primitive ectoderm

The Planarian Anatomoy Ontology (PLANA) is a collection of terms curated from the literature and other organism anatomy ontologies to describe anatomical features, life cycle stages and developmental processes in the regenerative flatworm Schmidtea mediterranea. The latest version of the PLANA Ontology is available through the Open Biological and Biomedical Ontology Foundry (OBO) . PLANA Ontology terms are searchable at the EMBL-EBI Ontology Lookup Service (OLS) and the PLANA Ontology Terms Page.

Below, the Overview Section is populated with infomration from the OLS.

Additional experimental information related to PLANA Ontology terms can be found in the Additional Term Information Section.



    ▻ Planarian Anatomy Ontology Term Overview

    ▻ Additional Term Information

      ▻ Description

      ▻ Figures

      ▻ In Situ Hybridization Data

      ▻ Sequences

      ▻ References




    Planarian Anatomy Ontology Term Overview


    NAME:

      primitive ectoderm


    DEFINITON:

      A single cell layer of extraembryonic, post-mitotic ectodermal cells bounding the embryo. The primitive ectoderm forms during Stage 2 and is thought to degenerate as the definitive epidermis forms during Stages 5-7.


    TERM DEFINITION CITATIONS:

      OCLC:20423827, planaref-0000001, OCLC:464776945, OCLC:82522822


    TERM ID:

      PLANA:0000029


    ABOUT THIS TERM:

      primitive ectoderm "is a" extraembryonic structure

      primitive ectoderm "contained in" oral hemisphere and aboral hemisphere

      primitive ectoderm "develops from" blastomere compartment

      primitive ectoderm "existence overlaps" Stage 4, Stage 3, Stage 5 and Stage 2

      primitive ectoderm "existence starts at point" Stage 2


      primitive ectoderm surface and primitive ectoderm cell "is a" primitive ectoderm


    BROWSE ONTOLOGY TREE (IN OLS):

    Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.


    Planarian Anatomy Ontology


    EXPLORE ONTOLOGY GRAPH:


    Dynamically explore this term by selecting additional relationships to display ( checkboxes on the right ) and by expanding nodes by double clicking on a node. Single click on a node to display the definition below.

     

    back to top


    Additional Term Information


    All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


    DESCRIPTION:   

    Sphere formation begins during S2 when some of the blastomeres exit the cell cycle and commit to primitive ectoderm fate (Hallez, 1887; Ijima, 1884; Le Moigne, 1963; Metschnikoff, 1883). These cells flatten, elaborate numerous processes, and ultimately generate a single cell layer bounding the sphere. The number of primitive ectoderm cells varied, with a mean of 21.5 +/- 2.9 per S3 embryo (Figure 1 – figure supplement 11 B). This observation is consistent with primitive ectoderm cell number estimations in Polycelis nigra embryos (Le Moigne, 1963). Moreover, the primitive ectoderm cell number remained constant during S4 as the embryo ingested yolk and increased in volume (Figure 1 – figure supplement 11 B-C). Consistent with this finding, cycling cells were not observed in the primitive ectoderm (Figure 3 A-E). Pan-embryonic cell markers, including EF1a-like-1 (SMED30004295), EF1a-like-2 (SMED30012165), and eIF4a-like (SMED30003202) were expressed in primitive ectoderm cells of S2-S3 embryos, (Figure 2A-B, Figure 5 E, Figure 5 – source data 3). gelsolin-like (SMED30014940) was expressed in blastomeres during S2, and primitive ectoderm cells and the temporary embryonic pharynx in S3-S4 embryos (Figure 1 – figure supplement 11 D). gelsolin-like mRNA was detected throughout the primitive ectoderm cell layer, with concentrated perinuclear staining. spondin-1-like (SMED30032088) was frequently detected in blastomeres during S2, and was expressed in primitive ectoderm cells with star-like morphology, as well as parenchymal cells, in S3-S4 embryos (Figure 1 – figure supplement 11 E).  Early embryo enriched (EEE) transcripts were not detected in the primitive ectoderm beyond S4 (Figure 5 – source data 3).


     

    back to top


    FIGURES:


    Figure 1 – figure supplement 11: Molecular markers for the primitive ectoderm

    A: Average RPKM values per embryo for primitive ectoderm markers gelsolin-like (SMED30014940, blue) and spondin1-like (SMED30032088, red) during embryogenesis, Y (yolk), S2-S8.  

    B-C: The number of primitive ectoderm cells remained constant while embryo volume increased during S3-S4. Primitive ectoderm cell nuclei were scored in SPIM reconstructed S3 and S4 embryos. B) S3: Average number of primitive ectoderm nuclei per embryo: 21.5 +/- 2.9. S4: Average number of primitive ectoderm nuclei per embryo: 22 +/- 1.4. n=5 embryos. Unpaired t-test, two tailed p value = 0.72.  C) Average S3 embryo volume: 7.4 x 107 µm3. Average S4 embryo volume: 1.5 x 108 µm3. Unpaired t-test, two tailed p value = 0.01. Embryo volumes were calculated by generating a masked surface in Imaris. Embryos scored, S3: n= 22. S4: n=5. Error bars: Standard deviation of the mean.

     D-E: gelsolin-like (D) and spondin1-like (E) expression (blue) during embryogenesis, S2-S8. Black arrowheads: temporary embryonic pharynx. Red arrowheads: definitive pharynx. Yellow arrows: primitive ectoderm cells. O: oral hemisphere. A: aboral hemisphere. V: ventral. Scale bars: 100 µm.

     

     

    back to top


    IN SITU HYBRIDIZATION DATA:


    Smed IDAccessionNameAliasEnriched during stage(s)Tissue/PatternImages
    SMED30018602ATP-dependent RNA helicase dbp2DDX5-likeStage 2, Stage 3, Stage 4embryonic digestive system, blastomere compartment, temporary embryonic pharynx, primitive ectoderm, blastomere
    SMED30003202Eukaryotic initiation factor 4A-IeIF4a-likeStage 2, Stage 3, Stage 4embryonic digestive system, blastomere compartment, temporary embryonic pharynx, primitive ectoderm, blastomere
    SMED30014940Gelsolingelsolin-likeStage 2, Stage 3, Stage 4, Stage 5embryonic digestive system, primitive ectoderm cell, temporary embryonic pharynx, primitive ectoderm
    SMED30033466Histone H4Stage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, blastomere compartment, temporary embryonic pharynx, neoblast compartment, primitive ectoderm, blastomere
    SMED30032088Spondin-1spondin1-likeStage 2, Stage 3, Stage 4blastomere compartment, primitive ectoderm cell, primitive ectoderm, blastomere
    SMED30027646Transcription factor BTF3 homologBTF3-likeStage 2, Stage 3, Stage 4embryonic digestive system, blastomere compartment, temporary embryonic pharynx, primitive ectoderm, blastomere
    SMED30025427Translationally-controlled tumor protein homologtct-likeStage 2, Stage 3, Stage 4embryonic digestive system, blastomere compartment, temporary embryonic pharynx, primitive ectoderm, blastomere
    Click to see image symbols and abbreviations
    Abbreviation or symbolDefinition
    Ooral hemisphere
    Aaboral hemisphere
    Ddorsal
    Vventral
    Llateral
    black arrowheadembryonic pharynx
    red arrowheaddefinitive pharynx
    black arrowsprimitive gut
    yellow arrowsprimitive ectoderm cells
    cyan arrowsbrain
    cyan arrowheadsnerve cords
    blue arrowheadseye progenitors (trail cells)
    purple arrowheadseyes
    scale bar100 µm

     

    back to top


    SEQUENCES:

    smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

    >SMED30014981 ID=SMED30014981|Name=Gelsolin|organism=Schmidtea mediterranea sexual|type=transcript|length=1397bp
    CTCTTCCGATCTTATCAACTTACTCACATAGATGATAAAATGTTTGGCTGGTTGTTTAAATATTTGAAAAAAAATTGACC
    AATAAGAAAAATTTCTGTGCGCCAATTCAATCGATAATTTGCTCACTGACATTTGCATAGTTTTACAGCCGATTTGGACA
    GTATAAATACGAATGTCACTTTAGATTAATTTCACTTGTCTTTACATTATCATGAAAAAAGCAGAAAAATACGACTGGAA
    GGATTCGAATGTCGAATTAATTGGTTCATCGGAGGATCGCAGTGTTAAAAAATCATCGGCAGACACTGAAAAAGCTTGGA
    ATGCTGCAAAAACTTGCAAAACAACCGCTTTGTTTATTTGGAGAATCGAGAAATTTAAGGTTGTTGAATGGCCTAAGCAG
    AGATTCGGAGAATTCTTCGAAGGTGATTCCTATATTGTTCTAAATATTTATCAAAAAGAAAAAGAACTACTTTATGATAT
    CCATTTTTGGATTGGAAAATATTCGACTCAAGACGAGTACGGCACTGCTGCTTACAAGACTGTGGAGTTGGATACCTTAC
    TAGATGACAAACCCATCCAACATCGCGAGGTTCAGGATTATGAGTCTGACATGTTTAAAAGCTATTTTCCAAATATTATA
    TATCTAAAAGGAGGTTGCGAAAGTGGATTCCGACACGTCAACACAAGAGAGTACAATCCAAGACTACTCCACGTCAGAGG
    CGAAAAGAATAATATAATTATATCTGAAGTTTCGTCGACCAAGAAAAATTTAAATTCTGATGATGTATTCATTTTTGATT
    CTGGAAGCTGTATATATCAATGGATCGGAAAAGGTGCTAATAAAGATGAAAGATTCAAAGCTCAACAGTTTGCTCAGCAG
    TTGAACTCCGATCGAAATGGGAAACTAAAAATCGAGGTACTTGATGAAGGACAAATGTCCCCAAATCATGAATTCTATAA
    TAAATTATCTAACAACGAACCAATTGCTGATGACAAAAACCATAAATCCTTAACAGCTCACGAAAAAAAGCTTTTTCGGA
    TTTCCGACGAAACTGGACATTTAAAGTTTGAACAAGTAGCAAGTGGAAATTTCAATAAATCTAATATTCATGAAAATGAC
    GTCTTTATTATTGACAATGGGCAAGTTATCTACGTTTATGTCGGAGAAAAGGCAAGTGACAATGAACGGAAAAACGCACT
    TATCTATGCACATAACTATCTGAAGGCTACGGATTATCCCCAAGCTCCTATTACCGTTGTCAAGAAGGATATCAAAGGTA
    AAAATGCCGAAGAATTCAACAAAGTGTTAAATGGCTGACGACTCAACTTCATATAGAATTTAAATAATTTTACTCTTACA
    ATAATTTAATTAAAATTTAGTAATTGTTATTAATAAA
    >SMED30026323 ID=SMED30026323|Name=Gelsolin|organism=Schmidtea mediterranea sexual|type=transcript|length=1381bp
    ATTTAATTATGCTTATTTTAAACCAATCACATTTGGACTAGCGAACTCATAAGACAGACAAGCTTTCATATATTTATTAA
    CATTTATTTCTTATTGTATATGAATACGGTTGAAGTGTTTTATTTAAACTAGATCTTTTTAGTATAGCTAAAACAAAATA
    GAAATGGTAAAACCGAAAAAATATTCTTGGAAAGATTCTAATGTTGAATTAATAGGAACAAAGGAAGATCGTAGTATAAA
    AAAAATATCTGCCGAAACGGAGAAAGCATGGGCTAAAGTAAAGTCATGCAATCATCCGGAATTATTTATCTGGAGGATAG
    AGAAGTTCAAAGTAGTTGAATGGCCTATAAACCAATTTGGGGAATTCTATAATGGAGATTCGTATATCATACTAAATATT
    TATACAAGAGGAAATGAGATTCTTTACGATGTACATTTTTGGATTGGAAAATATTCAACTCAAGATGAATACGGAACTGC
    CGCCTACAAAACAGTAGAATTGGATAATTTCCTTGATGATAAACCGGTACAACATAGAGAGGTGCAGCATTACGAATCAG
    AGTTGTTTAAGAGCTATTTTTCTCAATTAATTTATCTGAACGGTGGAATTGAAAGTGGATTTAGACATGTAATTACGAAA
    GAATATTCACCAAGATTGCTTCATGTCCGTGGCGACAAACTAAAAGTCATTGTATCGGAAGTTGCTGCAACGAAAAGAAA
    TTTGAACTCGGATGATGTTTTTCTGTATGACACAGGCACCCACATTTTTCAATGGATCGGAAAAGGTGCAAATAAAGATG
    AAAGATATCATGGTCAGAGGTTTGCTCAACAATTGAGTTCAGATAGAAATGGAAAAGTAAAAATTGAAGTTGTGGATGAA
    GATGACTCTTCATCAAATCTTATTTTTTATAATAAATTATCGGATGAAATTAGTGAGGATTGGGATGATGATAAACACTA
    TAAACCTTTATGTGAACATGAAAAATTACTTTTTAGAATTTCCGATGAAACAGGAAAACTAAAATTTGAAAAGATAGGCA
    AAGGAAATATTTCCAGAGCCCAAATAAATGAAGATGATGTTTTTATTATAGATAACGGACAGCAGATTTTCGTGTACATC
    GGTGAAAAATCAAGTCGGGCTGAACGGCAAAATGCACTTATATATGCTCATAACTACCTAAAGGGAACGGAATATCCTCA
    AGCTCCAATATCCGTGGTAAAGAAGGATCTGAAAGGAAATAGTGCTGAGCAATTCAATAAAGTTATTGGGGGCTAATCTT
    TGGAATTTTCGTTTCATTTTTTTACTTTGATTAAAACAAACATTTCATACTTTGATTTTCATTATTGTTAGAAATTTACA
    AAATCCTTTCTTTAAAAAAAA
    >SMED30025482 ID=SMED30025482|Name=Histone H4|organism=Schmidtea mediterranea sexual|type=transcript|length=552bp
    TGTCATTATCAAAATATTTTCAATATATAATAAATCAGAAATCACTAAACAGTCATTACTAAACTATTCTAACTCAAAAT
    GTCTGGTCGAGGAAAAGGAGGAAAAGGCTTAGGTAAAGGTGGAGCTAAAAGACATAGAAAAGTTTTGCGAGACAACATCC
    AAGGAATCACGAAACCAGCTATTAGAAGGTTAGCTCGCAGAGGTGGCGTGAAAAGAATTTCTGGTCTTATCTATGAAGAA
    ACTAGAGGTGTTTTAAAGGTTTTCCTTGAAAACGTAATCAGAGATGCTGTTACTTACACTGAACATGCTAAGCGTAAGAC
    AGTCACAGCTATGGATGTTGTTTATGCACTTAAACGACAAGGTCGTACTTTATACGGTTTTGGAGGGCCACAAATGTTGA
    TTGTAGTGAATTGTTCAAATATTGTTATTCTATCTAGTAATTCTCAGCAATTTTATTAACGTTATTTAGAAATTAATTTT
    ACAATTGCTAATTTCGAATGTTATATCTGGTGTCAATGTTCAGTTATATTATTTTACAAATGACTTGAAATG
    >SMED30029163 ID=SMED30029163|Name=Histone H4|organism=Schmidtea mediterranea sexual|type=transcript|length=537bp
    AGGTTACAGTTTTTCAACTAATACCTCAAAGAAATAATGAAAGATGGACAGTAGAGTTTTGTCACCATCAGGAGACCAAG
    TGTCATTTAGGATGATAATAGCCCAGTTAAGGAATCTTGCTGATCTAATCAATGCCAAAAATATTACAAAATTTCGATTT
    AAAAGAAGCTAAAGGAGAAAAATTACACGGAAAAGTTCAGAGGTACAACATCCAAGGCATCCCTAGGTCTGCAATTAAAC
    GATTAGCACAAAAAAGAGGTGTGAAAAGAATTCATGGGCTTATTTACAAAGAAACAATATATGTTATCAAGTTAGTCCTT
    GAAAATGTCATCTTATATGATATTAAATACACATTGCAAGCCAAGCAAGAAACTTTTACTGCCAAGGATGTTTTTAATAT
    TCTTGAATGTTTGGAGTTTTCTATTTTGTGATAACATCCTTCCCCAAATGAAAGTTATCAGATCATTTTGCAAAGTTTGT
    GAGAAGGGATATATATTTACCAACAAGAAAAATGTTTTGAATTTAAGAATAGGACTC
    >SMED30018602 ID=SMED30018602|Name=ATP-dependent RNA helicase dbp2|organism=Schmidtea mediterranea sexual|type=transcript|length=607bp
    TATTCAAAAGATAAACGATTGTTAGAAGTTGTTAGCAAAACTCCACGGGACAAAATGATTGTGTTCGCAGAAACGAAAAG
    GAAAGCTGATATGATTTGTTCTTTCCTACGTTCAAAACAATTCAGAGTTGGTGCAATGCATGGAGATAAGTCACAGAGCG
    ACAGAGAATATATTCTTAATGGGTTTCGAGGTGAAAATTTAAATATTCTCGTGGCAACAGATGTAGCAAGCAGGGGTTTA
    GATGTTGATGATATTAAAGTTGTAATCAATTACGACTTCCCTATTCAATTTGAAGATTACATTCATAGAATCGGTAGGAC
    AGGCCGACGAGGAAAATCCGGTGTGTCTTATACATTTTTCAATAGAAAGAATTCGAAAAGTGCTCGTCAATTGGTGAAAG
    TGATGGAAGAAGCTAATCAATCAGTTTCAGATAGTTTGTATGATCTTGCATATATACCAAGAAGTGAGCGTAGACAAAAT
    TTCAATCGTCCGCCAATGCCAGTGCCGCAAGTAAATAATTATCAAGTACCTCCGCCTCAATATAATGGTGGAAATAACAT
    GTATCCGCAACCAGATTTATATATGCAAAACGGAGCAGCACATCACA
    >SMED30022078 ID=SMED30022078|Name=Translationally-controlled tumor protein homolog|organism=Schmidtea mediterranea sexual|type=transcript|length=629bp
    GTCAAATATCTTAAATTTGTTTGTTTAAATACTTGTTTACACTAAACACTTTTATTTTGAAAGTTTATTCCACGATGTTA
    ATTTACAAAGACATAATTTCGGATGATGAAATAAGCAGTGATTCATATCCAATGAAACTGATTGATGATATTGTGTACGA
    ATTTAATGGAAAGAATATTACCATTAAAAATGGCATACCCGATGAAGCAATCGGTGGAAATAAATCTGCTGAAGGTGGAG
    ATGATGATTATTCTGAATCATGTGAAACTCAAATAGACATAGTCTATGCTAATCGACTAGTAGAAATGAGTTATTCGAAA
    AAAGAGTACACTACTTATATTAAGGATTACATGAAAAGAATACTCGATATTCTTAAAACTAAGAATCCTGCTCGAGTTGA
    TGTATTTAAAACGAATGCTCAAAAATATATTACGGAAATTCTTAAAAATTTTAAAGAATACAAATTCTACACGGGTGAAT
    CAATGAATCCTGATGCCATGGTAATTTTATGCAATTATCGGGAGGATCAAATTACTCCTTATTTCATCGTCTTTAAAGAT
    GGTGTTGTGGAAGAAAAATGCTAGGCCAAATTGCCAATGGAATGTTATATTAATAAAGAATTGATTGAC
    >SMED30001973 ID=SMED30001973|Name=Eukaryotic initiation factor 4A-I|organism=Schmidtea mediterranea sexual|type=transcript|length=361bp
    ATCGAAACTAATTATGATAAAATTGTGGAGTCTTTTGAAGATCTAAATTTAAAAGAAGATTTGTTGAGAGGAATATTTGC
    TTATGGTTTTGAAAAACCATCGGCAATTCAAAAAAGAGCCATTCTCCCAGCAATCGAAGGCCACGATGTCATTGCGCAAG
    CACAATCCGGAACTGGTAAAACTGCCACTTTCAGCATCTCAGTTTTGCAAAACATTGACACTTCCATCAACAAAACTCAA
    GCTATCATCTTAGCTCCAACTCGTGAATTGGCCCAACAAATTCATAAAGTCATCATGACAATCGGTGATTATTTGTCAGC
    AAAATGTTGTGCATGCATCGGCGGAAGAAATGTAAGAGATG
    >SMED30014940 ID=SMED30014940|Name=Gelsolin|organism=Schmidtea mediterranea sexual|type=transcript|length=530bp
    CAAATAAATTTTCGTTTCGTAATTATTTAAATTTCACATGTTTTTTATTTAACTATAAATTCTGGAAAATAAATTAATTT
    TACATTCAATTAATTCAAACAATGAAATTAGATTTTAAAAGTAAATCATTTCTAGAATTTTTTGTTTTTTAAACTTTCTA
    AAAAGGAAACAACTACGGAGCAGTCGAAGAAGTTCTTGTCACCGGACACAGAAAGTCTGACAAAACCGGAATGATAAAAC
    AAAAAAACTACGATTGGAAAGATTCCAATTTGGCTTTGTTTGGATCAGACACGGAAAAATTAGTAAAAAAAACTTCCGCT
    GAAACCGAACCAGCATGGAGAGTTGCTAAGGCAACTACGGTTCCAGGTTTATTTGTTTGGAGAATAGAAAAATTCAAAGT
    CATCAGTTTACCAAAGGAAGAATTCGGAAAATTTTACAATGGAGATTCTTACATTATTTTGAAAATCAATAAAGAAGAAG
    ACAGTCCGGAGTTGCTATACGATGTGCATTTTTGGATTGGAAAATATTCT
    >SMED30033466 ID=SMED30033466|Name=Histone H4|organism=Schmidtea mediterranea sexual|type=transcript|length=421bp
    GATCTCACTATATAAATAAGTATTTGTCCCTATTAATTCATAACAATTATTCAACATGTCTGGTCGAGGTAAAGGAGGAA
    AAGGACTAGGAAAAGGTGGAGCAAAGCGTCACAGAAAAGTCCTTCGTGATAACATTCAAGGTATCACAAAGCCAGCAATC
    AGAAGATTAGCTCGTCGAGGTGGTGTTAAGAGAATTTCTGGATTGATATATGAAGAAACCCGAGGTGTTCTTAAAGTATT
    CTTGGAAAATGTTATTAGAGACGCTGTGACATACACTGAGCACGCTAAGCGCAAGACAGTAACTGCCATGGATGTCGTCT
    ATGCTTTGAAACGACAAGGAAGAACTTTGTACGGTTTTGGAGGTTAAATAACACTTTCATATTTGTGAATGTTTTAGCGG
    CCCTCTTTAGGGCCACAAATG
    >SMED30000837 ID=SMED30000837|Name=Histone H4|organism=Schmidtea mediterranea sexual|type=transcript|length=1387bp
    ATTAACACTAAATTTTGTTTATATAATGATTAAATATTTCAATAATCAATTAATTGAAAAATGTCTGGTCGTGGTAAAGG
    AGGAAAAGGGTTAGGAAAAGGTGGAGCCAAGCGTCATCGTAAGGTTTTACGTGATAACATTCAAGGAATAACTAAGCCGG
    CAATTAGAAGATTAGCTCGTAGAGGCGGAGTAAAAAGAATATCTGGTTTAATTTACGAAGAAACTCGTGGTGTTCTCAAA
    GTTTTCCTGGAAAATGTTATAAGAGACGCTGTTACTTATACTGAACATGCTAAGCGTAAGACAGTAACTGCAATGGATGT
    TGTTTACGCTCTTAAACGCCAAGGAAGAACTTTATACGGATTCGGAGGTTAAATGTGAAACCAATGATATTTTAAGCTAA
    CATTTATTTGTTGAGAATGTTTATGGTCCTCCTTAGGGCCACAATTTTTGATTGTTTACTTTATTTTGTTAGCATTACGT
    AATTTTACAGTGATTGGTTATCTTGCTGGTTGTCTGAAATATTAAATAATAATATGCTATAATTAAATGATATTAGTATA
    GAAAACAAAAATCGGTTTTATTGTTTGATCAACACAATGAATATGTTTATCAATTATCATCATTTCCAGTTTTTCGATTT
    CAGTTGATAATAATTATTTGCGAATTTGTGATTATATTTTCTAATGGGTTGCGAGACATAAATGAGCGTGCAGATATCAC
    ATGCGAACCTGGTTCATGTAGTGTTTTGAGCTACACACTGCAGATAGACGATCAAATCTATAAAGTGAAAAAAGGGTTCA
    AATCAGCTTGCAGCACCAGACTATGTGAAAATTGTGCTCACAAAGGTGATTGGTCAATGAGACTGATTGACGGAAACAAA
    TATATGGTACGACAAGTCAATAAATGTTTAACTAATAATATTTTGGCAGTTGAGCAACTTTTCACAAATTTATATACTCC
    TGTCTCAGATTTTACATGCTCCTTGCATAAGTGCTCTAAATATAATTATTCTTATAATGGAAATATGATTAGCTTTAGCT
    ATATAGGAGTTTGTGACCATTCTTACTGTGACTCATGCCGCTATTCCGACAATTGGAGTCTATTAACCGGATATTTGCAG
    CGGACGACCATTTCATGTTATGTTGTCGATAAAATTAGACTTGAAGATTATTTTCTCATTCCAGAGTTTACCGAAACCTT
    CTATACACTAATTCGGAAATTAGCAATAACTATAAGCTGCGCTTCATTTTTGTGTTTGGTGATCATTCTTTTGGTTTGTT
    TTGCTAAAAAATGAGATCTTACAGAAGCTTTAAGGAACTTAATTTTATTTAACAATATATTTATACTTAGATCTAATGCT
    TTGAATGATCCTTTCGCAAGTCCATCC
    >SMED30002168 ID=SMED30002168|Name=Spondin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=2693bp
    CAATTGCTTAATAAAATTTTCCTTTCAATAATTACCGTAAAAGTTGATGAAATTAATTTTGAATATTTTATCCACTTTTT
    TCATATTGAAATTTGATTTTGCTGAATGTTTCGGATTTTGTGACATTCAATTTCCGAAATCATACGTTGCCTTTTCCACT
    AGATTCAATCTCTATACGAATCATGAAAAAGAAAAACTGACCAAAATCACCTCGTACATTCCTGATAAAACCTACGACAT
    AACTGTGTCATTGAATGATAAAGCTATGCACGAAAAGTTGACAATAAAAGAAATATACGTCTTAGTCTCAAATGTTCACA
    CGGAAATGGAAGAATTGTCGGAACATGACTGGAAAAACGCCGGTGAAGTGGTTTTTAATGTAACTCACGCATCCAAAACA
    GAATATTGCCCCCAAAGAGCTTACGTTCAGTATTTATATACCCAACCCCAACATGTCACATTCTATTGGATAGCACCTAA
    AATACCGAATTTTTGTATTAGAATAACAGTTATTTTGAAAATGAACGATTTGATTTCAGAAAGCAAATTCGAAGAAAGAT
    CCCACTGGATATGTGAACAAAAAAGAAACAAAATGGATCAGATGCAAGCAGATCAATATGCATCTACCTCTTGCGCAATG
    AAACAAAAAACTGATCCAGTTAAACAATGTAATATTGGATCAACAGCGGTATATAGAATGACAATTGAAAATAAATGGAA
    TTTATTAAATCATTGGAAAGATTGGCCGGGCAAAGACGGGTATTCTCCTAAAATAACTCAATATCTCGGAGCTTCTCATT
    CAAATGAGTTTAATATTTATCATCTTGGTGGAATGGCCAATGAAGGAGTTTCTCAGGTATGTGGAAACGGGAGCTACACT
    GAATTGCAAAAGCAATTCTACAAAGCTGGGAACGGGATCATGACAGTTATATTGGCCAGGTCACTAGATGCGTCATCAAA
    AACCAATAAAAGATCAGCACTGATTGTTGTAAATGCAACTCAACATTTGGTTAGTTTTCTTGCAAGACTTCATCCAAGTC
    CCGATTGGTGCACAGGTCTAAGTAGATTTGATCTTTGTAACGGCTCATGCAAATGGCAAGAAAAATTTATCGTCCATTTA
    TATCCTTGGGATGCCGGTGTTTACAGTGGAGAGACTTATTTAAATAAAAACGAGAAAACTAGACAGACTCCAATATGTCC
    AATCACTAGCAGTTGGCCAAAGGATAACCCTTTCACGGTGATGAACGGAAAAATCAAAAATATCGGAGTGGTAACCTTCC
    AATTAATACAAGAATATAACAAAAATGATAACCAGTATTGTAATTCTATTAATTCAATCCTTCAAGACGAAGCATACCAA
    AATGAACCGAAATCCAGTGCTCTGAAATCAAATCCAGATAAAACCAGGCATTGCTTATTGTCAGAATGGAGTGAATGGAG
    CTCTTGTTCAGAATCTTGTGGTAAAGGTGAAAAAACTCGTTACCGAAAACTGCTGAAAGGAAAATCCGAACAATGCATTG
    AATCTTCCCTAACTAATACAGAGAGCTGTAGCAGTAAATGTTCGACAGTAATTTCATTCGAAACATGTTCGTTTCGCTTG
    TGGGGCCAATGGAGCCCATGCAATGCTACTTGTTCCCAGAAGGGAATTATTCATAGGGAACGTGTTTTTATCAATGAACA
    GGAAAAACACGAATGTATGCAATATTCCGAAATGAAAGCCTCTCTTGAATGTGCATTAGCAAGCGAGAGGTGCAAACCCG
    ACGTGATCTGCAAGGAATATGTTTATCCTGGAGATTCGTGTTCTTGGTCTAGCCCATCACAAAGATTTTATTACGATTTT
    TCTAGTGGAACTTGTAATGCATTTATTTACAAAGGCTGCTATGGGGGTCTGAATAATTTTCACACCTACGAGGAATGTAT
    TTTACTCTGTCGACCAAAATTAAAAGAAACAGATCAAAGACGATTTAATACGCCAGAAACTTATCCCAACCGATGCGGAG
    TTTCGATGACATGGGGAATCTTTTGTGATAGTCAATCTTCATCAAACCGTTGGTACTATGACAATATTAATAAAGAATGC
    TACCGATTTCGTTTCGGGGGCTGTCGAGGGAATGCCAACAATTTCCGAACTAAAACTGAATGTCAAAATGTTTGCTTGAG
    AGAAAAGTCTACTTCAACAACAACGACAACGATCAGTCAGCCAGTAACGGTAAGAAAAGTCTGCATCTATTCCAACTGGT
    CGGACTGGAGTTCTTGTGATAACAACTGTCAAAATCAACAAACAAGAATAAGATTTTTAATTGAAAAAAATGACGACTGC
    ACCGAAAGTATCAGTGAAACAAGAAAATGTCAATCAGAGAAATGCAATTCGCCAAATAACGGGTTTATTTCACTAAGGAA
    TTGCAAGTATTCGAGTTGGTCGGAATGGTCGGCTTGTTCATCAAGATGCGGTCCTGGCGTTAGAGAGAGAAAGCGGAAGA
    AACTTTCTCGTAATTGTAAACCGGAATTTCCGCAATTTACTGACCGAGAATCATGTTACAATGCTTGTGCTTATGACTGA
    ATCCGGTAAAGAAAAAAAAACTGTCAATGTATTTGTGTCATGACATTTTACCTATTGTGCATTTCATTTTGTGAACTTTG
    TTTGGTTTTTGATTTATTTTTTCTTGGTGTTTTTCTCTAGAATATGATTTGTT
    >SMED30003202 ID=SMED30003202|Name=Eukaryotic initiation factor 4A-I|organism=Schmidtea mediterranea sexual|type=transcript|length=1324bp
    ATTAATAACAATGGAAAATCCAGGAGAAATAGAAAGTAATTACGACAAAATAGTTGAATCATTTGAAGATTTAAACTTAA
    AAGAAGATTTGTTAAGAGGAATCTTTGCTTATGGTTTTGAAAAACCTTCTGCTATTCAGAAGCGTGCTATTTTGCCAGCT
    ATTGAAGGTCACGATGTCATTGCCCAAGCACAATCTGGAACCGGAAAAACTGCCACTTTCAGTATTGCTGTTTTGCAGAA
    TATTGACACTTCTATCAATTCTACACAAGCTATTATTCTAGCACCTACCAGAGAACTTGCAGTTCAAATCCACAAAGTTA
    TAATGACCCTTGGTGACTATATGGGAGCTAAATGTTGCTCATGCATTGGTGGAAGAAATGTCCGTGACGACATTAACAAT
    TTGGAAAGTGGAATGCATGTTGTTGTCGGTACTCCAGGACGAGTTAAAGATATGATAAAGAAGGGCCATATTAAATCAGA
    TTTCGTGAAAATGTTTGTCCTTGATGAAGCCGATGAAATGTTGAGTCGAGGTTTTCAAAATGACGTTTGTGAATGCGTTC
    AATATTTATCTGCCGAAACCCAAAATTTCATTCTTTCTGCAACAATGCCAGATGAAGTTTTAAAAGTCAGTAACGAATTC
    ATGAATAATCCAGTGAAAATTCTCGTTAAAAAAGAGGAATTGACTCTGGAAGGTATTCGTCAATTCTACGTTAACGTTAG
    CCAAGAAGAATACAAATTTGATACCTTATGTGATTTATATGAATCTCTGACCATCACCCAAGCTGTCATTTTCTGTAACT
    TCAAAAACAAAGTTATATTTTTAAATGATAACTTGAAAAGTAAAGGATTTGTTGTTTCATCAGTCCACGGTGACATGGAG
    CAACAAGCTAGAGACCAGATTATGAAAGAGTTCCGAAGTGGATCAAGTAGAATTCTCATCACCACAGATTTGCTATGCCG
    AGGTATTGACGTCCAACAAGTCTCAATGGTCATTAATTATGATTTGCCTAAAAACAAAGAAAATTATATTCATCGAATTG
    GCAGAGGAGGCCGATTCGGAAGGAAAGGAGTTGCACTAAATTTTGTCACAGACAAAGATATTGCTGAAATGCAGGAGCTG
    GAAAATTTTTATAACACCAAGATTGAAGAGATGCCCATTAATTTATCTGAATTCTTATAAATGATTTACCGCTATTTTTG
    TAAATAAATTTTAATTTACAATTAAATTAGGTTATTCATAACTTCCTTTGTTACGTAATTTTTGCTATCTTATCTATTTT
    TGTTAGTAATGTATTTATGCTGCGTCACATTTTTGTTGCAAATT
    >SMED30020614 ID=SMED30020614|Name=ATP-dependent RNA helicase dbp2|organism=Schmidtea mediterranea sexual|type=transcript|length=2242bp
    CTTCCGATCTATTTTGTTTAACTTTTTCTCACTTTTAAATAAATATTATTAATCCAAAATGTCAGATTGGTCTGACAATG
    GAAGAGATCGTTCTGGAAAATACAATGGCAATGACAGAAGTGGTCGTCATGATCGAAGCGATCGTAATGATCGAAGTGAT
    CGTAATGATCAAAAGGAACGAGGATTTAGAAGCAGTTATAGTGGTCATAATGATAAATATAGCAAAAATAGTAGAACCGA
    AAGAAATGGATTTGATAAAAACAGGAAGGATAAATCTGATTGGAACGACAAATCCAGGCGATCTAGATCTCGTTCACCCT
    ATAGTAATTATAGATCGAAAGATAACAAAAAGGATGAACAAACTTTAGAAGTTGTTGATTGGAAAACCCACAATTTAATT
    CCATTTCAAAAAAATTTCTATAAGGAGAAAGCTGTTGTTTTGTGTAGATCACCAGATGAAGTTGAGAGATATCGTAAAAT
    AAAAGAAATGACTGTTGCTGGGGATGATATAGCAAAACCAATATTCTCATTTAATGAAATTGATTTTGCTCCTGAAATAG
    TGTCAGTGATTATTAAAAATGGATGGGTTGAACCAACCCCAATTCAAGCGCAAGGTTTGCCTATGGCATTAAGCGGTAAA
    AATGTTGTAGGTATAGCGAGAACTGGTTCAGGCAAAACTGCCAGTTTCGTTATTCCAGCAATTGTTCATTTAAAAGCGCA
    ACCTAGATTAAGAAAAGGTGATGGTCCCATATGTTTAATCATTGTTCCTACGAGAGAACTAGCTCAACAAGTACAAGGTG
    TTGCAAATGATTTCTGCAAATCTTATGGTATTAAATCAGTGTGTTGTTATGGTGGAGCTCATAAAGGTGATCAGATTGGT
    GAATTACGCAAAGGTGCGGAAATAGTAGTAGCTACCCCAGGTCGACTTATAGATTTACTAAAATGTGAAATAACAAATCT
    TCATAGAACAACTTATGTTGTTCTTGATGAAGCTGATCGTATGTTGGATATGGGGTTTGAGCCTCAAATCAGGAAAATCT
    TTAGTCAAATTAGACAAGATAGGCAGACCTTGATGTGGTCAGCTACTTGGCCACGAGAAGTTCAAAAATTGGCTCAAGAC
    TTTCTTGGTAAATACATTCAAGTAAATATTGGATCTAGAGATCTGCATGCAAATCCTGATATACAACAGTTTGTTGAAAT
    TGTCGATGAATATTCTAAAGATACAAGATTAATTGAAATAGTCAGGAAAAATGCTTGGGATAAAATGATAGTATTTACAG
    AGACTAAGAAAAAGGCTGATAAGATTTGTGGATTACTTAGGTCTAGTGGTTTCAATTCCGGATCTATGCATGGTGATAAA
    TCACAAAAAGATCGGGAATATATTTTACAAGGATTTAGGAATAAATCGTTGAATATTCTTGTTGCTACAGATGTGGCTAG
    TAGAGGATTAGATGTTGACGACATTAAAATGGTCATCAATTATGATTTTCCTAATCAGTTTGAAGATTACATACATCGTA
    TTGGAAGAACTGCGAGAAGTGGAAAAAGTGGAATGTCATATACATTTTTTAATAATAAAAGTGCAAAGAGTGCTTCATCA
    CTTATTAAGATAATGGAAGAGGCTAAACAAATAGTTCCTGATAGTTTGTACAAAATGGCTTGTATTCCAAGAGATCGTCG
    AAGAACAGACTTTCGTTTTCAACAGCCATTTTCTAATGGATTTTCTCAGCAGCAGTCAAATATATCCTCAATTGATTCTG
    GTACTATAAAAAATCATTATACCGATTCGTCTAAGGAATATAATTTTGATAAACCTCACGTGACACCAGTTTCCCAGACA
    AACGGAACACCACACAGAGTCAGTAGATTTGGTGATCGTATTACCCAGTTGCCAAGTTCTTTTACTTTACCACCTCCGAT
    TGATAGTTTTGTTAATGATGTGCATTGTAAACCGGTTATACAACCACATCATCCTACTTCTAATGGAAATGTCAATGGTG
    GTGTATATACGGATAATTTATCTGATTCTAATATATTTAACGATCCCAGATTTAATCACATGGCGTTTTACGGAGTACCT
    CCTCCAATATTAAATGGATCTATTAAACCTTTGTCGTTTGAACGAGACTAGTGATTTTTCAATTTGTCATATCGTTGATA
    TTATGAAATATTCGAGTTTTGTTTGACAGGTTAGTTCTTCAGTAATCATATTGTTTTTACGTAATAAATGTTGAGTTAAA
    TG
    >SMED30014692 ID=SMED30014692|Name=Histone H4|organism=Schmidtea mediterranea sexual|type=transcript|length=464bp
    AAATCTATATAAATCTTATATGAGATAAATGTCAGGTCGAGGAAAAGGTGGAAAAGGTCTTGGTAAAGGAGGTGCTAAGA
    GGCACAGAAAAGTATTGCGTGATAATATTCAAGGAATCACTAAACCTGCAATTAGACGTTTAGCAAGAAGAGGTGGCGTT
    AAACGAATATCTGGGCTGATTTATGAAGAAACACGAGGTGTGCTGAAGGTTTTTCTGGAAAATATCATCCGCGATGCTGT
    CACATATACGGAACACGCGAAGCGAAAAACCGTGACTGCAATGGATGTTGTTTATGCTTTGAAACGTCAAGGTCGAACTC
    TTTATGGGTTCGGTGGATAATCATTTTGTATTTTATTATTTAATGTTGTAATTGCTATAATTGTTGCTAGTATTAATCTT
    ATTTTAATAAATTATTTAACTGGATTTTAATTTAAATATGTCGGTTTTGTAAATCCAATTTGTA
    >SMED30027646 ID=SMED30027646|Name=Transcription factor BTF3 homolog|organism=Schmidtea mediterranea sexual|type=transcript|length=541bp
    AAATTAATTTGTTTAAATAAATTTCTTTAGAATCACGCAATGGACGGTTTTAAAATTAACACTGAAAAATTAGAAAAACT
    TAGTAAGTTGTCGGAAAATGTCCGAACAGGTGGTAAAGGTACAATGAGACGAAAGAAGAAGGTCATTGTCAAGAGTTCAG
    CAGCAGATGATAAGAAATTAGAGGCAACCTTCAAATCATTGTCAATGAGCCCGGTTCCAGTTGAAGAAGTAAACATGTTC
    AAGGATGATGGAACTGTTATTAATTTCGTTAATCCAAAAGTCAATGTGTCACTTCCATGCAACACTCTCTCAGTTACTGG
    AAAATCCGAAATTAAGCAATTGACCGAAATACTTCCAAAAGTTTGGCAACAACTTGGCCCACTTAAAGGAGATCTTTTCA
    AGAAAATTGCACAAAACATGGAAAATCAAGCAACTGTCGAAGATATTGATGATGAAGACGATGACGTTCCAACTCTCGTC
    ACAGACTTCGATCAACAAAGCAAATTGGAATAACTTTTTAATATCAATAAATTTTTTGGAC
    >SMED30025427 ID=SMED30025427|Name=Translationally-controlled tumor protein homolog|organism=Schmidtea mediterranea sexual|type=transcript|length=570bp
    AAGTAATACTTTTATCATTTAATTGAAAAAATGCTCATTTACAAGGATATTGTTGCCGGCGATGAGTTGTGCTCTGATAC
    ATTCCCAATGACGATTGTCGACGATGTCGTTTACGAATTCAACGGAAGAAATATTACTATTAAAAACGGTATTTCTGACG
    CCCTCTTTGGTGGAAATGCTTCAGAGGAAGCTGCTGGCGATGATGACGTTGCTGATTCGGACGAGACAGCAATTGACATT
    GTATACAGCAACCGATTAGTCGAAATGAGCTTTGACAAGAAAGGTTACACGAGTTACATCAAAGGTTACATGAAAAGTAT
    TTTGGAAAGATTGAATGCCACTAATAAAGAACGAGCTGAAATCTTCAAATCCAAAGTCGGTGCCTATGTTACAAAAATCA
    TCAAAAATTTTGATGAATATCGTTTCTACTGTGGAGAGTCAATGAACCCTGACGGAATGATCATTCCATGCAATTACAGA
    GAAGACCAAATTACCCCATACTTTGTTCTCTTCAAAGATGGCCTCGAAGAAGAAAAATGCTAGATTTCTGTTAAATAAAT
    TTAGTGGAAC
    >SMED30006887 ID=SMED30006887|Name=Gelsolin|organism=Schmidtea mediterranea sexual|type=transcript|length=1378bp
    CGATGAGTGGTAAAATGTATGTCATTGTCTCATTGGCGTTAGACCAATCAAAATCATCACGAATTATTTGCTCTCGATAC
    AATTCGATTAGAATATAATTGTCATCGTTTGACCTTCGATATCATTTCCATAAATCAAATTTTGTGAGAACATAATGAAG
    AGATCAGCGAAATATGATTGGAAAGATTCAAATGTTGAATTGATTGGTTCCAGCGAAGATCGAGCTGTAAAAAAATCGTC
    TGCTGAAACTGAAAAAGCATGGGCTGCTGCAAAGGCTTGCAATCATGCTGCATTATTTGTTTGGAGAATTGAAAAATTCA
    AAGTTGTTGAATGGCCAAAAGTGCAATATGGAGAGTTTTACGAAGGTGATTCATATATAGTGCTGAAGATATTTGAAAAA
    GAAAAACAACTGAATTATGATGTTCATTTCTGGATTGGGAAATATTCAACACAAGATGAATATGGAACGGCTGCGTATAA
    AACGGTTGAATTGGATACGCTGCTCGATGACAAGCCGGTCCAACACCGTGAAGTCCAACATTACGAATCGAATTTGTTTA
    AAAGTTATTTCCAAAATATTGTATATCTGAAAGGTGGACATGAAAGCGGGTTTAGACACGTTAATACTAGAGAATATATA
    CCAAGACTGCTACATTTTAAAGGTGATAAAAGAAATATAATTATTACTGAGATATCGGCGACGAAAAAAAATCTAAAATC
    TGACGACGTTTTTATTTATGATACTGGATCCAGTATTTTCCAGTGGATAGGCAAAGGTGCAAATAAAGATGAAAAATACA
    AAGCACAACAATTTGCTCAGCAATTGAATGCCGATCGAAATGGAAAGTTAAATATTGAAGTACTTGATGAAGAAGAAACT
    CCATCAAATCATGAATTATTCAAACATTTATCGGATTCTGATCCCGAGGAGGAGGACCAGCATCTAAAAGTTTTAAACTT
    ACAAGAAACCAAACTTTTCAAAATATCTGATGCAACTGGCTCGTTAAAATTTGAAAAGGTTGCAGCCGGAAAATTGAATA
    AATCTCAAATAAATGAAGAGGATGTTTTTATTGTTGACAACGGTCAAATTGTTTATGTCTATGTTGGAGAAGGATCGAGT
    CCCAATGAAAGAAAGAATGCCTTGATATATGCTCATAATTATTTGAAGGAAACGGATTATCCTCAAGCACCGGTTACGGT
    TATAAATAAGGATGTCAAAGGCGCCAATGCCGAGAATTTTAACAAATTAGTTGAAAATTAATCGGAAATTAAATAGCTGG
    AATTTGTGTTAACTTTTTCTTTGGTAATTATGATTAAATATATTTGCGTTTATATTTCTGATTTATGGATTTTAATATTT
    AATAAACACAATATTTTG
    >SMED30035179 ID=SMED30035179|Name=Spondin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=889bp
    AGAAAGGAACATGACCATTTTGAGACTTTTTTTCTTATTTATATTACTTATTAATTTATTCAGTAGTCGCAAATGTGCAA
    ATTGTGAAAATCGATTCAAATCCGATAAATATTCAATTCAAAACGGTAACGGAGGATTCTATTTGTATTTCACTGACGAG
    CATGGCAACCAAGTTGAAAGATTTCAGCCTGGAAAAATTCACCGAATCCTCGTCAAAAACGACATGATCGGAGTCAAGTT
    TCACACATTTCAGTTGAAAGTCTTCCCGACTGAAAAGGTTAAAAGAAACGAATCGTTGGGAACTTTCAAATATCCCAAAT
    TCATTACCGAGGATCCTCAATGTCCGGGAGTTTTCTCAAATAACAATAAACATCTCGTGTCCAAGGTCCATATCAACTGG
    ATTGCGCCTCAATATCCGGAACAGTGCATCAATTTACAAGCAACCGTTGCCATGGACTCGAATCTTGTTTATCAGAATTC
    TCACAACTTGCAAAAAACTGTTTGCTCCAATGAAATGTTTACTTTTATAAATGACAAGCCTATTGTAAACAATGGAATGA
    AGACGGCTTACAAACAATGTTGCGCCTGTGGAACTGCAAGTTATCGGGTGACTTTTCATGGGTTATGGAACAAAACCACT
    CATCCGCAAAACTGGCCCCAAGAAAAGAATCAGCTTCATTGGAGTGGCCCAGTTGGTCACCCACAATCATAATTACTTTA
    TTTATCATTTGGGAAGTCAAGCATCCTATCCATTTAGCAGTGTCTGCACTACCGGAGGATCCACTGCGTTAAAGGAAGAA
    TTCATATTACCTGAAAATAGATTAAATGTTAAGAGTCTCTTTACGTCAGGCTGGTTAAATGGGGAAGAACAGCTAAATGA
    AGAGCGTTC
    >SMED30030773 ID=SMED30030773|Name=ATP-dependent RNA helicase dbp2|organism=Schmidtea mediterranea sexual|type=transcript|length=1968bp
    TTTCTTTAAACGCATTATTTTATTTAATATTTTAACTTTCCATTTACAATAACAATAATTTAAAAGATGAATTATAGATA
    CAGAAGAGAAAGATCTCGATCTCCTATTAGCAGATTTGGAAGTAAATTTCAAAAGAAACAATTTGACTGTGAAATTACTA
    AAATAGATTGGCCTACTATTAGGCTGATGCCATTTAAAAAAAACTTTTATATTGAGCACCCAATTGTGACTGCTAGAAGC
    TCATACGAAATAGACAGATTTAGAAATGAAAAAGAAATGACAGTCGTTGGCAAAAATGTCCCACGGCCGATATTTAATTT
    TAGTGAAATGAATTTTCCAAATTTTATTTTGACCACAATATTAAAAAATAAATGGGTTAGACCAACACCAATTCAGTGTC
    AGGGTTGGCCAATGGCAATGAGTGGTCGAAATGTTGTTGGAATAGCACAAACAGGATCTGGAAAAACTGCAGCTTTTTTG
    TTACCTGCTTTAATTCACATTCGAGCACAGCCGCCTCTTGTAGCTGGTGATGGTCCAATTTGCCTAGTTCTTGTGCCTAC
    CAGAGAATTGGCACAGCAAGTTGAATCAGTTGTAGAAGAATTTGGCATATCAGGTGGATTCAATATGGTGTGTGTTTACG
    GAGGCTCTGATCGGCAGAATCAAATAAAAAATTTACACACTAAACGCCCAGAGATATTAGTTGCTACACCAGGGCGCTTA
    TTAGATCTCTTGAAACAAAACGAGACTAATCTAAGACGAACTACCTATTTAGTCTTAGATGAAGCTGATCGAATGCTCGA
    TATGGGATTTGAACCACAAATACGCGCAGTTCTAAATCAAGTAAGACCTGATAGGCAAATGTTACTGTGGTCTGCAACCT
    GGCCATTAGAAGTCAGGAGGTTGGCTGAAGATTTTTTAAATGAGTATATTCAAGTTAATATTGGGGCTATGTCATTACAC
    GCCAATCATAATATCTGTCAGTATGTTGAAGTTATTGACGAATTTGGCAAAGAGCGTCGATTAATTGAGTTACTTAAACA
    ATTTAATGGTTTGAAAACATTGGTGTTTGTCGCTCTAAAGAAAAGATGTGATAGAATGTCAGATATGTTGAATTCTAGAA
    GCTTTAAAGCCTTAGCCATGCATGGAGATAAGCCTCAAAGAGAAAGAGAACGCGCACTTGAAAATTTCAGAAATGGTAGA
    TCAAATATAATGGTTGCAACAGATGTCGCTTCAAGAGGATTAGACATTGATGACATAATGTTGGTAATAAACTATGATTT
    TCCAACACAAATCGAAGATTATGTACACAGAATAGGCAGAACTGCCAGACAAGAAAAGAAAGGAACATCTTATACATTTT
    TTACAAATAATGAAAAAAAACATGCTCAAAAATTAGTTTCAATTTTGGAAGAAGCTACTCAAAATATTTCGGATAAACTA
    TATGATTTGGCGGAAGTTCCGTATTCGAGTCGCAAGAAGTCCACTGCAAATGTACCCAAAGGATTAGTAACAGGTACTCC
    TGTAAATAACGATTGGGTAGATTCCGTTACTAATAAAAGAATGCCCAATAAATTTAATGGCGGTATTTCTCGTGATAACT
    TTTCAAATGTGGAAAGCGATCATAGAAAGCCAGATTATTTTAAATATAATGGCAGACCGGAAGAAATAGAATCGTTTCCT
    CCGAGTAATACTTCTTCATTTAGAGATTCCGGAAATTGGAGAAATAATGAGTCTTTTAATAATTACAACCAACCACAACA
    GCAGCAGCAACATCAGCCTCCCTATACTAATAATAGCAATAGCTATAATTCAGCCAAAACTTTCAATTATAATGATGATT
    TCAATTCTGTAGGAATCATTGCTAATAGATGGTAAACTTAGCTTATATGTTCTTGTTATATGTTGTAGTTTAAACTTTAA
    TTGTAATCAAATTTGTTGTAATTATTTTAATTATTAATATTATTCTTT
    >SMED30035218 ID=SMED30035218|Name=Gelsolin|organism=Schmidtea mediterranea sexual|type=transcript|length=1573bp
    TTATAACAGTCGCTTAATAAAATGATTAAAATCCTTAATTTTTAGTGAATTCAAATAACAAATTTTAAAATCTAATTAAT
    AATTAAAATCTGTGACTTTGACAATCGATATGATAAAACAAAAAAAATACAACTGGAAAGACTCCAACTTATCTTTATTT
    GGATCTGATACGGAAAAATTAGTCAAAAAAACTTCGTCGGAAACAGAAGCAGCATGGAAATTGGTAAAAACTGTAACTAC
    ACCGAGTCTTTTTATTTGGAGAATTGAAAAATTTAAAGTTGTCAATTGGCCTAAAGAAGACTATGGGAAATTTTTCAATG
    GAGATTCGTATATCATTTTAAAAATAAAAAAGGAAGAAAATAGTCCTGAATTATTTTATGATATTCATTTTTGGATTGGA
    AAAAGAAGTACACAAGACGAGTATGGCACAGCTGCGTACAAAACAGTAGAACTAGATACATTTCTTGATGATAAAGCAAT
    ACAGCATCGTGAAGTTCACGGTTTTGAATCTGATTTATTTAAGTCCTATTTTCCGGTTATTACAATAATGAAAGGCGGAT
    GTGAAAGTGGTTTCAGACAAGTAACTCCAGAAAAATATGAACCAAGACTTTTACATTTTCACTGTGCTGATCAAAAACAT
    GTTGAACTTGTAGAAGTGAAATTTTCAAAAAACTCTTTGGATTCAGGCGATGTATTTATTTTAGACAACGGACTAGAGGC
    TTTTCAGTGGAATGGAAAACTATCAAATAAAAATGAGAAAGTTAAAGCAGCACAATTTTTACAGCAATTAGAATCAGAAC
    GAAACGGTCGGTGCAAAACAGATGTATTAGACGAAGAAGATACTCCTTTGACGCATAAAATTTACAAATTACTACCTGAT
    ACAGCTGTTACTAAGAAGGTTCACAAAGACTTGGCAATTTCCAAACGTCTGTATAGATTATCTGATGAGACAGGCAAAAT
    AACGTTTTCTCTAATCTCAGAGGGCAAAACTCCAAAATCTATGCTGAAAGACAATGATGTGTTTATGATAGATAATGGGC
    GACACATGTTTGTATATATTGGCGCCGGTGCGTCTCCGGATGAAAAGAAAAATGCAATGTCATATGCACATAATTACTTG
    AAAGAAACTGACCATCCATTAATTGGAATTACTTGTCTCCAAGCTGGCCAGCATAGCAAAGAATTTGAGCTTCAATTGGA
    CTAGAAAATGATTATGAAATTTTAAATTGCATGGCATTTCAATATTTTTAAATATTTGTGTTTTTACTTAATTTTTACAA
    AATGCATGAGTTTATGGTAATTCATTTTCTTAGAAGAGTGAAGAAATATTTTTTTGTTTATGTATTTCATAAATTGCTTA
    AATATAATTAAACCTAATGTATATATTGCTGTATTATTTGCTGTTACGAATATTATTGGGCTTGATAGAGCTATCAGAAC
    TAACTCGCCATGCTCTTGATCATAACAAGAAATCTACGCAATCAATATATTTGTACCAAAAATCATAACCATTACAATTT
    TCACCAACACAAATCAATCTAGTTTTTATTTGTTGCCAGAATCAAATTTTGGG
    >SMED30012850 ID=SMED30012850|Name=Spondin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=2699bp
    GGTGAATGAAAGATTGAAAGTAAACAAATTTATGAGACATTGACATTATTCATTTAACTTACATCACAGGACGACCAATA
    TCACATAATACTTCTTCCTGTTTACAAGGTTGAAGTCGTTTATATAAATCGTCAAAGTCTCAGTTAAGATCATTGATATT
    ATGAAAATTTACATCTTAATTTGGAATATCCTTTGGATGTTGCTATGTCTTCATTGGATGATCCAGGAAAGTTTTGCCAT
    GAATACTAGAACCAATTGTTTTAAAATGCATAAAAAAACCTACCAAAAAGTCATGATGAAAGATGGAGAATTTCGAATAG
    TAATTAGAGACATGAAAGGCAAAATGGCAGATAGATTCGAACCTGGTGAAAGCTATAGAATAATTTTGAATAATGCAATG
    TATGGAATGGATTTCAGAGATTTTTCAATATTCGCGGCCTACGAGATGGAGGATTCGTTGCAAATGGAAAGTCATAAAAT
    GATTCCCGATGAAGGACTTGGTCATTTTATTATAAATAAAAAATTTGGGTTGGTTGATTATAAATGTCCTAACAGAATGC
    ATGGAAATGATAATATGTTTCTAACTTATGTAGAGTCGACATGGATAGCTCCGCATAATCCTATAAATTGTATTCGCTTT
    GAGGCTCAAGTTGTAAAATTTGATTTTATGGTGTATGAAAGTATCGGACGTTTAGTAAAAGTTATTTGTCCAACAAAAAT
    GTATAAAATGATTAGTGAAGAAAATAAAAACATGAAAATATCTAAACCTTTTGATGAGATGACTCCTATGGTTAAAGAAT
    GTTGCGCTTGTGGAGTAGCGTCTTATAAAGTAACATTTATGGGGTTATGGTCAAAGAAAACTCATCCCAAAGATTGGCCA
    AAACAAAAGAGCATGGTTCATTGGACCAATCTTATAGGGGCCACACATACTGGCGATTACTTTATATATTATAACGGTGG
    TCAAGCAAGCCAGGCAGTTCAAAGTATTTGTTCATATGGAGATAGCACGGTTTTGAAACAGCAGTTCGCAGAAGAGACAA
    TAAAACCGCATTTGAAGAGTTATTTTAATACTTCAGGCATGTGGAATGAAGACGAAATTGAACAGAGTAGATCGGGATTC
    ATATCGGTTAATCGTACTCATCATTTCTTTAGCTTTCTCACAATGATGGGCCCAAGTCCTGATTGGTGTACTGGAGTAGC
    AGCTGTAGACATGTGTATGAATGATTGTACATGGAAGGATGATTTCACCATGGATCTATTCCCATTTGATGCTGGAATTA
    AAAACGGTTTCACATATTTCCCAGAAAATTCGGACAGGCAAGACATTCCTGATCCAATTAGAACAATCAACACTACATAT
    ATGACCCAATTCCCTTTCACAGCAAATGTTCCAGTTGCCCGGGTAATTTATCAAAAGATCAAACCAAAACACAATTGGGA
    GTGCACCAAGATGAATGCAAAACAAGTAAAAGAATTTGATGAAATGAATTCAAACAAAAACGGAAATTCTCAATTCGATG
    GAAGTAGTTTGACGAAAAAACGCCGACACATTAACAAGAAAAGTCCCCTTGATGATCCGACTTTGGCCAATATGGCTACA
    TTTTTGTGTATAACATCTCCATGGAGTGAGTGGACTAAATGTTCAGTTACGTGTGGCATTGGGACAGAGATGAGATCTCG
    AGACATGTTGAAAAATGCTAAAACAGAATTATGTCGTCACTTACCTTTGCTTGAAAGTCGGACATGCGAAGGAAGAAAAC
    GTTCGTGTGATTTCTCAGCACCATGTAGCCTTCTTTCCTGGTCAAGATGGGGTCCATGCAATGCAACTTGTGAGATGCAC
    GGATACCAACAGAGATCTCGAATGTTTGCAAGATTTGAAGAAAAAGAGAAATGTCTCAAAAACAAAGAAAGACGATTTAA
    AATTTTTGAAGAAAAACGGTGCAAAAAAGACACAGCCTTGTGTGACCCAGTTATTATATGTAGTGAGGGCCTAATAATGG
    GCAGCAGCTGTGGCAAGCCTGTTATGAAATATTTCTATGATGCTGCCAAACACAGTTGTGTGCCTTTTGAATACCTCGGT
    TGTAAAGGAAGTCTGAATAACTTTCCTTCTAAAATGTCTTGCGAAAAGACTTGCTTAGCAGCTGTCAATGCGCTGCCTCA
    GTGGAGAAAAGACAAAATGGCTCACTTACAGTTTCAGTCTCAGTCGAATTCAGATAAACGAAAGAAAATGCCAACAATGG
    CTAACAAATGTCGGCTTGAAGTAAAATACGGCGGAATGAATTGCGATGGAACAATGGGACCGGACATTCGATATTATTAT
    GATAACAGAAATGGACGCTGTAGACAATTTAAATACACTGGCTGTGATGGGAATAGTAACAACTTCCGGTCTTATCACAG
    CTGCATTAAGGCTTGCATGCCAGATCAAATCGACTTTATGAAAACTGCTCCGATCAAAGCTTGTCAAGTATCTGAGTGGT
    CACATTGGGGTCCATGTTCTACGACCTGCGGTGTGGGAGAGAGATTCAAATGGCGATCTGTGCTTCGGCCGGCATTGAAT
    GGCGGTCCAGCTTGTCCAGAGTTATTTCTATCGGAACCTTGTTTCGCGACAACTTGTTGAAAAATTTATATAAATTTTGT
    ATCCATTTTTGATGACATTTATAATAATTTTATGGGTAAATATATTTTAGTTCTTCCTC
    >SMED30022124 ID=SMED30022124|Name=Gelsolin|organism=Schmidtea mediterranea sexual|type=transcript|length=998bp
    TGTACATTAGGATGAATATGGAACAGCAGCGTATAAAACCGTTGAGTTGGACACTTTACTCGACGATAAAGCCATTCAGC
    ATAGAGAGGTGCAAGGAAATGAAACTGATCTTTTCAAATCTTATTTCCCAATTATGACAATTATGAAAGGCGGTTGCGAA
    AGCGGTTTCCATCATGTTACCCCAGACAAATATGAACCGAGACTTTTACATTTCCGATGCACCGATCACAAGCATGTTGA
    ATTGGTGGAGGTGAAACTTTCAAAGCAGGCTTTGGATTCGGAAGATGTTTTAATCTTAGACAATGGCTTAGAGGTTTTCC
    AATGGAACGGAAAATTATCCAATAAAAATGAGAAATTTAAAGCCGCACAATTTTTGCAACAGTTGAAATCCGAAAGAAGC
    GGACGTGTTAAGACCGATGTTTTGGATGAGGAATTCACTGCTGCCAACCATAGAATATTTAAATTGTTGCCAGATGTTCC
    ATTTACAAAGAAAACTCAAAACGATTTAAATATGAGTAAAATGCTTTATCGATTGTCTGATGAAAGTGGAAAAATGACTT
    TCTCCTGCATTTCTGAAGGATCAATTCCAAGGTCAATGTTAAAGGATGACGATGTCTACATGATTGACAATGGCAGACAT
    TTGTTCGTGTATATTGGAGCACGGGCATCGCAGGAGGAAAAGAAGAACGCGATGTCATATGCCCACAACTACCTGAAGAC
    GACTGAGCACCCACTTATCGGAATCACATGCCTCCAATCTGGTCAACATAACAAGGAATATGATCTTCAATTAGAATAGG
    ATGTTAAATGATAATTTTGGAATATGTAATAAAAATTAACAAAGCAATTTTTTAAAAACAATAATTTCACAAAATAGGAA
    TGAAAATCACAAAAGTATTAAAATTCCATCTATGAATTGAATATCACAATTATAAATTCTTCAACACATAAATCTTGAGC
    GAAGCAATAACTTAAAGATTTCAAACATTTACCGCCGC
    >SMED30025221 ID=SMED30025221|Name=Eukaryotic initiation factor 4A-I|organism=Schmidtea mediterranea sexual|type=transcript|length=374bp
    GGAATGCATGTTGTAGTTGGAACTCCCGGAAGAGTAAAAGATATGCTAAAAAGAGGTCACATCAAATCAGAATACATCAA
    AATGTTTGTACTTGATGAAGCTGATGAAATGTTGAGTCGAGGTTTCCAGGAAGATGTCTGTGAGTGTATTACTTATCTTG
    AAGCCGACGCTCAAATGTTCATTTTATCTGCCACAATGCCCGATGAAGTTCTTACAGTAACAAAGAGATTCATGAAAGAT
    CCGGTAAAGATCTTAGTCAAGACAGAAGAATTGACTTTGGAAGGAATACGACAATTTTATGTCAATGTTAGTCAAGAAGA
    ATACAAATTTGACACTTTGACTGATCTCTATGAATCATTAACGATTACACAGGC
    >SMED30032088 ID=SMED30032088|Name=Spondin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1776bp
    TTACCTGAAAATAGATTAAATGTTAAGAGTCTCTTTACGTCAGGCTGGTTAAATGGGGAAGAACAGCTAAATGAAGAGCG
    TTCTGGATTCGTTTCTGTTAATAGAACTCATAATTTATTTAGTATGATTTCAATGATGGGACCAAGTCCGGATTGGTGTA
    CCGGAGTGTCAGGAATCGATCTTTGTATGGACGGATGCAAATGGAAATCAAATCTAACAATTCCTCTTTATCCTATCGAC
    GCTGGAATACAAACTGGAGAGACCTACAAACCAAATAATGTCACAAGACTTGATGAACCCGACACTATTAGAGAAATTAA
    TAAAATTTGGATGAAAAGTAATCCTTTTACTCCAGATACTCCAGTAGCAGAAATCACCCTCACCAGAGTAGAGCCACAGA
    AAGACACACAATGTGTTAAAACTCCAGTTAAGGGTGTAAATGAATTTCAAAATGCACAAAAAGAGTCTAGATCTAACACG
    CTCGGTAGAAATGGTGCCGTGGAAAAATATAATGTTCTAGATGATCCTCAGTTAGCTCAAATGGCAAAAGCCTTTTGTGG
    ATTTTCCGAATGGACCAGCTGGTCACCATGTTCCGTAAAATGTGGAGAAGGTGAAACGTCTCGTACTAGAAATTTGATAA
    AAAACTTGAAAAATGAATTGTGTATTCAATTGCCAAGAAAGGAGCAAAAAAATTGTGCCGGTGCTCGATTGGAATGTGAT
    CTCTCAAAGAAATGTAGTCTATTACCTTGGAGCTCATGGAGTCCGTGTTCTGCATCTTGTACAACTGAAGGGAAAATGAT
    CAGAATTAGAAAATTTGCGAGGTCAAAAGAAAAGGACGAATGCATGAAAAACGTCAAACCAGAAATTATTCTTCAACAAG
    TGAAAACTTGTAAATTGGATAAAACGGACTTCCGATGTGATCCGATATCAATTTGCAGCGCCGGTAAATTGGCACCTTGC
    ATCAATGGTAAACCCAAGACGAGATTTTTCTACCACATCAAAACTGGAAAATGCGAACCGTTTAAATACTATGATTGCAA
    AAAAGGAAATCTGAACAATTTCCCAACTATAGATTCATGTGAAAATGTTTGCTCTAAAGTTATTCAGGAATTACCAAAAA
    TAAGACGATCTAATTTAGCCTTGCTTCAAGCAAGAACATCTTATTCAGCTGAAGAGAGTCTTTCGCAAAAAGCCAAAAAC
    ATTCCGGAATTCTGCTTTCATGAAGTGGATTCCAGTAAGACCTGCATGAAATCCAAACCAAAGACAATCTGGTATTATAG
    TCATCGAAATCGAAAATGCCAATCACTGGTGGATTATGATTGTAAAGGAACTTTAAATAAGTTTTCGACTTTCGACGATT
    GCATGAAAACCTGCCGACCTGATTCACAACTCGAATCATTGAAACTTGATAAAGTAGATTGTCAGGTCTCTGAATGGAGT
    TTATGGAGGCCATGTTCAAAGTCATGCGGTTGGGGAACTCAATACAAGAAAAGAGTCATTCAAAAGGATTCATTGAATGG
    GGGCTTACCATGTCCGGTGCTATATGAATCTCGAAAATGCTTTTCCAAACCTTGTTAATCTGTCAATATTTATTTAAAAA
    TTGTTTTTTGTGAATTATAATTTCTATTTCTTAATCTATTTGAAAATGTAATAAATATTACTTTGCGTATTTGATTTAGT
    TTAAAGTTTTCTCATTGGTCAATCCGCCGTTGCTAACCAATGAGATCGGCTACTACATCAATTGCGATAATTGACAGTGG
    TGAGCAAACCTTTAAG
    >SMED30015672 ID=SMED30015672|Name=Gelsolin|organism=Schmidtea mediterranea sexual|type=transcript|length=1435bp
    TCTTGTCATTTCAGCATGCATATATCATTAGCGTAAAGATAAAAATACTAACAACTCCTAGTCAAATTGCAACCAACCGT
    AAATTGCAGACACACACGAACCAATCACATTTGCTGCCATCGGACAGCCTATGAGACAGCAGATTGGATTAATCAATAAA
    GATTTATTGTTCGGTTTTCATTGTATAAATACTGAAATCATTTGTCAATCCAATTGTTAAGTCAACCATGCAGAAAACTA
    AAAAATATGACTGGAAAGATTCCAATGTGGAATTGATTGGAAGCAGCGAGGACAGAGCTGTCAAGAAATCATCGGCTGAA
    AACGAGCCAGCTTGGAAGAAAGCTAAAGCTTGCGGCCATTCTGAATTGTTTATATGGCGAATTGAGAAATTCAAAGTTGT
    TGAATGGCCTCAAAAGCAACATGGGGAATTTTATGAAGGAGATTCTTACATTGTCTTAAATATATATCAAAGAGAAAATG
    AATTACTGTACGATGTGCATTTTTGGATTGGTAAATATTCTACCCAAGACGAGTATGGGACTGCTGCCTACAAAACTGTG
    GAATTGGACAATTTGCTCGATGACAAACCAGTTCAACATAGAGAGGTCCAACATTACGAATCGGAATTGTTCAAAAGTTA
    TTTCAAAAATCTAATATATCTGAAAGGTGGTTGCGAAAGTGGATTTAGACATGTTAAAACTGTAGAGTACACTCCGAGAT
    TATTACATGTACGAGGGGAAAAACGTAACATCATTGTTTCTGAGGTGACTGCAACTAAACATAATTTAAATTCCAATGAT
    GTGTTCATCTATGACACTGGAACTCACATTTTTGAGTGGATTGGAAAAGGTGCGAACAAAGATGAAAAGTTCAAAGGTCA
    AGAATTTGCGCAAGCGCTAAATAGTGACCGCAATGGAAAGGCTAAAGTTGAAGTTGTCGACGAGGCAAATATATCAGAAA
    ATCACGAATTCTACAAACATTTATCAGATTTACAACCCGACGAAGATGACAAATGGCAAAATAAGTTATCAGTTAAAGAT
    AAGAAACTTTTTAGAATATCTGATGCCAGTGGATCTTTGAAATTCGAAAATATTGCTATTGGAAAATTTGCAAAAAAGGA
    CATTAACGAAGATGATATTTTCATTGTTGACAACGGTTTAGAAGTATATGTTTATATTGGAGAAAACGCCAGCCCTAACG
    AAAGGCAAAATGCCTTGATTTATGCCCATAATTACCTAAAACAAACCGAATATCCCCAAGTTCCGGTGACAGTAATGAAA
    AAGGATGTCAAAGGCAAGAATGCTGAAAACTTCAATAAAGTAATTGAAGGATAAACTCTGGCAAATTTGTTTGTTATTTA
    ATTCATAATTTATTTTCAATCTAACTAGGTTTTACTTTTCAATAATAAAATATTTATGTTTGTTTTAAAAAAAAA
    >SMED30012543 ID=SMED30012543|Name=Spondin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=2035bp
    CTCCAATGAAATGTTTACTTTTATAAATGACAAGCCTATTGTAAACAATGGAATGAAGACGGCTTACAAACAATGTTGCG
    CCTGTGGAACTGCAAGTTATCGGGTGACTTTTCATGGGTTATGGAACAAAACAACTCATCCAAAAGAATGGCCAGAAGAA
    AAAGGTCAGCTTCATTGGACAGATCCTATTGGAGTCACCCATAATCATAATTACTTTATTTATCATTTGGGAGGACAAGC
    TTCATTTGCGGTTGGTAGTGTATGTACAACAGGAAATTCGAGATCTTTGAAAGAGGAATTCACCTTACCTGAAAATAGAT
    TAAATGTTAAGAGTCTCTTTACGTCAGGCTGGTTAAATGGGGAAGAACAGCTAAATGAAGAGCGTTCAGGATTCATTTCT
    GTTAATAGAACTCATAATTTATTTAGTATGATTTCAATGATGGGACCAAGTCCGGATTGGTGTACCGGAGTGTCAGGAAT
    CGATCTTTGTATGGAAGGATGCAAATGGAAATCAAATCTCACTATACCTTTGTTTCCGTTTGATGCTGGAATACAGACTG
    GGGAAACCTATAAACCTGAATCTATTACTCGGCTTGATGAACCGGAGCCTATTAAAGAAATCAGTAAAATTTGGATGAAA
    AGTAGTCCGTTTACACCGAATGTTCCTGTTGCTGAATTAATTCTGACAAGAATCTCTCCAAAGACCGACGAAAAATGTTC
    TAAATCCCCTATGAAAAATGTTGATGAATTTAATAAGTCAAATGAATTAATAAAACAAAATTATCGCGGTAAAAATAAAG
    GAATAGCAAAATATAATGTTCTTGATGACCCCCAGCTGGCTCAGATGGCAAAAGCTTTTTGTGGATTTTCTCAATGGGCT
    AGCTGGTCTCGGTGTTCAGTGGATTGTGGAGTTGGGGAATCTTCTCGTAAGCGAGAGTTGATCAAGAATTTTAAAAATGA
    ATTATGTGTCCAGCTGCCAAGGAAAGAAACCAGATATTGCTATGGTCGACGAAGAAATTGTGATTTTTCTATGAAATGTA
    GTCTTCTTCCGTGGACTGAATGGACTAAATGTACTGCTACTTGTAAAGAAGCAGGAAAGATAGCAAGATCGAGAAGATTC
    GTGAGGGAGGCGGAACGAGAAGAATGTTTGAGAGAAGTGACACCAACTACTAGACTATATGAGGAAAAGCCATGTAAACT
    CGATCAAACTGACAGCCGCTGTGATCCAGTGTCAATTTGCAGTGCTGGAAAATTGCCTCCTTGTACTAGAGGTAAACGTC
    AAACAAGATATTTCTATCACGTCAAGACTGGAAAATGTGAACCGTTTTTTTATTTTAATTTTTGCCAGATTGGCCTAAAC
    AACTTTCGCACTGAGGTAGACTGTGAGAAAATGTGCGTTAAAGCCATTGGTCAGCTGCCTGGAATTAAAAGATCAAATTT
    AGCTCTTTTGCAGTTTCGAACTTCTTATTCAGGAGACCTTTCTCAAAAAGAAACTAAAATACCAGCTCAATGTTTCAACG
    AAATAGAATCAGTAAAGACATGTATTCATAAATCTCCAAGAACCGTATGGTACTACAGTCACCGAAACCAGAAATGTCGT
    TCTTTGGTGGATTTCGGTTGTCAGGGAAGTTTGAATAAGTTTTCTTCTTTTGAACAATGCATGAAGATTTGTCGACCTAA
    TTTACAGAGTCGTTCTTCAACATCTGATAAAGTAGACTGCCAGGTCTCTAATTGGAGTTCCTGGAGGCCTTGCTCTAAAA
    GCTGTGGCAAAGGAACACAGATCAGAAAGCGAATAATTTATAAAGATTCTCTTAATGGTGGAGAACCTTGTCCACTTCTT
    TACGATTCTAGAGATTGTTACGGTATATCTTGCAATTAGAGATAGCCATAACTATTTTAGTTTATAAAAGCATTCATCCA
    GGCCACAGTTGAAAAGCATTTTAATTATTAATAAATTTTAGAATTGTTAATTTTAGTATTTTAGTATATTTTTGCTGTAT
    TTAGTGCAAAAAAAAAAGACGGGTATAAAAAGGTG

     

    back to top


    ADDITIONAL REFERENCES:


    Hallez, P. (1887). Embryogénie des Dendrocoeles d’eau douce, Vol 16.

    Ijima, I. (1884). Untersuchungeniiber den Bau und die Entwicklungsgeschichte der stisswasser-Dendrocoelen(Tricladen). Vol Bd. 40.

    Le Moigne, A. (1963). Etude du developpement embryonnaire de Polycelis nigra (Turbellarie - Triclade). Bulletin de la Societe Zoologique de France 88, 403-422.

    Metschnikoff, E. (1883). Die embryologie von Planaria polychroa. Zeitschrift fur wissenschaftliche Zoologie 38, 331-354.

     

    back to top