Category 2 cell

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ In Situ Hybridization Data

  ▻ Sequences

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  Category 2 cell


DEFINITON:

  Post-mitotic, mesenchymally located epidermal progenitors downstream of the zeta neoblasts.


TERM DEFINITION CITATIONS:

  PMID:20040488, PMID:22385657, PMID:25017721, PMID:18786419, PMID:26114597


TERM CITATIONS:


TERM ID:

  PLANA:0000028


ABOUT THIS TERM:

Category 2 cell

  ↳is a epidermal progenitor cell, material entity and somatic cell

  ↳contained in tail, copulatory region, ventral region of the whole animal, posterior region of the whole animal, parapharyngeal region, prepharyngeal region, head, dorsal region of the whole animal and anterior region of the whole animal

  ↳develops from zeta neoblast

  ↳existence overlaps Stage 6, juvenile, Stage 5, asexual adult, adult hermaphrodite, Stage 8 and Stage 7

  ↳existence starts during or after Stage 5

  ↳part of integumental system


  → Category 3 cell develops from Category 2 cell



BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30035904AFP81697.1PROG-1prog-1, NB.21.11eStage 5, Stage 6, Stage 7, Stage 8integumental system, Category 2 cell
SMED30026364ACN51391.1SMED-P53p53Stage 5, Stage 6, Stage 7, Stage 8zeta neoblast, integumental system, Category 2 cell
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30026364 ID=SMED30026364|Name=SMED-P53|organism=Schmidtea mediterranea sexual|type=transcript|length=2047bp
CTCATGACAGTTTTATTAAAGTTACTATTATTAGGAATTCTGCGCGTTAAACTAGACATTATCGATGGCCCAGCAATATA
TTACTTCGGCTTTCGATCCAAACTTCACAACGTTACAGCATCAGACTTCAATACATTATAAATCCTCTCCAATTGAAATG
ATTGTTCCGATGCAATGCAACCAAAACCAAGCCACCTTATCTATAACCCCTGTTCATATTTCTCCATTTGTTAATATATC
AGATTCTAATAATCACAATTTGACGAATATCGTCGAGCCTGTTTCATCAAATACTATGTCTCCTGCTTTTAAATCCGACG
ACATGCCAACATTGTCTTCTTATCCAGGTCCGTATAATTTTCAAATCTTTATTCCCAACGGAGAATTTGATGAATCCAAA
AGAAAAGGACAGACATGTGTGTTTCAAACCGATAAAATGGGAAATCACCAATTATTTACCAAACCTCATCCTCATTATTG
GAGGTTAAATTATTCAGCTGATCCTTCTATGTCAACGGAAAACATGTATATTCGGATGGTTCCAGTTTTTGGGGATCCAG
AAAAAGCTCAATGCATTTTGGAAAGATGTGCAAAACACAAAGAAGTAACAACAGATGAAAATCACTGGAAATATCGTAGC
ATGCTCATTGTAGAAAAAACCTGTGCACATTACTTTCAGGATTCGGCAACGAAAAGAGTTTGCATTTTATTACCGTTTGA
AAAGCATGCGGAAGGAGAGATTTATTCTTCCGTCAACTGTCAATTTGCATGCTACAACAGTTGCTTTAATCAAGATTCAG
GTGGTCGGAAAACACTTTATTTAATCATCACTCTAGAATTTCTCGATAAAAAAACAAATAAATTCGATGTATGGGGTCGA
CAGTGTTTGCAATTTCGCAGTTGTGCTTGTCCAAGTAGAGACTGGAGAGATAAAAAGATTAAAGGCGATCCAGAAATGTT
ACTGAAATTCAAAGAAAAACGAATCAAAACCGAAGAAAAATTAAATAATTTGGTGATTTCTAAAAGCGTCCCTATTAATA
TGGGTGGAAAGGATGCTATCATAAGAGTTCTTCCCTCGTTGCCAGGACTCGATGACGCTATTAACGCATTAGTTTGCGGA
TACTTACTGAATCGAACAACCAACATAAGCGCAATAATAGCAGCATTTAATCAGATGAAAGACGTAGAACATTTAATTAT
CGATCAATTCACATCAAATTTAGATCAAAATACATGTGACAGTAAAAGTCCTTCACAAACTCCAGAGTCTCAGATTTCTC
CGAATACATCAAACCTTCAATTCAACGATTACGGTTCACTTTACGGTGAACCATGTCAACCCTATAGACCGATGCACCAG
CAAGTTGTTAATAATTTTTCCTCTCCAGGAATTTTCAGTAAAATACCTTTTGAAACTTATCCGGTTAGTTATGACATTAA
ACTTTCACATGAAATGCCGCAGCACTTTGATGAGCTGCCATCAGACAACTATAATAGACACTGAAAAATTGCGTCCTTCC
ACGTTTAAAATTGTATAAAAAATAATATGCTTGATTTTTATTTTTGCATTTGTTTTATTTTTTAATGTTGAAAATATTTA
CGTTTGTATTATTTTTTTTTGATTAGTAGTAGTAATGCTGCTTTCAAATTTTATTGAACTTTGATCAGTGATTTTTAATA
TTCAATGACCTGAATTTTTCATGCGTCTTGATGAGGGTTTGAGTGAAAAAATTATCAATTTCTTCACTTTGTCATGTGTG
CTATGTGCATTTATTGATGTATATAACAATATATGTGTAGATAAATTTTATTTTTGTATCCGATTTAGGTTTGCAGGCAC
GATGATGAGTGGTTTTTATTTTGTAAAAATTTTTCGAGATAACATGTGCTCAAATATCAATATTATATATGGTAACATAT
TTTTGCAATAAAAATGCATTTATTGTCAATTTGGCTATAAATTAAGTATCGTACGAATCAAGCAATATTTTATCATTGCT
GTCAATATTTTGTTGATAATTTTTTATTTGCTTTGTTAATAAAGAGC
>SMED30035904 ID=SMED30035904|Name=PROG-1|organism=Schmidtea mediterranea sexual|type=transcript|length=728bp
GCAATATTTTGTCATGAATGTTTAATTGAAAAATATGAAAGTTTTAATTATATTTCTATTTGTGATTGCGTTCGCGTATA
TTGAATGCCGTCCTCAACATCTATTGGGGTTCATGAGGAAAGAAAAGTCCAAGCTAGAAAAAGACTCAGCAGATGACGTG
AAACAAGGAAAAGATTCGGATAAAAGCTCTGATAAATATTCACATGAAGGATCTAATAAAGAGTCTGACAAAGAGACAGA
TAAAGAAGAAGAAACTAATTCTAAGACTTCTGCAAAGTCTCCCGCCAAATCAAGTAGACGAAAGAAACAAGTGGAAAAAT
TGGAAGAAGAGGAAGGAGAAACTTTAAAAGAGAAATTAAAAGGACACATTACGAAAGCAGATTGCATGAAATTATACGAA
GAAACTGATAAATACTGCGATCCACTTTATTTGAAGCTCGACAAAGATTGCGACTGCAGATATGTGAAAGCATTGAATGA
CTACACGAAAAGATGGGACAGTTATCATTCCAAATGTGGTAGCAAATATGACAAAAAATGCCGAACCGAATTGCGAGCTT
TGGAGAATTGGTTTAATGGCCTTTATGATTCAATCGACGGCCACTGTGACGCAGAATATGACGCGCTGGATAAATATTGT
GACGTAGAATACAACAAAGTTGATCAATGTGAAAAAGGACAGAAAGTGTAATAAAATTGATTTGTAATAAAATTTATTAA
ATAAAAAA

 

back to top





PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in Category 2 cell. Click this link to learn more about PAGE.


PAGE Curations: 291


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
Category 2 cellSMED30019573Retrovirus Pol polyprotein from transposon opusSMESG000024333.1 dd_Smed_v4_8812_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30019060Neutral sphingomyelinaseSMESG000012166.1 dd_Smed_v4_8717_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30019130Junctophilin-1SMESG000001306.1 dd_Smed_v4_4752_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30019541SMED30019541SMESG000025545.1 dd_Smed_v4_651_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30025889Mucolipin-3 like proteinSMESG000015162.1 dd_Smed_v4_3616_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED3002169814-3-3 protein epsilonSMESG000047644.1 dd_Smed_v6_36_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30025164Protein NDRG4SMESG000065324.1 dd_Smed_v4_2911_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30021606Polysacc_synt_4 domain-containing proteinSMESG000051316.1 dd_Smed_v4_3346_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30020396SMED30020396SMESG000046779.1 SMESG000024881.1 dd_Smed_v4_478_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30020396SMED30020396SMESG000046779.1 SMESG000024881.1 dd_Smed_v6_478_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30020396SMED30020396SMESG000046779.1 SMESG000024881.1 SmedASXL_013664SmedAsxl_ww_GCZZ01PMID:26114597
Category 2 cellSMED30024860SMED30024860SMESG000001317.1 dd_Smed_v6_520_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30020015ABC transporter domain-containing proteinSMESG000015153.1 dd_Smed_v4_4142_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30021920Potassium channel subfamily K memberSMESG000074840.1 dd_Smed_v4_9028_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30023605Cathepsin L2SMESG000049716.1 dd_Smed_v4_582_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30024309Isocitrate dehydrogenase [NADP]SMESG000049154.1 dd_Smed_v6_449_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30022769Glycine receptor subunit alpha-3SMESG000061905.1 dd_Smed_v4_8110_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30022586SMED30022586SMESG000035473.1 dd_Smed_v4_23389_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30020996ADP-ribosylation factor GTPase-activating protein 2SMESG000008345.1 dd_Smed_v6_539_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30012643Eukaryotic translation initiation factor 3 subunit ASMESG000076681.1 SMESG000076677.1 dd_Smed_v6_804_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30014876SMED30014876SMESG000054780.1 SMESG000025014.1 SMESG000025004.1 dd_Smed_v4_61_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30014876SMED30014876SMESG000054780.1 SMESG000025014.1 SMESG000025004.1 dd_Smed_v6_61_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30017639SMED30017639SMESG000035327.1 SMESG000035325.1 dd_Smed_v4_8_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30018709solute carrier family 52, riboflavin transporter, member 3SMESG000040831.1 dd_Smed_v4_5546_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30014866Low density lipoprotein-receptor, class A,domain-containing proteinSMESG000033681.1 dd_Smed_v4_5576_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30009302SMED30009302SMESG000025000.1 dd_Smed_v4_363_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30009302SMED30009302SMESG000025000.1 SmedASXL_008106SmedAsxl_ww_GCZZ01PMID:26114597
Category 2 cellSMED30009302SMED30009302SMESG000025000.1 dd_Smed_v6_363_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30011506SH2 domain-containing proteinSMESG000006496.1 dd_Smed_v4_7305_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30013494SMED30013494SMESG000045973.1 dd_Smed_v4_49796_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30009269Collagen alpha-6(VI) chainSMESG000024982.1 dd_Smed_v4_2803_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30012725Arf-GAP with dual PH domain-containing 1 isoform X2SMESG000016864.1 dd_Smed_v4_5945_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30016314SMED30016314SMESG000011577.1 dd_Smed_v4_7855_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30012826SMED30012826SMESG000017012.1 SMESG000017011.1 dd_Smed_v6_309_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30009745Flotillin-2SMESG000017953.1 SMESG000017954.1 dd_Smed_v4_6436_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30013768SMED30013768SMESG000056915.1 dd_Smed_v4_3761_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30017934TPA_inf: neuropeptide precursor-4SMESG000036661.1 dd_Smed_v4_4417_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30011602Kinesin-like proteinSMESG000004399.1 dd_Smed_v4_50623_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30017664Anosmin-1SMESG000069895.1 dd_Smed_v4_6746_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30014654Low density lipoprotein-receptor, class A,domain-containing proteinSMESG000021406.1 dd_Smed_v4_2598_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30017300SMED30017300SMESG000001317.1 dd_Smed_v6_520_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30012850Spondin-1SMESG000009946.1 dd_Smed_v4_2400_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30001667SMED30001667SMESG000003539.1 SMESG000057219.1 dd_Smed_v4_8541_1_1dd_Smed_v4PMID:28292427
Category 2 cellSMED3000170160S ribosomal protein L7aSMESG000020535.1 dd_Smed_v6_296_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30006119X-box-binding protein 1SMESG000048111.1 dd_Smed_v6_415_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30000562Acyl-CoA synthetase short chain family member 3SMESG000043630.1 dd_Smed_v4_2832_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30002598Histone-lysine N-methyltransferaseSMESG000039926.1 dd_Smed_v4_99_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30005670RapunzelSMESG000052592.1 dd_Smed_v4_279_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30003343Peptidyl-prolyl cis-trans isomeraseSMESG000038766.1 dd_Smed_v6_686_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30004705SMED30004705SMESG000001306.1 dd_Smed_v4_4752_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30008921SMED30008921SMESG000006132.1 SMESG000006122.1 dd_Smed_v4_3549_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30008921SMED30008921SMESG000006132.1 SMESG000006122.1 dd_Smed_v6_3549_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30000378SMED30000378SMESG000061591.1 dd_Smed_v4_512_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30003482Endoplasmic reticulum chaperone BiPSMESG000061528.1 dd_Smed_v6_2648_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30008007Discoidin domain-containing receptor 2SMESG000066441.1 dd_Smed_v4_6578_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30005837SMED30005837SMESG000016663.1 dd_Smed_v4_229_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30002983Tropomyosin-2SMESG000000190.1 dd_Smed_v4_436_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30005231Polyadenylate-binding proteinSMESG000058745.1 dd_Smed_v6_93_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30003577Enhancer of yellow 2 transcription factorSMESG000004606.1 SMESG000004604.1 dd_Smed_v6_928_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30028321SMED30028321SMESG000002889.1 dd_Smed_v4_17406_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30025363SMED30025363SMESG000014711.1 dd_Smed_v4_1754_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30028311Spectrin beta chainSMESG000066485.1 dd_Smed_v4_12996_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30033694SMED30033694SMESG000049916.1 dd_Smed_v4_8376_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30026844Protein MAK16 homologSMESG000060104.1 dd_Smed_v6_1416_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30031990SMED30031990SMESG000025001.1 dd_Smed_v4_213_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30031990SMED30031990SMESG000025001.1 dd_Smed_v6_213_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30031990SMED30031990 dd_Smed_v4_40742_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30017516Collagen alpha-2(IV) chainSMESG000021729.1 dd_Smed_v4_2197_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30017164InnexinSMESG000031896.1 SMESG000031895.1 dd_Smed_v4_15239_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30017206Band 4.1 protein 2SMESG000062476.1 dd_Smed_v6_2032_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30019834Guanine nucleotide-binding protein subunit beta-2-like 1SMESG000076568.1 dd_Smed_v6_174_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30001004InnexinSMESG000031896.1 SMESG000031895.1 dd_Smed_v4_15239_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30004881Discoidin domain-containing receptorSMESG000016549.1 dd_Smed_v4_12157_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30015739Aldo-keto reductaseSMESG000081151.1 dd_Smed_v6_1044_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30014286Multidrug resistance-associated protein 1SMESG000074229.1 SMESG000074226.1 dd_Smed_v4_13596_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30000989SMED30000989SMESG000038344.1 dd_Smed_v4_20486_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30008778SMED30008778SMESG000004626.1 dd_Smed_v4_13872_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30007084TNF receptor-associated factorSMESG000053469.1 dd_Smed_v4_13061_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30004886Hsp70-Hsp90 organizing protein 1SMESG000033618.1 dd_Smed_v4_14717_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30015373SMED30015373SMESG000000625.1 dd_Smed_v6_1629_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30008553Phosphoenolpyruvate carboxykinase [GTP]SMESG000062868.1 dd_Smed_v6_196_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30022078Translationally-controlled tumor protein homologSMESG000023212.1 dd_Smed_v6_136_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30022312COesterase domain-containing proteinSMESG000064723.1 dd_Smed_v4_18958_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30022628G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000060403.1 SMED30022628smed_20140614PMID:29100657
Category 2 cellSMED30022628G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000060403.1 dd_Smed_v6_361_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30023100InnexinSMESG000031896.1 SMESG000031895.1 dd_Smed_v4_15239_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30032499C2H2-type domain-containing proteinSMESG000075452.1 SMED30032499smed_20140614PMID:29100657
Category 2 cellSMED30012332EGR-1SMESG000034285.1 SMED30012332smed_20140614PMID:29100657
Category 2 cellSMED30012332EGR-1SMESG000034285.1 SmedASXL_008042SmedAsxl_ww_GCZZ01PMID:26114597
Category 2 cellSMED30012332EGR-1SMESG000034285.1 dd_Smed_v6_3935_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30000303HoxC12-like proteinSMESG000022668.1 SMED30000303smed_20140614PMID:29100657
Category 2 cellSMED30019046SD2SMESG000021468.1 SMED30019046smed_20140614PMID:29100657
Category 2 cellSMED30008505SOXP-3SMESG000051170.1 SMED30008505smed_20140614PMID:29100657
Category 2 cellSMED30008505SOXP-3SMESG000051170.1 dd_Smed_v4_5942_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30008505SOXP-3SMESG000051170.1 SmedASXL_004704SmedAsxl_ww_GCZZ01PMID:26114597
Category 2 cellSMED30008505SOXP-3SMESG000051170.1 dd_Smed_v6_5942_0dd_Smed_v6PMID:29674432
Category 2 cellSMED3002552260 kDa heat shock protein, mitochondrialSMESG000065325.1 dd_Smed_v6_141_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30035904PROG-1SMESG000024882.1 SMESG000024707.1 dd_Smed_v4_332_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30035904PROG-1SMESG000024882.1 SMESG000024707.1 JX122762.1smed_ncbi_20200123PMID:23318635
Category 2 cellSMED30035904PROG-1SMESG000024882.1 SMESG000024707.1 JX122762.1smed_ncbi_20200123PMID:18786419
Category 2 cellSMED30035904PROG-1SMESG000024882.1 SMESG000024707.1 JX122762.1smed_ncbi_20200123PMID:18786419
Category 2 cellSMED30035904PROG-1SMESG000024882.1 SMESG000024707.1 JX122762.1smed_ncbi_20200123PMID:28072387
Category 2 cellSMED30035904PROG-1SMESG000024882.1 SMESG000024707.1 JX122762.1smed_ncbi_20200123PMID:28072387
Category 2 cellSMED30035904PROG-1SMESG000024882.1 SMESG000024707.1 JX122762.1smed_ncbi_20200123PMID:24415944
Category 2 cellSMED30035904PROG-1SMESG000024882.1 SMESG000024707.1 JX122762.1smed_ncbi_20200123PMID:28072387
Category 2 cellSMED30035904PROG-1SMESG000024882.1 SMESG000024707.1 JX122762.1smed_ncbi_20200123PMID:28072387
Category 2 cellSMED30035904PROG-1SMESG000024882.1 SMESG000024707.1 JX122762.1smed_ncbi_20200123PMID:26114597
Category 2 cellSMED30035904PROG-1SMESG000024882.1 SMESG000024707.1 JX122762.1smed_ncbi_20200123PMID:24523458
Category 2 cellSMED30035904PROG-1SMESG000024882.1 SMESG000024707.1 AFP81697.1smed_ncbi_20200123PMID:28072387
Category 2 cellSMED30035904PROG-1SMESG000024882.1 SMESG000024707.1 AFP81697.1smed_ncbi_20200123PMID:28072387
Category 2 cellSMED30035904PROG-1SMESG000024882.1 SMESG000024707.1 AFP81697.1smed_ncbi_20200123PMID:28072387
Category 2 cellSMED30035904PROG-1SMESG000024882.1 SMESG000024707.1 AFP81697.1smed_ncbi_20200123PMID:28072387
Category 2 cellSMED30035904PROG-1SMESG000024882.1 SMESG000024707.1 SMED30035904smed_20140614PMID:28072387
Category 2 cellSMED30035904PROG-1SMESG000024882.1 SMESG000024707.1 SMED30035904smed_20140614PMID:28072387
Category 2 cellSMED30035904PROG-1SMESG000024882.1 SMESG000024707.1 SMED30035904smed_20140614PMID:28072387
Category 2 cellSMED30035904PROG-1SMESG000024882.1 SMESG000024707.1 SMED30035904smed_20140614PMID:28072387
Category 2 cellSMED30035904PROG-1SMESG000024882.1 SMESG000024707.1 dd_Smed_v6_332_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30034201Delta-like proteinSMESG000036778.1 dd_Smed_v4_15985_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30029873SMED30029873SMESG000042500.1 SMED30029873smed_20140614PMID:29100657
Category 2 cellSMED30032645Heterochromatin protein 1-1SMESG000004606.1 SMESG000004604.1 dd_Smed_v6_928_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30022325SMED30022325SMESG000022410.1 SMESG000022409.1 dd_Smed_v6_1683_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30009224early growth response-3SMESG000000959.1 dd_Smed_v6_14711_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30009224early growth response-3SMESG000000959.1 dd_Smed_v6_12410_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30016718SMED30016718SMESG000063591.1 SMESG000063590.1 SMESG000063568.1 dd_Smed_v4_8628_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30013735Elongation factor 1-alphaSMESG000061164.1 SMESG000061099.1 dd_Smed_v6_30_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30003044ReticulocalbinSMESG000077405.1 dd_Smed_v6_5905_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30009893RNA-binding proteinSMESG000006741.1 dd_Smed_v4_11008_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30009457reticulocalbin-1SMESG000034805.1 dd_Smed_v6_493_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30015672Gelsolin-like proteinSMESG000015928.1 dd_Smed_v6_1215_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30013312CalpainSMESG000062904.1 SMESG000062902.1 dd_Smed_v6_1971_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30016196SMED30016196SMESG000059283.1 dd_Smed_v6_62_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30013893Histocompatibility (minor) 13SMESG000016697.1 dd_Smed_v6_1203_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30005014ATP synthase subunit alphaSMESG000004897.1 dd_Smed_v6_731_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30017114Elongation factor 1-gammaSMESG000018714.1 dd_Smed_v6_308_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30010051Smed-notumSMESG000004222.1 dd_Smed_v4_24180_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30014525Dolichyl-diphosphooligosaccharide--protein glycosyltransferase 48 kDa subunitSMESG000010589.1 dd_Smed_v6_948_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30006464TCF15SMESG000044395.1 SMED30006464smed_20140614PMID:29100657
Category 2 cellSMED30007322Synaptic vesicle 2-related proteinSMESG000000254.1 dd_Smed_v4_12102_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30005345SMED30005345SMESG000059907.1 dd_Smed_v6_125_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30015942Threonine--tRNA ligase, cytoplasmicSMESG000061707.1 dd_Smed_v6_1476_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30017430Protein disulfide-isomeraseSMESG000023147.1 SMESG000017020.1 dd_Smed_v6_250_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30004267Actin, cytoplasmicSMESG000035518.1 dd_Smed_v6_232_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30006136protein disulfide-isomerase A5-likeSMESG000077361.1 dd_Smed_v4_821_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30012544TetraspaninSMESG000078683.1 dd_Smed_v4_1003_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30005038AP complex subunit sigmaSMESG000019676.1 dd_Smed_v4_9393_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30018637Heat shock cognate 70 kDa proteinSMESG000040632.1 dd_Smed_v6_15_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30011419SMED30011419SMESG000025002.1 dd_Smed_v6_183_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30009513Glycine amidinotransferase, mitochondrialSMESG000051953.1 dd_Smed_v6_899_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30014813Y box protein-1SMESG000058043.1 SMESG000058013.1 dd_Smed_v6_35_0dd_Smed_v6PMID:29674432
Category 2 cellSMED3001198260S ribosomal protein L17SMESG000009564.1 dd_Smed_v6_95_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30000938Homeobox domain-containing proteinSMESG000060967.1 SMED30000938smed_20140614PMID:29100657
Category 2 cellSMED3001160940S ribosomal protein S3SMESG000016955.1 dd_Smed_v6_269_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30010878six3-1SMESG000009894.1 SMED30010878smed_20140614PMID:29100657
Category 2 cellSMED30006011T box transcription factor tbx2SMESG000023378.1 SMED30006011smed_20140614PMID:29100657
Category 2 cellSMED30002242Nucleobindin 2SMESG000016720.1 dd_Smed_v6_6912_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30002242Nucleobindin 2SMESG000016720.1 dd_Smed_v4_6912_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30000955tRNA (Uracil-5-)-methyltransferase homolog ASMESG000008614.1 dd_Smed_v4_11602_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30011923SMED30011923SMESG000009894.1 SMED30010878smed_20140614PMID:29100657
Category 2 cellSMED30012869Y-box-binding protein 1SMESG000032189.1 dd_Smed_v6_114_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30001172Elongation factor 1-betaSMESG000026862.1 dd_Smed_v6_206_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30004532Y box protein-1SMESG000058043.1 SMESG000058013.1 dd_Smed_v6_35_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30013168CalpainSMESG000062904.1 SMESG000062902.1 dd_Smed_v6_1971_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30000485SMED30000485SMESG000069311.1 SMED30000485smed_20140614PMID:29100657
Category 2 cellSMED30002454Staphylococcal nuclease domain-containing proteinSMESG000062403.1 dd_Smed_v6_906_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30015362SMED30015362SMESG000043289.1 dd_Smed_v4_80_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30007742Protein transport protein Sec61 subunit alphaSMESG000003007.1 dd_Smed_v6_282_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30018353Glycine amidinotransferase, mitochondrialSMESG000051964.1 dd_Smed_v6_920_0dd_Smed_v6PMID:29674432
Category 2 cellSMED3001360660S ribosomal protein L7SMESG000022296.1 dd_Smed_v6_276_0dd_Smed_v6PMID:29674432
Category 2 cellSMED3000270360S ribosomal protein L23aSMESG000074545.1 dd_Smed_v6_281_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30001367ADP-ribosylation factor 1SMESG000067743.1 dd_Smed_v6_203_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30010637Nucleolar RNA helicase II/Gu proteinSMESG000065959.1 dd_Smed_v6_283_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30001546Y box protein-1SMESG000058043.1 SMESG000058013.1 dd_Smed_v6_35_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30002537Y box protein-1SMESG000058043.1 SMESG000058013.1 dd_Smed_v6_35_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30006353SMED30006353SMESG000004009.1 SMED30006353smed_20140614PMID:29100657
Category 2 cellSMED30000428Glutathione S-transferaseSMESG000016836.1 dd_Smed_v6_816_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30002134SMED30002134SMESG000024991.1 SMESG000054781.1 SMESG000025013.1 SMESG000025003.1 dd_Smed_v6_69_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30002134SMED30002134SMESG000054781.1 SMESG000025013.1 SMESG000025003.1 SMED30002134smed_20140614PMID:26114597
Category 2 cellSMED30002134SMED30002134SMESG000054781.1 SMESG000025013.1 SMESG000025003.1 NB.32.1gncbi_smed_estsPMID:18786419
Category 2 cellSMED30002134SMED30002134SMESG000054781.1 SMESG000025013.1 SMESG000025003.1 NB.32.1gncbi_smed_estsPMID:18786419
Category 2 cellSMED30002134SMED30002134SMESG000054781.1 SMESG000025013.1 SMESG000025003.1 NB.32.1gncbi_smed_estsPMID:24704339
Category 2 cellSMED30002134SMED30002134SMESG000054781.1 SMESG000025013.1 SMESG000025003.1 dd_Smed_v4_69_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30005737Death-associated protein kinase 1SMESG000048879.1 dd_Smed_v4_9475_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30023223Glutamate receptor ionotropicSMESG000005067.1 dd_Smed_v4_11004_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30021635Succinate dehydrogenase [ubiquinone] flavoprotein subunit, mitochondrialSMESG000008280.1 dd_Smed_v6_897_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30027460Troponin iSMESG000002071.1 dd_Smed_v4_323_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30020792SMED30020792SMESG000016092.1 SMED30020792smed_20140614PMID:27523733
Category 2 cellSMED30028141SMED30028141SMESG000013493.1 dd_Smed_v4_9600_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30021036Homeobox domain-containing proteinSMESG000054107.1 SMED30021036smed_20140614PMID:29100657
Category 2 cellSMED30029293SMED30029293SMESG000064498.1 dd_Smed_v4_5527_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30031538Chitobiosyldiphosphodolichol beta-mannosyltransferaseSMESG000070652.1 dd_Smed_v4_2340_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30023308SMED30023308SMESG000063568.1 dd_Smed_v6_762_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30034629Golgi-associated plant pathogenesis-related protein 1SMESG000063568.1 dd_Smed_v6_762_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30029716GYF domain-containing proteinSMESG000052533.1 dd_Smed_v6_3448_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30035571Protein disulfide-isomerase A5SMESG000005268.1 dd_Smed_v6_1537_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30028641Sorting nexin 22SMESG000034870.1 SMESG000034864.1 SMESG000024585.1 SMESG000017900.1 SMESG000006895.1 SMESG000035129.1 dd_Smed_v4_4469_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30022331Translocon-associated protein, gamma subunitSMESG000066628.1 dd_Smed_v6_1265_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30031235Tubulin alpha chainSMESG000017700.1 dd_Smed_v6_648_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30022030EGR-like protein 1SMESG000000959.1 dd_Smed_v6_12410_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30020948SMED30020948SMESG000024857.1 dd_Smed_v6_409_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30021590Spectrin beta chainSMESG000081696.1 dd_Smed_v6_1122_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30023969LIM domain only protein 3SMESG000037556.1 SMED30023969smed_20140614PMID:29100657
Category 2 cellSMED30022992Myosin heavy chainSMESG000062420.1 dd_Smed_v6_791_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30033839Sp5SMESG000023227.1 SMED30033839smed_20140614PMID:29100657
Category 2 cellSMED30026114SMED30026114SMESG000006121.1 SMESG000006132.1 dd_Smed_v4_3665_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30026114SMED30026114SMESG000006121.1 SMESG000006132.1 dd_Smed_v6_3665_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30026364SMED-P53SMESG000078256.1 AY068713.3smed_ncbi_20200123PMID:20040488
Category 2 cellSMED30026364SMED-P53SMESG000078256.1 AY068713.3smed_ncbi_20200123PMID:28072387
Category 2 cellSMED30026364SMED-P53SMESG000078256.1 AY068713.3smed_ncbi_20200123PMID:28072387
Category 2 cellSMED30026364SMED-P53SMESG000078256.1 AY068713.3smed_ncbi_20200123PMID:28072387
Category 2 cellSMED30026364SMED-P53SMESG000078256.1 AY068713.3smed_ncbi_20200123PMID:28072387
Category 2 cellSMED30026364SMED-P53SMESG000078256.1 ACN51391.1smed_ncbi_20200123PMID:28072387
Category 2 cellSMED30026364SMED-P53SMESG000078256.1 ACN51391.1smed_ncbi_20200123PMID:28072387
Category 2 cellSMED30026364SMED-P53SMESG000078256.1 ACN51391.1smed_ncbi_20200123PMID:28072387
Category 2 cellSMED30026364SMED-P53SMESG000078256.1 ACN51391.1smed_ncbi_20200123PMID:28072387
Category 2 cellSMED30026364SMED-P53SMESG000078256.1 SMESG000078255.1 SMED30026364smed_20140614PMID:28072387
Category 2 cellSMED30026364SMED-P53SMESG000078256.1 SMESG000078255.1 SMED30026364smed_20140614PMID:28072387
Category 2 cellSMED30026364SMED-P53SMESG000078256.1 SMESG000078255.1 SMED30026364smed_20140614PMID:28072387
Category 2 cellSMED30026364SMED-P53SMESG000078256.1 SMESG000078255.1 SMED30026364smed_20140614PMID:28072387
Category 2 cellSMED30026364SMED-P53SMESG000078256.1 SMESG000078255.1 SMED30026364smed_20140614PMID:29100657
Category 2 cellSMED30026364SMED-P53SMESG000078256.1 SMESG000078255.1 dd_Smed_v6_5563_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30027218DNA-directed RNA polymerase subunit betaSMESG000032705.1 SmedASXL_006583SmedAsxl_ww_GCZZ01PMID:26114597
Category 2 cellSMED30025741SMED30025741SMESG000024991.1 SMESG000054781.1 SMESG000025013.1 SMESG000025003.1 dd_Smed_v6_69_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30025741SMED30025741SMESG000054781.1 SMESG000025013.1 SMESG000025003.1 SMED30002134smed_20140614PMID:26114597
Category 2 cellSMED30025741SMED30025741SMESG000054781.1 SMESG000025013.1 SMESG000025003.1 dd_Smed_v4_69_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30032389slc24a-1SMESG000010390.1 dd_Smed_v4_5868_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30025910Microtubule-associated protein futschSMESG000025422.1 SMESG000044270.1 SMESG000030021.1 dd_Smed_v6_1999_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30031764ADF-H domain-containing proteinSMESG000022423.1 dd_Smed_v4_112_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30026513SMED30026513SMESG000005268.1 dd_Smed_v6_1537_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30035924SMED30035924SMESG000043662.1 dd_Smed_v4_11896_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30031061Nucleobindin-2SMESG000017142.1 dd_Smed_v6_6010_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30029555Serine/arginine-rich splicing factor 4SMESG000045501.1 dd_Smed_v6_473_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30023930slit1SMESG000068721.1 dd_Smed_v4_12111_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30026763SMED30026763SMESG000025004.1 dd_Smed_v4_11575_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30023708ZFP-1SMESG000066384.1 SMED30023708smed_20140614PMID:29100657
Category 2 cellSMED30034254calreticulin-1SMESG000077304.1 SMESG000009012.1 dd_Smed_v6_220_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30033302RNA-binding protein MEX3BSMESG000025422.1 SMESG000044270.1 SMESG000030021.1 dd_Smed_v6_1999_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30031823Translocating chain-associated membrane proteinSMESG000051052.1 dd_Smed_v6_1740_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30035736SMED30035736SMESG000025545.1 dd_Smed_v4_651_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30035648X1.C.A4.1SMESG000028445.1 dd_Smed_v4_3815_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30028808calreticulin-2SMESG000077304.1 SMESG000009012.1 dd_Smed_v6_220_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30028938Protein disulfide-isomerase A6SMESG000023147.1 SMESG000017020.1 dd_Smed_v6_250_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30022344FERM domain containing-1SMESG000070273.1 dd_Smed_v6_1131_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30023672E3 ubiquitin-protein ligase TRIM9SMESG000032020.1 dd_Smed_v4_12595_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30027707S-adenosylmethionine synthaseSMESG000027587.1 dd_Smed_v6_1580_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30028417Bardet-Biedl syndrome 1 protein homologSMESG000009880.1 dd_Smed_v4_7298_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30015635SMED30015635SMESG000074058.1 dd_Smed_v4_12328_1_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30007676Peroxisomal biogenesis factor 2 dd_Smed_v4_11478_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30003313SMED30003313 dd_Smed_v6_616_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30004937Elongation factor 2SMESG000042430.1 dd_Smed_v6_186_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30005911SMED30005911 dd_Smed_v4_12_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30016772SMED30016772 dd_Smed_v4_17734_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30011747SMED30011747 dd_Smed_v6_494_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30015704Hox class homeodomain protein DjAbd-Ba SMED30015704smed_20140614PMID:29100657
Category 2 cellSMED30011041Heat shock protein 903SMESG000041107.1 dd_Smed_v6_758_1dd_Smed_v6PMID:29674432
Category 2 cellSMED30018991ATP-dependent DNA helicaseSMESG000064966.1 dd_Smed_v4_7318_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30016794G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000004267.1 dd_Smed_v4_16725_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30007501lectin-like proteinSMESG000028264.1 dd_Smed_v4_79_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30005470Selenoprotein W dd_Smed_v6_616_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30014877BMPSMESG000013937.1 dd_Smed_v4_17402_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30012272ZP domain-containing proteinSMESG000039966.1 dd_Smed_v4_13456_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30012162SMED30012162SMESG000074058.1 dd_Smed_v4_12328_1_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30005188Venom allergen 5SMESG000062609.1 dd_Smed_v4_159_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30006347U2 small nuclear ribonucleoprotein B dd_Smed_v6_2274_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30028497AdenosylhomocysteinaseSMESG000012954.1 SMESG000012950.1 dd_Smed_v6_526_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30032025NPYR-5SMESG000004267.1 dd_Smed_v4_16725_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30021219Retinol dehydrogenase 13SMESG000010175.1 dd_Smed_v4_10881_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30025879THAP-type domain-containing protein dd_Smed_v4_16619_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30032290SMED30032290SMESG000014241.1 SMESG000014240.1 dd_Smed_v4_185_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30024739Transcription initiation factor IIA subunit 1-like protein 1 dd_Smed_v6_868_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30034546Protein transport protein Sec61 subunit gammaSMESG000062123.1 SMESG000063809.1 dd_Smed_v6_429_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30035346SMED30035346SMESG000063591.1 SMESG000063590.1 SMESG000063568.1 dd_Smed_v4_8628_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30026063TNF receptor-associated factorSMESG000044583.1 dd_Smed_v4_11100_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30020317Heat shock protein 90SMESG000024822.1 dd_Smed_v6_678_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30020269MyophilinSMESG000081505.1 SMESG000049198.1 SMESG000047694.1 SMESG000035451.1 SMESG000035348.1 dd_Smed_v6_395_0dd_Smed_v6PMID:29674432
Category 2 cellSMED3002653910 kDa heat shock protein, mitochondrialSMESG000000556.1 dd_Smed_v6_421_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30025067Endoplasmic reticulum chaperone BiPSMESG000062699.1 dd_Smed_v6_511_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30028449High density lipoprotein binding protein (Vigilin)SMESG000016436.1 dd_Smed_v6_553_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30021982Troponin ISMESG000036684.1 dd_Smed_v4_7974_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED3003333640S ribosomal protein S29 dd_Smed_v4_214_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30020656SMED30020656SMESG000034285.1 dd_Smed_v6_3935_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30024839Mitochondrial ATP synthase subunit bSMESG000077800.1 dd_Smed_v6_905_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30026101Reticulocalbin-1SMESG000077405.1 dd_Smed_v6_5905_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30030234Tubulin alpha chainSMESG000041107.1 dd_Smed_v6_758_1dd_Smed_v6PMID:29674432
Category 2 cellSMED30029770ATP-binding cassette sub-family F member 2SMESG000071613.1 dd_Smed_v6_434_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30028888Transmembrane emp24 domain-containing protein 10SMESG000024933.1 dd_Smed_v6_746_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30021105Tubulin alpha chainSMESG000005506.1 SMESG000005505.1 SMESG000005493.1 SMESG000005489.1 SMESG000005487.1 dd_Smed_v6_38_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30025931SMED30025931SMESG000066313.1 dd_Smed_v6_2987_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30028513Transcriptional activator protein Pur-beta dd_Smed_v6_346_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30023427Carboxylic ester hydrolase dd_Smed_v4_4101_0_1dd_Smed_v4PMID:28292427
Category 2 cellSMED30026732NADH dehydrogenase iron-sulfur protein 8, mitochondrialSMESG000002076.1 dd_Smed_v6_849_0dd_Smed_v6PMID:29674432
Category 2 cellSMED30033898SMED30033898SMESG000063591.1 SMESG000063590.1 SMESG000063568.1 dd_Smed_v4_8628_0_1dd_Smed_v4PMID:28292427

 

 

back to top