gamma neoblast

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ In Situ Hybridization Data

  ▻ Sequences

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  gamma neoblast


DEFINITON:

  An abundant neoblast subclass, exhibiting enriched expression of gata456a, hnf4, prox-1 and nkx2.2, implicated in maintenance and regeneration of the definitive gut.


TERM DEFINITION CITATIONS:

  PMID:25017721


TERM CITATIONS:


TERM ID:

  PLANA:0000039


ABOUT THIS TERM:

gamma neoblast

  ↳is a neoblast

  ↳part of digestive system


Expand to see terms that develops from gamma neoblast


BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30007290AFF18488.1GATA456gata456aStage 2, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, gut, digestive system, gamma neoblast, embryonic pharynx
SMED30005748AFF18489.1HNF4hnf-4Stage 2, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, gut, digestive system, gamma neoblast, embryonic pharynx
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30005748 ID=SMED30005748|Name=HNF4|organism=Schmidtea mediterranea sexual|type=transcript|length=3066bp
GAAGAATAACAAAGAAATTTATTGCCAAACTAAAATACCCGGCCTATTTCATCAAAAAAAAAACAATCAAAAACACAAAT
CGCTACGAAAACTTGTATAAAAGATTCACATTAAAAGTCATCAATATTCCTCTTTTTTAAAGACTGATGATTCAGATTCT
TGGATCCGAATGGGGTGATCTGTTAGGAAGTGAGCTGTTGACGAGATAGCTGAATAGTTTGATCTGGAATTGTGCTGTTG
GTTCGCTTCCGATGATCTGTTGGCGATTGATTGAATTTGGCAGTTTTCTATCGGCGAGTTTGGAAGCGACTTGGTATAGG
CCACAAGAAGCGACGGATCAACGACATTTTGAGTGGAATTCACAGAAAGAGCTGGGTGGATTAGGTCATCTGAATTGGAA
GAATTTGAGCAGTTATGATTTGCGTCACTGTTATAGGCGTATTTTGACTGGTTGATCATGGGGAACCCTTGATCAAGGTT
GACCAAGAAATGGCTGGTATCCTGTGATAAATTGGAATGCTGATAAAGATTGATGGAATCATTGACGCATGAAAACAGAG
AAGGAACGCCGACTCTTTCATTTTTCAGCATCATCCCATCGCTGTTGATTATCATACCGAAGTTGCTATTGTCCTGGGAA
TTTTGCTGCATTATTTCAGTTCCTTGATTAACAAAAGCTCGATATATATTTCCTGAAGGCATCGACGTAGAACTTGGCAA
ATATGCACTCCATATTTTTGAGGCCGCTTCAGGTGATATGTTTTGGTTGTTGATATTGAGTAGGACACTGTCTGGCATGA
AAGGGGGAATTCCGTAGCAGTCCTGGTAAGTATATTTCGGTGAGGAAATCCTGTGGGAGTTAATTATATCCATGGAATCG
TTTTGATTATTGTTATTGTTCCCATCTGTTTCTGGATCTATGCTGAATACCCCTGGTGGATTGTCACCCAATAATGTTTC
AGATAACAAGCTATCAATCTCGGCTAATCCTGTCATTTTCATGAACTCGACCTTCTTTACCATCAGCTGGGTGACCAATC
TCAGATCAGGAATTGTCAGCAGCAATTCCCCGAATCTACCCGGCTTGTGGTATTGCTTGTCATTCATGTGGTTCATCAGG
TCCATTTGTATTTGGTATCGGCATCGTCTCACGAACTCCTTGCCAGACTCGCTGACTCTCGGATCAAAAAATACGATCGC
TTTCAAACAAGCGAATTCTGCGTCATCCAATTGCAATTCTCGCAGCGGAATGAACAGGTCGTCAAGGATGTGACTGGCTA
TTTCAGCGAAATGTTTGTCACTGGAGTTCCTACTGATGATAAGATTGTTTCCCAATAATAGCACATCGTCTTCGTCCAAT
TGAAACGACCGCCTTATTACTCCAAGAATTAGAATTTCTCCCGCGTGTGCTTTTAAAAGGGAAATTTGATCGCTCAAGTT
TAACTGTGAAAAACAAGGCAAAGACTTTGCCCAATTCACTAGAAGAAATAACTGATTTTTCATGGACTCGCAAACATCAG
GCACATCGGCATATCTGTTCATGTATTCCTGAGGATTCGGGGGCTTTTGTATTGCAACCCTTTGCTCGGCCTGCATCAAC
TGAGAAATGGAGAGAATGACATTCGGAGGAATATCATCAAACGACGATCTTCGAGTACTGATCCTATCTCGTTCATTTTG
AACCGCTGCTCGCTTCATTCCTACAAGAATGCATTTCTTTAGCCGACAATAACGGCATTGGTTTCGTTTATCCTTGTCCA
TTTTACAATTCCGATTGTACTGGCAAGTGTAGTTATTCTTCTTCCTCACTGACCTCCGAAAAAATCCTTTACAACCGTCA
CACGAGAAAGCCCCATAATGTTTTCCTGTAGCTTTGTCACTGCAAATGAGACAGAGTTGATTGTTTTCCATTCCTTCTGG
TCCCGACGCGTTAGACGCATAGACTTCATGTTGTTGCGAGGACACTGAAACGAAAACTATTTGATAATATTTGTACAAAA
CAACTGACAGATGGTTTCGGAAAAGGTTCAATGTTCAGCCATAGTTCAGCGAAAGGTCAAATTCCTGAACTACTATTTCA
AGGTATAAATTTGAATATATTGGTTTTGCCTCGTGCTAACAAAGTCCAGAAATATAATAAGCAAAGTCTGAATCGTGTAC
TTTGGATTTCTAGCCAGGGGCACACAATAACCTATATTTAATAGCAGTTCATTGCGTTCACTCGTTATTTCTCCGACTGA
ACTGCATTGCAGGAGGATCCGCAACCATGGAGATTTCATAATTATTATCAAAATGATAATAATAATAATTATTATGAGGT
ATTGTAAAAGAAAACGTAACTCACTTTCACTTTCCAATGGATATTGCATCGAGGAAGCGTTGCTGGAAATGGAAATCGGA
GCTGAATTGCTAGTCAATAGTTGATAGGAGAATGCTGGATTGAGGTTCGGATGCTGGGTAGACGTCATATAGAATTGGCT
CGACGGATTCGGTAAAATTATGGTGAAGTTTACAATCGAAGCTCAGATATAACGTATTATAATGAAGTATTATTAATAAA
CTGCAAGTAACGTGCGCGCATTCTGAAGTGGTTGATTGAGAATAATCAGTTCTTATTCGACAAATTCAGATAAAAAAGGC
ACCACTCGAATTGTTCAGCTGCGTCATGTGAATGCCGGAACGTTGTGCGTTGGCTGTTGGCAGATCAGCGCTCCGTGTTC
ACTGCAATCCGGATACACCAGACCACTTGAAATCGTTGCGAATTCAGCGTGTCGAGTGCATTGTGCGAGATCAGTATCGG
TGTGTATGTGTGTCTGCCTGTGTGCGTGTGGATGTGTGTGCTTGTCGAGTCGGTTGTGTGTTTATGAGTGTAACTGTGTC
GATTTGGTCGAATGCAGTAGCAGATAGCTGAAATGCGATTGTTCCTATTTTTCATTTAATATTGTTTTATGTTTTGTTTC
TATTTTTATAATTTAATTTATCAGTTTTTGTTTAGATTATGCAATCATTGTTTAATTTATTTTTGTCAATTTAAAATTTA
TTATTAATTAAATTATTATAATTATT
>SMED30007290 ID=SMED30007290|Name=GATA456|organism=Schmidtea mediterranea sexual|type=transcript|length=2033bp
AGGTAAGTGTCGTCATCACAAGTGGCTTTATTATTATCATTTAAATTTTTTATCATATTATCATTGATTGCTTGTTTTCC
TCATTCAAAATTTAACTGATTGTTATCAAGCTCATTTGATAACTCCAAATCTAATTGACACTCATGTAAATATCCCATTC
GAATTTCCGTTCCCGTCCGTAAGATCCACGATCCGACAATGTTTCTCCCATCGGTATTGTCGAATTCTCACCAGAGAAAC
TCACCAATAATGGACATTGTATCACCAAAATCCAACACCAGCAATCTGAATGCGTTGATCACGTATTCGAATTGTCCCAA
CATAGATCTACAGTCGAATGATCTGTCAGTGAACTTGACGAATTCTCAAAACTTCCACGAATTGGATCACAAAACCAATT
ACGGATACAAAGTTTCAAACAACGAGACAAAACTGAATGCTTTTCCATATTTAGCTCAATCGAACTTAACAGATTGCACA
ACAGACATCAGTGGAGATCTGAAAAATCCAAATTCACATCTCAACTATGGAAACGGAATTTCGTTCTCGGAATTTTCGAA
AATGTCCGAAACCAACATCCACGGATATCCGCCATATTGTTTCTCCACTAAACTGTTTCCCATTCCAAATCTACAAGAGA
AATCAATTATCAACGACAACTATTCCGTGAAATCCACCGCCGGAGGCTTTATCACCGAATCGAATGAGCATCAAAACTCT
GTAAATACTGGAAATTCCTACAATTCCAATTTAAGCTCATACAGAACGGTAATTCCCGCTCATTTTCATCTCTTCAATCA
GAATTCACCAGAATCGAACTCGTTTTACAATACGGCTTGGAACAACTATCCGTTTCAAATATCCCCAACTTATCCCATAC
AAAATCTACCGGATTCAACAATCAACTGGACAACAAACAATCAAATTCCAAGCAGCAATTTAGTTTTTGATCCCTGGAGC
TGTAAATCAAATCTTAATCTTCCTCCGATTAATGAATTCGGTTCCAATTGCGATGTCAGCAGAGAGTGTGTGAACTGTGG
AGCTAGCAATACTCAGTTGTGGTCCCGGGATAATTCTGGCTATTATTTGTGTGATGAATGCGACAGGTTCTCTCAAAACA
ACAGTAGAAACCTCGAAAAACTACCAACGAATCAAGTCTCATCAAGTACCGAAAATGAGTTCATGAAAAAATCCAATGCC
AACTTTCAACAATATGGAAAAAGATCCGACCTCGAATGCAGCAATTGTAAAATTACCAAGACTTCTTTATGGAGAAGAAA
CAACGAAGGAGAACCTGTCTGCAATGCTTGCGGCTTGTATTATAAATTACATAAGTCTCTAAGACCTCTTTCAATGAGGA
AAGAAGGAATACAAACAAGGAAAAGAAAACGGAAAACACAAATGAAACCGGTTTCCACTCATATTGCCAATAATCAAAAG
GTGCCGTCTTCAGAATCGTCATCAGAACAAAATCAGTTTATAAACACTGTGAAATCAAGTGAAAATTGCTATAACATGAT
TTCTGAAAATTCTCCAACATATATGCCAAATATATCAGTCCAGCCCTTCAATCACATTCTGAACTCCAGCCAATATCAAT
TCCAATCTACAGAAAATCCCATTAATCAATCATATTTAAATTCCTCAATCAAAAACAGCAATCCCTTTTACGATTCCGAA
AGTATACTTTATTCCTACAACAATTCAAACAAAATCAAAGATGAGCCCCTATTATCCATGGACAACGAACCGAAGCCCTA
TTCCTCAATCAACGAGAAAATTGACGTCAACTCCATAGTGAGAATTAATGAAATCTCAAACAATTCGAATTCGAGTTAAT
TATTCTGATCTACTTTTTAATTATATATTTAAGAACCGTATATACTTCGAAATATAATTTTAATGATAAAATTTTATATC
TAAAAAATGTAATTTTTAAGTGCGAATTATTAAGTATGCATTTAAATAGTGCAATTATTGTGGTAGTTATTTTTATTACT
AAATAAATGTTGTTTGTAAATTCGAGAATTTGT

 

back to top



PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in gamma neoblast. Click this link to learn more about PAGE.


PAGE Curations: 155


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
gamma neoblastSMED30026979ribosomal protein S11 dd_Smed_v6_227_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30013549Calponin-homology CH domain-containing protein dd_Smed_v6_6577_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30001039ribosomal protein S7 dd_Smed_v6_204_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30021508glutamate dehydrogenase 1 dd_Smed_v6_932_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30002703ribosomal protein L23a dd_Smed_v6_281_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30012386glycogen phosphorylase B dd_Smed_v6_1532_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30013549Tubulin alpha chain dd_Smed_v6_6577_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30009052ribosomal protein L18 dd_Smed_v6_128_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30027299PBX homeobox 3 dd_Smed_v6_3098_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30021667receptor for activated C kinase 1 dd_Smed_v6_174_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30010163Tubulin alpha chain dd_Smed_v6_6577_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30021022Calponin-homology CH domain-containing protein dd_Smed_v6_6577_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30025338E3 ubiquitin-protein ligase CBL-B dd_Smed_v6_330_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30022209ATPase family AAA domain containing 3A dd_Smed_v6_1807_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30003912aldehyde dehydrogenase 1 family member A1 dd_Smed_v6_400_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30024839ATP synthase peripheral stalk-membrane subunit b dd_Smed_v6_905_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30003176ribosomal protein S2 dd_Smed_v6_226_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30023308SCP domain-containing protein dd_Smed_v6_762_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30001495ribosomal protein L15 dd_Smed_v6_193_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30005190ribosomal protein S15a dd_Smed_v6_237_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30006638Tu translation elongation factor, mitochondrial dd_Smed_v6_818_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30022078tumor protein, translationally-controlled 1 dd_Smed_v6_136_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30019834receptor for activated C kinase 1 dd_Smed_v6_174_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30029147ribosomal protein S7 dd_Smed_v6_204_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30029147anorexia; transcript_id=FBtr0091702 dd_Smed_v6_204_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30007704actin dd_Smed_v6_3_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30025467TNF receptor associated protein 1 dd_Smed_v6_1445_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30009052ribosomal protein L18 dd_Smed_v6_128_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30018944 dd_Smed_v6_592_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30022855 dd_Smed_v6_691_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30000702 dd_Smed_v6_344_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30013571 dd_Smed_v6_344_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30019959 dd_Smed_v6_344_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30019959 dd_Smed_v6_292_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30005334 dd_Smed_v6_344_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30004246 dd_Smed_v6_344_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30008414 dd_Smed_v6_289_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30026531 dd_Smed_v6_297_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30003686 dd_Smed_v6_505_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30015310 dd_Smed_v6_54_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30019189 dd_Smed_v6_140_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30012421 dd_Smed_v6_140_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30024160 dd_Smed_v6_142_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30018504 dd_Smed_v6_111_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30036013 dd_Smed_v6_123_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30023413 dd_Smed_v6_134_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30023889 dd_Smed_v6_857_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30004214 dd_Smed_v6_857_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30004214 dd_Smed_v6_909_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30010253 dd_Smed_v6_957_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30033740 dd_Smed_v6_957_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30001799 dd_Smed_v6_957_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30010375 dd_Smed_v6_753_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30014560 dd_Smed_v6_858_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30019702 dd_Smed_v6_661_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30022975caudal type homeobox 4 SMED30022975smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30028798h1SMcT0009294.1 SMED30028798smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30022596Uncharacterized protein SMED30022596smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30027929tubulin beta 4B class IVb SMED30016265smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30027929tubulin beta 4B class IVb SMED30027929smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30023874ABHD14A-ACY1 readthrough SMED30023874smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30028938protein disulfide isomerase family A member 6 SMED30017430smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30028938protein disulfide isomerase family A member 6 SMED30028938smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30011793Homeobox protein DTH-1 SMED30011793smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30007290Transcription factor GATA-4 SMED30007290smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30004081Derived by automated computational analysis using gene prediction method Gnomon SMED30004081smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30021063ciboulot SMED30021063smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30004939Uncharacterized protein SMED30004939smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30005571aldehyde dehydrogenase 18 family member A1 SMED30005571smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30016265tubulin beta 4B class IVb SMED30016265smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30016265tubulin beta 4B class IVb SMED30027929smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30007346Achaete-scute homolog 4 SMED30007346smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30005748Derived by automated computational analysis using gene prediction method Gnomon SMED30005748smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30034629SCP domain-containing protein SMED30034629smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30023308SCP domain-containing protein SMED30034629smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30007599 SMED30032778smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30032778 SMED30032778smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30017430 SMED30017430smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30019234 SMED30019234smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30030204 SMED30030204smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30007290Transcription factor GATA-4 JF802198.1smed_ncbi_20240424PMID:30194301
Mihaylova et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
gamma neoblastSMED30007290Transcription factor GATA-4 SMED30007290smed_20140614PMID:30194301
Mihaylova et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
gamma neoblastSMED30005748Derived by automated computational analysis using gene prediction method Gnomon JF802199.1smed_ncbi_20240424PMID:30194301
Mihaylova et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
gamma neoblastSMED30005748Derived by automated computational analysis using gene prediction method Gnomon SMED30005748smed_20140614PMID:30194301
Mihaylova et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
gamma neoblastSMED30007290Transcription factor GATA-4 AFF18488.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 5 fluorescence in situ hybridization evidence
gamma neoblastSMED30007290Transcription factor GATA-4 JF802198.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 5 fluorescence in situ hybridization evidence
gamma neoblastSMED30007290Transcription factor GATA-4 SMED30007290smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 5 fluorescence in situ hybridization evidence
gamma neoblastSMED30025778Transcription factor SOX-2 SMED30025778smed_20140614PMID:25017721
van Wolfswinkel et al., 2014
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30011793Homeobox protein DTH-1 SMED30011793smed_20140614PMID:25017721
van Wolfswinkel et al., 2014
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30007290Transcription factor GATA-4 JF802198smed_ncbi_20240424PMID:25017721
van Wolfswinkel et al., 2014
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30023483Innexin 5 JQ425145smed_ncbi_20240424PMID:25017721
van Wolfswinkel et al., 2014
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30009204Fibroblast growth factor receptor 1 JQ425159.1smed_ncbi_20240424PMID:25017721
van Wolfswinkel et al., 2014
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30005748Derived by automated computational analysis using gene prediction method Gnomon JF802199.1smed_ncbi_20240424PMID:25017721
van Wolfswinkel et al., 2014
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30016901Homeobox protein prospero homolog 1 JQ425149.1smed_ncbi_20240424PMID:25017721
van Wolfswinkel et al., 2014
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30005950transcriptional adapter 3 JQ425157.1smed_ncbi_20240424PMID:25017721
van Wolfswinkel et al., 2014
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30005950nemo like kinase JQ425157.1smed_ncbi_20240424PMID:25017721
van Wolfswinkel et al., 2014
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30035424nemo like kinase JQ425157.1smed_ncbi_20240424PMID:25017721
van Wolfswinkel et al., 2014
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30035063Transcription factor Sox-7 JQ425152smed_ncbi_20240424PMID:25017721
van Wolfswinkel et al., 2014
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30027299PBX homeobox 3 KC353351.1smed_ncbi_20240424PMID:25017721
van Wolfswinkel et al., 2014
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30019390Kelch domain-containing protein 9 JQ425152smed_ncbi_20240424PMID:25017721
van Wolfswinkel et al., 2014
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30007744 JQ278719.1smed_ncbi_20240424PMID:25017721
van Wolfswinkel et al., 2014
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30007290Transcription factor GATA-4 dd_Smed_v6_4075_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30000639Calponin-homology CH domain-containing protein dd_Smed_v6_6577_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30003249prohibitin dd_Smed_v6_1038_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30000639Tubulin alpha chain dd_Smed_v6_6577_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30004081Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v6_1144_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30021063ciboulot dd_Smed_v6_17_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30021513ribosomal protein S9 dd_Smed_v6_92_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30030013RAN, member RAS oncogene family dd_Smed_v6_330_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30025522heat shock protein family D (Hsp60) member 1 dd_Smed_v6_141_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30034629SCP domain-containing protein dd_Smed_v6_762_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30000040aldehyde dehydrogenase 1 family member A1 dd_Smed_v6_400_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30030234tubulin alpha chain dd_Smed_v6_648_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30030766RNA binding motif protein 3 dd_Smed_v6_52_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30011550ribosomal protein S10 dd_Smed_v6_117_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30011420CUGBP Elav-like family member 4 dd_Smed_v6_11349_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30033949protein disulfide isomerase family A member 5 dd_Smed_v6_1537_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30034375Tubulin alpha chain dd_Smed_v6_6577_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30032456aldehyde dehydrogenase 1 family member A1 dd_Smed_v6_400_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30013161golgin A6 family like 1 dd_Smed_v6_2630_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30020124h1SMcT0007689.2 dd_Smed_v6_2458_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30031980ribosomal protein S10 dd_Smed_v6_117_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30034152ribosomal protein L11 dd_Smed_v6_144_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30008769ribosomal protein S10 dd_Smed_v6_117_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30035571protein disulfide isomerase family A member 5 dd_Smed_v6_1537_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30023341exocyst complex component 1 dd_Smed_v6_6427_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30016163ribosomal protein L27a dd_Smed_v6_155_1dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30008509DNA topoisomerase III alpha dd_Smed_v6_20479_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30034070Calponin-homology CH domain-containing protein dd_Smed_v6_6577_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30034070Tubulin alpha chain dd_Smed_v6_6577_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30001096ribosomal protein S23 dd_Smed_v6_290_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30031235tubulin alpha chain dd_Smed_v6_648_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30020431COP9 signalosome subunit 4 dd_Smed_v6_4122_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30034375Calponin-homology CH domain-containing protein dd_Smed_v6_6577_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30034943HPS1 biogenesis of lysosomal organelles complex 3 subunit 1 dd_Smed_v6_9781_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30009283ribosomal protein L18a dd_Smed_v6_437_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30014945DNA topoisomerase III alpha dd_Smed_v6_20479_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30030431small nuclear ribonucleoprotein U1 subunit 70 dd_Smed_v6_633_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30030435serine and arginine rich splicing factor 5 dd_Smed_v6_3431_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30001039anorexia; transcript_id=FBtr0091702 dd_Smed_v6_204_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30021022Tubulin alpha chain dd_Smed_v6_6577_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30006461Tubulin alpha chain dd_Smed_v6_6577_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30015534ribosomal protein L21 dd_Smed_v6_189_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30004484ribosomal protein L8 dd_Smed_v6_108_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30013018ribosomal protein S6 dd_Smed_v6_178_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30014493ribosomal protein L5 dd_Smed_v6_151_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30017114eukaryotic translation elongation factor 1 gamma dd_Smed_v6_308_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30008910ribosomal protein S4 X-linked dd_Smed_v6_82_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30006461Calponin-homology CH domain-containing protein dd_Smed_v6_6577_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30010163Calponin-homology CH domain-containing protein dd_Smed_v6_6577_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30022575pescadillo ribosomal biogenesis factor 1 dd_Smed_v6_900_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30021386RNA binding motif protein 3 dd_Smed_v6_52_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30014769hydroxyacyl-CoA dehydrogenase dd_Smed_v6_725_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30006216ribosomal protein S8 dd_Smed_v6_156_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30012383ribosomal protein SA dd_Smed_v6_171_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Note: Hover over icons to view figure legend

 

 

back to top