eye

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ In Situ Hybridization Data

  ▻ Sequences

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  eye


DEFINITON:

  An organ that detects light.


TERM DEFINITION CITATIONS:

  UBERON:0000970


TERM CITATIONS:

Expand publication list


TERM ID:

  PLANA:0000036


ABOUT THIS TERM:

eye

  ↳is a material entity and organ

  ↳contained in head region, dorsal region of the whole animal and anterior region of the whole animal

  ↳develops from trail cell

  ↳existence overlaps juvenile stage, asexual adult, adult hermaphrodite, Stage 8 and Stage 7

  ↳existence starts during or after Stage 7

  ↳part of central nervous system and visual system


  → posterior region of the eye and anterior region of the eye contained in eye


  → eye primordium develops into eye


Expand to see terms that part of eye

  → rhabdome
  → optic cup
  → photoreceptor neuron


DEPICTED BY:


COMMENTS:

Depicted by field contains hematoxylin and eosin staining section of a asexual adult animal. The eyes are indicated by arrows. Scale bar = 250um


BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30030594OpsinopsinStage 7, Stage 8photoreceptor neuron, visual system, eye
SMED30018592AFP48372.1ovoovoStage 6, Stage 7, Stage 8trail cell, photoreceptor neuron, optic cup, pigment cup cell, visual system, eye
SMED30006796AFC87780.1tyrosinasetyrosinaseStage 7, Stage 8optic cup, pigment cup cell, visual system, eye
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30006796 ID=SMED30006796|Name=tyrosinase|organism=Schmidtea mediterranea sexual|type=transcript|length=1755bp
TGTCAGTTTAGTCATGCTCGTAATCACAATAGGCATAGTCTTTGCATCTTTCTTACCTTTGAGTGACTGCCTAATCCCAA
GGATTTGCAGTAGGAATGTCACTCTTTCTAATTCAACATGTTGTCCAATTTATAATGATTTTGTTTGCGGTGGTCCTTTT
CGTGGATCTTGTGAAGTCTCCATTCTTTTTCAAAATCACACTGAGCACTCGGATGTTATCACCGGAAAATTGGAAAATGA
CGACAGACTCAACTGGCCATCAAGATTTTTTAAATTTCTTTGCAGTTGCAAGTCAAACTATGATGGAATAGCCTGTGACA
AGTGTAAATCAGGGTGGCAAGGGGAAAACTGTGAGGTGGTCTCCCCGAGAAAGATTAGACAAAATATTCTTAACATGAGA
TCATACGATGTTTTTATTTTTTTATCGATACTGAACATCAGCAAATATCAGTTGGCCGATTTCCTGATCACAAATTCGTC
CTCAAACCTTCACTGTGACCCTGTCAATGAAGACAACATTCAATTGGTCAATGCTTCCATTTATGATACAATGGTTTACT
TACATTTCTATGCGTCCAGGAGTACAATGTCTAAAGAACTTATGGAATCCTGCACAGACAAGGATAACAAATTAGACTTC
GCTCATAAAGGTCCAGCTTTTTTTACATGGCACCGACATTATTTACTGATGTTTGAAGACTTATTAAGGAGTATTGCAGT
CGAACAATTTGGATATTATAATTTCACATTACCATATTGGGACTGGACGAATCAAATAACTTGTAATATATGTACAAATG
ACTTACTTGGCGATATTCCCACTGAAGATCAAGAATCTAACAGCACATTTTTTAAATGGAAACCGATTTGCCCTCAGAAA
CCTAACGATTTTGATTGTCATATTTGCGATCCAAGCCAGGAAGAACCTTTTTTATGGAGAAAATACTCATCAACGGTAGA
CAGACTTCCTAATCAGAACGAAATTGATGAGTTATTCTCAATCAACCAATATGATTCGGAGCCCTTCAATTCCAGCTCAT
TTAGTAGGAAAAGCTTTCGGAATTTTGCAGAGGGATATTATCGAGTTCATCCAAACTCAGATGATATGAAAATGAAAGAC
ATTGGGAAGGGACTCCCCCATCAAAATATCATGATGCATAATATGTTTTATCAATGGAACTTGGATGGATTTCACAACGA
GTCCCAATGATCCATTATTTCTACTACATCATACGTTTATGGACAAAATCTTTGAAATTTGGCTATTAAGAAATAGACGA
TCTACATACCCTGGGAAATCTTCAACACCAATCGGGCAGCATGCTGACGATTTTATTGTGCCTTTCCTTCCACTAATCAG
AAACAGGAATTTGTTTACTTCAGCAAATGAATTTGGCTACGCCTACGATAACAATATTGTTGGAAATAAATTGTTCACAA
ATCATCAACTAGATTTCGAAAAGAGCTCATCGGAAATTTACTACATCCTAACGGCAGTTGCCTTTGTAGTACTAGTTGCG
ATCGTCGTCGGATTGTACTGCTTCAGACCCAGTCAAATCAGTCACACGGCTTATGAATTCATTGAAGACCAGGAGCAGGA
GGAAAAGACAAATTACTTTAACAACAATGAAAAAATGCCTCTACTGAAATGACAAGCCATTTCTGATGACTATTATAATA
TTGTCACCTTAAATTTTCTTTGAAACAACTTTATTATTGACAAATTTTGAAGAATCCTTTTAAGCAAAATAAAGT
>SMED30030594 ID=SMED30030594|Name=Opsin|organism=Schmidtea mediterranea sexual|type=transcript|length=1880bp
AATAAAATGAAATTTATAATGCCATTGGTATTTACACTGTGGTTAATAACGATAATAATCAGAATTTTTAATGATAAATA
TAGTAAACGATAACTAGTAACGGTAACCCTAATAATGAATGCTATATTACATATAGTAGTGTTACCAAAATTTTGGAATT
TAAAATAATAAGTTTATTATGAGTGACCATGATAATAAAAAAGATTTTTAAATAAAATGATAATATTACTATATAGTCGG
TTATAGTTCCGATTAGTCTACTATCGTAGACGTAATAAAAAGAGTTTAGTAACCTAATTTTCAATGTTTTTTGAAAGTTG
CTCGTCTCTATGGCAACTTATTATCGTAAGGAAAATTTTCTACTTCACTATGATATTTTCGGAGTGAATTTATTGATTTA
CATTCAAGGACTTTCACTATTGCATTTACTGAAGCGATCGTTTCATTTGGAACTCATATTTTCGCCCCTAATCGTTCTGG
AATTTATTATTTATGATCCTTTATCTGACCTTAAAAATTTTCATATTCATGAGTGTCCAATCTTTTGCCAATTTGGGAAA
TAAGCTCCTAGAAAATGCTACCTTCAATAATGAATCCCTTACAAAGTCAGTATGGCATTGGGATCCTGAATTTGAATCAA
TTGTCCATCCGTACTGGCGGACTTTTGATATGGTGCCAGAAGTTTATCATTATTTAGTTGGAGTGTATATTTCTATTGTT
GGAATATCGGGAGTTCTGGGAAATCTTCTTGTTCTTTACATATTTGCAAGCGCCAAAAGTTTAAGAACTCCTCCAAATAT
GTTTATAATGAGTTTAGCAATTGGAGATTTGACATTTTCTGCTGTGAATGGCTTCCCCTTACTTACTATTTCAAGTTTTA
ACACTCGATGGGCTTGGGGAAAATTAACGTGTGAGATTTATGGTTTCATCGGTGGTCTTTTTGGGTTTATATCCATCAAC
ACAATGGCACTAATTTCTCTGGATAGGTATTTTGTTATTGCCCAACCATTTCAAACAATGAAATCCCTGACAATCAAAAG
AGCAATAATCATGTTGGTTTTCGTATGGCTTTATTCATTAATTTGGTCAACACCGCCATTTTTTGGATATGGAAATTATG
TGCCGGAAGGATTTCAAACGTCTTGTACATTCGACTATTTGACCCAATCAAAAGGTAACATAATATTCAATATTGGGATG
TACATAGGAAATTTCATAATTCCCGTTGGAATAATTATATTTTGCTATTATCAAATTGTCAAAGCAGTGCGAGTACATGA
ATTAGAAATGTTAAAAATGGCTCAAAAGATGAATGCATCTCATCCAACTTCCATGAAAACGGGTGCAAAAAAGGCTGATG
TTCAAGCTGCAAAGATTTCTGTCATAATTGTCTTTTTATATATGTTATCATGGACACCATATGCAATAATTGCCCTTATG
GCTCTCACAGGGCGTAGAGATCATCTGAATCCATACACTGCAGAATTGCCGGTACTCTTTGCTAAGACCTCAGCTATGTA
CAACCCATTTATATACGCAATAAATCATCCAAAATTTCGAATTCAGCTGGAAAAGAAATTTCCATGTTTGATTTGTTGCT
GTCCACCAAAACCAAAAGAAAGGGACACTACAAGTGCAGCATCAGCAACGAAACCGAGTAAATATCAGAGTGAAAGAGAA
AGTTCAATGTCTCAACTGGATCCTGAAGACGATAAACAAGTCGTAGAAACCACCAAGAATCAAACCACAAGTGGACATAC
AAATGAAGCTTACGAGAGTGAACAGAAGTAGTTGATGAAACTAAATTATTCTATTTTTAATGACACTAGATCTTTATAAT
AATTTTATTTAAGGGAATGAGCACTGAATTTTGCGCAAAT
>SMED30018592 ID=SMED30018592|Name=ovo|organism=Schmidtea mediterranea sexual|type=transcript|length=1211bp
GTCATATTGAACACTGAGACTAGCTATCAATAGCTGACAATTAGACGTATAAAATGTTAGGGTACGCCTTTTTGGCCATT
ATTTCACACCAAAATTTCCATGAGTATTTTTCTAATAAGCACTCTACTCGCAAACGATGACGAAATGCCCACAGATTTGT
CATCGAAAACTGAAAAGATTGAAAACCATGAAAAATCTGAAAGGAATCTCTGCAAGTATTCCAGTCAGTTTCTTTCCTGT
TTTTATTCACAGGAAATGTTGACACTACTTATGAGAAAAAATTTCATCAATCAATATTCATTTTATTTAAAGATTTTCTC
GGGGTTTCCACAATTCGTCGATAACTTCAACTTAGTAAATCCAACAGATTTCACCGTCAATTCAAATTCAACAACAATTT
TGCCCTCATTCAACTTCCATAAAACGTCATTGAATATCGAAATGAACACCTCACTGGCCAATTCTTCAAGCACTGGTAGG
TCGTCTCCAACTGAAACTGTGTCTGAAAATCTTTGGTTAGAAAAAGTAAAGGTGGAAAAATATTTCCATTTAATTGAAAA
TCTATCACAATCCCAAGAGAACATTGAAGACATTGTCAAAACGATCAAAGTCAAACGAAGAAATTTTGCTGAATATATTA
AGAAACTTTACCTAAGTGATCCAGCCAAATTTAAGTTGACAAATGGTGGAGATGGAATAGTAAATCCATTTAGAAAACAA
TTCAAAGAAGAACGAGATAAATCTATGGACAAATTTTGCATCGAAGTTAATCACAATTATCAATGTAAGATATGTAACAA
GGTGTTTCCTTCCAAAAAGCACATGCAACGTCATATACGTTCACACGGTGTAAATTTTGATTGGTTGTGTAAATATTGTT
TTAAACCGTTTATTGATTCCTACGATTTAAAACGACATACGAGAGTCCATACAGGAGTTCAACCATACAAATGTCAAAGT
TGCACAAGAAAATTCAGTCAACGATGCTCATTGGAAAGTCATCAGGTGAAAATCCATGGAGTAGCACTGAATTATCTATA
CAAAGAAAGAAGGAACAAGTTGTATCCGTGTGAAATCTGCAGTTATAGTACGTCTTGTAAAGCAACTTGGTTGAGTCACA
TCATTCAGGAGCACCCGAATTCACTTTATGCAAAAGAAGAAGCACTCAAAGGAAAATACAACTGACTTTGAAAAATATTG
ATTTTTCAAGC

 

back to top



PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in eye. Click this link to learn more about PAGE.


PAGE Curations: 73


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
eyeSMED30003366Homeobox protein DLL-1 JN983829smed_ncbi_20240424PMID:27034770
Currie et al., 2016
whole organism asexual adult fluorescence in situ hybridization evidence
eyeSMED30003366Homeobox protein DLL-1 SmedASXL_012281SmedAsxl_ww_GCZZ01PMID:27034770
Currie et al., 2016
whole organism asexual adult fluorescence in situ hybridization evidence
eyeSMED30014877Protein decapentaplegic EF633689.1smed_ncbi_20240424PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30030594opsin 4 SmedASXL_005730SmedAsxl_ww_GCZZ01PMID:29158443
He et al., 2017
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30012020tryptophan hydroxylase 1 tphsmed_ncbi_20240424PMID:25558068
Reuter et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
eyeSMED30034479 BK007033.1smed_ncbi_20240424PMID:21806978
Iglesias et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30012020tryptophan hydroxylase 1 KF134114.1smed_ncbi_20240424PMID:24131630
März et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30020439dopa decarboxylase KC568452smed_ncbi_20240424PMID:24131630
März et al., 2013
whole organism asexual adult fluorescence in situ hybridization evidence
eyeSMED30018592Transcription factor ovo-like homolog lin-48 JX091074smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
eyeSMED30018592Transcription factor ovo-like homolog lin-48 JX091074smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
eyeSMED30018592Transcription factor ovo-like homolog lin-48 JX091074smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
eyeSMED30018592Transcription factor ovo-like homolog lin-48 ovosmed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
eyeSMED30018592Transcription factor ovo-like homolog lin-48 ovosmed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
eyeSMED30018592Transcription factor ovo-like homolog lin-48 ovosmed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
eyeSMED30018592Transcription factor ovo-like homolog lin-48 JX091074smed_ncbi_20240424PMID:22884275
Lapan et al., 2012
whole organism juvenile stagefluorescence in situ hybridization evidence
eyeSMED30018592Transcription factor ovo-like homolog lin-48 ovosmed_ncbi_20240424PMID:25254346
Scimone et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30026741Krueppel-like factor 2 klfsmed_ncbi_20240424PMID:25254346
Scimone et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30011934Transcription factor Sp9 sp6-9smed_ncbi_20240424PMID:25254346
Scimone et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30008787zero population growth; transcript_id=FBtr0076983 Contig38798uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30008787zero population growth; transcript_id=FBtr0076983 Contig38798newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30009712receptor protein-tyrosine kinase Contig29100newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30009712receptor protein-tyrosine kinase Contig29100uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30007698SID1 transmembrane family member 2 Contig34061newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30007698SID1 transmembrane family member 2 Contig34061uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30002918Innexin Contig34604newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30002918Innexin Contig34604uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30028961inosine monophosphate dehydrogenase 1 Contig37052newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30028961inosine monophosphate dehydrogenase 1 Contig37052uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30013770JmjC domain-containing protein Contig55456newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30013770JmjC domain-containing protein Contig55456uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30002918shaking B Contig34604newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30002918shaking B Contig34604uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30024778somatomedin-B and thrombospondin type-1 domain-containing Contig50773newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30024778somatomedin-B and thrombospondin type-1 domain-containing Contig50773uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30012447filamin A Contig18792newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30012447filamin A Contig18792uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30012447filamin A Contig38577uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30012447filamin A Contig38577newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30004839E3 ubiquitin-protein ligase ICP0 Contig28920uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30004839E3 ubiquitin-protein ligase ICP0 Contig28920newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30016057receptor protein-tyrosine kinase Contig29100newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30016057receptor protein-tyrosine kinase Contig29100uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30012133shaking B Contig34604uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30012133shaking B Contig34604newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30032370beta 3-glucosyltransferase Contig40970newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30032370beta 3-glucosyltransferase Contig40970uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30035838ADAM metallopeptidase with thrombospondin type 1 motif 9 Contig12938uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30035838ADAM metallopeptidase with thrombospondin type 1 motif 9 Contig12938newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30021430SID1 transmembrane family member 2 Contig34061newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30021430SID1 transmembrane family member 2 Contig34061uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30012133Innexin Contig34604uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30012133Innexin Contig34604newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30022422tetratricopeptide repeat domain 39B Contig11545uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30022422tetratricopeptide repeat domain 39B Contig11545newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30011934Transcription factor Sp9 Contig37509uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30011934Transcription factor Sp9 Contig37509newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30027813ADAM metallopeptidase with thrombospondin type 1 motif 9 Contig12938uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30027813ADAM metallopeptidase with thrombospondin type 1 motif 9 Contig12938newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30029236 Contig27612uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30029236 Contig27612newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30017830Transcription factor 7 Smed-TCF-2smed_ncbi_20240424PMID:28976975
Su et al., 2017
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30025683Transcription factor 7 Smed-TCF-2smed_ncbi_20240424PMID:28976975
Su et al., 2017
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30034479 BK007033.1smed_ncbi_20240424PMID:18287199
Iglesias et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30007858neogenin 1 DQ086493smed_ncbi_20240424PMID:16033796
Cebrià et al., 2005
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30031540 BK007025.1smed_ncbi_20240424PMID:26884331
Ong et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30009456 GU295180.1smed_ncbi_20240424PMID:26884331
Ong et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30033797 GU295180.1smed_ncbi_20240424PMID:26884331
Ong et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30034479 BK007033.1smed_ncbi_20240424PMID:26884331
Ong et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30030594opsin 4 AF112361smed_ncbi_20240424PMID:30485821
Tewari et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
eyeSMED30007326Homeobox protein OTX1 B JN983826.1smed_ncbi_20240424PMID:21852957
Lapan et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
eyeSMED30011934Transcription factor Sp9 sp6-9smed_ncbi_20240424PMID:21852957
Lapan et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
eyeSMED30034479 BK007033.1smed_ncbi_20240424PMID:23318635
Blassberg et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
eyeSMED30034479 BK007033.1smed_ncbi_20240424PMID:17905225
Molina et al., 2007
whole organism asexual adult colorimetric in situ hybridization evidence
Note: Hover over icons to view figure legend

 

 

back to top