gamma neoblast

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ In Situ Hybridization Data

  ▻ Sequences

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  gamma neoblast


DEFINITON:

  An abundant neoblast subclass, exhibiting enriched expression of gata456a, hnf4, prox-1 and nkx2.2, implicated in maintenance and regeneration of the definitive gut.


TERM DEFINITION CITATIONS:

  PMID:25017721


TERM CITATIONS:


TERM ID:

  PLANA:0000039


ABOUT THIS TERM:

gamma neoblast

  ↳is a neoblast

  ↳part of digestive system


Expand to see terms that develops from gamma neoblast


BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30007290AFF18488.1GATA456gata456aStage 2, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, gut, digestive system, gamma neoblast, embryonic pharynx
SMED30005748AFF18489.1HNF4hnf-4Stage 2, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, gut, digestive system, gamma neoblast, embryonic pharynx
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30005748 ID=SMED30005748|Name=HNF4|organism=Schmidtea mediterranea sexual|type=transcript|length=3066bp
GAAGAATAACAAAGAAATTTATTGCCAAACTAAAATACCCGGCCTATTTCATCAAAAAAAAAACAATCAAAAACACAAAT
CGCTACGAAAACTTGTATAAAAGATTCACATTAAAAGTCATCAATATTCCTCTTTTTTAAAGACTGATGATTCAGATTCT
TGGATCCGAATGGGGTGATCTGTTAGGAAGTGAGCTGTTGACGAGATAGCTGAATAGTTTGATCTGGAATTGTGCTGTTG
GTTCGCTTCCGATGATCTGTTGGCGATTGATTGAATTTGGCAGTTTTCTATCGGCGAGTTTGGAAGCGACTTGGTATAGG
CCACAAGAAGCGACGGATCAACGACATTTTGAGTGGAATTCACAGAAAGAGCTGGGTGGATTAGGTCATCTGAATTGGAA
GAATTTGAGCAGTTATGATTTGCGTCACTGTTATAGGCGTATTTTGACTGGTTGATCATGGGGAACCCTTGATCAAGGTT
GACCAAGAAATGGCTGGTATCCTGTGATAAATTGGAATGCTGATAAAGATTGATGGAATCATTGACGCATGAAAACAGAG
AAGGAACGCCGACTCTTTCATTTTTCAGCATCATCCCATCGCTGTTGATTATCATACCGAAGTTGCTATTGTCCTGGGAA
TTTTGCTGCATTATTTCAGTTCCTTGATTAACAAAAGCTCGATATATATTTCCTGAAGGCATCGACGTAGAACTTGGCAA
ATATGCACTCCATATTTTTGAGGCCGCTTCAGGTGATATGTTTTGGTTGTTGATATTGAGTAGGACACTGTCTGGCATGA
AAGGGGGAATTCCGTAGCAGTCCTGGTAAGTATATTTCGGTGAGGAAATCCTGTGGGAGTTAATTATATCCATGGAATCG
TTTTGATTATTGTTATTGTTCCCATCTGTTTCTGGATCTATGCTGAATACCCCTGGTGGATTGTCACCCAATAATGTTTC
AGATAACAAGCTATCAATCTCGGCTAATCCTGTCATTTTCATGAACTCGACCTTCTTTACCATCAGCTGGGTGACCAATC
TCAGATCAGGAATTGTCAGCAGCAATTCCCCGAATCTACCCGGCTTGTGGTATTGCTTGTCATTCATGTGGTTCATCAGG
TCCATTTGTATTTGGTATCGGCATCGTCTCACGAACTCCTTGCCAGACTCGCTGACTCTCGGATCAAAAAATACGATCGC
TTTCAAACAAGCGAATTCTGCGTCATCCAATTGCAATTCTCGCAGCGGAATGAACAGGTCGTCAAGGATGTGACTGGCTA
TTTCAGCGAAATGTTTGTCACTGGAGTTCCTACTGATGATAAGATTGTTTCCCAATAATAGCACATCGTCTTCGTCCAAT
TGAAACGACCGCCTTATTACTCCAAGAATTAGAATTTCTCCCGCGTGTGCTTTTAAAAGGGAAATTTGATCGCTCAAGTT
TAACTGTGAAAAACAAGGCAAAGACTTTGCCCAATTCACTAGAAGAAATAACTGATTTTTCATGGACTCGCAAACATCAG
GCACATCGGCATATCTGTTCATGTATTCCTGAGGATTCGGGGGCTTTTGTATTGCAACCCTTTGCTCGGCCTGCATCAAC
TGAGAAATGGAGAGAATGACATTCGGAGGAATATCATCAAACGACGATCTTCGAGTACTGATCCTATCTCGTTCATTTTG
AACCGCTGCTCGCTTCATTCCTACAAGAATGCATTTCTTTAGCCGACAATAACGGCATTGGTTTCGTTTATCCTTGTCCA
TTTTACAATTCCGATTGTACTGGCAAGTGTAGTTATTCTTCTTCCTCACTGACCTCCGAAAAAATCCTTTACAACCGTCA
CACGAGAAAGCCCCATAATGTTTTCCTGTAGCTTTGTCACTGCAAATGAGACAGAGTTGATTGTTTTCCATTCCTTCTGG
TCCCGACGCGTTAGACGCATAGACTTCATGTTGTTGCGAGGACACTGAAACGAAAACTATTTGATAATATTTGTACAAAA
CAACTGACAGATGGTTTCGGAAAAGGTTCAATGTTCAGCCATAGTTCAGCGAAAGGTCAAATTCCTGAACTACTATTTCA
AGGTATAAATTTGAATATATTGGTTTTGCCTCGTGCTAACAAAGTCCAGAAATATAATAAGCAAAGTCTGAATCGTGTAC
TTTGGATTTCTAGCCAGGGGCACACAATAACCTATATTTAATAGCAGTTCATTGCGTTCACTCGTTATTTCTCCGACTGA
ACTGCATTGCAGGAGGATCCGCAACCATGGAGATTTCATAATTATTATCAAAATGATAATAATAATAATTATTATGAGGT
ATTGTAAAAGAAAACGTAACTCACTTTCACTTTCCAATGGATATTGCATCGAGGAAGCGTTGCTGGAAATGGAAATCGGA
GCTGAATTGCTAGTCAATAGTTGATAGGAGAATGCTGGATTGAGGTTCGGATGCTGGGTAGACGTCATATAGAATTGGCT
CGACGGATTCGGTAAAATTATGGTGAAGTTTACAATCGAAGCTCAGATATAACGTATTATAATGAAGTATTATTAATAAA
CTGCAAGTAACGTGCGCGCATTCTGAAGTGGTTGATTGAGAATAATCAGTTCTTATTCGACAAATTCAGATAAAAAAGGC
ACCACTCGAATTGTTCAGCTGCGTCATGTGAATGCCGGAACGTTGTGCGTTGGCTGTTGGCAGATCAGCGCTCCGTGTTC
ACTGCAATCCGGATACACCAGACCACTTGAAATCGTTGCGAATTCAGCGTGTCGAGTGCATTGTGCGAGATCAGTATCGG
TGTGTATGTGTGTCTGCCTGTGTGCGTGTGGATGTGTGTGCTTGTCGAGTCGGTTGTGTGTTTATGAGTGTAACTGTGTC
GATTTGGTCGAATGCAGTAGCAGATAGCTGAAATGCGATTGTTCCTATTTTTCATTTAATATTGTTTTATGTTTTGTTTC
TATTTTTATAATTTAATTTATCAGTTTTTGTTTAGATTATGCAATCATTGTTTAATTTATTTTTGTCAATTTAAAATTTA
TTATTAATTAAATTATTATAATTATT
>SMED30007290 ID=SMED30007290|Name=GATA456|organism=Schmidtea mediterranea sexual|type=transcript|length=2033bp
AGGTAAGTGTCGTCATCACAAGTGGCTTTATTATTATCATTTAAATTTTTTATCATATTATCATTGATTGCTTGTTTTCC
TCATTCAAAATTTAACTGATTGTTATCAAGCTCATTTGATAACTCCAAATCTAATTGACACTCATGTAAATATCCCATTC
GAATTTCCGTTCCCGTCCGTAAGATCCACGATCCGACAATGTTTCTCCCATCGGTATTGTCGAATTCTCACCAGAGAAAC
TCACCAATAATGGACATTGTATCACCAAAATCCAACACCAGCAATCTGAATGCGTTGATCACGTATTCGAATTGTCCCAA
CATAGATCTACAGTCGAATGATCTGTCAGTGAACTTGACGAATTCTCAAAACTTCCACGAATTGGATCACAAAACCAATT
ACGGATACAAAGTTTCAAACAACGAGACAAAACTGAATGCTTTTCCATATTTAGCTCAATCGAACTTAACAGATTGCACA
ACAGACATCAGTGGAGATCTGAAAAATCCAAATTCACATCTCAACTATGGAAACGGAATTTCGTTCTCGGAATTTTCGAA
AATGTCCGAAACCAACATCCACGGATATCCGCCATATTGTTTCTCCACTAAACTGTTTCCCATTCCAAATCTACAAGAGA
AATCAATTATCAACGACAACTATTCCGTGAAATCCACCGCCGGAGGCTTTATCACCGAATCGAATGAGCATCAAAACTCT
GTAAATACTGGAAATTCCTACAATTCCAATTTAAGCTCATACAGAACGGTAATTCCCGCTCATTTTCATCTCTTCAATCA
GAATTCACCAGAATCGAACTCGTTTTACAATACGGCTTGGAACAACTATCCGTTTCAAATATCCCCAACTTATCCCATAC
AAAATCTACCGGATTCAACAATCAACTGGACAACAAACAATCAAATTCCAAGCAGCAATTTAGTTTTTGATCCCTGGAGC
TGTAAATCAAATCTTAATCTTCCTCCGATTAATGAATTCGGTTCCAATTGCGATGTCAGCAGAGAGTGTGTGAACTGTGG
AGCTAGCAATACTCAGTTGTGGTCCCGGGATAATTCTGGCTATTATTTGTGTGATGAATGCGACAGGTTCTCTCAAAACA
ACAGTAGAAACCTCGAAAAACTACCAACGAATCAAGTCTCATCAAGTACCGAAAATGAGTTCATGAAAAAATCCAATGCC
AACTTTCAACAATATGGAAAAAGATCCGACCTCGAATGCAGCAATTGTAAAATTACCAAGACTTCTTTATGGAGAAGAAA
CAACGAAGGAGAACCTGTCTGCAATGCTTGCGGCTTGTATTATAAATTACATAAGTCTCTAAGACCTCTTTCAATGAGGA
AAGAAGGAATACAAACAAGGAAAAGAAAACGGAAAACACAAATGAAACCGGTTTCCACTCATATTGCCAATAATCAAAAG
GTGCCGTCTTCAGAATCGTCATCAGAACAAAATCAGTTTATAAACACTGTGAAATCAAGTGAAAATTGCTATAACATGAT
TTCTGAAAATTCTCCAACATATATGCCAAATATATCAGTCCAGCCCTTCAATCACATTCTGAACTCCAGCCAATATCAAT
TCCAATCTACAGAAAATCCCATTAATCAATCATATTTAAATTCCTCAATCAAAAACAGCAATCCCTTTTACGATTCCGAA
AGTATACTTTATTCCTACAACAATTCAAACAAAATCAAAGATGAGCCCCTATTATCCATGGACAACGAACCGAAGCCCTA
TTCCTCAATCAACGAGAAAATTGACGTCAACTCCATAGTGAGAATTAATGAAATCTCAAACAATTCGAATTCGAGTTAAT
TATTCTGATCTACTTTTTAATTATATATTTAAGAACCGTATATACTTCGAAATATAATTTTAATGATAAAATTTTATATC
TAAAAAATGTAATTTTTAAGTGCGAATTATTAAGTATGCATTTAAATAGTGCAATTATTGTGGTAGTTATTTTTATTACT
AAATAAATGTTGTTTGTAAATTCGAGAATTTGT

 

back to top



PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in gamma neoblast. Click this link to learn more about PAGE.


PAGE Curations: 128


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
gamma neoblastSMED30008414NADH-ubiquinone oxidoreductase chain 3 dd_Smed_v6_289_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30004214SMED30004214SMESG000055805.1 dd_Smed_v6_857_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30004214SMED30004214 dd_Smed_v6_909_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED3000270360S ribosomal protein L23aSMESG000074545.1 dd_Smed_v6_281_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED3002341340S ribosomal protein S25SMESG000059049.1 dd_Smed_v6_134_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30035571Protein disulfide-isomerase A5SMESG000005268.1 dd_Smed_v6_1537_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30022078Translationally-controlled tumor protein homologSMESG000023212.1 dd_Smed_v6_136_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED3003601340S ribosomal protein S20SMESG000002673.1 dd_Smed_v6_123_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED3003415260S ribosomal protein L11SMESG000012668.1 SMESG000012475.1 dd_Smed_v6_144_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30022209ATPase family AAA domain containing proteinSMESG000003318.1 dd_Smed_v6_1807_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30026979SMED30026979SMESG000076644.1 SMESG000076643.1 dd_Smed_v6_227_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30026513SMED30026513SMESG000005268.1 dd_Smed_v6_1537_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30034375SMED30034375SMESG000029570.1 SMESG000045686.1 SMESG000045684.1 SMESG000017522.1 SMESG000017520.1 SMESG000017517.1 SMESG000017519.1 dd_Smed_v6_6577_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30025467Heat shock protein 75 kDa, mitochondrialSMESG000016949.1 dd_Smed_v6_1445_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30024160SMED30024160SMESG000046560.1 SMESG000010944.1 dd_Smed_v6_142_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30030431U1 small nuclear ribonucleoprotein 70 kDaSMESG000010283.1 dd_Smed_v6_633_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30023308SMED30023308SMESG000063568.1 dd_Smed_v6_762_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30030435Serine/arginine-rich splicing factorSMESG000015564.1 dd_Smed_v6_3431_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30034070SMED30034070SMESG000029570.1 SMESG000045686.1 SMESG000045684.1 SMESG000017522.1 SMESG000017520.1 SMESG000017517.1 SMESG000017519.1 dd_Smed_v6_6577_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30023889SMED30023889SMESG000055805.1 dd_Smed_v6_857_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30031235Tubulin alpha chainSMESG000017700.1 dd_Smed_v6_648_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30027299PBXSMESG000022232.1 SMESG000001913.1 dd_Smed_v6_3098_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30025338E3 ubiquitin-protein ligase CBLSMESG000072524.1 SMESG000072522.1 dd_Smed_v6_330_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30024839Mitochondrial ATP synthase subunit bSMESG000077800.1 dd_Smed_v6_905_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30023341Exocyst complex component 1SMESG000030781.1 dd_Smed_v6_6427_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30032456Aldehyde dehydrogenase,putativeSMESG000001708.1 dd_Smed_v6_400_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30030766Y box protein-1SMESG000058066.1 dd_Smed_v6_52_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30034943SMED30034943SMESG000013014.1 dd_Smed_v6_9781_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30004939SMED30004939SMESG000001797.1 SMED30004939smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30016265Tubulin beta chainSMESG000022928.1 SMED30016265smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30007346Achaete-scute-like proteinSMESG000026861.1 SMED30007346smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30017430Protein disulfide-isomeraseSMESG000023147.1 SMESG000017020.1 SMED30017430smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30017430Protein disulfide-isomeraseSMESG000023147.1 SMESG000017020.1 SMED30028938smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30005571Delta-1-pyrroline-5-carboxylate synthaseSMESG000045474.1 SMED30005571smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30004081SMED30004081SMESG000040291.1 SMED30004081smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30022975Homeobox protein DTH-2SMESG000037282.1 SMED30022975smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30021063SMED30021063SMESG000025889.1 SMED30021063smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30023874Aminoacylase-1SMESG000028017.1 SMED30023874smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30028798Farnesoic acid O-methyltransferaseSMESG000029910.1 SMED30028798smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30022596SMED30022596SMESG000071344.1 SMED30022596smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30028938Protein disulfide-isomerase A6SMESG000023147.1 SMESG000017020.1 SMED30017430smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30028938Protein disulfide-isomerase A6SMESG000023147.1 SMESG000017020.1 SMED30028938smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30007599SMED30007599 SMED30032778smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30019234SMED30019234 SMED30019234smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30027929Tubulin beta chain SMED30027929smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30032778SMED30032778 SMED30032778smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30007290GATA456SMESG000039559.1 SMESG000037031.1 SMED30007290smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30011793Homeobox protein DTH-1SMESG000079512.1 SMED30011793smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30005748HNF4SMESG000014588.1 SMED30005748smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30034629Golgi-associated plant pathogenesis-related protein 1SMESG000063568.1 SMED30034629smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30030204SMED30030204SMESG000018900.1 SMED30030204smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30007290GATA456SMESG000039559.1 SMESG000037031.1 SMED30007290smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 5 fluorescence in situ hybridization evidence
gamma neoblastSMED30007290GATA456SMESG000039559.1 SMESG000037031.1 JF802198.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 5 fluorescence in situ hybridization evidence
gamma neoblastSMED30007290GATA456SMESG000039559.1 SMESG000037031.1 AFF18488.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 5 fluorescence in situ hybridization evidence
gamma neoblastSMED30007744SMED-SMAD6/7-1SMESG000002697.1 JQ278719.1smed_ncbi_20200123PMID:25017721
van Wolfswinkel et al., 2014
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30007290GATA456SMESG000039559.1 SMESG000037031.1 JF802198smed_ncbi_20200123PMID:25017721
van Wolfswinkel et al., 2014
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30011793Homeobox protein DTH-1SMESG000079512.1 SMED30011793smed_20140614PMID:25017721
van Wolfswinkel et al., 2014
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30005748HNF4SMESG000014588.1 JF802199.1smed_ncbi_20200123PMID:25017721
van Wolfswinkel et al., 2014
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30009204FGFR4SMESG000054557.1 JQ425159.1smed_ncbi_20200123PMID:25017721
van Wolfswinkel et al., 2014
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30035063SOXP-2SMESG000074761.1 JQ425152smed_ncbi_20200123PMID:25017721
van Wolfswinkel et al., 2014
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30025778SOXB1-1SMESG000011244.1 SMED30025778smed_20140614PMID:25017721
van Wolfswinkel et al., 2014
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30035424NLK-1SMESG000023289.1 JQ425157.1smed_ncbi_20200123PMID:25017721
van Wolfswinkel et al., 2014
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30023483INX-13SMESG000043575.1 JQ425145smed_ncbi_20200123PMID:25017721
van Wolfswinkel et al., 2014
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30016901PROX-1SMESG000068287.1 JQ425149.1smed_ncbi_20200123PMID:25017721
van Wolfswinkel et al., 2014
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30027299PBXSMESG000022232.1 SMESG000001913.1 KC353351.1smed_ncbi_20200123PMID:25017721
van Wolfswinkel et al., 2014
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30004081SMED30004081SMESG000040291.1 dd_Smed_v6_1144_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30021063SMED30021063SMESG000025889.1 dd_Smed_v6_17_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30019959NADH dehydrogenase subunit 4 dd_Smed_v6_344_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30019959NADH dehydrogenase subunit 4 dd_Smed_v6_292_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30001799NADH dehydrogenase subunit 5 dd_Smed_v6_957_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30010253NADH dehydrogenase subunit 6 dd_Smed_v6_957_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30013571NADH dehydrogenase subunit 4L dd_Smed_v6_344_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30000702cytochrome b dd_Smed_v6_344_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30004246SMED30004246 dd_Smed_v6_344_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30003686NADH dehydrogenase subunit 2 dd_Smed_v6_505_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30026531cytochrome c oxidase subunit II dd_Smed_v6_297_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30033740SMED30033740 dd_Smed_v6_957_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30007290GATA456SMESG000039559.1 SMESG000037031.1 dd_Smed_v6_4075_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30000639Microtubule-actin cross-linking factor 1-like isoform X28SMESG000029570.1 SMESG000045686.1 SMESG000045684.1 SMESG000017522.1 SMESG000017520.1 SMESG000017517.1 SMESG000017519.1 dd_Smed_v6_6577_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30003249ProhibitinSMESG000038397.1 dd_Smed_v6_1038_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED3002552260 kDa heat shock protein, mitochondrialSMESG000065325.1 dd_Smed_v6_141_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30030013GTP-binding nuclear proteinSMESG000072524.1 SMESG000072522.1 dd_Smed_v6_330_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED3001850460S ribosomal protein L30SMESG000022893.1 dd_Smed_v6_111_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30008509DNA topoisomeraseSMESG000081337.1 SMESG000081321.1 dd_Smed_v6_20479_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30011420Trinucleotide repeat containing 4-like proteinSMESG000005424.1 dd_Smed_v6_11349_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED3000905260S ribosomal protein L18SMESG000017166.1 dd_Smed_v6_128_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED3000103940S ribosomal protein S7SMESG000053117.1 SMESG000031967.1 SMESG000031033.1 SMESG000014878.1 dd_Smed_v6_204_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30012386Alpha-1,4 glucan phosphorylaseSMESG000061417.1 dd_Smed_v6_1532_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED3000621640S ribosomal protein S8SMESG000047167.1 dd_Smed_v6_156_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED3000317640S ribosomal protein S2SMESG000051503.1 dd_Smed_v6_226_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED3001616360S ribosomal protein L27aSMESG000034631.1 dd_Smed_v6_155_1dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED3000876940S ribosomal protein S10SMESG000034720.1 dd_Smed_v6_117_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED3001553460S ribosomal protein L21SMESG000040216.1 dd_Smed_v6_189_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED3001238340S ribosomal protein SASMESG000071180.1 dd_Smed_v6_171_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED3001918960S ribosomal protein L37aSMESG000078736.1 dd_Smed_v6_140_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED3001301840S ribosomal protein S6SMESG000000674.1 dd_Smed_v6_178_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30001495Ribosomal protein L15SMESG000056940.1 dd_Smed_v6_193_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED3001242160S ribosomal protein L37aSMESG000078736.1 dd_Smed_v6_140_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30000289SMED30000289SMESG000076644.1 SMESG000076643.1 dd_Smed_v6_227_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED3000448460S ribosomal protein L8SMESG000017087.1 dd_Smed_v6_108_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED3001449360S ribosomal protein L5SMESG000004748.1 dd_Smed_v6_151_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30034629Golgi-associated plant pathogenesis-related protein 1SMESG000063568.1 dd_Smed_v6_762_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED3000891040S ribosomal protein S4SMESG000026320.1 dd_Smed_v6_82_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30014560SMED30014560SMESG000026537.1 dd_Smed_v6_858_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30017114Elongation factor 1-gammaSMESG000018714.1 dd_Smed_v6_308_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30019702SMED30019702SMESG000016033.1 SMESG000000571.1 dd_Smed_v6_661_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30015310DUF3421 domain-containing proteinSMESG000046710.1 SMESG000046697.1 dd_Smed_v6_54_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30018944SMED30018944SMESG000028183.1 dd_Smed_v6_592_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30010163SMED30010163SMESG000029570.1 SMESG000045686.1 SMESG000045684.1 SMESG000017522.1 SMESG000017520.1 SMESG000017517.1 SMESG000017519.1 dd_Smed_v6_6577_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30018385Hydroxyacyl-coenzyme A dehydrogenase, mitochondrialSMESG000032777.1 dd_Smed_v6_725_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED3000928360S ribosomal protein L18aSMESG000060163.1 dd_Smed_v6_437_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30010576Short coiled-coil protein homologSMESG000029570.1 SMESG000045686.1 SMESG000045684.1 SMESG000017522.1 SMESG000017520.1 SMESG000017517.1 SMESG000017519.1 dd_Smed_v6_6577_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30013161SMED30013161SMESG000051379.1 dd_Smed_v6_2630_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30010375cytochrome c oxidase subunit I dd_Smed_v6_753_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30014769SMED30014769SMESG000032777.1 dd_Smed_v6_725_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30022855Reactive oxygen species modulator 1 family proteinSMESG000039761.1 dd_Smed_v6_691_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30020431COP9 signalosome complex subunit 4SMESG000006062.1 dd_Smed_v6_4122_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30021508Glutamate dehydrogenaseSMESG000061402.1 dd_Smed_v6_932_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30021386Y box protein-1SMESG000058066.1 dd_Smed_v6_52_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30020124Ribosome biogenesis regulatory proteinSMESG000071880.1 dd_Smed_v6_2458_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED3002151340S ribosomal protein S9SMESG000058106.1 dd_Smed_v6_92_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30022575pescadillo-1SMESG000032689.1 dd_Smed_v6_900_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30007704ActinSMESG000051672.1 SMESG000051670.1 dd_Smed_v6_3_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED3000109640S ribosomal protein S23SMESG000017264.1 dd_Smed_v6_290_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30019834Guanine nucleotide-binding protein subunit beta-2-like 1SMESG000076568.1 dd_Smed_v6_174_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30005190SMED30005190SMESG000041069.1 dd_Smed_v6_237_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30005334SMED30005334 dd_Smed_v6_344_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gamma neoblastSMED30006638Elongation factor TuSMESG000068535.1 dd_Smed_v6_818_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Note: Hover over icons to view figure legend

 

 

back to top