distal tubule

The Planarian Anatomoy Ontology (PLANA) is a collection of terms curated from the literature and other organism anatomy ontologies to describe anatomical features, life cycle stages and developmental processes in the regenerative flatworm Schmidtea mediterranea. The latest version of the PLANA Ontology is available through the Open Biological and Biomedical Ontology Foundry (OBO) . PLANA Ontology terms are searchable at the EMBL-EBI Ontology Lookup Service (OLS) and the PLANA Ontology Terms Page.

Below, the Overview Section is populated with infomration from the OLS.

Additional experimental information related to PLANA Ontology terms can be found in the Additional Term Information Section.



    ▻ Planarian Anatomy Ontology Term Overview

    ▻ Additional Term Information

      ▻ In Situ Hybridization Data

      ▻ Sequences




    Planarian Anatomy Ontology Term Overview


    NAME:

      distal tubule


    DEFINITON:

      Sinusoidal, non-ciliated tubules connected to proximal tubules within the parenchyma. Tubules are formed via intercellular junctions between two epithelial cells.


    TERM DEFINITION CITATIONS:

      PMID:21828097


    TERM ID:

      PLANA:0000053


    ABOUT THIS TERM:

      distal tubule "is a" definitive tissue

      distal tubule "adjacent to" collecting duct

      distal tubule "contained in" dorsal compartment, tail, posterior compartment, copulatory region, parapharyngeal region, anterior compartment, neck and head

      distal tubule "develops from" protonephridial progenitor

      distal tubule "existence overlaps" juvenile, asexual adult and sexually mature adult

      distal tubule "part of" protonephridia


      proximal tubule and collecting duct "is a" distal tubule

      proximal tubule, collecting duct and distal tubule epithelial cell "is a" distal tubule


    BROWSE ONTOLOGY TREE (IN OLS):

    Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.


    Planarian Anatomy Ontology


    EXPLORE ONTOLOGY GRAPH:


    Dynamically explore this term by selecting additional relationships to display ( checkboxes on the right ) and by expanding nodes by double clicking on a node. Single click on a node to display the definition below.

     

    back to top


    Additional Term Information


    All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


    IN SITU HYBRIDIZATION DATA:


    Smed IDAccessionNameAliasEnriched during stage(s)Tissue/PatternImages
    SMED30021661Carbonic anhydrase 7CAVII-1Stage 6, Stage 7, Stage 8protonephridia, renal system, distal tubule
    Click to see image symbols and abbreviations
    Abbreviation or symbolDefinition
    Ooral hemisphere
    Aaboral hemisphere
    Ddorsal
    Vventral
    Llateral
    black arrowheadembryonic pharynx
    red arrowheaddefinitive pharynx
    black arrowsprimitive gut
    yellow arrowsprimitive ectoderm cells
    cyan arrowsbrain
    cyan arrowheadsnerve cords
    blue arrowheadseye progenitors (trail cells)
    purple arrowheadseyes
    scale bar100 µm

     

    back to top


    SEQUENCES:

    smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

    >SMED30023854 ID=SMED30023854|Name=Carbonic anhydrase 7|organism=Schmidtea mediterranea sexual|type=transcript|length=1335bp
    GTCCAATAAACTGATAACATATGGTACAAATGTGCCTCGAGGTGTTGTGCAAATATACAAGCACATTTTCATCCAATCAA
    ATCGATAATTAAAACAAATTAAATAATATATACGCACAAAATTACTTGCTTATTATCGGTATCTCATTTTAGTTTTTAAT
    ATATCGAAATTACTCATGAGAATAATTTTGTGTTTTGGAATAATAATTGCCAGTTTCGTGATCCGATCGGATTCGGTGCT
    GGACGTCCACGAGTCCTCCTCGGACAACTGGGGCTACAAAGAAGGCCAATCGTTCAAGGGTCCCTCTCAATGGTGGCAGT
    TGCCAAATACAACATGTGGAGGCCAAAGACAGTCTCCAATCGACATCGTGCCGAAGTTCACAATATATTGGGAGGATTTG
    AAGTTGCCCATCATTTCCCGAATAAACTCCATCAATCATTCTGTAACAATTGAAAAACATTTTGCCTCAATTTACCTCAA
    TTTCAATGACAATTGGAAAATAACCTTCGGTGGAAACGGATGCTTGAAACCGGTTGCAGTCCACTGGCATTGGGGGTCAA
    GTAACTATATTGGATCGGAACATAGACTGCAGGGTACCCGGTTCCCGATGGAAGGCCATTTAGTAAGCTATGATTGCGGC
    CTTTACTCTTCCTTTCAGCAAGCATCCGTCTCACCAAATGGCCTCCATGTAATTGGCTTCTTTTACCGGGTCGGGTTAAA
    TAACCCTGCAATAACTATGGTAGCTAGCGCCATTAAATCACACATGAAATTGAAAACGTTCTCTGTCAATGTCTCAGAAA
    TTCCTCCTAAAGATATTTTGCCACTAGAACTGATGAACTATTATAGATATGAGGGCTCCCTTACCACCCCGCCATGTACT
    CAGAATGTGATTTGGACGGTGCTGCGATCTGTGCAAGATATCAGCGAAGATCAATTGTCTGTTTTCCGAAATTTAGTCTT
    CGGAGATCCCGAATTTGGAAAGTTGGTAAACAATTTTCGGCCGATTTTTCCAATCGAAAAGTCAACGGATTATATTCTCC
    GTGTCGTCTACGCATCCTTTAATTACAGTTCGAAACTCATGACCAATTTTGTGTTACCTGCGTTTATTTTATTACTCACG
    CCTTTTTTCAACAATTATTTACGGAAGTAAAGTCCCGTACAGACGGACTAGGACAGTACAGAGTGTAGTTTTTGTCTCTT
    GGATGAAGTCAAGTTCAGAAATATTAATCATAGTTTTTTTTTCTAATAAACTTTTTATTTATATTTTTGTTTTATGTTAT
    TATATTTGCAAAATAAAGTATAATGAGTTTTGGGTTATGTTTATTTTCATCGGAA
    >SMED30021661 ID=SMED30021661|Name=Carbonic anhydrase 7|organism=Schmidtea mediterranea sexual|type=transcript|length=1073bp
    CATACATATATATATATATATATTGAGACTATTCATTTTTTTCCATACAAAATTCAAACAAAATGAAACCATTTCTATTT
    CTATTTTTATTTCTTGTCTCATCTCTTGATCTGAAGATCACCGAGGCTTCAGGCACCGGAAATTGGGGCTATACGTCAAC
    CAGTGACATCAAAGGCCCCTCGGACTGGAAAGACATTAATCCAACTTGCGACGGAGCTCGGCAATCACCGATTGATATCG
    TGACAAGAAGTGCGGTTTATTTGAAAGATTTACAAAGGATTGAAATTAAAAAAATTGACAACTTTGCTAACTTTTCCACT
    CTCGAAAGACATGAAACCTCTATTTACTTAAAGCTTAATAACAGTTGGGGAATCACTTTCGGAGGAAATCAATGCCTAAG
    ACCTGACTCCATTCATTGGCATTGGGGATCCAAGGGTACTTTAGGATCGGAACACTCTCTAGATGGGAAGCATTATCCAA
    TAGAAGGCCATCTGTTGTCATATAATTGTATGAAATACAGTTCTTTGAATGAAGCAAAATCGAGTCCGGAAGGTCTTTAT
    GTAATTGGTATTTTTTATAAAATCGGAAAAAAAAATATGTTAATTGACAAAATTATCCCGGCAATGCAAAGTCTGATTTC
    CAGTAGTGATATCTCGAGCGTGATCATTAACGAGATTTCGGTGGAGGAAATTCTACCGAAAAATTTGGACAAGTATTATC
    AATATGACGGCTCATTGACGACCCCTCCATGTACAGAAAACGTCAGGTGGACAGTGCTAAATGAAGAGCTAACTATAGAT
    GAATCTCAATTGGAAGTTTTTCGCCAATTCGACTTCGAATCTCCCAATTCTGGGGAAATGGAGAACAATTTCCGACCAAT
    CTTATCAAAGTTCAATGAAAAACGAACAATATATTCCTCATTCAAAACGGGGTCCAGTTAGACAATCTTATTATGGGTGC
    TTTGTGCAATCTTCATGTGCCTGAATAGTCGATAATATGATGTTCATAACACTCAAATAGCACATTTAATTCATTTTGAT
    TAACACTATTTTTCATTTCATTTATGTCAATTA

     

    back to top