Category 3 cell
▻ Planarian Anatomy Ontology Class Overview
▻ Embryonic Molecular Fate Mapping
▻ In Situ Hybridization Data
▻ Sequences
▻ PAGE: Planarian Anatomy Gene Expression
Planarian Anatomy Ontology Class Overview
For more information about the ontology visit PLANA Overview
NAME:
Category 3 cell
DEFINITON:
Post-mitotic, mesenchymally located epidermal progenitors downstream of the Category 2 cells.
TERM DEFINITION CITATIONS:
PMID:20040488, PMID:26114597, PMID:18786419, PMID:26457503
TERM CITATIONS:
Expand publication list
TERM ID:
PLANA:0000035
ABOUT THIS TERM:
Category 3 cell
↳is a epidermal progenitor cell, material entity and somatic cell ↳contained in tail region, ventral region of the whole animal, copulatory region, posterior region of the whole animal, parapharyngeal region, prepharyngeal region, head region, dorsal region of the whole animal and anterior region of the whole animal
↳develops from Category 2 cell
↳existence overlaps Stage 6, juvenile stage, Stage 5, asexual adult, adult hermaphrodite, Stage 8 and Stage 7
↳existence starts during or after Stage 5
↳part of integumental system
→ Category 4 cell develops from Category 3 cell
DEPICTED BY:
BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):
Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.
EXPLORE ONTOLOGY GRAPH:
Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.
Embryonic Molecular Fate Mapping
All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource
IN SITU HYBRIDIZATION DATA:
Smed ID Accession Name Alias Expressed during stage(s) Tissue/Pattern Images
SMED30018353 Glycine amidinotransferase, mitochondrial AGAT-1 Stage 5, Stage 6, Stage 7, Stage 8 Category 3 cell, integumental system 
Click to see image symbols and abbreviations
Abbreviation or symbol Definition
O oral hemisphere
A aboral hemisphere
D dorsal
V ventral
L lateral
black arrowhead embryonic pharynx
red arrowhead definitive pharynx
black arrows primitive gut
yellow arrows primitive ectoderm cells
cyan arrows brain
cyan arrowheads nerve cords
blue arrowheads eye progenitors (trail cells)
purple arrowheads eyes
scale bar 100 µm
SEQUENCES:
smed_20140614 transcript sequences for genes validated by in situ hybridization (above).
>SMED30018353 ID=SMED30018353|Name=Glycine amidinotransferase, mitochondrial|organism=Schmidtea mediterranea sexual|type=transcript|length=1408bp
CAAGGGTAGTTTGATTATTTAGAAAAAAAGGATTTCCACCGGTTTTCTGTGATAAAAATTGTACAAAAATGCTTACCAAA
ATTGCTAGATCTCTGCACGATCAGATTTCCATAAACGTTGTCAACAAATTGTCAGCTAGGTTATGCTCGTATACACCTGG
TAACAAAAAACACAGCCCGGTTTGGGCCTGGAATGAATGGGACCCATTAGAAGAAATCGTTTTGGGACTTCCAGATATGG
CATGTTGTCCAGAGATTTTACCAGAAGCCAAAGCTTGCATTTCGGAAAACAAATTTGATTTCCTTTTAAAACACAAAGGA
AAATATTGGAAGGATGTAATTGAACCAGAACACTACAAAATAATGCTAGATGAGCACAAGAACTTCATAAAGATTCTACA
AGGAGAAGGAGTTAAAGTCGTCCATCCAGAACCGATTGATTTCGCTAAAACGCTCTGTACTCCAAACTTTACTGCCCATG
GAGTCGACTGTGCGATGCCGAGAGATTTTCTATTAATTGTCGGAAATGAAATGATTGAGTCCACCATGACTTGGAGATCG
AGATATTTTGAATTTATGTGCTATAAAAAATTAATTAAAGATTACTGGAGCCGGGGCGCTAAATGGACAGCGGCACCAAA
GCCGATGTGTAAAGAAACACTTTTTAAAGAAAATTATCGTGCTGACGAAGATTCAACAGCATTTTTCGATGAAAAGACTT
CGATTCTAACGGAAGAGGAACCAGTTTTCGACGCCGCAGATTTCATTCGATGTGGTAGGGATATATTTGCGCATGTCAGT
CAGGTTAGCAACAATGCAGGAATTGAATGGGTACGTAGACATTTGGCACCGAAAGGAATTAGAGTTCATTCAATGAATTT
CGTTGACCCTAAACCAATGCATATTGACACGACACTTTTCACACCTCGGCCAGGCCTCGCGATAACATGCCCAGAAAGAC
CATGCTTACAAATTGGTATGCTTAAAAAAGCCGGCTGGGATGTTGTCGTTGCTCCTTATCCAGATATTGCAAAGAATTTC
CCATACTATATCAGCTCTCAATGGTTGTCTCTTAATGTTGTCATGTTGGATGAAAACCGAGTTCTCGTAGAGAAAGATGA
AATTGGAATTCAAAAACTGTTTGAAAAGTGTGGCATTACTCCTGTAAAAGTTCCATTCAAACACTGCTTTTCCATAGGAG
GTGGTATTCATTGCTGGACATCGGATGTTAGAAGGCGAGGAGACCTTCAAAACTATTTTGACTGGCCTCAAGAAATCTTG
GAGAAATTTGAAACTCACTGAATATCACAATTGAAAATATAAAGAACATAACTTTTCCAACGTATATTAATTATTTGTAA
TAAAATACACTGCTTACATCGTGTCAATTTTATTTACTGATTAATTAC
>SMED30009513 ID=SMED30009513|Name=Glycine amidinotransferase, mitochondrial|organism=Schmidtea mediterranea sexual|type=transcript|length=1650bp
AAATCTATATAAATCTTATATGATCCTTTGATGCTTTCAAAATTCAACCGAATCCTTCCATTAAACAGTGTTTATAAAAT
TAGCGCTCCAGCAGCCAACATCAAATATAGAAATTGTTGTAGCAAATCCTCAACAGATAAACCAACAAATAAGCGTAACA
GTCCCGTATGGAGCTGGAATGAATGGGATCCTTTGGAAGAAGTAATTGTTGGTGTACCTGATCATGGTGTAGTTCCATAT
CCTTATCCAGAAACAGCGGCATGCTTTGGAGAACGTTTAACAGAAAACTTTATGAAAAAATATGGAGGAAAATACTGGAG
TGACATCATGCCTAAAGAAGTTTGGAATAACGTTTTGAAGGAACATAAAGAATTCTGTAACATCCTAAAAGGCGAAGGTG
TGACTGTGGTTCATCCAACACCAATGGATATGAAAAAAGAATACGAAACTCCATATTTCAAATCTGTCGGTTTGGATGTT
GCATTTCCAAGAGATATAATTCTCGTAGTTGGCGATGAAATTATGGAAACAACGATGACTTGGAGGTCAAGATTTTGGGA
ATATCTTTGCTACAGACCATTGATGCTAGATTATTGGAAACGGGGAGCAAATTTTCAATCAGCACCAAAACCAGTGTGTA
GCGAAGAAAGTTTTAAAAAGGATTTTGACATTTCAGGCAATAAATTCGATGAGTTGGGATATGTAACAACTGAATTCGAA
CCGATGTTTGATGCCGCAGATTTCATGAGGGCTGGCCGAGATATTTTTGTTCAACAAAGTCACGTAACAAATGCCACTGG
AATTGAATGGATGCGTCGCCATTTAGCTGAAAAAGGAATTCGGTTACACTTGTTGAATTTCAATGATCCATATGCCATGC
ATATCGATGCTACATTTTTCACAGTGAAACCCGGATACTTAATAGAGAATCCTGAAGTCATAAATCCGTATGCTGATTAT
TTGAAGAAGGCCGGTTGGAAGATTGTGAAGGGTCCAAAACCAGCAGATAGATCAGACATGTATGAAGGCATGAGTTACAA
GTGGCTATCTATGAACGTTTTAGTTCTTGATCAAAAACGAGTGTTAGTTGAAAAGCGAGAGGTTGGAATGCACAAAATGT
TTGAGTCAATCGGCATGCAACCGATCAAAGTTGATTTCGGACATTGTTTCGCTGTTGGCGGAGGGTTGCATTGTTGGACT
TCCGATGTTCGAAGAAAAGGAACTCTGGAAAATTACTTTGATTGGCCACAAGAAGTATTGGAAAAAGTATCATTGGATAA
ATAAACAATAATAGTTGAACAAGCTCCTATACTATCAGCAAAATCGACACTATCGCTGATTATATATAAATATTTATATA
TTTTGATAAAATATGTATTTATAATTTTCTCTTATTTTATTGTTATGATAATTTATAAATTTGAATTTTACTTTGTTTGA
ATCATAAACATTTATTAAAGTTATTTGTCAAAAGATGAAAATTAAAACAAAACGTGTAATCATTGCTATCTTCAATCATG
TAACAAGAAATAATTGCAATTTATCTTTATGTTGAGATAGCTCTTAGAACGCTTGGACCGATAGCGCTAAACTGTATGTT
TTATGCTTCATTTAATTACTTGAATGATAAAGGAAATTTGTTTATTGTAC
>SMED30032169 ID=SMED30032169|Name=Glycine amidinotransferase, mitochondrial|organism=Schmidtea mediterranea sexual|type=transcript|length=1380bp
CGTGTTTCTGCCAGAATCCAAGTTTGGTAGGGTGGGTGGAGTAGGCTTTTATATCATATCTAAATCTGAAAATGAATTTT
TATCATCATATTTTCTCAAATGTTGTCTGTATTACGACAAATTAGCCATTCAAAATCTGCCATTTCTTCGAAAATATCGG
TAATTCACATTTCAAAGTACTTCGGTCATTATTCATGCCACGATGAAAAGAAACAGACTTCTCCAGTTTGGGCTTGGAAT
GAATGGGATCCACTTGAAGAAGTTGTGGTCGGTGTTCCTAATAATGCAACTTTGCCCTTTCCATCACAGGAAGTAGCAGC
CACTTTTGGACCCCCTAGACTTCCATTTTTTCAAAAACATGGTGGCAAAAAATTCTCAGAGGTTATGGGTCAAGAAATGT
GGATGAAAATTGAAAATGAAATAAAAGAATTAGTAAGAGTATTAGAGGGAGAAGGTGTAAAAGTTGTGCAACCAGAGGCT
ATAGATTACGATCAAAAGTGGACTACGCCAAAGTTTTCTTCAACAGGTTTGTATGCCGCTATGCCAAGAGATTTTTTACT
TATCGTTGGTGATGAAATCATTGAATCCCCTATGGCTTGGAGGTGTAGATACTTTGAATACGAAGCATACAGACCACTTA
TTCGAAAATATTTTAATGAAGGAGCCAGATGGACATCGGCTCCTAAATGCACTATGGAAGACGCTCTCTATGATATGGAA
TTCGATGTTGCTCAAGAGAAACCATATGTGTATGTAACAACTGAATTAGAACCATGTTTTGATGCGGCTGACTTTACAAG
AATTGGCAGGGATATTTTTGGTCAAAGAAGTCATGTAACCAACAAAAAGGCAATACAGTGGCTCCGGCGTCATTTAGCTC
CTAGTGGAGTCAGGGTCCATGACATTGAATTTGACTCTCTCTATTCAATGCATATTGATACCAATTTTTTCCCCGTGAAA
CCTGGTATGTTTTTACTTAAAGATGGACTCAATTGTAAAACCCCGGATCTATTAAAAAAATCTAAATGGGACATAGTCAT
TATGCCAAAAGGACCTCATCGAGACGAGCATTACAAATGGATGAATTATCACGGATTACCGAACAATATGCTCAGTATAG
ACACAGAGAGGGTCCTAGTTGAGAAAACCGAAGAATACATGATAAAATTCATGCAAGAAATTGGATTCAAACCGATTCCA
GTTTCGCTTAAATTCGCAAATAATCTAGGAGGGGGCTTCCACTGCTGGACAGCGGACATCAGACGGCGAGGAAAACTAGA
AAGCTATTTTGAGTGGCCAGATGAGATTTTGGAGCGATTGACTCCATAAATCGGAAATATTAAATTAAAAAATATTTTTT
GTTTTAATTTTCTATACAAT
PAGE: Planarian Anatomy Gene Expression
These transcripts were reported as being expressed in Category 3 cell. Click this link to learn more about PAGE.
PAGE Curations: 530
PLANA Term Reference Transcript Description Gene Models Published Transcript Transcriptome Publication Specimen Lifecycle Evidence Category 3 cell SMED30028476 Glutamate receptor, ionotropic kainate SMESG000080378.1 dd_Smed_v4_34941_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30028417 Bardet-Biedl syndrome 1 protein homolog SMESG000009880.1 dd_Smed_v4_7298_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30021542 SMED30021542 SMESG000074220.1 dd_Smed_v4_22388_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30014220 SMED30014220 SMESG000052497.1 dd_Smed_v4_2843_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30010415 pmp-10 SMESG000068428.1 dd_Smed_v4_343_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30008715 Dimer_Tnp_hAT domain-containing protein SMESG000010564.1 dd_Smed_v4_8271_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30002834 SMED30002834 SMESG000043420.1 dd_Smed_v4_460_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30005229 Amine oxidase SMESG000077616.1 dd_Smed_v4_20536_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30002992 SMED30002992 SMESG000012171.1 dd_Smed_v4_247_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30007370 SMED30007370 SMESG000045571.1 dd_Smed_v4_7603_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30006734 SMED30006734 SMESG000010564.1 dd_Smed_v4_8271_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30014918 Ornithine decarboxylase SMESG000060777.1 dd_Smed_v4_4916_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30027833 Guanylate cyclase SMESG000079311.1 dd_Smed_v4_15400_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30018353 Glycine amidinotransferase, mitochondrial SMESG000051964.1 NB.8.8b smed_ncbi_20200123 PMID:18786419
Eisenhoffer et al., 2008
Category 3 cell SMED30018353 Glycine amidinotransferase, mitochondrial SMESG000051964.1 NB.8.8b smed_ncbi_20200123 PMID:18786419
Eisenhoffer et al., 2008
Category 3 cell SMED30027207 Ornithine decarboxylase SMESG000055750.1 H.63.4c smed_ncbi_20200123 PMID:18786419
Eisenhoffer et al., 2008
Category 3 cell SMED30027207 Ornithine decarboxylase SMESG000055750.1 H.63.4c smed_ncbi_20200123 PMID:18786419
Eisenhoffer et al., 2008
Category 3 cell SMED30001325 slc25a-12 SMESG000064880.1 H.45.8g smed_ncbi_20200123 PMID:18786419
Eisenhoffer et al., 2008
Category 3 cell SMED30001325 slc25a-12 SMESG000064880.1 H.45.8g smed_ncbi_20200123 PMID:18786419
Eisenhoffer et al., 2008
Category 3 cell SMED30019154 Glycine amidinotransferase mitochondrial SMESG000068402.1 NB.2.5d ncbi_smed_ests PMID:18786419
Eisenhoffer et al., 2008
Category 3 cell SMED30019154 Glycine amidinotransferase mitochondrial SMESG000068402.1 NB.2.5d ncbi_smed_ests PMID:18786419
Eisenhoffer et al., 2008
Category 3 cell SMED30009513 Glycine amidinotransferase, mitochondrial SMESG000051953.1 H.56.4h smed_ncbi_20200123 PMID:18786419
Eisenhoffer et al., 2008
Category 3 cell SMED30009513 Glycine amidinotransferase, mitochondrial SMESG000051953.1 H.56.4h smed_ncbi_20200123 PMID:18786419
Eisenhoffer et al., 2008
Category 3 cell SMED30011402 Ras family SMESG000007281.1 H.18.4a ncbi_smed_ests PMID:18786419
Eisenhoffer et al., 2008
Category 3 cell SMED30011402 Ras family SMESG000007281.1 H.18.4a smed_ncbi_20200123 PMID:18786419
Eisenhoffer et al., 2008
Category 3 cell SMED30011402 Ras family SMESG000007281.1 H.18.4a ncbi_smed_ests PMID:18786419
Eisenhoffer et al., 2008
Category 3 cell SMED30011402 Ras family SMESG000007281.1 H.18.4a smed_ncbi_20200123 PMID:18786419
Eisenhoffer et al., 2008
Category 3 cell SMED30018353 Glycine amidinotransferase, mitochondrial SMESG000051964.1 DN303276 ncbi_smed_ests PMID:23235145
Hubert et al., 2013
Category 3 cell SMED30018353 Glycine amidinotransferase, mitochondrial SMESG000051964.1 DN290976 ncbi_smed_ests PMID:23235145
Hubert et al., 2013
Category 3 cell SMED30018353 Glycine amidinotransferase, mitochondrial SMESG000051964.1 NB.8.8b smed_ncbi_20200123 PMID:25956527
Henderson et al., 2015
Category 3 cell SMED30018353 Glycine amidinotransferase, mitochondrial SMESG000051964.1 SMED30018353 smed_20140614 PMID:24704339
Vogg et al., 2014
Category 3 cell SMED30018353 Glycine amidinotransferase, mitochondrial SMESG000051964.1 SMED30018353 smed_20140614 PMID:23318641
Chen et al., 2013
Category 3 cell SMED30000850 slc7a-8 SMESG000006721.1 SmedASXL_001816 SmedAsxl_ww_GCZZ01 PMID:26114597
Zhu et al., 2015
Category 3 cell SMED30026394 SMED30026394 SMESG000029612.1 SMESG000029602.1 SmedASXL_009684 SmedAsxl_ww_GCZZ01 PMID:26114597
Zhu et al., 2015
Category 3 cell SMED30018353 Glycine amidinotransferase, mitochondrial SMESG000051964.1 SMED30018353 smed_20140614 PMID:26114597
Zhu et al., 2015
Category 3 cell SMED30029823 MFS domain-containing protein SMESG000000287.1 SMESG000000110.1 SmedASXL_018064 SmedAsxl_ww_GCZZ01 PMID:26114597
Zhu et al., 2015
Category 3 cell SMED30027539 MFS domain-containing protein SMESG000000287.1 SMESG000000110.1 SmedASXL_018064 SmedAsxl_ww_GCZZ01 PMID:26114597
Zhu et al., 2015
Category 3 cell SMED30000746 SMED30000746 SMESG000024821.1 SMESG000024754.1 SmedASXL_008207 SmedAsxl_ww_GCZZ01 PMID:26114597
Zhu et al., 2015
Category 3 cell SMED30033892 SMED30033892 SMESG000029612.1 SMESG000029602.1 SmedASXL_009684 SmedAsxl_ww_GCZZ01 PMID:26114597
Zhu et al., 2015
Category 3 cell SMED30030996 hypothetical protein SMESG000029612.1 SMESG000029602.1 SmedASXL_009684 SmedAsxl_ww_GCZZ01 PMID:26114597
Zhu et al., 2015
Category 3 cell SMED30033839 Sp5 SMESG000023227.1 SMED30033839 smed_20140614 PMID:29100657
Cheng et al., 2018
Category 3 cell SMED30012332 EGR-1 SMESG000034285.1 SMED30012332 smed_20140614 PMID:29100657
Cheng et al., 2018
Category 3 cell SMED30000303 HoxC12-like protein SMESG000022668.1 SMED30000303 smed_20140614 PMID:29100657
Cheng et al., 2018
Category 3 cell SMED30006464 TCF15 SMESG000044395.1 SMED30006464 smed_20140614 PMID:29100657
Cheng et al., 2018
Category 3 cell SMED30008505 SOXP-3 SMESG000051170.1 SMED30008505 smed_20140614 PMID:29100657
Cheng et al., 2018
Category 3 cell SMED30006353 SMED30006353 SMESG000004009.1 SMED30006353 smed_20140614 PMID:29100657
Cheng et al., 2018
Category 3 cell SMED30015704 Hox class homeodomain protein DjAbd-Ba SMED30015704 smed_20140614 PMID:29100657
Cheng et al., 2018
Category 3 cell SMED30019046 SD2 SMESG000021468.1 SMED30019046 smed_20140614 PMID:29100657
Cheng et al., 2018
Category 3 cell SMED30032499 C2H2-type domain-containing protein SMESG000075452.1 SMED30032499 smed_20140614 PMID:29100657
Cheng et al., 2018
Category 3 cell SMED30015041 Retinoic acid receptor beta SMESG000054304.1 SMED30015041 smed_20140614 PMID:29100657
Cheng et al., 2018
Category 3 cell SMED30026364 SMED-P53 SMESG000078256.1 SMESG000078255.1 SMED30026364 smed_20140614 PMID:29100657
Cheng et al., 2018
Category 3 cell SMED30029873 SMED30029873 SMESG000042500.1 SMED30029873 smed_20140614 PMID:29100657
Cheng et al., 2018
Category 3 cell SMED30022628 G_PROTEIN_RECEP_F1_2 domain-containing protein SMESG000060403.1 SMED30022628 smed_20140614 PMID:29100657
Cheng et al., 2018
Category 3 cell SMED30000485 SMED30000485 SMESG000069311.1 SMED30000485 smed_20140614 PMID:29100657
Cheng et al., 2018
Category 3 cell SMED30018353 Glycine amidinotransferase, mitochondrial SMESG000051964.1 SMED30018353 smed_20140614 PMID:30194301
Mihaylova et al., 2018
Category 3 cell SMED30018353 Glycine amidinotransferase, mitochondrial SMESG000051964.1 SMED30018353 smed_20140614 PMID:28072387
Davies et al., 2017
Category 3 cell SMED30018353 Glycine amidinotransferase, mitochondrial SMESG000051964.1 SMED30018353 smed_20140614 PMID:28072387
Davies et al., 2017
Category 3 cell SMED30018353 Glycine amidinotransferase, mitochondrial SMESG000051964.1 SMED30018353 smed_20140614 PMID:28072387
Davies et al., 2017
Category 3 cell SMED30018353 Glycine amidinotransferase, mitochondrial SMESG000051964.1 SMED30018353 smed_20140614 PMID:28072387
Davies et al., 2017
Category 3 cell SMED30018353 Glycine amidinotransferase, mitochondrial SMESG000051964.1 SMED30018353 smed_20140614 PMID:22445864
Tu et al., 2012
Category 3 cell SMED30026364 SMED-P53 SMESG000078256.1 AY068713.3 smed_ncbi_20200123 PMID:20040488
Pearson et al., 2010
Category 3 cell SMED30024368 chromodomain helicase DNA-binding protein 4 SMESG000068192.1 GU980571.1 smed_ncbi_20200123 PMID:26457503
Tu et al., 2015
Category 3 cell SMED30018353 Glycine amidinotransferase, mitochondrial SMESG000051964.1 SMED30018353 smed_20140614 PMID:29357350
de Sousa et al., 2018
Category 3 cell SMED30018353 Glycine amidinotransferase, mitochondrial SMESG000051964.1 SMED30018353 smed_20140614 PMID:23318635
Blassberg et al., 2013
Category 3 cell SMED30001515 Annexin SMESG000042839.1 dd_Smed_v6_1104_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30011420 Trinucleotide repeat containing 4-like protein SMESG000005424.1 dd_Smed_v6_11349_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30007770 SMED30007770 SMESG000059904.1 SMESG000042945.1 SMESG000007620.1 SMESG000072638.1 SMESG000039380.1 SMESG000042352.1 SMESG000028417.1 dd_Smed_v6_10138_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30005345 SMED30005345 SMESG000059907.1 dd_Smed_v6_125_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30010940 Tetraspanin SMESG000021642.1 dd_Smed_v6_1257_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30006877 SMED30006877 SMESG000017277.1 SMESG000017274.1 SMESG000017276.1 dd_Smed_v6_1245_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30003259 Aminopeptidase SMESG000039842.1 dd_Smed_v6_1249_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30011350 Serine palmitoyltransferase 1 SMESG000080769.1 SMESG000052311.1 dd_Smed_v6_1567_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30013241 SMED30013241 SMESG000007775.1 dd_Smed_v6_137_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30001401 SMED30001401 SMESG000059904.1 SMESG000042945.1 SMESG000007620.1 SMESG000072638.1 SMESG000039380.1 SMESG000042352.1 SMESG000028417.1 dd_Smed_v6_10138_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30006473 MFS domain-containing protein SMESG000018042.1 dd_Smed_v6_11486_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30034257 CRAL-TRIO domain-containing protein SMESG000009988.1 dd_Smed_v6_3680_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30031568 Cytochrome P450 2L1 SMESG000050434.1 dd_Smed_v6_5307_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30032538 MFS domain-containing protein SMESG000055803.1 dd_Smed_v6_5294_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30029717 SMED30029717 SMESG000018042.1 dd_Smed_v6_11486_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30011291 Acidic phospholipase A2 SMESG000079712.1 dd_Smed_v6_2969_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30006083 SMED30006083 SMESG000061797.1 dd_Smed_v6_6028_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30013885 SMED30013885 SMESG000046850.1 dd_Smed_v6_9640_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30010951 SMED30010951 SMESG000076142.1 dd_Smed_v6_719_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30011447 SMED30011447 SMESG000034829.1 dd_Smed_v6_1321_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30011140 Argininosuccinate synthase SMESG000053053.1 SMESG000053052.1 dd_Smed_v6_3086_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30004057 DUF3421 domain-containing protein dd_Smed_v6_1355_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30003372 SMED30003372 SMESG000020860.1 dd_Smed_v6_14_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30004351 SMED30004351 dd_Smed_v6_15429_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30012767 SMED30012767 dd_Smed_v6_917_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30005188 Venom allergen 5 dd_Smed_v6_607_1 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30021793 Pmp-10 SMESG000068743.1 dd_Smed_v6_2178_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30030292 Cytochrome P450, family 1, subfamily D, polypeptide 1 SMESG000012534.1 dd_Smed_v6_2162_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30024165 SMED30024165 dd_Smed_v6_2664_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30005357 hypothetical protein SMESG000027979.1 dd_Smed_v6_775_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30000058 SMED30000058 SMESG000022049.1 dd_Smed_v6_499_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30018924 SMED30018924 SMESG000028420.1 dd_Smed_v6_468_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30017430 Protein disulfide-isomerase SMESG000023147.1 SMESG000017020.1 dd_Smed_v6_250_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30013445 Tetraspanin SMESG000063435.1 dd_Smed_v6_389_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30002098 carboxypeptidase E SMESG000062760.1 dd_Smed_v6_4210_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30016382 SMED30016382 SMESG000029089.1 dd_Smed_v6_2873_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30005740 SMED30005740 SMESG000029096.1 dd_Smed_v6_480_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30003172 Adenylosuccinate synthetase SMESG000078697.1 dd_Smed_v6_2154_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30000827 SMED30000827 SMESG000043280.1 dd_Smed_v6_278_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30002356 SMED30002356 SMESG000069796.1 dd_Smed_v6_4492_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30020865 Aminopeptidase SMESG000033900.1 SMESG000033518.1 SMESG000022330.1 SMESG000022279.1 SMESG000022278.1 dd_Smed_v6_4516_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30020794 SMED30020794 SMESG000056235.1 dd_Smed_v6_1413_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30018353 Glycine amidinotransferase, mitochondrial SMESG000051964.1 dd_Smed_v6_920_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30022130 SMED30022130 SMESG000026848.1 dd_Smed_v6_1128_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30025584 SMED30025584 SMESG000077266.1 dd_Smed_v6_1066_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30026364 SMED-P53 SMESG000078256.1 SMESG000078255.1 dd_Smed_v6_5563_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30027207 Ornithine decarboxylase SMESG000055750.1 dd_Smed_v6_5493_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30027266 SMED30027266 SMESG000041022.1 dd_Smed_v6_7160_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30020710 Succinyl-CoA:3-ketoacid-coenzyme A transferase SMESG000080432.1 SMESG000080424.1 dd_Smed_v6_1189_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30024934 3-hydroxybutyrate dehydrogenase, type 1 SMESG000039796.1 SMESG000039794.1 SMESG000039792.1 dd_Smed_v6_8012_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30026414 MPV17 mitochondrial membrane protein-like 2 SMESG000062744.1 dd_Smed_v6_4214_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30029102 SMED30029102 SMESG000059907.1 dd_Smed_v6_1664_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30035874 SMED30035874 SMESG000043890.1 SMESG000043321.1 SMESG000043310.1 SMESG000043263.1 SMESG000020012.1 SMESG000019997.1 dd_Smed_v6_517_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30035490 SMED30035490 SMESG000042765.1 dd_Smed_v6_5159_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30027899 slc26a-10 SMESG000052008.1 SMESG000051986.1 dd_Smed_v6_5066_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30033456 ATP-dependent (S)-NAD(P)H-hydrate dehydratase SMESG000002442.1 dd_Smed_v6_3409_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30031918 SMED30031918 SMESG000043420.1 dd_Smed_v6_460_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30029019 16 kDa calcium-binding protein SMESG000066843.1 dd_Smed_v6_299_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30033411 Dynein light chain SMESG000041239.1 dd_Smed_v6_3149_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30030317 ATP-dependent (S)-NAD(P)H-hydrate dehydratase SMESG000002442.1 dd_Smed_v6_3409_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30029159 SMED30029159 SMESG000029594.1 SMESG000029589.1 dd_Smed_v6_315_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30035101 Protein kinase SMESG000024804.1 dd_Smed_v6_3989_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30031335 slc26a-4 SMESG000064562.1 dd_Smed_v6_4250_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30030034 Argininosuccinate lyase SMESG000039074.1 dd_Smed_v6_3792_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30029561 SMED30029561 SMESG000041756.1 dd_Smed_v6_3569_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30026350 slc26a-8 SMESG000064562.1 dd_Smed_v6_4250_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30008464 Glyceraldehyde-3-phosphate dehydrogenase SMESG000033355.1 dd_Smed_v6_45250_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30006074 SMED30006074 SMESG000019341.1 dd_Smed_v6_177_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30005551 Spectrin alpha chain SMESG000005289.1 dd_Smed_v6_919_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30002454 Staphylococcal nuclease domain-containing protein SMESG000062403.1 dd_Smed_v6_906_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30019431 SMED30019431 SMESG000032527.1 SMESG000022725.1 dd_Smed_v6_1563_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30007742 Protein transport protein Sec61 subunit alpha SMESG000003007.1 dd_Smed_v6_282_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30017772 SMED30017772 SMESG000043278.1 dd_Smed_v6_3331_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30006263 SMED30006263 SMESG000056319.1 SMESG000056318.1 SMESG000022275.1 dd_Smed_v6_674_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30006887 Gelsolin-like protein SMESG000015927.1 dd_Smed_v6_929_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30014565 Angiotensin-converting enzyme SMESG000005704.1 SMESG000005698.1 dd_Smed_v6_3745_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30009956 SMED30009956 SMESG000022273.1 dd_Smed_v6_8344_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30007718 Flotillin-1 SMESG000063612.1 dd_Smed_v6_1887_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30005231 Polyadenylate-binding protein SMESG000058745.1 dd_Smed_v6_93_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30019325 Myosin regulatory light chain SMESG000000175.1 dd_Smed_v6_383_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30007396 Citrate lyase beta like SMESG000054468.1 SMESG000054465.1 dd_Smed_v6_4186_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30016902 CRAL-TRIO domain-containing protein SMESG000009876.1 dd_Smed_v6_2760_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30010637 Nucleolar RNA helicase II/Gu protein SMESG000065959.1 dd_Smed_v6_283_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30000428 Glutathione S-transferase SMESG000016836.1 dd_Smed_v6_816_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30000995 Pyruvate kinase SMESG000052083.1 SMESG000048475.1 dd_Smed_v6_605_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30030679 Elongation of very long chain fatty acids protein SMESG000068877.1 SMESG000068874.1 dd_Smed_v6_4252_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30027156 SMED30027156 SMESG000038687.1 SMESG000038673.1 dd_Smed_v6_1013_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30031352 SMED30031352 SMESG000006235.1 dd_Smed_v6_6275_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30025313 Thioredoxin glutathione reductase SMESG000020047.1 dd_Smed_v6_960_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30030422 SMED30030422 SMESG000077265.1 dd_Smed_v6_830_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30022078 Translationally-controlled tumor protein homolog SMESG000023212.1 dd_Smed_v6_136_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30022992 Myosin heavy chain SMESG000062420.1 dd_Smed_v6_791_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30034381 Malate dehydrogenase SMESG000056995.1 dd_Smed_v6_467_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30030681 SMED30030681 SMESG000038678.1 dd_Smed_v6_327_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30028142 SMED30028142 SMESG000061765.1 SMESG000061762.1 dd_Smed_v6_379_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30024058 SMED30024058 SMESG000020813.1 dd_Smed_v6_3688_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30032169 Glycine amidinotransferase, mitochondrial SMESG000043142.1 dd_Smed_v6_1943_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30027745 molybdate-anion transporter isoform X2 SMESG000027072.1 dd_Smed_v6_3699_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30020269 Myophilin SMESG000081505.1 SMESG000049198.1 SMESG000047694.1 SMESG000035451.1 SMESG000035348.1 dd_Smed_v6_395_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30023536 Microsomal glutathione S-transferase 3 SMESG000078588.1 dd_Smed_v6_1661_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30026803 X1.D.D8.3 SMESG000053883.1 dd_Smed_v6_8540_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30028449 High density lipoprotein binding protein (Vigilin) SMESG000016436.1 dd_Smed_v6_553_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30023489 CDGSH iron sulfur domain-containing protein 3, mitochondrial SMESG000016828.1 dd_Smed_v6_935_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30032429 Inositol phosphoceramide mannosyltransferase 3 SMESG000065897.1 SMESG000065885.1 SMESG000065880.1 SMESG000065849.1 dd_Smed_v6_7249_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30031061 Nucleobindin-2 SMESG000017142.1 dd_Smed_v6_6010_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30026101 Reticulocalbin-1 SMESG000077405.1 dd_Smed_v6_5905_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30030234 Tubulin alpha chain SMESG000041107.1 dd_Smed_v6_758_1 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30029770 ATP-binding cassette sub-family F member 2 SMESG000071613.1 dd_Smed_v6_434_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30028888 Transmembrane emp24 domain-containing protein 10 SMESG000024933.1 dd_Smed_v6_746_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30031631 6-phosphogluconate dehydrogenase, decarboxylating SMESG000005721.1 dd_Smed_v6_366_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30028069 SMED30028069 SMESG000059907.1 dd_Smed_v6_5497_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30029873 SMED30029873 SMESG000042500.1 dd_Smed_v6_5474_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30029873 SMED30029873 SMESG000042500.1 dd_Smed_v6_7038_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30021105 Tubulin alpha chain SMESG000005506.1 SMESG000005505.1 SMESG000005493.1 SMESG000005489.1 SMESG000005487.1 dd_Smed_v6_38_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30025603 SMED30025603 SMESG000018472.1 dd_Smed_v6_3226_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30035148 SMED30035148 SMESG000021388.1 dd_Smed_v6_1925_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30026808 EF-hand domain-containing protein SMESG000081370.1 dd_Smed_v6_446_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30022769 Glycine receptor subunit alpha-3 SMESG000061905.1 dd_Smed_v6_8110_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30030642 Cytochrome P450 2C3 SMESG000023530.1 SMESG000023528.1 dd_Smed_v6_7874_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30022628 G_PROTEIN_RECEP_F1_2 domain-containing protein SMESG000060403.1 dd_Smed_v6_361_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30020328 X1.C4.1 SMESG000046999.1 dd_Smed_v6_558_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30034746 Ornithine decarboxylase-1 SMESG000062429.1 dd_Smed_v6_6130_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30003044 Reticulocalbin SMESG000077405.1 dd_Smed_v6_5905_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30018929 Glycine N-acyltransferase 3 SMESG000063826.1 dd_Smed_v6_5477_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30016080 Deoxyhypusine hydroxylase SMESG000051726.1 SMESG000051721.1 dd_Smed_v6_703_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30019154 Glycine amidinotransferase mitochondrial SMESG000068402.1 dd_Smed_v6_2385_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30015411 GLTP domain-containing protein dd_Smed_v6_2621_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30011747 SMED30011747 dd_Smed_v6_494_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30005644 X1.A.D4.1 SMESG000053861.1 dd_Smed_v6_771_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30000902 SMED30000902 SMESG000043277.1 dd_Smed_v6_647_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30004267 Actin, cytoplasmic SMESG000035518.1 dd_Smed_v6_232_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30014713 SMED30014713 SMESG000061767.1 dd_Smed_v6_767_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30009513 Glycine amidinotransferase, mitochondrial SMESG000051953.1 dd_Smed_v6_899_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30005470 Selenoprotein W dd_Smed_v6_616_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30008120 SMED30008120 SMESG000042787.1 dd_Smed_v6_263_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30012026 SMED30012026 dd_Smed_v6_617_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30013107 Glyceraldehyde-3-phosphate dehydrogenase SMESG000052353.1 dd_Smed_v6_78_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30009290 SMED30009290 dd_Smed_v6_7103_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30001567 SMED30001567 SMESG000022139.1 dd_Smed_v6_715_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30006057 SMED30006057 SMESG000064381.1 dd_Smed_v6_2460_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30017499 SMED30017499 dd_Smed_v6_459_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30031984 Selenoprotein F dd_Smed_v6_304_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30024172 SMED30024172 dd_Smed_v6_13035_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30024881 Actin, cytoplasmic 2 SMESG000035518.1 dd_Smed_v6_218_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30021565 Proline dehydrogenase SMESG000077440.1 dd_Smed_v6_7017_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30034660 Spectrin beta chain, non-erythrocytic 5 SMESG000023006.1 dd_Smed_v6_2514_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30025667 Cell division cycle protein 16 SMESG000050407.1 dd_Smed_v6_7357_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30029103 Glutamine synthetase SMESG000000228.1 SMESG000000227.1 SMESG000000225.1 SMESG000000212.1 dd_Smed_v6_896_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30028513 Transcriptional activator protein Pur-beta dd_Smed_v6_346_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30020810 SMED30020810 SMESG000068262.1 SMESG000053435.1 SMESG000049288.1 dd_Smed_v6_6797_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30031869 SMED30031869 SMESG000055717.1 dd_Smed_v6_2079_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30030707 SMED30030707 dd_Smed_v6_13035_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30020996 ADP-ribosylation factor GTPase-activating protein 2 SMESG000008345.1 dd_Smed_v6_539_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30014220 SMED30014220 SMESG000052497.1 dd_Smed_v6_2843_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30010415 pmp-10 SMESG000068428.1 dd_Smed_v6_343_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30006119 X-box-binding protein 1 SMESG000048111.1 dd_Smed_v6_415_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30002834 SMED30002834 SMESG000043420.1 dd_Smed_v6_460_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30013480 Dihydropyrimidinase SMESG000060188.1 dd_Smed_v6_2040_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30008522 Fatty acid-binding protein SMESG000015143.1 dd_Smed_v6_271_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30009457 reticulocalbin-1 SMESG000034805.1 dd_Smed_v6_493_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30013312 Calpain SMESG000062904.1 SMESG000062902.1 dd_Smed_v6_1971_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30002992 SMED30002992 SMESG000012171.1 dd_Smed_v6_247_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30017206 Band 4.1 protein 2 SMESG000062476.1 dd_Smed_v6_2032_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30015020 E3 ubiquitin-protein ligase XIAP SMESG000031958.1 dd_Smed_v6_2104_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30000771 SMED30000771 SMESG000059918.1 SMESG000052306.1 SMESG000022407.1 dd_Smed_v6_1996_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30000771 SMED30000771 SMESG000059918.1 SMESG000052306.1 SMESG000022407.1 dd_Smed_v6_474_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30006777 Collagen alpha-1(XV) chain SMESG000081921.1 dd_Smed_v4_3516_1_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30008797 SMED30008797 SMESG000076328.1 dd_Smed_v4_1587_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30019936 slc16a-7 SMESG000023800.1 SMESG000016424.1 dd_Smed_v4_16824_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30000032 SMED30000032 SMESG000064381.1 dd_Smed_v4_2460_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30016212 Protocadherin gamma-B5 SMESG000016762.1 dd_Smed_v4_10495_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30034468 SMED30034468 dd_Smed_v4_28220_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30021328 SMED30021328 SMESG000028190.1 dd_Smed_v4_17722_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30033585 Elongation of very long chain fatty acids protein SMESG000021565.1 dd_Smed_v4_523_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30033890 SMED30033890 dd_Smed_v4_16890_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30024056 SMED30024056 dd_Smed_v4_14719_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30029539 Protocadherin Fat 4 SMESG000002878.1 dd_Smed_v4_30149_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30030192 SMED30030192 SMESG000055517.1 dd_Smed_v4_8042_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30030464 SMED30030464 SMESG000029581.1 SMESG000029574.1 dd_Smed_v4_135_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30032006 slc7a-2 SMESG000031905.1 dd_Smed_v4_16390_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30033621 Ornithine decarboxylase SMESG000041045.1 dd_Smed_v4_8195_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30033184 SMED30033184 dd_Smed_v4_16881_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30026041 SMED30026041 dd_Smed_v4_16497_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30034839 SMED30034839 SMESG000042050.1 dd_Smed_v4_14160_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30020944 SMED30020944 dd_Smed_v4_15635_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30027137 SMED30027137 dd_Smed_v4_13786_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30025171 SMED30025171 SMESG000014769.1 dd_Smed_v4_1952_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30008541 Synaptotagmin-1 Synaptotagmin I SMESG000041533.1 dd_Smed_v4_20033_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30011491 SMED30011491 SMESG000011704.1 dd_Smed_v4_12109_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30016659 slc22a-10 SMESG000075938.1 dd_Smed_v4_12547_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30007738 SMED30007738 SMESG000035479.1 dd_Smed_v4_19930_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30010404 SMED30010404 SMESG000076927.1 dd_Smed_v4_5958_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30001853 Protein kinase domain-containing protein SMESG000003859.1 dd_Smed_v4_1897_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30007341 TBC1 domain family member 2B SMESG000078416.1 dd_Smed_v4_6508_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30008591 Zinc finger MYM-type protein 1 SMESG000042369.1 dd_Smed_v4_12925_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30011700 Calcium-binding protein A SMESG000052083.1 SMESG000048475.1 dd_Smed_v4_605_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30017770 Zinc finger MYM-type protein 1 SMESG000042369.1 dd_Smed_v4_12925_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30016515 SMED30016515 SMESG000023204.1 dd_Smed_v4_38949_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30004339 Slc16a-7 SMESG000023798.1 SMESG000016446.1 dd_Smed_v4_13379_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30014053 Cationic amino acid transporter 4 SMESG000081300.1 dd_Smed_v4_11305_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30002489 Apical junction component 1 homolog SMESG000037093.1 dd_Smed_v4_11689_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30006091 CA domain-containing protein SMESG000044292.1 dd_Smed_v4_12872_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30006180 Fibrillar collagen NC1 domain-containing protein SMESG000031448.1 dd_Smed_v4_702_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30007084 TNF receptor-associated factor SMESG000053469.1 dd_Smed_v4_13061_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30005565 SMED30005565 SMESG000010564.1 dd_Smed_v4_8271_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30000995 Pyruvate kinase SMESG000052083.1 SMESG000048475.1 dd_Smed_v4_605_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30022933 SMED30022933 SMESG000007221.1 dd_Smed_v4_38861_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30028236 slc16a-2 SMESG000026519.1 dd_Smed_v4_8997_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30025375 SMED30025375 SMESG000035479.1 dd_Smed_v4_19930_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30031328 slc7a-3 SMESG000081300.1 dd_Smed_v4_11305_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30027156 SMED30027156 SMESG000038687.1 SMESG000038673.1 dd_Smed_v4_1013_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30030422 SMED30030422 SMESG000077265.1 dd_Smed_v4_830_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30020157 SMED30020157 SMESG000042369.1 dd_Smed_v4_12925_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30021257 Synaptic vesicle 2-related protein SMESG000069049.1 SMESG000069045.1 dd_Smed_v4_12695_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30028142 SMED30028142 SMESG000061765.1 SMESG000061762.1 dd_Smed_v4_379_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30032169 Glycine amidinotransferase, mitochondrial SMESG000043142.1 dd_Smed_v4_1943_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30024902 C2H2-type domain-containing protein SMESG000014973.1 dd_Smed_v4_11893_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30030952 LITAF domain-containing protein SMESG000020864.1 dd_Smed_v4_11813_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30029873 SMED30029873 SMESG000042500.1 dd_Smed_v4_7038_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30029873 SMED30029873 SMESG000042500.1 dd_Smed_v4_5474_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30025603 SMED30025603 SMESG000018472.1 dd_Smed_v4_3226_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30030958 SMED30030958 SMESG000016877.1 dd_Smed_v4_10004_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30030202 BAR domain-containing protein SMESG000043769.1 dd_Smed_v4_5879_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30034242 SMED30034242 SMESG000044292.1 dd_Smed_v4_12872_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30030642 Cytochrome P450 2C3 SMESG000023530.1 SMESG000023528.1 dd_Smed_v4_7874_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30034746 Ornithine decarboxylase-1 SMESG000062429.1 dd_Smed_v4_6130_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30013950 gdf-like protein SMESG000080854.1 dd_Smed_v4_26705_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30009021 SMED30009021 dd_Smed_v4_31431_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30018929 Glycine N-acyltransferase 3 SMESG000063826.1 dd_Smed_v4_5477_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30011193 SMED30011193 dd_Smed_v4_21173_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30019154 Glycine amidinotransferase mitochondrial SMESG000068402.1 dd_Smed_v4_2385_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30013415 Fibronectin type III and ankyrin repeat domains 1 SMESG000029032.1 dd_Smed_v4_34489_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30006449 SMED30006449 dd_Smed_v4_20132_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30019017 SMED30019017 SMESG000074220.1 dd_Smed_v4_22388_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30006968 SMED30006968 dd_Smed_v4_55350_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30003326 SMED30003326 SMESG000013799.1 dd_Smed_v4_2896_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30014006 MFS domain-containing protein SMESG000060691.1 dd_Smed_v4_3455_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30014713 SMED30014713 SMESG000061767.1 dd_Smed_v4_767_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30010366 slc25a-19 SMESG000020909.1 SMESG000020904.1 dd_Smed_v4_10436_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30009513 Glycine amidinotransferase, mitochondrial SMESG000051953.1 dd_Smed_v4_899_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30001471 Cytochrome P450 2K1-like protein SMESG000022101.1 SMESG000022100.1 dd_Smed_v4_11238_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30012888 SMED30012888 dd_Smed_v4_20132_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30004033 SMED30004033 dd_Smed_v4_33434_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30008120 SMED30008120 SMESG000042787.1 dd_Smed_v4_263_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30011135 MFS domain-containing protein SMESG000060691.1 dd_Smed_v4_3455_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30010806 SMED30010806 SMESG000022711.1 SMESG000068945.1 dd_Smed_v4_21342_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30015561 SMED30015561 dd_Smed_v4_6429_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30001567 SMED30001567 SMESG000022139.1 dd_Smed_v4_715_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30003923 MFS domain-containing protein SMESG000060691.1 dd_Smed_v4_3455_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30006057 SMED30006057 SMESG000064381.1 dd_Smed_v4_2460_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30014522 SMED30014522 dd_Smed_v4_20132_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30030057 GLOBIN domain-containing protein SMESG000048632.1 SMESG000022262.1 dd_Smed_v4_2237_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30023961 RING finger protein 150 SMESG000026513.1 dd_Smed_v4_5532_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30026081 SMED30026081 dd_Smed_v4_21173_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30020601 SMED30020601 dd_Smed_v4_53499_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30032980 DDE_Tnp_IS1595 domain-containing protein dd_Smed_v4_23804_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30028506 SMED30028506 dd_Smed_v4_20920_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30035267 Alkylglycerol monooxygenase SMESG000043173.1 dd_Smed_v4_3673_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30025272 Laminin subunit gamma-1 SMESG000019909.1 dd_Smed_v4_7359_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30023436 MFS domain-containing protein SMESG000000088.1 dd_Smed_v4_35070_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30020042 SMED30020042 SMESG000014768.1 dd_Smed_v4_6346_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30021298 SMED30021298 dd_Smed_v4_21183_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30026973 SMED30026973 SMESG000033974.1 dd_Smed_v4_34155_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30029229 SMED30029229 SMESG000033974.1 dd_Smed_v4_34155_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30031869 SMED30031869 SMESG000055717.1 dd_Smed_v4_2079_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30028261 Innexin SMESG000030970.1 dd_Smed_v4_6798_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30029960 SMED30029960 SMESG000056926.1 dd_Smed_v6_270_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30034254 calreticulin-1 SMESG000077304.1 SMESG000009012.1 dd_Smed_v6_220_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30028808 calreticulin-2 SMESG000077304.1 SMESG000009012.1 dd_Smed_v6_220_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30031756 SMED30031756 SMESG000043890.1 SMESG000043321.1 SMESG000043310.1 SMESG000043263.1 SMESG000020012.1 SMESG000019997.1 dd_Smed_v6_517_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30034619 SMED30034619 SMESG000029095.1 dd_Smed_v6_3913_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30018088 SMED30018088 SMESG000068428.1 dd_Smed_v6_343_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30019369 SMED30019369 SMESG000042765.1 dd_Smed_v6_2147_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30018339 SMED30018339 SMESG000005125.1 dd_Smed_v6_4793_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30021698 14-3-3 protein epsilon SMESG000047644.1 dd_Smed_v6_36_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30024106 Mitochondrial ATP synthase subunit 9 SMESG000059768.1 dd_Smed_v6_401_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30020948 SMED30020948 SMESG000024857.1 dd_Smed_v6_409_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30021758 SMED30021758 SMESG000078995.1 dd_Smed_v6_3725_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30024954 X1.C4.1 SMESG000043890.1 SMESG000043321.1 SMESG000043310.1 SMESG000043263.1 SMESG000020012.1 SMESG000019997.1 dd_Smed_v6_517_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30023530 Peptidase M20 domain-containing protein 2 SMESG000049098.1 dd_Smed_v6_7395_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30021619 X1.C4.1 SMESG000043890.1 SMESG000043321.1 SMESG000043310.1 SMESG000043263.1 SMESG000020012.1 SMESG000019997.1 dd_Smed_v6_517_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30022783 X1.C4.1 SMESG000043890.1 SMESG000043321.1 SMESG000043310.1 SMESG000043263.1 SMESG000020012.1 SMESG000019997.1 dd_Smed_v6_517_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30025830 Ornithine decarboxylase SMESG000015244.1 SMESG000015241.1 SMESG000004848.1 SMESG000004822.1 SMESG000004820.1 SMESG000004806.1 dd_Smed_v6_280_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30019041 Synaptic vesicle 2-related protein SMESG000035457.1 dd_Smed_v6_59_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30015546 Cyclic AMP-responsive element-binding protein 3 SMESG000059546.1 dd_Smed_v6_1032_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30000205 SMED30000205 SMESG000068262.1 SMESG000053435.1 SMESG000049288.1 dd_Smed_v6_6797_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30008536 SMED30008536 dd_Smed_v6_15429_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30015672 Gelsolin-like protein SMESG000015928.1 dd_Smed_v6_1215_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30003313 SMED30003313 dd_Smed_v6_616_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30013893 Histocompatibility (minor) 13 SMESG000016697.1 dd_Smed_v6_1203_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30016392 SMED30016392 SMESG000059904.1 SMESG000042945.1 SMESG000007620.1 SMESG000072638.1 SMESG000039380.1 SMESG000042352.1 SMESG000028417.1 dd_Smed_v6_10138_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30003086 GTP-binding protein-like protein SMESG000018556.1 dd_Smed_v6_589_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30004121 SMED30004121 SMESG000014792.1 dd_Smed_v6_694_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30008381 SMED30008381 SMESG000068262.1 SMESG000053435.1 SMESG000049288.1 dd_Smed_v6_6797_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30004108 SMED30004108 SMESG000043419.1 dd_Smed_v6_644_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30003274 X1.A.C4.1 SMESG000079273.1 dd_Smed_v6_3278_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30018138 SMED30018138 SMESG000017277.1 SMESG000017274.1 SMESG000017276.1 dd_Smed_v6_1245_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30018138 SMED30018138 SMESG000017276.1 dd_Smed_v6_639_1 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30005429 SMED30005429 SMESG000030956.1 SMESG000030911.1 dd_Smed_v6_902_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30012378 Clathrin heavy chain SMESG000035457.1 dd_Smed_v6_59_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30018173 Sodium/potassium-transporting ATPase subunit beta-1 isoform 2 SMESG000064592.1 dd_Smed_v6_6559_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30018637 Heat shock cognate 70 kDa protein SMESG000040632.1 dd_Smed_v6_15_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30016539 SMED30016539 SMESG000017277.1 SMESG000017274.1 SMESG000017276.1 dd_Smed_v6_1245_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30012310 SMED30012310 SMESG000028761.1 dd_Smed_v6_5231_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30013293 Major vault protein SMESG000037707.1 dd_Smed_v6_1098_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30005835 SMED30005835 SMESG000012702.1 SMESG000012701.1 SMESG000012690.1 SMESG000012688.1 SMESG000012672.1 dd_Smed_v6_55_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30001824 SMED30001824 SMESG000026020.1 dd_Smed_v6_2027_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30018603 Receptor expression-enhancing protein SMESG000043862.1 dd_Smed_v6_838_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30015906 Succinyl-CoA:3-ketoacid-coenzyme A transferase SMESG000080432.1 SMESG000080424.1 dd_Smed_v6_1189_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30015362 SMED30015362 SMESG000043289.1 dd_Smed_v6_80_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30011492 HTH CENPB-type domain-containing protein SMESG000068262.1 SMESG000053435.1 SMESG000049288.1 dd_Smed_v6_6797_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30005321 Malate dehydrogenase SMESG000008924.1 dd_Smed_v6_656_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30005838 X1.C3.3 SMESG000058321.1 SMESG000058307.1 dd_Smed_v6_68_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30010405 SMED30010405 SMESG000043444.1 SMESG000043435.1 dd_Smed_v6_18_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30018809 Transposase, Tc1-like protein SMESG000068262.1 SMESG000053435.1 SMESG000049288.1 dd_Smed_v6_6797_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30001367 ADP-ribosylation factor 1 SMESG000067743.1 dd_Smed_v6_203_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30008856 SMED30008856 SMESG000025888.1 dd_Smed_v6_1422_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30004608 Protein kinase domain-containing protein SMESG000030766.1 dd_Smed_v6_85086_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30000032 SMED30000032 SMESG000064381.1 dd_Smed_v6_2460_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30011623 SMED30011623 SMESG000043444.1 SMESG000043435.1 dd_Smed_v6_18_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30002867 SMED30002867 dd_Smed_v6_9764_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30021511 SMED30021511 SMESG000038232.1 SMESG000010788.1 dd_Smed_v6_759_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30025127 Tigger transposable element-derived protein 1 SMESG000068262.1 SMESG000053435.1 SMESG000049288.1 dd_Smed_v6_6797_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30033585 Elongation of very long chain fatty acids protein SMESG000021565.1 dd_Smed_v6_523_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30029823 MFS domain-containing protein SMESG000000287.1 SMESG000000110.1 dd_Smed_v6_11835_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30020511 Tigger transposable element-derived protein 2 SMESG000068262.1 SMESG000053435.1 SMESG000049288.1 dd_Smed_v6_6797_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30021590 Spectrin beta chain SMESG000081696.1 dd_Smed_v6_1122_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30023766 SMED30023766 SMESG000073811.1 dd_Smed_v6_116_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30029450 Succinyl-CoA:3-ketoacid-coenzyme A transferase SMESG000080432.1 SMESG000080424.1 dd_Smed_v6_1189_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30030192 SMED30030192 SMESG000055517.1 dd_Smed_v6_8042_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30034546 Protein transport protein Sec61 subunit gamma SMESG000062123.1 SMESG000063809.1 dd_Smed_v6_429_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30025783 NADPH--cytochrome P450 reductase SMESG000022047.1 dd_Smed_v6_542_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30033621 Ornithine decarboxylase SMESG000041045.1 dd_Smed_v6_8195_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30020317 Heat shock protein 90 SMESG000024822.1 dd_Smed_v6_678_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30033197 SMED30033197 SMESG000073811.1 dd_Smed_v6_116_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30034506 Angiotensin-converting enzyme SMESG000005710.1 dd_Smed_v6_6160_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30025067 Endoplasmic reticulum chaperone BiP SMESG000062699.1 dd_Smed_v6_511_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30035193 Heat shock protein 90 SMESG000071533.1 SMESG000071531.1 dd_Smed_v6_56_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30022677 sphingolipid delta(4)-desaturase DES1 SMESG000025057.1 dd_Smed_v6_1100_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30021601 SMED30021601 SMESG000003951.1 dd_Smed_v6_6596_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30025310 SMED30025310 SMESG000050440.1 dd_Smed_v6_1552_1 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30031823 Translocating chain-associated membrane protein SMESG000051052.1 dd_Smed_v6_1740_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30027539 MFS domain-containing protein SMESG000000287.1 SMESG000000110.1 dd_Smed_v6_11835_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30022344 FERM domain containing-1 SMESG000070273.1 dd_Smed_v6_1131_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30026646 Dynein light chain SMESG000009941.1 dd_Smed_v6_107_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30020630 Usp domain-containing protein SMESG000068262.1 SMESG000053435.1 SMESG000049288.1 dd_Smed_v6_6797_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30028204 Succinyl-CoA:3-ketoacid-coenzyme A transferase SMESG000080432.1 SMESG000080424.1 dd_Smed_v6_1189_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30025174 Selenoprotein W dd_Smed_v6_1908_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30005523 Alpha-actinin SMESG000026000.1 dd_Smed_v6_1951_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30011525 SMED30011525 SMESG000000175.1 dd_Smed_v6_383_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30008609 SMED30008609 SMESG000059918.1 SMESG000052306.1 SMESG000022407.1 dd_Smed_v6_474_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30010404 SMED30010404 SMESG000076927.1 dd_Smed_v6_5958_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30008169 EF-hand domain-containing protein SMESG000026622.1 dd_Smed_v6_1881_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30003468 Phosphoenolpyruvate carboxykinase [GTP] SMESG000073058.1 SMESG000003144.1 dd_Smed_v6_536_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30001853 Protein kinase domain-containing protein SMESG000003859.1 dd_Smed_v6_1897_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30002705 SMED30002705 SMESG000020813.1 dd_Smed_v6_3688_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30001586 Spectrin alpha chain SMESG000005289.1 dd_Smed_v6_919_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30011041 Heat shock protein 903 SMESG000041107.1 dd_Smed_v6_758_1 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30007341 TBC1 domain family member 2B SMESG000078416.1 dd_Smed_v6_6508_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30010712 SMED30010712 SMESG000051055.1 dd_Smed_v6_4926_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30012787 MANSC domain-containing protein SMESG000015184.1 dd_Smed_v6_5586_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30011700 Calcium-binding protein A SMESG000052083.1 SMESG000048475.1 dd_Smed_v6_605_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30014980 Lamin SMESG000009886.1 dd_Smed_v6_850_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30011490 EF-hand domain-containing protein SMESG000026288.1 dd_Smed_v6_824_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30018297 Dynein light chain SMESG000019341.1 dd_Smed_v6_177_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30019692 DUF3421 domain-containing protein SMESG000046732.1 dd_Smed_v6_844_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30001359 SMED30001359 SMESG000059918.1 SMESG000052306.1 SMESG000022407.1 dd_Smed_v6_1996_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30001359 SMED30001359 SMESG000059918.1 SMESG000052306.1 SMESG000022407.1 dd_Smed_v6_474_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30014017 1.C5.1 SMESG000003566.1 dd_Smed_v6_291_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30001329 SMED30001329 SMESG000074407.1 SMESG000074416.1 dd_Smed_v6_3361_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30003482 Endoplasmic reticulum chaperone BiP SMESG000061528.1 dd_Smed_v6_2648_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30013168 Calpain SMESG000062904.1 SMESG000062902.1 dd_Smed_v6_1971_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30009287 Protein kinase, putative SMESG000074407.1 SMESG000074416.1 dd_Smed_v6_3361_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30012826 SMED30012826 SMESG000017012.1 SMESG000017011.1 dd_Smed_v6_309_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30014918 Ornithine decarboxylase SMESG000060777.1 dd_Smed_v6_4916_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30010792 Protein kinase SMESG000074407.1 SMESG000074416.1 dd_Smed_v6_3361_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30016338 Alpha-adducin SMESG000051636.1 dd_Smed_v6_2345_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30008553 Phosphoenolpyruvate carboxykinase [GTP] SMESG000062868.1 dd_Smed_v6_196_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30022249 Clathrin interactor 1 SMESG000032527.1 SMESG000022725.1 dd_Smed_v6_1563_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30031345 Pyruvate dehydrogenase E1 component subunit alpha SMESG000073271.1 dd_Smed_v6_1310_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30035571 Protein disulfide-isomerase A5 SMESG000005268.1 dd_Smed_v6_1537_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30022331 Translocon-associated protein, gamma subunit SMESG000066628.1 dd_Smed_v6_1265_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30027542 CRAL-TRIO domain-containing protein SMESG000019717.1 dd_Smed_v6_1619_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30026513 SMED30026513 SMESG000005268.1 dd_Smed_v6_1537_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30028938 Protein disulfide-isomerase A6 SMESG000023147.1 SMESG000017020.1 dd_Smed_v6_250_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30035250 lipopolysaccharide-induced tumor necrosis factor-alpha factor homolog SMESG000033033.1 dd_Smed_v6_2503_0 dd_Smed_v6 PMID:29674432
Plass et al., 2018
Category 3 cell SMED30006473 MFS domain-containing protein SMESG000018042.1 dd_Smed_v4_11486_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30034257 CRAL-TRIO domain-containing protein SMESG000009988.1 dd_Smed_v4_3680_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30031568 Cytochrome P450 2L1 SMESG000050434.1 dd_Smed_v4_5307_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30032538 MFS domain-containing protein SMESG000055803.1 dd_Smed_v4_5294_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30029717 SMED30029717 SMESG000018042.1 dd_Smed_v4_11486_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30011291 Acidic phospholipase A2 SMESG000079712.1 dd_Smed_v4_2969_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30006083 SMED30006083 SMESG000061797.1 dd_Smed_v4_6028_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30013885 SMED30013885 SMESG000046850.1 dd_Smed_v4_9640_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30010951 SMED30010951 SMESG000076142.1 dd_Smed_v4_719_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30011447 SMED30011447 SMESG000034829.1 dd_Smed_v4_1321_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30011140 Argininosuccinate synthase SMESG000053053.1 SMESG000053052.1 dd_Smed_v4_3086_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30004312 Parvo_coat_N domain-containing protein dd_Smed_v4_28220_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30002693 SMED30002693 SMESG000078700.1 dd_Smed_v4_15736_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30004351 SMED30004351 dd_Smed_v4_15429_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30004513 Gamma-aminobutyric acid type B receptor SMESG000049232.1 dd_Smed_v4_60992_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30001371 P/Homo B domain-containing protein SMESG000074553.1 SMESG000074551.1 dd_Smed_v4_1484_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30012767 SMED30012767 dd_Smed_v4_917_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30000850 slc7a-8 SMESG000006721.1 dd_Smed_v4_12027_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30021793 Pmp-10 SMESG000068743.1 dd_Smed_v4_2178_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30030292 Cytochrome P450, family 1, subfamily D, polypeptide 1 SMESG000012534.1 dd_Smed_v4_2162_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30024165 SMED30024165 dd_Smed_v4_2664_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30005357 hypothetical protein SMESG000027979.1 dd_Smed_v4_775_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30000058 SMED30000058 SMESG000022049.1 dd_Smed_v4_499_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30018924 SMED30018924 SMESG000028420.1 dd_Smed_v4_468_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30002098 carboxypeptidase E SMESG000062760.1 dd_Smed_v4_4210_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30016382 SMED30016382 SMESG000029089.1 dd_Smed_v4_2873_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30005740 SMED30005740 SMESG000029096.1 dd_Smed_v4_480_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30000827 SMED30000827 SMESG000043280.1 dd_Smed_v4_278_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30002356 SMED30002356 SMESG000069796.1 dd_Smed_v4_4492_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30020865 Aminopeptidase SMESG000033900.1 SMESG000033518.1 SMESG000022330.1 SMESG000022279.1 SMESG000022278.1 dd_Smed_v4_4516_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30020794 SMED30020794 SMESG000056235.1 dd_Smed_v4_1413_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30018353 Glycine amidinotransferase, mitochondrial SMESG000051964.1 dd_Smed_v4_920_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30022130 SMED30022130 SMESG000026848.1 dd_Smed_v4_1128_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30025584 SMED30025584 SMESG000077266.1 dd_Smed_v4_1066_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30027207 Ornithine decarboxylase SMESG000055750.1 dd_Smed_v4_5493_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30027266 SMED30027266 SMESG000041022.1 dd_Smed_v4_7160_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30024934 3-hydroxybutyrate dehydrogenase, type 1 SMESG000039796.1 SMESG000039794.1 SMESG000039792.1 dd_Smed_v4_8012_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30026414 MPV17 mitochondrial membrane protein-like 2 SMESG000062744.1 dd_Smed_v4_4214_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30035874 SMED30035874 SMESG000043890.1 SMESG000043321.1 SMESG000043310.1 SMESG000043263.1 SMESG000020012.1 SMESG000019997.1 dd_Smed_v4_517_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30035490 SMED30035490 SMESG000042765.1 dd_Smed_v4_5159_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30027899 slc26a-10 SMESG000052008.1 SMESG000051986.1 dd_Smed_v4_5066_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30031918 SMED30031918 SMESG000043420.1 dd_Smed_v4_460_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30028892 SMED30028892 SMESG000010564.1 dd_Smed_v4_8271_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30029055 Protein-tyrosine-phosphatase SMESG000055801.1 dd_Smed_v4_4629_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30029159 SMED30029159 SMESG000029594.1 SMESG000029589.1 dd_Smed_v4_315_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30026350 slc26a-8 SMESG000064562.1 dd_Smed_v4_4250_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30029960 SMED30029960 SMESG000056926.1 dd_Smed_v4_270_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30031756 SMED30031756 SMESG000043890.1 SMESG000043321.1 SMESG000043310.1 SMESG000043263.1 SMESG000020012.1 SMESG000019997.1 dd_Smed_v4_517_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30034619 SMED30034619 SMESG000029095.1 dd_Smed_v4_3913_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30019369 SMED30019369 SMESG000042765.1 dd_Smed_v4_2147_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30018430 Active breakpoint cluster region-related protein SMESG000025211.1 dd_Smed_v4_4507_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30024954 X1.C4.1 SMESG000043890.1 SMESG000043321.1 SMESG000043310.1 SMESG000043263.1 SMESG000020012.1 SMESG000019997.1 dd_Smed_v4_517_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30023530 Peptidase M20 domain-containing protein 2 SMESG000049098.1 dd_Smed_v4_7395_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30021619 X1.C4.1 SMESG000043890.1 SMESG000043321.1 SMESG000043310.1 SMESG000043263.1 SMESG000020012.1 SMESG000019997.1 dd_Smed_v4_517_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30022783 X1.C4.1 SMESG000043890.1 SMESG000043321.1 SMESG000043310.1 SMESG000043263.1 SMESG000020012.1 SMESG000019997.1 dd_Smed_v4_517_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30025596 Ca(2 )/calmodulin-responsive adenylate cyclase SMESG000023584.1 dd_Smed_v4_4439_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30007566 Voltage-dependent calcium channel subunit alpha-2/delta-3 SMESG000020654.1 dd_Smed_v4_16278_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30001222 persulfide dioxygenase ETHE1, mitochondrial SMESG000066719.1 SMESG000066710.1 dd_Smed_v4_4089_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30000223 Otoferlin SMESG000010367.1 dd_Smed_v4_3993_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30001916 IRS-type PTB domain-containing protein SMESG000027222.1 dd_Smed_v4_9490_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30008536 SMED30008536 dd_Smed_v4_15429_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30018938 Innexin SMESG000003944.1 dd_Smed_v4_39254_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30004121 SMED30004121 SMESG000014792.1 dd_Smed_v4_694_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30002813 hypothetical protein SMESG000024478.1 SMESG000024473.1 dd_Smed_v4_574_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30003274 X1.A.C4.1 SMESG000079273.1 dd_Smed_v4_3278_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30005429 SMED30005429 SMESG000030956.1 SMESG000030911.1 dd_Smed_v4_902_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30012110 C2H2-type domain-containing protein SMESG000064731.1 dd_Smed_v4_18947_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30008964 SMED30008964 SMESG000010167.1 dd_Smed_v4_8925_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30018178 SMED30018178 SMESG000035470.1 dd_Smed_v4_16195_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30012310 SMED30012310 SMESG000028761.1 dd_Smed_v4_5231_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30014067 Integrase catalytic domain-containing protein dd_Smed_v4_16497_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30011944 Synaptic vesicle 2-related protein SMESG000020112.1 dd_Smed_v4_12720_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30016267 beta-secretase 1 SMESG000037819.1 dd_Smed_v4_4132_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30005835 SMED30005835 SMESG000012702.1 SMESG000012701.1 SMESG000012690.1 SMESG000012688.1 SMESG000012672.1 dd_Smed_v4_55_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30010746 Bestrophin homolog SMESG000003961.1 dd_Smed_v4_33028_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30019420 SMED30019420 SMESG000071974.1 dd_Smed_v4_16457_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30007756 SMED30007756 SMESG000007194.1 dd_Smed_v4_15484_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30017222 Histone H2A SMESG000074553.1 SMESG000074551.1 dd_Smed_v4_1484_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30000261 Ig-like domain-containing protein SMESG000044415.1 dd_Smed_v4_8619_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 3 cell SMED30010406 SMED30010406 SMESG000009335.1 dd_Smed_v4_18243_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Note: Hover over icons to view figure legend
↳contained in tail region, ventral region of the whole animal, copulatory region, posterior region of the whole animal, parapharyngeal region, prepharyngeal region, head region, dorsal region of the whole animal and anterior region of the whole animal
↳develops from Category 2 cell
↳existence overlaps Stage 6, juvenile stage, Stage 5, asexual adult, adult hermaphrodite, Stage 8 and Stage 7
↳existence starts during or after Stage 5
↳part of integumental system
→ Category 4 cell develops from Category 3 cell
DEPICTED BY:
BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):
Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.
EXPLORE ONTOLOGY GRAPH:
Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.
Embryonic Molecular Fate Mapping
All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource
IN SITU HYBRIDIZATION DATA:
Smed ID | Accession | Name | Alias | Expressed during stage(s) | Tissue/Pattern | Images |
---|---|---|---|---|---|---|
SMED30018353 | Glycine amidinotransferase, mitochondrial | AGAT-1 | Stage 5, Stage 6, Stage 7, Stage 8 | Category 3 cell, integumental system | ![]() |
Click to see image symbols and abbreviations
Abbreviation or symbol | Definition |
---|---|
O | oral hemisphere |
A | aboral hemisphere |
D | dorsal |
V | ventral |
L | lateral |
black arrowhead | embryonic pharynx |
red arrowhead | definitive pharynx |
black arrows | primitive gut |
yellow arrows | primitive ectoderm cells |
cyan arrows | brain |
cyan arrowheads | nerve cords |
blue arrowheads | eye progenitors (trail cells) |
purple arrowheads | eyes |
scale bar | 100 µm |
SEQUENCES:
smed_20140614 transcript sequences for genes validated by in situ hybridization (above).
>SMED30018353 ID=SMED30018353|Name=Glycine amidinotransferase, mitochondrial|organism=Schmidtea mediterranea sexual|type=transcript|length=1408bp
CAAGGGTAGTTTGATTATTTAGAAAAAAAGGATTTCCACCGGTTTTCTGTGATAAAAATTGTACAAAAATGCTTACCAAA
ATTGCTAGATCTCTGCACGATCAGATTTCCATAAACGTTGTCAACAAATTGTCAGCTAGGTTATGCTCGTATACACCTGG
TAACAAAAAACACAGCCCGGTTTGGGCCTGGAATGAATGGGACCCATTAGAAGAAATCGTTTTGGGACTTCCAGATATGG
CATGTTGTCCAGAGATTTTACCAGAAGCCAAAGCTTGCATTTCGGAAAACAAATTTGATTTCCTTTTAAAACACAAAGGA
AAATATTGGAAGGATGTAATTGAACCAGAACACTACAAAATAATGCTAGATGAGCACAAGAACTTCATAAAGATTCTACA
AGGAGAAGGAGTTAAAGTCGTCCATCCAGAACCGATTGATTTCGCTAAAACGCTCTGTACTCCAAACTTTACTGCCCATG
GAGTCGACTGTGCGATGCCGAGAGATTTTCTATTAATTGTCGGAAATGAAATGATTGAGTCCACCATGACTTGGAGATCG
AGATATTTTGAATTTATGTGCTATAAAAAATTAATTAAAGATTACTGGAGCCGGGGCGCTAAATGGACAGCGGCACCAAA
GCCGATGTGTAAAGAAACACTTTTTAAAGAAAATTATCGTGCTGACGAAGATTCAACAGCATTTTTCGATGAAAAGACTT
CGATTCTAACGGAAGAGGAACCAGTTTTCGACGCCGCAGATTTCATTCGATGTGGTAGGGATATATTTGCGCATGTCAGT
CAGGTTAGCAACAATGCAGGAATTGAATGGGTACGTAGACATTTGGCACCGAAAGGAATTAGAGTTCATTCAATGAATTT
CGTTGACCCTAAACCAATGCATATTGACACGACACTTTTCACACCTCGGCCAGGCCTCGCGATAACATGCCCAGAAAGAC
CATGCTTACAAATTGGTATGCTTAAAAAAGCCGGCTGGGATGTTGTCGTTGCTCCTTATCCAGATATTGCAAAGAATTTC
CCATACTATATCAGCTCTCAATGGTTGTCTCTTAATGTTGTCATGTTGGATGAAAACCGAGTTCTCGTAGAGAAAGATGA
AATTGGAATTCAAAAACTGTTTGAAAAGTGTGGCATTACTCCTGTAAAAGTTCCATTCAAACACTGCTTTTCCATAGGAG
GTGGTATTCATTGCTGGACATCGGATGTTAGAAGGCGAGGAGACCTTCAAAACTATTTTGACTGGCCTCAAGAAATCTTG
GAGAAATTTGAAACTCACTGAATATCACAATTGAAAATATAAAGAACATAACTTTTCCAACGTATATTAATTATTTGTAA
TAAAATACACTGCTTACATCGTGTCAATTTTATTTACTGATTAATTAC
>SMED30009513 ID=SMED30009513|Name=Glycine amidinotransferase, mitochondrial|organism=Schmidtea mediterranea sexual|type=transcript|length=1650bp
AAATCTATATAAATCTTATATGATCCTTTGATGCTTTCAAAATTCAACCGAATCCTTCCATTAAACAGTGTTTATAAAAT
TAGCGCTCCAGCAGCCAACATCAAATATAGAAATTGTTGTAGCAAATCCTCAACAGATAAACCAACAAATAAGCGTAACA
GTCCCGTATGGAGCTGGAATGAATGGGATCCTTTGGAAGAAGTAATTGTTGGTGTACCTGATCATGGTGTAGTTCCATAT
CCTTATCCAGAAACAGCGGCATGCTTTGGAGAACGTTTAACAGAAAACTTTATGAAAAAATATGGAGGAAAATACTGGAG
TGACATCATGCCTAAAGAAGTTTGGAATAACGTTTTGAAGGAACATAAAGAATTCTGTAACATCCTAAAAGGCGAAGGTG
TGACTGTGGTTCATCCAACACCAATGGATATGAAAAAAGAATACGAAACTCCATATTTCAAATCTGTCGGTTTGGATGTT
GCATTTCCAAGAGATATAATTCTCGTAGTTGGCGATGAAATTATGGAAACAACGATGACTTGGAGGTCAAGATTTTGGGA
ATATCTTTGCTACAGACCATTGATGCTAGATTATTGGAAACGGGGAGCAAATTTTCAATCAGCACCAAAACCAGTGTGTA
GCGAAGAAAGTTTTAAAAAGGATTTTGACATTTCAGGCAATAAATTCGATGAGTTGGGATATGTAACAACTGAATTCGAA
CCGATGTTTGATGCCGCAGATTTCATGAGGGCTGGCCGAGATATTTTTGTTCAACAAAGTCACGTAACAAATGCCACTGG
AATTGAATGGATGCGTCGCCATTTAGCTGAAAAAGGAATTCGGTTACACTTGTTGAATTTCAATGATCCATATGCCATGC
ATATCGATGCTACATTTTTCACAGTGAAACCCGGATACTTAATAGAGAATCCTGAAGTCATAAATCCGTATGCTGATTAT
TTGAAGAAGGCCGGTTGGAAGATTGTGAAGGGTCCAAAACCAGCAGATAGATCAGACATGTATGAAGGCATGAGTTACAA
GTGGCTATCTATGAACGTTTTAGTTCTTGATCAAAAACGAGTGTTAGTTGAAAAGCGAGAGGTTGGAATGCACAAAATGT
TTGAGTCAATCGGCATGCAACCGATCAAAGTTGATTTCGGACATTGTTTCGCTGTTGGCGGAGGGTTGCATTGTTGGACT
TCCGATGTTCGAAGAAAAGGAACTCTGGAAAATTACTTTGATTGGCCACAAGAAGTATTGGAAAAAGTATCATTGGATAA
ATAAACAATAATAGTTGAACAAGCTCCTATACTATCAGCAAAATCGACACTATCGCTGATTATATATAAATATTTATATA
TTTTGATAAAATATGTATTTATAATTTTCTCTTATTTTATTGTTATGATAATTTATAAATTTGAATTTTACTTTGTTTGA
ATCATAAACATTTATTAAAGTTATTTGTCAAAAGATGAAAATTAAAACAAAACGTGTAATCATTGCTATCTTCAATCATG
TAACAAGAAATAATTGCAATTTATCTTTATGTTGAGATAGCTCTTAGAACGCTTGGACCGATAGCGCTAAACTGTATGTT
TTATGCTTCATTTAATTACTTGAATGATAAAGGAAATTTGTTTATTGTAC
>SMED30032169 ID=SMED30032169|Name=Glycine amidinotransferase, mitochondrial|organism=Schmidtea mediterranea sexual|type=transcript|length=1380bp
CGTGTTTCTGCCAGAATCCAAGTTTGGTAGGGTGGGTGGAGTAGGCTTTTATATCATATCTAAATCTGAAAATGAATTTT
TATCATCATATTTTCTCAAATGTTGTCTGTATTACGACAAATTAGCCATTCAAAATCTGCCATTTCTTCGAAAATATCGG
TAATTCACATTTCAAAGTACTTCGGTCATTATTCATGCCACGATGAAAAGAAACAGACTTCTCCAGTTTGGGCTTGGAAT
GAATGGGATCCACTTGAAGAAGTTGTGGTCGGTGTTCCTAATAATGCAACTTTGCCCTTTCCATCACAGGAAGTAGCAGC
CACTTTTGGACCCCCTAGACTTCCATTTTTTCAAAAACATGGTGGCAAAAAATTCTCAGAGGTTATGGGTCAAGAAATGT
GGATGAAAATTGAAAATGAAATAAAAGAATTAGTAAGAGTATTAGAGGGAGAAGGTGTAAAAGTTGTGCAACCAGAGGCT
ATAGATTACGATCAAAAGTGGACTACGCCAAAGTTTTCTTCAACAGGTTTGTATGCCGCTATGCCAAGAGATTTTTTACT
TATCGTTGGTGATGAAATCATTGAATCCCCTATGGCTTGGAGGTGTAGATACTTTGAATACGAAGCATACAGACCACTTA
TTCGAAAATATTTTAATGAAGGAGCCAGATGGACATCGGCTCCTAAATGCACTATGGAAGACGCTCTCTATGATATGGAA
TTCGATGTTGCTCAAGAGAAACCATATGTGTATGTAACAACTGAATTAGAACCATGTTTTGATGCGGCTGACTTTACAAG
AATTGGCAGGGATATTTTTGGTCAAAGAAGTCATGTAACCAACAAAAAGGCAATACAGTGGCTCCGGCGTCATTTAGCTC
CTAGTGGAGTCAGGGTCCATGACATTGAATTTGACTCTCTCTATTCAATGCATATTGATACCAATTTTTTCCCCGTGAAA
CCTGGTATGTTTTTACTTAAAGATGGACTCAATTGTAAAACCCCGGATCTATTAAAAAAATCTAAATGGGACATAGTCAT
TATGCCAAAAGGACCTCATCGAGACGAGCATTACAAATGGATGAATTATCACGGATTACCGAACAATATGCTCAGTATAG
ACACAGAGAGGGTCCTAGTTGAGAAAACCGAAGAATACATGATAAAATTCATGCAAGAAATTGGATTCAAACCGATTCCA
GTTTCGCTTAAATTCGCAAATAATCTAGGAGGGGGCTTCCACTGCTGGACAGCGGACATCAGACGGCGAGGAAAACTAGA
AAGCTATTTTGAGTGGCCAGATGAGATTTTGGAGCGATTGACTCCATAAATCGGAAATATTAAATTAAAAAATATTTTTT
GTTTTAATTTTCTATACAAT
PAGE: Planarian Anatomy Gene Expression
These transcripts were reported as being expressed in Category 3 cell. Click this link to learn more about PAGE.
PAGE Curations: 530
PLANA Term | Reference Transcript | Description | Gene Models | Published Transcript | Transcriptome | Publication | Specimen | Lifecycle | Evidence |
---|---|---|---|---|---|---|---|---|---|
Category 3 cell | SMED30028476 | Glutamate receptor, ionotropic kainate | SMESG000080378.1 | dd_Smed_v4_34941_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30028417 | Bardet-Biedl syndrome 1 protein homolog | SMESG000009880.1 | dd_Smed_v4_7298_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30021542 | SMED30021542 | SMESG000074220.1 | dd_Smed_v4_22388_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30014220 | SMED30014220 | SMESG000052497.1 | dd_Smed_v4_2843_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30010415 | pmp-10 | SMESG000068428.1 | dd_Smed_v4_343_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30008715 | Dimer_Tnp_hAT domain-containing protein | SMESG000010564.1 | dd_Smed_v4_8271_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30002834 | SMED30002834 | SMESG000043420.1 | dd_Smed_v4_460_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30005229 | Amine oxidase | SMESG000077616.1 | dd_Smed_v4_20536_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30002992 | SMED30002992 | SMESG000012171.1 | dd_Smed_v4_247_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30007370 | SMED30007370 | SMESG000045571.1 | dd_Smed_v4_7603_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30006734 | SMED30006734 | SMESG000010564.1 | dd_Smed_v4_8271_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30014918 | Ornithine decarboxylase | SMESG000060777.1 | dd_Smed_v4_4916_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30027833 | Guanylate cyclase | SMESG000079311.1 | dd_Smed_v4_15400_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30018353 | Glycine amidinotransferase, mitochondrial | SMESG000051964.1 | NB.8.8b | smed_ncbi_20200123 | PMID:18786419 Eisenhoffer et al., 2008 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30018353 | Glycine amidinotransferase, mitochondrial | SMESG000051964.1 | NB.8.8b | smed_ncbi_20200123 | PMID:18786419 Eisenhoffer et al., 2008 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30027207 | Ornithine decarboxylase | SMESG000055750.1 | H.63.4c | smed_ncbi_20200123 | PMID:18786419 Eisenhoffer et al., 2008 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30027207 | Ornithine decarboxylase | SMESG000055750.1 | H.63.4c | smed_ncbi_20200123 | PMID:18786419 Eisenhoffer et al., 2008 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30001325 | slc25a-12 | SMESG000064880.1 | H.45.8g | smed_ncbi_20200123 | PMID:18786419 Eisenhoffer et al., 2008 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30001325 | slc25a-12 | SMESG000064880.1 | H.45.8g | smed_ncbi_20200123 | PMID:18786419 Eisenhoffer et al., 2008 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30019154 | Glycine amidinotransferase mitochondrial | SMESG000068402.1 | NB.2.5d | ncbi_smed_ests | PMID:18786419 Eisenhoffer et al., 2008 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30019154 | Glycine amidinotransferase mitochondrial | SMESG000068402.1 | NB.2.5d | ncbi_smed_ests | PMID:18786419 Eisenhoffer et al., 2008 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30009513 | Glycine amidinotransferase, mitochondrial | SMESG000051953.1 | H.56.4h | smed_ncbi_20200123 | PMID:18786419 Eisenhoffer et al., 2008 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30009513 | Glycine amidinotransferase, mitochondrial | SMESG000051953.1 | H.56.4h | smed_ncbi_20200123 | PMID:18786419 Eisenhoffer et al., 2008 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30011402 | Ras family | SMESG000007281.1 | H.18.4a | ncbi_smed_ests | PMID:18786419 Eisenhoffer et al., 2008 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30011402 | Ras family | SMESG000007281.1 | H.18.4a | smed_ncbi_20200123 | PMID:18786419 Eisenhoffer et al., 2008 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30011402 | Ras family | SMESG000007281.1 | H.18.4a | ncbi_smed_ests | PMID:18786419 Eisenhoffer et al., 2008 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30011402 | Ras family | SMESG000007281.1 | H.18.4a | smed_ncbi_20200123 | PMID:18786419 Eisenhoffer et al., 2008 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30018353 | Glycine amidinotransferase, mitochondrial | SMESG000051964.1 | DN303276 | ncbi_smed_ests | PMID:23235145 Hubert et al., 2013 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30018353 | Glycine amidinotransferase, mitochondrial | SMESG000051964.1 | DN290976 | ncbi_smed_ests | PMID:23235145 Hubert et al., 2013 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30018353 | Glycine amidinotransferase, mitochondrial | SMESG000051964.1 | NB.8.8b | smed_ncbi_20200123 | PMID:25956527 Henderson et al., 2015 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30018353 | Glycine amidinotransferase, mitochondrial | SMESG000051964.1 | SMED30018353 | smed_20140614 | PMID:24704339 Vogg et al., 2014 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30018353 | Glycine amidinotransferase, mitochondrial | SMESG000051964.1 | SMED30018353 | smed_20140614 | PMID:23318641 Chen et al., 2013 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30000850 | slc7a-8 | SMESG000006721.1 | SmedASXL_001816 | SmedAsxl_ww_GCZZ01 | PMID:26114597 Zhu et al., 2015 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30026394 | SMED30026394 | SMESG000029612.1 SMESG000029602.1 | SmedASXL_009684 | SmedAsxl_ww_GCZZ01 | PMID:26114597 Zhu et al., 2015 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30018353 | Glycine amidinotransferase, mitochondrial | SMESG000051964.1 | SMED30018353 | smed_20140614 | PMID:26114597 Zhu et al., 2015 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30029823 | MFS domain-containing protein | SMESG000000287.1 SMESG000000110.1 | SmedASXL_018064 | SmedAsxl_ww_GCZZ01 | PMID:26114597 Zhu et al., 2015 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30027539 | MFS domain-containing protein | SMESG000000287.1 SMESG000000110.1 | SmedASXL_018064 | SmedAsxl_ww_GCZZ01 | PMID:26114597 Zhu et al., 2015 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30000746 | SMED30000746 | SMESG000024821.1 SMESG000024754.1 | SmedASXL_008207 | SmedAsxl_ww_GCZZ01 | PMID:26114597 Zhu et al., 2015 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30033892 | SMED30033892 | SMESG000029612.1 SMESG000029602.1 | SmedASXL_009684 | SmedAsxl_ww_GCZZ01 | PMID:26114597 Zhu et al., 2015 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30030996 | hypothetical protein | SMESG000029612.1 SMESG000029602.1 | SmedASXL_009684 | SmedAsxl_ww_GCZZ01 | PMID:26114597 Zhu et al., 2015 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30033839 | Sp5 | SMESG000023227.1 | SMED30033839 | smed_20140614 | PMID:29100657 Cheng et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30012332 | EGR-1 | SMESG000034285.1 | SMED30012332 | smed_20140614 | PMID:29100657 Cheng et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30000303 | HoxC12-like protein | SMESG000022668.1 | SMED30000303 | smed_20140614 | PMID:29100657 Cheng et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30006464 | TCF15 | SMESG000044395.1 | SMED30006464 | smed_20140614 | PMID:29100657 Cheng et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30008505 | SOXP-3 | SMESG000051170.1 | SMED30008505 | smed_20140614 | PMID:29100657 Cheng et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30006353 | SMED30006353 | SMESG000004009.1 | SMED30006353 | smed_20140614 | PMID:29100657 Cheng et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30015704 | Hox class homeodomain protein DjAbd-Ba | SMED30015704 | smed_20140614 | PMID:29100657 Cheng et al., 2018 | ![]() | ![]() | ![]() | |
Category 3 cell | SMED30019046 | SD2 | SMESG000021468.1 | SMED30019046 | smed_20140614 | PMID:29100657 Cheng et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30032499 | C2H2-type domain-containing protein | SMESG000075452.1 | SMED30032499 | smed_20140614 | PMID:29100657 Cheng et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30015041 | Retinoic acid receptor beta | SMESG000054304.1 | SMED30015041 | smed_20140614 | PMID:29100657 Cheng et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30026364 | SMED-P53 | SMESG000078256.1 SMESG000078255.1 | SMED30026364 | smed_20140614 | PMID:29100657 Cheng et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30029873 | SMED30029873 | SMESG000042500.1 | SMED30029873 | smed_20140614 | PMID:29100657 Cheng et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30022628 | G_PROTEIN_RECEP_F1_2 domain-containing protein | SMESG000060403.1 | SMED30022628 | smed_20140614 | PMID:29100657 Cheng et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30000485 | SMED30000485 | SMESG000069311.1 | SMED30000485 | smed_20140614 | PMID:29100657 Cheng et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30018353 | Glycine amidinotransferase, mitochondrial | SMESG000051964.1 | SMED30018353 | smed_20140614 | PMID:30194301 Mihaylova et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30018353 | Glycine amidinotransferase, mitochondrial | SMESG000051964.1 | SMED30018353 | smed_20140614 | PMID:28072387 Davies et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30018353 | Glycine amidinotransferase, mitochondrial | SMESG000051964.1 | SMED30018353 | smed_20140614 | PMID:28072387 Davies et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30018353 | Glycine amidinotransferase, mitochondrial | SMESG000051964.1 | SMED30018353 | smed_20140614 | PMID:28072387 Davies et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30018353 | Glycine amidinotransferase, mitochondrial | SMESG000051964.1 | SMED30018353 | smed_20140614 | PMID:28072387 Davies et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30018353 | Glycine amidinotransferase, mitochondrial | SMESG000051964.1 | SMED30018353 | smed_20140614 | PMID:22445864 Tu et al., 2012 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30026364 | SMED-P53 | SMESG000078256.1 | AY068713.3 | smed_ncbi_20200123 | PMID:20040488 Pearson et al., 2010 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30024368 | chromodomain helicase DNA-binding protein 4 | SMESG000068192.1 | GU980571.1 | smed_ncbi_20200123 | PMID:26457503 Tu et al., 2015 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30018353 | Glycine amidinotransferase, mitochondrial | SMESG000051964.1 | SMED30018353 | smed_20140614 | PMID:29357350 de Sousa et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30018353 | Glycine amidinotransferase, mitochondrial | SMESG000051964.1 | SMED30018353 | smed_20140614 | PMID:23318635 Blassberg et al., 2013 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30001515 | Annexin | SMESG000042839.1 | dd_Smed_v6_1104_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30011420 | Trinucleotide repeat containing 4-like protein | SMESG000005424.1 | dd_Smed_v6_11349_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30007770 | SMED30007770 | SMESG000059904.1 SMESG000042945.1 SMESG000007620.1 SMESG000072638.1 SMESG000039380.1 SMESG000042352.1 SMESG000028417.1 | dd_Smed_v6_10138_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30005345 | SMED30005345 | SMESG000059907.1 | dd_Smed_v6_125_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30010940 | Tetraspanin | SMESG000021642.1 | dd_Smed_v6_1257_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30006877 | SMED30006877 | SMESG000017277.1 SMESG000017274.1 SMESG000017276.1 | dd_Smed_v6_1245_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30003259 | Aminopeptidase | SMESG000039842.1 | dd_Smed_v6_1249_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30011350 | Serine palmitoyltransferase 1 | SMESG000080769.1 SMESG000052311.1 | dd_Smed_v6_1567_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30013241 | SMED30013241 | SMESG000007775.1 | dd_Smed_v6_137_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30001401 | SMED30001401 | SMESG000059904.1 SMESG000042945.1 SMESG000007620.1 SMESG000072638.1 SMESG000039380.1 SMESG000042352.1 SMESG000028417.1 | dd_Smed_v6_10138_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30006473 | MFS domain-containing protein | SMESG000018042.1 | dd_Smed_v6_11486_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30034257 | CRAL-TRIO domain-containing protein | SMESG000009988.1 | dd_Smed_v6_3680_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30031568 | Cytochrome P450 2L1 | SMESG000050434.1 | dd_Smed_v6_5307_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30032538 | MFS domain-containing protein | SMESG000055803.1 | dd_Smed_v6_5294_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30029717 | SMED30029717 | SMESG000018042.1 | dd_Smed_v6_11486_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30011291 | Acidic phospholipase A2 | SMESG000079712.1 | dd_Smed_v6_2969_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30006083 | SMED30006083 | SMESG000061797.1 | dd_Smed_v6_6028_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30013885 | SMED30013885 | SMESG000046850.1 | dd_Smed_v6_9640_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30010951 | SMED30010951 | SMESG000076142.1 | dd_Smed_v6_719_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30011447 | SMED30011447 | SMESG000034829.1 | dd_Smed_v6_1321_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30011140 | Argininosuccinate synthase | SMESG000053053.1 SMESG000053052.1 | dd_Smed_v6_3086_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30004057 | DUF3421 domain-containing protein | dd_Smed_v6_1355_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() | |
Category 3 cell | SMED30003372 | SMED30003372 | SMESG000020860.1 | dd_Smed_v6_14_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30004351 | SMED30004351 | dd_Smed_v6_15429_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() | |
Category 3 cell | SMED30012767 | SMED30012767 | dd_Smed_v6_917_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() | |
Category 3 cell | SMED30005188 | Venom allergen 5 | dd_Smed_v6_607_1 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() | |
Category 3 cell | SMED30021793 | Pmp-10 | SMESG000068743.1 | dd_Smed_v6_2178_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30030292 | Cytochrome P450, family 1, subfamily D, polypeptide 1 | SMESG000012534.1 | dd_Smed_v6_2162_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30024165 | SMED30024165 | dd_Smed_v6_2664_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() | |
Category 3 cell | SMED30005357 | hypothetical protein | SMESG000027979.1 | dd_Smed_v6_775_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30000058 | SMED30000058 | SMESG000022049.1 | dd_Smed_v6_499_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30018924 | SMED30018924 | SMESG000028420.1 | dd_Smed_v6_468_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30017430 | Protein disulfide-isomerase | SMESG000023147.1 SMESG000017020.1 | dd_Smed_v6_250_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30013445 | Tetraspanin | SMESG000063435.1 | dd_Smed_v6_389_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30002098 | carboxypeptidase E | SMESG000062760.1 | dd_Smed_v6_4210_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30016382 | SMED30016382 | SMESG000029089.1 | dd_Smed_v6_2873_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30005740 | SMED30005740 | SMESG000029096.1 | dd_Smed_v6_480_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30003172 | Adenylosuccinate synthetase | SMESG000078697.1 | dd_Smed_v6_2154_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30000827 | SMED30000827 | SMESG000043280.1 | dd_Smed_v6_278_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30002356 | SMED30002356 | SMESG000069796.1 | dd_Smed_v6_4492_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30020865 | Aminopeptidase | SMESG000033900.1 SMESG000033518.1 SMESG000022330.1 SMESG000022279.1 SMESG000022278.1 | dd_Smed_v6_4516_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30020794 | SMED30020794 | SMESG000056235.1 | dd_Smed_v6_1413_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30018353 | Glycine amidinotransferase, mitochondrial | SMESG000051964.1 | dd_Smed_v6_920_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30022130 | SMED30022130 | SMESG000026848.1 | dd_Smed_v6_1128_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30025584 | SMED30025584 | SMESG000077266.1 | dd_Smed_v6_1066_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30026364 | SMED-P53 | SMESG000078256.1 SMESG000078255.1 | dd_Smed_v6_5563_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30027207 | Ornithine decarboxylase | SMESG000055750.1 | dd_Smed_v6_5493_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30027266 | SMED30027266 | SMESG000041022.1 | dd_Smed_v6_7160_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30020710 | Succinyl-CoA:3-ketoacid-coenzyme A transferase | SMESG000080432.1 SMESG000080424.1 | dd_Smed_v6_1189_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30024934 | 3-hydroxybutyrate dehydrogenase, type 1 | SMESG000039796.1 SMESG000039794.1 SMESG000039792.1 | dd_Smed_v6_8012_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30026414 | MPV17 mitochondrial membrane protein-like 2 | SMESG000062744.1 | dd_Smed_v6_4214_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30029102 | SMED30029102 | SMESG000059907.1 | dd_Smed_v6_1664_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30035874 | SMED30035874 | SMESG000043890.1 SMESG000043321.1 SMESG000043310.1 SMESG000043263.1 SMESG000020012.1 SMESG000019997.1 | dd_Smed_v6_517_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30035490 | SMED30035490 | SMESG000042765.1 | dd_Smed_v6_5159_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30027899 | slc26a-10 | SMESG000052008.1 SMESG000051986.1 | dd_Smed_v6_5066_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30033456 | ATP-dependent (S)-NAD(P)H-hydrate dehydratase | SMESG000002442.1 | dd_Smed_v6_3409_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30031918 | SMED30031918 | SMESG000043420.1 | dd_Smed_v6_460_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30029019 | 16 kDa calcium-binding protein | SMESG000066843.1 | dd_Smed_v6_299_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30033411 | Dynein light chain | SMESG000041239.1 | dd_Smed_v6_3149_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30030317 | ATP-dependent (S)-NAD(P)H-hydrate dehydratase | SMESG000002442.1 | dd_Smed_v6_3409_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30029159 | SMED30029159 | SMESG000029594.1 SMESG000029589.1 | dd_Smed_v6_315_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30035101 | Protein kinase | SMESG000024804.1 | dd_Smed_v6_3989_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30031335 | slc26a-4 | SMESG000064562.1 | dd_Smed_v6_4250_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30030034 | Argininosuccinate lyase | SMESG000039074.1 | dd_Smed_v6_3792_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30029561 | SMED30029561 | SMESG000041756.1 | dd_Smed_v6_3569_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30026350 | slc26a-8 | SMESG000064562.1 | dd_Smed_v6_4250_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30008464 | Glyceraldehyde-3-phosphate dehydrogenase | SMESG000033355.1 | dd_Smed_v6_45250_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30006074 | SMED30006074 | SMESG000019341.1 | dd_Smed_v6_177_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30005551 | Spectrin alpha chain | SMESG000005289.1 | dd_Smed_v6_919_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30002454 | Staphylococcal nuclease domain-containing protein | SMESG000062403.1 | dd_Smed_v6_906_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30019431 | SMED30019431 | SMESG000032527.1 SMESG000022725.1 | dd_Smed_v6_1563_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30007742 | Protein transport protein Sec61 subunit alpha | SMESG000003007.1 | dd_Smed_v6_282_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30017772 | SMED30017772 | SMESG000043278.1 | dd_Smed_v6_3331_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30006263 | SMED30006263 | SMESG000056319.1 SMESG000056318.1 SMESG000022275.1 | dd_Smed_v6_674_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30006887 | Gelsolin-like protein | SMESG000015927.1 | dd_Smed_v6_929_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30014565 | Angiotensin-converting enzyme | SMESG000005704.1 SMESG000005698.1 | dd_Smed_v6_3745_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30009956 | SMED30009956 | SMESG000022273.1 | dd_Smed_v6_8344_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30007718 | Flotillin-1 | SMESG000063612.1 | dd_Smed_v6_1887_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30005231 | Polyadenylate-binding protein | SMESG000058745.1 | dd_Smed_v6_93_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30019325 | Myosin regulatory light chain | SMESG000000175.1 | dd_Smed_v6_383_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30007396 | Citrate lyase beta like | SMESG000054468.1 SMESG000054465.1 | dd_Smed_v6_4186_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30016902 | CRAL-TRIO domain-containing protein | SMESG000009876.1 | dd_Smed_v6_2760_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30010637 | Nucleolar RNA helicase II/Gu protein | SMESG000065959.1 | dd_Smed_v6_283_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30000428 | Glutathione S-transferase | SMESG000016836.1 | dd_Smed_v6_816_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30000995 | Pyruvate kinase | SMESG000052083.1 SMESG000048475.1 | dd_Smed_v6_605_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30030679 | Elongation of very long chain fatty acids protein | SMESG000068877.1 SMESG000068874.1 | dd_Smed_v6_4252_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30027156 | SMED30027156 | SMESG000038687.1 SMESG000038673.1 | dd_Smed_v6_1013_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30031352 | SMED30031352 | SMESG000006235.1 | dd_Smed_v6_6275_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30025313 | Thioredoxin glutathione reductase | SMESG000020047.1 | dd_Smed_v6_960_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30030422 | SMED30030422 | SMESG000077265.1 | dd_Smed_v6_830_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30022078 | Translationally-controlled tumor protein homolog | SMESG000023212.1 | dd_Smed_v6_136_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30022992 | Myosin heavy chain | SMESG000062420.1 | dd_Smed_v6_791_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30034381 | Malate dehydrogenase | SMESG000056995.1 | dd_Smed_v6_467_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30030681 | SMED30030681 | SMESG000038678.1 | dd_Smed_v6_327_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30028142 | SMED30028142 | SMESG000061765.1 SMESG000061762.1 | dd_Smed_v6_379_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30024058 | SMED30024058 | SMESG000020813.1 | dd_Smed_v6_3688_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30032169 | Glycine amidinotransferase, mitochondrial | SMESG000043142.1 | dd_Smed_v6_1943_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30027745 | molybdate-anion transporter isoform X2 | SMESG000027072.1 | dd_Smed_v6_3699_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30020269 | Myophilin | SMESG000081505.1 SMESG000049198.1 SMESG000047694.1 SMESG000035451.1 SMESG000035348.1 | dd_Smed_v6_395_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30023536 | Microsomal glutathione S-transferase 3 | SMESG000078588.1 | dd_Smed_v6_1661_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30026803 | X1.D.D8.3 | SMESG000053883.1 | dd_Smed_v6_8540_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30028449 | High density lipoprotein binding protein (Vigilin) | SMESG000016436.1 | dd_Smed_v6_553_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30023489 | CDGSH iron sulfur domain-containing protein 3, mitochondrial | SMESG000016828.1 | dd_Smed_v6_935_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30032429 | Inositol phosphoceramide mannosyltransferase 3 | SMESG000065897.1 SMESG000065885.1 SMESG000065880.1 SMESG000065849.1 | dd_Smed_v6_7249_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30031061 | Nucleobindin-2 | SMESG000017142.1 | dd_Smed_v6_6010_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30026101 | Reticulocalbin-1 | SMESG000077405.1 | dd_Smed_v6_5905_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30030234 | Tubulin alpha chain | SMESG000041107.1 | dd_Smed_v6_758_1 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30029770 | ATP-binding cassette sub-family F member 2 | SMESG000071613.1 | dd_Smed_v6_434_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30028888 | Transmembrane emp24 domain-containing protein 10 | SMESG000024933.1 | dd_Smed_v6_746_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30031631 | 6-phosphogluconate dehydrogenase, decarboxylating | SMESG000005721.1 | dd_Smed_v6_366_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30028069 | SMED30028069 | SMESG000059907.1 | dd_Smed_v6_5497_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30029873 | SMED30029873 | SMESG000042500.1 | dd_Smed_v6_5474_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30029873 | SMED30029873 | SMESG000042500.1 | dd_Smed_v6_7038_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30021105 | Tubulin alpha chain | SMESG000005506.1 SMESG000005505.1 SMESG000005493.1 SMESG000005489.1 SMESG000005487.1 | dd_Smed_v6_38_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30025603 | SMED30025603 | SMESG000018472.1 | dd_Smed_v6_3226_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30035148 | SMED30035148 | SMESG000021388.1 | dd_Smed_v6_1925_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30026808 | EF-hand domain-containing protein | SMESG000081370.1 | dd_Smed_v6_446_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30022769 | Glycine receptor subunit alpha-3 | SMESG000061905.1 | dd_Smed_v6_8110_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30030642 | Cytochrome P450 2C3 | SMESG000023530.1 SMESG000023528.1 | dd_Smed_v6_7874_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30022628 | G_PROTEIN_RECEP_F1_2 domain-containing protein | SMESG000060403.1 | dd_Smed_v6_361_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30020328 | X1.C4.1 | SMESG000046999.1 | dd_Smed_v6_558_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30034746 | Ornithine decarboxylase-1 | SMESG000062429.1 | dd_Smed_v6_6130_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30003044 | Reticulocalbin | SMESG000077405.1 | dd_Smed_v6_5905_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30018929 | Glycine N-acyltransferase 3 | SMESG000063826.1 | dd_Smed_v6_5477_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30016080 | Deoxyhypusine hydroxylase | SMESG000051726.1 SMESG000051721.1 | dd_Smed_v6_703_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30019154 | Glycine amidinotransferase mitochondrial | SMESG000068402.1 | dd_Smed_v6_2385_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30015411 | GLTP domain-containing protein | dd_Smed_v6_2621_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() | |
Category 3 cell | SMED30011747 | SMED30011747 | dd_Smed_v6_494_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() | |
Category 3 cell | SMED30005644 | X1.A.D4.1 | SMESG000053861.1 | dd_Smed_v6_771_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30000902 | SMED30000902 | SMESG000043277.1 | dd_Smed_v6_647_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30004267 | Actin, cytoplasmic | SMESG000035518.1 | dd_Smed_v6_232_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30014713 | SMED30014713 | SMESG000061767.1 | dd_Smed_v6_767_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30009513 | Glycine amidinotransferase, mitochondrial | SMESG000051953.1 | dd_Smed_v6_899_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30005470 | Selenoprotein W | dd_Smed_v6_616_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() | |
Category 3 cell | SMED30008120 | SMED30008120 | SMESG000042787.1 | dd_Smed_v6_263_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30012026 | SMED30012026 | dd_Smed_v6_617_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() | |
Category 3 cell | SMED30013107 | Glyceraldehyde-3-phosphate dehydrogenase | SMESG000052353.1 | dd_Smed_v6_78_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30009290 | SMED30009290 | dd_Smed_v6_7103_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() | |
Category 3 cell | SMED30001567 | SMED30001567 | SMESG000022139.1 | dd_Smed_v6_715_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30006057 | SMED30006057 | SMESG000064381.1 | dd_Smed_v6_2460_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30017499 | SMED30017499 | dd_Smed_v6_459_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() | |
Category 3 cell | SMED30031984 | Selenoprotein F | dd_Smed_v6_304_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() | |
Category 3 cell | SMED30024172 | SMED30024172 | dd_Smed_v6_13035_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() | |
Category 3 cell | SMED30024881 | Actin, cytoplasmic 2 | SMESG000035518.1 | dd_Smed_v6_218_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30021565 | Proline dehydrogenase | SMESG000077440.1 | dd_Smed_v6_7017_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30034660 | Spectrin beta chain, non-erythrocytic 5 | SMESG000023006.1 | dd_Smed_v6_2514_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30025667 | Cell division cycle protein 16 | SMESG000050407.1 | dd_Smed_v6_7357_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30029103 | Glutamine synthetase | SMESG000000228.1 SMESG000000227.1 SMESG000000225.1 SMESG000000212.1 | dd_Smed_v6_896_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30028513 | Transcriptional activator protein Pur-beta | dd_Smed_v6_346_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() | |
Category 3 cell | SMED30020810 | SMED30020810 | SMESG000068262.1 SMESG000053435.1 SMESG000049288.1 | dd_Smed_v6_6797_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30031869 | SMED30031869 | SMESG000055717.1 | dd_Smed_v6_2079_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30030707 | SMED30030707 | dd_Smed_v6_13035_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() | |
Category 3 cell | SMED30020996 | ADP-ribosylation factor GTPase-activating protein 2 | SMESG000008345.1 | dd_Smed_v6_539_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30014220 | SMED30014220 | SMESG000052497.1 | dd_Smed_v6_2843_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30010415 | pmp-10 | SMESG000068428.1 | dd_Smed_v6_343_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30006119 | X-box-binding protein 1 | SMESG000048111.1 | dd_Smed_v6_415_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30002834 | SMED30002834 | SMESG000043420.1 | dd_Smed_v6_460_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30013480 | Dihydropyrimidinase | SMESG000060188.1 | dd_Smed_v6_2040_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30008522 | Fatty acid-binding protein | SMESG000015143.1 | dd_Smed_v6_271_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30009457 | reticulocalbin-1 | SMESG000034805.1 | dd_Smed_v6_493_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30013312 | Calpain | SMESG000062904.1 SMESG000062902.1 | dd_Smed_v6_1971_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30002992 | SMED30002992 | SMESG000012171.1 | dd_Smed_v6_247_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30017206 | Band 4.1 protein 2 | SMESG000062476.1 | dd_Smed_v6_2032_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30015020 | E3 ubiquitin-protein ligase XIAP | SMESG000031958.1 | dd_Smed_v6_2104_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30000771 | SMED30000771 | SMESG000059918.1 SMESG000052306.1 SMESG000022407.1 | dd_Smed_v6_1996_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30000771 | SMED30000771 | SMESG000059918.1 SMESG000052306.1 SMESG000022407.1 | dd_Smed_v6_474_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30006777 | Collagen alpha-1(XV) chain | SMESG000081921.1 | dd_Smed_v4_3516_1_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30008797 | SMED30008797 | SMESG000076328.1 | dd_Smed_v4_1587_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30019936 | slc16a-7 | SMESG000023800.1 SMESG000016424.1 | dd_Smed_v4_16824_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30000032 | SMED30000032 | SMESG000064381.1 | dd_Smed_v4_2460_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30016212 | Protocadherin gamma-B5 | SMESG000016762.1 | dd_Smed_v4_10495_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30034468 | SMED30034468 | dd_Smed_v4_28220_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() | |
Category 3 cell | SMED30021328 | SMED30021328 | SMESG000028190.1 | dd_Smed_v4_17722_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30033585 | Elongation of very long chain fatty acids protein | SMESG000021565.1 | dd_Smed_v4_523_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30033890 | SMED30033890 | dd_Smed_v4_16890_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() | |
Category 3 cell | SMED30024056 | SMED30024056 | dd_Smed_v4_14719_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() | |
Category 3 cell | SMED30029539 | Protocadherin Fat 4 | SMESG000002878.1 | dd_Smed_v4_30149_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30030192 | SMED30030192 | SMESG000055517.1 | dd_Smed_v4_8042_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30030464 | SMED30030464 | SMESG000029581.1 SMESG000029574.1 | dd_Smed_v4_135_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30032006 | slc7a-2 | SMESG000031905.1 | dd_Smed_v4_16390_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30033621 | Ornithine decarboxylase | SMESG000041045.1 | dd_Smed_v4_8195_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30033184 | SMED30033184 | dd_Smed_v4_16881_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() | |
Category 3 cell | SMED30026041 | SMED30026041 | dd_Smed_v4_16497_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() | |
Category 3 cell | SMED30034839 | SMED30034839 | SMESG000042050.1 | dd_Smed_v4_14160_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30020944 | SMED30020944 | dd_Smed_v4_15635_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() | |
Category 3 cell | SMED30027137 | SMED30027137 | dd_Smed_v4_13786_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() | |
Category 3 cell | SMED30025171 | SMED30025171 | SMESG000014769.1 | dd_Smed_v4_1952_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30008541 | Synaptotagmin-1 Synaptotagmin I | SMESG000041533.1 | dd_Smed_v4_20033_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30011491 | SMED30011491 | SMESG000011704.1 | dd_Smed_v4_12109_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30016659 | slc22a-10 | SMESG000075938.1 | dd_Smed_v4_12547_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30007738 | SMED30007738 | SMESG000035479.1 | dd_Smed_v4_19930_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30010404 | SMED30010404 | SMESG000076927.1 | dd_Smed_v4_5958_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30001853 | Protein kinase domain-containing protein | SMESG000003859.1 | dd_Smed_v4_1897_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30007341 | TBC1 domain family member 2B | SMESG000078416.1 | dd_Smed_v4_6508_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30008591 | Zinc finger MYM-type protein 1 | SMESG000042369.1 | dd_Smed_v4_12925_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30011700 | Calcium-binding protein A | SMESG000052083.1 SMESG000048475.1 | dd_Smed_v4_605_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30017770 | Zinc finger MYM-type protein 1 | SMESG000042369.1 | dd_Smed_v4_12925_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30016515 | SMED30016515 | SMESG000023204.1 | dd_Smed_v4_38949_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30004339 | Slc16a-7 | SMESG000023798.1 SMESG000016446.1 | dd_Smed_v4_13379_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30014053 | Cationic amino acid transporter 4 | SMESG000081300.1 | dd_Smed_v4_11305_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30002489 | Apical junction component 1 homolog | SMESG000037093.1 | dd_Smed_v4_11689_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30006091 | CA domain-containing protein | SMESG000044292.1 | dd_Smed_v4_12872_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30006180 | Fibrillar collagen NC1 domain-containing protein | SMESG000031448.1 | dd_Smed_v4_702_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30007084 | TNF receptor-associated factor | SMESG000053469.1 | dd_Smed_v4_13061_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30005565 | SMED30005565 | SMESG000010564.1 | dd_Smed_v4_8271_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30000995 | Pyruvate kinase | SMESG000052083.1 SMESG000048475.1 | dd_Smed_v4_605_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30022933 | SMED30022933 | SMESG000007221.1 | dd_Smed_v4_38861_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30028236 | slc16a-2 | SMESG000026519.1 | dd_Smed_v4_8997_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30025375 | SMED30025375 | SMESG000035479.1 | dd_Smed_v4_19930_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30031328 | slc7a-3 | SMESG000081300.1 | dd_Smed_v4_11305_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30027156 | SMED30027156 | SMESG000038687.1 SMESG000038673.1 | dd_Smed_v4_1013_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30030422 | SMED30030422 | SMESG000077265.1 | dd_Smed_v4_830_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30020157 | SMED30020157 | SMESG000042369.1 | dd_Smed_v4_12925_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30021257 | Synaptic vesicle 2-related protein | SMESG000069049.1 SMESG000069045.1 | dd_Smed_v4_12695_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30028142 | SMED30028142 | SMESG000061765.1 SMESG000061762.1 | dd_Smed_v4_379_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30032169 | Glycine amidinotransferase, mitochondrial | SMESG000043142.1 | dd_Smed_v4_1943_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30024902 | C2H2-type domain-containing protein | SMESG000014973.1 | dd_Smed_v4_11893_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30030952 | LITAF domain-containing protein | SMESG000020864.1 | dd_Smed_v4_11813_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30029873 | SMED30029873 | SMESG000042500.1 | dd_Smed_v4_7038_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30029873 | SMED30029873 | SMESG000042500.1 | dd_Smed_v4_5474_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30025603 | SMED30025603 | SMESG000018472.1 | dd_Smed_v4_3226_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30030958 | SMED30030958 | SMESG000016877.1 | dd_Smed_v4_10004_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30030202 | BAR domain-containing protein | SMESG000043769.1 | dd_Smed_v4_5879_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30034242 | SMED30034242 | SMESG000044292.1 | dd_Smed_v4_12872_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30030642 | Cytochrome P450 2C3 | SMESG000023530.1 SMESG000023528.1 | dd_Smed_v4_7874_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30034746 | Ornithine decarboxylase-1 | SMESG000062429.1 | dd_Smed_v4_6130_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30013950 | gdf-like protein | SMESG000080854.1 | dd_Smed_v4_26705_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30009021 | SMED30009021 | dd_Smed_v4_31431_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() | |
Category 3 cell | SMED30018929 | Glycine N-acyltransferase 3 | SMESG000063826.1 | dd_Smed_v4_5477_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30011193 | SMED30011193 | dd_Smed_v4_21173_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() | |
Category 3 cell | SMED30019154 | Glycine amidinotransferase mitochondrial | SMESG000068402.1 | dd_Smed_v4_2385_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30013415 | Fibronectin type III and ankyrin repeat domains 1 | SMESG000029032.1 | dd_Smed_v4_34489_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30006449 | SMED30006449 | dd_Smed_v4_20132_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() | |
Category 3 cell | SMED30019017 | SMED30019017 | SMESG000074220.1 | dd_Smed_v4_22388_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30006968 | SMED30006968 | dd_Smed_v4_55350_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() | |
Category 3 cell | SMED30003326 | SMED30003326 | SMESG000013799.1 | dd_Smed_v4_2896_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30014006 | MFS domain-containing protein | SMESG000060691.1 | dd_Smed_v4_3455_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30014713 | SMED30014713 | SMESG000061767.1 | dd_Smed_v4_767_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30010366 | slc25a-19 | SMESG000020909.1 SMESG000020904.1 | dd_Smed_v4_10436_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30009513 | Glycine amidinotransferase, mitochondrial | SMESG000051953.1 | dd_Smed_v4_899_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30001471 | Cytochrome P450 2K1-like protein | SMESG000022101.1 SMESG000022100.1 | dd_Smed_v4_11238_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30012888 | SMED30012888 | dd_Smed_v4_20132_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() | |
Category 3 cell | SMED30004033 | SMED30004033 | dd_Smed_v4_33434_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() | |
Category 3 cell | SMED30008120 | SMED30008120 | SMESG000042787.1 | dd_Smed_v4_263_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30011135 | MFS domain-containing protein | SMESG000060691.1 | dd_Smed_v4_3455_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30010806 | SMED30010806 | SMESG000022711.1 SMESG000068945.1 | dd_Smed_v4_21342_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30015561 | SMED30015561 | dd_Smed_v4_6429_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() | |
Category 3 cell | SMED30001567 | SMED30001567 | SMESG000022139.1 | dd_Smed_v4_715_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30003923 | MFS domain-containing protein | SMESG000060691.1 | dd_Smed_v4_3455_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30006057 | SMED30006057 | SMESG000064381.1 | dd_Smed_v4_2460_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30014522 | SMED30014522 | dd_Smed_v4_20132_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() | |
Category 3 cell | SMED30030057 | GLOBIN domain-containing protein | SMESG000048632.1 SMESG000022262.1 | dd_Smed_v4_2237_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30023961 | RING finger protein 150 | SMESG000026513.1 | dd_Smed_v4_5532_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30026081 | SMED30026081 | dd_Smed_v4_21173_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() | |
Category 3 cell | SMED30020601 | SMED30020601 | dd_Smed_v4_53499_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() | |
Category 3 cell | SMED30032980 | DDE_Tnp_IS1595 domain-containing protein | dd_Smed_v4_23804_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() | |
Category 3 cell | SMED30028506 | SMED30028506 | dd_Smed_v4_20920_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() | |
Category 3 cell | SMED30035267 | Alkylglycerol monooxygenase | SMESG000043173.1 | dd_Smed_v4_3673_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30025272 | Laminin subunit gamma-1 | SMESG000019909.1 | dd_Smed_v4_7359_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30023436 | MFS domain-containing protein | SMESG000000088.1 | dd_Smed_v4_35070_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30020042 | SMED30020042 | SMESG000014768.1 | dd_Smed_v4_6346_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30021298 | SMED30021298 | dd_Smed_v4_21183_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() | |
Category 3 cell | SMED30026973 | SMED30026973 | SMESG000033974.1 | dd_Smed_v4_34155_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30029229 | SMED30029229 | SMESG000033974.1 | dd_Smed_v4_34155_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30031869 | SMED30031869 | SMESG000055717.1 | dd_Smed_v4_2079_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30028261 | Innexin | SMESG000030970.1 | dd_Smed_v4_6798_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30029960 | SMED30029960 | SMESG000056926.1 | dd_Smed_v6_270_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30034254 | calreticulin-1 | SMESG000077304.1 SMESG000009012.1 | dd_Smed_v6_220_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30028808 | calreticulin-2 | SMESG000077304.1 SMESG000009012.1 | dd_Smed_v6_220_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30031756 | SMED30031756 | SMESG000043890.1 SMESG000043321.1 SMESG000043310.1 SMESG000043263.1 SMESG000020012.1 SMESG000019997.1 | dd_Smed_v6_517_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30034619 | SMED30034619 | SMESG000029095.1 | dd_Smed_v6_3913_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30018088 | SMED30018088 | SMESG000068428.1 | dd_Smed_v6_343_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30019369 | SMED30019369 | SMESG000042765.1 | dd_Smed_v6_2147_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30018339 | SMED30018339 | SMESG000005125.1 | dd_Smed_v6_4793_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30021698 | 14-3-3 protein epsilon | SMESG000047644.1 | dd_Smed_v6_36_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30024106 | Mitochondrial ATP synthase subunit 9 | SMESG000059768.1 | dd_Smed_v6_401_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30020948 | SMED30020948 | SMESG000024857.1 | dd_Smed_v6_409_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30021758 | SMED30021758 | SMESG000078995.1 | dd_Smed_v6_3725_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30024954 | X1.C4.1 | SMESG000043890.1 SMESG000043321.1 SMESG000043310.1 SMESG000043263.1 SMESG000020012.1 SMESG000019997.1 | dd_Smed_v6_517_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30023530 | Peptidase M20 domain-containing protein 2 | SMESG000049098.1 | dd_Smed_v6_7395_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30021619 | X1.C4.1 | SMESG000043890.1 SMESG000043321.1 SMESG000043310.1 SMESG000043263.1 SMESG000020012.1 SMESG000019997.1 | dd_Smed_v6_517_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30022783 | X1.C4.1 | SMESG000043890.1 SMESG000043321.1 SMESG000043310.1 SMESG000043263.1 SMESG000020012.1 SMESG000019997.1 | dd_Smed_v6_517_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30025830 | Ornithine decarboxylase | SMESG000015244.1 SMESG000015241.1 SMESG000004848.1 SMESG000004822.1 SMESG000004820.1 SMESG000004806.1 | dd_Smed_v6_280_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30019041 | Synaptic vesicle 2-related protein | SMESG000035457.1 | dd_Smed_v6_59_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30015546 | Cyclic AMP-responsive element-binding protein 3 | SMESG000059546.1 | dd_Smed_v6_1032_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30000205 | SMED30000205 | SMESG000068262.1 SMESG000053435.1 SMESG000049288.1 | dd_Smed_v6_6797_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30008536 | SMED30008536 | dd_Smed_v6_15429_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() | |
Category 3 cell | SMED30015672 | Gelsolin-like protein | SMESG000015928.1 | dd_Smed_v6_1215_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30003313 | SMED30003313 | dd_Smed_v6_616_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() | |
Category 3 cell | SMED30013893 | Histocompatibility (minor) 13 | SMESG000016697.1 | dd_Smed_v6_1203_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30016392 | SMED30016392 | SMESG000059904.1 SMESG000042945.1 SMESG000007620.1 SMESG000072638.1 SMESG000039380.1 SMESG000042352.1 SMESG000028417.1 | dd_Smed_v6_10138_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30003086 | GTP-binding protein-like protein | SMESG000018556.1 | dd_Smed_v6_589_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30004121 | SMED30004121 | SMESG000014792.1 | dd_Smed_v6_694_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30008381 | SMED30008381 | SMESG000068262.1 SMESG000053435.1 SMESG000049288.1 | dd_Smed_v6_6797_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30004108 | SMED30004108 | SMESG000043419.1 | dd_Smed_v6_644_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30003274 | X1.A.C4.1 | SMESG000079273.1 | dd_Smed_v6_3278_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30018138 | SMED30018138 | SMESG000017277.1 SMESG000017274.1 SMESG000017276.1 | dd_Smed_v6_1245_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30018138 | SMED30018138 | SMESG000017276.1 | dd_Smed_v6_639_1 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30005429 | SMED30005429 | SMESG000030956.1 SMESG000030911.1 | dd_Smed_v6_902_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30012378 | Clathrin heavy chain | SMESG000035457.1 | dd_Smed_v6_59_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30018173 | Sodium/potassium-transporting ATPase subunit beta-1 isoform 2 | SMESG000064592.1 | dd_Smed_v6_6559_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30018637 | Heat shock cognate 70 kDa protein | SMESG000040632.1 | dd_Smed_v6_15_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30016539 | SMED30016539 | SMESG000017277.1 SMESG000017274.1 SMESG000017276.1 | dd_Smed_v6_1245_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30012310 | SMED30012310 | SMESG000028761.1 | dd_Smed_v6_5231_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30013293 | Major vault protein | SMESG000037707.1 | dd_Smed_v6_1098_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30005835 | SMED30005835 | SMESG000012702.1 SMESG000012701.1 SMESG000012690.1 SMESG000012688.1 SMESG000012672.1 | dd_Smed_v6_55_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30001824 | SMED30001824 | SMESG000026020.1 | dd_Smed_v6_2027_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30018603 | Receptor expression-enhancing protein | SMESG000043862.1 | dd_Smed_v6_838_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30015906 | Succinyl-CoA:3-ketoacid-coenzyme A transferase | SMESG000080432.1 SMESG000080424.1 | dd_Smed_v6_1189_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30015362 | SMED30015362 | SMESG000043289.1 | dd_Smed_v6_80_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30011492 | HTH CENPB-type domain-containing protein | SMESG000068262.1 SMESG000053435.1 SMESG000049288.1 | dd_Smed_v6_6797_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30005321 | Malate dehydrogenase | SMESG000008924.1 | dd_Smed_v6_656_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30005838 | X1.C3.3 | SMESG000058321.1 SMESG000058307.1 | dd_Smed_v6_68_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30010405 | SMED30010405 | SMESG000043444.1 SMESG000043435.1 | dd_Smed_v6_18_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30018809 | Transposase, Tc1-like protein | SMESG000068262.1 SMESG000053435.1 SMESG000049288.1 | dd_Smed_v6_6797_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30001367 | ADP-ribosylation factor 1 | SMESG000067743.1 | dd_Smed_v6_203_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30008856 | SMED30008856 | SMESG000025888.1 | dd_Smed_v6_1422_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30004608 | Protein kinase domain-containing protein | SMESG000030766.1 | dd_Smed_v6_85086_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30000032 | SMED30000032 | SMESG000064381.1 | dd_Smed_v6_2460_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30011623 | SMED30011623 | SMESG000043444.1 SMESG000043435.1 | dd_Smed_v6_18_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30002867 | SMED30002867 | dd_Smed_v6_9764_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() | |
Category 3 cell | SMED30021511 | SMED30021511 | SMESG000038232.1 SMESG000010788.1 | dd_Smed_v6_759_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30025127 | Tigger transposable element-derived protein 1 | SMESG000068262.1 SMESG000053435.1 SMESG000049288.1 | dd_Smed_v6_6797_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30033585 | Elongation of very long chain fatty acids protein | SMESG000021565.1 | dd_Smed_v6_523_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30029823 | MFS domain-containing protein | SMESG000000287.1 SMESG000000110.1 | dd_Smed_v6_11835_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30020511 | Tigger transposable element-derived protein 2 | SMESG000068262.1 SMESG000053435.1 SMESG000049288.1 | dd_Smed_v6_6797_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30021590 | Spectrin beta chain | SMESG000081696.1 | dd_Smed_v6_1122_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30023766 | SMED30023766 | SMESG000073811.1 | dd_Smed_v6_116_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30029450 | Succinyl-CoA:3-ketoacid-coenzyme A transferase | SMESG000080432.1 SMESG000080424.1 | dd_Smed_v6_1189_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30030192 | SMED30030192 | SMESG000055517.1 | dd_Smed_v6_8042_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30034546 | Protein transport protein Sec61 subunit gamma | SMESG000062123.1 SMESG000063809.1 | dd_Smed_v6_429_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30025783 | NADPH--cytochrome P450 reductase | SMESG000022047.1 | dd_Smed_v6_542_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30033621 | Ornithine decarboxylase | SMESG000041045.1 | dd_Smed_v6_8195_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30020317 | Heat shock protein 90 | SMESG000024822.1 | dd_Smed_v6_678_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30033197 | SMED30033197 | SMESG000073811.1 | dd_Smed_v6_116_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30034506 | Angiotensin-converting enzyme | SMESG000005710.1 | dd_Smed_v6_6160_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30025067 | Endoplasmic reticulum chaperone BiP | SMESG000062699.1 | dd_Smed_v6_511_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30035193 | Heat shock protein 90 | SMESG000071533.1 SMESG000071531.1 | dd_Smed_v6_56_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30022677 | sphingolipid delta(4)-desaturase DES1 | SMESG000025057.1 | dd_Smed_v6_1100_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30021601 | SMED30021601 | SMESG000003951.1 | dd_Smed_v6_6596_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30025310 | SMED30025310 | SMESG000050440.1 | dd_Smed_v6_1552_1 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30031823 | Translocating chain-associated membrane protein | SMESG000051052.1 | dd_Smed_v6_1740_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30027539 | MFS domain-containing protein | SMESG000000287.1 SMESG000000110.1 | dd_Smed_v6_11835_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30022344 | FERM domain containing-1 | SMESG000070273.1 | dd_Smed_v6_1131_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30026646 | Dynein light chain | SMESG000009941.1 | dd_Smed_v6_107_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30020630 | Usp domain-containing protein | SMESG000068262.1 SMESG000053435.1 SMESG000049288.1 | dd_Smed_v6_6797_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30028204 | Succinyl-CoA:3-ketoacid-coenzyme A transferase | SMESG000080432.1 SMESG000080424.1 | dd_Smed_v6_1189_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30025174 | Selenoprotein W | dd_Smed_v6_1908_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() | |
Category 3 cell | SMED30005523 | Alpha-actinin | SMESG000026000.1 | dd_Smed_v6_1951_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30011525 | SMED30011525 | SMESG000000175.1 | dd_Smed_v6_383_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30008609 | SMED30008609 | SMESG000059918.1 SMESG000052306.1 SMESG000022407.1 | dd_Smed_v6_474_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30010404 | SMED30010404 | SMESG000076927.1 | dd_Smed_v6_5958_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30008169 | EF-hand domain-containing protein | SMESG000026622.1 | dd_Smed_v6_1881_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30003468 | Phosphoenolpyruvate carboxykinase [GTP] | SMESG000073058.1 SMESG000003144.1 | dd_Smed_v6_536_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30001853 | Protein kinase domain-containing protein | SMESG000003859.1 | dd_Smed_v6_1897_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30002705 | SMED30002705 | SMESG000020813.1 | dd_Smed_v6_3688_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30001586 | Spectrin alpha chain | SMESG000005289.1 | dd_Smed_v6_919_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30011041 | Heat shock protein 903 | SMESG000041107.1 | dd_Smed_v6_758_1 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30007341 | TBC1 domain family member 2B | SMESG000078416.1 | dd_Smed_v6_6508_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30010712 | SMED30010712 | SMESG000051055.1 | dd_Smed_v6_4926_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30012787 | MANSC domain-containing protein | SMESG000015184.1 | dd_Smed_v6_5586_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30011700 | Calcium-binding protein A | SMESG000052083.1 SMESG000048475.1 | dd_Smed_v6_605_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30014980 | Lamin | SMESG000009886.1 | dd_Smed_v6_850_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30011490 | EF-hand domain-containing protein | SMESG000026288.1 | dd_Smed_v6_824_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30018297 | Dynein light chain | SMESG000019341.1 | dd_Smed_v6_177_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30019692 | DUF3421 domain-containing protein | SMESG000046732.1 | dd_Smed_v6_844_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30001359 | SMED30001359 | SMESG000059918.1 SMESG000052306.1 SMESG000022407.1 | dd_Smed_v6_1996_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30001359 | SMED30001359 | SMESG000059918.1 SMESG000052306.1 SMESG000022407.1 | dd_Smed_v6_474_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30014017 | 1.C5.1 | SMESG000003566.1 | dd_Smed_v6_291_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30001329 | SMED30001329 | SMESG000074407.1 SMESG000074416.1 | dd_Smed_v6_3361_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30003482 | Endoplasmic reticulum chaperone BiP | SMESG000061528.1 | dd_Smed_v6_2648_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30013168 | Calpain | SMESG000062904.1 SMESG000062902.1 | dd_Smed_v6_1971_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30009287 | Protein kinase, putative | SMESG000074407.1 SMESG000074416.1 | dd_Smed_v6_3361_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30012826 | SMED30012826 | SMESG000017012.1 SMESG000017011.1 | dd_Smed_v6_309_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30014918 | Ornithine decarboxylase | SMESG000060777.1 | dd_Smed_v6_4916_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30010792 | Protein kinase | SMESG000074407.1 SMESG000074416.1 | dd_Smed_v6_3361_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30016338 | Alpha-adducin | SMESG000051636.1 | dd_Smed_v6_2345_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30008553 | Phosphoenolpyruvate carboxykinase [GTP] | SMESG000062868.1 | dd_Smed_v6_196_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30022249 | Clathrin interactor 1 | SMESG000032527.1 SMESG000022725.1 | dd_Smed_v6_1563_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30031345 | Pyruvate dehydrogenase E1 component subunit alpha | SMESG000073271.1 | dd_Smed_v6_1310_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30035571 | Protein disulfide-isomerase A5 | SMESG000005268.1 | dd_Smed_v6_1537_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30022331 | Translocon-associated protein, gamma subunit | SMESG000066628.1 | dd_Smed_v6_1265_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30027542 | CRAL-TRIO domain-containing protein | SMESG000019717.1 | dd_Smed_v6_1619_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30026513 | SMED30026513 | SMESG000005268.1 | dd_Smed_v6_1537_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30028938 | Protein disulfide-isomerase A6 | SMESG000023147.1 SMESG000017020.1 | dd_Smed_v6_250_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30035250 | lipopolysaccharide-induced tumor necrosis factor-alpha factor homolog | SMESG000033033.1 | dd_Smed_v6_2503_0 | dd_Smed_v6 | PMID:29674432 Plass et al., 2018 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30006473 | MFS domain-containing protein | SMESG000018042.1 | dd_Smed_v4_11486_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30034257 | CRAL-TRIO domain-containing protein | SMESG000009988.1 | dd_Smed_v4_3680_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30031568 | Cytochrome P450 2L1 | SMESG000050434.1 | dd_Smed_v4_5307_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30032538 | MFS domain-containing protein | SMESG000055803.1 | dd_Smed_v4_5294_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30029717 | SMED30029717 | SMESG000018042.1 | dd_Smed_v4_11486_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30011291 | Acidic phospholipase A2 | SMESG000079712.1 | dd_Smed_v4_2969_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30006083 | SMED30006083 | SMESG000061797.1 | dd_Smed_v4_6028_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30013885 | SMED30013885 | SMESG000046850.1 | dd_Smed_v4_9640_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30010951 | SMED30010951 | SMESG000076142.1 | dd_Smed_v4_719_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30011447 | SMED30011447 | SMESG000034829.1 | dd_Smed_v4_1321_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30011140 | Argininosuccinate synthase | SMESG000053053.1 SMESG000053052.1 | dd_Smed_v4_3086_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30004312 | Parvo_coat_N domain-containing protein | dd_Smed_v4_28220_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() | |
Category 3 cell | SMED30002693 | SMED30002693 | SMESG000078700.1 | dd_Smed_v4_15736_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30004351 | SMED30004351 | dd_Smed_v4_15429_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() | |
Category 3 cell | SMED30004513 | Gamma-aminobutyric acid type B receptor | SMESG000049232.1 | dd_Smed_v4_60992_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30001371 | P/Homo B domain-containing protein | SMESG000074553.1 SMESG000074551.1 | dd_Smed_v4_1484_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30012767 | SMED30012767 | dd_Smed_v4_917_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() | |
Category 3 cell | SMED30000850 | slc7a-8 | SMESG000006721.1 | dd_Smed_v4_12027_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30021793 | Pmp-10 | SMESG000068743.1 | dd_Smed_v4_2178_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30030292 | Cytochrome P450, family 1, subfamily D, polypeptide 1 | SMESG000012534.1 | dd_Smed_v4_2162_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30024165 | SMED30024165 | dd_Smed_v4_2664_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() | |
Category 3 cell | SMED30005357 | hypothetical protein | SMESG000027979.1 | dd_Smed_v4_775_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30000058 | SMED30000058 | SMESG000022049.1 | dd_Smed_v4_499_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30018924 | SMED30018924 | SMESG000028420.1 | dd_Smed_v4_468_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30002098 | carboxypeptidase E | SMESG000062760.1 | dd_Smed_v4_4210_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30016382 | SMED30016382 | SMESG000029089.1 | dd_Smed_v4_2873_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30005740 | SMED30005740 | SMESG000029096.1 | dd_Smed_v4_480_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30000827 | SMED30000827 | SMESG000043280.1 | dd_Smed_v4_278_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30002356 | SMED30002356 | SMESG000069796.1 | dd_Smed_v4_4492_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30020865 | Aminopeptidase | SMESG000033900.1 SMESG000033518.1 SMESG000022330.1 SMESG000022279.1 SMESG000022278.1 | dd_Smed_v4_4516_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30020794 | SMED30020794 | SMESG000056235.1 | dd_Smed_v4_1413_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30018353 | Glycine amidinotransferase, mitochondrial | SMESG000051964.1 | dd_Smed_v4_920_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30022130 | SMED30022130 | SMESG000026848.1 | dd_Smed_v4_1128_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30025584 | SMED30025584 | SMESG000077266.1 | dd_Smed_v4_1066_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30027207 | Ornithine decarboxylase | SMESG000055750.1 | dd_Smed_v4_5493_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30027266 | SMED30027266 | SMESG000041022.1 | dd_Smed_v4_7160_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30024934 | 3-hydroxybutyrate dehydrogenase, type 1 | SMESG000039796.1 SMESG000039794.1 SMESG000039792.1 | dd_Smed_v4_8012_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30026414 | MPV17 mitochondrial membrane protein-like 2 | SMESG000062744.1 | dd_Smed_v4_4214_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30035874 | SMED30035874 | SMESG000043890.1 SMESG000043321.1 SMESG000043310.1 SMESG000043263.1 SMESG000020012.1 SMESG000019997.1 | dd_Smed_v4_517_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30035490 | SMED30035490 | SMESG000042765.1 | dd_Smed_v4_5159_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30027899 | slc26a-10 | SMESG000052008.1 SMESG000051986.1 | dd_Smed_v4_5066_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30031918 | SMED30031918 | SMESG000043420.1 | dd_Smed_v4_460_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30028892 | SMED30028892 | SMESG000010564.1 | dd_Smed_v4_8271_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30029055 | Protein-tyrosine-phosphatase | SMESG000055801.1 | dd_Smed_v4_4629_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30029159 | SMED30029159 | SMESG000029594.1 SMESG000029589.1 | dd_Smed_v4_315_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30026350 | slc26a-8 | SMESG000064562.1 | dd_Smed_v4_4250_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30029960 | SMED30029960 | SMESG000056926.1 | dd_Smed_v4_270_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30031756 | SMED30031756 | SMESG000043890.1 SMESG000043321.1 SMESG000043310.1 SMESG000043263.1 SMESG000020012.1 SMESG000019997.1 | dd_Smed_v4_517_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30034619 | SMED30034619 | SMESG000029095.1 | dd_Smed_v4_3913_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30019369 | SMED30019369 | SMESG000042765.1 | dd_Smed_v4_2147_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30018430 | Active breakpoint cluster region-related protein | SMESG000025211.1 | dd_Smed_v4_4507_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30024954 | X1.C4.1 | SMESG000043890.1 SMESG000043321.1 SMESG000043310.1 SMESG000043263.1 SMESG000020012.1 SMESG000019997.1 | dd_Smed_v4_517_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30023530 | Peptidase M20 domain-containing protein 2 | SMESG000049098.1 | dd_Smed_v4_7395_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30021619 | X1.C4.1 | SMESG000043890.1 SMESG000043321.1 SMESG000043310.1 SMESG000043263.1 SMESG000020012.1 SMESG000019997.1 | dd_Smed_v4_517_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30022783 | X1.C4.1 | SMESG000043890.1 SMESG000043321.1 SMESG000043310.1 SMESG000043263.1 SMESG000020012.1 SMESG000019997.1 | dd_Smed_v4_517_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30025596 | Ca(2 )/calmodulin-responsive adenylate cyclase | SMESG000023584.1 | dd_Smed_v4_4439_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30007566 | Voltage-dependent calcium channel subunit alpha-2/delta-3 | SMESG000020654.1 | dd_Smed_v4_16278_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30001222 | persulfide dioxygenase ETHE1, mitochondrial | SMESG000066719.1 SMESG000066710.1 | dd_Smed_v4_4089_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30000223 | Otoferlin | SMESG000010367.1 | dd_Smed_v4_3993_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30001916 | IRS-type PTB domain-containing protein | SMESG000027222.1 | dd_Smed_v4_9490_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30008536 | SMED30008536 | dd_Smed_v4_15429_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() | |
Category 3 cell | SMED30018938 | Innexin | SMESG000003944.1 | dd_Smed_v4_39254_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30004121 | SMED30004121 | SMESG000014792.1 | dd_Smed_v4_694_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30002813 | hypothetical protein | SMESG000024478.1 SMESG000024473.1 | dd_Smed_v4_574_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30003274 | X1.A.C4.1 | SMESG000079273.1 | dd_Smed_v4_3278_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30005429 | SMED30005429 | SMESG000030956.1 SMESG000030911.1 | dd_Smed_v4_902_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30012110 | C2H2-type domain-containing protein | SMESG000064731.1 | dd_Smed_v4_18947_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30008964 | SMED30008964 | SMESG000010167.1 | dd_Smed_v4_8925_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30018178 | SMED30018178 | SMESG000035470.1 | dd_Smed_v4_16195_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30012310 | SMED30012310 | SMESG000028761.1 | dd_Smed_v4_5231_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30014067 | Integrase catalytic domain-containing protein | dd_Smed_v4_16497_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() | |
Category 3 cell | SMED30011944 | Synaptic vesicle 2-related protein | SMESG000020112.1 | dd_Smed_v4_12720_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30016267 | beta-secretase 1 | SMESG000037819.1 | dd_Smed_v4_4132_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30005835 | SMED30005835 | SMESG000012702.1 SMESG000012701.1 SMESG000012690.1 SMESG000012688.1 SMESG000012672.1 | dd_Smed_v4_55_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30010746 | Bestrophin homolog | SMESG000003961.1 | dd_Smed_v4_33028_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30019420 | SMED30019420 | SMESG000071974.1 | dd_Smed_v4_16457_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30007756 | SMED30007756 | SMESG000007194.1 | dd_Smed_v4_15484_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30017222 | Histone H2A | SMESG000074553.1 SMESG000074551.1 | dd_Smed_v4_1484_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30000261 | Ig-like domain-containing protein | SMESG000044415.1 | dd_Smed_v4_8619_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 3 cell | SMED30010406 | SMED30010406 | SMESG000009335.1 | dd_Smed_v4_18243_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |