cephalic ganglia

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ In Situ Hybridization Data

  ▻ Sequences

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  cephalic ganglia


DEFINITON:

  The planarian brain, consisting of two bilaterally symmetric lobes occupying a ventral position in the head.


TERM CITATIONS:


TERM ID:

  PLANA:0000044


ABOUT THIS TERM:

cephalic ganglia

  ↳is a material entity and organ

  ↳contained in ventral region of the whole animal, head region, dorsal region of the whole animal and anterior region of the whole animal

  ↳existence overlaps Stage 6, juvenile stage, asexual adult, adult hermaphrodite, Stage 8 and Stage 7

  ↳existence starts during or after Stage 6

  ↳part of central nervous system


  → cephalic ganglia primordium and cephalic ganglia progenitor cell develops into cephalic ganglia


Expand to see terms that part of cephalic ganglia


BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30022907SynaptotagminDj-sytStage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, ventral nerve cord, neuron, cephalic ganglia, nervous system, embryonic pharynx
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 ┬Ám

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30019471 ID=SMED30019471|Name=Synaptotagmin|organism=Schmidtea mediterranea sexual|type=transcript|length=1910bp
TTTGGGACTTCTCCAATCTATTAAATATATTTAGAACGAACATCGTTGTGAGAAGCTTTGTCTTGCAAATGCACACCAAC
ACATTCTCTGCCTACTCGAGACCAGCCTGAAGGACGCACCCAGTCATCTCTTATAAAAAAAAAACTCTTCTCTGATTCGG
TATTTTCTGATTAATGGAGATCAAACAATGATTGGGCAACGTCTAGTTTAGAATATTTACAACTAAATCTGCGTATTTCA
ATTTTTTTTCGATTTTGATTGTTGCAAATATTTATGAGTATATCCAATAATATAAGCAGCGCTAGTAATATGACGATAAA
AATGCAACAAAATGTTGAAAAGTCTGTATCACAGCATGTAACAGCGCAAACAAAGGAATCAACATCAAATAAACTTCATA
CAACAACAGCCGGTATCTCGGTTTTGGAGAAAACATTAAAAACATTTCACATGAGTACTGGCACTTTGATTGGAATCGGA
GTTACAGTGTCTATCGTAGTTTTATTACTTCTTTATTGTATTTGCAAACGATGCATTAAGAAACGAAAGAAAAAGAAAGA
TGGCGGCAAAAAAGGTGGAAAAGGCGTAGACATGAAAAGCGTACAACTATTAGGAAATGCTTATAAAGAAAAGGTACAGC
CGGACCTAGAAGAACTGGATGCTAACATGGAAGATAATGAAGGGGCGCAAGATAAAGAAGCAGTCAATCTTGGAAAATTA
CAGTATTCCCTTGATTACGATTTTACAAAAGGCGAGCTAACAGTCGGAGTAATTCAAGCCACAGATCTCCCAGCAATGGA
CATGTCAGGAACTTCTGATCCATATGTGAAAGTTTTTCTATTACCGGATAAAAAGAAAAAATTCGAAACCAAAGTTCATC
GAAAAATATTAAATCCAGTCTTTAATGAGACATTTGTATTCAAGATTCCTTATTCTGAGGTCGGGTCTAAAACTTTGGTA
TTTAATGTTTTCGATTTCGACAGATTTTCAAAGCATGATCAAATTGGGCAAATCCAAATTCCACTGGGTTCAGTAGATTT
ATGCAAAGTTATTGAGGAATGGAAGGAACTCGGCCCACCTGACAGTGATAATGAAAAGGAAAATCGATTAGGAGACATTT
GTTTTTCTTTGAGATATGTTCCAACGTCTGGAAAGTTGAATATCGTCATTCTGGAAGCTAAAAACCTCAAGAAAATGGAT
GTTGGAGGATTGTCGGATCCTTACGTGAAACTATCGTTGATGCTTAACGGCAAACGAGTGAAAAAGAAGAAAACCACAAT
AAAAAAATACACATTAAATCCTTATTATAATGAGTCATTTTCATTCGAAGTTCCATTCGAGCAAATACAAAAAGTTAATT
TAATAGTGACAGTAGTTGATTATGATAGAATTGGAACAAGTGAACCTATTGGAAGAGTAGTTCTTGGATGCAATGCTACA
GGAGCAGAACTTCGGCACTGGTCCGATATGCTTGCTAATCCTAGGAGACCAATTGCCCAGTGGCATACCCTTCAAGATAT
GCCGGAGAAGAGCTGATTTCATTGATTTTAATTTTAAAATCTGTCATATTTTGTGATAAATTTTGCGTATTTATACAATC
ATTCGATTCGATCTTTCCATCAAGTTTCGTAAAATCTGCAGACATTCACGAGGATGCAGAAGAAATAGAAACTTTGTAAT
AAATTAGCATTAGCTGTGATCTCCTATTGACCAAAAAACATAAACTTAATTTTTATAAAGAATTGTGGTGAAATGTTGTT
AGGTTTCAGTCATAGATAACTGTATTTGTGTAATAGTTTGTGTATTTCTCGTCCTGGCCCGATTTTGTGCATTCCACTGG
CAATACTATTTCACTAATAAATTATGTCTGATAATGTATACCAGTATAGGATTTTGTTTGAATTAATGAA
>SMED30022907 ID=SMED30022907|Name=Synaptotagmin|organism=Schmidtea mediterranea sexual|type=transcript|length=1814bp
ATTTATTGAAAATTATTTTTTCTATTATTAGGAGAAAATTGATTATTTTTTTTTGACAAAATAAGTTTTGGATATATTTC
CCATTTGTTTGTATTCGTAAACCAATGAAGAATTCGACTCACGGATCGGATCATTCGGCCAGCAAGGCCAGTATGAAAAC
GAATGTGGAAAAATTTTGGCATGATCTCGGAAAAAAATTGCACATGGATCCAAAAGCATTAATAGGAGTAACAATCGGTT
TGGGAATATTGTTTTTGTTGTTCCTTTATTGCTTATGTAAAAAATGTGTTTTCAAGCGTCGAAAAAAGAAGGAAACGGCC
AAAAAAGGAGCCAAGGGAGTAGTCGATATGAAAAGTGCCCAATTGTTGGGGAATTCATATAAAGAAAAAATTCAACCCGA
TCTTGAAGAACTTGATGCAAACATGGAAGACAATGAAGGTGTAAAAGAAAAAGAAGATGTTCATTTAGGAAAATTACAAT
ATTCTCTAGATTATGATTTTCAGAAAGGAGAATTAACTGTTGGAGTTATTCAAGCAACTGATCTTCCAGCTATGGATATG
TCAGGAACATCAGATCCATATGTCAAATTATACCTTCTCCCAGACAAGAAAAAGAAATTCGAAACAAAGGTTCATAGGAA
AATTTTAAATCCTGTATTCAATGAAACTTTTGTTTTCAAAGTTCCTTTCAATGAAGTTGCATCGAAGACTTTGATTTTCA
ACGTTTATGACTTTGACAGATTTTCCAAACACGATCAAATCGGTCAAATAAAAGTACCATTGGGAGCTATAGATTTAGGT
CGAGTTATTGAAGAATGGAAGGAACTGGAATCTCCAGAAAACGATGGGGAAAAGGAAAACAGGTTGGGAGACATTTGTTT
CTCTTTAAGATACGTACCGACATCTGGAAAGCTTACAATAGTCATTTTGGAAGCAAAGAATCTTAAAAAAATGGATGTCG
GAGGATTGTCTGATCCATATGTTAAACTTTCCTTGATGCTTAATGGTAAACGAGTGAAGAAGAAGAAAACTACCATCAAA
AAGTATACACTAAATCCTTACTACAATGAATCATTTTCCTTTGAAGTACCATTCGAACAAATACAAAAAGTGAACTTGAT
CGTCACGGTTGTTGATTATGACAGAATCGGAACCAGCGAACCGATAGGTAGAATTGTTCTGGGATGTAACGCAACTGGAG
CAGAATTGCGACATTGGTCGGATATGTTGGCAAATCCCCGGCGACCAATCGCCCAGTGGCATACCCTCCAAGAGATGCCA
GAGAACAATTGATAGTGTTCGTTTGATGCTTTAAAGCGGTTTGCATAATTCGTGAAATAAGTTATCAAAATTTGAGAAAT
GTTTTTTTTTCTGAAACAAAAATGGCATGAGACAATATACCAGAGTTCATTAGTGTGTGGTTTCGTTGAATATTTTGGTG
GTGTTGCATCTTATCGTTTGTCCTCTAATCTAATAATGTTTTATTCTTTATATAGCTGATTTATTCTCGAGCGAAACATT
TTTTATGTGTACCAAAATACTTATGTCATAGCCATTGTGATTAGTCTGTAAACTATTGCGTAATAGCCCCTCTCATTGGC
TTTTTTTAAGAGTAGTGAGTTGGAAAAAAAAATACAAAAATGACTTCAATTGTTAAACATTACTCATATTTTATCAGTAA
GTTAACTTGCATATTTGCAGTTAATTATGGCATTTTATCTCTAAATCTCTGAAGCATGGCCTCAAGTCTTTTGTTTGTTT
TAATGTAATTATGTCTAGATGAGAATATTAAAATACTTCGGTTTATATAAAAGA

 

back to top



PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in cephalic ganglia. Click this link to learn more about PAGE.


PAGE Curations: 6724


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
cephalic gangliaSMED30007891Galactosylceramide sulfotransferaseSMESG000021672.1 dd_Smed_v4_13130_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005292Post-GPI attachment to proteins factor 3SMESG000077193.1 dd_Smed_v4_11282_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30013823Zinc finger protein 319SMESG000075339.1 dd_Smed_v4_12912_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30008917Tubulin alpha chainSMESG000079650.1 SMESG000010171.1 dd_Smed_v4_124_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009182SMED30009182SMESG000006804.1 dd_Smed_v4_12952_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002754TPR_REGION domain-containing proteinSMESG000008310.1 dd_Smed_v4_11374_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30008024NFX1-type zinc finger-containing protein 1-likeSMESG000034891.1 SMESG000034868.1 SMESG000034856.1 dd_Smed_v4_10633_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004485Fibrillar collagenSMESG000038928.1 dd_Smed_v4_1070_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30016919TNF receptor associated factor-2SMESG000024584.1 dd_Smed_v4_10569_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004039Fibrillin-2SMESG000081571.1 SMESG000081561.1 SMESG000081557.1 SMESG000081553.1 dd_Smed_v4_10142_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002357SMED30002357SMESG000038052.1 dd_Smed_v4_101_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001801NME/NM23 nucleoside diphosphate kinase 1SMESG000008082.1 dd_Smed_v4_1096_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007670DystrobrevinSMESG000078318.1 dd_Smed_v4_12275_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000491Cornifelin-like ASMESG000023836.1 dd_Smed_v4_1291_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015671Baculoviral IAP repeat-containing protein 7SMESG000067794.1 dd_Smed_v4_10803_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005845NPHS1-6SMESG000028689.1 dd_Smed_v4_10689_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002156TNF receptor associated factor-2SMESG000065606.1 SMESG000000563.1 SMESG000000559.1 SMESG000000493.1 SMESG000000294.1 dd_Smed_v4_1243_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002298Nucleolar protein isoform 2SMESG000009276.1 dd_Smed_v4_10255_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000013Transforming growth factor-beta-induced proteinSMESG000036037.1 SMESG000036036.1 dd_Smed_v4_1088_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004972SMED30004972SMESG000007019.1 dd_Smed_v4_10965_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004930Irregular chiasm C-roughest-like isoform X2SMESG000077979.1 dd_Smed_v4_12549_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002925Alpha-2-macroglobulin-like protein 1SMESG000041500.1 dd_Smed_v4_12472_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30008388slc1a-4SMESG000064122.1 dd_Smed_v4_11206_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005863DUF3421 domain-containing proteinSMESG000074396.1 SMESG000074378.1 dd_Smed_v4_11_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005445Transient receptor potential cation channel subfamily A member 1SMESG000078034.1 dd_Smed_v4_12031_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005445Transient receptor potential cation channel subfamily A member 1SMESG000078036.1 dd_Smed_v4_18706_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005457SMED30005457SMESG000035312.1 dd_Smed_v4_131_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30008070DAO domain-containing proteinSMESG000037253.1 dd_Smed_v4_10791_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015069ANK_REP_REGION domain-containing proteinSMESG000063648.1 dd_Smed_v4_10764_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004455DUF2428 domain-containing proteinSMESG000032327.1 dd_Smed_v4_12316_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003110Ig-like domain-containing proteinSMESG000018621.1 dd_Smed_v4_10688_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30012188Small nuclear ribonucleoprotein FSMESG000025747.1 dd_Smed_v4_1056_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009645SMED30009645SMESG000037851.1 SMESG000037843.1 SMESG000037842.1 SMESG000037831.1 SMESG000037828.1 SMESG000019412.1 dd_Smed_v4_10887_0_2dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002255Regulating synaptic membrane exocytosis protein 2SMESG000023007.1 dd_Smed_v4_10734_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002255Regulating synaptic membrane exocytosis protein 2SMESG000023007.1 dd_Smed_v4_15661_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004449B-cell lymphoma/leukemia 11BSMESG000029867.1 dd_Smed_v4_10320_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004537Proteasome subunit betaSMESG000004962.1 dd_Smed_v4_1264_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000919Bravo_FIGEY domain-containing proteinSMESG000026407.1 dd_Smed_v4_11307_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001493Calcium-activated potassium channel slo-1, putativeSMESG000014623.1 dd_Smed_v4_13498_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000192ankyrin and armadillo repeat-containing proteinSMESG000068683.1 dd_Smed_v4_10062_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30010366slc25a-19SMESG000020909.1 SMESG000020904.1 dd_Smed_v4_10436_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004913Ras-like GTP-binding protein YPT1SMESG000076068.1 dd_Smed_v4_11071_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007075Fibrillin-2SMESG000081571.1 SMESG000081561.1 SMESG000081557.1 SMESG000081553.1 dd_Smed_v4_10142_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30011043Protein kinase domain-containing proteinSMESG000025533.1 dd_Smed_v4_12789_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED3000876940S ribosomal protein S10SMESG000034720.1 dd_Smed_v4_117_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30014212SMED30014212SMESG000064028.1 dd_Smed_v4_10207_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30008115TPR repeat-containing protein DDB_G0287407 isoform X2SMESG000012448.1 dd_Smed_v4_12326_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009480SMED30009480SMESG000063980.1 dd_Smed_v4_11408_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015710Glycine receptor subunit alpha-3SMESG000008993.1 dd_Smed_v4_10794_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30013091SMED30013091SMESG000070818.1 dd_Smed_v4_1178_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30008580potassium voltage-gated channel subfamily H member 8SMESG000017883.1 SMESG000017882.1 dd_Smed_v4_10983_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30016911SMED30016911SMESG000025369.1 dd_Smed_v4_11368_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007470Coiled-coil domain-containing protein 180SMESG000039547.1 dd_Smed_v4_12302_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000824slc32a-2SMESG000056569.1 dd_Smed_v4_13324_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004194SMED30004194SMESG000009646.1 dd_Smed_v4_12139_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004194SMED30004194SMESG000009646.1 dd_Smed_v4_23871_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30013972Plexin-B2SMESG000033322.1 SMESG000033300.1 dd_Smed_v4_13016_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30013350HPHLAWLY domain-containing proteinSMESG000034214.1 SMESG000030723.1 SMESG000030612.1 SMESG000030179.1 dd_Smed_v4_10891_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000535CEP72SMESG000043538.1 dd_Smed_v4_12835_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30008627SMED30008627SMESG000041685.1 SMESG000041696.1 dd_Smed_v4_13591_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30010258Synaptosomal-associated proteinSMESG000005619.1 dd_Smed_v4_13255_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007420hypothetical proteinSMESG000037088.1 SMESG000032688.1 dd_Smed_v4_10376_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30016369SMED30016369SMESG000022115.1 dd_Smed_v4_12348_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003978SMED30003978SMESG000052391.1 dd_Smed_v4_10608_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007606Nucleoside diphosphate kinase 7SMESG000069915.1 dd_Smed_v4_10129_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30006145slc18a-6SMESG000051356.1 dd_Smed_v4_11630_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30013833acetyl-CoA acetyltransferase, mitochondrialSMESG000056408.1 dd_Smed_v4_1377_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009204FGFR4SMESG000054557.1 dd_Smed_v4_11024_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000649Beta-arrestin-1SMESG000078454.1 dd_Smed_v4_12583_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009491DNA polymerase alpha subunit BSMESG000051237.1 SMESG000051238.1 dd_Smed_v4_1195_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30011875CTF/NF-I domain-containing proteinSMESG000028598.1 dd_Smed_v4_12312_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003733c-SKI_SMAD_bind domain-containing proteinSMESG000067290.1 dd_Smed_v4_10921_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015853SMED30015853SMESG000069882.1 dd_Smed_v4_10099_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30016898Copine-3SMESG000043402.1 dd_Smed_v4_12323_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30006473MFS domain-containing proteinSMESG000018042.1 dd_Smed_v4_11486_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005718Guanine nucleotide-binding protein G(I) subunit alphaSMESG000026774.1 dd_Smed_v4_12112_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001414UPF0728 protein C10orf53 homologSMESG000073355.1 dd_Smed_v4_10501_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30006859Peptidyl-prolyl cis-trans isomeraseSMESG000059112.1 dd_Smed_v4_10327_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005314Beta-arrestinSMESG000078454.1 dd_Smed_v4_12583_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30016654Intraflagellar transport protein 140SMESG000001316.1 dd_Smed_v4_11300_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000370ANK_REP_REGION domain-containing proteinSMESG000013802.1 dd_Smed_v4_11317_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000370ANK_REP_REGION domain-containing proteinSMESG000013802.1 dd_Smed_v4_7813_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004666ATP-dependent zinc metalloprotease FtsHSMESG000006322.1 dd_Smed_v4_10293_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004666ATP-dependent zinc metalloprotease FtsHSMESG000006323.1 dd_Smed_v4_1250_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003947transient receptor potential cation channel subfamily M member 3SMESG000005077.1 SMESG000004900.1 dd_Smed_v4_10485_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30006907InnexinSMESG000033444.1 dd_Smed_v4_10567_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015419SMED30015419SMESG000021688.1 dd_Smed_v4_11297_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30017638SMED30017638SMESG000026230.1 dd_Smed_v4_11346_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30013824Unc-5 netrin receptor BSMESG000040323.1 dd_Smed_v4_10380_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015560SMED30015560SMESG000024738.1 dd_Smed_v4_10117_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007993GTP-binding proteinSMESG000065983.1 dd_Smed_v4_11291_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30006792Argonaute 1SMESG000050993.1 SMESG000050994.1 dd_Smed_v4_1194_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30022043Protein odd-skipped-related 2SMESG000032229.1 dd_Smed_v4_10039_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30025584SMED30025584SMESG000077266.1 dd_Smed_v4_1066_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30029717SMED30029717SMESG000018042.1 dd_Smed_v4_11486_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30021266Uncoordinated 5SMESG000073898.1 dd_Smed_v4_10585_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30026757Steroid 17-alpha-hydroxylase/17,20 lyaseSMESG000059323.1 SMESG000057929.1 dd_Smed_v4_10722_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30032823NeurotrypsinSMESG000081574.1 SMESG000081529.1 SMESG000079557.1 SMESG000079250.1 SMESG000077556.1 SMESG000075496.1 SMESG000073961.1 SMESG000073618.1 SMESG000073174.1 SMESG000071859.1 SMESG000071198.1 SMESG000071073.1 SMESG000070153.1 SMESG000068262.1 SMESG000068028.1 SMESG000067334.1 SMESG000065567.1 SMESG000061192.1 SMESG000060952.1 SMESG000060260.1 SMESG000059623.1 SMESG000050492.1 SMESG000050479.1 SMESG000050299.1 SMESG000049776.1 SMESG000048159.1 SMESG000044971.1 SMESG000043973.1 SMESG000042620.1 SMESG000040932.1 SMESG000039792.1 SMESG000039741.1 SMESG000039356.1 SMESG000034716.1 SMESG000033763.1 SMESG000029286.1 SMESG000028614.1 SMESG000027381.1 SMESG000025022.1 SMESG000021522.1 SMESG000020398.1 SMESG000019968.1 SMESG000018320.1 SMESG000015216.1 SMESG000015117.1 SMESG000015102.1 SMESG000013389.1 SMESG000012534.1 SMESG000012464.1 SMESG000011278.1 SMESG000011147.1 SMESG000007021.1 SMESG000006554.1 SMESG000001897.1 SMESG000070487.1 SMESG000068881.1 SMESG000064552.1 SMESG000063831.1 SMESG000056926.1 SMESG000050300.1 SMESG000047318.1 SMESG000047014.1 SMESG000043279.1 SMESG000030931.1 SMESG000023641.1 SMESG000018675.1 SMESG000017256.1 SMESG000013665.1 SMESG000013089.1 SMESG000011196.1 SMESG000009621.1 SMESG000008519.1 SMESG000005066.1 dd_Smed_v4_129_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30032823NeurotrypsinSMESG000016088.1 dd_Smed_v4_790_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30021279Retinal-binding proteinSMESG000035531.1 dd_Smed_v4_11513_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009489Polypeptide N-acetylgalactosaminyltransferaseSMESG000027520.1 dd_Smed_v4_12207_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009489Polypeptide N-acetylgalactosaminyltransferaseSMESG000027520.1 dd_Smed_v4_12539_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005978Cyclic nucleotide gated channel alpha 3SMESG000044898.1 SMESG000035733.1 dd_Smed_v4_12825_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001245GCR098SMESG000016694.1 dd_Smed_v4_34479_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30018024SMED30018024SMESG000078454.1 dd_Smed_v4_12583_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30018233Troponin C, skeletal muscleSMESG000005066.1 dd_Smed_v4_12048_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30011699calcium/calmodulin-dependent protein kinase type IVSMESG000042100.1 dd_Smed_v4_10731_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30011343Phospholipase A2SMESG000075160.1 dd_Smed_v4_13334_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30018278Small conductance calcium-activated potassium channel protein 2SMESG000075601.1 SMESG000075590.1 dd_Smed_v4_12169_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009279DystoninSMESG000043809.1 SMESG000043799.1 dd_Smed_v4_1205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009586SMED30009586SMESG000030829.1 dd_Smed_v4_10825_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000843X1.A.G7.1SMESG000070405.1 dd_Smed_v4_4731_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009537bmp-like proteinSMESG000063420.1 dd_Smed_v4_12035_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30010620Histone acetyltransferaseSMESG000017094.1 dd_Smed_v4_12274_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000577Septin-5SMESG000046276.1 SMESG000040239.1 dd_Smed_v4_4312_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019793slc16a-8SMESG000026692.1 dd_Smed_v4_1284_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003503Phospholipid scramblaseSMESG000046276.1 SMESG000040239.1 dd_Smed_v4_4312_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009337SMED30009337SMESG000045673.1 dd_Smed_v4_1022_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30013182Rho GTPase-activating proteinSMESG000017186.1 dd_Smed_v4_12363_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30008102ANK_REP_REGION domain-containing proteinSMESG000034080.1 dd_Smed_v4_10280_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009869fas-binding factor 1 homologSMESG000037546.1 dd_Smed_v4_12422_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005517Receptor type tyrosine protein phosphataseSMESG000041927.1 dd_Smed_v4_10176_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30018208neurexin-1 isoform X16SMESG000066308.1 dd_Smed_v4_11832_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30011663slc1a-5SMESG000064126.1 dd_Smed_v4_1106_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007518PIH1 domain-containing protein 1SMESG000041927.1 dd_Smed_v4_10176_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015677fucolectinSMESG000046841.1 dd_Smed_v4_12352_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015677fucolectinSMESG000046841.1 dd_Smed_v4_22212_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30020058Basement membrane-specific heparan sulfate proteoglycan core proteinSMESG000012051.1 dd_Smed_v4_1054_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30022217Trans-L-3-hydroxyproline dehydrataseSMESG000021281.1 dd_Smed_v4_12066_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30022604SMED30022604SMESG000076527.1 SMESG000069759.1 SMESG000057276.1 SMESG000045286.1 SMESG000040833.1 SMESG000017867.1 dd_Smed_v4_12301_1_2dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30029823MFS domain-containing proteinSMESG000000287.1 SMESG000000110.1 dd_Smed_v4_11835_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30022331Translocon-associated protein, gamma subunitSMESG000066628.1 dd_Smed_v4_1265_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30022153NPHP4SMESG000062716.1 dd_Smed_v4_12520_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30022030EGR-like protein 1SMESG000000960.1 dd_Smed_v4_7731_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30022030EGR-like protein 1SMESG000000959.1 dd_Smed_v4_12410_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30029450Succinyl-CoA:3-ketoacid-coenzyme A transferaseSMESG000080424.1 dd_Smed_v4_1189_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30020070High mobility group protein B1SMESG000034017.1 dd_Smed_v4_1095_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30029078SMED30029078SMESG000041568.1 dd_Smed_v4_12636_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30020371Hemicentin-1SMESG000021248.1 dd_Smed_v4_1161_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED3003601340S ribosomal protein S20SMESG000002673.1 dd_Smed_v4_123_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30027057G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000031888.1 dd_Smed_v4_12500_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30020007Dystrobrevin betaSMESG000078318.1 dd_Smed_v4_12275_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30020518XK-related proteinSMESG000041934.1 dd_Smed_v4_11903_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30021707SMED30021707SMESG000063964.1 dd_Smed_v4_11231_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30030521SMED30030521SMESG000076527.1 SMESG000069759.1 SMESG000057276.1 SMESG000045286.1 SMESG000040833.1 SMESG000017867.1 dd_Smed_v4_12301_1_2dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30022677sphingolipid delta(4)-desaturase DES1SMESG000025057.1 dd_Smed_v4_1100_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30027539MFS domain-containing proteinSMESG000000287.1 SMESG000000110.1 dd_Smed_v4_11835_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30025240SMED30025240SMESG000072364.1 dd_Smed_v4_1200_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30025240SMED30025240SMESG000072370.1 SMESG000072365.1 SMESG000072364.1 dd_Smed_v4_792_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30023672E3 ubiquitin-protein ligase TRIM9SMESG000032020.1 dd_Smed_v4_12595_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30022681Dynein heavy chain 7 axonemalSMESG000012956.1 dd_Smed_v4_5350_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30022681Dynein heavy chain 7 axonemalSMESG000012956.1 dd_Smed_v4_13792_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30032143slc16a-28SMESG000056616.1 dd_Smed_v4_12311_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30021783SMED30021783SMESG000020654.1 dd_Smed_v4_10409_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30026336Beta-hexosaminidaseSMESG000008181.1 dd_Smed_v4_12408_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30022167SMED30022167SMESG000031417.1 dd_Smed_v4_11958_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30029634Kinesin family member 15SMESG000064131.1 dd_Smed_v4_11717_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30023487Protein LSM14 homolog B-ASMESG000014632.1 dd_Smed_v4_1125_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30024984LisH domain-containing protein ARMC9SMESG000049428.1 dd_Smed_v4_10926_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30024864SMED30024864SMESG000011362.1 SMESG000011359.1 dd_Smed_v4_10942_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30024587TNF receptor-associated factorSMESG000081574.1 SMESG000081529.1 SMESG000079557.1 SMESG000079250.1 SMESG000077556.1 SMESG000075496.1 SMESG000073961.1 SMESG000073618.1 SMESG000073174.1 SMESG000071859.1 SMESG000071198.1 SMESG000071073.1 SMESG000070153.1 SMESG000068262.1 SMESG000068028.1 SMESG000067334.1 SMESG000065567.1 SMESG000061192.1 SMESG000060952.1 SMESG000060260.1 SMESG000059623.1 SMESG000050492.1 SMESG000050479.1 SMESG000050299.1 SMESG000049776.1 SMESG000048159.1 SMESG000044971.1 SMESG000043973.1 SMESG000042620.1 SMESG000040932.1 SMESG000039792.1 SMESG000039741.1 SMESG000039356.1 SMESG000034716.1 SMESG000033763.1 SMESG000029286.1 SMESG000028614.1 SMESG000027381.1 SMESG000025022.1 SMESG000021522.1 SMESG000020398.1 SMESG000019968.1 SMESG000018320.1 SMESG000015216.1 SMESG000015117.1 SMESG000015102.1 SMESG000013389.1 SMESG000012534.1 SMESG000012464.1 SMESG000011278.1 SMESG000011147.1 SMESG000007021.1 SMESG000006554.1 SMESG000001897.1 SMESG000070487.1 SMESG000068881.1 SMESG000064552.1 SMESG000063831.1 SMESG000056926.1 SMESG000050300.1 SMESG000047318.1 SMESG000047014.1 SMESG000043279.1 SMESG000030931.1 SMESG000023641.1 SMESG000018675.1 SMESG000017256.1 SMESG000013665.1 SMESG000013089.1 SMESG000011196.1 SMESG000009621.1 SMESG000008519.1 SMESG000005066.1 dd_Smed_v4_129_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30024396Centrosomal protein 295SMESG000023095.1 dd_Smed_v4_11068_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30023129FERM domain-containing proteinSMESG000077981.1 dd_Smed_v4_10131_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30026439Peptidase M60 domain-containing proteinSMESG000070472.1 dd_Smed_v4_10257_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30023266cilia- and flagella-associated protein 43SMESG000000491.1 dd_Smed_v4_10271_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30018741SMED30018741SMESG000046855.1 dd_Smed_v4_12552_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002038Calsyntenin 1SMESG000002834.1 SMESG000002830.1 dd_Smed_v4_1518_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30011420Trinucleotide repeat containing 4-like proteinSMESG000005424.1 dd_Smed_v4_11349_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004546Receptor protein-tyrosine kinaseSMESG000044602.1 dd_Smed_v4_11608_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30017378Aldose 1-epimeraseSMESG000011518.1 dd_Smed_v4_1947_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30016068SMED30016068SMESG000024947.1 SMESG000024945.1 SMESG000024886.1 SMESG000024883.1 dd_Smed_v4_15610_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007389Peripheral plasma membrane protein CASKSMESG000060582.1 dd_Smed_v4_7723_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009327plexin B-4SMESG000019626.1 dd_Smed_v4_11182_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30017565Ephrin type-B receptor 2SMESG000008191.1 dd_Smed_v4_16928_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30006481WD repeat-containing protein 49SMESG000041940.1 dd_Smed_v4_13248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009921SMED30009921SMESG000018657.1 dd_Smed_v4_15255_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30008855Copper-transporting ATPase 1SMESG000058134.1 dd_Smed_v4_8956_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30006985WD repeat-containing protein 49SMESG000041940.1 dd_Smed_v4_13248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003166slc4a-4SMESG000039045.1 dd_Smed_v4_12290_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30016607SMED30016607SMESG000042667.1 SMESG000042664.1 SMESG000042670.1 dd_Smed_v4_11981_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30011486migration and invasion-inhibitory proteinSMESG000018657.1 dd_Smed_v4_15255_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30013692Small HSP proteinSMESG000059879.1 SMESG000059868.1 SMESG000059853.1 dd_Smed_v4_1039_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009324SMED30009324SMESG000062402.1 dd_Smed_v4_15771_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001366SMED30001366SMESG000014648.1 dd_Smed_v4_1227_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30008349Histone-lysine N-methyltransferase SETMARSMESG000017253.1 SMESG000015137.1 dd_Smed_v4_1612_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000343SMED30000343SMESG000016758.1 dd_Smed_v4_11194_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30014047SMED30014047SMESG000025950.1 dd_Smed_v4_1574_6_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009463WD repeat-containing protein 49SMESG000041940.1 dd_Smed_v4_13248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019942Roc domain-containing proteinSMESG000038728.1 dd_Smed_v4_11334_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30017785PDZ domain-containing proteinSMESG000023284.1 dd_Smed_v4_1210_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30008651Guanylate cyclaseSMESG000019264.1 dd_Smed_v4_9453_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30016779JmjC domain-containing proteinSMESG000053108.1 dd_Smed_v4_12267_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30014394cyclin B-1SMESG000028669.1 dd_Smed_v4_11487_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30006964SMED30006964SMESG000011995.1 dd_Smed_v4_1851_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009442Acetylcholine receptor subunit alpha-likeSMESG000068777.1 dd_Smed_v4_12182_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30024549Copine-3SMESG000029196.1 dd_Smed_v4_13873_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30033841FERM domain-containing proteinSMESG000016903.1 dd_Smed_v4_2996_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30022812Receptor-type tyrosine-protein phosphatase SSMESG000068618.1 dd_Smed_v4_9734_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30022812Receptor-type tyrosine-protein phosphatase SSMESG000068618.1 dd_Smed_v4_12771_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30033779SMED30033779SMESG000022691.1 SMESG000022690.1 dd_Smed_v4_2130_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30032216SCY1-like protein 2SMESG000015319.1 SMESG000015308.1 dd_Smed_v4_12908_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30028343Cytosolic carboxypeptidase 2SMESG000006325.1 dd_Smed_v4_13454_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30021820Guanylate cyclaseSMESG000056411.1 dd_Smed_v4_11767_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30027209SMED30027209SMESG000078034.1 dd_Smed_v4_12031_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035250lipopolysaccharide-induced tumor necrosis factor-alpha factor homologSMESG000033033.1 dd_Smed_v4_2503_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005280SMED30005280SMESG000077104.1 dd_Smed_v4_4063_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30010755Ig-like domain-containing proteinSMESG000068292.1 dd_Smed_v4_3852_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019147SMED30019147SMESG000061850.1 dd_Smed_v4_11560_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015481DNA topoisomerase 2SMESG000070153.1 dd_Smed_v4_15570_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015481DNA topoisomerase 2SMESG000070153.1 SMESG000068232.1 SMESG000077027.1 dd_Smed_v4_1626_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30018984prefoldin subunit 2SMESG000075156.1 SMESG000075150.1 dd_Smed_v4_1368_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019594Lipoma-preferred partnerSMESG000031084.1 dd_Smed_v4_12584_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30012446Ras-like GTP-binding protein RHOSMESG000068769.1 dd_Smed_v4_4294_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30008165Connector enhancer of kinase suppressor of ras 2SMESG000044449.1 SMESG000044448.1 dd_Smed_v4_4457_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30013844Transposase, Tc1-like proteinSMESG000052306.1 SMESG000022767.1 dd_Smed_v4_3842_3_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30010842EF-hand domain-containing protein 1SMESG000078434.1 dd_Smed_v4_2935_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED300118493-hydroxy-3-methylglutaryl coenzyme A synthaseSMESG000010026.1 dd_Smed_v4_2847_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015473Actin cytoplasmic type 5SMESG000080982.1 SMESG000080969.1 dd_Smed_v4_2624_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015427V-type proton ATPase subunit aSMESG000006351.1 dd_Smed_v4_4805_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30012672Ectonucleoside triphosphate diphosphohydrolase 1SMESG000051033.1 dd_Smed_v4_4184_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30008519WD_REPEATS_REGION domain-containing proteinSMESG000018097.1 dd_Smed_v4_29867_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019107SMED30019107SMESG000027122.1 dd_Smed_v4_12855_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30011534Nucleobindin-2SMESG000022270.1 dd_Smed_v4_4003_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30017647SMED30017647SMESG000013908.1 dd_Smed_v4_1173_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30006203Methyltranfer_dom domain-containing proteinSMESG000031406.1 dd_Smed_v4_3811_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019292Ring finger protein 34bSMESG000045336.1 dd_Smed_v4_1395_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007753SMED30007753SMESG000016633.1 dd_Smed_v4_31397_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004824SMED30004824SMESG000022810.1 dd_Smed_v4_25334_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30013157KHD-1SMESG000070471.1 dd_Smed_v4_294_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30011715Splicing factor, arginine/serine-rich 6SMESG000041210.1 dd_Smed_v4_1177_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30012690SMED30012690SMESG000044628.1 dd_Smed_v4_12170_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015227Elongation of very long chain fatty acids proteinSMESG000009654.1 dd_Smed_v4_1977_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30008250SMED30008250SMESG000048885.1 SMESG000048881.1 dd_Smed_v4_6815_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007607SMED30007607SMESG000050535.1 SMESG000050533.1 dd_Smed_v4_5107_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001950Muscle associated receptor tyrosine kinaseSMESG000017131.1 dd_Smed_v4_6799_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30012757Tektin-4SMESG000068903.1 dd_Smed_v4_4872_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30014055SMED30014055SMESG000044628.1 dd_Smed_v4_12170_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30014136Centrosome-associated protein 350SMESG000069358.1 dd_Smed_v4_20651_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004765Acetyl-CoA acetyltransferase,mitochondrialSMESG000016312.1 dd_Smed_v4_3883_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30006200Ig-like domain-containing proteinSMESG000024474.1 dd_Smed_v4_22211_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED3001301840S ribosomal protein S6SMESG000000674.1 dd_Smed_v4_178_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED300145464-hydroxyphenylpyruvate dioxygenaseSMESG000056251.1 dd_Smed_v4_1114_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002685SMED30002685SMESG000065828.1 dd_Smed_v4_43988_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001660ras and EF-hand domain-containing protein homologSMESG000076099.1 dd_Smed_v4_4284_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30017337Serine/threonine kinaseSMESG000014619.1 dd_Smed_v4_1212_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019590notch-1SMESG000056635.1 dd_Smed_v4_4586_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019456Dipeptidyl peptidase 2SMESG000048843.1 dd_Smed_v4_1123_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30018224Adenylate kinaseSMESG000077377.1 SMESG000076900.1 SMESG000063429.1 SMESG000060686.1 SMESG000043019.1 SMESG000031308.1 SMESG000028811.1 SMESG000023833.1 SMESG000023573.1 SMESG000019820.1 SMESG000011532.1 SMESG000052813.1 dd_Smed_v4_1229_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000917Ring finger protein, transmembrane 1SMESG000013556.1 dd_Smed_v4_6905_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30016899Transcription factor ETV6SMESG000035130.1 dd_Smed_v4_5087_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30018013Protein F37C4.5SMESG000042992.1 SMESG000007398.1 dd_Smed_v4_3629_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009834TNF receptor-associated factorSMESG000047296.1 dd_Smed_v4_2916_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019226SMED30019226SMESG000047314.1 dd_Smed_v4_12313_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019364Si:ch211-193l2.10SMESG000062713.1 dd_Smed_v4_3203_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30013795FSA_C domain-containing proteinSMESG000033549.1 dd_Smed_v4_4377_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30027848Peptidase M60 domain-containing proteinSMESG000042720.1 SMESG000042676.1 dd_Smed_v4_3451_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30026215DDHD domain-containing proteinSMESG000016266.1 dd_Smed_v4_13571_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30022889SeptinSMESG000079489.1 SMESG000049701.1 dd_Smed_v4_2586_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30025887Protein kinase domain-containing proteinSMESG000074945.1 SMESG000074944.1 dd_Smed_v4_3571_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30033551PhosphotransferaseSMESG000043559.1 dd_Smed_v4_4327_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30027439SMED30027439SMESG000031258.1 dd_Smed_v4_12080_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30032568SMED30032568SMESG000047314.1 dd_Smed_v4_12313_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED3002604960S ribosomal protein L35aSMESG000003977.1 dd_Smed_v4_318_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30022590SMED30022590SMESG000021950.1 dd_Smed_v4_28740_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30021538SMED30021538SMESG000021950.1 dd_Smed_v4_28740_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30029716GYF domain-containing proteinSMESG000052533.1 dd_Smed_v4_3448_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30024061SMED30024061SMESG000016986.1 SMESG000016975.1 dd_Smed_v4_14434_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30033411Dynein light chainSMESG000041239.1 dd_Smed_v4_3149_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30025076SMED30025076SMESG000010166.1 dd_Smed_v4_2518_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30029205SMED30029205SMESG000040424.1 dd_Smed_v4_33167_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30026086MIEAP domain-containing proteinSMESG000057251.1 dd_Smed_v4_14351_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035359SMED30035359SMESG000081574.1 SMESG000081529.1 SMESG000079557.1 SMESG000079250.1 SMESG000077556.1 SMESG000075496.1 SMESG000073961.1 SMESG000073618.1 SMESG000073174.1 SMESG000071859.1 SMESG000071198.1 SMESG000071073.1 SMESG000070153.1 SMESG000068262.1 SMESG000068028.1 SMESG000067334.1 SMESG000065567.1 SMESG000061192.1 SMESG000060952.1 SMESG000060260.1 SMESG000059623.1 SMESG000050492.1 SMESG000050479.1 SMESG000050299.1 SMESG000049776.1 SMESG000048159.1 SMESG000044971.1 SMESG000043973.1 SMESG000042620.1 SMESG000040932.1 SMESG000039792.1 SMESG000039741.1 SMESG000039356.1 SMESG000034716.1 SMESG000033763.1 SMESG000029286.1 SMESG000028614.1 SMESG000027381.1 SMESG000025022.1 SMESG000021522.1 SMESG000020398.1 SMESG000019968.1 SMESG000018320.1 SMESG000015216.1 SMESG000015117.1 SMESG000015102.1 SMESG000013389.1 SMESG000012534.1 SMESG000012464.1 SMESG000011278.1 SMESG000011147.1 SMESG000007021.1 SMESG000006554.1 SMESG000001897.1 SMESG000070487.1 SMESG000068881.1 SMESG000064552.1 SMESG000063831.1 SMESG000056926.1 SMESG000050300.1 SMESG000047318.1 SMESG000047014.1 SMESG000043279.1 SMESG000030931.1 SMESG000023641.1 SMESG000018675.1 SMESG000017256.1 SMESG000013665.1 SMESG000013089.1 SMESG000011196.1 SMESG000009621.1 SMESG000008519.1 SMESG000005066.1 dd_Smed_v4_129_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30026298Protein kinase domain-containing proteinSMESG000014619.1 dd_Smed_v4_1212_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30027782SMED30027782SMESG000031406.1 dd_Smed_v4_3811_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30028277SMED30028277SMESG000050296.1 dd_Smed_v4_11076_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30024920Ectonucleoside triphosphate diphosphohydrolaseSMESG000068450.1 dd_Smed_v4_11962_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30026420Leucyl aminopeptidaseSMESG000037609.1 dd_Smed_v4_2903_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30020437Glutamate receptor ionotropic kainate 3SMESG000005192.1 dd_Smed_v4_13705_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30031605Cyclic nucleotide-binding domain-containing proteinSMESG000076149.1 dd_Smed_v4_11972_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30023244TLC domain-containing protein 2SMESG000060101.1 SMESG000039123.1 dd_Smed_v4_4223_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035881noggin-like protein 7SMESG000016086.1 dd_Smed_v4_10469_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30024058SMED30024058SMESG000020813.1 dd_Smed_v4_3688_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30033098WD repeat-containing protein 97 isoform X2SMESG000010382.1 dd_Smed_v4_11828_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30024416Potassium channel tetramerization domain containing 1SMESG000067417.1 dd_Smed_v4_3793_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30026296SMED30026296SMESG000077674.1 dd_Smed_v4_25487_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30029761lhx1-5-1SMESG000043039.1 SMESG000016568.1 dd_Smed_v4_11521_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30024185slc10a-5SMESG000064830.1 dd_Smed_v4_11330_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30024442Serine/threonine kinaseSMESG000079489.1 SMESG000049701.1 dd_Smed_v4_2586_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30027715G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000062905.1 dd_Smed_v4_28970_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30020344SMED30020344SMESG000077674.1 dd_Smed_v4_25487_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30025981SMED30025981SMESG000059781.1 dd_Smed_v4_12332_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30024527non-gastric H ,K -ATPase alpha subunitSMESG000041938.1 SMESG000041937.1 SMESG000051989.1 dd_Smed_v4_1179_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30020807Phosphatase and actin regulatorSMESG000077760.1 dd_Smed_v4_4162_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035723nesprin-1-likeSMESG000023320.1 dd_Smed_v4_43173_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035723nesprin-1-likeSMESG000023320.1 dd_Smed_v4_26396_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035723nesprin-1-likeSMESG000023320.1 dd_Smed_v4_64459_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035723nesprin-1-likeSMESG000023320.1 dd_Smed_v4_20344_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035723nesprin-1-likeSMESG000023320.1 dd_Smed_v4_20714_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035723nesprin-1-likeSMESG000023320.1 dd_Smed_v4_47116_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035723nesprin-1-likeSMESG000023320.1 dd_Smed_v4_51249_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30014280Malignant brain tumor-like proteinSMESG000025138.1 dd_Smed_v4_11547_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30006223SMED30006223SMESG000076262.1 dd_Smed_v4_18847_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30006223SMED30006223SMESG000076262.1 dd_Smed_v4_6442_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED3001361360S ribosomal protein L26SMESG000066644.1 dd_Smed_v4_235_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30008560Secretogranin 5SMESG000016510.1 dd_Smed_v4_3862_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30016784SMED30016784SMESG000033408.1 dd_Smed_v4_14494_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009072Protein phosphatase 1BSMESG000027795.1 SMESG000027796.1 dd_Smed_v4_1148_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30011703Death domain-containing proteinSMESG000040750.1 dd_Smed_v4_11696_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30017491Spermatogenesis associated 1SMESG000029165.1 dd_Smed_v4_13541_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001301TPA_inf: secreted peptide prohormone-16SMESG000079890.1 dd_Smed_v4_1545_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30006383SMED30006383SMESG000008503.1 dd_Smed_v4_15602_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004487SMED30004487SMESG000012170.1 SMESG000012168.1 dd_Smed_v4_1367_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30006822SMED30006822SMESG000043386.1 dd_Smed_v4_15542_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003294SMED30003294SMESG000042814.1 dd_Smed_v4_16153_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30013845Phosphoglucomutase-1SMESG000046578.1 dd_Smed_v4_3503_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30008062SMED30008062SMESG000023281.1 dd_Smed_v4_16057_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001520SMED30001520SMESG000063654.1 dd_Smed_v4_18750_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019616Doublesex and mab 3 transcriptionSMESG000002896.1 dd_Smed_v4_14213_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019975E3 ubiquitin-protein ligaseSMESG000008708.1 dd_Smed_v4_1444_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30014539cAMP-dependent protein kinase type II regulatory subunitSMESG000019065.1 dd_Smed_v4_2902_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30017231NEPH-3SMESG000022777.1 dd_Smed_v4_11280_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30014286Multidrug resistance-associated protein 1SMESG000074229.1 SMESG000074226.1 dd_Smed_v4_13596_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30017309SMED30017309SMESG000037799.1 dd_Smed_v4_4196_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005805Homeobox domain-containing proteinSMESG000041571.1 dd_Smed_v4_18972_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007227PLOX3-DjSMESG000071019.1 dd_Smed_v4_22992_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30006606Alpha-mannosidaseSMESG000045085.1 SMESG000045072.1 dd_Smed_v4_1942_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001647SMED30001647SMESG000005004.1 dd_Smed_v4_2246_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015172Protein kinase CSMESG000039865.1 SMESG000039854.1 SMESG000032749.1 SMESG000032747.1 dd_Smed_v4_4244_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30006247SMED30006247SMESG000070072.1 dd_Smed_v4_1789_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004725SMED30004725SMESG000023005.1 dd_Smed_v4_1571_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019422SMED30019422SMESG000025002.1 dd_Smed_v4_18079_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019681Xaa-Pro aminopeptidase 1SMESG000020489.1 dd_Smed_v4_4029_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30010096TPA_inf: prohormone convertase 2SMESG000008070.1 dd_Smed_v4_1566_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007500coiled-coil domain-containing protein 170SMESG000074429.1 dd_Smed_v4_10140_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003967Ninein-like proteinSMESG000041298.1 dd_Smed_v4_16759_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002537Y box protein-1SMESG000058013.1 dd_Smed_v4_35_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005995SMED30005995SMESG000018616.1 dd_Smed_v4_24171_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30006871Growth factor independent 1 transcriptional repressorSMESG000042630.1 dd_Smed_v4_14824_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019663slc18a-4SMESG000064025.1 dd_Smed_v4_16043_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30012850Spondin-1SMESG000009946.1 dd_Smed_v4_2400_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30011819SMED30011819SMESG000017281.1 SMESG000068502.1 dd_Smed_v4_1704_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30024562Degenerin unc-8SMESG000011525.1 dd_Smed_v4_14159_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035970transcription initiation factor TFIID subunit 2SMESG000037189.1 dd_Smed_v4_15494_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30021847SMED30021847SMESG000017151.1 dd_Smed_v4_16489_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30021808SMED30021808SMESG000054507.1 dd_Smed_v4_14111_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30025671pim-1SMESG000017137.1 dd_Smed_v4_4012_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30034448synaptotagmin-17SMESG000076969.1 dd_Smed_v4_19213_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30026663Tropomyosin Tod p 1.0102SMESG000074053.1 dd_Smed_v4_405_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035597SMED30035597SMESG000029469.1 dd_Smed_v4_1765_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30020977SMED30020977SMESG000069851.1 dd_9493dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
cephalic gangliaSMED30020977SMED30020977SMESG000069851.1 dd_Smed_v4_9493_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30022193SMED30022193SMESG000069851.1 dd_9493dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
cephalic gangliaSMED30022193SMED30022193SMESG000069851.1 dd_Smed_v4_9493_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30034531Filamin-ASMESG000017288.1 dd_Smed_v4_1745_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30029973Ribonucleoside-diphosphate reductaseSMESG000029273.1 dd_Smed_v4_1651_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30020736nucleolar protein 58SMESG000071386.1 dd_Smed_v4_1982_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30020057SMED30020057SMESG000077666.1 dd_Smed_v4_1652_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30027641Serrate RNA effector moleculeSMESG000023055.1 dd_Smed_v4_3660_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED3002930240S ribosomal protein S16SMESG000018349.1 SMESG000018333.1 dd_Smed_v4_170_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30034422Antigen KI-67SMESG000050427.1 dd_Smed_v4_13700_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30023473EGF-like domain-containing proteinSMESG000068371.1 dd_Smed_v4_3774_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30032160Calponin-homology (CH) domain-containing proteinSMESG000017288.1 dd_Smed_v4_1745_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035101Protein kinaseSMESG000024804.1 dd_Smed_v4_3989_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30020746AnoctaminSMESG000052528.1 dd_Smed_v4_19189_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30034697Testis-specific Y-encoded-like protein 1SMESG000027817.1 SMESG000027807.1 dd_Smed_v4_393_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED3002317260s ribosomal protein L14SMESG000022343.1 dd_Smed_v4_167_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30029047GTP cyclohydrolase 1SMESG000064560.1 dd_Smed_v4_11172_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30027419msh6SMESG000073017.1 dd_Smed_v4_15463_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30027466FMRFamide-activated amiloride-sensitive sodium channelSMESG000034894.1 dd_Smed_v4_15920_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30027833Guanylate cyclaseSMESG000079311.1 dd_Smed_v4_15400_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30020862Transient receptor potential cation channel subfamily M memberSMESG000017281.1 SMESG000068502.1 dd_Smed_v4_1704_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035258transient receptor potential cation channel subfamily A member-1SMESG000035379.1 dd_Smed_v4_14207_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30030581Melanocyte proliferating gene 1SMESG000027795.1 SMESG000027796.1 dd_Smed_v4_1148_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30026619Mitochondrial calcium uniporterSMESG000000983.1 dd_Smed_v4_4033_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED3002950760S ribosomal protein L12SMESG000006898.1 dd_Smed_v4_259_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30023736sine oculis-1/2SMESG000001687.1 dd_Smed_v4_15436_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30022844NEPH-3SMESG000022777.1 dd_Smed_v4_11280_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30022407Transient receptor potential cation channel subfamily A member 1SMESG000070631.1 dd_Smed_v4_41539_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30022407Transient receptor potential cation channel subfamily A member 1SMESG000070631.1 dd_Smed_v4_33748_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30020430Very-long-chain (3R)-3-hydroxyacyl-CoA dehydrataseSMESG000034959.1 dd_Smed_v4_3998_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30031879Protein kinase domain-containing proteinSMESG000043386.1 dd_Smed_v4_15542_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30017321Mitochondria localized glutamic acid rich proteinSMESG000000761.1 dd_Smed_v4_6622_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30012338G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000063133.1 dd_Smed_v4_38431_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019820PiggyBac transposable element-derived protein 4SMESG000065350.1 SMESG000058681.1 SMESG000023666.1 dd_Smed_v4_9347_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019820PiggyBac transposable element-derived protein 4 dd_Smed_v4_22567_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30012572Leucine--tRNA ligaseSMESG000071689.1 dd_Smed_v4_9705_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003672Mitochondrial import inner membrane translocase subunit TIM17SMESG000027783.1 SMESG000027888.1 dd_Smed_v4_904_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30010350SMED30010350SMESG000017804.1 SMESG000017801.1 dd_Smed_v4_1_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30010008SMED30010008SMESG000075346.1 dd_Smed_v4_6802_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30010453SMED30010453SMESG000058221.1 dd_Smed_v4_6938_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019945Granulin precursorSMESG000018767.1 SMESG000018762.1 SMESG000018760.1 dd_Smed_v4_427_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30014149Ras-related protein Rab-3SMESG000034019.1 dd_Smed_v4_5920_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30010425Acid-sensing ion channel 4SMESG000027783.1 SMESG000027888.1 dd_Smed_v4_904_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30018069DDE_Tnp_IS1595 domain-containing proteinSMESG000065350.1 SMESG000058681.1 SMESG000023666.1 dd_Smed_v4_9347_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30013651SMED30013651SMESG000004219.1 dd_Smed_v4_5288_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005723Synaptotagmin, putativeSMESG000040037.1 dd_Smed_v4_7243_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30016405SMED30016405SMESG000056350.1 dd_Smed_v4_6674_0_2dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30027899slc26a-10SMESG000052008.1 SMESG000051986.1 dd_Smed_v4_5066_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035291PikachurinSMESG000079944.1 dd_Smed_v4_10946_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30026889Ras-related protein Rab-10SMESG000042605.1 dd_Smed_v4_2906_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035723nesprin-1-likeSMESG000023320.1 dd_Smed_v4_10282_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035723nesprin-1-likeSMESG000023320.1 dd_Smed_v4_39583_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035723nesprin-1-likeSMESG000023320.1 dd_Smed_v4_44969_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30028228Centrosomal protein 164SMESG000054195.1 SMESG000021687.1 dd_Smed_v4_12228_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30026380Phospholipid-transporting ATPaseSMESG000034375.1 SMESG000034325.1 dd_Smed_v4_13628_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30020525Dynein intermediate chain 2, ciliarySMESG000001839.1 SMESG000001830.1 dd_Smed_v4_4753_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30021710Sine oculis binding protein homolog (Drosophila) aSMESG000042199.1 dd_Smed_v4_31841_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30023486Intraflagellar transport 74SMESG000074086.1 dd_Smed_v4_12702_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30028994Protein kinase domain-containing proteinSMESG000033598.1 dd_Smed_v4_13819_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30032108ProtocadherinSMESG000033639.1 dd_Smed_v4_12429_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30023155Thyroid adenoma-associated-like proteinSMESG000023235.1 dd_Smed_v4_12325_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30022087TNFR CD27 30 40 95 cysteine rich regionSMESG000065173.1 dd_Smed_v4_3783_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30033097SMED30033097SMESG000044449.1 SMESG000044448.1 dd_Smed_v4_4457_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30031047Small conductance calcium-activated potassium channel proteinSMESG000046926.1 dd_Smed_v4_13707_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005357hypothetical proteinSMESG000027979.1 dd_Smed_v4_775_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30014283LIM zinc-binding domain-containing proteinSMESG000013742.1 dd_Smed_v4_16924_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30014283LIM zinc-binding domain-containing proteinSMESG000013742.1 dd_Smed_v4_7540_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30018716Acidic leucine-rich nuclear phosphoprotein 32 family member ASMESG000065271.1 dd_Smed_v4_1396_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019205Neur_chan_LBD domain-containing proteinSMESG000039749.1 dd_Smed_v4_15962_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003981Tctex1 domain containing 1SMESG000021852.1 dd_Smed_v4_12108_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED300097175-aminolevulinate synthaseSMESG000078664.1 dd_Smed_v4_1226_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30010202NPHS1-3SMESG000070688.1 dd_Smed_v4_14980_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30011641SMED30011641SMESG000073490.1 dd_Smed_v4_19224_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005620Homeobox protein SIX1SMESG000005975.1 dd_Smed_v4_9774_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30017880Alpha-int-1SMESG000022733.1 dd_Smed_v4_11655_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002330Peptidyl-prolyl cis-trans isomeraseSMESG000079924.1 dd_Smed_v4_1242_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003523Threonine synthase-like 2SMESG000081526.1 dd_Smed_v4_1547_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30016673Cylindromatosis (turban tumor syndrome), bSMESG000056847.1 SMESG000056843.1 SMESG000056838.1 SMESG000044770.1 SMESG000044762.1 SMESG000007140.1 dd_Smed_v4_1137_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED3001369960S ribosomal protein L9SMESG000003774.1 dd_Smed_v4_150_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30016080Deoxyhypusine hydroxylaseSMESG000051726.1 SMESG000051721.1 dd_Smed_v4_703_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30018755Small ubiquitin-related modifierSMESG000018835.1 dd_Smed_v4_1253_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30018418Serine/threonine-protein phosphatase 2A regulatory subunit BSMESG000015273.1 dd_Smed_v4_14696_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015642low density lipoprotein receptor-1SMESG000027826.1 SMESG000027815.1 dd_Smed_v4_1581_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30011104HTH La-type RNA-binding domain-containing proteinSMESG000000519.1 dd_Smed_v4_1420_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000707Sodium/hydrogen exchangerSMESG000062012.1 dd_Smed_v4_11493_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004536Snail-1SMESG000076673.1 dd_Smed_v4_15506_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004841GTP-binding proteinSMESG000057130.1 dd_Smed_v4_18884_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002478death domain-containing protein 1SMESG000048822.1 dd_Smed_v4_15379_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004534SMED30004534SMESG000035431.1 dd_Smed_v4_12610_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30017048cilia- and flagella-associated protein 206SMESG000021247.1 dd_Smed_v4_11199_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30011817SMED30011817SMESG000000519.1 dd_Smed_v4_1420_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30010934Ectonucleoside triphosphate diphosphohydrolase 3SMESG000010140.1 dd_Smed_v4_16337_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007346Achaete-scute-like proteinSMESG000026861.1 dd_Smed_v4_1854_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015704Hox class homeodomain protein DjAbd-BaSMESG000062714.1 dd_Smed_v4_12317_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30012867NEPH-2SMESG000071657.1 dd_Smed_v4_12118_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001584SMED30001584SMESG000058817.1 dd_Smed_v4_12647_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002788Four and a half LIM domains protein 3SMESG000013182.1 dd_Smed_v4_1244_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004097SMED30004097SMESG000031258.1 dd_Smed_v4_12080_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30012991endoglycoceramidaseSMESG000030369.1 SMESG000030357.1 SMESG000030353.1 dd_Smed_v4_1570_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007592SMED30007592SMESG000075491.1 dd_Smed_v4_11446_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015584Nesprin-1SMESG000016745.1 dd_Smed_v4_17767_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015584Nesprin-1SMESG000016745.1 dd_Smed_v4_23532_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015584Nesprin-1SMESG000016745.1 dd_Smed_v4_16850_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015584Nesprin-1SMESG000016745.1 dd_Smed_v4_23535_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015584Nesprin-1SMESG000016745.1 dd_Smed_v4_13561_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015584Nesprin-1SMESG000016745.1 dd_Smed_v4_34184_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30016327Ras GTPase-activating protein SynGAPSMESG000060891.1 SMESG000060888.1 SMESG000060447.1 dd_Smed_v4_11115_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019834Guanine nucleotide-binding protein subunit beta-2-like 1SMESG000076568.1 dd_Smed_v4_174_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30016801Phosphatidylcholine-sterol acyltransferase (Lecithin-cholesterol acyltransferase)/ Phospholipase ASMESG000037748.1 dd_Smed_v4_1306_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001808Calcium-transporting ATPaseSMESG000056345.1 dd_Smed_v4_13223_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001808Calcium-transporting ATPaseSMESG000056345.1 dd_Smed_v4_9557_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30017997WSC domain-containing proteinSMESG000057220.1 dd_Smed_v4_10762_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002139Vacuole membrane protein 1SMESG000034612.1 dd_Smed_v4_1156_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30017379DJ-1SMESG000003454.1 dd_Smed_v4_1223_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30016817SMED30016817SMESG000016762.1 dd_Smed_v4_11137_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019554SMED30019554SMESG000069999.1 dd_Smed_v4_13564_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30013278Serine/threonine-protein phosphataseSMESG000076282.1 dd_Smed_v4_16123_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30006221PHB domain-containing proteinSMESG000037334.1 dd_Smed_v4_6396_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30014950Serine/threonine-protein phosphatase with EF-handsSMESG000076282.1 dd_Smed_v4_16123_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30010364SMED30010364SMESG000056847.1 SMESG000056843.1 SMESG000056838.1 SMESG000044770.1 SMESG000044762.1 SMESG000007140.1 dd_Smed_v4_1137_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30017265Protocadherin gammaSMESG000046654.1 dd_Smed_v4_11223_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30018297Dynein light chainSMESG000019341.1 dd_Smed_v4_177_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019034SMED30019034SMESG000025346.1 dd_Smed_v4_18479_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30011180Kinesin-like protein KIF26ASMESG000051203.1 dd_Smed_v4_8860_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005802SMED30005802SMESG000072483.1 dd_Smed_v4_5611_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30018391Kv channel-interacting protein 1 isoform X2SMESG000056720.1 dd_Smed_v4_13820_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015004SMED30015004SMESG000042350.1 dd_Smed_v4_13840_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30018441CUGBP, Elav-like family member 4SMESG000026947.1 dd_Smed_v4_14010_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30012574Carboxyl-terminal PDZ ligand of neuronal nitric oxide synthase proteinSMESG000071224.1 dd_Smed_v4_13377_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002377DNA-binding proteinSMESG000062714.1 dd_Smed_v4_12317_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30010515FR47 domain-containing proteinSMESG000035878.1 dd_Smed_v4_1705_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30018324Voltage-dependent T-type calcium channel subunit alphaSMESG000005761.1 SMESG000005760.1 dd_Smed_v4_14730_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30016234General transcription factor II-I repeat domain-containing protein 2ASMESG000039749.1 dd_Smed_v4_15962_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003172Adenylosuccinate synthetaseSMESG000078697.1 dd_Smed_v4_2154_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30011326SJCHGC02540 proteinSMESG000056369.1 dd_Smed_v4_16852_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30014428Receptor-type tyrosine-protein phosphatase FSMESG000025325.1 dd_Smed_v4_14794_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003876SMED30003876SMESG000079921.1 SMESG000079899.1 SMESG000079877.1 SMESG000000911.1 SMESG000000908.1 dd_Smed_v4_13944_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005046Dynein heavy chain, axonemalSMESG000050247.1 dd_Smed_v4_13135_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005046Dynein heavy chain, axonemalSMESG000050247.1 SMESG000050248.1 dd_Smed_v4_10191_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30017333centrosomal protein of 83 kDa-likeSMESG000033227.1 SMESG000033225.1 dd_Smed_v4_12969_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30011963SMED30011963SMESG000032294.1 dd_Smed_v4_1381_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30013313SMED30013313SMESG000060891.1 SMESG000060888.1 SMESG000060447.1 dd_Smed_v4_11115_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30017825SMED30017825SMESG000026672.1 dd_Smed_v4_13542_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005211cilia- and flagella-associated protein 47SMESG000060264.1 dd_Smed_v4_8294_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30012842SMED30012842SMESG000043342.1 dd_Smed_v4_11532_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019073SMED30019073SMESG000041235.1 dd_Smed_v4_13685_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003169Potassium voltage-gated channel subfamily A member 2SMESG000069004.1 dd_Smed_v4_13717_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30008883Protein CEPU-1SMESG000040207.1 dd_Smed_v4_11326_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019103TetraspaninSMESG000021627.1 dd_Smed_v4_1650_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30020733SMED30020733SMESG000013963.1 SMESG000013955.1 dd_Smed_v4_14808_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035566SMED30035566SMESG000005776.1 dd_Smed_v4_3522_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30030681SMED30030681SMESG000038678.1 dd_Smed_v4_327_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30020296Vitellogenin domain-containing proteinSMESG000037978.1 SMESG000037977.1 dd_Smed_v4_194_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30034893glypican-1SMESG000052359.1 dd_Smed_v4_4154_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30034660Spectrin beta chain, non-erythrocytic 5SMESG000023006.1 dd_Smed_v4_2514_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30027672Plac8 onzin related protein 1SMESG000050229.1 SMESG000050221.1 dd_Smed_v4_1219_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035114Potassium voltage-gated channel protein ShawSMESG000069015.1 dd_Smed_v4_42862_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035114Potassium voltage-gated channel protein ShawSMESG000069015.1 dd_Smed_v4_25015_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30024611Terminal nucleotidyltransferase 5CSMESG000052359.1 dd_Smed_v4_4154_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30024611Terminal nucleotidyltransferase 5CSMESG000016756.1 dd_Smed_v4_3449_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30031633enkurin isoform X1SMESG000076528.1 dd_Smed_v4_2868_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30024742Transient receptor potential cation channel subfamily V member 6SMESG000039339.1 dd_Smed_v4_29474_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30033071SMED30033071SMESG000037721.1 dd_Smed_v4_34084_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30010974InnexinSMESG000055742.1 SMESG000055733.1 dd_Smed_v4_1120_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007990FH2 domain-containing proteinSMESG000034094.1 dd_Smed_v4_15344_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007990FH2 domain-containing proteinSMESG000034095.1 SMESG000034094.1 dd_Smed_v4_414_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009224early growth response-3SMESG000000959.1 dd_Smed_v4_12410_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009224early growth response-3SMESG000000959.1 dd_Smed_v4_14711_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002503SMED30002503SMESG000062999.1 SMESG000062995.1 dd_Smed_v4_3686_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000200Polypeptide N-acetylgalactosaminyltransferaseSMESG000017211.1 dd_Smed_v4_5368_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005825P2X purinoceptor 4SMESG000046729.1 dd_Smed_v4_7865_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30018579SMED30018579SMESG000017019.1 dd_Smed_v4_13580_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003857Centrosomal protein of 162 kDaSMESG000027479.1 dd_Smed_v4_9279_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005681Nkap_C domain-containing proteinSMESG000047456.1 SMESG000047455.1 dd_Smed_v4_6988_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002705SMED30002705SMESG000020813.1 dd_Smed_v4_3688_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005175SMED30005175SMESG000022792.1 dd_Smed_v4_65996_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004813SMED30004813SMESG000048822.1 dd_Smed_v4_15379_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005345SMED30005345SMESG000059907.1 dd_Smed_v4_125_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002598Histone-lysine N-methyltransferaseSMESG000039926.1 dd_Smed_v4_99_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009043Fork-head domain-containing proteinSMESG000044628.1 dd_Smed_v4_12170_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002065ANK_REP_REGION domain-containing proteinSMESG000020707.1 dd_Smed_v4_82108_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002065ANK_REP_REGION domain-containing proteinSMESG000020707.1 dd_Smed_v4_91547_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30008752Homeobox domain-containing proteinSMESG000016670.1 dd_Smed_v4_11150_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001560SMED30001560SMESG000033391.1 dd_Smed_v4_5969_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30011581AP2-associated protein kinase 1-like ProteinSMESG000041938.1 SMESG000041937.1 SMESG000051989.1 dd_Smed_v4_1179_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002110Dipeptidyl peptidase 1SMESG000077202.1 dd_Smed_v4_219_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005209Ankyrin repeat domain 50SMESG000028414.1 dd_Smed_v4_12936_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30010687Serine/threonine-protein kinase STE20SMESG000014619.1 dd_Smed_v4_1212_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001626Guanine nucleotide-binding protein G(S) subunit alphaSMESG000051618.1 SMESG000049680.1 SMESG000049670.1 SMESG000049645.1 dd_Smed_v4_33116_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003975Ceramide synthase 5SMESG000060101.1 SMESG000039123.1 dd_Smed_v4_4223_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007202Guanylate cyclaseSMESG000068881.1 dd_Smed_v4_14331_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004741Phorbol-ester/DAG-type domain-containing proteinSMESG000021967.1 dd_Smed_v4_7146_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005074Protein kinase domain-containing proteinSMESG000014619.1 dd_Smed_v4_1212_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30011413Histone H2ASMESG000022910.1 SMESG000006040.1 dd_Smed_v4_12365_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30010029T-complex-associated-testis-expressed 1SMESG000023093.1 dd_Smed_v4_12524_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003831SMED30003831SMESG000071535.1 dd_Smed_v4_3895_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005421CAP-Gly domain-containing proteinSMESG000006189.1 dd_Smed_v4_14698_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000886BED-type domain-containing proteinSMESG000028095.1 dd_Smed_v4_5332_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005365Serine/threonine-protein kinaseSMESG000007586.1 dd_Smed_v4_15228_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30033594Microtubule-associated protein 1ASMESG000014298.1 dd_Smed_v4_3654_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30033594Microtubule-associated protein 1ASMESG000014298.1 dd_Smed_v4_1301_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30028895Pyrazinamidase/nicotinamidase, putativeSMESG000005583.1 dd_Smed_v4_11420_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30024115Ubiquitin-40S ribosomal protein S27aSMESG000048830.1 dd_Smed_v4_121_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30024295Mitogen-activated protein kinaseSMESG000032743.1 dd_Smed_v4_1319_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30027858Zinc finger proteinSMESG000060422.1 dd_Smed_v4_14937_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30025688Protein tilB homologSMESG000058220.1 dd_Smed_v4_10124_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035248Sprouty related EVH1 domain containing 2aSMESG000045033.1 dd_Smed_v4_14816_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30033232Retinoid isomerohydrolaseSMESG000054001.1 dd_Smed_v4_13185_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035484PKD2-3SMESG000059487.1 SMESG000033381.1 dd_Smed_v4_17348_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30028992Guanine nucleotide-binding protein subunit betaSMESG000038555.1 dd_Smed_v4_1615_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30022178SMED30022178SMESG000057910.1 dd_Smed_v4_1090_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30034597PeriostinSMESG000070985.1 dd_Smed_v4_1505_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30023475SMED30023475SMESG000047326.1 dd_Smed_v4_13864_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30022534SMED30022534SMESG000064314.1 dd_Smed_v4_13603_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30032163Transcription factor RFX4SMESG000058756.1 dd_Smed_v4_11406_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30022784SMED30022784SMESG000058274.1 dd_Smed_v4_4103_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30031442Protocadherin-1SMESG000042783.1 dd_Smed_v4_17621_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30031442Protocadherin-1SMESG000042783.1 dd_Smed_v4_13423_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30023424Multidrug and toxin extrusion proteinSMESG000005478.1 dd_Smed_v4_12128_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30027644cAMP-dependent protein kinase regulatory subunitSMESG000003135.1 dd_Smed_v4_14355_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30023907SMED30023907SMESG000042253.1 dd_Smed_v4_13413_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30031035SMED30031035SMESG000069327.1 dd_Smed_v4_13889_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015470SparcSMESG000024280.1 dd_Smed_v4_1021_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30006079Nucleobindin-2SMESG000013792.1 dd_Smed_v4_9013_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30012229Cilia- and flagella-associated protein 20SMESG000081781.1 dd_Smed_v4_3751_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003461SMED30003461SMESG000019927.1 dd_Smed_v4_8528_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009210Protein kinase domain-containing proteinSMESG000039711.1 dd_Smed_v4_13767_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004424Integrator complex subunit 2SMESG000061179.1 dd_Smed_v4_7197_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30010611Tudor and KH domain containing-1SMESG000075675.1 dd_Smed_v4_3961_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007917SMED30007917SMESG000070256.1 dd_Smed_v4_410_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30012205ATP-binding cassette sub-family A member 7-like proteinSMESG000068605.1 dd_Smed_v4_20782_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30012205ATP-binding cassette sub-family A member 7-like proteinSMESG000068605.1 dd_Smed_v4_21124_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001916IRS-type PTB domain-containing proteinSMESG000027222.1 dd_Smed_v4_9490_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001861mitochondrial sodium/calcium exchanger proteinSMESG000022808.1 dd_Smed_v4_20334_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019571Protein kinase domain containing proteinSMESG000024532.1 dd_Smed_v4_2822_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30006515ZZ-type domain-containing proteinSMESG000055420.1 dd_Smed_v4_10173_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30014645HP domain-containing proteinSMESG000075965.1 dd_Smed_v4_4193_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30010317MFS domain-containing proteinSMESG000026516.1 dd_Smed_v4_6235_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30016106Methyltransf_21 domain-containing proteinSMESG000071837.1 SMESG000020353.1 dd_Smed_v4_25359_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30006456ClaspinSMESG000049039.1 dd_Smed_v4_7575_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30014549Prominin (Prom) protein, putativeSMESG000013192.1 dd_Smed_v4_1386_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30017876ATP-dependent 6-phosphofructokinaseSMESG000028432.1 dd_Smed_v4_3613_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002006SMED30002006SMESG000037097.1 SMESG000037096.1 dd_Smed_v4_12526_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002319SMED30002319SMESG000049481.1 dd_Smed_v4_4006_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001983SMED30001983SMESG000066197.1 SMESG000053558.1 dd_Smed_v4_4363_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003269Reticulon-like proteinSMESG000007676.1 dd_Smed_v4_1796_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED300089653'-5' exoribonuclease 1SMESG000016564.1 dd_Smed_v4_9578_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30011568Ragulator complex protein isoform 1SMESG000058434.1 dd_Smed_v4_2623_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30008402G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000075377.1 SMESG000003543.1 dd_Smed_v4_12494_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003603SMED30003603SMESG000071647.1 dd_Smed_v4_9231_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015414G_PROTEIN_RECEP_F2_4 domain-containing proteinSMESG000070072.1 dd_Smed_v4_1789_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015414G_PROTEIN_RECEP_F2_4 domain-containing proteinSMESG000033615.1 dd_Smed_v4_10981_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30006230Sperm surface protein Sp17SMESG000046919.1 dd_Smed_v4_2279_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30006230Sperm surface protein Sp17SMESG000046919.1 dd_Smed_v4_4783_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30011291Acidic phospholipase A2SMESG000079712.1 dd_Smed_v4_2969_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30013300Mitochondrial ATP synthase subunit 9SMESG000078181.1 dd_Smed_v4_23_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30003838SMED30003838SMESG000026730.1 dd_Smed_v4_13017_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED3000103940S ribosomal protein S7SMESG000053117.1 SMESG000031967.1 SMESG000031033.1 SMESG000014878.1 dd_Smed_v4_204_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30012386Alpha-1,4 glucan phosphorylaseSMESG000061417.1 dd_Smed_v4_1532_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007161SMED30007161SMESG000070072.1 dd_Smed_v4_1789_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015821Neuropeptide-22SMESG000043852.1 dd_Smed_v4_1483_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30013770JmjC domain-containing proteinSMESG000028946.1 dd_Smed_v4_14490_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30018221Epithelial cell transforming 2 likeSMESG000074748.1 dd_Smed_v4_14243_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019888Homeobox protein aristalessSMESG000020038.1 dd_Smed_v4_16955_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30016231Protocadherin 11SMESG000051413.1 dd_Smed_v4_16397_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000559Transposon Ty3-I Gag-Pol polyproteinSMESG000063504.1 SMESG000063503.1 SMESG000026061.1 dd_Smed_v4_3587_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000559Transposon Ty3-I Gag-Pol polyproteinSMESG000013684.1 dd_Smed_v4_14881_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000559Transposon Ty3-I Gag-Pol polyprotein dd_Smed_v4_14472_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30010111TPA_inf: neuropeptide precursor-2SMESG000072719.1 dd_Smed_v4_1015_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30013404SMED30013404SMESG000027863.1 dd_Smed_v4_16528_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009006SMED30009006SMESG000076708.1 dd_Smed_v4_13935_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30008418SMED30008418SMESG000027863.1 dd_Smed_v4_16528_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30017686HTH La-type RNA-binding domain-containing proteinSMESG000076708.1 dd_Smed_v4_13935_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30016609SMED30016609SMESG000044186.1 dd_Smed_v4_13633_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002469TPA_inf: pedal peptide prohormone like-1SMESG000035027.1 dd_Smed_v4_3211_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001473Lipoxygenase homology domain-containing protein 1SMESG000059926.1 SMESG000059927.1 dd_Smed_v4_10460_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30017031FMRFamide-activated amiloride-sensitive sodium channelSMESG000045131.1 dd_Smed_v4_18219_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30012553SMED30012553SMESG000067029.1 dd_Smed_v4_15528_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30011515Secreted peptide prohormone-13SMESG000009971.1 dd_Smed_v4_1538_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30018442PHB domain-containing proteinSMESG000026539.1 dd_Smed_v4_15992_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000972Leucine-rich repeat-containing protein 71SMESG000006778.1 dd_Smed_v4_12043_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000972Leucine-rich repeat-containing protein 71SMESG000006778.1 dd_Smed_v4_10715_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED3000239240S ribosomal protein S15SMESG000015520.1 dd_Smed_v4_201_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019752Ninein-like proteinSMESG000041298.1 dd_Smed_v4_16759_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30017021PhosphodiesteraseSMESG000044149.1 dd_Smed_v4_15950_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002438SMED30002438SMESG000003366.1 dd_Smed_v4_12927_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019431SMED30019431SMESG000032527.1 SMESG000022725.1 dd_Smed_v4_1563_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30010239SMED30010239SMESG000023005.1 dd_Smed_v4_1571_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30017934TPA_inf: neuropeptide precursor-4SMESG000036661.1 dd_Smed_v4_4417_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009933WH1 domain-containing proteinSMESG000052345.1 dd_Smed_v4_1714_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009313SMED30009313SMESG000050309.1 dd_Smed_v4_18399_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004686Oxygen-dependent choline dehydrogenaseSMESG000064120.1 dd_Smed_v4_13047_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002829Tubulin-specific chaperone DSMESG000000964.1 dd_Smed_v4_10610_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30014459bak-2SMESG000008222.1 dd_Smed_v4_1767_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30008797SMED30008797SMESG000076328.1 dd_Smed_v4_1587_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30011980G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000060945.1 dd_Smed_v4_14651_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000594Polycomb protein suz12SMESG000054377.1 dd_Smed_v4_12930_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30017943SMED30017943SMESG000022837.1 dd_Smed_v4_16017_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007142Sperm surface protein Sp17SMESG000046919.1 dd_Smed_v4_2279_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007142Sperm surface protein Sp17SMESG000046919.1 dd_Smed_v4_4783_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30024673SMED30024673SMESG000067310.1 dd_Smed_v4_2088_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30034020Ninein-like proteinSMESG000041298.1 dd_Smed_v4_16759_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30023307TNF receptor-associated factor-2-like protein BSMESG000024592.1 SMESG000013347.1 dd_Smed_v4_1308_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30022249Clathrin interactor 1SMESG000032527.1 SMESG000022725.1 dd_Smed_v4_1563_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30025806Metabotropic glutamate receptorSMESG000033752.1 SMESG000033749.1 dd_Smed_v4_15419_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30022612Ester hydrolase C11orf54-like proteinSMESG000027576.1 SMESG000007855.1 dd_Smed_v4_1733_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30021019CYTOSOL_AP domain-containing proteinSMESG000037599.1 dd_Smed_v4_181_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30026042SMED30026042SMESG000034251.1 dd_Smed_v4_16722_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED3002420240S ribosomal protein S14SMESG000036550.1 dd_Smed_v4_139_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30031058Galanin receptor type 2SMESG000043375.1 SMESG000043376.1 dd_Smed_v4_18897_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED3002728060S acidic ribosomal protein P0SMESG000079482.1 dd_Smed_v4_161_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30027661PhosphodiesteraseSMESG000044149.1 dd_Smed_v4_15950_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30026519SMED30026519SMESG000064314.1 dd_Smed_v4_16650_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30021821Transient receptor potential cation channel subfamily M memberSMESG000078720.1 dd_Smed_v4_17981_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30032899Transient receptor potential cation channel,putativeSMESG000041546.1 dd_Smed_v4_17857_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30032899Transient receptor potential cation channel,putativeSMESG000041546.1 dd_Smed_v4_39557_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30030168Latent transforming growth factor beta binding protein 3SMESG000008188.1 dd_Smed_v4_1886_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30028921SMED30028921SMESG000024592.1 SMESG000013347.1 dd_Smed_v4_1308_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30020502SMED30020502SMESG000017789.1 dd_Smed_v4_13625_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30024880SMED30024880SMESG000024592.1 SMESG000013347.1 dd_Smed_v4_1308_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30031136Protein CBR-HHAT-1SMESG000001542.1 dd_Smed_v4_14970_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035432SMED30035432SMESG000044186.1 dd_Smed_v4_13633_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30024357Tissue factor pathway inhibitor 2SMESG000009888.1 dd_Smed_v4_2293_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30021870Potassium voltage-gated channel protein ShawSMESG000039493.1 dd_Smed_v4_14595_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30025454SMED30025454SMESG000057709.1 SMESG000057704.1 dd_Smed_v4_2169_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30025421exonuclease 1-likeSMESG000064333.1 dd_Smed_v4_14547_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30025874SMED30025874SMESG000014644.1 dd_Smed_v4_1924_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30034839SMED30034839SMESG000042050.1 dd_Smed_v4_14160_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30023897Deoxynucleoside triphosphate triphosphohydrolase SAMHD1SMESG000079585.1 SMESG000079583.1 dd_Smed_v4_17810_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30025517PhosphodiesteraseSMESG000044149.1 dd_Smed_v4_15950_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30031470FMRFamide-activated amiloride-sensitive sodium channelSMESG000016707.1 dd_Smed_v4_17431_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30026242Secretory carrier-associated membrane proteinSMESG000060788.1 dd_Smed_v4_1544_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30025608X1.A.G7.1SMESG000046817.1 SMESG000046814.1 dd_Smed_v4_1507_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30031869SMED30031869SMESG000055717.1 dd_Smed_v4_2079_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30025800ras-related protein Rab-24SMESG000031513.1 dd_Smed_v4_2486_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30026844Protein MAK16 homologSMESG000060104.1 dd_Smed_v4_1416_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30032806F5/8 type C domain-containing proteinSMESG000059878.1 dd_Smed_v4_1477_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035336LLGL scribble cell polarity complex component 2SMESG000018172.1 dd_Smed_v4_2164_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30030294SMED30030294SMESG000026870.1 dd_Smed_v4_2495_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30024943SMED30024943SMESG000064314.1 dd_Smed_v4_16650_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30034115tlxSMESG000017206.1 dd_Smed_v4_13781_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30023116Glycine receptor subunit alpha-3SMESG000037124.1 dd_Smed_v4_15331_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30033117ANK_REP_REGION domain-containing proteinSMESG000048145.1 dd_Smed_v4_16174_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30017663Fer-1-relatedSMESG000070967.1 dd_Smed_v4_4648_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000316Interferon-induced GTP-binding protein Mx1SMESG000002219.1 SMESG000002216.1 SMESG000002004.1 dd_Smed_v4_3169_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000316Interferon-induced GTP-binding protein Mx1SMESG000066856.1 SMESG000002221.1 SMESG000002213.1 dd_Smed_v4_5708_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015197SMED30015197SMESG000000489.1 dd_Smed_v4_2712_3_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30007408Peptidase S1 domain-containing proteinSMESG000055023.1 dd_Smed_v4_2492_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED3000170160S ribosomal protein L7aSMESG000020535.1 dd_Smed_v4_296_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30018300slc42a-2SMESG000005978.1 dd_Smed_v4_2323_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002777Serine/threonine-protein phosphatase 4 regulatory subunit 2SMESG000049039.1 dd_Smed_v4_7575_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30012267Kinesin-like proteinSMESG000073771.1 dd_Smed_v4_6755_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004809TNF receptor-associated factorSMESG000038724.1 dd_Smed_v4_7950_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30006233GTP-binding protein GEMSMESG000032890.1 dd_Smed_v4_11010_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001818TNF receptor associated factor 3SMESG000026104.1 dd_Smed_v4_9703_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30014682Group XV phospholipase A2SMESG000010284.1 dd_Smed_v4_3058_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30010523SMED30010523SMESG000077800.1 SMESG000054046.1 SMESG000052058.1 SMESG000044674.1 SMESG000066333.1 SMESG000052053.1 SMESG000052952.1 SMESG000080770.1 SMESG000065333.1 SMESG000063486.1 SMESG000059844.1 SMESG000058646.1 SMESG000055266.1 SMESG000054970.1 SMESG000052813.1 SMESG000043147.1 SMESG000037745.1 SMESG000037601.1 SMESG000036070.1 SMESG000034880.1 SMESG000034368.1 SMESG000031415.1 SMESG000019663.1 SMESG000010897.1 SMESG000009005.1 SMESG000006729.1 SMESG000005029.1 SMESG000003989.1 dd_Smed_v4_1760_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001380Zinc finger FYVE domain-containing proteinSMESG000014968.1 dd_Smed_v4_4344_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30006189SMED30006189SMESG000001434.1 dd_Smed_v4_16150_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30011674PapilinSMESG000003930.1 SMESG000003917.1 dd_Smed_v4_8833_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30010410SMED30010410SMESG000021757.1 dd_Smed_v4_8797_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED3001160940S ribosomal protein S3SMESG000016955.1 dd_Smed_v4_269_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30017369Disabled 2-interacting proteinSMESG000043888.1 dd_Smed_v4_3238_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED3000928360S ribosomal protein L18aSMESG000060163.1 dd_Smed_v4_437_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30008281GCR160SMESG000008854.1 dd_Smed_v4_13742_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30018477Myc box-dependent-interacting protein 1SMESG000021147.1 dd_Smed_v4_3292_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005675WASH complex subunit CCDC53SMESG000036694.1 dd_Smed_v4_3637_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30016017NeuroglianSMESG000005684.1 dd_Smed_v4_4031_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30018570Dynein intermediate chain 2, ciliarySMESG000023117.1 dd_Smed_v4_39721_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30018570Dynein intermediate chain 2, ciliarySMESG000023117.1 dd_Smed_v4_32427_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001214Squamous cell carcinoma antigen recognized by T-cells 3SMESG000008868.1 dd_Smed_v4_6820_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30016880Zinc finger Ran-binding domain-containing protein 2SMESG000017096.1 dd_Smed_v4_1397_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED3001360660S ribosomal protein L7SMESG000022296.1 dd_Smed_v4_276_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30016804neurexin-1 isoform X19SMESG000058569.1 dd_Smed_v4_13697_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019802SMED30019802SMESG000017096.1 dd_Smed_v4_1397_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30014610GCR149SMESG000009159.1 dd_Smed_v4_32664_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30016938SMED30016938SMESG000020498.1 dd_Smed_v4_16795_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30010461Dynamin-binding proteinSMESG000001434.1 dd_Smed_v4_16150_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30014820Centrosomal protein of 135 kDa (Cep135 protein) (Centrosomal protein 4), putativeSMESG000052451.1 dd_Smed_v4_11072_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000005SMED30000005SMESG000072036.1 dd_Smed_v4_13746_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000114Lariat debranching enzymeSMESG000024481.1 dd_Smed_v4_3274_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30016391Voltage-gated hydrogen channel 1SMESG000002770.1 dd_Smed_v4_16233_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30023872Zinc finger MYM-type protein 5SMESG000055398.1 dd_Smed_v4_11239_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30025287Protein unc-13SMESG000042667.1 SMESG000042664.1 SMESG000042670.1 dd_Smed_v4_11981_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30031317Secreted peptide prohormone 19SMESG000053016.1 SMESG000053015.1 dd_Smed_v4_1588_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30033014Phosphatidylinositol-4,5-bisphosphate 4-phosphataseSMESG000063221.1 dd_Smed_v4_1079_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30025135SMED30025135SMESG000042667.1 SMESG000042664.1 SMESG000042670.1 dd_Smed_v4_11981_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30033774CatalaseSMESG000055572.1 dd_Smed_v4_859_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30022453AquaporinSMESG000023352.1 dd_Smed_v4_1224_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30026769cAMP dependent protein kinase catalytic subunitSMESG000077092.1 dd_Smed_v4_15088_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30023043SMED30023043SMESG000019067.1 dd_Smed_v4_13671_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30023857Calpain 5aSMESG000009459.1 dd_Smed_v4_101944_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30033909UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 4SMESG000066601.1 dd_Smed_v4_12354_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30022748ETS domain-containing proteinSMESG000078333.1 dd_Smed_v4_11113_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30030594OpsinSMESG000074489.1 dd_Smed_v4_15036_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30031552SMED30031552SMESG000025950.1 dd_Smed_v4_1574_6_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30034292SMED30034292SMESG000076603.1 dd_Smed_v4_11476_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30031682Ras guanyl-releasing protein 3SMESG000035948.1 dd_Smed_v4_15742_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30031682Ras guanyl-releasing protein 3SMESG000035948.1 dd_Smed_v4_15742_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30022949SMED30022949SMESG000011995.1 dd_Smed_v4_1851_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30026015InnexinSMESG000068735.1 dd_Smed_v4_15435_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30029081CalmodulinSMESG000065184.1 dd_Smed_v4_16185_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30034379SMED30034379SMESG000002573.1 dd_Smed_v4_95036_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30024117SMED30024117SMESG000013212.1 dd_Smed_v4_16870_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30020318WD repeat-containing protein 49SMESG000041940.1 dd_Smed_v4_13248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035906Protein unc-13 homolog BSMESG000061526.1 dd_Smed_v4_11394_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30023661Reverse transcriptase domain-containing proteinSMESG000042224.1 dd_Smed_v4_11697_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035260SMED30035260SMESG000035564.1 dd_Smed_v4_12208_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30032426pou4l-1SMESG000013430.1 dd_Smed_v4_15555_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30025363SMED30025363SMESG000014711.1 dd_Smed_v4_1754_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30029053Protein chibby homolog 1SMESG000024740.1 dd_Smed_v4_12205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30025388Myosin heavy chainSMESG000013389.1 dd_Smed_v4_579_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30020109R3H domain containing-likeSMESG000044056.1 dd_Smed_v4_11014_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30033065InnexinSMESG000046667.1 dd_Smed_v4_11077_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30032420SMED30032420SMESG000050229.1 SMESG000050221.1 dd_Smed_v4_1219_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035408Zeb-1SMESG000013012.1 dd_Smed_v4_10038_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30034138Coiled-coil domain-containing protein 96SMESG000050787.1 dd_Smed_v4_11884_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30021628SMED30021628SMESG000068735.1 dd_Smed_v4_15435_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035333MFS transporterSMESG000061401.1 dd_Smed_v4_10656_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035307Forkhead box C1SMESG000015673.1 dd_Smed_v4_16297_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30021815SMED30021815SMESG000002058.1 dd_Smed_v4_18036_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035875Non-SMC condensin II complex subunit G2SMESG000024947.1 SMESG000024945.1 SMESG000024886.1 SMESG000024883.1 dd_Smed_v4_15610_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30020771SMED30020771SMESG000016758.1 dd_Smed_v4_11194_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002774SMED30002774SMESG000017229.1 dd_Smed_v4_613_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30018987SMED30018987SMESG000076175.1 dd_Smed_v4_11221_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30017299Protein kinase C beta typeSMESG000053142.1 dd_Smed_v4_12946_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30010054ADP-ribose pyrophosphatase, mitochondrialSMESG000042492.1 dd_Smed_v4_1143_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30017193Protocadherin 1SMESG000010555.1 dd_Smed_v4_12697_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019993SMED30019993SMESG000051649.1 dd_Smed_v4_1687_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30006022Epidermal growth factor-8SMESG000077703.1 dd_Smed_v4_5019_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30010061APOBEC1 complementation factorSMESG000032489.1 dd_Smed_v4_2228_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30011384protein phosphatase 1 regulatory subunit 12C isoform X12SMESG000010821.1 dd_Smed_v4_8624_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009446glutathione hydrolase 1 proenzymeSMESG000000747.1 dd_Smed_v4_7401_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30016022SMED30016022SMESG000053405.1 dd_Smed_v4_3318_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30018395WD_REPEATS_REGION domain-containing proteinSMESG000032761.1 dd_Smed_v4_10217_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002944GGACT domain-containing proteinSMESG000081395.1 dd_Smed_v4_8685_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30010251Neurogenic differentiation factorSMESG000066244.1 dd_Smed_v4_21717_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000342SMED30000342SMESG000047115.1 SMESG000004000.1 dd_Smed_v4_2558_0_2dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30018165SMED30018165SMESG000008712.1 dd_Smed_v4_13053_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002009Regulator of G-protein signalingSMESG000048981.1 dd_Smed_v4_8648_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30002327Tectonin beta-propeller repeat containing 2SMESG000064457.1 SMESG000064450.1 dd_Smed_v4_5998_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30012709SMED30012709SMESG000030742.1 dd_Smed_v4_1138_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30005459SMED30005459SMESG000014884.1 dd_Smed_v4_2661_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30006482SMED30006482SMESG000055742.1 dd_Smed_v4_63060_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30016015Cilia and flagella associated protein 157SMESG000020913.1 dd_Smed_v4_11523_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30016440SMED30016440SMESG000079970.1 dd_Smed_v4_10005_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30000256Golgin subfamily A member 2SMESG000047115.1 SMESG000004000.1 dd_Smed_v4_2558_0_2dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001024SMED30001024SMESG000079945.1 dd_Smed_v4_9265_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30014320Four and A half lim domainsSMESG000037769.1 dd_Smed_v4_5037_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30010913Protein kinase domain-containing proteinSMESG000056716.1 dd_Smed_v4_8986_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30018641SMED30018641SMESG000034073.1 dd_Smed_v4_15772_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009148acid-sensing ion channel 5SMESG000028094.1 dd_Smed_v4_13943_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004383SMED30004383SMESG000026569.1 dd_Smed_v4_1955_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015748SMED30015748SMESG000036160.1 dd_Smed_v4_14291_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004593SMED30004593SMESG000009948.1 dd_Smed_v4_19022_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30004593SMED30004593 dd_Smed_v4_15248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30006773Calpain-BSMESG000039299.1 dd_Smed_v4_1752_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED3001238340S ribosomal protein SASMESG000071180.1 dd_Smed_v4_171_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30017158Dynein heavy chainSMESG000073407.1 dd_Smed_v4_8201_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001495Ribosomal protein L15SMESG000056940.1 dd_Smed_v4_193_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001567SMED30001567SMESG000022139.1 dd_Smed_v4_715_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30001687SMED30001687SMESG000043798.1 dd_Smed_v4_1857_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019734Neur_chan_LBD domain-containing proteinSMESG000064435.1 dd_Smed_v4_17839_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30006132PHB domain-containing proteinSMESG000048102.1 dd_Smed_v4_16206_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30015725SMED30015725SMESG000034073.1 dd_Smed_v4_15772_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30028497AdenosylhomocysteinaseSMESG000012954.1 SMESG000012950.1 dd_Smed_v4_526_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30026777Exonuclease 3'-5' domain-containing protein 1SMESG000036160.1 dd_Smed_v4_14291_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30026097Phosducin like 3SMESG000022403.1 SMESG000022402.1 dd_Smed_v4_1472_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30028011Polypeptide N-acetylgalactosaminyltransferaseSMESG000070134.1 dd_Smed_v4_5242_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30034259Indoleamine 2,3-dioxygenase 1SMESG000058473.1 dd_Smed_v4_13826_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30034888Dynein heavy chain 5, axonemalSMESG000049144.1 dd_Smed_v4_4569_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30026430WD_REPEATS_REGION domain-containing proteinSMESG000018097.1 dd_Smed_v4_74366_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30029796SMED30029796SMESG000056350.1 dd_Smed_v4_6674_0_2dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30025924SMED30025924SMESG000035449.1 dd_Smed_v4_14944_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30029961SMED30029961SMESG000060288.1 dd_Smed_v4_19513_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30032014GCR320SMESG000028490.1 dd_Smed_v4_17008_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30021971SMED30021971SMESG000001202.1 dd_Smed_v4_14508_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30033431Protocadherin-11 X-linkedSMESG000072628.1 dd_Smed_v4_17019_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30030117Neur_chan_LBD domain-containing proteinSMESG000066647.1 dd_Smed_v4_14925_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30030281BHLH domain-containing proteinSMESG000019783.1 SMESG000019789.1 dd_Smed_v4_4438_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30029432SMED30029432SMESG000057599.1 dd_Smed_v4_533_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30029432SMED30029432SMESG000057599.1 dd_Smed_v4_450_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30029432SMED30029432SMESG000057599.1 dd_Smed_v4_635_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30033164Heat shock 70 kDa proteinSMESG000041117.1 dd_Smed_v4_1378_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035396SMED30035396SMESG000003693.1 dd_Smed_v4_58098_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30033835synaptotagmin-14 isoform X1SMESG000070077.1 dd_Smed_v4_8785_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30025883Forkhead associated phosphopeptide binding domain 1SMESG000071072.1 dd_Smed_v4_14350_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30031461Phosphatidylinositol 4-phosphate 5-kinase 2SMESG000012434.1 dd_Smed_v4_9195_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30031080KH domain-containing proteinSMESG000004103.1 dd_Smed_v4_1578_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30034688SMED30034688SMESG000043655.1 SMESG000043653.1 dd_Smed_v4_8062_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30027121SMED30027121SMESG000068489.1 dd_Smed_v4_9079_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30032297BTB domain-containing proteinSMESG000017289.1 SMESG000017288.1 dd_Smed_v4_8895_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30023628Heat shock factor-binding proteinSMESG000032253.1 dd_Smed_v4_15016_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30029814slc17a-3SMESG000066847.1 dd_Smed_v4_1874_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30028698LITAF domain-containing proteinSMESG000020869.1 dd_Smed_v4_5171_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30032346Tetratricopeptide repeat protein 27SMESG000020023.1 dd_Smed_v4_6638_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30034987Low density lipoprotein-receptor, class A,domain-containing proteinSMESG000059509.1 dd_Smed_v4_6710_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30033279slc39a-4SMESG000026205.1 dd_Smed_v4_6113_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30030133RNA binding protein fox-1 homolog 1SMESG000019470.1 dd_Smed_v4_6567_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30028328Protocadherin alpha-2SMESG000069340.1 dd_Smed_v4_14209_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30026279FumarylacetoacetaseSMESG000049554.1 dd_Smed_v4_916_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30027364Epidermal growth factor Smed-egf-6SMESG000029319.1 dd_Smed_v4_6222_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30028597GTPase activator proteinSMESG000018097.1 dd_Smed_v4_74366_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED3003147314-3-3 protein epsilonSMESG000044296.1 dd_Smed_v4_7107_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035033SMED30035033SMESG000056350.1 dd_Smed_v4_6674_0_2dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30024383Transmembrane protein 26SMESG000079787.1 dd_Smed_v4_15637_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30034156Peptidase S1 domain-containing proteinSMESG000012752.1 dd_Smed_v4_7481_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30032798SMED30032798SMESG000013320.1 SMESG000013316.1 dd_Smed_v4_9011_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30032478SMED30032478SMESG000065350.1 SMESG000058681.1 SMESG000023666.1 dd_Smed_v4_9347_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30026527Serine palmitoyltransferase 2SMESG000011189.1 dd_Smed_v4_4337_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30031868HTH_Tnp_Tc3_2 domain-containing proteinSMESG000047299.1 dd_Smed_v4_9253_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30034753NmrA domain-containing proteinSMESG000006969.1 dd_Smed_v4_8623_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30027937SMED30027937SMESG000004925.1 dd_Smed_v4_8053_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30029235carbamoyl-phosphate synthase [ammonia], mitochondrial-likeSMESG000066808.1 dd_Smed_v4_4349_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035947Rab9A proteinSMESG000057972.1 dd_Smed_v4_6588_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30031120SMED30031120SMESG000036622.1 dd_Smed_v4_9680_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30030202BAR domain-containing proteinSMESG000043769.1 dd_Smed_v4_5879_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30033010DAB adaptor protein 1bSMESG000022403.1 SMESG000022402.1 dd_Smed_v4_1472_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30029668Adenylate kinase isoenzyme 5SMESG000020486.1 SMESG000020480.1 dd_Smed_v4_5119_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30025832SMED30025832SMESG000001878.1 dd_Smed_v4_714_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED300333781-acyl-sn-glycerol-3-phosphate acyltransferase deltaSMESG000046088.1 dd_Smed_v4_9745_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30032627Protocadherin gammaSMESG000020970.1 dd_Smed_v4_15362_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30011528PDZ and LIM domain proteinSMESG000015397.1 dd_Smed_v4_4618_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009016SSRP1SMESG000049360.1 dd_Smed_v4_3904_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30012713Peptidase S1 domain-containing proteinSMESG000025209.1 dd_Smed_v4_198_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30014305Tubulin alpha chainSMESG000009951.1 dd_Smed_v4_10947_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30014097Cytochrome P450 2K1-like proteinSMESG000034110.1 dd_Smed_v4_3919_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30019784Oxalate:formate antiporterSMESG000069668.1 dd_Smed_v4_10829_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30013366Sodium/potassium-transporting ATPase subunit alphaSMESG000078146.1 dd_Smed_v4_2828_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30014938SMED30014938SMESG000052729.1 dd_Smed_v4_10341_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30012966SMED30012966SMESG000052698.1 SMESG000027142.1 SMESG000059994.1 dd_Smed_v4_1029_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30012966SMED30012966SMESG000079607.1 SMESG000072955.1 SMESG000049847.1 SMESG000049844.1 SMESG000049832.1 SMESG000049812.1 SMESG000049806.1 SMESG000049805.1 SMESG000049772.1 SMESG000049767.1 SMESG000049756.1 SMESG000049745.1 SMESG000049740.1 SMESG000049739.1 SMESG000049695.1 SMESG000049688.1 SMESG000049683.1 SMESG000049676.1 SMESG000049665.1 SMESG000049663.1 SMESG000049647.1 SMESG000049621.1 SMESG000049614.1