Category 3 cell

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ In Situ Hybridization Data

  ▻ Sequences

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  Category 3 cell


DEFINITON:

  Post-mitotic, mesenchymally located epidermal progenitors downstream of the Category 2 cells.


TERM DEFINITION CITATIONS:

  PMID:26114597, PMID:20040488, PMID:18786419, PMID:26457503


TERM CITATIONS:


TERM ID:

  PLANA:0000035


ABOUT THIS TERM:

Category 3 cell

  ↳is a epidermal progenitor cell, material entity and somatic cell

  ↳contained in tail, copulatory region, ventral region of the whole animal, posterior region of the whole animal, parapharyngeal region, prepharyngeal region, head, dorsal region of the whole animal and anterior region of the whole animal

  ↳develops from Category 2 cell

  ↳existence overlaps Stage 6, juvenile, Stage 5, asexual adult, adult hermaphrodite, Stage 8 and Stage 7

  ↳existence starts during or after Stage 5

  ↳part of integumental system


  → Category 4 cell develops from Category 3 cell



DEPICTED BY:


BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30018353Glycine amidinotransferase, mitochondrialAGAT-1Stage 5, Stage 6, Stage 7, Stage 8Category 3 cell, integumental system
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30018353 ID=SMED30018353|Name=Glycine amidinotransferase, mitochondrial|organism=Schmidtea mediterranea sexual|type=transcript|length=1408bp
CAAGGGTAGTTTGATTATTTAGAAAAAAAGGATTTCCACCGGTTTTCTGTGATAAAAATTGTACAAAAATGCTTACCAAA
ATTGCTAGATCTCTGCACGATCAGATTTCCATAAACGTTGTCAACAAATTGTCAGCTAGGTTATGCTCGTATACACCTGG
TAACAAAAAACACAGCCCGGTTTGGGCCTGGAATGAATGGGACCCATTAGAAGAAATCGTTTTGGGACTTCCAGATATGG
CATGTTGTCCAGAGATTTTACCAGAAGCCAAAGCTTGCATTTCGGAAAACAAATTTGATTTCCTTTTAAAACACAAAGGA
AAATATTGGAAGGATGTAATTGAACCAGAACACTACAAAATAATGCTAGATGAGCACAAGAACTTCATAAAGATTCTACA
AGGAGAAGGAGTTAAAGTCGTCCATCCAGAACCGATTGATTTCGCTAAAACGCTCTGTACTCCAAACTTTACTGCCCATG
GAGTCGACTGTGCGATGCCGAGAGATTTTCTATTAATTGTCGGAAATGAAATGATTGAGTCCACCATGACTTGGAGATCG
AGATATTTTGAATTTATGTGCTATAAAAAATTAATTAAAGATTACTGGAGCCGGGGCGCTAAATGGACAGCGGCACCAAA
GCCGATGTGTAAAGAAACACTTTTTAAAGAAAATTATCGTGCTGACGAAGATTCAACAGCATTTTTCGATGAAAAGACTT
CGATTCTAACGGAAGAGGAACCAGTTTTCGACGCCGCAGATTTCATTCGATGTGGTAGGGATATATTTGCGCATGTCAGT
CAGGTTAGCAACAATGCAGGAATTGAATGGGTACGTAGACATTTGGCACCGAAAGGAATTAGAGTTCATTCAATGAATTT
CGTTGACCCTAAACCAATGCATATTGACACGACACTTTTCACACCTCGGCCAGGCCTCGCGATAACATGCCCAGAAAGAC
CATGCTTACAAATTGGTATGCTTAAAAAAGCCGGCTGGGATGTTGTCGTTGCTCCTTATCCAGATATTGCAAAGAATTTC
CCATACTATATCAGCTCTCAATGGTTGTCTCTTAATGTTGTCATGTTGGATGAAAACCGAGTTCTCGTAGAGAAAGATGA
AATTGGAATTCAAAAACTGTTTGAAAAGTGTGGCATTACTCCTGTAAAAGTTCCATTCAAACACTGCTTTTCCATAGGAG
GTGGTATTCATTGCTGGACATCGGATGTTAGAAGGCGAGGAGACCTTCAAAACTATTTTGACTGGCCTCAAGAAATCTTG
GAGAAATTTGAAACTCACTGAATATCACAATTGAAAATATAAAGAACATAACTTTTCCAACGTATATTAATTATTTGTAA
TAAAATACACTGCTTACATCGTGTCAATTTTATTTACTGATTAATTAC
>SMED30009513 ID=SMED30009513|Name=Glycine amidinotransferase, mitochondrial|organism=Schmidtea mediterranea sexual|type=transcript|length=1650bp
AAATCTATATAAATCTTATATGATCCTTTGATGCTTTCAAAATTCAACCGAATCCTTCCATTAAACAGTGTTTATAAAAT
TAGCGCTCCAGCAGCCAACATCAAATATAGAAATTGTTGTAGCAAATCCTCAACAGATAAACCAACAAATAAGCGTAACA
GTCCCGTATGGAGCTGGAATGAATGGGATCCTTTGGAAGAAGTAATTGTTGGTGTACCTGATCATGGTGTAGTTCCATAT
CCTTATCCAGAAACAGCGGCATGCTTTGGAGAACGTTTAACAGAAAACTTTATGAAAAAATATGGAGGAAAATACTGGAG
TGACATCATGCCTAAAGAAGTTTGGAATAACGTTTTGAAGGAACATAAAGAATTCTGTAACATCCTAAAAGGCGAAGGTG
TGACTGTGGTTCATCCAACACCAATGGATATGAAAAAAGAATACGAAACTCCATATTTCAAATCTGTCGGTTTGGATGTT
GCATTTCCAAGAGATATAATTCTCGTAGTTGGCGATGAAATTATGGAAACAACGATGACTTGGAGGTCAAGATTTTGGGA
ATATCTTTGCTACAGACCATTGATGCTAGATTATTGGAAACGGGGAGCAAATTTTCAATCAGCACCAAAACCAGTGTGTA
GCGAAGAAAGTTTTAAAAAGGATTTTGACATTTCAGGCAATAAATTCGATGAGTTGGGATATGTAACAACTGAATTCGAA
CCGATGTTTGATGCCGCAGATTTCATGAGGGCTGGCCGAGATATTTTTGTTCAACAAAGTCACGTAACAAATGCCACTGG
AATTGAATGGATGCGTCGCCATTTAGCTGAAAAAGGAATTCGGTTACACTTGTTGAATTTCAATGATCCATATGCCATGC
ATATCGATGCTACATTTTTCACAGTGAAACCCGGATACTTAATAGAGAATCCTGAAGTCATAAATCCGTATGCTGATTAT
TTGAAGAAGGCCGGTTGGAAGATTGTGAAGGGTCCAAAACCAGCAGATAGATCAGACATGTATGAAGGCATGAGTTACAA
GTGGCTATCTATGAACGTTTTAGTTCTTGATCAAAAACGAGTGTTAGTTGAAAAGCGAGAGGTTGGAATGCACAAAATGT
TTGAGTCAATCGGCATGCAACCGATCAAAGTTGATTTCGGACATTGTTTCGCTGTTGGCGGAGGGTTGCATTGTTGGACT
TCCGATGTTCGAAGAAAAGGAACTCTGGAAAATTACTTTGATTGGCCACAAGAAGTATTGGAAAAAGTATCATTGGATAA
ATAAACAATAATAGTTGAACAAGCTCCTATACTATCAGCAAAATCGACACTATCGCTGATTATATATAAATATTTATATA
TTTTGATAAAATATGTATTTATAATTTTCTCTTATTTTATTGTTATGATAATTTATAAATTTGAATTTTACTTTGTTTGA
ATCATAAACATTTATTAAAGTTATTTGTCAAAAGATGAAAATTAAAACAAAACGTGTAATCATTGCTATCTTCAATCATG
TAACAAGAAATAATTGCAATTTATCTTTATGTTGAGATAGCTCTTAGAACGCTTGGACCGATAGCGCTAAACTGTATGTT
TTATGCTTCATTTAATTACTTGAATGATAAAGGAAATTTGTTTATTGTAC
>SMED30032169 ID=SMED30032169|Name=Glycine amidinotransferase, mitochondrial|organism=Schmidtea mediterranea sexual|type=transcript|length=1380bp
CGTGTTTCTGCCAGAATCCAAGTTTGGTAGGGTGGGTGGAGTAGGCTTTTATATCATATCTAAATCTGAAAATGAATTTT
TATCATCATATTTTCTCAAATGTTGTCTGTATTACGACAAATTAGCCATTCAAAATCTGCCATTTCTTCGAAAATATCGG
TAATTCACATTTCAAAGTACTTCGGTCATTATTCATGCCACGATGAAAAGAAACAGACTTCTCCAGTTTGGGCTTGGAAT
GAATGGGATCCACTTGAAGAAGTTGTGGTCGGTGTTCCTAATAATGCAACTTTGCCCTTTCCATCACAGGAAGTAGCAGC
CACTTTTGGACCCCCTAGACTTCCATTTTTTCAAAAACATGGTGGCAAAAAATTCTCAGAGGTTATGGGTCAAGAAATGT
GGATGAAAATTGAAAATGAAATAAAAGAATTAGTAAGAGTATTAGAGGGAGAAGGTGTAAAAGTTGTGCAACCAGAGGCT
ATAGATTACGATCAAAAGTGGACTACGCCAAAGTTTTCTTCAACAGGTTTGTATGCCGCTATGCCAAGAGATTTTTTACT
TATCGTTGGTGATGAAATCATTGAATCCCCTATGGCTTGGAGGTGTAGATACTTTGAATACGAAGCATACAGACCACTTA
TTCGAAAATATTTTAATGAAGGAGCCAGATGGACATCGGCTCCTAAATGCACTATGGAAGACGCTCTCTATGATATGGAA
TTCGATGTTGCTCAAGAGAAACCATATGTGTATGTAACAACTGAATTAGAACCATGTTTTGATGCGGCTGACTTTACAAG
AATTGGCAGGGATATTTTTGGTCAAAGAAGTCATGTAACCAACAAAAAGGCAATACAGTGGCTCCGGCGTCATTTAGCTC
CTAGTGGAGTCAGGGTCCATGACATTGAATTTGACTCTCTCTATTCAATGCATATTGATACCAATTTTTTCCCCGTGAAA
CCTGGTATGTTTTTACTTAAAGATGGACTCAATTGTAAAACCCCGGATCTATTAAAAAAATCTAAATGGGACATAGTCAT
TATGCCAAAAGGACCTCATCGAGACGAGCATTACAAATGGATGAATTATCACGGATTACCGAACAATATGCTCAGTATAG
ACACAGAGAGGGTCCTAGTTGAGAAAACCGAAGAATACATGATAAAATTCATGCAAGAAATTGGATTCAAACCGATTCCA
GTTTCGCTTAAATTCGCAAATAATCTAGGAGGGGGCTTCCACTGCTGGACAGCGGACATCAGACGGCGAGGAAAACTAGA
AAGCTATTTTGAGTGGCCAGATGAGATTTTGGAGCGATTGACTCCATAAATCGGAAATATTAAATTAAAAAATATTTTTT
GTTTTAATTTTCTATACAAT

 

back to top



PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in Category 3 cell. Click this link to learn more about PAGE.


PAGE Curations: 525


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
Category 3 cellSMED30022933SMED30022933SMESG000007221.1 dd_Smed_v4_38861_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30028892SMED30028892SMESG000010564.1 dd_Smed_v4_8271_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30023961RING finger protein 150SMESG000026513.1 dd_Smed_v4_5532_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30026081SMED30026081 dd_Smed_v4_21173_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30029055Protein-tyrosine-phosphataseSMESG000055801.1 dd_Smed_v4_4629_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30020601SMED30020601 dd_Smed_v4_53499_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30032980DDE_Tnp_IS1595 domain-containing protein dd_Smed_v4_23804_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30035267Alkylglycerol monooxygenaseSMESG000043173.1 dd_Smed_v4_3673_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30025272Laminin subunit gamma-1SMESG000019909.1 dd_Smed_v4_7359_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30033184SMED30033184 dd_Smed_v4_16881_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30023436MFS domain-containing proteinSMESG000000088.1 dd_Smed_v4_35070_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30020042SMED30020042SMESG000014768.1 dd_Smed_v4_6346_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30026041SMED30026041 dd_Smed_v4_16497_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30027833Guanylate cyclaseSMESG000079311.1 dd_Smed_v4_15400_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30025596Ca(2 )/calmodulin-responsive adenylate cyclaseSMESG000023584.1 dd_Smed_v4_4439_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30028261InnexinSMESG000030970.1 dd_Smed_v4_6798_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30030202BAR domain-containing proteinSMESG000043769.1 dd_Smed_v4_5879_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30028476Glutamate receptor, ionotropic kainateSMESG000080378.1 dd_Smed_v4_34941_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30028417Bardet-Biedl syndrome 1 protein homologSMESG000009880.1 dd_Smed_v4_7298_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult fluorescence in situ hybridization evidence
Category 3 cellSMED30027137SMED30027137 dd_Smed_v4_13786_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30025171SMED30025171SMESG000014769.1 dd_Smed_v4_1952_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30019369SMED30019369SMESG000042765.1 dd_Smed_v4_2147_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30004121SMED30004121SMESG000014792.1 dd_Smed_v4_694_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30016212Protocadherin gamma-B5SMESG000016762.1 dd_Smed_v4_10495_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30032538MFS domain-containing proteinSMESG000055803.1 dd_Smed_v4_5294_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30021257Synaptic vesicle 2-related proteinSMESG000069049.1 SMESG000069045.1 dd_Smed_v4_12695_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30028142SMED30028142SMESG000061765.1 SMESG000061762.1 dd_Smed_v4_379_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30027207Ornithine decarboxylaseSMESG000055750.1 dd_Smed_v4_5493_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30030958SMED30030958SMESG000016877.1 dd_Smed_v4_10004_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30026414MPV17 mitochondrial membrane protein-like 2SMESG000062744.1 dd_Smed_v4_4214_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30009513Glycine amidinotransferase, mitochondrialSMESG000051953.1 H.56.4hsmed_ncbi_20200123PMID:18786419
Eisenhoffer et al., 2008
whole organism asexual adult cDNA to DNA expression microarray evidence
Category 3 cellSMED30009513Glycine amidinotransferase, mitochondrialSMESG000051953.1 H.56.4hsmed_ncbi_20200123PMID:18786419
Eisenhoffer et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
Category 3 cellSMED30011402Ras familySMESG000007281.1 H.18.4ancbi_smed_estsPMID:18786419
Eisenhoffer et al., 2008
whole organism asexual adult cDNA to DNA expression microarray evidence
Category 3 cellSMED30011402Ras familySMESG000007281.1 H.18.4ancbi_smed_estsPMID:18786419
Eisenhoffer et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
Category 3 cellSMED30011402Ras familySMESG000007281.1 H.18.4asmed_ncbi_20200123PMID:18786419
Eisenhoffer et al., 2008
whole organism asexual adult cDNA to DNA expression microarray evidence
Category 3 cellSMED30011402Ras familySMESG000007281.1 H.18.4asmed_ncbi_20200123PMID:18786419
Eisenhoffer et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
Category 3 cellSMED30019154Glycine amidinotransferase mitochondrialSMESG000068402.1 NB.2.5dncbi_smed_estsPMID:18786419
Eisenhoffer et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
Category 3 cellSMED30019154Glycine amidinotransferase mitochondrialSMESG000068402.1 NB.2.5dncbi_smed_estsPMID:18786419
Eisenhoffer et al., 2008
whole organism asexual adult cDNA to DNA expression microarray evidence
Category 3 cellSMED30018353Glycine amidinotransferase, mitochondrialSMESG000051964.1 NB.8.8bsmed_ncbi_20200123PMID:18786419
Eisenhoffer et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
Category 3 cellSMED30018353Glycine amidinotransferase, mitochondrialSMESG000051964.1 NB.8.8bsmed_ncbi_20200123PMID:18786419
Eisenhoffer et al., 2008
whole organism asexual adult cDNA to DNA expression microarray evidence
Category 3 cellSMED30001325slc25a-12SMESG000064880.1 H.45.8gsmed_ncbi_20200123PMID:18786419
Eisenhoffer et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
Category 3 cellSMED30001325slc25a-12SMESG000064880.1 H.45.8gsmed_ncbi_20200123PMID:18786419
Eisenhoffer et al., 2008
whole organism asexual adult cDNA to DNA expression microarray evidence
Category 3 cellSMED30027207Ornithine decarboxylaseSMESG000055750.1 H.63.4csmed_ncbi_20200123PMID:18786419
Eisenhoffer et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
Category 3 cellSMED30027207Ornithine decarboxylaseSMESG000055750.1 H.63.4csmed_ncbi_20200123PMID:18786419
Eisenhoffer et al., 2008
whole organism asexual adult cDNA to DNA expression microarray evidence
Category 3 cellSMED30033621Ornithine decarboxylaseSMESG000041045.1 dd_Smed_v4_8195_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30028506SMED30028506 dd_Smed_v4_20920_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30029717SMED30029717SMESG000018042.1 dd_Smed_v4_11486_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30024902C2H2-type domain-containing proteinSMESG000014973.1 dd_Smed_v4_11893_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30026350slc26a-8SMESG000064562.1 dd_Smed_v4_4250_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30034839SMED30034839SMESG000042050.1 dd_Smed_v4_14160_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30021298SMED30021298 dd_Smed_v4_21183_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30020944SMED30020944 dd_Smed_v4_15635_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30024165SMED30024165 dd_Smed_v4_2664_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30005357hypothetical proteinSMESG000027979.1 dd_Smed_v4_775_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30014220SMED30014220SMESG000052497.1 dd_Smed_v4_2843_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30007566Voltage-dependent calcium channel subunit alpha-2/delta-3SMESG000020654.1 dd_Smed_v4_16278_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30013950gdf-like proteinSMESG000080854.1 dd_Smed_v4_26705_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30002693SMED30002693SMESG000078700.1 dd_Smed_v4_15736_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30007738SMED30007738SMESG000035479.1 dd_Smed_v4_19930_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30018430Active breakpoint cluster region-related proteinSMESG000025211.1 dd_Smed_v4_4507_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30002992SMED30002992SMESG000012171.1 dd_Smed_v4_247_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30019017SMED30019017SMESG000074220.1 dd_Smed_v4_22388_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30001853Protein kinase domain-containing proteinSMESG000003859.1 dd_Smed_v4_1897_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30003274X1.A.C4.1SMESG000079273.1 dd_Smed_v4_3278_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30005429SMED30005429SMESG000030956.1 SMESG000030911.1 dd_Smed_v4_902_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30007370SMED30007370SMESG000045571.1 dd_Smed_v4_7603_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30008591Zinc finger MYM-type protein 1SMESG000042369.1 dd_Smed_v4_12925_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30010366slc25a-19SMESG000020909.1 SMESG000020904.1 dd_Smed_v4_10436_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30009513Glycine amidinotransferase, mitochondrialSMESG000051953.1 dd_Smed_v4_899_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30011700Calcium-binding protein ASMESG000052083.1 SMESG000048475.1 dd_Smed_v4_605_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30012110C2H2-type domain-containing proteinSMESG000064731.1 dd_Smed_v4_18947_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30012310SMED30012310SMESG000028761.1 dd_Smed_v4_5231_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30016267beta-secretase 1SMESG000037819.1 dd_Smed_v4_4132_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30010746Bestrophin homologSMESG000003961.1 dd_Smed_v4_33028_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30002098carboxypeptidase ESMESG000062760.1 dd_Smed_v4_4210_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30007756SMED30007756SMESG000007194.1 dd_Smed_v4_15484_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30017770Zinc finger MYM-type protein 1SMESG000042369.1 dd_Smed_v4_12925_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30000261Ig-like domain-containing proteinSMESG000044415.1 dd_Smed_v4_8619_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30010406SMED30010406SMESG000009335.1 dd_Smed_v4_18243_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30007084TNF receptor-associated factorSMESG000053469.1 dd_Smed_v4_13061_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult fluorescence in situ hybridization evidence
Category 3 cellSMED30019936slc16a-7SMESG000023800.1 SMESG000016424.1 dd_Smed_v4_16824_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30000032SMED30000032SMESG000064381.1 dd_Smed_v4_2460_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30000850slc7a-8SMESG000006721.1 dd_Smed_v4_12027_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30006057SMED30006057SMESG000064381.1 dd_Smed_v4_2460_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30000995Pyruvate kinaseSMESG000052083.1 SMESG000048475.1 dd_Smed_v4_605_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30035490SMED30035490SMESG000042765.1 dd_Smed_v4_5159_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30034257CRAL-TRIO domain-containing proteinSMESG000009988.1 dd_Smed_v4_3680_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30028236slc16a-2SMESG000026519.1 dd_Smed_v4_8997_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30025375SMED30025375SMESG000035479.1 dd_Smed_v4_19930_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30031568Cytochrome P450 2L1SMESG000050434.1 dd_Smed_v4_5307_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30033585Elongation of very long chain fatty acids proteinSMESG000021565.1 dd_Smed_v4_523_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30027156SMED30027156SMESG000038687.1 SMESG000038673.1 dd_Smed_v4_1013_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30021793Pmp-10SMESG000068743.1 dd_Smed_v4_2178_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30029539Protocadherin Fat 4SMESG000002878.1 dd_Smed_v4_30149_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30030422SMED30030422SMESG000077265.1 dd_Smed_v4_830_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30030192SMED30030192SMESG000055517.1 dd_Smed_v4_8042_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30030464SMED30030464SMESG000029581.1 SMESG000029574.1 dd_Smed_v4_135_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30032006slc7a-2SMESG000031905.1 dd_Smed_v4_16390_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30020157SMED30020157SMESG000042369.1 dd_Smed_v4_12925_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30024954X1.C4.1SMESG000043890.1 SMESG000043321.1 SMESG000043310.1 SMESG000043263.1 SMESG000020012.1 SMESG000019997.1 dd_Smed_v4_517_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30029159SMED30029159SMESG000029594.1 SMESG000029589.1 dd_Smed_v4_315_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30032169Glycine amidinotransferase, mitochondrialSMESG000043142.1 dd_Smed_v4_1943_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30023530Peptidase M20 domain-containing protein 2SMESG000049098.1 dd_Smed_v4_7395_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30030292Cytochrome P450, family 1, subfamily D, polypeptide 1SMESG000012534.1 dd_Smed_v4_2162_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30021619X1.C4.1SMESG000043890.1 SMESG000043321.1 SMESG000043310.1 SMESG000043263.1 SMESG000020012.1 SMESG000019997.1 dd_Smed_v4_517_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30029960SMED30029960SMESG000056926.1 dd_Smed_v4_270_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30029873SMED30029873SMESG000042500.1 dd_Smed_v4_5474_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30029873SMED30029873SMESG000042500.1 dd_Smed_v4_7038_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30022783X1.C4.1SMESG000043890.1 SMESG000043321.1 SMESG000043310.1 SMESG000043263.1 SMESG000020012.1 SMESG000019997.1 dd_Smed_v4_517_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30035874SMED30035874SMESG000043890.1 SMESG000043321.1 SMESG000043310.1 SMESG000043263.1 SMESG000020012.1 SMESG000019997.1 dd_Smed_v4_517_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30025603SMED30025603SMESG000018472.1 dd_Smed_v4_3226_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30027266SMED30027266SMESG000041022.1 dd_Smed_v4_7160_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30031756SMED30031756SMESG000043890.1 SMESG000043321.1 SMESG000043310.1 SMESG000043263.1 SMESG000020012.1 SMESG000019997.1 dd_Smed_v4_517_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30031869SMED30031869SMESG000055717.1 dd_Smed_v4_2079_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30030642Cytochrome P450 2C3SMESG000023530.1 SMESG000023528.1 dd_Smed_v4_7874_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30020794SMED30020794SMESG000056235.1 dd_Smed_v4_1413_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30021542SMED30021542SMESG000074220.1 dd_Smed_v4_22388_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30034746Ornithine decarboxylase-1SMESG000062429.1 dd_Smed_v4_6130_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30008715Dimer_Tnp_hAT domain-containing proteinSMESG000010564.1 dd_Smed_v4_8271_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30011291Acidic phospholipase A2SMESG000079712.1 dd_Smed_v4_2969_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30009021SMED30009021 dd_Smed_v4_31431_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30000058SMED30000058SMESG000022049.1 dd_Smed_v4_499_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30006083SMED30006083SMESG000061797.1 dd_Smed_v4_6028_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30018929Glycine N-acyltransferase 3SMESG000063826.1 dd_Smed_v4_5477_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30019154Glycine amidinotransferase mitochondrialSMESG000068402.1 dd_Smed_v4_2385_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30013415Fibronectin type III and ankyrin repeat domains 1SMESG000029032.1 dd_Smed_v4_34489_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30006968SMED30006968 dd_Smed_v4_55350_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30014006MFS domain-containing proteinSMESG000060691.1 dd_Smed_v4_3455_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30014713SMED30014713SMESG000061767.1 dd_Smed_v4_767_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30008964SMED30008964SMESG000010167.1 dd_Smed_v4_8925_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30014067Integrase catalytic domain-containing protein dd_Smed_v4_16497_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30004033SMED30004033 dd_Smed_v4_33434_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30016515SMED30016515SMESG000023204.1 dd_Smed_v4_38949_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30016382SMED30016382SMESG000029089.1 dd_Smed_v4_2873_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30008120SMED30008120SMESG000042787.1 dd_Smed_v4_263_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30011135MFS domain-containing proteinSMESG000060691.1 dd_Smed_v4_3455_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30011447SMED30011447SMESG000034829.1 dd_Smed_v4_1321_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30015561SMED30015561 dd_Smed_v4_6429_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30000827SMED30000827SMESG000043280.1 dd_Smed_v4_278_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30006777Collagen alpha-1(XV) chainSMESG000081921.1 dd_Smed_v4_3516_1_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30018353Glycine amidinotransferase, mitochondrialSMESG000051964.1 dd_Smed_v4_920_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30006734SMED30006734SMESG000010564.1 dd_Smed_v4_8271_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30011140Argininosuccinate synthaseSMESG000053053.1 SMESG000053052.1 dd_Smed_v4_3086_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30002356SMED30002356SMESG000069796.1 dd_Smed_v4_4492_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30000995Pyruvate kinaseSMESG000052083.1 SMESG000048475.1 dd_Smed_v6_605_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30035490SMED30035490SMESG000042765.1 dd_Smed_v6_5159_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30034257CRAL-TRIO domain-containing proteinSMESG000009988.1 dd_Smed_v6_3680_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30031568Cytochrome P450 2L1SMESG000050434.1 dd_Smed_v6_5307_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30033585Elongation of very long chain fatty acids proteinSMESG000021565.1 dd_Smed_v6_523_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30027156SMED30027156SMESG000038687.1 SMESG000038673.1 dd_Smed_v6_1013_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30029823MFS domain-containing proteinSMESG000000287.1 SMESG000000110.1 dd_Smed_v6_11835_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30024106Mitochondrial ATP synthase subunit 9SMESG000059768.1 dd_Smed_v6_401_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30021793Pmp-10SMESG000068743.1 dd_Smed_v6_2178_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30030422SMED30030422SMESG000077265.1 dd_Smed_v6_830_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30030192SMED30030192SMESG000055517.1 dd_Smed_v6_8042_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30024954X1.C4.1SMESG000043890.1 SMESG000043321.1 SMESG000043310.1 SMESG000043263.1 SMESG000020012.1 SMESG000019997.1 dd_Smed_v6_517_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30029159SMED30029159SMESG000029594.1 SMESG000029589.1 dd_Smed_v6_315_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30032169Glycine amidinotransferase, mitochondrialSMESG000043142.1 dd_Smed_v6_1943_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30023536Microsomal glutathione S-transferase 3SMESG000078588.1 dd_Smed_v6_1661_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30023530Peptidase M20 domain-containing protein 2SMESG000049098.1 dd_Smed_v6_7395_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30026803X1.D.D8.3SMESG000053883.1 dd_Smed_v6_8540_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30034506Angiotensin-converting enzymeSMESG000005710.1 dd_Smed_v6_6160_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30030292Cytochrome P450, family 1, subfamily D, polypeptide 1SMESG000012534.1 dd_Smed_v6_2162_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30023489CDGSH iron sulfur domain-containing protein 3, mitochondrialSMESG000016828.1 dd_Smed_v6_935_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30035193Heat shock protein 90SMESG000071533.1 SMESG000071531.1 dd_Smed_v6_56_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30021619X1.C4.1SMESG000043890.1 SMESG000043321.1 SMESG000043310.1 SMESG000043263.1 SMESG000020012.1 SMESG000019997.1 dd_Smed_v6_517_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30029960SMED30029960SMESG000056926.1 dd_Smed_v6_270_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30030234Tubulin alpha chainSMESG000041107.1 dd_Smed_v6_758_1dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30028888Transmembrane emp24 domain-containing protein 10SMESG000024933.1 dd_Smed_v6_746_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30029873SMED30029873SMESG000042500.1 dd_Smed_v6_5474_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30029873SMED30029873SMESG000042500.1 dd_Smed_v6_7038_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30022783X1.C4.1SMESG000043890.1 SMESG000043321.1 SMESG000043310.1 SMESG000043263.1 SMESG000020012.1 SMESG000019997.1 dd_Smed_v6_517_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30035874SMED30035874SMESG000043890.1 SMESG000043321.1 SMESG000043310.1 SMESG000043263.1 SMESG000020012.1 SMESG000019997.1 dd_Smed_v6_517_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30027539MFS domain-containing proteinSMESG000000287.1 SMESG000000110.1 dd_Smed_v6_11835_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30025603SMED30025603SMESG000018472.1 dd_Smed_v6_3226_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30027266SMED30027266SMESG000041022.1 dd_Smed_v6_7160_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30031756SMED30031756SMESG000043890.1 SMESG000043321.1 SMESG000043310.1 SMESG000043263.1 SMESG000020012.1 SMESG000019997.1 dd_Smed_v6_517_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30031869SMED30031869SMESG000055717.1 dd_Smed_v6_2079_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30026646Dynein light chainSMESG000009941.1 dd_Smed_v6_107_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30022769Glycine receptor subunit alpha-3SMESG000061905.1 dd_Smed_v6_8110_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30020996ADP-ribosylation factor GTPase-activating protein 2SMESG000008345.1 dd_Smed_v6_539_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30030642Cytochrome P450 2C3SMESG000023530.1 SMESG000023528.1 dd_Smed_v6_7874_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30020794SMED30020794SMESG000056235.1 dd_Smed_v6_1413_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30034746Ornithine decarboxylase-1SMESG000062429.1 dd_Smed_v6_6130_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30011291Acidic phospholipase A2SMESG000079712.1 dd_Smed_v6_2969_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30000058SMED30000058SMESG000022049.1 dd_Smed_v6_499_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30006083SMED30006083SMESG000061797.1 dd_Smed_v6_6028_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30018929Glycine N-acyltransferase 3SMESG000063826.1 dd_Smed_v6_5477_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30019154Glycine amidinotransferase mitochondrialSMESG000068402.1 dd_Smed_v6_2385_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30015411GLTP domain-containing protein dd_Smed_v6_2621_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30011747SMED30011747 dd_Smed_v6_494_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30014713SMED30014713SMESG000061767.1 dd_Smed_v6_767_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30005470Selenoprotein W dd_Smed_v6_616_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30016382SMED30016382SMESG000029089.1 dd_Smed_v6_2873_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30008120SMED30008120SMESG000042787.1 dd_Smed_v6_263_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30012026SMED30012026 dd_Smed_v6_617_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30011447SMED30011447SMESG000034829.1 dd_Smed_v6_1321_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30000827SMED30000827SMESG000043280.1 dd_Smed_v6_278_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30009290SMED30009290 dd_Smed_v6_7103_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30018353Glycine amidinotransferase, mitochondrialSMESG000051964.1 dd_Smed_v6_920_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30016902CRAL-TRIO domain-containing proteinSMESG000009876.1 dd_Smed_v6_2760_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30016338Alpha-adducinSMESG000051636.1 dd_Smed_v6_2345_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30011140Argininosuccinate synthaseSMESG000053053.1 SMESG000053052.1 dd_Smed_v6_3086_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30017499SMED30017499 dd_Smed_v6_459_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30002356SMED30002356SMESG000069796.1 dd_Smed_v6_4492_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30031984Selenoprotein F dd_Smed_v6_304_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30024172SMED30024172 dd_Smed_v6_13035_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30029102SMED30029102SMESG000059907.1 dd_Smed_v6_1664_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30028513Transcriptional activator protein Pur-beta dd_Smed_v6_346_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30030707SMED30030707 dd_Smed_v6_13035_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30028204Succinyl-CoA:3-ketoacid-coenzyme A transferaseSMESG000080432.1 SMESG000080424.1 dd_Smed_v6_1189_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30025174Selenoprotein W dd_Smed_v6_1908_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30005523Alpha-actininSMESG000026000.1 dd_Smed_v6_1951_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30013480DihydropyrimidinaseSMESG000060188.1 dd_Smed_v6_2040_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30019369SMED30019369SMESG000042765.1 dd_Smed_v6_2147_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30004121SMED30004121SMESG000014792.1 dd_Smed_v6_694_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30018138SMED30018138SMESG000017277.1 SMESG000017274.1 SMESG000017276.1 dd_Smed_v6_1245_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30018138SMED30018138SMESG000017276.1 dd_Smed_v6_639_1dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30015020E3 ubiquitin-protein ligase XIAPSMESG000031958.1 dd_Smed_v6_2104_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30018637Heat shock cognate 70 kDa proteinSMESG000040632.1 dd_Smed_v6_15_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30018353Glycine amidinotransferase, mitochondrialSMESG000051964.1 SMED30018353smed_20140614PMID:24704339
Vogg et al., 2014
whole organism asexual adult fluorescence in situ hybridization evidence
Category 3 cellSMED30018353Glycine amidinotransferase, mitochondrialSMESG000051964.1 SMED30018353smed_20140614PMID:23318641
Chen et al., 2013
whole organism asexual adult fluorescence in situ hybridization evidence
Category 3 cellSMED30000746SMED30000746SMESG000024821.1 SMESG000024754.1 SmedASXL_008207SmedAsxl_ww_GCZZ01PMID:26114597
Zhu et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
Category 3 cellSMED30000850slc7a-8SMESG000006721.1 SmedASXL_001816SmedAsxl_ww_GCZZ01PMID:26114597
Zhu et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
Category 3 cellSMED30029823MFS domain-containing proteinSMESG000000287.1 SMESG000000110.1 SmedASXL_018064SmedAsxl_ww_GCZZ01PMID:26114597
Zhu et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
Category 3 cellSMED30033892SMED30033892SMESG000029612.1 SMESG000029602.1 SmedASXL_009684SmedAsxl_ww_GCZZ01PMID:26114597
Zhu et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
Category 3 cellSMED30026394SMED30026394SMESG000029612.1 SMESG000029602.1 SmedASXL_009684SmedAsxl_ww_GCZZ01PMID:26114597
Zhu et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
Category 3 cellSMED30030996hypothetical proteinSMESG000029612.1 SMESG000029602.1 SmedASXL_009684SmedAsxl_ww_GCZZ01PMID:26114597
Zhu et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
Category 3 cellSMED30027539MFS domain-containing proteinSMESG000000287.1 SMESG000000110.1 SmedASXL_018064SmedAsxl_ww_GCZZ01PMID:26114597
Zhu et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
Category 3 cellSMED30018353Glycine amidinotransferase, mitochondrialSMESG000051964.1 SMED30018353smed_20140614PMID:26114597
Zhu et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
Category 3 cellSMED30015704Hox class homeodomain protein DjAbd-Ba SMED30015704smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
Category 3 cellSMED30012332EGR-1SMESG000034285.1 SMED30012332smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
Category 3 cellSMED30008505SOXP-3SMESG000051170.1 SMED30008505smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
Category 3 cellSMED30029873SMED30029873SMESG000042500.1 SMED30029873smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
Category 3 cellSMED30015041Retinoic acid receptor betaSMESG000054304.1 SMED30015041smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
Category 3 cellSMED30000303HoxC12-like proteinSMESG000022668.1 SMED30000303smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
Category 3 cellSMED30006464TCF15SMESG000044395.1 SMED30006464smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
Category 3 cellSMED30019046SD2SMESG000021468.1 SMED30019046smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
Category 3 cellSMED30000485SMED30000485SMESG000069311.1 SMED30000485smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
Category 3 cellSMED30006353SMED30006353SMESG000004009.1 SMED30006353smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
Category 3 cellSMED30033839Sp5SMESG000023227.1 SMED30033839smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
Category 3 cellSMED30026364SMED-P53SMESG000078256.1 SMESG000078255.1 SMED30026364smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
Category 3 cellSMED30022628G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000060403.1 SMED30022628smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
Category 3 cellSMED30032499C2H2-type domain-containing proteinSMESG000075452.1 SMED30032499smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
Category 3 cellSMED30018353Glycine amidinotransferase, mitochondrialSMESG000051964.1 SMED30018353smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
Category 3 cellSMED30018353Glycine amidinotransferase, mitochondrialSMESG000051964.1 SMED30018353smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
Category 3 cellSMED30018353Glycine amidinotransferase, mitochondrialSMESG000051964.1 SMED30018353smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 5 colorimetric in situ hybridization evidence
Category 3 cellSMED30018353Glycine amidinotransferase, mitochondrialSMESG000051964.1 SMED30018353smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
Category 3 cellSMED30026364SMED-P53SMESG000078256.1 AY068713.3smed_ncbi_20200123PMID:20040488
Pearson et al., 2010
whole organism asexual adult fluorescence in situ hybridization evidence
Category 3 cellSMED30024368chromodomain helicase DNA-binding protein 4SMESG000068192.1 GU980571.1smed_ncbi_20200123PMID:26457503
Tu et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
Category 3 cellSMED30018353Glycine amidinotransferase, mitochondrialSMESG000051964.1 SMED30018353smed_20140614PMID:29357350
de Sousa et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
Category 3 cellSMED30018353Glycine amidinotransferase, mitochondrialSMESG000051964.1 SMED30018353smed_20140614PMID:23318635
Blassberg et al., 2013
whole organism asexual adult fluorescence in situ hybridization evidence
Category 3 cellSMED30017430Protein disulfide-isomeraseSMESG000023147.1 SMESG000017020.1 dd_Smed_v6_250_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30000771SMED30000771SMESG000059918.1 SMESG000052306.1 SMESG000022407.1 dd_Smed_v6_1996_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30000771SMED30000771SMESG000059918.1 SMESG000052306.1 SMESG000022407.1 dd_Smed_v6_474_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30030681SMED30030681SMESG000038678.1 dd_Smed_v6_327_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30025584SMED30025584SMESG000077266.1 dd_Smed_v6_1066_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30031061Nucleobindin-2SMESG000017142.1 dd_Smed_v6_6010_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30028938Protein disulfide-isomerase A6SMESG000023147.1 SMESG000017020.1 dd_Smed_v6_250_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30035250lipopolysaccharide-induced tumor necrosis factor-alpha factor homologSMESG000033033.1 dd_Smed_v6_2503_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30007770SMED30007770SMESG000059904.1 SMESG000042945.1 SMESG000007620.1 SMESG000072638.1 SMESG000039380.1 SMESG000042352.1 SMESG000028417.1 dd_Smed_v6_10138_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30008169EF-hand domain-containing proteinSMESG000026622.1 dd_Smed_v6_1881_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30005345SMED30005345SMESG000059907.1 dd_Smed_v6_125_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30001359SMED30001359SMESG000059918.1 SMESG000052306.1 SMESG000022407.1 dd_Smed_v6_1996_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30001359SMED30001359SMESG000059918.1 SMESG000052306.1 SMESG000022407.1 dd_Smed_v6_474_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30003259AminopeptidaseSMESG000039842.1 dd_Smed_v6_1249_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30001401SMED30001401SMESG000059904.1 SMESG000042945.1 SMESG000007620.1 SMESG000072638.1 SMESG000039380.1 SMESG000042352.1 SMESG000028417.1 dd_Smed_v6_10138_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30007718Flotillin-1SMESG000063612.1 dd_Smed_v6_1887_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30008553Phosphoenolpyruvate carboxykinase [GTP]SMESG000062868.1 dd_Smed_v6_196_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30002834SMED30002834SMESG000043420.1 dd_Smed_v6_460_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30003468Phosphoenolpyruvate carboxykinase [GTP]SMESG000073058.1 SMESG000003144.1 dd_Smed_v6_536_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30003086GTP-binding protein-like proteinSMESG000018556.1 dd_Smed_v6_589_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30002705SMED30002705SMESG000020813.1 dd_Smed_v6_3688_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30001586Spectrin alpha chainSMESG000005289.1 dd_Smed_v6_919_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30004267Actin, cytoplasmicSMESG000035518.1 dd_Smed_v6_232_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30001329SMED30001329SMESG000074407.1 SMESG000074416.1 dd_Smed_v6_3361_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30003482Endoplasmic reticulum chaperone BiPSMESG000061528.1 dd_Smed_v6_2648_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30005551Spectrin alpha chainSMESG000005289.1 dd_Smed_v6_919_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30002454Staphylococcal nuclease domain-containing proteinSMESG000062403.1 dd_Smed_v6_906_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30005231Polyadenylate-binding proteinSMESG000058745.1 dd_Smed_v6_93_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30004608Protein kinase domain-containing proteinSMESG000030766.1 dd_Smed_v6_85086_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30024881Actin, cytoplasmic 2SMESG000035518.1 dd_Smed_v6_218_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30025310SMED30025310SMESG000050440.1 dd_Smed_v6_1552_1dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30008609SMED30008609SMESG000059918.1 SMESG000052306.1 SMESG000022407.1 dd_Smed_v6_474_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30013893Histocompatibility (minor) 13SMESG000016697.1 dd_Smed_v6_1203_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30016392SMED30016392SMESG000059904.1 SMESG000042945.1 SMESG000007620.1 SMESG000072638.1 SMESG000039380.1 SMESG000042352.1 SMESG000028417.1 dd_Smed_v6_10138_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30011350Serine palmitoyltransferase 1SMESG000080769.1 SMESG000052311.1 dd_Smed_v6_1567_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30019431SMED30019431SMESG000032527.1 SMESG000022725.1 dd_Smed_v6_1563_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30008856SMED30008856SMESG000025888.1 dd_Smed_v6_1422_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30022249Clathrin interactor 1SMESG000032527.1 SMESG000022725.1 dd_Smed_v6_1563_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30022331Translocon-associated protein, gamma subunitSMESG000066628.1 dd_Smed_v6_1265_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30021590Spectrin beta chainSMESG000081696.1 dd_Smed_v6_1122_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30022677sphingolipid delta(4)-desaturase DES1SMESG000025057.1 dd_Smed_v6_1100_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30003044ReticulocalbinSMESG000077405.1 dd_Smed_v6_5905_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30006877SMED30006877SMESG000017277.1 SMESG000017274.1 SMESG000017276.1 dd_Smed_v6_1245_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30001824SMED30001824SMESG000026020.1 dd_Smed_v6_2027_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30018297Dynein light chainSMESG000019341.1 dd_Smed_v6_177_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30006074SMED30006074SMESG000019341.1 dd_Smed_v6_177_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30013107Glyceraldehyde-3-phosphate dehydrogenaseSMESG000052353.1 dd_Smed_v6_78_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30013241SMED30013241SMESG000007775.1 dd_Smed_v6_137_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30010405SMED30010405SMESG000043444.1 SMESG000043435.1 dd_Smed_v6_18_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30011623SMED30011623SMESG000043444.1 SMESG000043435.1 dd_Smed_v6_18_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30000428Glutathione S-transferaseSMESG000016836.1 dd_Smed_v6_816_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30030679Elongation of very long chain fatty acids proteinSMESG000068877.1 SMESG000068874.1 dd_Smed_v6_4252_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30025127Tigger transposable element-derived protein 1SMESG000068262.1 SMESG000053435.1 SMESG000049288.1 dd_Smed_v6_6797_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30035571Protein disulfide-isomerase A5SMESG000005268.1 dd_Smed_v6_1537_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30022078Translationally-controlled tumor protein homologSMESG000023212.1 dd_Smed_v6_136_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30032538MFS domain-containing proteinSMESG000055803.1 dd_Smed_v6_5294_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30026364SMED-P53SMESG000078256.1 SMESG000078255.1 dd_Smed_v6_5563_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30028142SMED30028142SMESG000061765.1 SMESG000061762.1 dd_Smed_v6_379_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30027542CRAL-TRIO domain-containing proteinSMESG000019717.1 dd_Smed_v6_1619_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30026513SMED30026513SMESG000005268.1 dd_Smed_v6_1537_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30027207Ornithine decarboxylaseSMESG000055750.1 dd_Smed_v6_5493_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30034254calreticulin-1SMESG000077304.1 SMESG000009012.1 dd_Smed_v6_220_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30021105Tubulin alpha chainSMESG000005506.1 SMESG000005505.1 SMESG000005493.1 SMESG000005489.1 SMESG000005487.1 dd_Smed_v6_38_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30031823Translocating chain-associated membrane proteinSMESG000051052.1 dd_Smed_v6_1740_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30028808calreticulin-2SMESG000077304.1 SMESG000009012.1 dd_Smed_v6_220_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30022628G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000060403.1 dd_Smed_v6_361_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30026414MPV17 mitochondrial membrane protein-like 2SMESG000062744.1 dd_Smed_v6_4214_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30025584SMED30025584SMESG000077266.1 dd_Smed_v4_1066_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30002489Apical junction component 1 homologSMESG000037093.1 dd_Smed_v4_11689_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30006091CA domain-containing proteinSMESG000044292.1 dd_Smed_v4_12872_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30002834SMED30002834SMESG000043420.1 dd_Smed_v4_460_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30031328slc7a-3SMESG000081300.1 dd_Smed_v4_11305_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30030952LITAF domain-containing proteinSMESG000020864.1 dd_Smed_v4_11813_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30034242SMED30034242SMESG000044292.1 dd_Smed_v4_12872_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30011491SMED30011491SMESG000011704.1 dd_Smed_v4_12109_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30016659slc22a-10SMESG000075938.1 dd_Smed_v4_12547_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30011944Synaptic vesicle 2-related proteinSMESG000020112.1 dd_Smed_v4_12720_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30014053Cationic amino acid transporter 4SMESG000081300.1 dd_Smed_v4_11305_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30018924SMED30018924SMESG000028420.1 dd_Smed_v4_468_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30013885SMED30013885SMESG000046850.1 dd_Smed_v4_9640_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30010951SMED30010951SMESG000076142.1 dd_Smed_v4_719_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30001471Cytochrome P450 2K1-like proteinSMESG000022101.1 SMESG000022100.1 dd_Smed_v4_11238_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30005740SMED30005740SMESG000029096.1 dd_Smed_v4_480_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30001567SMED30001567SMESG000022139.1 dd_Smed_v4_715_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30022130SMED30022130SMESG000026848.1 dd_Smed_v4_1128_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30020865AminopeptidaseSMESG000033900.1 SMESG000033518.1 SMESG000022330.1 SMESG000022279.1 SMESG000022278.1 dd_Smed_v4_4516_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED300249343-hydroxybutyrate dehydrogenase, type 1SMESG000039796.1 SMESG000039794.1 SMESG000039792.1 dd_Smed_v4_8012_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30010415pmp-10SMESG000068428.1 dd_Smed_v4_343_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30010404SMED30010404SMESG000076927.1 dd_Smed_v4_5958_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30018938InnexinSMESG000003944.1 dd_Smed_v4_39254_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30006180Fibrillar collagen NC1 domain-containing proteinSMESG000031448.1 dd_Smed_v4_702_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30027899slc26a-10SMESG000052008.1 SMESG000051986.1 dd_Smed_v4_5066_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30026973SMED30026973SMESG000033974.1 dd_Smed_v4_34155_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30029229SMED30029229SMESG000033974.1 dd_Smed_v4_34155_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30034619SMED30034619SMESG000029095.1 dd_Smed_v4_3913_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30001222persulfide dioxygenase ETHE1, mitochondrialSMESG000066719.1 SMESG000066710.1 dd_Smed_v4_4089_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30004312Parvo_coat_N domain-containing protein dd_Smed_v4_28220_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30008541Synaptotagmin-1 Synaptotagmin ISMESG000041533.1 dd_Smed_v4_20033_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30004351SMED30004351 dd_Smed_v4_15429_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30004513Gamma-aminobutyric acid type B receptorSMESG000049232.1 dd_Smed_v4_60992_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30000223OtoferlinSMESG000010367.1 dd_Smed_v4_3993_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30001916IRS-type PTB domain-containing proteinSMESG000027222.1 dd_Smed_v4_9490_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30008536SMED30008536 dd_Smed_v4_15429_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30005229Amine oxidaseSMESG000077616.1 dd_Smed_v4_20536_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30011193SMED30011193 dd_Smed_v4_21173_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30002813hypothetical proteinSMESG000024478.1 SMESG000024473.1 dd_Smed_v4_574_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30006449SMED30006449 dd_Smed_v4_20132_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30007341TBC1 domain family member 2BSMESG000078416.1 dd_Smed_v4_6508_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30001371P/Homo B domain-containing proteinSMESG000074553.1 SMESG000074551.1 dd_Smed_v4_1484_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30003326SMED30003326SMESG000013799.1 dd_Smed_v4_2896_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30012767SMED30012767 dd_Smed_v4_917_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30018178SMED30018178SMESG000035470.1 dd_Smed_v4_16195_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30012888SMED30012888 dd_Smed_v4_20132_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30005835SMED30005835SMESG000012702.1 SMESG000012701.1 SMESG000012690.1 SMESG000012688.1 SMESG000012672.1 dd_Smed_v4_55_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30019420SMED30019420SMESG000071974.1 dd_Smed_v4_16457_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30017222Histone H2ASMESG000074553.1 SMESG000074551.1 dd_Smed_v4_1484_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30004339Slc16a-7SMESG000023798.1 SMESG000016446.1 dd_Smed_v4_13379_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30010806SMED30010806SMESG000022711.1 SMESG000068945.1 dd_Smed_v4_21342_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30014918Ornithine decarboxylaseSMESG000060777.1 dd_Smed_v4_4916_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30006473MFS domain-containing proteinSMESG000018042.1 dd_Smed_v4_11486_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30003923MFS domain-containing proteinSMESG000060691.1 dd_Smed_v4_3455_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30008797SMED30008797SMESG000076328.1 dd_Smed_v4_1587_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30005565SMED30005565SMESG000010564.1 dd_Smed_v4_8271_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30014522SMED30014522 dd_Smed_v4_20132_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30034468SMED30034468 dd_Smed_v4_28220_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30021328SMED30021328SMESG000028190.1 dd_Smed_v4_17722_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30030057GLOBIN domain-containing proteinSMESG000048632.1 SMESG000022262.1 dd_Smed_v4_2237_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30031918SMED30031918SMESG000043420.1 dd_Smed_v4_460_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30033890SMED30033890 dd_Smed_v4_16890_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30024056SMED30024056 dd_Smed_v4_14719_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30018924SMED30018924SMESG000028420.1 dd_Smed_v6_468_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30013885SMED30013885SMESG000046850.1 dd_Smed_v6_9640_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30010951SMED30010951SMESG000076142.1 dd_Smed_v6_719_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30005644X1.A.D4.1SMESG000053861.1 dd_Smed_v6_771_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30013445TetraspaninSMESG000063435.1 dd_Smed_v6_389_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30005740SMED30005740SMESG000029096.1 dd_Smed_v6_480_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30001567SMED30001567SMESG000022139.1 dd_Smed_v6_715_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30022130SMED30022130SMESG000026848.1 dd_Smed_v6_1128_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30020865AminopeptidaseSMESG000033900.1 SMESG000033518.1 SMESG000022330.1 SMESG000022279.1 SMESG000022278.1 dd_Smed_v6_4516_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED300249343-hydroxybutyrate dehydrogenase, type 1SMESG000039796.1 SMESG000039794.1 SMESG000039792.1 dd_Smed_v6_8012_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30019041Synaptic vesicle 2-related proteinSMESG000035457.1 dd_Smed_v6_59_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30010415pmp-10SMESG000068428.1 dd_Smed_v6_343_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30018088SMED30018088SMESG000068428.1 dd_Smed_v6_343_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30010404SMED30010404SMESG000076927.1 dd_Smed_v6_5958_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30009457reticulocalbin-1SMESG000034805.1 dd_Smed_v6_493_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30012378Clathrin heavy chainSMESG000035457.1 dd_Smed_v6_59_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30010712SMED30010712SMESG000051055.1 dd_Smed_v6_4926_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30018339SMED30018339SMESG000005125.1 dd_Smed_v6_4793_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED300140171.C5.1SMESG000003566.1 dd_Smed_v6_291_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30008464Glyceraldehyde-3-phosphate dehydrogenaseSMESG000033355.1 dd_Smed_v6_45250_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30012826SMED30012826SMESG000017012.1 SMESG000017011.1 dd_Smed_v6_309_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30005321Malate dehydrogenaseSMESG000008924.1 dd_Smed_v6_656_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30017772SMED30017772SMESG000043278.1 dd_Smed_v6_3331_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30006887Gelsolin-like proteinSMESG000015927.1 dd_Smed_v6_929_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30020511Tigger transposable element-derived protein 2SMESG000068262.1 SMESG000053435.1 SMESG000049288.1 dd_Smed_v6_6797_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30020269MyophilinSMESG000081505.1 SMESG000049198.1 SMESG000047694.1 SMESG000035451.1 SMESG000035348.1 dd_Smed_v6_395_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30021565Proline dehydrogenaseSMESG000077440.1 dd_Smed_v6_7017_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30020810SMED30020810SMESG000068262.1 SMESG000053435.1 SMESG000049288.1 dd_Smed_v6_6797_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30020328X1.C4.1SMESG000046999.1 dd_Smed_v6_558_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30020630Usp domain-containing proteinSMESG000068262.1 SMESG000053435.1 SMESG000049288.1 dd_Smed_v6_6797_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30000205SMED30000205SMESG000068262.1 SMESG000053435.1 SMESG000049288.1 dd_Smed_v6_6797_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30008381SMED30008381SMESG000068262.1 SMESG000053435.1 SMESG000049288.1 dd_Smed_v6_6797_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30016539SMED30016539SMESG000017277.1 SMESG000017274.1 SMESG000017276.1 dd_Smed_v6_1245_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30011492HTH CENPB-type domain-containing proteinSMESG000068262.1 SMESG000053435.1 SMESG000049288.1 dd_Smed_v6_6797_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30018809Transposase, Tc1-like proteinSMESG000068262.1 SMESG000053435.1 SMESG000049288.1 dd_Smed_v6_6797_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30027899slc26a-10SMESG000052008.1 SMESG000051986.1 dd_Smed_v6_5066_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30033456ATP-dependent (S)-NAD(P)H-hydrate dehydrataseSMESG000002442.1 dd_Smed_v6_3409_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED3002901916 kDa calcium-binding proteinSMESG000066843.1 dd_Smed_v6_299_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED3002169814-3-3 protein epsilonSMESG000047644.1 dd_Smed_v6_36_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30031352SMED30031352SMESG000006235.1 dd_Smed_v6_6275_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30034546Protein transport protein Sec61 subunit gammaSMESG000062123.1 SMESG000063809.1 dd_Smed_v6_429_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30030317ATP-dependent (S)-NAD(P)H-hydrate dehydrataseSMESG000002442.1 dd_Smed_v6_3409_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30035101Protein kinaseSMESG000024804.1 dd_Smed_v6_3989_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30027745molybdate-anion transporter isoform X2SMESG000027072.1 dd_Smed_v6_3699_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30032429Inositol phosphoceramide mannosyltransferase 3SMESG000065897.1 SMESG000065885.1 SMESG000065880.1 SMESG000065849.1 dd_Smed_v6_7249_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30034660Spectrin beta chain, non-erythrocytic 5SMESG000023006.1 dd_Smed_v6_2514_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30025667Cell division cycle protein 16SMESG000050407.1 dd_Smed_v6_7357_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30034619SMED30034619SMESG000029095.1 dd_Smed_v6_3913_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30004057DUF3421 domain-containing protein dd_Smed_v6_1355_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30015546Cyclic AMP-responsive element-binding protein 3SMESG000059546.1 dd_Smed_v6_1032_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30003372SMED30003372SMESG000020860.1 dd_Smed_v6_14_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30004351SMED30004351 dd_Smed_v6_15429_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30006119X-box-binding protein 1SMESG000048111.1 dd_Smed_v6_415_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30008536SMED30008536 dd_Smed_v6_15429_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30008522Fatty acid-binding proteinSMESG000015143.1 dd_Smed_v6_271_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30003313SMED30003313 dd_Smed_v6_616_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30013312CalpainSMESG000062904.1 SMESG000062902.1 dd_Smed_v6_1971_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30017206Band 4.1 protein 2SMESG000062476.1 dd_Smed_v6_2032_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30007341TBC1 domain family member 2BSMESG000078416.1 dd_Smed_v6_6508_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30010940TetraspaninSMESG000021642.1 dd_Smed_v6_1257_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30012787MANSC domain-containing proteinSMESG000015184.1 dd_Smed_v6_5586_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30012767SMED30012767 dd_Smed_v6_917_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30011490EF-hand domain-containing proteinSMESG000026288.1 dd_Smed_v6_824_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30013293Major vault proteinSMESG000037707.1 dd_Smed_v6_1098_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30005835SMED30005835SMESG000012702.1 SMESG000012701.1 SMESG000012690.1 SMESG000012688.1 SMESG000012672.1 dd_Smed_v6_55_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30019692DUF3421 domain-containing proteinSMESG000046732.1 dd_Smed_v6_844_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30015906Succinyl-CoA:3-ketoacid-coenzyme A transferaseSMESG000080432.1 SMESG000080424.1 dd_Smed_v6_1189_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30005188Venom allergen 5 dd_Smed_v6_607_1dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30013168CalpainSMESG000062904.1 SMESG000062902.1 dd_Smed_v6_1971_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30009287Protein kinase, putativeSMESG000074407.1 SMESG000074416.1 dd_Smed_v6_3361_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30003172Adenylosuccinate synthetaseSMESG000078697.1 dd_Smed_v6_2154_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30015362SMED30015362SMESG000043289.1 dd_Smed_v6_80_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30007742Protein transport protein Sec61 subunit alphaSMESG000003007.1 dd_Smed_v6_282_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30014565Angiotensin-converting enzymeSMESG000005704.1 SMESG000005698.1 dd_Smed_v6_3745_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30014918Ornithine decarboxylaseSMESG000060777.1 dd_Smed_v6_4916_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30006473MFS domain-containing proteinSMESG000018042.1 dd_Smed_v6_11486_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30010792Protein kinaseSMESG000074407.1 SMESG000074416.1 dd_Smed_v6_3361_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30001367ADP-ribosylation factor 1SMESG000067743.1 dd_Smed_v6_203_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30010637Nucleolar RNA helicase II/Gu proteinSMESG000065959.1 dd_Smed_v6_283_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30002867SMED30002867 dd_Smed_v6_9764_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30021511SMED30021511SMESG000038232.1 SMESG000010788.1 dd_Smed_v6_759_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30031918SMED30031918SMESG000043420.1 dd_Smed_v6_460_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30031345Pyruvate dehydrogenase E1 component subunit alphaSMESG000073271.1 dd_Smed_v6_1310_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30025313Thioredoxin glutathione reductaseSMESG000020047.1 dd_Smed_v6_960_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30033411Dynein light chainSMESG000041239.1 dd_Smed_v6_3149_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30020948SMED30020948SMESG000024857.1 dd_Smed_v6_409_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30023766SMED30023766SMESG000073811.1 dd_Smed_v6_116_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30029450Succinyl-CoA:3-ketoacid-coenzyme A transferaseSMESG000080432.1 SMESG000080424.1 dd_Smed_v6_1189_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30021758SMED30021758SMESG000078995.1 dd_Smed_v6_3725_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30025783NADPH--cytochrome P450 reductaseSMESG000022047.1 dd_Smed_v6_542_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30022992Myosin heavy chainSMESG000062420.1 dd_Smed_v6_791_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30034381Malate dehydrogenaseSMESG000056995.1 dd_Smed_v6_467_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30033621Ornithine decarboxylaseSMESG000041045.1 dd_Smed_v6_8195_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30024058SMED30024058SMESG000020813.1 dd_Smed_v6_3688_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30031335slc26a-4SMESG000064562.1 dd_Smed_v6_4250_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30020317Heat shock protein 90SMESG000024822.1 dd_Smed_v6_678_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30029717SMED30029717SMESG000018042.1 dd_Smed_v6_11486_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30033197SMED30033197SMESG000073811.1 dd_Smed_v6_116_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30025067Endoplasmic reticulum chaperone BiPSMESG000062699.1 dd_Smed_v6_511_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30028449High density lipoprotein binding protein (Vigilin)SMESG000016436.1 dd_Smed_v6_553_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30030034Argininosuccinate lyaseSMESG000039074.1 dd_Smed_v6_3792_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30021601SMED30021601SMESG000003951.1 dd_Smed_v6_6596_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30029561SMED30029561SMESG000041756.1 dd_Smed_v6_3569_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30026101Reticulocalbin-1SMESG000077405.1 dd_Smed_v6_5905_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30026350slc26a-8SMESG000064562.1 dd_Smed_v6_4250_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30029770ATP-binding cassette sub-family F member 2SMESG000071613.1 dd_Smed_v6_434_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED300316316-phosphogluconate dehydrogenase, decarboxylatingSMESG000005721.1 dd_Smed_v6_366_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30028069SMED30028069SMESG000059907.1 dd_Smed_v6_5497_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30029103Glutamine synthetaseSMESG000000228.1 SMESG000000227.1 SMESG000000225.1 SMESG000000212.1 dd_Smed_v6_896_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30022344FERM domain containing-1SMESG000070273.1 dd_Smed_v6_1131_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30035148SMED30035148SMESG000021388.1 dd_Smed_v6_1925_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30026808EF-hand domain-containing proteinSMESG000081370.1 dd_Smed_v6_446_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30025830Ornithine decarboxylaseSMESG000015244.1 SMESG000015241.1 SMESG000004848.1 SMESG000004822.1 SMESG000004820.1 SMESG000004806.1 dd_Smed_v6_280_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30020710Succinyl-CoA:3-ketoacid-coenzyme A transferaseSMESG000080432.1 SMESG000080424.1 dd_Smed_v6_1189_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30024165SMED30024165 dd_Smed_v6_2664_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30005357hypothetical proteinSMESG000027979.1 dd_Smed_v6_775_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30014220SMED30014220SMESG000052497.1 dd_Smed_v6_2843_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30001515AnnexinSMESG000042839.1 dd_Smed_v6_1104_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30011525SMED30011525SMESG000000175.1 dd_Smed_v6_383_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30011420Trinucleotide repeat containing 4-like proteinSMESG000005424.1 dd_Smed_v6_11349_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30016080Deoxyhypusine hydroxylaseSMESG000051726.1 SMESG000051721.1 dd_Smed_v6_703_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30015672Gelsolin-like proteinSMESG000015928.1 dd_Smed_v6_1215_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30002992SMED30002992SMESG000012171.1 dd_Smed_v6_247_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30001853Protein kinase domain-containing proteinSMESG000003859.1 dd_Smed_v6_1897_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30004108SMED30004108SMESG000043419.1 dd_Smed_v6_644_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30003274X1.A.C4.1SMESG000079273.1 dd_Smed_v6_3278_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30000902SMED30000902SMESG000043277.1 dd_Smed_v6_647_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30011041Heat shock protein 903SMESG000041107.1 dd_Smed_v6_758_1dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30005429SMED30005429SMESG000030956.1 SMESG000030911.1 dd_Smed_v6_902_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30018173Sodium/potassium-transporting ATPase subunit beta-1 isoform 2SMESG000064592.1 dd_Smed_v6_6559_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30009513Glycine amidinotransferase, mitochondrialSMESG000051953.1 dd_Smed_v6_899_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30011700Calcium-binding protein ASMESG000052083.1 SMESG000048475.1 dd_Smed_v6_605_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30012310SMED30012310SMESG000028761.1 dd_Smed_v6_5231_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30014980LaminSMESG000009886.1 dd_Smed_v6_850_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30002098carboxypeptidase ESMESG000062760.1 dd_Smed_v6_4210_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30018603Receptor expression-enhancing proteinSMESG000043862.1 dd_Smed_v6_838_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30006263SMED30006263SMESG000056319.1 SMESG000056318.1 SMESG000022275.1 dd_Smed_v6_674_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30009956SMED30009956SMESG000022273.1 dd_Smed_v6_8344_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30005838X1.C3.3SMESG000058321.1 SMESG000058307.1 dd_Smed_v6_68_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30019325Myosin regulatory light chainSMESG000000175.1 dd_Smed_v6_383_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30007396Citrate lyase beta likeSMESG000054468.1 SMESG000054465.1 dd_Smed_v6_4186_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30000032SMED30000032SMESG000064381.1 dd_Smed_v6_2460_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 3 cellSMED30006057SMED30006057SMESG000064381.1 dd_Smed_v6_2460_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Note: Hover over icons to view figure legend

 

 

back to top