eye

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ In Situ Hybridization Data

  ▻ Sequences

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  eye


DEFINITON:

  An organ that detects light.


TERM DEFINITION CITATIONS:

  UBERON:0000970


TERM CITATIONS:

Expand publication list


TERM ID:

  PLANA:0000036


ABOUT THIS TERM:

eye

  ↳is a material entity and organ

  ↳contained in head, dorsal region of the whole animal and anterior region of the whole animal

  ↳develops from trail cell

  ↳existence overlaps juvenile, asexual adult, adult hermaphrodite, Stage 8 and Stage 7

  ↳existence starts during or after Stage 7

  ↳part of visual system


  → eye primordium develops into eye


Expand to see terms that part of eye


DEPICTED BY:


COMMENTS:

Depicted by field contains hematoxylin and eosin staining section of a asexual adult animal. The eyes are indicated by arrows. Scale bar = 250um


BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30030594OpsinopsinStage 7, Stage 8photoreceptor neuron, visual system, eye
SMED30018592AFP48372.1ovoovoStage 6, Stage 7, Stage 8trail cell, photoreceptor neuron, optic cup, pigment cup cell, visual system, eye
SMED30006796AFC87780.1tyrosinasetyrosinaseStage 7, Stage 8optic cup, pigment cup cell, visual system, eye
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30006796 ID=SMED30006796|Name=tyrosinase|organism=Schmidtea mediterranea sexual|type=transcript|length=1755bp
TGTCAGTTTAGTCATGCTCGTAATCACAATAGGCATAGTCTTTGCATCTTTCTTACCTTTGAGTGACTGCCTAATCCCAA
GGATTTGCAGTAGGAATGTCACTCTTTCTAATTCAACATGTTGTCCAATTTATAATGATTTTGTTTGCGGTGGTCCTTTT
CGTGGATCTTGTGAAGTCTCCATTCTTTTTCAAAATCACACTGAGCACTCGGATGTTATCACCGGAAAATTGGAAAATGA
CGACAGACTCAACTGGCCATCAAGATTTTTTAAATTTCTTTGCAGTTGCAAGTCAAACTATGATGGAATAGCCTGTGACA
AGTGTAAATCAGGGTGGCAAGGGGAAAACTGTGAGGTGGTCTCCCCGAGAAAGATTAGACAAAATATTCTTAACATGAGA
TCATACGATGTTTTTATTTTTTTATCGATACTGAACATCAGCAAATATCAGTTGGCCGATTTCCTGATCACAAATTCGTC
CTCAAACCTTCACTGTGACCCTGTCAATGAAGACAACATTCAATTGGTCAATGCTTCCATTTATGATACAATGGTTTACT
TACATTTCTATGCGTCCAGGAGTACAATGTCTAAAGAACTTATGGAATCCTGCACAGACAAGGATAACAAATTAGACTTC
GCTCATAAAGGTCCAGCTTTTTTTACATGGCACCGACATTATTTACTGATGTTTGAAGACTTATTAAGGAGTATTGCAGT
CGAACAATTTGGATATTATAATTTCACATTACCATATTGGGACTGGACGAATCAAATAACTTGTAATATATGTACAAATG
ACTTACTTGGCGATATTCCCACTGAAGATCAAGAATCTAACAGCACATTTTTTAAATGGAAACCGATTTGCCCTCAGAAA
CCTAACGATTTTGATTGTCATATTTGCGATCCAAGCCAGGAAGAACCTTTTTTATGGAGAAAATACTCATCAACGGTAGA
CAGACTTCCTAATCAGAACGAAATTGATGAGTTATTCTCAATCAACCAATATGATTCGGAGCCCTTCAATTCCAGCTCAT
TTAGTAGGAAAAGCTTTCGGAATTTTGCAGAGGGATATTATCGAGTTCATCCAAACTCAGATGATATGAAAATGAAAGAC
ATTGGGAAGGGACTCCCCCATCAAAATATCATGATGCATAATATGTTTTATCAATGGAACTTGGATGGATTTCACAACGA
GTCCCAATGATCCATTATTTCTACTACATCATACGTTTATGGACAAAATCTTTGAAATTTGGCTATTAAGAAATAGACGA
TCTACATACCCTGGGAAATCTTCAACACCAATCGGGCAGCATGCTGACGATTTTATTGTGCCTTTCCTTCCACTAATCAG
AAACAGGAATTTGTTTACTTCAGCAAATGAATTTGGCTACGCCTACGATAACAATATTGTTGGAAATAAATTGTTCACAA
ATCATCAACTAGATTTCGAAAAGAGCTCATCGGAAATTTACTACATCCTAACGGCAGTTGCCTTTGTAGTACTAGTTGCG
ATCGTCGTCGGATTGTACTGCTTCAGACCCAGTCAAATCAGTCACACGGCTTATGAATTCATTGAAGACCAGGAGCAGGA
GGAAAAGACAAATTACTTTAACAACAATGAAAAAATGCCTCTACTGAAATGACAAGCCATTTCTGATGACTATTATAATA
TTGTCACCTTAAATTTTCTTTGAAACAACTTTATTATTGACAAATTTTGAAGAATCCTTTTAAGCAAAATAAAGT
>SMED30030594 ID=SMED30030594|Name=Opsin|organism=Schmidtea mediterranea sexual|type=transcript|length=1880bp
AATAAAATGAAATTTATAATGCCATTGGTATTTACACTGTGGTTAATAACGATAATAATCAGAATTTTTAATGATAAATA
TAGTAAACGATAACTAGTAACGGTAACCCTAATAATGAATGCTATATTACATATAGTAGTGTTACCAAAATTTTGGAATT
TAAAATAATAAGTTTATTATGAGTGACCATGATAATAAAAAAGATTTTTAAATAAAATGATAATATTACTATATAGTCGG
TTATAGTTCCGATTAGTCTACTATCGTAGACGTAATAAAAAGAGTTTAGTAACCTAATTTTCAATGTTTTTTGAAAGTTG
CTCGTCTCTATGGCAACTTATTATCGTAAGGAAAATTTTCTACTTCACTATGATATTTTCGGAGTGAATTTATTGATTTA
CATTCAAGGACTTTCACTATTGCATTTACTGAAGCGATCGTTTCATTTGGAACTCATATTTTCGCCCCTAATCGTTCTGG
AATTTATTATTTATGATCCTTTATCTGACCTTAAAAATTTTCATATTCATGAGTGTCCAATCTTTTGCCAATTTGGGAAA
TAAGCTCCTAGAAAATGCTACCTTCAATAATGAATCCCTTACAAAGTCAGTATGGCATTGGGATCCTGAATTTGAATCAA
TTGTCCATCCGTACTGGCGGACTTTTGATATGGTGCCAGAAGTTTATCATTATTTAGTTGGAGTGTATATTTCTATTGTT
GGAATATCGGGAGTTCTGGGAAATCTTCTTGTTCTTTACATATTTGCAAGCGCCAAAAGTTTAAGAACTCCTCCAAATAT
GTTTATAATGAGTTTAGCAATTGGAGATTTGACATTTTCTGCTGTGAATGGCTTCCCCTTACTTACTATTTCAAGTTTTA
ACACTCGATGGGCTTGGGGAAAATTAACGTGTGAGATTTATGGTTTCATCGGTGGTCTTTTTGGGTTTATATCCATCAAC
ACAATGGCACTAATTTCTCTGGATAGGTATTTTGTTATTGCCCAACCATTTCAAACAATGAAATCCCTGACAATCAAAAG
AGCAATAATCATGTTGGTTTTCGTATGGCTTTATTCATTAATTTGGTCAACACCGCCATTTTTTGGATATGGAAATTATG
TGCCGGAAGGATTTCAAACGTCTTGTACATTCGACTATTTGACCCAATCAAAAGGTAACATAATATTCAATATTGGGATG
TACATAGGAAATTTCATAATTCCCGTTGGAATAATTATATTTTGCTATTATCAAATTGTCAAAGCAGTGCGAGTACATGA
ATTAGAAATGTTAAAAATGGCTCAAAAGATGAATGCATCTCATCCAACTTCCATGAAAACGGGTGCAAAAAAGGCTGATG
TTCAAGCTGCAAAGATTTCTGTCATAATTGTCTTTTTATATATGTTATCATGGACACCATATGCAATAATTGCCCTTATG
GCTCTCACAGGGCGTAGAGATCATCTGAATCCATACACTGCAGAATTGCCGGTACTCTTTGCTAAGACCTCAGCTATGTA
CAACCCATTTATATACGCAATAAATCATCCAAAATTTCGAATTCAGCTGGAAAAGAAATTTCCATGTTTGATTTGTTGCT
GTCCACCAAAACCAAAAGAAAGGGACACTACAAGTGCAGCATCAGCAACGAAACCGAGTAAATATCAGAGTGAAAGAGAA
AGTTCAATGTCTCAACTGGATCCTGAAGACGATAAACAAGTCGTAGAAACCACCAAGAATCAAACCACAAGTGGACATAC
AAATGAAGCTTACGAGAGTGAACAGAAGTAGTTGATGAAACTAAATTATTCTATTTTTAATGACACTAGATCTTTATAAT
AATTTTATTTAAGGGAATGAGCACTGAATTTTGCGCAAAT
>SMED30018592 ID=SMED30018592|Name=ovo|organism=Schmidtea mediterranea sexual|type=transcript|length=1211bp
GTCATATTGAACACTGAGACTAGCTATCAATAGCTGACAATTAGACGTATAAAATGTTAGGGTACGCCTTTTTGGCCATT
ATTTCACACCAAAATTTCCATGAGTATTTTTCTAATAAGCACTCTACTCGCAAACGATGACGAAATGCCCACAGATTTGT
CATCGAAAACTGAAAAGATTGAAAACCATGAAAAATCTGAAAGGAATCTCTGCAAGTATTCCAGTCAGTTTCTTTCCTGT
TTTTATTCACAGGAAATGTTGACACTACTTATGAGAAAAAATTTCATCAATCAATATTCATTTTATTTAAAGATTTTCTC
GGGGTTTCCACAATTCGTCGATAACTTCAACTTAGTAAATCCAACAGATTTCACCGTCAATTCAAATTCAACAACAATTT
TGCCCTCATTCAACTTCCATAAAACGTCATTGAATATCGAAATGAACACCTCACTGGCCAATTCTTCAAGCACTGGTAGG
TCGTCTCCAACTGAAACTGTGTCTGAAAATCTTTGGTTAGAAAAAGTAAAGGTGGAAAAATATTTCCATTTAATTGAAAA
TCTATCACAATCCCAAGAGAACATTGAAGACATTGTCAAAACGATCAAAGTCAAACGAAGAAATTTTGCTGAATATATTA
AGAAACTTTACCTAAGTGATCCAGCCAAATTTAAGTTGACAAATGGTGGAGATGGAATAGTAAATCCATTTAGAAAACAA
TTCAAAGAAGAACGAGATAAATCTATGGACAAATTTTGCATCGAAGTTAATCACAATTATCAATGTAAGATATGTAACAA
GGTGTTTCCTTCCAAAAAGCACATGCAACGTCATATACGTTCACACGGTGTAAATTTTGATTGGTTGTGTAAATATTGTT
TTAAACCGTTTATTGATTCCTACGATTTAAAACGACATACGAGAGTCCATACAGGAGTTCAACCATACAAATGTCAAAGT
TGCACAAGAAAATTCAGTCAACGATGCTCATTGGAAAGTCATCAGGTGAAAATCCATGGAGTAGCACTGAATTATCTATA
CAAAGAAAGAAGGAACAAGTTGTATCCGTGTGAAATCTGCAGTTATAGTACGTCTTGTAAAGCAACTTGGTTGAGTCACA
TCATTCAGGAGCACCCGAATTCACTTTATGCAAAAGAAGAAGCACTCAAAGGAAAATACAACTGACTTTGAAAAATATTG
ATTTTTCAAGC

 

back to top





PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in eye. Click this link to learn more about PAGE.


PAGE Curations: 74


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
eyeSMED30034479EYE53-1 BK007033.1smed_ncbi_20200123PMID:18287199
eyeSMED30034479EYE53-1 BK007033.1smed_ncbi_20200123PMID:21806978
eyeSMED30034479EYE53-1 BK007033.1smed_ncbi_20200123PMID:23318635
eyeSMED30034479EYE53-1 BK007033.1smed_ncbi_20200123PMID:17905225
eyeSMED30034479EYE53-1 BK007033.1smed_ncbi_20200123PMID:26884331
eyeSMED30007858netrin receptor-like proteinSMESG000042475.1 DQ086493smed_ncbi_20200123PMID:16033796
eyeSMED30003366distal-lessSMESG000045025.1 SMED30003366smed_20140614PMID:27034770
eyeSMED30003366distal-lessSMESG000045025.1 SmedASXL_012281SmedAsxl_ww_GCZZ01PMID:27034770
eyeSMED30003366distal-lessSMESG000045025.1 JN983829smed_ncbi_20200123PMID:27034770
eyeSMED30011934sp6-9SMESG000050160.1 sp6-9smed_ncbi_20200123PMID:21852957
eyeSMED30011934sp6-9SMESG000050160.1 sp6-9smed_ncbi_20200123PMID:25254346
eyeSMED30011934sp6-9SMESG000050160.1 Contig37509newmark_estsPMID:27612384
eyeSMED30011934sp6-9SMESG000050160.1 Contig37509uc_Smed_v2PMID:27612384
eyeSMED30008787innexin-1SMESG000043134.1 Contig38798newmark_estsPMID:27612384
eyeSMED30008787innexin-1SMESG000043134.1 Contig38798uc_Smed_v2PMID:27612384
eyeSMED30007698Zinc finger protein 28SMESG000041575.1 Contig34061newmark_estsPMID:27612384
eyeSMED30007698Zinc finger protein 28SMESG000041575.1 Contig34061uc_Smed_v2PMID:27612384
eyeSMED30004839SMED30004839SMESG000054763.1 SMESG000054762.1 SMESG000037691.1 SMESG000037688.1 Contig28920newmark_estsPMID:27612384
eyeSMED30004839SMED30004839SMESG000054763.1 SMESG000054762.1 SMESG000037691.1 SMESG000037688.1 Contig28920uc_Smed_v2PMID:27612384
eyeSMED30018592ovoSMESG000081129.1 JX091074smed_ncbi_20200123PMID:22884275
eyeSMED30018592ovoSMESG000081129.1 JX091074smed_ncbi_20200123PMID:28072387
eyeSMED30018592ovoSMESG000081129.1 JX091074smed_ncbi_20200123PMID:28072387
eyeSMED30018592ovoSMESG000081129.1 JX091074smed_ncbi_20200123PMID:28072387
eyeSMED30018592ovoSMESG000081129.1 SMED30018592smed_20140614PMID:28072387
eyeSMED30018592ovoSMESG000081129.1 SMED30018592smed_20140614PMID:28072387
eyeSMED30018592ovoSMESG000081129.1 SMED30018592smed_20140614PMID:28072387
eyeSMED30018592ovoSMESG000081129.1 ovosmed_ncbi_20200123PMID:28072387
eyeSMED30018592ovoSMESG000081129.1 ovosmed_ncbi_20200123PMID:28072387
eyeSMED30018592ovoSMESG000081129.1 ovosmed_ncbi_20200123PMID:25254346
eyeSMED30018592ovoSMESG000081129.1 ovosmed_ncbi_20200123PMID:28072387
eyeSMED30015071Eyes absent homologSMESG000001561.1 SMED30015071smed_20140614PMID:25254346
eyeSMED30007326otxASMESG000031965.1 JN983826.1smed_ncbi_20200123PMID:21852957
eyeSMED30020439aadc SMESG000066844.1 KC568452smed_ncbi_20200123PMID:24131630
eyeSMED30032892foxQ2SMESG000062929.1 SMED30032892smed_20140614PMID:25254346
eyeSMED30030594OpsinSMESG000074489.1 SmedASXL_005730SmedAsxl_ww_GCZZ01PMID:29158443
eyeSMED30030594OpsinSMESG000074489.1 AF112361smed_ncbi_20200123PMID:30485821
eyeSMED30025778SOXB1-1SMESG000011244.1 SMED30025778smed_20140614PMID:25254346
eyeSMED30031425Homeobox protein Hox-D12SMESG000003389.1 SMED30031425smed_20140614PMID:27034770
eyeSMED30002918InnexinSMESG000000555.1 Contig34604newmark_estsPMID:27612384
eyeSMED30002918InnexinSMESG000000555.1 Contig34604uc_Smed_v2PMID:27612384
eyeSMED30012020tphSMESG000000522.1 SMESG000000520.1 tphsmed_ncbi_20200123PMID:25558068
eyeSMED30009712epidermal growth factor receptor 1SMESG000070834.1 Contig29100newmark_estsPMID:27612384
eyeSMED30009712epidermal growth factor receptor 1SMESG000070834.1 Contig29100uc_Smed_v2PMID:27612384
eyeSMED30013770JmjC domain-containing proteinSMESG000028946.1 Contig55456newmark_estsPMID:27612384
eyeSMED30013770JmjC domain-containing proteinSMESG000028946.1 Contig55456uc_Smed_v2PMID:27612384
eyeSMED30009456SMED30009456SMESG000039758.1 GU295180.1smed_ncbi_20200123PMID:26884331
eyeSMED30014877BMPSMESG000013937.1 EF633689.1smed_ncbi_20200123PMID:22451003
eyeSMED30012447FilaminSMESG000064795.1 Contig18792newmark_estsPMID:27612384
eyeSMED30012447FilaminSMESG000064795.1 Contig18792uc_Smed_v2PMID:27612384
eyeSMED30012447FilaminSMESG000064795.1 Contig38577newmark_estsPMID:27612384
eyeSMED30012447FilaminSMESG000064795.1 Contig38577uc_Smed_v2PMID:27612384
eyeSMED30011526SMED30011526SMESG000064795.1 Contig18792newmark_estsPMID:27612384
eyeSMED30011526SMED30011526SMESG000064795.1 Contig18792uc_Smed_v2PMID:27612384
eyeSMED30011526SMED30011526SMESG000064795.1 Contig38577newmark_estsPMID:27612384
eyeSMED30011526SMED30011526SMESG000064795.1 Contig38577uc_Smed_v2PMID:27612384
eyeSMED30032370Beta-1,3-glucosyltransferaseSMESG000009947.1 Contig40970newmark_estsPMID:27612384
eyeSMED30032370Beta-1,3-glucosyltransferaseSMESG000009947.1 Contig40970uc_Smed_v2PMID:27612384
eyeSMED30027813A disintegrin and metalloproteinase with thrombospondin motifsSMESG000038885.1 Contig12938newmark_estsPMID:27612384
eyeSMED30027813A disintegrin and metalloproteinase with thrombospondin motifsSMESG000038885.1 Contig12938uc_Smed_v2PMID:27612384
eyeSMED30024778SMB domain-containing proteinSMESG000022577.1 Contig50773newmark_estsPMID:27612384
eyeSMED30024778SMB domain-containing proteinSMESG000022577.1 Contig50773uc_Smed_v2PMID:27612384
eyeSMED30027751SMED30027751SMESG000054763.1 SMESG000054762.1 SMESG000037691.1 SMESG000037688.1 Contig28920newmark_estsPMID:27612384
eyeSMED30027751SMED30027751SMESG000054763.1 SMESG000054762.1 SMESG000037691.1 SMESG000037688.1 Contig28920uc_Smed_v2PMID:27612384
eyeSMED30029236Uro-adherence factor ASMESG000076818.1 Contig27612newmark_estsPMID:27612384
eyeSMED30029236Uro-adherence factor ASMESG000076818.1 Contig27612uc_Smed_v2PMID:27612384
eyeSMED30022422Tetratricopeptide repeat protein 39BSMESG000031495.1 Contig11545newmark_estsPMID:27612384
eyeSMED30022422Tetratricopeptide repeat protein 39BSMESG000031495.1 Contig11545uc_Smed_v2PMID:27612384
eyeSMED30021430SID1 transmembrane family member 1SMESG000041575.1 Contig34061newmark_estsPMID:27612384
eyeSMED30021430SID1 transmembrane family member 1SMESG000041575.1 Contig34061uc_Smed_v2PMID:27612384
eyeSMED30025683Transcription factor 7-like 1SMESG000017328.1 Smed-TCF-2smed_ncbi_20200123PMID:28976975
eyeSMED30028961Inosine-5'-monophosphate dehydrogenaseSMESG000078264.1 Contig37052newmark_estsPMID:27612384
eyeSMED30028961Inosine-5'-monophosphate dehydrogenaseSMESG000078264.1 Contig37052uc_Smed_v2PMID:27612384
eyeSMED30026741klf klfsmed_ncbi_20200123PMID:25254346
eyeSMED30031540Neuropeptide-3SMESG000014460.1 BK007025.1smed_ncbi_20200123PMID:26884331

 

 

back to top