAAATGAAGTCA
    ATAGTGCAGTTAGATTCAAATTTGATTTCACATTTTTCAAAATATCCGTCGACTACTTCTAAATCTATTAATGCGGAAGC
    AAGTGGAGAAACGAAGAAATATTCAATCAGTGGATCTTTTTCCAATGAAAGGGAAGACGTAAAACGAAATCAGTTAAATT
    CTAAATCCTCAATATCCCAATCTCAATTGAGATACGATCTTTACAAAATTTCTCATATCGTAGACGCTGAACTTGATACA
    AAGTTTCACCAAAGAATCCTAAACATTGGGGTGTTGATTGAAACAAAAAAGGATTCTTTATATTCAGCATATCTCGCTGA
    TTTAATCGTCAGAGAATTTGGAACTCATGTCATTACATCGGTGGATGCTGGAGCCGTTTTGTCGAAAATTGACATCTTGA
    AACAAAAATATGTCTTAGATAGTCAAGTACAAAATAGTGACGTATCAGTTGCAGCATCATTCAGTTTGGGACAAATTTGT
    GGATTTAAATTCGGTTCAAATTTTAAAAATGATGACACAAAAATTGAGGAATATAACAATAATTGTGCCAGTACGAGAAT
    TAAAACAATTGGCGGTGGACCTTTCGGCTCGGATTTCTCTTTAGAAGAATGGGAAAAAACCCTTGACACAAACTTGGTGG
    CTATAGATAGAATCGGAGAGCCTTTGTATAACGTAATTACAAAGCATAATATTCCAGAATTTAGTGACAAAACGATTTAC
    GAAATAAACTTACTTGTCAAAACTGCTATTGAGAAATATTATTCCACAAACACTCGATTAGGATGCATGGATTTTAATTC
    ACATAGCTTTGATGAAAATGCCAATGTCAACTCCGGTTTGTGCAATGAAACGGGAAATACTTATCCCTTTGGTGGGGTTT
    ATCAAACCTGCCAGAATTCAGACAAATGTGACACATATAATCAAAAGAATCCCGCCACCGGAGACTATAGCTGTCCAAAG
    GCATTTAATCCTATCAAACTGTTTGAACTTGACAATCCAAGTATCACTTTTGTTTGGTGTGCTCCACGAAGCTCTTCAAG
    CGCAATAAATGGATATCTATTTGGCGGAATGTATACTGAACAATATCCGAATCTTGTTACTAATAATCACAACTGTCCGC
    AATATTACTTTCCTGTCCAGTATGGAATCAGTGGGAAAATATGCATAACTCAAGATAAAGAACTCGGCGGCAAAAATAGT
    TTGCCATTCGGAGGATTCTACAGCTGCAAGACTGGAAATCCATTAGCTTTGGCCATTTACAATGGAACTCAGACAAACTT
    TCCTCTGACCTGCGGTTCGGGTTATTCTACTCATTTAGCGTCTATTTTTAACAACTGCCATTATTCGTATTGCGTTAAAA
    ATAATGCTATAAAAACGAAAGCTGCGACTCCACTTTACAGGCCTCCGTTTGTTGATTTGCAAATGGATTCGAATATTGAA
    GTCGTCAGTGAACTCACTACTTCAGCAGGAATGAAGCTGGTTTTAGCCGAAGATGGAATATGGAAGGAAGAAATCCTGAG
    AACTTACATGGTCGAGTATATAATGATAGCAGTAACTGTTGCGTTGCTGACTCTAATTGCTATATATATCAAGTTCAAAT
    GTTTCGTTGGAAAGAAGTTAAATCCTACTCAAGTTTCAGCAGATCGGAAG
    >SMED30023322 ID=SMED30023322|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=613bp
    ACGCATTCTCTACGACAGGCGCGTTAGAAGGTCAACTATTCAGAAAAACTGGAAATTTGATAAGTTTATCTGAACAACAG
    ATTGTTGATTGTGATAGTTTTGATTATGCATGTAACGGTGGATTTGTGACTGATACTTTAACTTATATTAAACAAAATGG
    AGGAATTGAATCTGAGCAAGATTATCCATATGTGTCAGGAAGGACGAAGAAACCTAATAAAAAATGTTATTTCAAAAAAG
    AAAAAATAGTGGGAACAGATACTGGTTTCGTATCTTTACCTCCAGGAGATGAAGAAGCTCTGAGAGAAGCTCTAGTAACA
    ATTGGGCCAATTTCAATAGCTTTTTCCGCGTCGCCTTTGTTATCAGGATATAAGAATGGGATATATCATGATTACATGTG
    TGCTGATGTTCGCATCAATCATGCAGTTTTACTAGTAGGATATGGAACGGATGAAGAATCAGGAACACCTTATTGGATAA
    TAAAAAACAGTTGGGGTCCCGCATGGGGAGAAAATGGATATTTTCGAATGGAAAGAAATAAAAACATGTGCAACATGGCA
    TACAATTCATACTATCCATTGGTTTGATTGAACGACTTCTTATGAGTGTGTGT
    >SMED30020956 ID=SMED30020956|Name=Lysosomal alpha-glucosidase|organism=Schmidtea mediterranea sexual|type=transcript|length=2869bp
    GTAAAGTGCTAAATTTCAAGATGATGTATAGAGAAAATGAATGACCAAAGTACAAAATATAAAGATATTTAAGTAATAAA
    ATTGAATTCCGAACTTAAATTGAAATGTTGAAGTTATTGTTGATAATCTCCTTGAACTTTATAATCGTGTCCAATGCTCT
    CCAATGTTCAGTACCGAATAACAATTATAGGCTAGACTGCTTTCCTGGGTCCAATGCAAATCAGAACGATTGTTTGGCTA
    GAGGATGTTGTTGGTCACCACCGGAAACCCGGGAATATAGTCAGAATAATCCGACTATTCCATACTGCTACTTTCCAATA
    GAATATCCAAACTACCAAATTAATTCATTCACTCCTACCGATCGAGGATTCAAAGCTCGTCTAACAAAACAACAAAAATC
    ATTTTTACCGAAGGAAATATTAAATTTGAACTTTGAAGTGATCTTTGAGACAAATACTCGATTGAGAATAAGAATCACCG
    ATCCGAATGTGCAAAGATTTGAAGTTCCGATTCAGCTTGGATCTCCTGATCCGACTCCACCTTCAAATGTTCAATATAAA
    TTCACAATGCCCACAAATGGTTCTTTTGGATTCGAAGTCAAAAGAAATTCCGACGGATTGAGCTTGTTCAAAACATTTGG
    TCCTCTATTGTATTCTGATCAGTTCATACAAATATCTTCTTTGATGTCAATCCAACACGTTTATGGAATCGGAGAACAGA
    ATCGTCCATTTCTACATGATTTGTCTACTCAATGGGAAAGAATAGGACTGTGGGCACGCGATAATGGAATAGATACATAT
    AATAATTTATATGGTACTCACCCGTTTTATATGTCACTGCCTGATTCTGGAGAAGCGTTTGGAGTTTATTATTTCAATAG
    CAATGCACAAGAATTTGTTTTACAACCGGCTCCAGCGATTACTTACCGAACAATCGGAGGAATACTCGATATTTTCATTT
    TTTCAGGTGGAACACCGGAAACAACCGTTAGTCAATACACTGAATTAATAGGAAGACCAATGCTTCCTCCGTTTTGGTCT
    CTTGGATTCCATCTATCAAAATACGGTTATAAAAGTATTGCTGATGTTTCTAACACTCTGTATAGAAATATTAATATAAG
    CATACCAATAGAGGTCCAGTGGTCTGACATTGATTACATGGACAAATATAAAGACTTCACATCCGATCCGATCAAATATG
    CAAATTTTGGTTCATTTGTTGCATATCTTAATATAACTTTAGGAATAAGGTATATTGTTATAATAGATCCCGGAATCAGT
    ATACAAAGTCCCGGTGCATATTCCCCATATGATGAAGGACTTGAAATGAACTTATATATTAAAGATGCGAATACTAAGAA
    ACCTTTAATTGGACAGGTTTGGCCAGGGGAAACATGTTATCCTGATTTTACTCATCCTAATGCTTCAAAGTATTGGTCAA
    ATCAAATTCAAAGATTTCATTCTCAAGTACCAATAGATGGTTTGTGGATTGATATGAATGAACCATCAAATTTCTACGAT
    GGATCTAGAACCGGATGCGCTCTAAATAATCCGTATGACTATCCATTCTTTGTACCGACAATCAGAGATGGTTCGTTAAT
    TAAAAAAACAATATGTTCATCTTCTCTTCATTATAACAATGTCATGCATTACAACTTGCATAATTTATATGGTTACACCG
    AGGCAGTAGCGACTCATAGTGCTTTATTGAATACCATTCCAAACAAAAGACCATTTATTTTATCTCGTTCCACATTCAGT
    GGATCTGGTAAGTACACCTTTCATTGGACCGGTGATAATTCGGCAAATTGGGATCAGTTAGCCAATTCAATCAGGCAAGT
    CCTCAATTTCAACATGTTTGGTATTCCAATGACGGGTGCGGATATTTGTGGATTCAATGGAGATAGTAATGAAGAACTGT
    GTATAAGATGGATGCAATTAGGTGCTTTCTATCCATTCATGCGGAATCATAATACCTATGGTGTAAGAGATCAAGACCCA
    GCATCTTGGAGTAAAGAAGCTCAGAACATTATGAGAAAAAGTATCAATTTAAGATATGTTTGGTTACCTAACTTTTATAC
    ATTATTGGTTAAATCATATTTGTACGGTGGCACTGTGATGCGACCATTGAGTTTCCAGTTTTACAGTGATGCTGAGACGC
    ATGAAATTGAGAGGCAATTTATGATTGGTTCCTCGATGCTCGTCAATCCAGTTGTTGTCCAAGGAGCTAGAAATGTTGTA
    GCATATTTTCCAACTGGAGTCTGGTATGATGGATACACAAATCAAGTCGTCCATTCAGGACCAATTGGAAAATGGATCAG
    TTTAGATGCGCCGATAGATAAATTGAATTATGCAATTAGAGGGGGCTCTATTTTGACAGGATTGTTTCCAGCTATGACCA
    CTACGTCATCTCGCAATGGTCCTTGCTTTTTATATTGTGCTCTTTCTCTTAACAGAACTGCTTCTGGCGAATTGTATTGG
    GACGATGGAGAAAGCTTCGACAGTTATTCAGGAAATAAATATAGTTATATTACCTTTACGGCAGACTCGAGGGGATTAAA
    GGTGACACCTCAATTCGTTGGATTCCGTTCTATTCCTTTACTGGCAAGTATTTCTGTTGTTGGACTTGAAAATTTGTCAA
    TCACAAAAGTGTCATTAAATGGAAAAGAAGTTCCATTTATTGTTTTGAACAATTGCTTAATAATTACGACTGGGAAGGTT
    TCAATGTCAACTGATATTCATGTAACTTGGCTATAAAATTCGGGAATTTTATTTTTGATTTAATTATTCATTTGTTTAAA
    AGAGTCATTATTATGGTTTCATTTTATTCAAATTAAATTGAGTTACTTTCACAGATAAAAATCTCACCT
    >SMED30019695 ID=SMED30019695|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=1216bp
    TTGAAATTCTGCATTGATGGGAATTGCGTCGTAATAATCACGCGCCGAATATCAAATGTATAAATAAGATATTTGTTCTT
    CACTTAATATAATTATAATGTTTGCGATGGGTCCTATCTTGATATGTTTATTATTAGCAGTGATTTCAGAAGCCAGAACC
    ACTTATAGCCATCACAAATCAGTTCCAAGTGATGACATTTCTAGTAAATTTGAACTAGAAAATATGGTATCTCTCTTGTC
    CCGTTACGACGGAGAATTCCAAACCTTCAAACAGCGATATAATAAATCTTATAGTTCCATGCATGAAGAGAATTCCAGAT
    TTTTAAATTTTATATCATCTCTACTTGAGATCAATCATCACAATCAACTTTATGAAAACGGTCAGAAATCATACGAGATT
    GGAATCAACCATTTGAGTGATTGGAGTGATGAAGAACTCGCTCAACTGACTAAATTGAAACAATCAAACCTGACGGGCTC
    ATCATATTTATCATCCAGTGTGAAAATTGACCTTCCTGATTCATTCGACTGGAGAGAGAAGGGTGCAGTTACTGAAGTTA
    AAGATCAAGGAAAGTGTGGATCATGCTATGCATTTGCTGCTACTGGCACTCTAGAAGCCCAAATCTGGAGAAAGACTGGG
    AAATTGATCAGTTTATCAGAACAACAAATTGTTGATTGCGATACTAATGATAACAATTGTTACGGTGGATTTGTACAAGA
    CGCGTTATCATACATCAAGTCAAATGGAGGCATTGAAAATGAGGAAAATTACCCTTATGTTTCCGGCAAAACAGCAGATA
    TGAACCCAAAATGTAATTTCGTAAAAAGCAAAGTAGTGGCGACTGATACTGGATTTGTTAAAATGCCAGCAAATGATGAA
    GAAAAATTAAAAGAAGCTCTTGTTACAATTGGCCCTATTTCTGCATTATTATCTGCTCCTAAATCGCTTATAAAATATTC
    AAAAGGAATTTTCTACGACAAAGAATGTGAAAAACTAAGAGTTAATCACGCTGTTCTGATAGTCGGATATGGAACAGATC
    AAACTTCCGGGACACCATATTGGATAATTAAGAATAGTTGGAACGCATCTTGGGGTGAAAAAGGATATTTCCGGTTACCC
    AGAAATATAAATGCTTGCAAAATAGCGTCAGTGCCAGTTTATCCTTTGGTTTGAATTAAAATGTTTATGTAATAAATATA
    TTTTTTTGTCTCAAAA
    >SMED30011264 ID=SMED30011264|Name=Macrophage-expressed gene 1 protein|organism=Schmidtea mediterranea sexual|type=transcript|length=2311bp
    AGTCGCGATAGCACGCAACGTCGACATTGCGATGACGTAATCATTGTGAATCTCTACTACAATCGGATCATTCTAATCAC
    GTGCATCCTAAAACAATATAAATCTTACAAACGGGAATCCAATTGAACATTTATTTACTCAAGCGTGAAACCAATGATAC
    CGTGTAGACTTAATAGTATAATATTGTTTATATTTGTTTATGGAGTTCTATCGGTTTCATGTGAAATTGAACCTAACCGA
    GATCAACCATCTTCAAGACGAGTTCATGAGTGTAAACTCACCAGCAACCAATATCCAGTGAATGTTCTTCCCGGATCTGG
    GTGGGATAATCTTGAAAACAAAGAACTCGGTCAAGTTTTAGAAATTTCATATAAAGGATGTTTTGGATCGAATGATGGAA
    GCTTTCTCATTCCAGACAATGTGGTGATCACCCCAATAAAGAAATCTATTGTCGAGTTAACTTCAGATATATTTGACCAT
    TTCTCAAATGTCACCTCTACAACGGCGATGTCTATCAACGCCGATGCCAGTTACTCAACACCAAGCTACAAAATCAGTGG
    ATCATTTTCATTTGAAAAAATAAGAATAAAAAACGATCAAATCAAAGAAAAGTCGTCGATTTCGAGATCCCAGTTAAGAC
    ATGAATTATATGAAGTAGCGTTCCAACCACACTCAAAACTAGACGCAAAATTCAGAAACAGAATTCTAGATATTGGAGCG
    TTATTGAAAGAAGGAAAAGACACAATTTATCCACAATATTTAGCGGATTTAATTGTCCGTGACTTCGGCACTCACGTCAT
    TCGGTCGGTGGATGCGGGAGCGACTTTAATAAAGACTGACGTTCTGAAGTCGAAATACGTTAATAAATTCAAAGGAGATA
    CAACAACCATAGCAGCCGCCGCATCGTTTAGTATGACAAAAGTTCTTGGGGTAACAATCAAAGGAAACTACTTCAGTGAC
    ACTGCTAGCCTCGATGAATACAACAATAACAGCGCAAGCACTAAAGTTGAAACAGTTGGTGGAAGACCATTCGGTTCGAA
    CTTCAAATTGGAAGATTGGGAAAAATCTCTGGATTCAAATTTGGTGGCCATTGATCGTCGAGGCAATCCATTATTCTACG
    CAATAACACCAAGAAGTCTCCCGGAATTTGATGATAAAACCGTTAATAAAATTGTTACTCTTATCAAAAACGCTGTCAAC
    AGATATTATGCAGCCAACACTAGAGTAGGTAAGTTAAACTTTAATAATAAAATACAACGTTGAGACTAGGGTGCATGAAT
    ATGGAATCAGAAAATTTCAATGACGATGCAAATATTGATGGTGGAAATTGTGAAACTCCAAAATCATATTACACACTTGG
    AGGAACATTTCAAACCTGCAAAGGGCCGGATTACCAATGTGAAAACGTAGCTGGCAAGAACCCCATAACGAATAGCTATG
    CGTGTCCTGCAAATTACAAAACCGTTGAATTGGAAAGTGGATTGAGTAAATGCGAAAAGGTTTGCGTTAGGACTTTTTGG
    TTTAGTTACAACTGTCATTACGAATGTTCCTATTACGCACTCTATTGGTGTGCTGCAACGAAAGCGACAACAAAATCAGA
    AGGATCATTATTCGGTGGATTTTACTCAAATACATATCCGAACCCGATAACAAATGCCTATAATTGTCCGCAATATTATT
    ATCCATCTCGATTTGGAATGGTCGGAACGATTTGTTTGGCATTCAATAGAGCAGAGACAATGGAACACCATTTGCCTTTC
    GGAGGATTTTACAGCTGCAAGGTCGGAAATCCACTCTCAGACAAATTTGTAGATAATACCACACAGGATCCCAAATATTG
    GTCGGAAGGTTGCGCAACTGGATACTCATCTCATGTGGCTATTGTCAACCGAGGCTGTCAAATTTCTTACTGTATCAAGA
    ACAACGCGCTTAGCAAAAGGGAGCAACCTCCTCTTTTTAGACCCCCATTTGTTGATTTGGGATTCGGACCGAATGCGACC
    ATCACTACTAGTTTAGAAACTCCAACTGGACTCAAACTCTCCGTCGACGAAAACGGGAAGTGGAGTGAAAACAAAAAATC
    AAAATCATCCAATTATAATATTATTATATTTTCTGTAACAGCAGTAGCAATAATCACCATAATGATTATAATATTAATTC
    TTGGAATTAAAATTCATAGAAAAACTCGAAGAATAACCGTTTTGCCAGAATATAATGGCAGCGATAGGAGCAATTCTACG
    AGTTCTTTGAATAATCCAACAACATCGAATCGCGTTCAGCCATTCAAAATACTTATAGATGAGAATCAATA
    >SMED30016824 ID=SMED30016824|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=375bp
    AAATGTATTTATGATAAATCAAAAGTTGTTGCAAATTTCACTTCGTTTACTGTTATCGAGCCAGGAAACGAATCTGACTT
    GGCAGCCGCCGTGGCCACCGTTGGACCTGTGTCCGTATGCATCGATGCCGATCATCCAGGTTTCCAACATTATAAAACTG
    GTATTTACAATAACCCCAAATGTTCATTTTTATGCTTAAATCATGCCGTTTTAATCGTTGGTTATGGATCACTCAATGGA
    GATAACTTTTGGATTGTGAAGAACAGTTGGGGACCAGATTGGGGAATAGAAGGATACATACTCATGTCAAAGGACAAGGA
    CAACCAATGTGGAATTGCTAGTCTAGCCGCTTATCCAGTGGTCTAATATGCATGC
    >SMED30002704 ID=SMED30002704|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=1178bp
    GAAGATCAAAGGAAGAACCGCTCACATAGGCCCCGCCATGAAAGGAATGTATAAACTGACCCTTGATACCAAGCATACTA
    TAAAACTCAAAGTAATCGCATCATATTTCATAACATGAAGGCATTCATAATTTTGTCGTTATTCCTTGTTGCTATTGAGG
    CTGGGCCAAGGAGATTCACGGTCAACAGTGAGTTGAATGAAGAATGGGAAATATTCAAAGCCCAATTTCATAAACAGTAT
    GAACCGCTAACGGAGGTTATGAGAAGAATCATTTGGGAAGAAAATCTCGACTTCATTAGACAACACAATCTTGAATACGA
    TCTCGGAAAACATTCTTACACTTTGGGATTGAATGAATATTCTGATCTCACTAATGCAGAATTTAAAGCCAAACTTTTAG
    GAAACAGATTGAATGGATCAAACTCAAAAGGATCAGAATTTATGGTGCCAGAAAACATTGGAGCTTTGCCTTCATCTGTG
    GATTGGAGAACTAAAGGATACGTAACCCCTGTGAAAAATCAATATACTTGCGGTTCATGTTGGGCTTTCTCAGCCACGGG
    AGCTCTTGAAGGTCAATATTTTCGAAAAACAGGAAAATTAATTAGTTTGTCTGAACAGCAACTTGTTGACTGCAGTAGAC
    CATATGGAAACCTTGGATGTGGTGGTGGGTTTCCGTATCAGGCGTTTGACTATGTTAATAAATACGGAATGGAATCCGAG
    GATGATTATATATATCGTAACAAAGAAAACAAATGTATTTATGATAAATCAAAAGTTGTTGCAAATTTCACTTCGTATAC
    TTTTACCAAGCAAAGAAACGAATCTGACTTGGCAGCCGCCGTGGCCACAGTTGGACCTTTGTCTGTAGGCATCGATGCCC
    GTGATTGGCGTCTTCAATATTATAAAAATGGTATTTACAATAACCCCAATTGTTCTTCAGAATACTTAGGTCATTACGTT
    TTAGTCGTTGGTTACGGATCACTCAATGGAGATAACTATTGGATTGTGAAGAACAGTTGGGGAACTGACTATGGAATAGG
    AGGATACATCCTCATGTCAAAGGACAAGGACAACCAATGTGGAATTGCTACTCGAGCCGTTTATCCAGTGGTCTAATATA
    AACAATTCTTGATTGAATTTATGACTTTTATTATTAATAAATAAATAAATTTGCTTTC
    >SMED30015696 ID=SMED30015696|Name=Macrophage-expressed gene 1 protein|organism=Schmidtea mediterranea sexual|type=transcript|length=2665bp
    AGTCGCGATAGCACGCAACGTCGACATTGCGATGACGTAATCATTGTGAATCTCTACTACAATCGGATCATTCTAATCAC
    GTGCATCCTAAAACAATATAAATCTTACAAACGGGAATCCAATTGAACATTTATTTACTCAAGCGTGAAACCAATGATAC
    CGTGTAGACTTAATAGTATAATATTGTTTATATTTGTTTATGGAGTTCTATCGGTTTCATGTGAAATTGAACCTAACCGA
    GATCAACCATCTTCAAGACGAGTTCATGAGTGTAAACTCACCAGCAACCAATATCCAGTGAATGTTCTTCCCGGATCTGG
    GTGGGATAATCTTGAAAACAAAGAACTCGGTCAAGTTTTAGAAATTTCATATAAAGGATGTTTTGGATCGAATGATGGAA
    GCTTTCTCATTCCAGACAATGTGGTGATCACCCCAATAAAGAAATCTATTGTCGAGTTAACTTCAGATATATTTGACCAT
    TTCTCAAATGTCACCTCTACAACGGCGATGTCTATCAACGCCGATGCCAGTTACTCAACACCAAGCTACAAAATCAGTGG
    ATCATTTTCATTTGAAAAAATAAGAATAAAAAACGATCAAATCAAAGAAAAGTCGTCGATTTCGAGATCCCAGTTAAGAC
    ATGAATTATATGAAGTAGCGTTCCAACCACACTCAAAACTAGACGCAAAATTCAGAAACAGAATTCTAGATATTGGAGCG
    TTATTGAAAGAAGGAAAAGACACAATTTATCCACAATATTTAGCGGATTTAATTGTCCGTGACTTCGGCACTCACGTCAT
    TCGGTCGGTGGATGCGGGAGCGACACTAATAAAGACTGATGTTTTAAAATCGAATTATGTCAAAGGTTTTAAAGGGGATA
    CAACTAAGATTGCAGCTGCGGCATCATTCAGTATGACAACAATGCTTTCAGTCAACCTCAAAGGAACCTATGTTGGTGAT
    ACCACGAGTCTCAATGAATTCAATAGTAATAGTGCAAGTACAAAAGTCGAAACTTTTGGTGGTATACCGTTTGGTTCGAA
    TTTTAAGTTGGAAGATTGGGAGAAAACCCTTGAAACGAATTTGGTAGCAATTGATCGCAAAGGTGAACCGTTGTCCTATG
    CTATCACACCAAAAAATCTTCCAGAATTCGATGAACAAGCAGTTTTCAAAATAGCTACGCTCATCAAAGAAGCAGTCAAT
    AGATATTATGCAGCCAACACGAGAGTGGGATGTATGAATATGGAGTCAGAAAATTTCAATGACGACGCAAATGTTGACGG
    TGGAAACTGCGAACCTCCTAATACATTTTACAGTTTTGGAGGAACTTTTCAAACCTGCTCAGGCCCTGATTATCAGTGTA
    TGGATGTCGCGGCAAAAAACCCAGTGACCAATAGTTATGCTTGTCCTGATAACTATGATACCATTGAATTACAAAGTGGA
    TTGAATAAATGCATAAATTATTGCACCAAATACTTATTTTCCACTCAATGTCATTACGAGTGTTCCCAATATGCATTGTA
    TTGGTGTTCTTCTACAAACAAAACGAAAATATCAGAAGGCGCACTTTTCGGGGGATTCTACACTAATACATTTCCGAATC
    CACTTACAAATTCCTATAGTTGTCCACAATACTATGTAGCGACAAGATTCGGCGTAAACGCCAAGGTTTGCACTGCACTC
    AATAAGGCAGAGGCTATGGAACACCATTTGCCGTTTGGAGGATTTTATAGTTGCAAAGTTGGAAATCCTCTACTAGATGA
    TCCTCTCTACAACATTACACAGGATCCCAAATATTGGCCTCAAGGTTGTTCAACCGGATATTCATCACATGTAGCTATTG
    TCGACAGAGCTTGTCAAATTTCCTATTGCGTTAAAAATAACGCCCTTAGCATGAGAGAGCAACCGCCTCTCTACCGACCA
    CCTTTTATTGATTTGGGATTTGGACCCAATATGACAGTAATTACCTCTCTGGACACTCCAATGGGGGTCCGATTATCTGT
    TGATGAAAACGGGAAATGGAGTCATAATCACCAATACAAATTATCCAATTACAATATTATAATAATATCAGTCATTATGG
    CGGCAGGAGCCAGCATTGCAATTATTATTATAATTCTTGGAGTTCAAAGATTCAGCAGAAACCGAAAAGGTCAAGTCTCA
    CCGGAATCTCATGAATTTGATAGCAGATATGATTCTACTAAAGATGTTGCCAATCTTGCGTTACCCGGCGAGGTTCCACC
    GTTTCGTGTTATAATTGACGGAGCGAAATGATGCTTGGAACCTTTTATTATTTCTGTTGAATCTGATCTGTAAATGTTTT
    CAGAATATTTTTCTAATAAAATCGTTCTGAAATTTTAAAGTGATCCTTGATGCTATTAAATGATGGACTTTATTGTACCC
    CGAATTGGGTCACCCTTGTTCACGCAAATTCGTGCTTAGGATATTTGTACGGGCTTATGCAACTTTTTAAATTTTTATTT
    TTCCTTATTTTTATTAGCAATCCGTTTTATTTATAACGACAAATGCTTGATGTTTGAATCAAATTTTTATTATGTTTCTT
    AATGAAACATAGTGAACAATGTGCCACTAATTTCATAACCAAGGTCTAATCAAATAGTTTGGGTAGTGAAAGCAATATTA
    CAGAGTTTAGGTTTGTCATTCATAT
    >SMED30000139 ID=SMED30000139|Name=Macrophage-expressed gene 1 protein|organism=Schmidtea mediterranea sexual|type=transcript|length=2115bp
    GTTTGATAAAAGTTATAATTTTATTATTAAATAGTGAAAATGACAATTTTTATGTTGGGTCGAGTAATTTTATTCCTCTC
    AATCGGATCCATTTTGGCTGTGCTGGCTGAGGAGAAAGAGCTAAATATTACTCATCCCCACAAAAATATTGCCACTTCGA
    ATTTGCCATCAGCCAAATTTGTACATGGATGCCATTTGACCAACAATCAGTATCCATTCAATGTGCTTCCTGGATCTGGC
    TGGGATAATTTGTCAAACCGCGAGTTGGGACAAGTTCTAAAAGTAGCCTATTCTCGTTGCAAATCATCCAATGATGGAAC
    CTTTCTCATTCCGGACAAAACAAAAATTACGGCGTTTATGAAATCTAGAGTTCAAATGGATTCAGATATTGTAACACACT
    TTTCCAAATATTCCTCCTTGACTTCGAAATCAGTAAATCTTGAAGTCAGTTCTGCAACTCCGAATGTTCAGATCAGCGGT
    TCATTTTCTTATGAAAAGAAAGACATCAAGGACAATCAAATGAAAGAAAAATCCGCCTTTTCTCAAACTCAGTTAAGATA
    TGAATTGTATCGAGTATCCTTCGAACCGGATAGTGAATTGAATGACAGATTTCGTGAAAGGATCCTTGATCTTGGAGTAC
    TTATAGAGAATAAAAAGGGTTCAGCTCATGCTCACTATCTCGCTGATTTGATTGTCAGAGATTTCGGAACTCATGTTATT
    AAATCTGTTGATGCTGGAGCAATTCTTTCAAAAATTGATGTCCTAAAAGGTGACTATCTTTCAAAACACGAGGGCTCTCA
    ACATTCCGTGACATTAGCTGCGTCAGTTAGTATGAGAGAAACACTTGGAATTAAAATAAGTGGTAATTACAAAACCGGTC
    ATTCGGAAATGGAAGAGTACAACAAAAATTGCGTAAGCACTCGAATCTCTACAATCGGTGGTGGACCTTTCGGTTCGAAT
    TTCACGCTAACAAAATGGGAAAAAACTCTTTCAACAAATCTTGTGGCCATTGACCGTATTGGGGAACCGCTTAATCACAT
    TATTACCAAACGTAACGTACCGGAGTTTGACGATAAAATTGTGTATGAAATCGGAAACCATATCAAGGAAGCAATAAGCC
    GATATTATTCTGCTAATACTCGAACTGGATGCATGGACATTATGTCAAAGAACTTTGATGAAAATGCAAATGCCGACAGT
    GGATTATGTAATAACATTGAAAATGGAAATTTCTTTGGGGGTTTATACCAAAAATGCAGTTTAGACGATGACTCTCTCTG
    TGAGAATATAATACAAAAAAATGCCGCTACTGGGGATTACTCGTGTCCAAATGGGTTCACTCCAGTCAAACTATATTCAT
    TCAAGTATAAATGTGAAGGTGATAACTGTCCTATTTATGAAACCTTCTGGTGTGTCTCTAACGGTAAATCGTCAAAAGGA
    TATGAAATTTTTTTCGGAGGAATCTACACAACAAATATTCAGAATCCGTTTTATAGGGCTGACAGTTGTCCGCAATACTT
    CTTTCCTGCTAATGTTGGAATTAACGGTAAAGTCTGCATTTCAATGGATAAAGAACTGGGATTTAAAAATAGTTTACCAT
    TTGGAGGATTTTACAGCTGTTCTATGGGAAATCCATTAGCTCAAAAGAAAGGATTTAATTCAACTGTAAATGGAAGTTAT
    TTTCCAAAAGCTTGTGGAAGTGGCTATTCTTCTCATTTTGCTCTCCTAGATGGTGTCTGTCAGTTGTCCTATTGTGTTAG
    TACTAATGCACTGACAAAGGGATATGACCTACCGTTGTACAGACCCCCATTTATTGATATTAAAACGGAATCAGAAGTTG
    TCAACATCAACGCATTGAAAACGTCGGCTGGAATAAAAATGATTCTTTCTGAAAATGGATCTTGGGAAACAATGATTCCT
    GAATTCTATTCCACGTACAAATATGCAATAATAACAGTGCTATTTCTCGTGCTATTATCCTTGCTTTTCCTGATGGCAGT
    TTTAGCTTGGAAGGGTTTTAGACAATTTCTTGGAAGGATTTTCACTAAAATACCTTTAGTGAATAAAAAACAATCAAACC
    ATAAACCGATTCGCGTACAAATAAAGGTGACCAGA
    >SMED30017650 ID=SMED30017650|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=1091bp
    GATGGGTCCTATCTTGATATGTTTATTATTAGCAGTGATTTCAGAAGCCAGAACCACTTATAGCCATCACAAATCAGTTC
    CAAGTGATGACATTTCTAGTAAATTTGAACTAGAAAATATGGTATCTCTCTTGTCCCGTTACGATGGAGAATTCCAAACC
    TTCAAACAGCGATATAATAAATCTTATAGTTCCATGCATGAAGAGAATTCCAGATTTTTAAATTTTATATCATCTCTACT
    TGAGATCAATCATCACAATCAACTTTATGAAAACGGTCAGAAATCATACGAGATTGGAATCAACCATTTGAGTGATTGGA
    GTGGCGAAGAACTCGCTCAACTGACTAAATTGAAACAATCAAACCTGACGGGCTCATCATATCTATCATCCAATGTGAAA
    ATTGACCTTCCAGATTCATTCGACTGGAGAGAGAAAGGTGCAGTTACTGAAGTAAAAAACCAAGGATTTTGTGGATCATG
    TTATGCATTTGCTACTACTGGCACCCTAGAAGCCCAAATCTGGAGGAAGACTGGGAAATTGATCAGTTTATCAGAACAAC
    AAATTGTTGATTGCGATACTAATGATGATGGTTGTGATGGCGGATTTGTGCAAGACGCGTTATCATACATCAAGTCAAAT
    GGAGGCATTGAAAATGAGGAAAGTTACCCTTACATATCAAGTGAAACATTTAAACCTAATTCTAAATGCAATTTCTTCAA
    AAGCAAAGTAGTGGCCACCGACACTGGATTCGTTCAAATGCCAGCAAATGACGAAACAAAAATGAAAGAAGCTCTAGTTA
    CAATTGGGCCTATTTCAGTAGCAATATCTGCAACCAAATCGCTCAAAAGATATACAAGTGGCATTTTTCATGAGGATGAA
    TGTGACAAACTAAAACTTAATCACGCTGTTCTGATAGTCGGATATGGAACAGATCAAACTTCCGGGACACCATATTGGAT
    AATTAAAAATAGTTGGAGCTCATTTTGGGGAGAAAATGGATATTTCCGGTTACCCAGAAATATAAATGCTTGCAAAGTAG
    CGATGATGCCAGTTTATCCTTTGGTTTGAATTGATAAAATTTTGTTCACAC
    >SMED30019754 ID=SMED30019754|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=1366bp
    ATTTAATTTGCTCTATTTTATTTATCAGTAATTTGTTTATTCAAAATATATAATTAACATTGTTTTGGACATCTGTTATG
    AAGTTAGTAATAGTTTGTGTTATTCTCTGTTCAGGCCTTGTTAATTGTAATCCAATAACTAAGCTTTCTGACAATGAAGA
    CAATTTAATTTTTGATTCAAACCTTTCTAATTCCAAGTCAAATCATGATCATTTTATTGTCAACTTTGGTCAACTAATTA
    CTTATGATTCCAAGTTAGTAAAAGAATTGTCGAATTTATTAAATGAATTTCTACAACTCCCAACAATTGAGTTTATAAAT
    CAAATAAAAATAGAATGGACAAATTTTAAAGTTAAATTTAAGAAAATTTACAAAGATGTTAAAGAAGAATCTGAACGGTT
    TTTGATATTCTTAAAAAATTATCTCAAAATAAAAAGCCACAATTTAAAATTTAATTCCGGAACAGTTCAATTCAATATGT
    CAACTAATCATTTATCTGATCTAACTGATTCTGAATATTCAACATTATTGGGCTTTAAATTTGGAAAGCGTAAAGATGGG
    CCTTCGTATTTGTCACCTATGTCTCGCGTAATGTTACCGAACCAAGTTGACTGGAGATTAACTGCAGTTACTCCAGTGAA
    AGACCAAGGAAATTGTGGGTCATGTTGGGCTTTTTCTGCAACAGGCTCGTTAGAAGGTCAACATTATAGGAAAACGAAAA
    AACTTATCAGTTTATCTGAACAGCAATTGGTGGATTGCAGTCTAGATAATAGCGGTTGCAATGGTGGGTTAATGGATCTG
    GCTTTCACATATGTCAATGATAATGGGGGTATTGACAATGAGCAAGCCTATCCATATACCAGTGGGAAAACCGGACGAAG
    ATCTGCCAAATGTAATTTTACTATACACAATATTGGCGCAAAGGATTTCGGATATATTGATATTCCTCAAGGAAATGAAG
    TTTTGCTTAAAGAGACTGTGGCATTGATTGGTCCAATTAGTGTTGCTATTGATGCTAGTCAATTCAGTTTCAGAAATTAC
    CATTCTGGTGTTTATGAAGATCCCAATTGTAGTTCTGTAGAACTTGATCATGGTGTATTGTTAGTAGGCTACGGAATCGA
    AAAAGAATCGAACATTCCATATTGGTTAGTTAAAAATAGTTGGAGTACAAATTGGGGAGATTCGGGTTACATAAAAATGA
    GACGAAATTCTAATAACATGTGCGGAATCGCTACAGCCGCTTCATTTCCTATAGTGTGAAAGTCTGTCATATTTATTATT
    GTTCATTCTCATGATATTCTGTTCATGTTTCAATAGTTGTCCATATCGTACTCTACGTTCTTTTTTATATAATAAAAAGT
    TAATAT
    >SMED30001027 ID=SMED30001027|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=1243bp
    TAATAATTTGCACATCAAACCGTAATAATAACGGATCCGTACAATTTCATCAATATAAAATATTACACAACAAATGCGAC
    TTGCATCGACAATTCATATAAAAATCTCCAACTTTCACTACTATTCATAAATTACAAATGATCTCCTCAGTTGTATTGTT
    ATTTTCTATCTCAGTCGCATTCCTAGCAAATGCCGAAATCTGGGAACCAGATCGAAACCTTTCAAACGTCCATCAGAGTC
    ACGCTAATACAAAGTTTTCCAGGAAAATTTCATCTTTGATGGTGGATTTCAAGTCAGAATTCGCCAAATTTAAATTACAA
    TATGGAAAGGTTTACGAGTCAATTGAGAAAGAAAACGAAAGATTCAACAATTTCATATTATCTCAAGTTGAAATAAACAA
    TCACAATCAAATGTTTGAAAAGGGTCACAAGAAATTCCAAATGGAAATTAATCACATGAGTGATTGGACTCCAGAAGAAT
    TCAATCAACTTAATAGCCTAAAGATATCTAATCTCACCGGTTCGACATATTTGCCATTGAACATAAAGCCTGGCCTTCCA
    GAGTCTTTTGATTGGAGAGACAAAGGTGCAGTTACTGAAGTCAAAAATCAGAAATATTGCGGTTCGTGCTACGCATTCTC
    TACGACAGGCGCGTTAGAAGGTCAACTATTCAGAAAAACCGGAAATTTGATAAGTTTATCTGAACAACAAATTGTTGATT
    GTGATCATGTTGATTATGGTTGTAGTGGTGGCTTAGTACCAGACGCTTTCAATTACATCAAATACTCCGGAGGAATTGAA
    TCCGAACAAGAGTATCCATATGTATCTGGATTGACAAAGAAACCAAATCCAAATTGTAATTTCAAAGAAAAAAAAGCAGT
    TGGAACAGATACCGGATTTGTGAAATTGCCTCCTGGAGATGAAGAGGCTTTGAGAGAAGCTTTAGTGACAATAGGCCCGA
    TTTCGATAGCGTTTTCCGCCACTGAGCGATTCAAACATTACAAAAATGGAATTTACCATGATGATTGGTGTTCAAATGTC
    CGTATCAATCATGCAGTTTTACTCGTCGGATATGGAATGGATGAAGAATCAGGAACGCCTTATTGGATAATAAAAAATAG
    TTGGGGACCCAAATGGGGAGAAAACGGATATTTCCGTTTCGAAAGAAATAAAAACATGTGCAACATGGCATACAATTCAT
    ACTATCCATTGGTTTGATTGAACGACTTCTTATGAGTGTGTGC
    >SMED30008458 ID=SMED30008458|Name=Lysosomal alpha-glucosidase|organism=Schmidtea mediterranea sexual|type=transcript|length=3017bp
    ATTGTTATGCAAAATTATTTTAGCAAAAATTCCGATAGGTTTTATCTAATTAGTAATTAAGTAGATACTTCATGCTCTTG
    AACTTGATTTTATTTTAAAATGGAGGTGTGTCGCTGATCTGGAAAAGTTTAATTTCAAATTATCTTTAATTAGATCATCA
    CACCTATTTTAGTTGTTGTAGAGAGTCAAAGTTCAGCTTTTAATTAATATATATTCAATTAAAAATTTGCAAAAAATTAT
    TTCCATTTCAAATGAAATTAATAATATTAATAAGTTTTATTAATTTGATTTCGTTATTCAACTTTTCCAACGCGACAGCA
    CAATGTCAAATAGCCAATAACAATGAGAGACTTGATTGCTACCCAGAATCCGGAGCCAATCAAGATTCATGTATAGCAAG
    GGGGTGTTGCTGGTCCGAACCAATGAGATTGTCCAATAAATTGCAAGGTGTTCCACTATCAATCCCATATTGCTATTATC
    CAACTGATTATTCCAACTATATGATTAAATCCTTAAGAAAATCTTCAAGAGGGATCAAAGCAAAATTAGTCAGGGAATCA
    CCAAGTTATTTACCCTATGAAGTTGCAATGTTAGATCTTGAGGTAATTTATGAAACAAAATCTAGAACTCGAGTCAGAAT
    AACAGATCCTAAACAAAAAAGATATGAAGTTCCAATGAAACTCAGTCCTCCAGATTTGAAGCCACCGACTGATCGAGAAT
    ATGAAGTCATAATCCCATCTGATGGTTCATTTTCTATTGAAATTAAACGAAAATCAGATGATCGTTCACTTTTCAAATCA
    TTTGGGCCACTTTTATATTCTGATCAATTTTTACAAATATCTTCAATAATGTCAACTGATCAAATCTATGGAATAGGAGA
    ACAAAATAGACCCTTTCTTCATCAATTATCCAATGGCTGGGAAAGAATTGGATTGTGGGCAAGAGACAATCCGATTGAAA
    CATTTATGAATCTTTATGGAGCTCATCCATTTTATATCGGTATGCCAGACGATGGAAAAGCTTTCGGTGTTTTTCACTTT
    AATAGTAATGGTCAAGAATTCGCTTTACAACCGGCACCAGCAGTAACTTATAGAACAATCGGTGGAATTTTAGATTTCTT
    TATTTTTACCGGAGGCAGCCCTGAAGAAACAGTAAAACAATACCTAGAATTGGTAGGAAAGCCAATGCTTCCTCCATATT
    GGTCTCTTGGATTCCATCTGTCAAAATGGGGTTACAAAAATATTGAGCAATTGTCTGAAATATTTCAAAGAAATATTAAT
    GCCGGTTTCCCAATCGGTACTCAGTGGAGTGATATAGATTATATGGAAAATTATAAAGATTTTACTGTCGACAAAGAGAA
    ATTTAATGGATTGGGAAGATTTGTCAGAGAGATTAAACAAAAATATAACTCTAGATTTGTTGCAATTGTTGATCCAGGAA
    TAAGCTGCACAAGTGGTAACGAATATCCACCTTATTATGAAGGAGTATTTATGGATATTTTCATCAAAGATTCACAGACC
    AATCAACCAATTGTTGGCAAGGTTTGGCCCGGAGAAACAGTTTATCCAGACTTCACTCATCCGAACATTTCTATGTATTG
    GTATAAACAAATTCAACGCTTTTATAATGATGTTCCAATTGATGGGCTTTGGATTGATATGAATGAGCCATCTAATTTCT
    ACGATGGTTCCAAAAGAGGCTGTCAAGGAAATAGTAAATATGACAATCCATTTTTTGTACCGGATATTCGAGATCAGTCA
    TTAATATCTAAAACTATTTGTTCTTCAGCACTCCATTACAATAACGAAAAGCATTATAATTTGCACAATCTCTACGGCTA
    TACGGAATCAGTAACAACAAATAAAGCATTATTAAAAACGATACACGGAAAAAGACCTTTTATTTTATCCCGGTCAACTT
    TCAGTGGATCTGGTAAATATACCTTCCATTGGACCGGGGATAATCAAGCAAGTTGGGATCAGTTAAGAAATTCCATTAGA
    CAAGTGCTTAATTTCAACATGTTTGGTATTCCGATGACTGGTGCTGACATTTGTGGATTTAACGGTAACAGTGATGAAGA
    ACTCTGTATTAGATGGATGCAATTGGGCGCTTTTTATCCATTCATGAGGAACCACAATGCAATCAACCAGAGAGATCAAG
    ATCCAGCTTCATGGAGTATTGAAGCTCAGAAAATCATGAAAATTGCAATAAACATTAGATATGCATTATTCCCTCATTTT
    TATACTTCTCTTGTTAAATCTCATTTATACGGTGGAACCGTGATGAAACCAATGAGCTTTGAGTTTTACTCTGATAGAAA
    TACCCACGGATTGGACCTACAATTCATGATTGGATCATCTATAATGGTTGTTCCTGTAGTTGATCAGGGTGCCAGAAAAG
    TCAATGCTTATTTCCCAGCTGGTATTTGGTATGATTTCCAAAGTGGTAGTATTTTGTATTCTGATTCCAAAGGTGCCCAG
    GTAACCCTAGATGCTCCATTAGATAAAATAAATGTTGCACTAAGAGGAGGCCATATAGTTTCATTGATATCAGATTCTAT
    GACAAATCCTCAGATGTCAACAAATAAAATGATTTTATATTGTGCTTTATCGGAAGATTCACAGGCATCTGGAGATGCAT
    ATTGGGATGATGGGGAAAATGTTGATTCTTATTCTGGAAATAAGTACAATTATTTGAAATTTATTGCCAACGGAAATAGG
    CTGGAAATTTCAGTAGAATTCAAGGGATATGAACTTGTCCCGGTGTTGTCAAAAGTAGTAATTTTGGGGGTAAAACAAAC
    TGGTGTACAAAATGTCTCTATAAATGACAGACCAGTAGACTATCAATTCGACGCAGAAAAATCAATTTTACTGATCAGCA
    ATATTGATCTTAGTATTGATTCGCACATTTTGCTTTCATGGAATTGACTGAAGCAATCTCACAAAAAATATTTTTATTAA
    TAAAACACTATTGTTTTTTAATGCTTGATTAAATTATATTTTTAAAGTTTTTAAAAA
    >SMED30018252 ID=SMED30018252|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=1107bp
    ATTAACAATCCTACAGTATATAAGTGATGTGAAATCCTTTCAAACTCATTGAGACAATGCAAATCATCATCCTTGTATCT
    CTATTCCTTGCCGCAGTAAGTGCCGCTCCACAGCAGTTCACAATCAACAGTGAACTCAACGACGAATGGGAAGCCTACAA
    AACCCAATTCGGAAAAAAGTACGTCTCTTTGAATGAAATCTCAAGACGACTTATTTGGGAACAAAATTTGAAATATATTC
    AACAACACAATCTTGAGCACGATCTCGGAAAACACACTTACACACTCGGATTGAATCATTTCGCTGACATGACCAACGAG
    GAATTCCGGGCGAATTATTTGGGAGTGTCACCAAAACGAATGAACTTCACATCACATTTCATTGCCCCAGAAAATGTGGG
    AGCTTTGCCAAGTTCTGTGGATTGGAGAACTAAGGGATTTGTGACCCCAGTGAAAAATCAACAACAATGTGGATCGTGTT
    GGTCATTCTCAACGACCGGTTCCTTGGAAGGTCAACATTATCGAAAAACTCAAAATCTTATCAGCTTTTCAGAACAACAG
    CTGGTTGATTGCAGTGGCTCTTTTGGAAATAACGGCTGCGATGGGGGGCTAATGGACAGTGCTTTCCAATACATCCAACA
    ATACGGAATTGAAGCCGAAAGTACATATCCTTACACCGCACAAGATGGAAATTGTGTATATGACAAATCAAAAGTTGTTG
    GAAGCTGCACTGGGTTCTCTGATATCCCCCACGGTAATGAGCAAGCATTGGCTTCAGCTGTTGCTACAGTTGGACCGATT
    TCAGTGGCCATTGATGCCAGCAATTATAGTTTCCAATTATACAAGAGTGGTATTTATAACGAACCTCAATGCTCTTCTTC
    CCAGTTAGATCACGGCGTCCTCGCCATCGGCTATGGAACCGAAAACGGTAAGAATTTCTGGCTCGTCAAAAATAGTTGGG
    GTATCGGATGGGGAATTCAAGGATACATCAAAATGAGCAAAGACCAAGGAAACCAATGTGGAATATCTACAATGGCAAGC
    TATCCTTTGGTCTAACTCATTTTGGATAAATGACATTATGCATAATGAAAAAATAAAATGATTTTTT
    >SMED30030421 ID=SMED30030421|Name=Macrophage-expressed gene 1 protein|organism=Schmidtea mediterranea sexual|type=transcript|length=802bp
    ATTGCATGAAGATATTTCAAATTGTTATTTAATGTGCACCCCATGACGCAAATTATAATTGTATAAAATAATTATCTCAT
    TCAAGAAGTTTCATTTCAGGAGCAATAATGACCATTTTATGGGTGTTTTTATTTGCATCAATTCATGGACGTTTTGTATA
    TGGAATATTAAATACAAAGGAAGTCACGAATTTAAAACTTAATTACCAGAATTGTCAGTTAGATACGACCCAAAAGACGT
    TTGATGTGCTACCAGGAACAGGATGGGATAACTTGGCCAACATTGATATGGGAAGAGTTTTGGACCTTAACTTCTCCTTA
    TGCTTATTCTCCAATGATAATAAATATCTGATTCCCAATGAATTGGCTCTATATCCGGAAAAAACTTCAAGAGTAGAAAT
    TTCTAGTGAAATCTTTAGTCATTTTGTGAATTATACATCTTCAACGTCAAAATCCATCAACTTGGCCGTAGAAGGAAGTG
    TTGAGGATTTGAAATTAGGTGGAGCGTTTTCATTTGAAAATACACAAATAAAGAATGATCAAGGTTGATCAACGTTTGAG
    TGACAACCTCTCAATGTATTTACCCAATTCTTCGCAGTTGATAACAAGTGGGCCACCCTCTGACCGGGAGACTACAACAG
    CTCGTGAAGTTCACTGCTAGTTTTCATTTGACAAAAAGAAATTTTATTCCGCTTCGATATTTAATAATTGAAATCATGAT
    ATTTTCCATTTTTCAACGCTCTGGCGCTATTTCAATCAAGCAAAATGACATATTGGACACAAAATCCATTTTCACCAGAG
    TT
    >SMED30028442 ID=SMED30028442|Name=Lysosomal alpha-glucosidase|organism=Schmidtea mediterranea sexual|type=transcript|length=2946bp
    ATTGTTATGCAAAATTATTTTAGCAAAAATTCCGATAGGTTTTATCTAATTAGTAATTAAGTAGATACTTCATGCTCTTG
    AACTTGATTTTATTTTAAAATGGAGGTGTGTCGCTGATCTGGAAAAGTTTAATTTCAAATTATCTTTAATTAGATCATCA
    CACCTATTTTAGTTGTTGTAGAGAGTCAAAGTTCAGCTTTTAATTAATATATATTCAATTAAAAATTTGCAAAAAATTAT
    TTCCATTTCAAATGAAATTAATAATATTAATAAGTTTTATTAATTTGATTTCGTTATTCAACTTTTCCAACGCGACAGCA
    CAATGTCAAATAGCCAATAACAATGAGAGACTTGATTGCTACCCAGAATCCGGAGCCAATCAAGATTCATGTATAGCAAG
    GGGGTGTTGCTGGTCCGAACCAATGAGATTGTCCAATAAATTGCAAGGTGTTCCACTATCAATCCCATATTGCTATTATC
    CAACTGATTATTCCAACTATATGATTAAATCCTTAAGAAAATCTTCAAGAGGGATCAAAGCAAAATTAGTCAGGGAATCA
    CCAAGTTATTTACCCTATGAAGTTGCAATGTTAGATCTTGAGGTAATTTATGAAACAAAATCTAGAACTCGAGTCAGAAT
    AACAGATCCTAAACAAAAAAGATATGAAGTTCCAATGAAACTCAGTCCTCCAGATTTGAAGCCACCGACTGATCGAGAAT
    ATGAAGTCATAATCCCATCTGATGGTTCATTTTCTATTGAAATTAAACGAAAATCAGATGATCGTTCACTTTTCAAATCA
    TTTGGGCCACTTTTATATTCTGATCAATTTTTACAAATATCTTCAATAATGTCAACTGATCAAATCTATGGAATAGGAGA
    ACAAAATAGACCCTTTCTTCATCAATTATCCAATGGCTGGGAAAGAATTGGATTGTGGGCAAGAGACAATCCGATTGAAA
    CATTTATGAATCTTTATGGAGCTCATCCATTTTATATCGGTATGCCAGACGATGGAAAAGCTTTCGGTGTTTTTCACTTT
    AATAGTAATGGTCAAGAATTCGCTTTACAACCGGCACCAGCAGTAACTTATAGAACAATCGGTGGAATTTTAGATTTCTT
    TATTTTTACCGGAGGCAGCCCTGAAGAAACAGTAAAACAATACCTAGAATTGGTAGGAAAGCCAATGCTTCCTCCATATT
    GGTCTCTTGGATTCCATCTGTCAAAATGGGGTTACAAAAATATTGAGCAATTGTCTGAAATATTTCAAAGAAATATTAAT
    GCCGGTTTCCCAATCGGTACTCAGTGGAGTGATATAGATTATATGGAAAATTATAAAGATTTTACTGTCGACAAAGAGAA
    ATTTAATGGATTGGGAAGATTTGTCAGAGAGATTAAACAAAAATATAACTCTAGATTTGTTGCAATTGTTGATCCAGGAA
    TAAGCTGCACAAGTGGTAACGAATATCCACCTTATTATGAAGGAGTATTTATGGATATTTTCATCAAAGATTCACAGACC
    AATCAACCAATTGTTGGCAAGGTTTGGCCCGGAGAAACAGTTTATCCAGACTTCACTCATCCGAACATTTCTATGTATTG
    GTATAAACAAATTCAACGCTTTTATAATGATGTTCCAATTGATGGGCTTTGGATTGATATGAATGAGCCATCTAATTTCT
    ACGATGGTTCCAAAAGAGGCTGTCAAGGAAATAGTAAATATGACAATCCATTTTTTGTACCGGATATTCGAGATCAGTCA
    TTAATATCTAAAACTATTTGTTCTTCAGCACTCCATTACAATAACGAAAAGCATTATAATTTGCACAATCTCTACGGCTA
    TACGGAATCAGTAACAACAAATAAAGCATTATTAAAAACGATACACGGAAAAAGACCTTTTATTTTATCCCGGTCAACTT
    TCAGTGGATCTGGTAAATATACCTTCCATTGGACCGGGGATAATCAAGCAAGTTGGGATCAGTTAAGAAATTCCATTAGA
    CAAGTGCTTAATTTCAACATGTTTGGTATTCCGATGACTGGTGCTGACATTTGTGGATTTAACGGTAACAGTGATGAAGA
    ACTCTGTATTAGATGGATGCAATTGGGCGCTTTTTATCCATTCATGAGGAACCACAATGCAATCAACCAGAGAGATCAAG
    ATCCAGCTTCATGGAATACGGAAGCCCAGAAAATAATGAAAACAGCTATTTCTAATCGTTATGCAATGTTGCCTTTATTT
    TATACATTATTAGTCAAATCCCATATGAATGGTGGCACCGTAATGAGACCAATGAGCTTTGAATTCTTTTCAGATAAAGT
    AACGCATTCTATAGAATTACAGTTTATGATTGGATCCTCGATTATGGCAACTCCAGTTGTTTATCCTGGGGCCAGATCTG
    TAGATGCATATTTTCCAGCTGGAGTCTGGTACGATTTTCACAGTGGAAAATTGTTACATTCAGATGCTGAAGGAGCTTGG
    TTGACTTTGGATGCTCCTTTGGACAAAATTAATATTGCATTACGCGGCGGTCATATAGTTCCTCTATTGGATTCCAATAG
    AAATTCTAAATCAAACATACCAAATAAAATGACATTGTATTGCGGAATGGCACAAGATATGAGTGCTTCTGGAGATTTAT
    ATTGGGACGATGGCGAGAGCATTGACTCCTACTCACGCAATAGATATAGCTATGTATCATTCAATGCTAGCCCTGAGCAA
    CTGTTAATAACACCGGTTTACTTTGGCTACGACTTGTTGCCGGTCTTAAACAAAATCGTAATCCTTGGGTTTGAGAATAA
    GTCAATTACTAAATTTCTATTAAATGACAATGATATTCCTTTCCATTATAATCCGGAGACTTCATCTGTGGTGCTCAGCA
    GTTTAAATGCCAATTTAAATTCCGAAATAAAAATTCAATGGATGTGAATAATTTTTTGTATTTTAT
    >SMED30008977 ID=SMED30008977|Name=Lysosomal alpha-glucosidase|organism=Schmidtea mediterranea sexual|type=transcript|length=2946bp
    ATTGTTATGCAAAATTATTTTAGCAAAAATTCCGATAGGTTTTATCTAATTAGTAATTAAGTAGATACTTCATGCTCTTG
    AACTTGATTTTATTTTAAAATGGAGGTGTGTCGCTGATCTGGAAAAGTTTAATTTCAAATTATCTTTAATTAGATCATCA
    CACCTATTTTAGTTGTTGTAGAGAGTCAAAGTTCAGCTTTTAATTAATATATATTCAATTAAAAATTTGCAAAAAATTAT
    TTCCATTTCAAATGAAATTAATAATATTAATAAGTTTTATTAATTTGATTTCGTTATTCAACTTTTCCAACGCGACAGCA
    CAATGTCAAATAGCCAATAACAATGAGAGACTTGATTGCTACCCAGAATCCGGAGCCAATCAAGATTCATGTATAGCAAG
    GGGGTGTTGCTGGTCCGAACCAATGAGATTGTCCAATAAATTGCAAGGTGTTCCACTATCAATCCCATATTGCTATTATC
    CAACTGATTATTCCAACTATATGATTAAATCCTTAAGAAAATCTTCAAGAGGGATCAAAGCAAAATTAGTCAGGGAATCA
    CCAAGTTATTTACCCTATGAAGTTGCAATGTTAGATCTTGAGGTAATTTATGAAACAAAATCTAGAACTCGAGTCAGAAT
    AACAGATCCTAAACAAAAAAGATATGAAGTTCCAATGAAACTCAGTCCTCCAGATTTGAAGCCACCGACTGATCGAGAAT
    ATGAAGTCATAATCCCATCTGATGGTTCATTTTCTATTGAAATTAAACGAAAATCAGATGATCGTTCACTTTTCAAATCA
    TTTGGGCCACTTTTATATTCTGATCAATTTTTACAAATATCTTCAATAATGTCAACTGATCAAATCTATGGAATAGGAGA
    ACAAAATAGACCCTTTCTTCATCAATTATCCAATGGCTGGGAAAGAATTGGATTGTGGGCAAGAGACAATCCGATTGAAA
    CATTTATGAATCTTTATGGAGCTCATCCATTTTATATCGGTATGCCAGACGATGGAAAAGCTTTCGGTGTTTTTCACTTT
    AATAGTAATGGTCAAGAATTCGCTTTACAACCGGCACCAGCAGTAACTTATAGAACAATCGGTGGAATTTTAGATTTCTT
    TATTTTTACCGGAGGCAGCCCTGAAGAAACAGTAAAACAATACCTAGAATTGGTAGGAAAGCCAATGCTTCCTCCATATT
    GGTCTCTCGGATTTCATTTATCTAAATACGGCTATAAAGATATCAAAGAAATCCATGAGACCCTACAAAGAAATGTCAAC
    TCCGGTATATCAGTGGATGTCCAATGGTCTGACATAGATTATATGGATGGTTACAAAGATTTTTCGGTTGATAATCAAAA
    TTATCAAAACTTTGGAGAATTTGTTAAACAGATCAGAGATGCTTACAATACGCGGTACATTAGTATAATTGATCCCGCCA
    TCAGTAATCAGAACACTGACAATTACTCTCCTTATACAGATGGATTGGAAATGGATATTTTCATCAAGAACCCTGACACA
    AATGAACCAATAATCGGAGAAGTGTGGCCAGGAAAAACAGTTTTCCCTGATTTTACTCATCCTGATATAACAAAATATTG
    GTCAAAACAGATTCGCGCCTTTCATGACATGGTACCAGTGGATGGCTTATGGATTGATATGAATGACCCTTCCAGTTTTG
    TTGATGGATCAACCACTGGATGCTCCAATAATAATCGGTATGACAGACCGTTTTTTGTGCCGGAAATTCGAGACCAGTCA
    TTAATAGCAAAGACAATTTGTTCATCATCCCTTCATTACAATAAAGAAAAACATTATAATTTACACAATATTTATGGCTT
    TAAAGAATCTGTGGTCACTAATGATGTATTACTTCAAATTTTTCCGAAGAAAAGACCTTTTCTTTTATCCCGGTCAACTT
    TCAGCGGATCTGGTAAATACGCTTTTCATTGGACGGGGGATAATCAAGCTAGTTGGGATCATTTAAGGAACTCCATTAGA
    CAAGTGCTTAATTTCAACATGTTTGGTATTCCGATGACTGGTGCTGACATTTGTGGATTTAACGGTAACAGTGATGAAGA
    ACTCTGTATTAGATGGATGCAATTAGGCGCTTTTTATCCATTCATGCGGAATCACAATGCAATCAACCAGAGAGATCAAG
    ATCCAGCTTCATGGAATACGGAAGCCCAGAAAATAATGAAAACAGCTATTTCTAATCGTTATGCAATGTTGCCTTTATTT
    TATACATTATTAGTCAAATCCCATATGAATGGTGGCACCGTAATGAGACCAATGAGCTTTGAATTCTTTTCAGATAAAGT
    AACGCATTCTATAGAATTACAGTTTATGATTGGATCCTCGATTATGGCAACTCCAGTTGTTTATCCTGGGGCCAGATCTG
    TAGATGCATATTTTCCAGCTGGAGTCTGGTACGATTTTCACAGTGGAAAATTGTTACATTCAGATGCTGAAGGAGCTTGG
    TTGACTTTGGATGCTCCTTTGGACAAAATTAATATTGCATTACGCGGCGGTCATATAGTTCCTCTATTGGATTCCAATAG
    AAATTCTAAATCAAACATACCAAATAAAATGACATTGTATTGCGGAATGGCACAAGATATGAGTGCTTCTGGAGATTTAT
    ATTGGGACGATGGCGAGAGCATTGACTCCTACTCACGCAATAGATATAGCTATGTATCATTCAATGCTAGCCCTGAGCAA
    CTGTTAATAACACCGGTTTACTTTGGCTACGACTTGTTGCCGGTCTTAAACAAAATCGTAATCCTTGGGTTTGAGAATAA
    GTCAATTACTAAATTTCTATTAAATGACAATGATATTCCTTTCCATTATAATCCGGAGACTTCATCTGTGGTGCTCAGCA
    GTTTAAATGCCAATTTAAATTCCGAAATAAAAATTCAATGGATGTGAATAATTTTTTGTATTTTAT
    >SMED30011876 ID=SMED30011876|Name=Macrophage-expressed gene 1 protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1880bp
    AACGGAAATACAAATAAATTCTCGATTTGTCAACTCTCTAAAGTTCAAGAGTGCTACAAAGAAAAAAATAGATCACAAAT
    GTCCTCTGAGCAATAATCAAACTCAATTCAACACTTTTCCCGGGTTGGGGTGGGACAATTTGGTAAATCAAGAAATGAAG
    CCCGTTCTGAAGATCTCATTTTCCAAGTGCGAAGAGTCCAGTGATGGAGTTTATCTCATTCCAGACATGACGACCATTTT
    TCCATTAAAAAAATCAAAATTTCATATGAATTCTGATTTATTCTCCAGCTCTTCTGAATATGTTTCTCTCACTTCTCAGT
    CCATTAATGAAGATATTAATTTCTCTGATTTCCCTACTTTAATAAATGGCGCATTTTCAAACGAAAAGACCTCTTTGAAA
    AGGAAAAAAATAAAGAAAAATTCTATTTTATCTCAAGTTCAATTGAGATACGAAGTTTATAATATTTTGTCTCAACCGGA
    CAGTGATCTCTCGAGGGAATTCAAAGACCGAATTGTTGAATTAACGAAATACTTGGACGACGAAAAGAATTTGTTATATT
    TGGATTACTTGTCGGATTTGATCATAAGAGATTTCGGAACGCATGTCATCAAGTCCGTGACAGCCGGGGCAATTCTTGCC
    AAAATTGACGTTCTCAAACCGGAATATGCGTCAAAATATAATAAAAATCAAGGGGAAATTAAATTAGCAGCCGCCTCAAG
    CATGGCTGAAAACGTCGGTACGAATCATGAAAAAGATGAAAGATCAAAAAAATTATTAAAAGAATATAAAGACAATTGTA
    TCAGTTCGACAATGAAAGCAATCGGTGGAATGCCAATTGAGTCAAATTTCAATTTGCAAAAATGGACAAATACCATAAAG
    TCGAACTTAGCACCCATCGACCGACAAGGTGACCCACTCAATTATGTGGTGACAAAGAAAAGTTTACCGGAATTGAAAGA
    TAAAGCAATTTTCGATATAAATAAATTAATTAGTAAAGCAATAAACCGTTACTACAGAGCAAATATGGGATCAGATTGTA
    CGAATATTGGTTCTATGAGTAATGAAAATAATGGAAATATTAATAATAAAATGTGCGAGCAGTCAACAGAAATTAAAAGA
    TTTGGTGGAATATACCAAACATGCGATGGTGAATCGTGTAGTGAATACAAACAGGATAATCCTGCGACTGGAAATTTAAG
    CTGTCCAAAAGGCTACAATTCGTCTATCCTTTATAAAACCATGAACATTAGTAAATGTAAAGAAAATTGTCGAAGCTTAA
    CTTTGTACATGTGTTATGCAAACAGCAATGGATTCAATGATCTTGGTTTTTCTTTTGGTAGAATAATACCCAGATTCAAG
    CCGAAGTCCGATTGCCCTAAATATCACATCTCGCTACGCTTTGGTGCGCAAAACATTTTATGTGTCACTTCAGGTAGAGA
    GCAAGTAGAAGAAAACAGCTTACAATTCGGTGGTTTTTACAGCTGTTTGATAGGAAATCCGTTTACTATAAAAAAACAAT
    CAAACGACAGTGCGAATGGCATTTATGAAAAATCATGCCCCCCAGGATTTACAAGTCAACTTAGTCAAGTCGATTCGGAT
    TGCCCGGTTTATTATTGTACGAGAATATACAAAACCATCAGCAGAGTCGTTTTATTAAGACCGCCATTTATCAAAATTGA
    TTGGAATTTAACTGCTACTAGCGCTGAAACATTCGACAAAATTGACGGTAAAACTGAGATGAAAAAGATCTGGAATAATA
    AAGCGTTTCGGTATTGTGTAATTGCATTAGCAATTTTCTTATTTGTTTTCTTACTTCTATTTTTAATATTGTTCCATCTG
    AAATTTTGCAAAAAATAAATGTTAACTAATTGGTGAGGCC
    >SMED30031287 ID=SMED30031287|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=505bp
    TTGGGCATTTTCAACGACTGAATCATTGAAAGGTCAAAACCAAAGTAAAACTGATAATTTATTCAGTTTTTCTGAGGAAC
    AATTGGCTGATTGTAGTCAGGCATACGGTAATTTTTGTTGTGAGGGTGGTCTGATGGACTTTGGTTTCCAATACGTTATG
    ATTAATAGAATTGAAGCTGAGGATGATTATCCATATTCCGGCATCTTGAGTTTCATAGGATAATAATTGCCGATGTAATG
    GATTCAAAGCAGTCTGGGAATGTATGGAATACAATGACATCGAATCAGGACATGAACAAGATCTTGTAATTGCCATAGCG
    ACAGGTGCACCAGTAAAACTATAATTCTGCGCAACTGCAAGTGTACTTGACATATGTTTAGAGACGGAGTTTATGATGAA
    CCCGGATGTGCATTGGATAACCTAGACTATGGAGTATTTGCAATACGGTATGGAAATGAGTATGGCAATGACTATTGGCT
    TGTCAAGAATAGTTGGAGAACACGT

     

    back to top


    ADDITIONAL REFERENCES:


    Forsthoefel, D.J., James, N.P., Escobar, D.J., Stary, J.M., Vieira, A.P., Waters, F.A., and Newmark, P.A. (2012). An RNAi screen reveals intestinal regulators of branching morphogenesis, differentiation, and stem cell proliferation in planarians. Dev Cell 23, 691-704.

    Forsthoefel, D.J., Park, A.E., and Newmark, P.A. (2011). Stem cell-based growth, regeneration, and remodeling of the planarian intestine. Dev Biol 356, 445-459.

    Martín-Durán, J.M., and Romero, R. (2011). Evolutionary implications of morphogenesis and molecular patterning of the blind gut in the planarian Schmidtea polychroa. Dev Biol 352, 164-176.

    Wurtzel, O., Cote, L.E., Poirier, A., Satija, R., Regev, A., and Reddien, P.W. (2015). A Generic and Cell-Type-Specific Wound Response Precedes Regeneration in Planarians. Dev Cell 35, 632-645.

     

    back to top