distal tubule

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ In Situ Hybridization Data

  ▻ Sequences




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  distal tubule


DEFINITON:

  Sinusoidal, non-ciliated tubules connected to proximal tubules within the parenchyma. Tubules are formed via intercellular junctions between two epithelial cells.


TERM DEFINITION CITATIONS:

  PMID:21828097


TERM CITATIONS:


TERM ID:

  PLANA:0000053


ABOUT THIS TERM:

distal tubule

  ↳is a material entity and tissue

  ↳adjacent to collecting duct

  ↳contained in tail region, copulatory region, posterior region of the whole animal, parapharyngeal region, prepharyngeal region, head region, dorsal region of the whole animal and anterior region of the whole animal

  ↳develops from protonephridial progenitor cell

  ↳existence overlaps juvenile, asexual adult and adult hermaphrodite

  ↳part of protonephridia


  → proximal tubule and collecting duct adjacent to distal tubule


  → distal tubule epithelial cell part of distal tubule



DEPICTED BY:


BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30021661Carbonic anhydrase 7CAVII-1Stage 6, Stage 7, Stage 8distal tubule, protonephridia, renal system
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30008552 ID=SMED30008552|Name=Carbonic anhydrase 7|organism=Schmidtea mediterranea sexual|type=transcript|length=911bp
CCGATCTAAATAATTTAATTCAATAAATAATTTCAACTAAAGTTTTTATGATTTCTGAAGATTGGGGATATGGACCTGAG
AACGGTCCACATTTATGGCACAAATCGTATTCCAGTGCGGGAGGATGTTCCCAATCTCCTATCAATATAGATCTTTCACA
GACAAAATACGATATGACTTTAAATTTACATCCTTTAAAAATATGCATTGATAGTTCGAGGACATCAAGTCAGACTTTGG
TATTTACAGGACATAATTTCCGAATCGACTGTGAAGGAGCACTATGCGCATCGGGAGGCCCAATTCCCTATGGTCAAATG
TACAAAATTTCCCAAATTGTGTTTCATTGGGGCAGTACAATTTATGGAGGATCTGAACATTTGATAAATTGTTTTCAATT
CCCATGTGAATGCCAAATGACCTGCTACAATGCCACTCGTTATAGGTGCTTCAATGAGGCGGTAAATAAAAGAGATGGGC
TAATTATCCTATCTACAATGATATTGGGAACAAAAATAAAACCCTCGATCGTTTATTGGGTCCTTTGACGTCGATTCACT
TTTTCAAACACCATGACTTCCGGCAAGAAACCGAACTGTTAGATTTGAAATGTCTTTTACCAGATTGCATCAATCGATAC
TTCACCTACACTGGGTCATTGACTACCCCACCTTGCTATGAAACTGTTACGTGGATCATATTCGAAGGATCCAACACAAT
CAGTGAGGATCAACTAAATCTCATGCAGAAAGTTCACGTAGCCGACGGCTGTAATGGCTTTGACAACTTCAGACCGGTTT
GCTCACTCGGCCAAAGAATCATTACCAGAAATTTTGTTTGAGCCTTTTTTGAACTTGATTTATTTAAATTTTATTTTTTT
AATTGCTACTGTAGTGGATGTTATGGGGAAT
>SMED30021661 ID=SMED30021661|Name=Carbonic anhydrase 7|organism=Schmidtea mediterranea sexual|type=transcript|length=1073bp
CATACATATATATATATATATATTGAGACTATTCATTTTTTTCCATACAAAATTCAAACAAAATGAAACCATTTCTATTT
CTATTTTTATTTCTTGTCTCATCTCTTGATCTGAAGATCACCGAGGCTTCAGGCACCGGAAATTGGGGCTATACGTCAAC
CAGTGACATCAAAGGCCCCTCGGACTGGAAAGACATTAATCCAACTTGCGACGGAGCTCGGCAATCACCGATTGATATCG
TGACAAGAAGTGCGGTTTATTTGAAAGATTTACAAAGGATTGAAATTAAAAAAATTGACAACTTTGCTAACTTTTCCACT
CTCGAAAGACATGAAACCTCTATTTACTTAAAGCTTAATAACAGTTGGGGAATCACTTTCGGAGGAAATCAATGCCTAAG
ACCTGACTCCATTCATTGGCATTGGGGATCCAAGGGTACTTTAGGATCGGAACACTCTCTAGATGGGAAGCATTATCCAA
TAGAAGGCCATCTGTTGTCATATAATTGTATGAAATACAGTTCTTTGAATGAAGCAAAATCGAGTCCGGAAGGTCTTTAT
GTAATTGGTATTTTTTATAAAATCGGAAAAAAAAATATGTTAATTGACAAAATTATCCCGGCAATGCAAAGTCTGATTTC
CAGTAGTGATATCTCGAGCGTGATCATTAACGAGATTTCGGTGGAGGAAATTCTACCGAAAAATTTGGACAAGTATTATC
AATATGACGGCTCATTGACGACCCCTCCATGTACAGAAAACGTCAGGTGGACAGTGCTAAATGAAGAGCTAACTATAGAT
GAATCTCAATTGGAAGTTTTTCGCCAATTCGACTTCGAATCTCCCAATTCTGGGGAAATGGAGAACAATTTCCGACCAAT
CTTATCAAAGTTCAATGAAAAACGAACAATATATTCCTCATTCAAAACGGGGTCCAGTTAGACAATCTTATTATGGGTGC
TTTGTGCAATCTTCATGTGCCTGAATAGTCGATAATATGATGTTCATAACACTCAAATAGCACATTTAATTCATTTTGAT
TAACACTATTTTTCATTTCATTTATGTCAATTA

 

back to top