cephalic ganglia

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ In Situ Hybridization Data

  ▻ Sequences

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  cephalic ganglia


DEFINITON:

  The planarian brain, consisting of two bilaterally symmetric lobes occupying a ventral position in the head.


TERM CITATIONS:


TERM ID:

  PLANA:0000044


ABOUT THIS TERM:

cephalic ganglia

  ↳is a material entity and organ

  ↳contained in ventral region of the whole animal, head, dorsal region of the whole animal and anterior region of the whole animal

  ↳existence overlaps Stage 6, juvenile, asexual adult, adult hermaphrodite, Stage 8 and Stage 7

  ↳existence starts during or after Stage 6

  ↳part of central nervous system


  → cephalic ganglia primordium and cephalic ganglia progenitor cell develops into cephalic ganglia


Expand to see terms that part of cephalic ganglia


BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30022907SynaptotagminDj-sytStage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, ventral nerve cord, neuron, cephalic ganglia, nervous system, embryonic pharynx
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30019471 ID=SMED30019471|Name=Synaptotagmin|organism=Schmidtea mediterranea sexual|type=transcript|length=1910bp
TTTGGGACTTCTCCAATCTATTAAATATATTTAGAACGAACATCGTTGTGAGAAGCTTTGTCTTGCAAATGCACACCAAC
ACATTCTCTGCCTACTCGAGACCAGCCTGAAGGACGCACCCAGTCATCTCTTATAAAAAAAAAACTCTTCTCTGATTCGG
TATTTTCTGATTAATGGAGATCAAACAATGATTGGGCAACGTCTAGTTTAGAATATTTACAACTAAATCTGCGTATTTCA
ATTTTTTTTCGATTTTGATTGTTGCAAATATTTATGAGTATATCCAATAATATAAGCAGCGCTAGTAATATGACGATAAA
AATGCAACAAAATGTTGAAAAGTCTGTATCACAGCATGTAACAGCGCAAACAAAGGAATCAACATCAAATAAACTTCATA
CAACAACAGCCGGTATCTCGGTTTTGGAGAAAACATTAAAAACATTTCACATGAGTACTGGCACTTTGATTGGAATCGGA
GTTACAGTGTCTATCGTAGTTTTATTACTTCTTTATTGTATTTGCAAACGATGCATTAAGAAACGAAAGAAAAAGAAAGA
TGGCGGCAAAAAAGGTGGAAAAGGCGTAGACATGAAAAGCGTACAACTATTAGGAAATGCTTATAAAGAAAAGGTACAGC
CGGACCTAGAAGAACTGGATGCTAACATGGAAGATAATGAAGGGGCGCAAGATAAAGAAGCAGTCAATCTTGGAAAATTA
CAGTATTCCCTTGATTACGATTTTACAAAAGGCGAGCTAACAGTCGGAGTAATTCAAGCCACAGATCTCCCAGCAATGGA
CATGTCAGGAACTTCTGATCCATATGTGAAAGTTTTTCTATTACCGGATAAAAAGAAAAAATTCGAAACCAAAGTTCATC
GAAAAATATTAAATCCAGTCTTTAATGAGACATTTGTATTCAAGATTCCTTATTCTGAGGTCGGGTCTAAAACTTTGGTA
TTTAATGTTTTCGATTTCGACAGATTTTCAAAGCATGATCAAATTGGGCAAATCCAAATTCCACTGGGTTCAGTAGATTT
ATGCAAAGTTATTGAGGAATGGAAGGAACTCGGCCCACCTGACAGTGATAATGAAAAGGAAAATCGATTAGGAGACATTT
GTTTTTCTTTGAGATATGTTCCAACGTCTGGAAAGTTGAATATCGTCATTCTGGAAGCTAAAAACCTCAAGAAAATGGAT
GTTGGAGGATTGTCGGATCCTTACGTGAAACTATCGTTGATGCTTAACGGCAAACGAGTGAAAAAGAAGAAAACCACAAT
AAAAAAATACACATTAAATCCTTATTATAATGAGTCATTTTCATTCGAAGTTCCATTCGAGCAAATACAAAAAGTTAATT
TAATAGTGACAGTAGTTGATTATGATAGAATTGGAACAAGTGAACCTATTGGAAGAGTAGTTCTTGGATGCAATGCTACA
GGAGCAGAACTTCGGCACTGGTCCGATATGCTTGCTAATCCTAGGAGACCAATTGCCCAGTGGCATACCCTTCAAGATAT
GCCGGAGAAGAGCTGATTTCATTGATTTTAATTTTAAAATCTGTCATATTTTGTGATAAATTTTGCGTATTTATACAATC
ATTCGATTCGATCTTTCCATCAAGTTTCGTAAAATCTGCAGACATTCACGAGGATGCAGAAGAAATAGAAACTTTGTAAT
AAATTAGCATTAGCTGTGATCTCCTATTGACCAAAAAACATAAACTTAATTTTTATAAAGAATTGTGGTGAAATGTTGTT
AGGTTTCAGTCATAGATAACTGTATTTGTGTAATAGTTTGTGTATTTCTCGTCCTGGCCCGATTTTGTGCATTCCACTGG
CAATACTATTTCACTAATAAATTATGTCTGATAATGTATACCAGTATAGGATTTTGTTTGAATTAATGAA
>SMED30022907 ID=SMED30022907|Name=Synaptotagmin|organism=Schmidtea mediterranea sexual|type=transcript|length=1814bp
ATTTATTGAAAATTATTTTTTCTATTATTAGGAGAAAATTGATTATTTTTTTTTGACAAAATAAGTTTTGGATATATTTC
CCATTTGTTTGTATTCGTAAACCAATGAAGAATTCGACTCACGGATCGGATCATTCGGCCAGCAAGGCCAGTATGAAAAC
GAATGTGGAAAAATTTTGGCATGATCTCGGAAAAAAATTGCACATGGATCCAAAAGCATTAATAGGAGTAACAATCGGTT
TGGGAATATTGTTTTTGTTGTTCCTTTATTGCTTATGTAAAAAATGTGTTTTCAAGCGTCGAAAAAAGAAGGAAACGGCC
AAAAAAGGAGCCAAGGGAGTAGTCGATATGAAAAGTGCCCAATTGTTGGGGAATTCATATAAAGAAAAAATTCAACCCGA
TCTTGAAGAACTTGATGCAAACATGGAAGACAATGAAGGTGTAAAAGAAAAAGAAGATGTTCATTTAGGAAAATTACAAT
ATTCTCTAGATTATGATTTTCAGAAAGGAGAATTAACTGTTGGAGTTATTCAAGCAACTGATCTTCCAGCTATGGATATG
TCAGGAACATCAGATCCATATGTCAAATTATACCTTCTCCCAGACAAGAAAAAGAAATTCGAAACAAAGGTTCATAGGAA
AATTTTAAATCCTGTATTCAATGAAACTTTTGTTTTCAAAGTTCCTTTCAATGAAGTTGCATCGAAGACTTTGATTTTCA
ACGTTTATGACTTTGACAGATTTTCCAAACACGATCAAATCGGTCAAATAAAAGTACCATTGGGAGCTATAGATTTAGGT
CGAGTTATTGAAGAATGGAAGGAACTGGAATCTCCAGAAAACGATGGGGAAAAGGAAAACAGGTTGGGAGACATTTGTTT
CTCTTTAAGATACGTACCGACATCTGGAAAGCTTACAATAGTCATTTTGGAAGCAAAGAATCTTAAAAAAATGGATGTCG
GAGGATTGTCTGATCCATATGTTAAACTTTCCTTGATGCTTAATGGTAAACGAGTGAAGAAGAAGAAAACTACCATCAAA
AAGTATACACTAAATCCTTACTACAATGAATCATTTTCCTTTGAAGTACCATTCGAACAAATACAAAAAGTGAACTTGAT
CGTCACGGTTGTTGATTATGACAGAATCGGAACCAGCGAACCGATAGGTAGAATTGTTCTGGGATGTAACGCAACTGGAG
CAGAATTGCGACATTGGTCGGATATGTTGGCAAATCCCCGGCGACCAATCGCCCAGTGGCATACCCTCCAAGAGATGCCA
GAGAACAATTGATAGTGTTCGTTTGATGCTTTAAAGCGGTTTGCATAATTCGTGAAATAAGTTATCAAAATTTGAGAAAT
GTTTTTTTTTCTGAAACAAAAATGGCATGAGACAATATACCAGAGTTCATTAGTGTGTGGTTTCGTTGAATATTTTGGTG
GTGTTGCATCTTATCGTTTGTCCTCTAATCTAATAATGTTTTATTCTTTATATAGCTGATTTATTCTCGAGCGAAACATT
TTTTATGTGTACCAAAATACTTATGTCATAGCCATTGTGATTAGTCTGTAAACTATTGCGTAATAGCCCCTCTCATTGGC
TTTTTTTAAGAGTAGTGAGTTGGAAAAAAAAATACAAAAATGACTTCAATTGTTAAACATTACTCATATTTTATCAGTAA
GTTAACTTGCATATTTGCAGTTAATTATGGCATTTTATCTCTAAATCTCTGAAGCATGGCCTCAAGTCTTTTGTTTGTTT
TAATGTAATTATGTCTAGATGAGAATATTAAAATACTTCGGTTTATATAAAAGA

 

back to top



PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in cephalic ganglia. Click this link to learn more about PAGE.


PAGE Curations: 251


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
cephalic gangliaSMED30022929WntASMESG000051375.1 FJ463750.1smed_ncbi_20200123PMID:18063757
Gurley et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30005718Guanine nucleotide-binding protein G(I) subunit alphaSMESG000026774.1 Gpassmed_ncbi_20200123PMID:22125640
Evans et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30008855Copper-transporting ATPase 1SMESG000058134.1 SMED30008855smed_20140614PMID:26457503
Tu et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30030818Heterogeneous nuclear ribonucleoprotein KSMESG000021944.1 SMED30030818smed_20140614PMID:26457503
Tu et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30035148SMED30035148SMESG000021388.1 SMED30035148smed_20140614PMID:26457503
Tu et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30024368chromodomain helicase DNA-binding protein 4SMESG000068192.1 GU980571.1smed_ncbi_20200123PMID:26457503
Tu et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
cephalic gangliaSMED30003366distal-lessSMESG000045025.1 SMED30003366smed_20140614PMID:21852957
Lapan et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
cephalic gangliaSMED30011934sp6-9SMESG000050160.1 sp6-9smed_ncbi_20200123PMID:21852957
Lapan et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
cephalic gangliaSMED30005718Guanine nucleotide-binding protein G(I) subunit alphaSMESG000026774.1 HQ121519smed_ncbi_20200123PMID:24523458
Lin et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30017196noggin 1SMESG000032158.1 EF633690.1smed_ncbi_20200123PMID:21295483
Gaviño et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30016207Wnt5SMESG000055035.1 FJ463749.1smed_ncbi_20200123PMID:21295483
Gaviño et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30034479EYE53-1 BK007033.1smed_ncbi_20200123PMID:21295483
Gaviño et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30005718Guanine nucleotide-binding protein G(I) subunit alphaSMESG000026774.1 HQ121519smed_ncbi_20200123PMID:23318635
Blassberg et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30022929WntASMESG000051375.1 FJ463750.1smed_ncbi_20200123PMID:20422023
Felix et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30017196noggin 1SMESG000032158.1 EF633690.1smed_ncbi_20200123PMID:19174194
Molina et al., 2009
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30027052noggin-like protein 1SMESG000032255.1 EF633691.1smed_ncbi_20200123PMID:19174194
Molina et al., 2009
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30026932noggin-like protein 8SMESG000008387.1 FJ471490.1smed_ncbi_20200123PMID:19174194
Molina et al., 2009
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30026932noggin-like protein 8SMESG000008387.1 FJ471490smed_ncbi_20200123PMID:19174194
Molina et al., 2009
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30035755Cytoplasmic polyadenylation element-binding protein 2SMESG000055629.1 KX074204smed_ncbi_20200123PMID:28434803
Rouhana et al., 2017
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
cephalic gangliaSMED30016672Cytoplasmic polyadenylation element-binding proteinSMESG000055629.1 KX074204smed_ncbi_20200123PMID:28434803
Rouhana et al., 2017
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
cephalic gangliaSMED30002914Nck-associated protein 1SMESG000055629.1 KX074204smed_ncbi_20200123PMID:28434803
Rouhana et al., 2017
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
cephalic gangliaSMED30028164Cytoplasmic polyadenylation element-binding protein 2SMESG000055629.1 KX074204smed_ncbi_20200123PMID:28434803
Rouhana et al., 2017
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
cephalic gangliaSMED30011055Evi/WlsSMESG000068488.1 FJ463748.1smed_ncbi_20200123PMID:19211673
Adell et al., 2009
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30011055Evi/WlsSMESG000068488.1 FJ463748smed_ncbi_20200123PMID:19211673
Adell et al., 2009
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30016207Wnt5SMESG000055035.1 FJ463749.1smed_ncbi_20200123PMID:19211673
Adell et al., 2009
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30016207Wnt5SMESG000055035.1 FJ463749smed_ncbi_20200123PMID:19211673
Adell et al., 2009
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30022929WntASMESG000051375.1 FJ463750.1smed_ncbi_20200123PMID:19211673
Adell et al., 2009
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30022929WntASMESG000051375.1 FJ463750smed_ncbi_20200123PMID:19211673
Adell et al., 2009
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30019367Set1/Ash2 histone methyltransferase complex subunit ASH2SMESG000051162.1 KC262336smed_ncbi_20200123PMID:23235145
Hubert et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30019367Set1/Ash2 histone methyltransferase complex subunit ASH2SMESG000051162.1 DN296978ncbi_smed_estsPMID:23235145
Hubert et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30019367Set1/Ash2 histone methyltransferase complex subunit ASH2SMESG000051162.1 DN305606ncbi_smed_estsPMID:23235145
Hubert et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30010430ptipSMESG000002680.1 KC262340smed_ncbi_20200123PMID:23235145
Hubert et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30010430ptipSMESG000002680.1 HO008340ncbi_smed_estsPMID:23235145
Hubert et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30028101meninSMESG000028616.1 KC262339smed_ncbi_20200123PMID:23235145
Hubert et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30028594ptipSMESG000002680.1 KC262340smed_ncbi_20200123PMID:23235145
Hubert et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30028594ptipSMESG000002680.1 DN315791ncbi_smed_estsPMID:23235145
Hubert et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30022027host cell factor-1SMESG000068250.1 KC262343smed_ncbi_20200123PMID:23235145
Hubert et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30032882utxSMESG000020110.1 KC262341smed_ncbi_20200123PMID:23235145
Hubert et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30034479EYE53-1 BK007033.1smed_ncbi_20200123PMID:17905225
Molina et al., 2007
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30006846Bardet-Biedl syndrome 9SMESG000064061.1 EE673351.1ncbi_smed_estsPMID:19852954
Glazer et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30035681Intraflagellar transport protein 88SMESG000039906.1 EE280776.1ncbi_smed_estsPMID:19852954
Glazer et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30028417Bardet-Biedl syndrome 1 protein homologSMESG000009880.1 EG344641.1ncbi_smed_estsPMID:19852954
Glazer et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30033407C2H2-type domain-containing proteinSMESG000059040.1 NB.10.6hsmed_ncbi_20200123PMID:19852954
Glazer et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30003466Neuropeptide Y receptor type 1SMESG000064757.1 SMED30003466smed_20140614PMID:27163480
Saberi et al., 2016
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
cephalic gangliaSMED30024342Neuropeptide Y receptor, invertebrateSMESG000059151.1 SMED30024342smed_20140614PMID:27163480
Saberi et al., 2016
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
cephalic gangliaSMED30016794G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000004267.1 SMED30016794smed_20140614PMID:27163480
Saberi et al., 2016
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
cephalic gangliaSMED30014850NPYR-7SMESG000036403.1 SMED30014850smed_20140614PMID:27163480
Saberi et al., 2016
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
cephalic gangliaSMED30031882NPYR-3SMESG000078214.1 SMED30031882smed_20140614PMID:27163480
Saberi et al., 2016
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
cephalic gangliaSMED30026435NPYR-6SMESG000062221.1 SMED30026435smed_20140614PMID:27163480
Saberi et al., 2016
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
cephalic gangliaSMED30023972NPYR-1SMESG000053241.1 SMED30023972smed_20140614PMID:27163480
Saberi et al., 2016
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
cephalic gangliaSMED30023972NPYR-1SMESG000053241.1 KX018969smed_ncbi_20200123PMID:27163480
Saberi et al., 2016
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
cephalic gangliaSMED30003852SMED30003852SMESG000068031.1 GCR159smed_ncbi_20200123PMID:27163480
Saberi et al., 2016
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
cephalic gangliaSMED30005030Metabotropic glutamate receptorSMESG000022915.1 GCR106smed_ncbi_20200123PMID:27163480
Saberi et al., 2016
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
cephalic gangliaSMED30023160GCR143SMESG000056837.1 SMESG000044783.1 GCR143smed_ncbi_20200123PMID:27163480
Saberi et al., 2016
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
cephalic gangliaSMED30023312GCR102SMESG000000533.1 GCR102smed_ncbi_20200123PMID:27163480
Saberi et al., 2016
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
cephalic gangliaSMED30035110GCR158SMESG000012028.1 GCR158smed_ncbi_20200123PMID:27163480
Saberi et al., 2016
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
cephalic gangliaSMED30033285GCR155SMESG000068447.1 GCR155smed_ncbi_20200123PMID:27163480
Saberi et al., 2016
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
cephalic gangliaSMED30023062bruno-likeSMESG000021009.1 DQ344977smed_ncbi_20200123PMID:16890156
Guo et al., 2006
whole organism asexual adult fluorescence in situ hybridization evidence
cephalic gangliaSMED30009858Polyadenylate-binding proteinSMESG000044671.1 SMED30009858smed_20140614PMID:28807897
Bansal et al., 2017
whole organism asexual adult fluorescence in situ hybridization evidence
cephalic gangliaSMED30029487Smed-NDKSMESG000062038.1 GU592830.1smed_ncbi_20200123PMID:24704339
Vogg et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30031525Choline O-acetyltransferaseSMESG000051357.1 FG310880ncbi_smed_estsPMID:23318641
Chen et al., 2013
whole organism asexual adult fluorescence in situ hybridization evidence
cephalic gangliaSMED30013386netrin 1SMESG000006806.1 AY945304.1smed_ncbi_20200123PMID:23318641
Chen et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30027299PBXSMESG000022232.1 SMESG000001913.1 KC353351.1smed_ncbi_20200123PMID:23318641
Chen et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30016207Wnt5SMESG000055035.1 ACJ64864.1smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult fluorescence in situ hybridization evidence
cephalic gangliaSMED30016207Wnt5SMESG000055035.1 ACJ64864.1smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30016207Wnt5SMESG000055035.1 FJ463749.1smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30016207Wnt5SMESG000055035.1 FJ463749.1smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult fluorescence in situ hybridization evidence
cephalic gangliaSMED30016207Wnt5SMESG000055035.1 FJ463749smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30016207Wnt5SMESG000055035.1 FJ463749smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult fluorescence in situ hybridization evidence
cephalic gangliaSMED30010096TPA_inf: prohormone convertase 2SMESG000008070.1 SMESG000008069.1 BK007043.1smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult fluorescence in situ hybridization evidence
cephalic gangliaSMED30027106SMED30027106SMESG000008070.1 SMESG000008069.1 BK007043.1smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult fluorescence in situ hybridization evidence
cephalic gangliaSMED30022929WntASMESG000051375.1 ACJ64865.1smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30022929WntASMESG000051375.1 ACJ64865.1smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult fluorescence in situ hybridization evidence
cephalic gangliaSMED30022929WntASMESG000051375.1 FJ463750.1smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30022929WntASMESG000051375.1 FJ463750.1smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult fluorescence in situ hybridization evidence
cephalic gangliaSMED30022929WntASMESG000051375.1 FJ463750smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult fluorescence in situ hybridization evidence
cephalic gangliaSMED30022929WntASMESG000051375.1 FJ463750smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30008848TPA_inf: insulin-like prohormone-1SMESG000080685.1 BK007034smed_ncbi_20200123PMID:22252538
Miller et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30008848TPA_inf: insulin-like prohormone-1SMESG000080685.1 BK007034smed_ncbi_20200123PMID:22252538
Miller et al., 2012
whole organism asexual adult fluorescence in situ hybridization evidence
cephalic gangliaSMED30008848TPA_inf: insulin-like prohormone-1SMESG000080685.1 BK007034smed_ncbi_20200123PMID:22252538
Miller et al., 2012
whole organism adult hermaphrodite fluorescence in situ hybridization evidence
cephalic gangliaSMED30008848TPA_inf: insulin-like prohormone-1SMESG000080685.1 BK007034smed_ncbi_20200123PMID:22252538
Miller et al., 2012
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
cephalic gangliaSMED30005718Guanine nucleotide-binding protein G(I) subunit alphaSMESG000026774.1 Gpassmed_ncbi_20200123PMID:24992682
Vásquez-Doorman et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30020522ap2SMESG000022356.1 JX010470.1smed_ncbi_20200123PMID:24992682
Vásquez-Doorman et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30034763c-Jun N-terminal kinasesSMESG000043618.1 JNKsmed_ncbi_20200123PMID:24922054
Almuedo-Castillo et al., 2014
whole organism asexual adult fluorescence in situ hybridization evidence
cephalic gangliaSMED30020168c-Jun N-terminal kinasesSMESG000043618.1 JNKsmed_ncbi_20200123PMID:24922054
Almuedo-Castillo et al., 2014
whole organism asexual adult fluorescence in situ hybridization evidence
cephalic gangliaSMED30019744SMED-SMAD6/7-2SMESG000021574.1 JQ278720.1smed_ncbi_20200123PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30019744SMED-SMAD6/7-2SMESG000021574.1 JQ278720smed_ncbi_20200123PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30020806Neuropeptide 12SMESG000038586.1 GU295182.1smed_ncbi_20200123PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30034479EYE53-1 BK007033.1smed_ncbi_20200123PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30006752TorSMESG000025384.1 JF894291.2smed_ncbi_20200123PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30006752TorSMESG000025384.1 JF894291.2smed_ncbi_20200123PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult fluorescence in situ hybridization evidence
cephalic gangliaSMED30002545Myomodulin prohormone like-2SMESG000036321.1 BK007016.1smed_ncbi_20200123PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30014131RPTOR independent companion of MTOR, complex 2 aSMESG000033571.1 SMESG000033570.1 JN815259.1smed_ncbi_20200123PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30023917SMED30023917SMESG000058631.1 BK007024.1smed_ncbi_20200123PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30030074Mothers against decapentaplegic homologSMESG000029614.1 SMED30030074smed_20140614PMID:25558068
Reuter et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30005458Phosphatidylinositol 4-kinase type 2-betaSMESG000074718.1 tr5_11049mu_Smed_v1PMID:25558068
Reuter et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30004187SMED30004187SMESG000043423.1 tr5_10443mu_Smed_v1PMID:25558068
Reuter et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30013828E3 ubiquitin-protein ligaseSMESG000029933.1 tr5_16130mu_Smed_v1PMID:25558068
Reuter et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30018250Telomerase-binding protein EST1A tr5_9369mu_Smed_v1PMID:25558068
Reuter et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30031525Choline O-acetyltransferaseSMESG000051357.1 FG310880ncbi_smed_estsPMID:25558068
Reuter et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
cephalic gangliaSMED30029487Smed-NDKSMESG000062038.1 GU592830.1smed_ncbi_20200123PMID:25558068
Reuter et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30013810TeashirtSMESG000008973.1 KP003815.1smed_ncbi_20200123PMID:25725068
Owen et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30013810TeashirtSMESG000008973.1 KP003815.1smed_ncbi_20200123PMID:25725068
Owen et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
cephalic gangliaSMED30012160SMED30012160SMESG000069851.1 dd_9493dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
cephalic gangliaSMED30020977SMED30020977SMESG000069851.1 dd_9493dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
cephalic gangliaSMED30022193SMED30022193SMESG000069851.1 dd_9493dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
cephalic gangliaSMED30031525Choline O-acetyltransferaseSMESG000051357.1 FG310880ncbi_smed_estsPMID:21566185
Wagner et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
cephalic gangliaSMED30025215Fzd-1/2/7SMESG000040115.1 dd_Smed_v6_6353_0_1dd_Smed_v6PMID:28171748
Stückemann et al., 2017
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30008131DjotxB proteinSMESG000023717.1 SMED30008131smed_20140614PMID:21806978
Iglesias et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30005718Guanine nucleotide-binding protein G(I) subunit alphaSMESG000026774.1 HQ121519smed_ncbi_20200123PMID:21806978
Iglesias et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30014446SMEDWI-2SMESG000069984.1 SMESG000069981.1 DQ186986.1smed_ncbi_20200123PMID:21806978
Iglesias et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30007326otxASMESG000031965.1 Smed-otxAsmed_ncbi_20200123PMID:21806978
Iglesias et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30007567Lysosomal trafficking regulatorSMESG000069984.1 SMESG000069981.1 DQ186986.1smed_ncbi_20200123PMID:21806978
Iglesias et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30024824beta-catenin-1SMESG000039528.1 Smed-beta-catenin-1smed_ncbi_20200123PMID:21806978
Iglesias et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30034479EYE53-1 BK007033.1smed_ncbi_20200123PMID:21806978
Iglesias et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30008639MyoD-like proteinSMESG000034317.1 SMED30008639smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
cephalic gangliaSMED30008639MyoD-like proteinSMESG000034317.1 SMED30008639smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
cephalic gangliaSMED30008639MyoD-like proteinSMESG000034317.1 SMED30008639smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
cephalic gangliaSMED30008639MyoD-like proteinSMESG000034317.1 KF487099.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
cephalic gangliaSMED30008639MyoD-like proteinSMESG000034317.1 KF487099.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
cephalic gangliaSMED30008639MyoD-like proteinSMESG000034317.1 KF487099.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
cephalic gangliaSMED30008639MyoD-like proteinSMESG000034317.1 myoDsmed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
cephalic gangliaSMED30008639MyoD-like proteinSMESG000034317.1 myoDsmed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
cephalic gangliaSMED30008639MyoD-like proteinSMESG000034317.1 myoDsmed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
cephalic gangliaSMED30022907SynaptotagminSMESG000025329.1 SMED30022907smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
cephalic gangliaSMED30022907SynaptotagminSMESG000025329.1 SMED30022907smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
cephalic gangliaSMED30022907SynaptotagminSMESG000025329.1 SMED30022907smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
cephalic gangliaSMED30024586Pax6ASMESG000039056.1 AFJ24746.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
cephalic gangliaSMED30024586Pax6ASMESG000039056.1 AFJ24746.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
cephalic gangliaSMED30024586Pax6ASMESG000039056.1 SMED30024586smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
cephalic gangliaSMED30024586Pax6ASMESG000039056.1 SMED30024586smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
cephalic gangliaSMED30024586Pax6ASMESG000039056.1 JX010503.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
cephalic gangliaSMED30024586Pax6ASMESG000039056.1 JX010503.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
cephalic gangliaSMED30016325Dmd-1 splice form 1SMESG000080385.1 KC736557smed_ncbi_20200123PMID:23652002
Chong et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30016325Dmd-1 splice form 1SMESG000080385.1 KC736557smed_ncbi_20200123PMID:23652002
Chong et al., 2013
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
cephalic gangliaSMED30016325Dmd-1 splice form 1SMESG000080385.1 KC736557smed_ncbi_20200123PMID:23652002
Chong et al., 2013
whole organism juvenile colorimetric in situ hybridization evidence
cephalic gangliaSMED30016325Dmd-1 splice form 1SMESG000080385.1 KC736558smed_ncbi_20200123PMID:23652002
Chong et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30016325Dmd-1 splice form 1SMESG000080385.1 KC736558smed_ncbi_20200123PMID:23652002
Chong et al., 2013
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
cephalic gangliaSMED30016325Dmd-1 splice form 1SMESG000080385.1 KC736558smed_ncbi_20200123PMID:23652002
Chong et al., 2013
whole organism juvenile colorimetric in situ hybridization evidence
cephalic gangliaSMED30016325Dmd-1 splice form 1SMESG000080385.1 KC736555smed_ncbi_20200123PMID:23652002
Chong et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30016325Dmd-1 splice form 1SMESG000080385.1 KC736555smed_ncbi_20200123PMID:23652002
Chong et al., 2013
whole organism juvenile colorimetric in situ hybridization evidence
cephalic gangliaSMED30016325Dmd-1 splice form 1SMESG000080385.1 KC736555smed_ncbi_20200123PMID:23652002
Chong et al., 2013
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
cephalic gangliaSMED30016325Dmd-1 splice form 1SMESG000080385.1 KC736556smed_ncbi_20200123PMID:23652002
Chong et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30016325Dmd-1 splice form 1SMESG000080385.1 KC736556smed_ncbi_20200123PMID:23652002
Chong et al., 2013
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
cephalic gangliaSMED30016325Dmd-1 splice form 1SMESG000080385.1 KC736556smed_ncbi_20200123PMID:23652002
Chong et al., 2013
whole organism juvenile colorimetric in situ hybridization evidence
cephalic gangliaSMED30029226glycogen synthase kinase 3SMESG000019899.1 ABD72512smed_ncbi_20200123PMID:18202849
Adell et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30021687glycogen synthase kinase 3SMESG000023764.1 ABD62975smed_ncbi_20200123PMID:18202849
Adell et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30017456epidermal growth factor receptor 3SMESG000016935.1 HM777016smed_ncbi_20200123PMID:21458439
Fraguas et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30002969transcription factor 7-like 2 isoform X1SMESG000009225.1 dd_Smed_v6_13056_0_1dd_Smed_v6PMID:29291981
Brown et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30008131DjotxB proteinSMESG000023717.1 SMED30008131smed_20140614PMID:21282632
Almuedo-Castillo et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30000196Vang-2SMESG000053210.1 HQ141794.1smed_ncbi_20200123PMID:21282632
Almuedo-Castillo et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30015069ANK_REP_REGION domain-containing proteinSMESG000063648.1 HQ141793.1smed_ncbi_20200123PMID:21282632
Almuedo-Castillo et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30005718Guanine nucleotide-binding protein G(I) subunit alphaSMESG000026774.1 HQ121519.1smed_ncbi_20200123PMID:21282632
Almuedo-Castillo et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30023352Vang-1SMESG000029281.1 Smed-vang-1smed_ncbi_20200123PMID:21282632
Almuedo-Castillo et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30033103Dvl-2SMESG000010246.1 EU130788.1smed_ncbi_20200123PMID:21282632
Almuedo-Castillo et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30032757DishevelledSMESG000049876.1 EU130787.1smed_ncbi_20200123PMID:21282632
Almuedo-Castillo et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30002969transcription factor 7-like 2 isoform X1SMESG000009225.1 KY196226smed_ncbi_20200123PMID:28976975
Su et al., 2017
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30012000tyrosine hydroxylaseSMESG000034472.1 thsmed_ncbi_20200123PMID:28976975
Su et al., 2017
whole organism asexual adult fluorescence in situ hybridization evidence
cephalic gangliaSMED30017498tyramine beta-hydroxilaseSMESG000005292.1 JN400361.1smed_ncbi_20200123PMID:28976975
Su et al., 2017
whole organism asexual adult fluorescence in situ hybridization evidence
cephalic gangliaSMED30014712Transcription factor 7-like 1SMESG000038786.1 KY196228.1smed_ncbi_20200123PMID:28976975
Su et al., 2017
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30014712Transcription factor 7-like 1SMESG000038786.1 KY196228smed_ncbi_20200123PMID:28976975
Su et al., 2017
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30023278Tyrosine hydroxylaseSMESG000034472.1 thsmed_ncbi_20200123PMID:28976975
Su et al., 2017
whole organism asexual adult fluorescence in situ hybridization evidence
cephalic gangliaSMED30025683Transcription factor 7-like 1SMESG000017328.1 Smed-TCF-2smed_ncbi_20200123PMID:28976975
Su et al., 2017
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30024824beta-catenin-1SMESG000039528.1 Smed-beta-catenin-1smed_ncbi_20200123PMID:18287199
Iglesias et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30024824beta-catenin-1SMESG000039528.1 EU082826smed_ncbi_20200123PMID:18287199
Iglesias et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30034479EYE53-1 BK007033.1smed_ncbi_20200123PMID:18287199
Iglesias et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30011440ARID domain-containing proteinSMESG000074600.1 SMESG000074580.1 SMU15033702SMUPMID:30237141
Trost et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30011440ARID domain-containing proteinSMESG000074600.1 SMESG000074580.1 SMU15017366SMUPMID:30237141
Trost et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED3001924239S ribosomal protein L19SMESG000050888.1 SMESG000050880.1 SMESG000076325.1 SMESG000050884.1 SMU15028413SMUPMID:30237141
Trost et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED3001924239S ribosomal protein L19SMESG000076325.1 SMESG000050888.1 SMESG000050884.1 SMESG000050880.1 SMU15002166SMUPMID:30237141
Trost et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30016154SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily B member 1SMESG000018094.1 SMU15037841SMUPMID:30237141
Trost et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30019938Transcription activator BRG1SMESG000050888.1 SMESG000050880.1 SMESG000076325.1 SMESG000050884.1 SMU15028413SMUPMID:30237141
Trost et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30019938Transcription activator BRG1SMESG000076325.1 SMESG000050888.1 SMESG000050884.1 SMESG000050880.1 SMU15002166SMUPMID:30237141
Trost et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30006037PHD-fingerSMESG000073716.1 SMU15013178SMUPMID:30237141
Trost et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30011685SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily E member 1SMESG000020191.1 SMU15005679SMUPMID:30237141
Trost et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30011685SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily E member 1SMESG000020191.1 SMU15025606SMUPMID:30237141
Trost et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30012791AT-rich interactive domain-containing protein 2SMESG000063130.1 SMU15031848SMUPMID:30237141
Trost et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30017381Protein polybromo-1SMESG000004446.1 SMU15005401SMUPMID:30237141
Trost et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30017381Protein polybromo-1SMESG000004446.1 SMU15020196SMUPMID:30237141
Trost et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30024863Transcription activator BRG1SMESG000076666.1 SMU15030580SMUPMID:30237141
Trost et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30033276SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily B member 1SMESG000018094.1 SMU15037841SMUPMID:30237141
Trost et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30033675AT-rich interactive domain-containing protein 2SMESG000020420.1 SMU15034748SMUPMID:30237141
Trost et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30035929SWI/SNF complex subunit SMARCC2SMESG000031576.1 SMESG000013315.1 SMU15037683SMUPMID:30237141
Trost et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30035929SWI/SNF complex subunit SMARCC2SMESG000031576.1 SMESG000013315.1 SMU15001981SMUPMID:30237141
Trost et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30001665Secreted peptide prohormone-13SMESG000009971.1 BK007029smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30013280Pedal peptide prohormone like-2SMESG000059588.1 BK007018smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30011515Secreted peptide prohormone-13SMESG000009971.1 BK007029smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30015821Neuropeptide-22SMESG000043852.1 BK007038smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30015821Neuropeptide-22SMESG000043852.1 BK007038smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
cephalic gangliaSMED30010111TPA_inf: neuropeptide precursor-2SMESG000072719.1 BK007035smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30010111TPA_inf: neuropeptide precursor-2SMESG000072719.1 BK007035smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
cephalic gangliaSMED30001301TPA_inf: secreted peptide prohormone-16SMESG000079890.1 BK007042smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30008848TPA_inf: insulin-like prohormone-1SMESG000080685.1 BK007034smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30008848TPA_inf: insulin-like prohormone-1SMESG000080685.1 BK007034smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
cephalic gangliaSMED30014397Neuropeptide 3 GU295187smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30010096TPA_inf: prohormone convertase 2SMESG000008070.1 SMESG000008069.1 BK007043smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
cephalic gangliaSMED30011959Myomodulin prohormone like-1SMESG000078202.1 BK007017smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30015947Neuropeptide-41 GU295179smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30016664SMED30016664SMESG000011618.1 BK007009smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30016731Neuropeptide Y prohormone-9 BK007040smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30018450Neuropeptide Y prohormone-7SMESG000002722.1 BK007020smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30002469TPA_inf: pedal peptide prohormone like-1SMESG000035027.1 BK007041smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30012851Secreted peptide prohormone-14SMESG000051526.1 BK007030smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30024988Secreted peptide prohormone-2SMESG000070298.1 BK007032smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30027106SMED30027106SMESG000008070.1 SMESG000008069.1 BK007043smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
cephalic gangliaSMED30022326Cerebral peptide prohormone like-1SMESG000015527.1 BK007012smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30022326Cerebral peptide prohormone like-1SMESG000015527.1 BK007012smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
cephalic gangliaSMED30032184Neuropeptide Y prohormone-10SMESG000058298.1 BK007011smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30026493TPA_inf: pyrokinin prohormone like-1SMESG000013290.1 BK007007smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30026493TPA_inf: pyrokinin prohormone like-1SMESG000013290.1 BK007007smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism juvenile colorimetric in situ hybridization evidence
cephalic gangliaSMED30009117Secreted peptide prohormone-3 BK007022smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30001806TPA_inf: neuropeptide precursor-5SMESG000056196.1 BK007015smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30016225Neuropeptide-49SMESG000003228.1 BK007023smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30000854Secreted peptide prohormone-15 BK007013smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30008210Secreted peptide prohormone 17 GU295183smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30029782Neuropeptide-42 GU295177smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30033037Secreted peptide prohormone-9SMESG000019950.1 BK007026smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30020806Neuropeptide 12SMESG000038586.1 GU295182smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30034479EYE53-1 BK007033smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30026615Neuropeptide Y prohormone-6 BK007031smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30034905Gonadotropin-releasing hormone like-1SMESG000061019.1 GU295185smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30033838Secreted peptide prohormone 18SMESG000030647.1 GU295184smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30029602Secreted peptide prohormone-15 BK007013smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30031540Neuropeptide-3SMESG000014460.1 BK007025smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30035859Neuropeptide Y prohormone-5SMESG000048959.1 BK007008smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30009105Neuropeptide 8SMESG000069019.1 GU295189smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30009456SMED30009456SMESG000039758.1 GU295180smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30002545Myomodulin prohormone like-2SMESG000036321.1 BK007016smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30019678SMED30019678SMESG000040636.1 GU295176smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30009462SMED30009462SMESG000023794.1 SMESG000022518.1 GU295188smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30017934TPA_inf: neuropeptide precursor-4SMESG000036661.1 BK007037smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30031317Secreted peptide prohormone 19SMESG000053016.1 SMESG000053015.1 GU295186smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30023917SMED30023917SMESG000058631.1 BK007024smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30025845SMED30025845SMESG000023745.1 BK007028smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30025845SMED30025845SMESG000023745.1 BK007028smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
cephalic gangliaSMED30026988Neuropeptide Y prohormone 1SMESG000069090.1 GU295175smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30025223Neuropeptide Y prohormone-2SMESG000050248.1 BK007019smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30034847Secreted peptide prohormone-11SMESG000069589.1 BK007014smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30018729T-complex protein subunit epsilonSMESG000012740.1 MF669567.1smed_ncbi_20200123PMID:29095551
Counts et al., 2017
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30015232Netrin-1SMESG000050895.1 AY945305smed_ncbi_20200123PMID:16033796
Cebrià et al., 2005
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30013386netrin 1SMESG000006806.1 AY945304smed_ncbi_20200123PMID:16033796
Cebrià et al., 2005
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30022921Netrin 1SMESG000050895.1 AY945305smed_ncbi_20200123PMID:16033796
Cebrià et al., 2005
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30003443Membrane-bound O-acyltransferase domain-containing protein 2SMESG000075570.1 SMED30003443smed_20140614PMID:18063757
Gurley et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30033656axis inhibition protein ASMESG000039725.1 GU808528.1smed_ncbi_20200123PMID:18063757
Gurley et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30016207Wnt5SMESG000055035.1 FJ463749.1smed_ncbi_20200123PMID:18063757
Gurley et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30015768adenomatous polyposis coli-like proteinSMESG000045688.1 SMESG000005328.1 EU130785.1smed_ncbi_20200123PMID:18063757
Gurley et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30015768adenomatous polyposis coli-like proteinSMESG000045688.1 SMESG000005328.1 EU130785smed_ncbi_20200123PMID:18063757
Gurley et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30024824beta-catenin-1SMESG000039528.1 EU130786.1smed_ncbi_20200123PMID:18063757
Gurley et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30033103Dvl-2SMESG000010246.1 EU130788.1smed_ncbi_20200123PMID:18063757
Gurley et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30032757DishevelledSMESG000049876.1 EU130787.1smed_ncbi_20200123PMID:18063757
Gurley et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
cephalic gangliaSMED30019916Beta-cateninSMESG000022923.1 KT983970.1smed_ncbi_20200123PMID:18063757
Gurley et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
Note: Hover over icons to view figure legend

 

 

back to top