cephalic ganglia

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ In Situ Hybridization Data

  ▻ Sequences

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  cephalic ganglia


DEFINITON:

  The planarian brain, consisting of two bilaterally symmetric lobes occupying a ventral position in the head.


TERM CITATIONS:


TERM ID:

  PLANA:0000044


ABOUT THIS TERM:

cephalic ganglia

  ↳is a material entity and organ

  ↳contained in ventral region of the whole animal, head region, dorsal region of the whole animal and anterior region of the whole animal

  ↳existence overlaps Stage 6, juvenile stage, asexual adult, adult hermaphrodite, Stage 8 and Stage 7

  ↳existence starts during or after Stage 6

  ↳part of central nervous system


  → cephalic ganglia primordium and cephalic ganglia progenitor cell develops into cephalic ganglia


Expand to see terms that part of cephalic ganglia


BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30022907SynaptotagminDj-sytStage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, ventral nerve cord, neuron, cephalic ganglia, nervous system, embryonic pharynx
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30019471 ID=SMED30019471|Name=Synaptotagmin|organism=Schmidtea mediterranea sexual|type=transcript|length=1910bp
TTTGGGACTTCTCCAATCTATTAAATATATTTAGAACGAACATCGTTGTGAGAAGCTTTGTCTTGCAAATGCACACCAAC
ACATTCTCTGCCTACTCGAGACCAGCCTGAAGGACGCACCCAGTCATCTCTTATAAAAAAAAAACTCTTCTCTGATTCGG
TATTTTCTGATTAATGGAGATCAAACAATGATTGGGCAACGTCTAGTTTAGAATATTTACAACTAAATCTGCGTATTTCA
ATTTTTTTTCGATTTTGATTGTTGCAAATATTTATGAGTATATCCAATAATATAAGCAGCGCTAGTAATATGACGATAAA
AATGCAACAAAATGTTGAAAAGTCTGTATCACAGCATGTAACAGCGCAAACAAAGGAATCAACATCAAATAAACTTCATA
CAACAACAGCCGGTATCTCGGTTTTGGAGAAAACATTAAAAACATTTCACATGAGTACTGGCACTTTGATTGGAATCGGA
GTTACAGTGTCTATCGTAGTTTTATTACTTCTTTATTGTATTTGCAAACGATGCATTAAGAAACGAAAGAAAAAGAAAGA
TGGCGGCAAAAAAGGTGGAAAAGGCGTAGACATGAAAAGCGTACAACTATTAGGAAATGCTTATAAAGAAAAGGTACAGC
CGGACCTAGAAGAACTGGATGCTAACATGGAAGATAATGAAGGGGCGCAAGATAAAGAAGCAGTCAATCTTGGAAAATTA
CAGTATTCCCTTGATTACGATTTTACAAAAGGCGAGCTAACAGTCGGAGTAATTCAAGCCACAGATCTCCCAGCAATGGA
CATGTCAGGAACTTCTGATCCATATGTGAAAGTTTTTCTATTACCGGATAAAAAGAAAAAATTCGAAACCAAAGTTCATC
GAAAAATATTAAATCCAGTCTTTAATGAGACATTTGTATTCAAGATTCCTTATTCTGAGGTCGGGTCTAAAACTTTGGTA
TTTAATGTTTTCGATTTCGACAGATTTTCAAAGCATGATCAAATTGGGCAAATCCAAATTCCACTGGGTTCAGTAGATTT
ATGCAAAGTTATTGAGGAATGGAAGGAACTCGGCCCACCTGACAGTGATAATGAAAAGGAAAATCGATTAGGAGACATTT
GTTTTTCTTTGAGATATGTTCCAACGTCTGGAAAGTTGAATATCGTCATTCTGGAAGCTAAAAACCTCAAGAAAATGGAT
GTTGGAGGATTGTCGGATCCTTACGTGAAACTATCGTTGATGCTTAACGGCAAACGAGTGAAAAAGAAGAAAACCACAAT
AAAAAAATACACATTAAATCCTTATTATAATGAGTCATTTTCATTCGAAGTTCCATTCGAGCAAATACAAAAAGTTAATT
TAATAGTGACAGTAGTTGATTATGATAGAATTGGAACAAGTGAACCTATTGGAAGAGTAGTTCTTGGATGCAATGCTACA
GGAGCAGAACTTCGGCACTGGTCCGATATGCTTGCTAATCCTAGGAGACCAATTGCCCAGTGGCATACCCTTCAAGATAT
GCCGGAGAAGAGCTGATTTCATTGATTTTAATTTTAAAATCTGTCATATTTTGTGATAAATTTTGCGTATTTATACAATC
ATTCGATTCGATCTTTCCATCAAGTTTCGTAAAATCTGCAGACATTCACGAGGATGCAGAAGAAATAGAAACTTTGTAAT
AAATTAGCATTAGCTGTGATCTCCTATTGACCAAAAAACATAAACTTAATTTTTATAAAGAATTGTGGTGAAATGTTGTT
AGGTTTCAGTCATAGATAACTGTATTTGTGTAATAGTTTGTGTATTTCTCGTCCTGGCCCGATTTTGTGCATTCCACTGG
CAATACTATTTCACTAATAAATTATGTCTGATAATGTATACCAGTATAGGATTTTGTTTGAATTAATGAA
>SMED30022907 ID=SMED30022907|Name=Synaptotagmin|organism=Schmidtea mediterranea sexual|type=transcript|length=1814bp
ATTTATTGAAAATTATTTTTTCTATTATTAGGAGAAAATTGATTATTTTTTTTTGACAAAATAAGTTTTGGATATATTTC
CCATTTGTTTGTATTCGTAAACCAATGAAGAATTCGACTCACGGATCGGATCATTCGGCCAGCAAGGCCAGTATGAAAAC
GAATGTGGAAAAATTTTGGCATGATCTCGGAAAAAAATTGCACATGGATCCAAAAGCATTAATAGGAGTAACAATCGGTT
TGGGAATATTGTTTTTGTTGTTCCTTTATTGCTTATGTAAAAAATGTGTTTTCAAGCGTCGAAAAAAGAAGGAAACGGCC
AAAAAAGGAGCCAAGGGAGTAGTCGATATGAAAAGTGCCCAATTGTTGGGGAATTCATATAAAGAAAAAATTCAACCCGA
TCTTGAAGAACTTGATGCAAACATGGAAGACAATGAAGGTGTAAAAGAAAAAGAAGATGTTCATTTAGGAAAATTACAAT
ATTCTCTAGATTATGATTTTCAGAAAGGAGAATTAACTGTTGGAGTTATTCAAGCAACTGATCTTCCAGCTATGGATATG
TCAGGAACATCAGATCCATATGTCAAATTATACCTTCTCCCAGACAAGAAAAAGAAATTCGAAACAAAGGTTCATAGGAA
AATTTTAAATCCTGTATTCAATGAAACTTTTGTTTTCAAAGTTCCTTTCAATGAAGTTGCATCGAAGACTTTGATTTTCA
ACGTTTATGACTTTGACAGATTTTCCAAACACGATCAAATCGGTCAAATAAAAGTACCATTGGGAGCTATAGATTTAGGT
CGAGTTATTGAAGAATGGAAGGAACTGGAATCTCCAGAAAACGATGGGGAAAAGGAAAACAGGTTGGGAGACATTTGTTT
CTCTTTAAGATACGTACCGACATCTGGAAAGCTTACAATAGTCATTTTGGAAGCAAAGAATCTTAAAAAAATGGATGTCG
GAGGATTGTCTGATCCATATGTTAAACTTTCCTTGATGCTTAATGGTAAACGAGTGAAGAAGAAGAAAACTACCATCAAA
AAGTATACACTAAATCCTTACTACAATGAATCATTTTCCTTTGAAGTACCATTCGAACAAATACAAAAAGTGAACTTGAT
CGTCACGGTTGTTGATTATGACAGAATCGGAACCAGCGAACCGATAGGTAGAATTGTTCTGGGATGTAACGCAACTGGAG
CAGAATTGCGACATTGGTCGGATATGTTGGCAAATCCCCGGCGACCAATCGCCCAGTGGCATACCCTCCAAGAGATGCCA
GAGAACAATTGATAGTGTTCGTTTGATGCTTTAAAGCGGTTTGCATAATTCGTGAAATAAGTTATCAAAATTTGAGAAAT
GTTTTTTTTTCTGAAACAAAAATGGCATGAGACAATATACCAGAGTTCATTAGTGTGTGGTTTCGTTGAATATTTTGGTG
GTGTTGCATCTTATCGTTTGTCCTCTAATCTAATAATGTTTTATTCTTTATATAGCTGATTTATTCTCGAGCGAAACATT
TTTTATGTGTACCAAAATACTTATGTCATAGCCATTGTGATTAGTCTGTAAACTATTGCGTAATAGCCCCTCTCATTGGC
TTTTTTTAAGAGTAGTGAGTTGGAAAAAAAAATACAAAAATGACTTCAATTGTTAAACATTACTCATATTTTATCAGTAA
GTTAACTTGCATATTTGCAGTTAATTATGGCATTTTATCTCTAAATCTCTGAAGCATGGCCTCAAGTCTTTTGTTTGTTT
TAATGTAATTATGTCTAGATGAGAATATTAAAATACTTCGGTTTATATAAAAGA

 

back to top



PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in cephalic ganglia. Click this link to learn more about PAGE.


PAGE Curations: 6724


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
cephalic gangliaSMED30019921SMED30019921SMESG000058949.1 dd_Smed_v4_10877_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30018242Guanine nucleotide binding protein subunitSMESG000068013.1 dd_Smed_v4_10481_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009224early growth response-3SMESG000000959.1 dd_Smed_v4_14711_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009224early growth response-3SMESG000000959.1 dd_Smed_v4_12410_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30011644tRNA wybutosine-synthesizing protein 3 homologSMESG000069968.1 SMESG000069969.1 dd_Smed_v4_180_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30008024NFX1-type zinc finger-containing protein 1-likeSMESG000034891.1 SMESG000034868.1 SMESG000034856.1 dd_Smed_v4_10633_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007957Iroquois-class homeodomain protein IRX-6SMESG000022899.1 dd_Smed_v4_14656_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015700Mitochondrial import receptor subunit TOM70SMESG000070025.1 dd_Smed_v4_10337_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019993SMED30019993SMESG000051649.1 dd_Smed_v4_1687_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009789SMED30009789SMESG000023107.1 dd_Smed_v4_14239_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007670DystrobrevinSMESG000078318.1 dd_Smed_v4_12275_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30017278Ig-like domain-containing proteinSMESG000001734.1 dd_Smed_v4_10042_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30017378Aldose 1-epimeraseSMESG000011518.1 dd_Smed_v4_1947_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004930Irregular chiasm C-roughest-like isoform X2SMESG000077979.1 dd_Smed_v4_12549_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30016068SMED30016068SMESG000024947.1 SMESG000024945.1 SMESG000024886.1 SMESG000024883.1 dd_Smed_v4_15610_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019393protocadherin-1SMESG000033799.1 dd_Smed_v4_16629_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30017565Ephrin type-B receptor 2SMESG000008191.1 dd_Smed_v4_16928_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004841GTP-binding proteinSMESG000057130.1 dd_Smed_v4_18884_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30014280Malignant brain tumor-like proteinSMESG000025138.1 dd_Smed_v4_11547_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30017286Major facilitator superfamily domain-containing 4SMESG000038006.1 dd_Smed_v4_10372_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30017811Alpha actininSMESG000047739.1 dd_Smed_v4_1492_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019001ras-specific guanine nucleotide-releasing factor 1SMESG000056262.1 dd_Smed_v4_18313_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019001ras-specific guanine nucleotide-releasing factor 1SMESG000073324.1 SMESG000056262.1 dd_Smed_v4_3107_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30016749T-cell acute lymphocytic leukemia protein 1SMESG000067729.1 dd_Smed_v4_16646_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30013360Deoxyribonuclease IISMESG000081053.1 SMESG000081051.1 dd_Smed_v4_1691_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30014507FibronectinSMESG000029226.1 SMESG000029259.1 dd_Smed_v4_16808_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30014507FibronectinSMESG000029259.1 dd_Smed_v4_43824_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30014212SMED30014212SMESG000064028.1 dd_Smed_v4_10207_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30008115TPR repeat-containing protein DDB_G0287407 isoform X2SMESG000012448.1 dd_Smed_v4_12326_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30011962ATP-binding cassette sub-family A member 1SMESG000056983.1 dd_Smed_v4_10304_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30013159LimbinSMESG000017303.1 dd_Smed_v4_10777_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015755SMED30015755SMESG000023987.1 SMESG000017232.1 SMESG000080953.1 SMESG000080618.1 SMESG000072700.1 SMESG000069163.1 SMESG000065358.1 SMESG000064426.1 SMESG000062577.1 SMESG000062150.1 SMESG000060043.1 SMESG000057576.1 SMESG000056292.1 SMESG000054362.1 SMESG000052870.1 SMESG000051517.1 SMESG000050768.1 SMESG000050005.1 SMESG000049698.1 SMESG000045813.1 SMESG000041318.1 SMESG000040743.1 SMESG000039279.1 SMESG000038973.1 SMESG000038321.1 SMESG000029893.1 SMESG000028198.1 SMESG000023025.1 SMESG000021897.1 SMESG000018432.1 SMESG000018410.1 SMESG000017430.1 SMESG000006729.1 SMESG000005334.1 dd_Smed_v4_1692_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30018024SMED30018024SMESG000078454.1 dd_Smed_v4_12583_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30006503InnexinSMESG000068735.1 dd_Smed_v4_15435_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30006503InnexinSMESG000016539.1 dd_Smed_v4_13475_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30013350HPHLAWLY domain-containing proteinSMESG000034214.1 SMESG000030723.1 SMESG000030612.1 SMESG000030179.1 dd_Smed_v4_10891_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30014355LIM domain only protein 7SMESG000039067.1 dd_Smed_v4_10011_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30014496Ribosome biogenesis protein NSA2SMESG000028599.1 dd_Smed_v4_1012_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30018983MANSC domain-containing proteinSMESG000068862.1 dd_Smed_v4_10934_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30016369SMED30016369SMESG000022115.1 dd_Smed_v4_12348_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30017231NEPH-3SMESG000022777.1 dd_Smed_v4_11280_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019886BCL3-1SMESG000023987.1 SMESG000017232.1 SMESG000080953.1 SMESG000080618.1 SMESG000072700.1 SMESG000069163.1 SMESG000065358.1 SMESG000064426.1 SMESG000062577.1 SMESG000062150.1 SMESG000060043.1 SMESG000057576.1 SMESG000056292.1 SMESG000054362.1 SMESG000052870.1 SMESG000051517.1 SMESG000050768.1 SMESG000050005.1 SMESG000049698.1 SMESG000045813.1 SMESG000041318.1 SMESG000040743.1 SMESG000039279.1 SMESG000038973.1 SMESG000038321.1 SMESG000029893.1 SMESG000028198.1 SMESG000023025.1 SMESG000021897.1 SMESG000018432.1 SMESG000018410.1 SMESG000017430.1 SMESG000006729.1 SMESG000005334.1 dd_Smed_v4_1692_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30010515FR47 domain-containing proteinSMESG000035878.1 dd_Smed_v4_1705_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015021Calcium/calmodulin-dependent protein kinase type II subunit deltaSMESG000019086.1 SMESG000006795.1 SMESG000044348.1 SMESG000042307.1 dd_Smed_v4_1035_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30011326SJCHGC02540 proteinSMESG000056369.1 dd_Smed_v4_16852_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30011875CTF/NF-I domain-containing proteinSMESG000028598.1 dd_Smed_v4_12312_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30014047SMED30014047SMESG000025950.1 dd_Smed_v4_1574_6_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30010810SMED30010810SMESG000013743.1 dd_Smed_v4_18851_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30017759neurofilament heavy polypeptide isoform X5SMESG000068550.1 dd_Smed_v4_10236_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30016898Copine-3SMESG000043402.1 dd_Smed_v4_12323_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30018499SMED30018499SMESG000029677.1 dd_Smed_v4_18268_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30013271SMED30013271SMESG000046778.1 dd_Smed_v4_14051_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30013817SMED30013817SMESG000021812.1 SMESG000013063.1 dd_Smed_v4_10629_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007755LIM and SH3 domain protein 1SMESG000002154.1 dd_Smed_v4_1218_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005314Beta-arrestinSMESG000078454.1 dd_Smed_v4_12583_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30017886Transitional endoplasmic reticulum ATPaseSMESG000016085.1 dd_Smed_v4_100930_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30012799slc39a-3SMESG000027903.1 dd_Smed_v4_10160_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30013349Carboxyl-terminal PDZ ligand of neuronal nitric oxide synthase proteinSMESG000010313.1 dd_Smed_v4_1082_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30012052SMED30012052SMESG000068013.1 dd_Smed_v4_10481_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000114Lariat debranching enzymeSMESG000024481.1 dd_Smed_v4_3274_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30006907InnexinSMESG000033444.1 dd_Smed_v4_10567_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007360SMED30007360SMESG000013666.1 dd_Smed_v4_1749_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30014193Peptidase S1 S6 chymotrypsin Hap active site isoform 2SMESG000060842.1 SMESG000038428.1 dd_Smed_v4_15903_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30006964SMED30006964SMESG000011995.1 dd_Smed_v4_1851_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30020058Basement membrane-specific heparan sulfate proteoglycan core proteinSMESG000012051.1 dd_Smed_v4_1054_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30026323Gelsolin-like proteinSMESG000015925.1 dd_Smed_v4_1464_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30022433SMED30022433SMESG000036199.1 dd_Smed_v4_11599_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30028012SMED30028012SMESG000045022.1 SMESG000045023.1 dd_Smed_v4_13675_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30023515SMED30023515SMESG000023987.1 SMESG000017232.1 SMESG000080953.1 SMESG000080618.1 SMESG000072700.1 SMESG000069163.1 SMESG000065358.1 SMESG000064426.1 SMESG000062577.1 SMESG000062150.1 SMESG000060043.1 SMESG000057576.1 SMESG000056292.1 SMESG000054362.1 SMESG000052870.1 SMESG000051517.1 SMESG000050768.1 SMESG000050005.1 SMESG000049698.1 SMESG000045813.1 SMESG000041318.1 SMESG000040743.1 SMESG000039279.1 SMESG000038973.1 SMESG000038321.1 SMESG000029893.1 SMESG000028198.1 SMESG000023025.1 SMESG000021897.1 SMESG000018432.1 SMESG000018410.1 SMESG000017430.1 SMESG000006729.1 SMESG000005334.1 dd_Smed_v4_1692_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30023043SMED30023043SMESG000019067.1 dd_Smed_v4_13671_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30020257DUF3421 domain-containing proteinSMESG000046742.1 dd_Smed_v4_1040_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30024872Cysteine and histidine-rich domain-containing protein 1SMESG000019808.1 dd_Smed_v4_1390_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30021611ElavSMESG000006390.1 dd_Smed_v4_11311_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30020248SMED30020248SMESG000038686.1 SMESG000038674.1 dd_Smed_v4_10256_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30032367SMED30032367SMESG000023987.1 SMESG000017232.1 SMESG000080953.1 SMESG000080618.1 SMESG000072700.1 SMESG000069163.1 SMESG000065358.1 SMESG000064426.1 SMESG000062577.1 SMESG000062150.1 SMESG000060043.1 SMESG000057576.1 SMESG000056292.1 SMESG000054362.1 SMESG000052870.1 SMESG000051517.1 SMESG000050768.1 SMESG000050005.1 SMESG000049698.1 SMESG000045813.1 SMESG000041318.1 SMESG000040743.1 SMESG000039279.1 SMESG000038973.1 SMESG000038321.1 SMESG000029893.1 SMESG000028198.1 SMESG000023025.1 SMESG000021897.1 SMESG000018432.1 SMESG000018410.1 SMESG000017430.1 SMESG000006729.1 SMESG000005334.1 dd_Smed_v4_1692_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30031552SMED30031552SMESG000025950.1 dd_Smed_v4_1574_6_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30022949SMED30022949SMESG000011995.1 dd_Smed_v4_1851_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30026015InnexinSMESG000068735.1 dd_Smed_v4_15435_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30021110Dynein heavy chain 17, axonemalSMESG000026263.1 dd_Smed_v4_10425_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30021110Dynein heavy chain 17, axonemalSMESG000026263.1 dd_Smed_v4_43708_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30029048SMED30029048SMESG000045022.1 SMESG000045023.1 dd_Smed_v4_13675_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30020296Vitellogenin domain-containing proteinSMESG000037978.1 SMESG000037977.1 dd_Smed_v4_194_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30028737Tubby-like proteinSMESG000009644.1 dd_Smed_v4_10462_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30020007Dystrobrevin betaSMESG000078318.1 dd_Smed_v4_12275_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30031269SMED30031269SMESG000023258.1 dd_Smed_v4_3718_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30024117SMED30024117SMESG000013212.1 dd_Smed_v4_16870_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30030127bcl2-like proteinSMESG000049099.1 dd_Smed_v4_1018_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30028905Chaperone protein DnaJSMESG000036199.1 dd_Smed_v4_11599_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035591SMED30035591SMESG000079666.1 dd_Smed_v4_18061_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30029150RNA-binding proteinSMESG000040788.1 dd_Smed_v4_11304_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035576Leucine-rich repeat-containing protein 56SMESG000036659.1 dd_Smed_v4_10834_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30023993SMED30023993SMESG000029226.1 SMESG000029259.1 dd_Smed_v4_16808_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30020829KH domain-containing proteinSMESG000069949.1 dd_Smed_v4_11601_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30026528slc37a-1SMESG000016731.1 dd_Smed_v4_1048_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30033758SMED30033758SMESG000005077.1 SMESG000004900.1 dd_Smed_v4_10485_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30030581Melanocyte proliferating gene 1SMESG000027795.1 SMESG000027796.1 dd_Smed_v4_1148_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30021628SMED30021628SMESG000068735.1 dd_Smed_v4_15435_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30022359leucine-rich repeat-containing protein 74BSMESG000008282.1 dd_Smed_v4_10342_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30029457S5 DRBM domain-containing proteinSMESG000023987.1 SMESG000017232.1 SMESG000080953.1 SMESG000080618.1 SMESG000072700.1 SMESG000069163.1 SMESG000065358.1 SMESG000064426.1 SMESG000062577.1 SMESG000062150.1 SMESG000060043.1 SMESG000057576.1 SMESG000056292.1 SMESG000054362.1 SMESG000052870.1 SMESG000051517.1 SMESG000050768.1 SMESG000050005.1 SMESG000049698.1 SMESG000045813.1 SMESG000041318.1 SMESG000040743.1 SMESG000039279.1 SMESG000038973.1 SMESG000038321.1 SMESG000029893.1 SMESG000028198.1 SMESG000023025.1 SMESG000021897.1 SMESG000018432.1 SMESG000018410.1 SMESG000017430.1 SMESG000006729.1 SMESG000005334.1 dd_Smed_v4_1692_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30022844NEPH-3SMESG000022777.1 dd_Smed_v4_11280_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30030198Lamin-B receptorSMESG000042131.1 dd_Smed_v4_2016_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30023331Transposon Ty3-I Gag-Pol polyproteinSMESG000073188.1 SMESG000070137.1 SMESG000003871.1 dd_Smed_v4_22501_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30023331Transposon Ty3-I Gag-Pol polyproteinSMESG000054198.1 dd_Smed_v4_6563_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30024367Small heat shock protein p36SMESG000033587.1 dd_Smed_v4_2736_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30031568Cytochrome P450 2L1SMESG000050434.1 dd_Smed_v4_5307_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30025532PhosphodiesteraseSMESG000004031.1 dd_Smed_v4_11039_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30021793Pmp-10SMESG000068743.1 dd_Smed_v4_2178_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30024544SMED30024544SMESG000048503.1 SMESG000048502.1 dd_Smed_v4_3851_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30020736nucleolar protein 58SMESG000071386.1 dd_Smed_v4_1982_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30034870SMED30034870SMESG000047469.1 dd_Smed_v4_16220_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED3002074960S acidic ribosomal protein P2SMESG000057890.1 dd_Smed_v4_556_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30021960AminopeptidaseSMESG000067986.1 dd_Smed_v4_2224_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30021042Phosphoenolpyruvate synthaseSMESG000026514.1 dd_Smed_v4_2604_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30027229Transmembrane protein 47SMESG000055359.1 SMESG000029557.1 dd_Smed_v4_20712_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30034649SMED30034649SMESG000026966.1 SMESG000026953.1 dd_Smed_v4_10998_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30022596SMED30022596SMESG000071344.1 dd_Smed_v4_245_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30029882TNF receptor associated factor-2SMESG000014624.1 dd_Smed_v4_5715_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30025747SMED30025747SMESG000049533.1 dd_Smed_v4_2058_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30025055NeurobeachinSMESG000017089.1 dd_Smed_v4_3880_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035723nesprin-1-likeSMESG000023320.1 dd_Smed_v4_10282_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035723nesprin-1-likeSMESG000023320.1 dd_Smed_v4_39583_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035723nesprin-1-likeSMESG000023320.1 dd_Smed_v4_20714_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035723nesprin-1-likeSMESG000023320.1 dd_Smed_v4_44969_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035723nesprin-1-likeSMESG000023320.1 dd_Smed_v4_43173_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035723nesprin-1-likeSMESG000023320.1 dd_Smed_v4_47116_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035723nesprin-1-likeSMESG000023320.1 dd_Smed_v4_51249_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035723nesprin-1-likeSMESG000023320.1 dd_Smed_v4_26396_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035723nesprin-1-likeSMESG000023320.1 dd_Smed_v4_64459_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035723nesprin-1-likeSMESG000023320.1 dd_Smed_v4_20344_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30022385Hyaluronan binding protein 2SMESG000061109.1 dd_Smed_v4_2031_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30025231radial spoke head protein 6 homolog ASMESG000079294.1 SMESG000044179.1 dd_Smed_v4_3854_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30031199Beta-arrestinSMESG000006894.1 dd_Smed_v4_19631_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30022905DihydropyrimidinaseSMESG000028784.1 SMESG000061889.1 dd_Smed_v4_3519_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000316Interferon-induced GTP-binding protein Mx1SMESG000002219.1 SMESG000002216.1 SMESG000002004.1 dd_Smed_v4_3169_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000316Interferon-induced GTP-binding protein Mx1SMESG000066856.1 SMESG000002221.1 SMESG000002213.1 dd_Smed_v4_5708_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007727Protocadherin gamma-B5SMESG000036217.1 dd_Smed_v4_19816_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015979PHB domain-containing proteinSMESG000063597.1 dd_Smed_v4_20857_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30013480DihydropyrimidinaseSMESG000060188.1 dd_Smed_v4_2040_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003335LipaseSMESG000014678.1 dd_Smed_v4_257_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007178SMED30007178SMESG000074721.1 dd_Smed_v4_20909_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30008259Progesterone receptor membrane component 1SMESG000069126.1 SMESG000069122.1 dd_Smed_v4_2076_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002449SMED30002449SMESG000051066.1 dd_Smed_v4_20805_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30011827PrefoldinSMESG000016835.1 dd_Smed_v4_2373_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30013826Cathepsin L2SMESG000049555.1 dd_Smed_v4_1975_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30014610GCR149SMESG000009159.1 dd_Smed_v4_32664_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015783O-acyltransferaseSMESG000000989.1 SMESG000000988.1 dd_Smed_v4_2567_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30014095NucleaseSMESG000013712.1 dd_Smed_v4_3312_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30011933Sorting nexinSMESG000005937.1 dd_Smed_v4_2732_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004453SMED30004453SMESG000038305.1 SMESG000038313.1 SMESG000035859.1 dd_Smed_v4_2262_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30029570GCR304SMESG000016325.1 dd_Smed_v4_10325_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30031485Lipoxygenase homology domain-containing protein 1SMESG000001054.1 dd_Smed_v4_10315_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30028832SMED30028832SMESG000029027.1 dd_Smed_v4_10089_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30026585UbiquitinSMESG000003212.1 dd_Smed_v4_104_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30026585Ubiquitin dd_Smed_v4_12463_0_3dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30030229E3 ubiquitin-protein ligase CBL-BSMESG000019086.1 SMESG000006795.1 SMESG000044348.1 SMESG000042307.1 dd_Smed_v4_1035_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30028184Ras-related protein Rab-32SMESG000060723.1 dd_Smed_v4_1037_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30030985SMED30030985SMESG000003465.1 dd_Smed_v4_10573_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30025753SMED30025753SMESG000016791.1 dd_Smed_v4_10_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30021250cAMP-dependent protein kinase catalytic subunitSMESG000038292.1 dd_Smed_v4_13597_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30032074ATP binding cassette subfamily A member 1SMESG000056983.1 dd_Smed_v4_10304_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30027677Carboxylic ester hydrolaseSMESG000005630.1 dd_Smed_v4_10334_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30021613Nesprin-1SMESG000077685.1 dd_Smed_v4_10214_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30021613Nesprin-1SMESG000077685.1 SMESG000072345.1 dd_Smed_v4_11466_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30021613Nesprin-1SMESG000077685.1 dd_Smed_v4_15904_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30023380SMED30023380SMESG000058140.1 dd_Smed_v4_11040_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30022677sphingolipid delta(4)-desaturase DES1SMESG000025057.1 dd_Smed_v4_1100_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30025363SMED30025363SMESG000014711.1 dd_Smed_v4_1754_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30030253Voltage-dependent L-type calcium channel subunit alphaSMESG000015876.1 dd_Smed_v4_10156_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30027561SMED30027561SMESG000072848.1 dd_Smed_v4_11162_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30026256vault protein inter alpha trypsin-1SMESG000053671.1 SMESG000053669.1 SMESG000053667.1 SMESG000053664.1 SMESG000053657.1 SMESG000053638.1 dd_Smed_v4_1027_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30029705SMED30029705SMESG000061752.1 dd_Smed_v4_12459_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30030586slc10a-2SMESG000064833.1 dd_Smed_v4_10199_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30029684SMED30029684SMESG000015828.1 dd_Smed_v4_10516_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30029139Ubiquitin-conjugating enzyme E2 L3SMESG000069968.1 SMESG000069969.1 dd_Smed_v4_180_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035044Deoxyribose-phosphate aldolaseSMESG000002972.1 SMESG000069749.1 dd_Smed_v4_12065_0_2dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30027019InnexinSMESG000030971.1 SMESG000030964.1 dd_Smed_v4_10061_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30030795Vault protein inter alpha trypsin-1SMESG000053671.1 SMESG000053669.1 SMESG000053667.1 SMESG000053664.1 SMESG000053657.1 SMESG000053638.1 dd_Smed_v4_1027_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30028125Glutamate receptor 2SMESG000014610.1 dd_Smed_v4_17901_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30029399SMED30029399SMESG000015116.1 dd_Smed_v4_10874_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035875Non-SMC condensin II complex subunit G2SMESG000024947.1 SMESG000024945.1 SMESG000024886.1 SMESG000024883.1 dd_Smed_v4_15610_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30027222Steroid dehydrogenaseSMESG000041295.1 dd_Smed_v4_1890_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30031622Fructose-1,6-bisphosphatase 1SMESG000031469.1 dd_Smed_v4_1709_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30023266cilia- and flagella-associated protein 43SMESG000000491.1 dd_Smed_v4_10271_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003613Calcium-binding protein, putativeSMESG000011029.1 dd_Smed_v4_660_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30017896Activator of 90 kDa heat shock protein ATPase-like protein 1SMESG000066442.1 dd_Smed_v4_2497_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002505Ethanolamine-phosphate cytidylyltransferaseSMESG000017201.1 dd_Smed_v4_3373_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30008506SMED30008506SMESG000037104.1 SMESG000037103.1 dd_Smed_v4_407_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019147SMED30019147SMESG000061850.1 dd_Smed_v4_11560_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30010852SMED30010852SMESG000063380.1 SMESG000001725.1 dd_Smed_v4_6535_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30014211MATH domain-containing proteinSMESG000075612.1 SMESG000026079.1 SMESG000018825.1 SMESG000002232.1 dd_Smed_v4_6759_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30011701Filamin-ASMESG000017288.1 dd_Smed_v4_5496_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005629Protein kinase domain-containing proteinSMESG000078509.1 SMESG000078507.1 dd_Smed_v4_4259_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007662Nuclear pore complex protein Nup98-Nup96SMESG000022283.1 dd_Smed_v4_5347_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30017018SMED30017018SMESG000007294.1 dd_Smed_v4_371_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004084SMED30004084SMESG000011029.1 dd_Smed_v4_660_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002040Endothelin converting enzyme 2SMESG000069765.1 SMESG000070035.1 dd_Smed_v4_5256_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001542CaveolinSMESG000063380.1 SMESG000001725.1 dd_Smed_v4_6535_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015595InnexinSMESG000032206.1 dd_Smed_v4_3879_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009996serine/arginine-rich splicing factor 1BSMESG000077573.1 dd_Smed_v4_3866_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009885SMED30009885SMESG000070660.1 SMESG000069659.1 SMESG000056147.1 SMESG000055898.1 SMESG000023221.1 SMESG000022877.1 SMESG000017867.1 SMESG000017539.1 SMESG000014828.1 SMESG000009159.1 SMESG000005977.1 SMESG000061817.1 SMESG000039834.1 SMESG000005147.1 dd_Smed_v4_684_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30006060Kinesin proteinSMESG000063375.1 dd_Smed_v4_15120_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30012889Family S33 non-peptidase homologue (S33 family)SMESG000021236.1 dd_Smed_v4_1414_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED300145464-hydroxyphenylpyruvate dioxygenaseSMESG000056251.1 dd_Smed_v4_1114_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019821LIM homeobox transcription factor 1-alphaSMESG000039808.1 dd_Smed_v4_14115_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005872NeurotrypsinSMESG000016089.1 dd_Smed_v4_1926_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009710SortilinSMESG000061919.1 dd_Smed_v4_1666_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015660SMED30015660SMESG000018225.1 SMESG000017035.1 dd_Smed_v4_1426_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009177Protocadherin-11 X-linkedSMESG000070713.1 dd_Smed_v4_14317_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015061G protein regulated inducer of neurite outgrowthSMESG000062691.1 dd_Smed_v4_10294_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30006859Peptidyl-prolyl cis-trans isomeraseSMESG000059112.1 dd_Smed_v4_10327_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002880Tetratricopeptide repeat domain 17SMESG000036512.1 dd_Smed_v4_11405_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007111SMED30007111SMESG000027823.1 SMESG000018075.1 dd_Smed_v4_14341_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30013396perilipin-2 isoform X1SMESG000075481.1 dd_Smed_v4_154_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001895Very-long-chain 3-oxoacyl-CoA reductaseSMESG000077527.1 dd_Smed_v4_2464_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30011096Centrosomal protein 131SMESG000051138.1 dd_Smed_v4_13976_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015677fucolectinSMESG000046841.1 dd_Smed_v4_22212_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015677fucolectinSMESG000046841.1 dd_Smed_v4_12352_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30023109Cathepsin L2SMESG000049790.1 SMESG000049783.1 SMESG000049781.1 dd_Smed_v4_1363_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30021987SMED30021987SMESG000059819.1 dd_Smed_v4_10195_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30032296SMED30032296SMESG000031763.1 dd_Smed_v4_45517_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30024723RanBP-type and C3HC4-type zinc finger-containing protein 1SMESG000080622.1 SMESG000037051.1 SMESG000028834.1 SMESG000018862.1 dd_Smed_v4_16339_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30031818C-Jun-amino-terminal kinase-interacting protein 4SMESG000027094.1 dd_Smed_v4_4531_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30027156SMED30027156SMESG000038687.1 SMESG000038673.1 dd_Smed_v4_1013_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30030415AminopeptidaseSMESG000026219.1 dd_Smed_v4_15623_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30029379Gamma-aminobutyric acid receptor-associated protein-like 2SMESG000033716.1 dd_Smed_v4_1441_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30034137SMED30034137SMESG000045996.1 dd_Smed_v4_13741_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30029249Serine/threonine-protein kinase NIM1SMESG000005159.1 dd_Smed_v4_15794_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30030425Ubiquitin carboxyl-terminal hydrolase 7SMESG000050890.1 dd_Smed_v4_1847_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30021059V(D)J recombination-activating protein 1SMESG000012339.1 dd_Smed_v4_11354_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30034409Thyrotropin-releasing hormone receptorSMESG000077152.1 dd_Smed_v4_16834_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30025826Somatostatin receptor type 1-like proteinSMESG000024273.1 dd_Smed_v4_16055_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30021824centromere protein JSMESG000028453.1 dd_Smed_v4_13670_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30023300Potassium voltage-gated channel subfamily B member 1SMESG000038809.1 SMESG000038805.1 dd_Smed_v4_14610_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30024738transmembrane emp24 domain-containing protein 7SMESG000038972.1 dd_Smed_v4_1465_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30034787Sodium/potassium-transporting ATPase subunit beta-1SMESG000032752.1 dd_Smed_v4_1688_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30027688SMED30027688SMESG000006072.1 dd_Smed_v4_14185_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30034691SMED30034691SMESG000036081.1 SMESG000036072.1 dd_Smed_v4_21787_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30024111Degenerin unc-8SMESG000017668.1 dd_Smed_v4_31416_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30023465Protein mab-21-likeSMESG000070861.1 dd_Smed_v4_14783_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30031214G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000078268.1 dd_Smed_v4_16815_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30033453Dimer_Tnp_hAT domain-containing proteinSMESG000001790.1 dd_Smed_v4_212_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30022815COesterase domain-containing proteinSMESG000017894.1 dd_Smed_v4_14790_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30031823Translocating chain-associated membrane proteinSMESG000051052.1 dd_Smed_v4_1740_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30030120Potassium voltage-gated channel protein ShabSMESG000038809.1 SMESG000038805.1 dd_Smed_v4_14610_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30024121TetraspaninSMESG000023248.1 dd_Smed_v4_1808_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30026922SMED30026922SMESG000068263.1 SMESG000068262.1 dd_Smed_v4_14477_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30028058SMED30028058SMESG000056175.1 SMESG000056172.1 dd_Smed_v4_13931_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30024952Coiled-coil domain containing 60SMESG000038986.1 dd_Smed_v4_14286_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007629Peptidyl-prolyl cis-trans isomeraseSMESG000067492.1 dd_Smed_v4_348_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30008334SMED30008334SMESG000068935.1 dd_Smed_v4_357_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001910Acid-sensing ion channel 1CSMESG000024270.1 dd_Smed_v4_19727_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019011DNA repair protein RAD50SMESG000039247.1 SMESG000039215.1 dd_Smed_v4_11475_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30006784ras-related protein Rab-7aSMESG000014290.1 dd_Smed_v4_419_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30006763SMED30006763SMESG000035957.1 dd_Smed_v4_2193_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007539ATP-binding cassette sub-family A member 1SMESG000032896.1 SMESG000029537.1 SMESG000029534.1 dd_Smed_v4_2300_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003820GTP-binding protein GEMSMESG000018613.1 dd_Smed_v4_7051_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019744SMED-SMAD6/7-2SMESG000021574.1 dd_Smed_v4_16758_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002529DNA-directed RNA polymerase subunit betaSMESG000067331.1 dd_Smed_v4_2182_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019107SMED30019107SMESG000027122.1 dd_Smed_v4_12855_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007385SMED30007385SMESG000003089.1 dd_Smed_v4_780_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007607SMED30007607SMESG000050535.1 SMESG000050533.1 dd_Smed_v4_5107_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002034SMED30002034SMESG000001789.1 dd_Smed_v4_3076_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007654SMED30007654SMESG000060598.1 SMESG000046845.1 dd_Smed_v4_20799_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002351Placenta specific protein 8SMESG000050210.1 dd_Smed_v4_5193_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002697SMED30002697SMESG000053884.1 SMESG000053881.1 dd_Smed_v4_4128_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001834SMED30001834SMESG000068935.1 dd_Smed_v4_357_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019020SMED30019020SMESG000015266.1 dd_Smed_v4_14297_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30014459bak-2SMESG000008222.1 dd_Smed_v4_1767_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30008797SMED30008797SMESG000076328.1 dd_Smed_v4_1587_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004348Alpha-2-macroglobulinSMESG000037145.1 SMESG000037203.1 SMESG000037155.1 SMESG000037154.1 SMESG000037147.1 SMESG000037146.1 dd_Smed_v4_568_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004317SMED30004317SMESG000032896.1 SMESG000029537.1 SMESG000029534.1 dd_Smed_v4_2300_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30008294SMED30008294SMESG000016970.1 dd_Smed_v4_2205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30011819SMED30011819SMESG000017281.1 SMESG000068502.1 dd_Smed_v4_1704_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30026658SMED30026658SMESG000008925.1 dd_Smed_v4_376_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30020291Centrosomal protein 104SMESG000023549.1 dd_Smed_v4_10228_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30020784SMED30020784SMESG000011782.1 dd_Smed_v4_10359_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED3002341340S ribosomal protein S25SMESG000059049.1 dd_Smed_v4_134_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30031952SMED30031952SMESG000003398.1 dd_Smed_v4_248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30025815SMED30025815SMESG000028784.1 SMESG000061889.1 dd_Smed_v4_3519_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30025153SMED30025153SMESG000029777.1 dd_Smed_v4_13914_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED3002728060S acidic ribosomal protein P0SMESG000079482.1 dd_Smed_v4_161_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30028277SMED30028277SMESG000050296.1 dd_Smed_v4_11076_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30027268Histone H1BSMESG000071975.1 dd_Smed_v4_3898_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30024429SMED30024429SMESG000037418.1 dd_Smed_v4_1471_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED300232331.B9.3SMESG000000901.1 dd_Smed_v4_13104_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30024013SMED30024013SMESG000059642.1 dd_Smed_v4_16281_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30034331Cytidine deaminaseSMESG000064137.1 SMESG000064135.1 dd_Smed_v4_3308_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30028312Protein tyrosine phosphatase receptor type DSMESG000053906.1 dd_Smed_v4_38917_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30028312Protein tyrosine phosphatase receptor type DSMESG000053906.1 dd_Smed_v4_12545_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30026114SMED30026114SMESG000006121.1 SMESG000006132.1 dd_Smed_v4_3665_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30026339Phospholipase A2SMESG000048503.1 SMESG000048502.1 dd_Smed_v4_3851_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30027858Zinc finger proteinSMESG000060422.1 dd_Smed_v4_14937_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30028670Eukaryotic translation initiation factor 1ASMESG000077643.1 dd_Smed_v4_334_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30024572SMED30024572SMESG000022691.1 SMESG000022690.1 dd_Smed_v4_2130_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30024185slc10a-5SMESG000064830.1 dd_Smed_v4_11330_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30022870SMED30022870SMESG000079579.1 dd_Smed_v4_16102_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30030507Glutamate receptorSMESG000013939.1 dd_Smed_v4_19602_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30029047GTP cyclohydrolase 1SMESG000064560.1 dd_Smed_v4_11172_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30023071SMED30023071SMESG000054475.1 dd_Smed_v4_10308_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30025874SMED30025874SMESG000014644.1 dd_Smed_v4_1924_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED3003147314-3-3 protein epsilonSMESG000044296.1 dd_Smed_v4_7107_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30028063SH3_10 domain-containing proteinSMESG000018362.1 SMESG000018320.1 dd_Smed_v4_16329_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30020359Smed-NDK-3SMESG000046244.1 SMESG000046208.1 dd_Smed_v4_6604_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30031736SMED30031736SMESG000019122.1 dd_Smed_v4_8185_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30024309Isocitrate dehydrogenase [NADP]SMESG000049154.1 dd_Smed_v4_449_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30024951SMED30024951SMESG000004925.1 dd_Smed_v4_8053_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30028354Eukaryotic translation initiation factor 4 gamma 3SMESG000040439.1 SMESG000040422.1 SMESG000040405.1 SMESG000035786.1 SMESG000005574.1 dd_Smed_v4_15446_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30024049Ribonuclease P protein subunit p20SMESG000026553.1 dd_Smed_v4_8102_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30022746Gamma-aminobutyric acid receptor subunit beta-2SMESG000041912.1 dd_Smed_v4_16116_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30027937SMED30027937SMESG000004925.1 dd_Smed_v4_8053_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30030320Leucine-rich repeat and WD repeat-containing protein 1SMESG000061887.1 dd_Smed_v4_2942_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30022392PKD1L-1SMESG000067002.1 dd_Smed_v4_15525_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30021908SMED30021908SMESG000010232.1 SMESG000010229.1 dd_Smed_v4_7466_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30031463VASA-1SMESG000067941.1 dd_Smed_v4_1985_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30025832SMED30025832SMESG000001878.1 dd_Smed_v4_714_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30026821BTB/POZ domain-containing proteinSMESG000025160.1 dd_Smed_v4_23099_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30022719Protein kinase domain-containing proteinSMESG000032703.1 dd_Smed_v4_7746_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30022719Protein kinase domain-containing proteinSMESG000032703.1 dd_Smed_v4_9652_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004142Calcium-dependent secretion activator 1SMESG000011756.1 dd_Smed_v4_11725_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001515AnnexinSMESG000042839.1 dd_Smed_v4_1104_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30014482DUF3421 domain-containing proteinSMESG000051527.1 dd_Smed_v4_2232_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004899WD repeat-containing protein 93SMESG000037987.1 dd_Smed_v4_12161_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004754RNA-binding protein 8ASMESG000051885.1 dd_Smed_v4_1169_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30011615SMED30011615SMESG000036524.1 dd_Smed_v4_11034_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30012957Neuronal acetylcholine receptor subunit alpha-2SMESG000015263.1 SMESG000015256.1 dd_Smed_v4_18201_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019526Membrane protein insertase YidCSMESG000039158.1 dd_Smed_v4_4072_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004485Fibrillar collagenSMESG000038928.1 dd_Smed_v4_1070_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001551Techylectin-5ASMESG000034251.1 dd_Smed_v4_18888_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001551Techylectin-5ASMESG000034251.1 dd_Smed_v4_16722_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001801NME/NM23 nucleoside diphosphate kinase 1SMESG000008082.1 dd_Smed_v4_1096_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30017080FHA domain-containing proteinSMESG000061238.1 dd_Smed_v4_11335_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30008650Beta-hexosaminidaseSMESG000008181.1 dd_Smed_v4_12408_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004027Receptor-type tyrosine-protein phosphatase etaSMESG000067957.1 dd_Smed_v4_10477_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004027Receptor-type tyrosine-protein phosphatase etaSMESG000068004.1 SMESG000068001.1 SMESG000049225.1 SMESG000049064.1 SMESG000048842.1 dd_Smed_v4_2577_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007004SMED30007004SMESG000019033.1 dd_Smed_v4_12403_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003418Guanine nucleotide-binding protein subunit betaSMESG000018712.1 dd_Smed_v4_1184_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000013Transforming growth factor-beta-induced proteinSMESG000036037.1 SMESG000036036.1 dd_Smed_v4_1088_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000014slc20a-1SMESG000012546.1 dd_Smed_v4_1270_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009893RNA-binding proteinSMESG000006741.1 dd_Smed_v4_11008_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30008195Non-specific serine/threonine protein kinaseSMESG000022413.1 dd_Smed_v4_10848_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005863DUF3421 domain-containing proteinSMESG000074396.1 SMESG000074378.1 dd_Smed_v4_11_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30006229SMED30006229SMESG000019033.1 dd_Smed_v4_12403_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009634Proteasome subunit alpha typeSMESG000060349.1 dd_Smed_v4_1154_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001706C2H2-type domain-containing proteinSMESG000043342.1 dd_Smed_v4_11532_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001115Death domain-containing proteinSMESG000034716.1 dd_Smed_v4_10509_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019505Ig-like domain-containing proteinSMESG000002617.1 dd_Smed_v4_4401_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30018924SMED30018924SMESG000028420.1 dd_Smed_v4_468_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30014307SMED30014307SMESG000064621.1 dd_Smed_v4_5431_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30010775SMED30010775SMESG000062858.1 dd_Smed_v4_10948_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30018944SMED30018944SMESG000028183.1 dd_Smed_v4_592_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30012981Cyclic nucleotide gated channel 1SMESG000036524.1 dd_Smed_v4_11034_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30012867NEPH-2SMESG000071657.1 dd_Smed_v4_12118_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003863Haloacid dehalogenase-like hydrolase domain-containing 5SMESG000006859.1 dd_Smed_v4_1170_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002255Regulating synaptic membrane exocytosis protein 2SMESG000023007.1 dd_Smed_v4_10734_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002255Regulating synaptic membrane exocytosis protein 2SMESG000023007.1 dd_Smed_v4_15661_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30012193Ornithine aminotransferaseSMESG000055175.1 dd_Smed_v4_1896_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003093SMED30003093SMESG000056847.1 SMESG000056843.1 SMESG000056838.1 SMESG000044770.1 SMESG000044762.1 SMESG000007140.1 dd_Smed_v4_1137_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30018173Sodium/potassium-transporting ATPase subunit beta-1 isoform 2SMESG000064592.1 dd_Smed_v4_6559_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000919Bravo_FIGEY domain-containing proteinSMESG000026407.1 dd_Smed_v4_11307_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004913Ras-like GTP-binding protein YPT1SMESG000076068.1 dd_Smed_v4_11071_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30014505kcnkaSMESG000016405.1 dd_Smed_v4_19825_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019678SMED30019678SMESG000040636.1 dd_Smed_v4_541_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009489Polypeptide N-acetylgalactosaminyltransferaseSMESG000027520.1 dd_Smed_v4_12207_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009489Polypeptide N-acetylgalactosaminyltransferaseSMESG000027520.1 dd_Smed_v4_12539_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009444CubilinSMESG000058235.1 dd_Smed_v4_11447_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007511Porphobilinogen deaminaseSMESG000025072.1 dd_Smed_v4_11623_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30008428SMED30008428SMESG000007463.1 dd_Smed_v4_13033_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30013091SMED30013091SMESG000070818.1 dd_Smed_v4_1178_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30011581AP2-associated protein kinase 1-like ProteinSMESG000041938.1 SMESG000041937.1 SMESG000051989.1 dd_Smed_v4_1179_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30008580potassium voltage-gated channel subfamily H member 8SMESG000017883.1 SMESG000017882.1 dd_Smed_v4_10983_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30010101STT3 oligosaccharyltransferase complex catalytic subunit ASMESG000013115.1 dd_Smed_v4_1174_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005536SMED30005536SMESG000028873.1 dd_Smed_v4_1076_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30016134SMED30016134SMESG000045543.1 dd_Smed_v4_2401_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019822Methyltranfer_dom domain-containing proteinSMESG000062732.1 dd_Smed_v4_4833_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30011699calcium/calmodulin-dependent protein kinase type IVSMESG000042100.1 dd_Smed_v4_10731_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009071SMED30009071SMESG000017123.1 dd_Smed_v4_10551_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30010334Voltage-dependent anion channelSMESG000013661.1 dd_Smed_v4_1424_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30010364SMED30010364SMESG000056847.1 SMESG000056843.1 SMESG000056838.1 SMESG000044770.1 SMESG000044762.1 SMESG000007140.1 dd_Smed_v4_1137_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015498SMED30015498SMESG000066416.1 SMESG000066413.1 dd_Smed_v4_115_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30008680SMED30008680SMESG000063962.1 dd_Smed_v4_18803_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002374phytanoyl-CoA dioxygenase domain-containing protein 1 homologSMESG000077696.1 SMESG000077694.1 dd_Smed_v4_1292_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005571Delta-1-pyrroline-5-carboxylate synthaseSMESG000045474.1 dd_Smed_v4_1060_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009586SMED30009586SMESG000030829.1 dd_Smed_v4_10825_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30017796SMED30017796SMESG000005654.1 dd_Smed_v4_37593_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015329SMED30015329SMESG000077377.1 SMESG000051626.1 SMESG000045843.1 SMESG000028811.1 SMESG000004638.1 SMESG000005029.1 dd_Smed_v4_4351_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007234Bardet-Biedl syndrome 7 protein homologSMESG000005653.1 dd_Smed_v4_15015_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30008349Histone-lysine N-methyltransferase SETMARSMESG000017253.1 SMESG000015137.1 dd_Smed_v4_1612_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009204FGFR4SMESG000054557.1 dd_Smed_v4_11024_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30013540Synaptotagmin-like protein 5SMESG000014370.1 dd_Smed_v4_10375_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002581SMED30002581SMESG000015302.1 dd_Smed_v4_10603_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001654SMED30001654SMESG000012124.1 dd_Smed_v4_11272_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002162Glycosyl transferaseSMESG000030921.1 dd_Smed_v4_11247_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003458Ras-related protein Rab-27BSMESG000077907.1 dd_Smed_v4_10266_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009525SMED30009525SMESG000024324.1 dd_Smed_v4_10586_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005517Receptor type tyrosine protein phosphataseSMESG000041927.1 dd_Smed_v4_10176_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003164SMED30003164SMESG000004884.1 dd_Smed_v4_15693_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005718Guanine nucleotide-binding protein G(I) subunit alphaSMESG000026774.1 dd_Smed_v4_12112_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30006669PDZ domain-containing proteinSMESG000023278.1 dd_Smed_v4_17308_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30016885Phytanoyl-CoA dioxygenase family proteinSMESG000077696.1 SMESG000077694.1 dd_Smed_v4_1292_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30012842SMED30012842SMESG000043342.1 dd_Smed_v4_11532_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30033071SMED30033071SMESG000037721.1 dd_Smed_v4_34084_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30021873Alpha-methylacyl-CoA racemaseSMESG000027631.1 dd_Smed_v4_5686_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30031435SMED30031435SMESG000020814.1 dd_Smed_v4_5728_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30024236InnexinSMESG000056430.1 dd_Smed_v4_734_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035226AnnexinSMESG000023108.1 dd_Smed_v4_5798_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30020811SMED30020811SMESG000005612.1 dd_Smed_v4_2483_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30031011ANK_REP_REGION domain-containing proteinSMESG000020705.1 SMESG000020698.1 dd_Smed_v4_29517_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30034859TetraspaninSMESG000056555.1 dd_Smed_v4_3116_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009514histone H2BSMESG000067931.1 dd_Smed_v4_2520_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004875EF-hand calcium-binding domain-containing protein 6SMESG000058629.1 dd_Smed_v4_20435_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001861mitochondrial sodium/calcium exchanger proteinSMESG000022808.1 dd_Smed_v4_20334_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009284Hsp70SMESG000056256.1 dd_Smed_v4_424_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30014371SMED30014371SMESG000077296.1 dd_Smed_v4_1778_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED3001927340S ribosomal protein S3aSMESG000066540.1 SMESG000066537.1 dd_Smed_v4_163_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED3000317640S ribosomal protein S2SMESG000051503.1 dd_Smed_v4_226_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002319SMED30002319SMESG000049481.1 dd_Smed_v4_4006_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007989IQ and ubiquitin-like domain-containing proteinSMESG000006819.1 dd_Smed_v4_9227_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002545Myomodulin prohormone like-2SMESG000036321.1 dd_Smed_v4_2748_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003269Reticulon-like proteinSMESG000007676.1 dd_Smed_v4_1796_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30006653SMED30006653SMESG000058633.1 dd_Smed_v4_2131_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001043SMED30001043SMESG000036225.1 dd_Smed_v4_372_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005670RapunzelSMESG000052592.1 dd_Smed_v4_279_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001220SMED30001220SMESG000009120.1 dd_Smed_v4_15964_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000771SMED30000771SMESG000059918.1 SMESG000052306.1 SMESG000022407.1 dd_Smed_v4_1996_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000771SMED30000771SMESG000059918.1 SMESG000052306.1 SMESG000022407.1 dd_Smed_v4_474_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001807ParamyosinSMESG000016909.1 dd_Smed_v4_249_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009782Outer dense fiber protein 3SMESG000038718.1 dd_Smed_v4_2658_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001359SMED30001359SMESG000059918.1 SMESG000052306.1 SMESG000022407.1 dd_Smed_v4_1996_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30016281Myosin heavy chainSMESG000056451.1 dd_Smed_v4_432_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30016281Myosin heavy chainSMESG000056451.1 dd_Smed_v4_1434_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001490ADF-H domain-containing proteinSMESG000080129.1 dd_Smed_v4_260_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004176SMED30004176SMESG000054821.1 dd_Smed_v4_1693_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002315kcnbSMESG000004060.1 dd_Smed_v4_19025_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002847Degenerin unc-8SMESG000017678.1 dd_Smed_v4_16557_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004031Cyclin-dependent kinase 16SMESG000023289.1 SMESG000023149.1 dd_Smed_v4_4172_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30010874slc18a-7SMESG000009088.1 dd_Smed_v4_19744_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002414Delta-like proteinSMESG000022173.1 dd_Smed_v4_13823_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003601GCR070SMESG000070898.1 dd_Smed_v4_17025_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019558Translocon-associated protein subunit betaSMESG000053650.1 dd_Smed_v4_1759_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30008651Guanylate cyclaseSMESG000019264.1 dd_Smed_v4_9453_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009566SMED30009566SMESG000015985.1 dd_Smed_v4_4240_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001521Transmembrane p24 trafficking protein 5SMESG000078204.1 dd_Smed_v4_3127_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019103TetraspaninSMESG000021627.1 dd_Smed_v4_1650_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30030432SMED30030432SMESG000045549.1 dd_Smed_v4_2975_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30020414SMED30020414SMESG000017203.1 dd_Smed_v4_391_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30033015SMED30033015SMESG000049533.1 dd_Smed_v4_2058_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30034170InnexinSMESG000075619.1 dd_Smed_v4_17716_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30028172Serine palmitoyltransferase 2SMESG000016646.1 dd_Smed_v4_1633_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30027670SMED30027670SMESG000011069.1 dd_Smed_v4_9532_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30030945FMRFamide-activated amiloride-sensitive sodium channelSMESG000045054.1 dd_Smed_v4_16959_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30030042Muscleblind proteinSMESG000056772.1 dd_Smed_v4_17985_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30029295Leucine-rich repeat-containing protein 1SMESG000013165.1 SMESG000013154.1 dd_Smed_v4_5407_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30031461Phosphatidylinositol 4-phosphate 5-kinase 2SMESG000012434.1 dd_Smed_v4_9195_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30028353Dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit DAD1SMESG000050730.1 dd_Smed_v4_2109_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30030504Iroquois-class homeodomain protein IRX-4SMESG000026100.1 dd_Smed_v4_17352_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30023661Reverse transcriptase domain-containing proteinSMESG000042224.1 dd_Smed_v4_11697_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30026405Glutamine synthetaseSMESG000003832.1 dd_Smed_v4_25996_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30021972PalmitoyltransferaseSMESG000053355.1 dd_Smed_v4_3873_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30030029SMED30030029SMESG000010225.1 dd_Smed_v4_2502_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30021317sim proteinSMESG000031846.1 dd_Smed_v4_17731_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30032830FMRFamide-activated amiloride-sensitive sodium channelSMESG000004049.1 dd_Smed_v4_25838_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30030238SMED30030238SMESG000014791.1 dd_Smed_v4_3172_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30024698TetraspaninSMESG000080274.1 dd_Smed_v4_1719_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30032272FMN_red domain-containing proteinSMESG000023871.1 dd_Smed_v4_1834_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30021105Tubulin alpha chainSMESG000005506.1 SMESG000005505.1 SMESG000005493.1 SMESG000005489.1 SMESG000005487.1 dd_Smed_v4_38_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30031868HTH_Tnp_Tc3_2 domain-containing proteinSMESG000047299.1 dd_Smed_v4_9253_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30025223Neuropeptide Y prohormone-2SMESG000050247.1 SMESG000050248.1 dd_Smed_v4_10191_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30034942SMED30034942SMESG000035861.1 SMESG000035819.1 dd_Smed_v4_25350_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30032816Multidrug and toxin extrusion proteinSMESG000005476.1 dd_Smed_v4_21619_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30030843Glycine receptor subunit alpha-3SMESG000071005.1 dd_Smed_v4_18321_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005222Protein kinase domain-containing proteinSMESG000063586.1 dd_Smed_v4_12058_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30016101SMED30016101SMESG000080786.1 dd_Smed_v4_14195_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30017648SMED30017648SMESG000045956.1 dd_Smed_v4_14755_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30018252Cathepsin L2SMESG000049723.1 dd_Smed_v4_48_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30012284SMED30012284SMESG000008538.1 dd_Smed_v4_15230_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000646Rho gtpase activating protein, putativeSMESG000074995.1 dd_Smed_v4_3975_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004697centrosomal protein of 70 kDa-like isoform X4SMESG000052033.1 dd_Smed_v4_14545_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004182Lipoxygenase homology domain-containing protein 1SMESG000008962.1 dd_Smed_v4_39713_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30011717SMED30011717SMESG000078112.1 dd_Smed_v4_16420_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007173Protocadherin-11 X-linkedSMESG000009208.1 dd_Smed_v4_15332_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30012386Alpha-1,4 glucan phosphorylaseSMESG000061417.1 dd_Smed_v4_1532_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30014122Fumarate hydrataseSMESG000048275.1 dd_Smed_v4_741_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30006365SMED30006365SMESG000006920.1 dd_Smed_v4_9417_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001335Muscarinic acetylcholine receptorSMESG000081829.1 dd_Smed_v4_14482_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002359Kv channel interacting protein 2SMESG000002155.1 dd_Smed_v4_17982_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30014243Lysosomal aspartic proteaseSMESG000035344.1 dd_Smed_v4_329_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003274X1.A.C4.1SMESG000079273.1 dd_Smed_v4_3278_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007277Tryptophan-2,3-dioxygenaseSMESG000075109.1 dd_Smed_v4_3550_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001421SMED30001421SMESG000078112.1 dd_Smed_v4_16420_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30012789Expressed conserved proteinSMESG000033789.1 SMESG000033788.1 dd_Smed_v4_3908_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009006SMED30009006SMESG000076708.1 dd_Smed_v4_13935_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30016784SMED30016784SMESG000033408.1 dd_Smed_v4_14494_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30016193Septin-5SMESG000076922.1 dd_Smed_v4_1717_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30012985Protein FAM188BSMESG000064698.1 dd_Smed_v4_13105_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000758SMED30000758SMESG000050509.1 dd_Smed_v4_1451_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30017686HTH La-type RNA-binding domain-containing proteinSMESG000076708.1 dd_Smed_v4_13935_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004487SMED30004487SMESG000012170.1 SMESG000012168.1 dd_Smed_v4_1367_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004383SMED30004383SMESG000026569.1 dd_Smed_v4_1955_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004447Family with sequence similarity 184 member ASMESG000058677.1 dd_Smed_v4_16975_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30018450Neuropeptide Y prohormone-7SMESG000002722.1 dd_Smed_v4_13221_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30010919SMED30010919SMESG000054561.1 dd_Smed_v4_11539_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001457SMED30001457SMESG000022121.1 dd_Smed_v4_11196_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001953Rab-like protein 3SMESG000023258.1 dd_Smed_v4_3718_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007674G patch domain-containing protein 4SMESG000035189.1 dd_Smed_v4_1355_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004194SMED30004194SMESG000009646.1 dd_Smed_v4_12139_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004194SMED30004194SMESG000009646.1 dd_Smed_v4_23871_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30011848SMED30011848SMESG000081465.1 dd_Smed_v4_11248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000994SMED30000994SMESG000023987.1 SMESG000017232.1 SMESG000080953.1 SMESG000080618.1 SMESG000072700.1 SMESG000069163.1 SMESG000065358.1 SMESG000064426.1 SMESG000062577.1 SMESG000062150.1 SMESG000060043.1 SMESG000057576.1 SMESG000056292.1 SMESG000054362.1 SMESG000052870.1 SMESG000051517.1 SMESG000050768.1 SMESG000050005.1 SMESG000049698.1 SMESG000045813.1 SMESG000041318.1 SMESG000040743.1 SMESG000039279.1 SMESG000038973.1 SMESG000038321.1 SMESG000029893.1 SMESG000028198.1 SMESG000023025.1 SMESG000021897.1 SMESG000018432.1 SMESG000018410.1 SMESG000017430.1 SMESG000006729.1 SMESG000005334.1 dd_Smed_v4_1692_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003768POU domain protein 1SMESG000057970.1 dd_Smed_v4_17324_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED3000448460S ribosomal protein L8SMESG000017087.1 dd_Smed_v4_108_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009397SMED30009397SMESG000019086.1 SMESG000006795.1 SMESG000044348.1 SMESG000042307.1 dd_Smed_v4_1035_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30010847SMED30010847SMESG000026789.1 dd_Smed_v4_10187_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009210Protein kinase domain-containing proteinSMESG000039711.1 dd_Smed_v4_13767_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007858netrin receptor-like proteinSMESG000042475.1 dd_Smed_v4_11409_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005772vault protein inter alpha trypsin-1SMESG000053671.1 SMESG000053669.1 SMESG000053667.1 SMESG000053664.1 SMESG000053657.1 SMESG000053638.1 dd_Smed_v4_1027_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007488SMED30007488SMESG000066167.1 dd_Smed_v4_10181_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005182ptf-4 proteinSMESG000079648.1 dd_Smed_v4_13704_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007371nuclear mitotic apparatus protein 1 isoform X2SMESG000071994.1 dd_Smed_v4_10823_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004449B-cell lymphoma/leukemia 11BSMESG000029867.1 dd_Smed_v4_10320_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30010316Echinoderm microtubule-associated protein-like 4SMESG000027261.1 dd_Smed_v4_10540_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30008461nuclear mitotic apparatus protein 1 isoform X2SMESG000071994.1 dd_Smed_v4_10823_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30010231SMED30010231SMESG000015116.1 dd_Smed_v4_10874_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007606Nucleoside diphosphate kinase 7SMESG000069915.1 dd_Smed_v4_10129_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30008102ANK_REP_REGION domain-containing proteinSMESG000034080.1 dd_Smed_v4_10280_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007500coiled-coil domain-containing protein 170SMESG000074429.1 dd_Smed_v4_10140_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007993GTP-binding proteinSMESG000065983.1 dd_Smed_v4_11291_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30034712GCR158SMESG000012027.1 dd_Smed_v4_2364_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035028Doublecortin domain-containing proteinSMESG000059704.1 dd_Smed_v4_20159_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30017721SMED30017721SMESG000037259.1 dd_Smed_v4_4831_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30016693InnexinSMESG000059204.1 dd_Smed_v4_3985_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007917SMED30007917SMESG000070256.1 dd_Smed_v4_410_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019308SMP-LTD domain-containing proteinSMESG000023076.1 dd_Smed_v4_4444_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005324SMED30005324SMESG000025293.1 SMESG000025291.1 SMESG000017972.1 SMESG000017971.1 dd_Smed_v4_451_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30006931SMED30006931SMESG000040565.1 dd_Smed_v4_4660_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30012219Protein disulfide-isomeraseSMESG000041085.1 dd_Smed_v4_426_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000044Degenerin unc-8SMESG000016391.1 dd_Smed_v4_44243_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002314SMED30002314SMESG000049166.1 dd_Smed_v4_4059_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002314SMED30002314SMESG000049166.1 dd_Smed_v4_3900_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001242Mitogen-activated protein kinase kinase kinase 1aSMESG000017260.1 dd_Smed_v4_4322_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003962Granulin bSMESG000018767.1 SMESG000018762.1 SMESG000018760.1 dd_Smed_v4_427_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003962Granulin bSMESG000018760.1 dd_Smed_v4_2701_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30034851Procollagen galactosyltransferaseSMESG000037408.1 dd_Smed_v4_10276_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035118leucine rich repeat and fibronectin type III domain containing-1SMESG000045027.1 dd_Smed_v4_10393_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30032285SMED30032285SMESG000037686.1 SMESG000035410.1 SMESG000013977.1 SMESG000013857.1 dd_Smed_v4_10407_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035314SMED30035314SMESG000020883.1 dd_Smed_v4_11620_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035495Ankyrin repeat domain-containing 42SMESG000005009.1 dd_Smed_v4_10615_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30018449TNF receptor-associated factorSMESG000014923.1 dd_Smed_v4_25112_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30018449TNF receptor-associated factorSMESG000014923.1 dd_Smed_v4_20034_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30018082Progesterone receptor membrane component 1SMESG000069126.1 SMESG000069122.1 dd_Smed_v4_2076_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019057SMED30019057SMESG000016216.1 dd_Smed_v4_2283_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30018826Mov10 like RISC complex RNA helicase 1SMESG000069873.1 dd_Smed_v4_2121_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019224SMED30019224SMESG000008279.1 SMESG000008247.1 SMESG000008244.1 SMESG000008241.1 dd_Smed_v4_23424_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30027909Mov10 like RISC complex RNA helicase 1SMESG000069873.1 dd_Smed_v4_2121_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED3002950160S acidic ribosomal protein P1SMESG000062259.1 dd_Smed_v4_224_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30021545glutathione S transferase-1SMESG000003087.1 dd_Smed_v4_20_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30027498SMED30027498SMESG000003505.1 dd_Smed_v4_2222_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30034119SPRY domain-containing SOCS box protein 3SMESG000069126.1 SMESG000069122.1 dd_Smed_v4_2076_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30032308ETS variant 4SMESG000008885.1 dd_Smed_v4_20282_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30028877epoxide hydrolase 4SMESG000022030.1 dd_Smed_v4_2011_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30020268Dynamin-type G domain-containing proteinSMESG000014761.1 SMESG000014754.1 dd_Smed_v4_2777_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30020268Dynamin-type G domain-containing proteinSMESG000014756.1 SMESG000014755.1 dd_Smed_v4_2390_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30023471Myosin, light chain kinase aSMESG000081274.1 dd_Smed_v4_3482_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005606Ubiquitin-like modifier-activating enzyme 1SMESG000070068.1 dd_Smed_v4_1107_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007932ULP_PROTEASE domain-containing proteinSMESG000021486.1 dd_Smed_v4_19123_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007788Transcription elongation regulator 1SMESG000011919.1 dd_Smed_v4_1147_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30008325Fatty acid synthaseSMESG000020850.1 dd_Smed_v4_10967_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019722secreted frizzled related protein 3SMESG000058717.1 dd_Smed_v4_11070_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009115Polypyrimidine tract-binding protein 1SMESG000033951.1 dd_Smed_v4_14748_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009645SMED30009645SMESG000037851.1 SMESG000037843.1 SMESG000037842.1 SMESG000037831.1 SMESG000037828.1 SMESG000019412.1 dd_Smed_v4_10887_0_2dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000247SMED30000247SMESG000023639.1 SMESG000023635.1 dd_Smed_v4_3360_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000559Transposon Ty3-I Gag-Pol polyproteinSMESG000013684.1 dd_Smed_v4_14881_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000559Transposon Ty3-I Gag-Pol polyproteinSMESG000063504.1 SMESG000063503.1 SMESG000026061.1 dd_Smed_v4_3587_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000559Transposon Ty3-I Gag-Pol polyprotein dd_Smed_v4_14472_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001160SMED30001160SMESG000000384.1 dd_Smed_v4_10941_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009324SMED30009324SMESG000062402.1 dd_Smed_v4_15771_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003546SMED30003546SMESG000072344.1 dd_Smed_v4_11255_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004942Amiloride-sensitive sodium channel subunit gammaSMESG000006412.1 dd_Smed_v4_11787_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002166SMED30002166SMESG000058880.1 SMESG000039065.1 dd_Smed_v4_4225_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002166SMED30002166SMESG000039065.1 dd_Smed_v4_11656_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005157SMED30005157SMESG000054684.1 SMESG000054674.1 dd_Smed_v4_18196_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30006391SMED30006391SMESG000026399.1 dd_Smed_v4_110_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019945Granulin precursorSMESG000018767.1 SMESG000018762.1 SMESG000018760.1 dd_Smed_v4_427_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004234SMED30004234SMESG000017336.1 dd_Smed_v4_17564_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009905SMED30009905SMESG000000384.1 dd_Smed_v4_10941_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30021641SMED30021641SMESG000040565.1 dd_Smed_v4_4660_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30023226SMED30023226SMESG000011108.1 dd_Smed_v4_4730_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30023111RBR-type E3 ubiquitin transferaseSMESG000054560.1 dd_Smed_v4_4845_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30034546Protein transport protein Sec61 subunit gammaSMESG000062123.1 SMESG000063809.1 dd_Smed_v4_429_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30034400Procollagen-lysine 2-oxoglutarate 5-dioxygenaseSMESG000016065.1 dd_Smed_v4_4942_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035522CalbindinSMESG000023194.1 dd_Smed_v4_5030_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30020431COP9 signalosome complex subunit 4SMESG000006062.1 dd_Smed_v4_4122_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30025067Endoplasmic reticulum chaperone BiPSMESG000062699.1 dd_Smed_v4_511_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED300226652-acylglycerol O-acyltransferase 2SMESG000021419.1 dd_Smed_v4_4947_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30022777SMED30022777SMESG000026662.1 dd_Smed_v4_5031_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30010050Protein kinase domain-containing proteinSMESG000017277.1 SMESG000017274.1 dd_Smed_v4_639_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30011533SMED30011533SMESG000035252.1 dd_Smed_v4_4468_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30008623Phospholipase B-likeSMESG000022762.1 dd_Smed_v4_485_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30013498LIM zinc-binding domain-containing proteinSMESG000072162.1 dd_Smed_v4_537_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005773SMED30005773SMESG000063175.1 dd_Smed_v4_11704_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30013949SMED30013949SMESG000031517.1 dd_Smed_v4_1406_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED3001553460S ribosomal protein L21SMESG000040216.1 dd_Smed_v4_189_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30006591ZMYM-1SMESG000032185.1 SMESG000032173.1 dd_Smed_v4_3776_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004115Exosome complex component Rrp41SMESG000040844.1 dd_Smed_v4_4086_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001501Vacuolar protein sorting-associated protein 13A/CSMESG000037244.1 dd_Smed_v4_1648_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001376Collagen IV NC1 domain-containing proteinSMESG000071508.1 dd_Smed_v4_1579_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009358slc16a-3SMESG000011418.1 dd_Smed_v4_16616_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003885Drebrin-like proteinSMESG000073128.1 dd_Smed_v4_1221_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30017749Peptidyl-glycine alpha-amidating monooxygenaseSMESG000042480.1 dd_Smed_v4_3093_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000972Leucine-rich repeat-containing protein 71SMESG000006778.1 dd_Smed_v4_12043_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000972Leucine-rich repeat-containing protein 71SMESG000006778.1 dd_Smed_v4_10715_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30018435Alpha-int-2SMESG000021746.1 dd_Smed_v4_3365_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30010500Fibronectin type III domain proteinSMESG000033545.1 dd_Smed_v4_15017_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002500achaete-scute homolog 3SMESG000032619.1 dd_Smed_v4_14753_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30006344Glyoxylate/hydroxypyruvate reductase BSMESG000080490.1 dd_Smed_v4_41385_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30014565Angiotensin-converting enzymeSMESG000005704.1 SMESG000005698.1 dd_Smed_v4_3745_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019318Sperm associated antigen 6SMESG000018022.1 dd_Smed_v4_3991_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30008873SMED30008873SMESG000009341.1 dd_Smed_v4_337_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30013286sn1-specific diacylglycerol lipase betaSMESG000046500.1 dd_Smed_v4_13306_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30017980Cyclin-dependent kinase 5 activatorSMESG000003825.1 dd_Smed_v4_13788_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED3001990360S ribosomal protein L13aSMESG000041483.1 dd_Smed_v4_287_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30010960Ig-like domain-containing proteinSMESG000013824.1 dd_Smed_v4_30208_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30012365S5A_REDUCTASE domain-containing proteinSMESG000004302.1 dd_Smed_v4_14327_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30018823ATP-dependent 6-phosphofructokinaseSMESG000029088.1 dd_Smed_v4_1604_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007046SMED30007046SMESG000004295.1 dd_Smed_v4_29022_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30012990G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000032545.1 dd_Smed_v4_17171_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000004ThioredoxinSMESG000039109.1 dd_Smed_v4_12784_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007857SMED30007857SMESG000022810.1 dd_Smed_v4_28465_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30010502SMED30010502SMESG000051310.1 dd_Smed_v4_15505_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30016063Low density lipoprotein-receptor, class A,domain-containing proteinSMESG000076971.1 dd_Smed_v4_3970_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005751Ras-related protein Rab-6ASMESG000032326.1 dd_Smed_v4_2879_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30029822Neuronal acetylcholine receptor subunit alpha-4SMESG000021568.1 dd_Smed_v4_9503_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30033565SMED30033565SMESG000050427.1 dd_Smed_v4_3777_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30020855Guanine nucleotide-binding protein G(o) subunit alphaSMESG000081490.1 dd_Smed_v4_1635_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30020855Guanine nucleotide-binding protein G(o) subunit alphaSMESG000081490.1 dd_Smed_v4_13658_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30027408TRAF-6SMESG000067201.1 dd_Smed_v4_16183_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30025026FCH and double SH3 domains proteinSMESG000023477.1 SMESG000006893.1 dd_Smed_v4_13998_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30031370Protein kinase domain-containing proteinSMESG000005514.1 dd_Smed_v4_14823_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30025757JUNLI-1SMESG000067959.1 dd_Smed_v4_4878_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30025129SMED30025129SMESG000004295.1 dd_Smed_v4_29022_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30034179SMED30034179SMESG000049924.1 dd_Smed_v4_736_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30025071Calcium/calmodulin-dependent protein kinase type IISMESG000008997.1 dd_Smed_v4_7480_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035571Protein disulfide-isomerase A5SMESG000005268.1 dd_Smed_v4_1537_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30027886SMED30027886SMESG000003427.1 dd_Smed_v4_2708_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30027506Ubiquitin-like domain-containing proteinSMESG000066583.1 dd_Smed_v4_14332_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30027593Protein polyglycylase TTLL10SMESG000042729.1 SMESG000042734.1 dd_Smed_v4_14858_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30021189SMED30021189SMESG000081490.1 dd_Smed_v4_1635_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30022713SMED30022713SMESG000017126.1 dd_Smed_v4_15999_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30022938SMED30022938SMESG000057519.1 SMESG000057514.1 dd_Smed_v4_3277_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30020502SMED30020502SMESG000017789.1 dd_Smed_v4_13625_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30030878Protocadherin gammaSMESG000036716.1 dd_Smed_v4_15643_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30024072Protein argonaute-3SMESG000051000.1 dd_Smed_v4_7594_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30029080Rhodanese-like proteinSMESG000079774.1 dd_Smed_v4_7388_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30026513SMED30026513SMESG000005268.1 dd_Smed_v4_1537_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035287Serine/threonine protein phosphatase 2A regulatory subunitSMESG000000161.1 dd_Smed_v4_3379_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30030295Peroxiredoxin-1SMESG000024235.1 dd_Smed_v4_3517_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30034361Glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase 1SMESG000045412.1 dd_Smed_v4_4310_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30020695SMED30020695SMESG000013824.1 dd_Smed_v4_30208_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30024795Ectonucleoside triphosphate diphosphohydrolase 5SMESG000077452.1 dd_Smed_v4_15646_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30021539Diacylglycerol lipase betaSMESG000046500.1 dd_Smed_v4_13306_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035556Vacuolar protein sorting-associated protein 13A/CSMESG000037244.1 dd_Smed_v4_1648_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30025709Chaperone protein DnaJSMESG000028986.1 SMESG000028985.1 dd_Smed_v4_9057_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30020390Potassium channel subfamily K member 18SMESG000078172.1 dd_Smed_v4_36644_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30023739SMED30023739SMESG000057519.1 SMESG000057514.1 dd_Smed_v4_3277_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30025398Glyoxylate/hydroxypyruvate reductase BSMESG000080490.1 dd_Smed_v4_41385_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30033385Endoglin CD105 antigenSMESG000025327.1 dd_Smed_v4_17373_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30030634Family with sequence similarity 184 member ASMESG000058677.1 dd_Smed_v4_16975_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30026844Protein MAK16 homologSMESG000060104.1 dd_Smed_v4_1416_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30028596Ornithine carbamoyltransferaseSMESG000040441.1 SMESG000035784.1 dd_Smed_v4_3906_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30023180slc6a-12SMESG000055640.1 dd_Smed_v4_8727_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30032948FMRFamide-activated amiloride-sensitive sodium channelSMESG000053390.1 dd_Smed_v4_16764_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30034847Secreted peptide prohormone-11SMESG000069589.1 dd_Smed_v4_1724_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30034115tlxSMESG000017206.1 dd_Smed_v4_13781_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30006516Multidrug and toxin extrusion proteinSMESG000079540.1 dd_Smed_v4_8335_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30013948SMED30013948SMESG000006883.1 dd_Smed_v4_13870_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30016586tubulin polyglutamylase complex subunit 2SMESG000041945.1 dd_Smed_v4_13845_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003406Bestrophin homologSMESG000060552.1 dd_Smed_v4_4179_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002596TBC1 domain family member 9SMESG000015478.1 dd_Smed_v4_3646_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30018757SMED30018757SMESG000031605.1 dd_Smed_v4_15648_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002168Spondin-1SMESG000039905.1 dd_Smed_v4_8655_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000689SMED30000689SMESG000001726.1 dd_Smed_v4_2615_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003270SMED30003270SMESG000052792.1 dd_Smed_v4_3513_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001873SMED30001873SMESG000016249.1 dd_Smed_v4_2556_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001818TNF receptor associated factor 3SMESG000026104.1 dd_Smed_v4_9703_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30010523SMED30010523SMESG000077800.1 SMESG000054046.1 SMESG000052058.1 SMESG000044674.1 SMESG000066333.1 SMESG000052053.1 SMESG000052952.1 SMESG000080770.1 SMESG000065333.1 SMESG000063486.1 SMESG000059844.1 SMESG000058646.1 SMESG000055266.1 SMESG000054970.1 SMESG000052813.1 SMESG000043147.1 SMESG000037745.1 SMESG000037601.1 SMESG000036070.1 SMESG000034880.1 SMESG000034368.1 SMESG000031415.1 SMESG000019663.1 SMESG000010897.1 SMESG000009005.1 SMESG000006729.1 SMESG000005029.1 SMESG000003989.1 dd_Smed_v4_1760_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019912SMED30019912SMESG000077221.1 dd_Smed_v4_15819_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001636E3 ubiquitin-protein ligase MYLIPSMESG000006029.1 SMESG000007955.1 dd_Smed_v4_2627_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004085hypothetical proteinSMESG000038086.1 dd_Smed_v4_5639_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30016967O-methyltransferaseSMESG000063332.1 dd_Smed_v4_1794_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003912SMED30003912SMESG000001726.1 dd_Smed_v4_2615_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30014469DUF862 domain-containing proteinSMESG000007684.1 dd_Smed_v4_1938_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED3001238340S ribosomal protein SASMESG000071180.1 dd_Smed_v4_171_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003788Mitochondrial import receptor subunit TOM70SMESG000070017.1 dd_Smed_v4_2190_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED3000236940S ribosomal protein S17SMESG000037102.1 dd_Smed_v4_195_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000040SMED30000040SMESG000001726.1 dd_Smed_v4_2615_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003374Spectrin beta chainSMESG000039799.1 dd_Smed_v4_6202_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002995SMED30002995SMESG000050337.1 dd_Smed_v4_2103_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000643Immunoglobulin superfamily member 10SMESG000051622.1 dd_Smed_v4_6576_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30031695SMED30031695SMESG000009161.1 SMESG000009116.1 dd_Smed_v4_18865_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30028006SMED30028006SMESG000063434.1 dd_Smed_v4_4972_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30025572Septin-7SMESG000064397.1 dd_Smed_v4_2641_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002344Bax inhibitor-1 proteinSMESG000038559.1 dd_Smed_v4_319_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019873plasminogen-1SMESG000018453.1 dd_Smed_v4_23420_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019554SMED30019554SMESG000069999.1 dd_Smed_v4_13564_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30010074TTF-type domain-containing proteinSMESG000076895.1 dd_Smed_v4_5933_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019538SMED30019538SMESG000078196.1 dd_Smed_v4_3823_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005250Maestro heat-like repeat-containing protein family member 1SMESG000073404.1 dd_Smed_v4_3372_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30018542slc4a-1SMESG000024335.1 dd_Smed_v4_3003_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009729G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000010008.1 dd_Smed_v4_24203_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30018278Small conductance calcium-activated potassium channel protein 2SMESG000075601.1 SMESG000075590.1 dd_Smed_v4_12169_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001648Phosphatase and actin regulatorSMESG000040085.1 dd_Smed_v4_5826_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30013688Insulin gene enhancer protein isl-1SMESG000029651.1 dd_Smed_v4_35379_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015004SMED30015004SMESG000042350.1 dd_Smed_v4_13840_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001497Rho guanine nucleotide exchange factor 17SMESG000018133.1 dd_Smed_v4_2922_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30014640Small heat shock protein p36SMESG000028601.1 dd_Smed_v4_6399_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015720SMED30015720SMESG000005201.1 dd_Smed_v4_4267_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015758Glutamate receptor ionotropic kainate 3SMESG000005201.1 dd_Smed_v4_4267_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED300191411-phosphatidylinositol 3-phosphate 5-kinaseSMESG000051464.1 dd_Smed_v4_3136_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30012271TalinSMESG000072542.1 dd_Smed_v4_2443_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30018224Adenylate kinaseSMESG000077377.1 SMESG000076900.1 SMESG000063429.1 SMESG000060686.1 SMESG000043019.1 SMESG000031308.1 SMESG000028811.1 SMESG000023833.1 SMESG000023573.1 SMESG000019820.1 SMESG000011532.1 SMESG000052813.1 dd_Smed_v4_1229_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005315Transient receptor potential cation channel, subfamily A, member 1aSMESG000014208.1 dd_Smed_v4_60518_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005315Transient receptor potential cation channel, subfamily A, member 1aSMESG000014208.1 dd_Smed_v4_86413_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005315Transient receptor potential cation channel, subfamily A, member 1aSMESG000014208.1 dd_Smed_v4_69068_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005315Transient receptor potential cation channel, subfamily A, member 1aSMESG000014208.1 dd_Smed_v4_81437_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005315Transient receptor potential cation channel, subfamily A, member 1aSMESG000014208.1 dd_Smed_v4_59015_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005315Transient receptor potential cation channel, subfamily A, member 1aSMESG000014208.1 dd_Smed_v4_28432_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30011959Myomodulin prohormone like-1SMESG000078202.1 dd_Smed_v4_1902_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005207Si:dkey-153k10.9SMESG000055380.1 dd_Smed_v4_5144_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED300163635'-nucleotidase proteinSMESG000032250.1 dd_Smed_v4_3474_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004840Coiled-coil domain containing 88AaSMESG000012304.1 dd_Smed_v4_3591_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30020521Glycerol-3-phosphate acyltransferase 3SMESG000061821.1 dd_Smed_v4_2445_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30029823MFS domain-containing proteinSMESG000000287.1 SMESG000000110.1 dd_Smed_v4_11835_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30025226CalmodulinSMESG000004980.1 dd_Smed_v4_13205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30022078Translationally-controlled tumor protein homologSMESG000023212.1 dd_Smed_v4_136_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035143PiggyBac transposable element-derived protein 2SMESG000066442.1 dd_Smed_v4_2497_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035143PiggyBac transposable element-derived protein 2SMESG000052698.1 SMESG000027142.1 SMESG000059994.1 dd_Smed_v4_1029_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30031605Cyclic nucleotide-binding domain-containing proteinSMESG000076149.1 dd_Smed_v4_11972_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30027057G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000031888.1 dd_Smed_v4_12500_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30031880Family with sequence similarity 227 member BSMESG000052176.1 SMESG000046302.1 dd_Smed_v4_15102_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30021702C2H2-type domain-containing proteinSMESG000080376.1 dd_Smed_v4_15473_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30034597PeriostinSMESG000070985.1 dd_Smed_v4_1505_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30022312COesterase domain-containing proteinSMESG000064723.1 dd_Smed_v4_18958_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30020409SMED30020409SMESG000045132.1 dd_Smed_v4_182_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30028228Centrosomal protein 164SMESG000054195.1 SMESG000021687.1 dd_Smed_v4_12228_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30027539MFS domain-containing proteinSMESG000000287.1 SMESG000000110.1 dd_Smed_v4_11835_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30027349CLUMA_CG020609, isoform ASMESG000019986.1 dd_Smed_v4_6531_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30027349CLUMA_CG020609, isoform ASMESG000019984.1 dd_Smed_v4_396_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30027349CLUMA_CG020609, isoform ASMESG000019986.1 dd_Smed_v4_1706_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30024278Diacylglycerol kinaseSMESG000015254.1 dd_Smed_v4_13264_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30031442Protocadherin-1SMESG000042783.1 dd_Smed_v4_17621_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30031442Protocadherin-1SMESG000042783.1 dd_Smed_v4_13423_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30027644cAMP-dependent protein kinase regulatory subunitSMESG000003135.1 dd_Smed_v4_14355_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30023339SMED30023339SMESG000045132.1 dd_Smed_v4_182_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30028343Cytosolic carboxypeptidase 2SMESG000006325.1 dd_Smed_v4_13454_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30029634Kinesin family member 15SMESG000064131.1 dd_Smed_v4_11717_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004755RING-type domain-containing proteinSMESG000015738.1 dd_Smed_v4_14782_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30010426GCR317SMESG000074480.1 dd_Smed_v4_14520_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30010974InnexinSMESG000055742.1 SMESG000055733.1 dd_Smed_v4_1120_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30006079Nucleobindin-2SMESG000013792.1 dd_Smed_v4_9013_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30013823Zinc finger protein 319SMESG000075339.1 dd_Smed_v4_12912_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30018263SMED30018263SMESG000033726.1 dd_Smed_v4_19428_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003789SMED30003789SMESG000011613.1 dd_Smed_v4_11093_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000831Golgi-associated plant pathogenesis protein 1SMESG000036937.1 dd_Smed_v4_2081_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000158Dipeptidyl peptidase 3SMESG000079740.1 dd_Smed_v4_1031_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30006061protein RRNAD1SMESG000022890.1 dd_Smed_v4_15897_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004389scna-1SMESG000017743.1 SMESG000017742.1 dd_Smed_v4_13973_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001259Fibroblast growth factor receptor 1SMESG000022746.1 dd_Smed_v4_5615_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003815SMED30003815SMESG000039247.1 SMESG000039215.1 dd_Smed_v4_11475_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000707Sodium/hydrogen exchangerSMESG000062012.1 dd_Smed_v4_11493_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004536Snail-1SMESG000076673.1 dd_Smed_v4_15506_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005454SMED30005454SMESG000014203.1 dd_Smed_v4_15413_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30013326slc35c-2SMESG000055012.1 dd_Smed_v4_12626_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019288Reticulocalbin 3SMESG000012033.1 dd_Smed_v4_1417_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019501Netrin receptor UNC5BSMESG000025091.1 dd_Smed_v4_10730_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30013319Long-chain-fatty-acid--CoA ligase ACSBG2SMESG000027204.1 dd_Smed_v4_1026_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004267Actin, cytoplasmicSMESG000035518.1 dd_Smed_v4_232_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001584SMED30001584SMESG000058817.1 dd_Smed_v4_12647_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30011703Death domain-containing proteinSMESG000040750.1 dd_Smed_v4_11696_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30016948Regulator of G-protein signaling 9-binding proteinSMESG000016932.1 dd_Smed_v4_14671_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30008752Homeobox domain-containing proteinSMESG000016670.1 dd_Smed_v4_11150_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30010392Golgi resident protein GCP60SMESG000035132.1 dd_Smed_v4_13546_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009385SMED30009385SMESG000031786.1 dd_Smed_v4_1365_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009148acid-sensing ion channel 5SMESG000028094.1 dd_Smed_v4_13943_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003292SMED30003292SMESG000066258.1 dd_Smed_v4_19593_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002472NPHS1-5SMESG000003549.1 dd_Smed_v4_18782_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30017847Protein kinase domain-containing proteinSMESG000056697.1 dd_Smed_v4_1371_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015687RING-type domain-containing proteinSMESG000007981.1 dd_Smed_v4_10019_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30006479SMED30006479SMESG000080622.1 SMESG000037051.1 SMESG000028834.1 SMESG000018862.1 dd_Smed_v4_16339_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005209Ankyrin repeat domain 50SMESG000028414.1 dd_Smed_v4_12936_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003672Mitochondrial import inner membrane translocase subunit TIM17SMESG000027783.1 SMESG000027888.1 dd_Smed_v4_904_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002614SMED30002614SMESG000064510.1 dd_Smed_v4_1635_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002962GC-rich sequence DNA-binding factor 1SMESG000061662.1 dd_Smed_v4_11179_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007420hypothetical proteinSMESG000037088.1 SMESG000032688.1 dd_Smed_v4_10376_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004519Novel proteinSMESG000039682.1 dd_Smed_v4_2676_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005964SMED30005964SMESG000065696.1 dd_Smed_v4_22938_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004081SMED30004081SMESG000040291.1 dd_Smed_v4_1144_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30008756SMED30008756SMESG000007049.1 dd_Smed_v4_14707_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30008756SMED30008756SMESG000007049.1 dd_Smed_v4_6538_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000539Transcriptional regulator ATRXSMESG000079240.1 dd_Smed_v4_5478_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002634SCP domain-containing proteinSMESG000036363.1 dd_Smed_v4_210_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002634SCP domain-containing proteinSMESG000036363.1 dd_Smed_v4_210_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30023344Sn1-specific diacylglycerol lipase betaSMESG000046500.1 dd_Smed_v4_13306_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30024394Dynein light chainSMESG000005286.1 dd_Smed_v4_898_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30028682SMED30028682SMESG000080319.1 dd_Smed_v4_713_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30030763Protein kinase C and casein kinase substrate in neurons proteinSMESG000054559.1 dd_Smed_v4_7987_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30027431Protein arginine N-methyltransferase 7SMESG000008380.1 dd_Smed_v4_8814_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30025294rRNA 2'-O-methyltransferase fibrillarinSMESG000051648.1 dd_Smed_v4_2811_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035648X1.C.A4.1SMESG000028445.1 dd_Smed_v4_3815_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30030866GCM domain-containing proteinSMESG000056241.1 dd_Smed_v4_7752_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30034335SMED30034335SMESG000009102.1 dd_Smed_v4_8341_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30024457Guanine nucleotide exchange factorSMESG000044434.1 dd_Smed_v4_6608_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30022764SMED30022764SMESG000049990.1 SMESG000010934.1 dd_Smed_v4_64358_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30020051ThioninSMESG000031412.1 dd_Smed_v4_3063_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30030379POU domain proteinSMESG000076173.1 dd_Smed_v4_8234_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30029771SMED30029771SMESG000075916.1 dd_Smed_v4_2326_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30021718COesterase domain-containing proteinSMESG000027379.1 dd_Smed_v4_6180_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30023714CTF/NF-I domain-containing proteinSMESG000029310.1 dd_Smed_v4_7403_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30031990SMED30031990SMESG000025001.1 dd_Smed_v4_213_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30027407SERPINE1 mRNA binding protein 1aSMESG000008791.1 dd_Smed_v4_697_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30034737Protocadherin-1SMESG000005378.1 dd_Smed_v4_10467_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30030122Insulinoma-associated protein 1SMESG000047651.1 dd_Smed_v4_64330_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30022232Glutathione s-transferaseSMESG000016846.1 dd_Smed_v4_1206_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019060Neutral sphingomyelinaseSMESG000012166.1 dd_Smed_v4_8717_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015503SMED30015503SMESG000072876.1 dd_Smed_v4_834_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019531NPHP6SMESG000072747.1 dd_Smed_v4_7145_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30012316Palmitoyl-protein thioesterase 1SMESG000036367.1 dd_Smed_v4_2388_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30017780transient receptor potential cation channel subfamily M member 3SMESG000014679.1 dd_Smed_v4_3620_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015453Poly [ADP-ribose] polymeraseSMESG000011115.1 dd_Smed_v4_2611_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30010068Formin-like protein 15SMESG000035694.1 SMESG000035692.1 dd_Smed_v4_8222_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009844Tubulin alpha chainSMESG000044805.1 SMESG000031184.1 dd_Smed_v4_29298_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019652SMED30019652SMESG000043998.1 dd_Smed_v4_8438_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015310DUF3421 domain-containing proteinSMESG000046710.1 SMESG000046697.1 dd_Smed_v4_54_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30014872beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase 3SMESG000051810.1 SMESG000051787.1 SMESG000043068.1 SMESG000043067.1 SMESG000043052.1 SMESG000009027.1 SMESG000008972.1 dd_Smed_v4_6205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30011674PapilinSMESG000003930.1 SMESG000003917.1 dd_Smed_v4_8833_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015219SMED30015219SMESG000067773.1 dd_Smed_v4_333_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30017171Protein suppressor of white apricotSMESG000040092.1 dd_Smed_v4_5178_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30012759SMED30012759SMESG000071063.1 dd_Smed_v4_8726_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30016636rRNA adenine N(6)-methyltransferaseSMESG000026090.1 dd_Smed_v4_5268_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019324Clathrin light chainSMESG000019387.1 dd_Smed_v4_2973_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30011928SMED30011928SMESG000046825.1 dd_Smed_v4_8221_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30023269ANK_REP_REGION domain-containing proteinSMESG000020728.1 dd_Smed_v4_4880_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30022014TetraspaninSMESG000043678.1 dd_Smed_v4_2693_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30024110TetraspaninSMESG000021637.1 dd_Smed_v4_2993_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED3002609340S ribosomal protein S5SMESG000076086.1 dd_Smed_v4_295_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30028430Secretory carrier-associated membrane proteinSMESG000035622.1 dd_Smed_v4_2702_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30034895SMED30034895SMESG000033387.1 dd_Smed_v4_82373_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30027641Serrate RNA effector moleculeSMESG000023055.1 dd_Smed_v4_3660_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30025299E3 ubiquitin-protein ligase TRIM9SMESG000048786.1 dd_Smed_v4_8386_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30021295SMED30021295SMESG000010069.1 dd_Smed_v4_4414_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30033835synaptotagmin-14 isoform X1SMESG000070077.1 dd_Smed_v4_8785_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30021874CaveolinSMESG000052389.1 dd_Smed_v4_877_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30033621Ornithine decarboxylaseSMESG000041045.1 dd_Smed_v4_8195_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30034836Protein kinaseSMESG000075057.1 SMESG000074969.1 SMESG000074956.1 dd_Smed_v4_2745_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30034506Angiotensin-converting enzymeSMESG000005710.1 dd_Smed_v4_6160_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30023860ParamyosinSMESG000058328.1 dd_Smed_v4_711_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30033791cilia- and flagella-associated protein 161SMESG000028972.1 dd_Smed_v4_8229_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30028809Transient receptor potential cation channel subfamily M member-like 2SMESG000004955.1 dd_Smed_v4_8493_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30030613AmidophosphoribosyltransferaseSMESG000003663.1 SMESG000003648.1 SMESG000003647.1 dd_Smed_v4_5319_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30029002Proton myo-inositol cotransporterSMESG000056331.1 dd_Smed_v4_3112_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30026176SMED30026176SMESG000062603.1 dd_Smed_v4_3069_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003079Prominin (Prom) protein, putativeSMESG000062666.1 dd_Smed_v4_4461_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001661Lysine specific histone demethylase 1BSMESG000065059.1 dd_Smed_v4_4269_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30013909tud-1SMESG000029236.1 SMESG000029232.1 dd_Smed_v4_1582_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005748HNF4SMESG000014588.1 dd_Smed_v4_1694_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019012Protein ENLSMESG000057165.1 dd_Smed_v4_14072_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003645slc35a-3SMESG000020105.1 dd_Smed_v4_8149_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001320SMED30001320SMESG000045393.1 dd_Smed_v4_9742_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015704Hox class homeodomain protein DjAbd-BaSMESG000062714.1 dd_Smed_v4_12317_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000360TetraspaninSMESG000052597.1 dd_Smed_v4_9647_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003162Chromatin assembly factor 1 subunit BSMESG000042345.1 dd_Smed_v4_5543_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001962Protein kinase domain-containing proteinSMESG000017252.1 SMESG000017249.1 SMESG000017248.1 dd_Smed_v4_311_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30011043Protein kinase domain-containing proteinSMESG000025533.1 dd_Smed_v4_12789_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003512MICAL-like 1SMESG000065945.1 dd_Smed_v4_4568_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005992Ras-responsive element-binding protein 1SMESG000027936.1 dd_Smed_v4_13753_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30014131RPTOR independent companion of MTOR, complex 2 aSMESG000024212.1 SMESG000033570.1 dd_Smed_v4_9324_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30008033Plasma membrane calcium-transporting ATPase 3SMESG000006504.1 dd_Smed_v4_12866_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30011447SMED30011447SMESG000034829.1 dd_Smed_v4_1321_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001958POU domain proteinSMESG000057970.1 dd_Smed_v4_22370_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009954C-type lectin domain family 18 member ASMESG000066354.1 SMESG000066348.1 dd_Smed_v4_4737_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003661SMED30003661SMESG000025366.1 SMESG000025363.1 SMESG000025362.1 dd_Smed_v4_9269_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002356SMED30002356SMESG000069796.1 dd_Smed_v4_4492_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult