Category 2 cell

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ In Situ Hybridization Data

  ▻ Sequences

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  Category 2 cell


DEFINITON:

  Post-mitotic, mesenchymally located epidermal progenitors downstream of the zeta neoblasts.


TERM DEFINITION CITATIONS:

  PMID:26114597, PMID:20040488, PMID:18786419, PMID:25017721, PMID:22385657


TERM CITATIONS:


TERM ID:

  PLANA:0000028


ABOUT THIS TERM:

Category 2 cell

  ↳is a epidermal progenitor cell, material entity and somatic cell

  ↳contained in tail region, ventral region of the whole animal, copulatory region, posterior region of the whole animal, parapharyngeal region, prepharyngeal region, head region, dorsal region of the whole animal and anterior region of the whole animal

  ↳develops from zeta neoblast

  ↳existence overlaps Stage 6, Stage 5, juvenile stage, asexual adult, adult hermaphrodite, Stage 8 and Stage 7

  ↳existence starts during or after Stage 5

  ↳part of integumental system


  → Category 3 cell develops from Category 2 cell



BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30035904AFP81697.1PROG-1prog-1, NB.21.11eStage 5, Stage 6, Stage 7, Stage 8integumental system, Category 2 cell
SMED30026364ACN51391.1SMED-P53p53Stage 5, Stage 6, Stage 7, Stage 8zeta neoblast, integumental system, Category 2 cell
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30026364 ID=SMED30026364|Name=SMED-P53|organism=Schmidtea mediterranea sexual|type=transcript|length=2047bp
CTCATGACAGTTTTATTAAAGTTACTATTATTAGGAATTCTGCGCGTTAAACTAGACATTATCGATGGCCCAGCAATATA
TTACTTCGGCTTTCGATCCAAACTTCACAACGTTACAGCATCAGACTTCAATACATTATAAATCCTCTCCAATTGAAATG
ATTGTTCCGATGCAATGCAACCAAAACCAAGCCACCTTATCTATAACCCCTGTTCATATTTCTCCATTTGTTAATATATC
AGATTCTAATAATCACAATTTGACGAATATCGTCGAGCCTGTTTCATCAAATACTATGTCTCCTGCTTTTAAATCCGACG
ACATGCCAACATTGTCTTCTTATCCAGGTCCGTATAATTTTCAAATCTTTATTCCCAACGGAGAATTTGATGAATCCAAA
AGAAAAGGACAGACATGTGTGTTTCAAACCGATAAAATGGGAAATCACCAATTATTTACCAAACCTCATCCTCATTATTG
GAGGTTAAATTATTCAGCTGATCCTTCTATGTCAACGGAAAACATGTATATTCGGATGGTTCCAGTTTTTGGGGATCCAG
AAAAAGCTCAATGCATTTTGGAAAGATGTGCAAAACACAAAGAAGTAACAACAGATGAAAATCACTGGAAATATCGTAGC
ATGCTCATTGTAGAAAAAACCTGTGCACATTACTTTCAGGATTCGGCAACGAAAAGAGTTTGCATTTTATTACCGTTTGA
AAAGCATGCGGAAGGAGAGATTTATTCTTCCGTCAACTGTCAATTTGCATGCTACAACAGTTGCTTTAATCAAGATTCAG
GTGGTCGGAAAACACTTTATTTAATCATCACTCTAGAATTTCTCGATAAAAAAACAAATAAATTCGATGTATGGGGTCGA
CAGTGTTTGCAATTTCGCAGTTGTGCTTGTCCAAGTAGAGACTGGAGAGATAAAAAGATTAAAGGCGATCCAGAAATGTT
ACTGAAATTCAAAGAAAAACGAATCAAAACCGAAGAAAAATTAAATAATTTGGTGATTTCTAAAAGCGTCCCTATTAATA
TGGGTGGAAAGGATGCTATCATAAGAGTTCTTCCCTCGTTGCCAGGACTCGATGACGCTATTAACGCATTAGTTTGCGGA
TACTTACTGAATCGAACAACCAACATAAGCGCAATAATAGCAGCATTTAATCAGATGAAAGACGTAGAACATTTAATTAT
CGATCAATTCACATCAAATTTAGATCAAAATACATGTGACAGTAAAAGTCCTTCACAAACTCCAGAGTCTCAGATTTCTC
CGAATACATCAAACCTTCAATTCAACGATTACGGTTCACTTTACGGTGAACCATGTCAACCCTATAGACCGATGCACCAG
CAAGTTGTTAATAATTTTTCCTCTCCAGGAATTTTCAGTAAAATACCTTTTGAAACTTATCCGGTTAGTTATGACATTAA
ACTTTCACATGAAATGCCGCAGCACTTTGATGAGCTGCCATCAGACAACTATAATAGACACTGAAAAATTGCGTCCTTCC
ACGTTTAAAATTGTATAAAAAATAATATGCTTGATTTTTATTTTTGCATTTGTTTTATTTTTTAATGTTGAAAATATTTA
CGTTTGTATTATTTTTTTTTGATTAGTAGTAGTAATGCTGCTTTCAAATTTTATTGAACTTTGATCAGTGATTTTTAATA
TTCAATGACCTGAATTTTTCATGCGTCTTGATGAGGGTTTGAGTGAAAAAATTATCAATTTCTTCACTTTGTCATGTGTG
CTATGTGCATTTATTGATGTATATAACAATATATGTGTAGATAAATTTTATTTTTGTATCCGATTTAGGTTTGCAGGCAC
GATGATGAGTGGTTTTTATTTTGTAAAAATTTTTCGAGATAACATGTGCTCAAATATCAATATTATATATGGTAACATAT
TTTTGCAATAAAAATGCATTTATTGTCAATTTGGCTATAAATTAAGTATCGTACGAATCAAGCAATATTTTATCATTGCT
GTCAATATTTTGTTGATAATTTTTTATTTGCTTTGTTAATAAAGAGC
>SMED30035904 ID=SMED30035904|Name=PROG-1|organism=Schmidtea mediterranea sexual|type=transcript|length=728bp
GCAATATTTTGTCATGAATGTTTAATTGAAAAATATGAAAGTTTTAATTATATTTCTATTTGTGATTGCGTTCGCGTATA
TTGAATGCCGTCCTCAACATCTATTGGGGTTCATGAGGAAAGAAAAGTCCAAGCTAGAAAAAGACTCAGCAGATGACGTG
AAACAAGGAAAAGATTCGGATAAAAGCTCTGATAAATATTCACATGAAGGATCTAATAAAGAGTCTGACAAAGAGACAGA
TAAAGAAGAAGAAACTAATTCTAAGACTTCTGCAAAGTCTCCCGCCAAATCAAGTAGACGAAAGAAACAAGTGGAAAAAT
TGGAAGAAGAGGAAGGAGAAACTTTAAAAGAGAAATTAAAAGGACACATTACGAAAGCAGATTGCATGAAATTATACGAA
GAAACTGATAAATACTGCGATCCACTTTATTTGAAGCTCGACAAAGATTGCGACTGCAGATATGTGAAAGCATTGAATGA
CTACACGAAAAGATGGGACAGTTATCATTCCAAATGTGGTAGCAAATATGACAAAAAATGCCGAACCGAATTGCGAGCTT
TGGAGAATTGGTTTAATGGCCTTTATGATTCAATCGACGGCCACTGTGACGCAGAATATGACGCGCTGGATAAATATTGT
GACGTAGAATACAACAAAGTTGATCAATGTGAAAAAGGACAGAAAGTGTAATAAAATTGATTTGTAATAAAATTTATTAA
ATAAAAAA

 

back to top



PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in Category 2 cell. Click this link to learn more about PAGE.


PAGE Curations: 304


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
Category 2 cellSMED30005288HECT and RLD domain containing E3 ubiquitin protein ligase 3 GAKN01018017.1SmedAsxl_pearson_GAKN01PMID:25956527
Henderson et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
Category 2 cellSMED30005288HECT and RLD domain containing E3 ubiquitin protein ligase 3 KP954684smed_ncbi_20240424PMID:25956527
Henderson et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
Category 2 cellSMED30002134 NB.32.1gsmed_ncbi_20240424PMID:25956527
Henderson et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
Category 2 cellSMED30035904 NB.21.11esmed_ncbi_20240424PMID:25956527
Henderson et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
Category 2 cellSMED30002134 NB.32.1gsmed_ncbi_20240424PMID:24704339
Vogg et al., 2014
whole organism asexual adult fluorescence in situ hybridization evidence
Category 2 cellSMED30027218RNA polymerase III subunit B SmedASXL_006583SmedAsxl_ww_GCZZ01PMID:26114597
Zhu et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
Category 2 cellSMED30012332Early growth response protein 3 SmedASXL_008042SmedAsxl_ww_GCZZ01PMID:26114597
Zhu et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
Category 2 cellSMED30008505Transcription factor Sox-8 SmedASXL_004704SmedAsxl_ww_GCZZ01PMID:26114597
Zhu et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
Category 2 cellSMED30035904 JX122762.1smed_ncbi_20240424PMID:26114597
Zhu et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
Category 2 cellSMED30009302 SmedASXL_008106SmedAsxl_ww_GCZZ01PMID:26114597
Zhu et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
Category 2 cellSMED30020396 SmedASXL_013664SmedAsxl_ww_GCZZ01PMID:26114597
Zhu et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
Category 2 cellSMED30003970Paired box protein Pax-5 SMED30006353smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
Category 2 cellSMED30004169Paired box protein Pax-5 SMED30006353smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
Category 2 cellSMED30011923Homeobox protein SIX6 SMED30010878smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
Category 2 cellSMED30035904 JX122762.1smed_ncbi_20240424PMID:30194301
Mihaylova et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
Category 2 cellSMED30026364Cellular tumor antigen p53 ACN51391.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
Category 2 cellSMED30026364Cellular tumor antigen p53 ACN51391.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
Category 2 cellSMED30026364Cellular tumor antigen p53 ACN51391.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 5 colorimetric in situ hybridization evidence
Category 2 cellSMED30026364Cellular tumor antigen p53 ACN51391.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
Category 2 cellSMED30026364Cellular tumor antigen p53 AY068713.3smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 5 colorimetric in situ hybridization evidence
Category 2 cellSMED30026364Cellular tumor antigen p53 AY068713.3smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
Category 2 cellSMED30026364Cellular tumor antigen p53 AY068713.3smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
Category 2 cellSMED30026364Cellular tumor antigen p53 AY068713.3smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
Category 2 cellSMED30035904 JX122762.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
Category 2 cellSMED30035904 JX122762.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
Category 2 cellSMED30035904 JX122762.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
Category 2 cellSMED30035904 JX122762.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 5 colorimetric in situ hybridization evidence
Category 2 cellSMED30035904 AFP81697.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 5 colorimetric in situ hybridization evidence
Category 2 cellSMED30035904 AFP81697.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
Category 2 cellSMED30035904 AFP81697.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
Category 2 cellSMED30035904 AFP81697.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
Category 2 cellSMED30035904 AFP81697.1smed_ncbi_20240424PMID:22445864
Tu et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
Category 2 cellSMED30026364Cellular tumor antigen p53 AY068713.3smed_ncbi_20240424PMID:20040488
Pearson et al., 2010
whole organism asexual adult fluorescence in situ hybridization evidence
Category 2 cellSMED30035904 JX122762.1smed_ncbi_20240424PMID:24523458
Lin et al., 2014
whole organism asexual adult fluorescence in situ hybridization evidence
Category 2 cellSMED30035904 JX122762.1smed_ncbi_20240424PMID:23318635
Blassberg et al., 2013
whole organism asexual adult fluorescence in situ hybridization evidence
Category 2 cellSMED30020269Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v6_395_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30024881actin dd_Smed_v6_232_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30000428hematopoietic prostaglandin D synthase dd_Smed_v6_816_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30001367ADP ribosylation factor 1 dd_Smed_v6_203_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30001701ribosomal protein L7a dd_Smed_v6_296_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30001172eukaryotic translation elongation factor 1 beta 2 dd_Smed_v6_206_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30002454staphylococcal nuclease and tudor domain containing 1 dd_Smed_v6_906_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30031061nucleobindin 2 dd_Smed_v6_6010_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30028938protein disulfide isomerase family A member 6 dd_Smed_v6_250_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30030234tubulin alpha chain dd_Smed_v6_648_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30026732NADH:ubiquinone oxidoreductase core subunit S8 dd_Smed_v6_849_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30012643Eukaryotic translation initiation factor 3 subunit A dd_Smed_v6_804_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30031235tubulin alpha chain dd_Smed_v6_648_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30004267actin dd_Smed_v6_232_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30029716GRB10 interacting GYF protein 2 dd_Smed_v6_3448_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30033949protein disulfide isomerase family A member 5 dd_Smed_v6_1537_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30029102AHNAK nucleoprotein dd_Smed_v6_125_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30028069AHNAK nucleoprotein dd_Smed_v6_125_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30035571protein disulfide isomerase family A member 5 dd_Smed_v6_1537_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30005345AHNAK nucleoprotein dd_Smed_v6_125_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30017114eukaryotic translation elongation factor 1 gamma dd_Smed_v6_308_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30026844MAK16 homolog dd_Smed_v6_1416_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30022992myosin heavy chain 10 dd_Smed_v6_791_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30006119X-box-binding protein 1 dd_Smed_v6_415_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30017206Band 4.1-like protein 2 dd_Smed_v6_2032_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30022078tumor protein, translationally-controlled 1 dd_Smed_v6_136_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30003343peptidylprolyl isomerase B dd_Smed_v6_686_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30018637heat shock protein family A (Hsp70) member 8 dd_Smed_v6_15_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30028497adenosylhomocysteinase dd_Smed_v6_526_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30001546Cold shock protein dd_Smed_v6_35_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30012332Early growth response protein 3 dd_Smed_v6_3935_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30007742SEC61 translocon subunit alpha 2 dd_Smed_v6_282_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30005231Polyadenylate-binding protein dd_Smed_v6_93_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30028449high density lipoprotein binding protein dd_Smed_v6_553_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30015739aldo-keto reductase family 1 member B15 dd_Smed_v6_1044_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30027707methionine adenosyltransferase 2A dd_Smed_v6_1580_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30014813CSD domain-containing protein dd_Smed_v6_35_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30011982ribosomal protein L17 dd_Smed_v6_95_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30018353Glycine amidinotransferase, mitochondrial dd_Smed_v6_920_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30008699rho guanine nucleotide exchange factor dd_Smed_v6_276_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30034629SCP domain-containing protein dd_Smed_v6_762_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30013312calpain 11 dd_Smed_v6_1971_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30008699ribosomal protein L7 dd_Smed_v6_276_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30025067heat shock protein family A (Hsp70) member 5 dd_Smed_v6_511_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30027903Calreticulin; transcript_id=FBtr0082103 dd_Smed_v6_220_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30028888transmembrane p24 trafficking protein 10 dd_Smed_v6_746_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30011609ribosomal protein S3 dd_Smed_v6_269_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30009513glycine amidinotransferase dd_Smed_v6_899_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30004937eukaryotic translation elongation factor 2 dd_Smed_v6_186_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30002537Cold shock protein dd_Smed_v6_35_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30028513purine rich element binding protein A dd_Smed_v6_346_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30022344radixin dd_Smed_v6_1131_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30022331signal sequence receptor subunit 3 dd_Smed_v6_1265_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED3002610145 kDa calcium-binding protein dd_Smed_v6_5905_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30034254calreticulin dd_Smed_v6_220_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30013735eukaryotic translation elongation factor 1 alpha 1 dd_Smed_v6_30_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30013606rho guanine nucleotide exchange factor dd_Smed_v6_276_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30002703ribosomal protein L23a dd_Smed_v6_281_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30029770ABCF2-H2BE1 readthrough dd_Smed_v6_434_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30024739transcription factor IIA dd_Smed_v6_868_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30014525dolichyl-diphosphooligosaccharide--protein glycosyltransferase non-catalytic subunit dd_Smed_v6_948_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30013606ribosomal protein L7 dd_Smed_v6_276_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30015373hyaluronan binding protein 4 dd_Smed_v6_1629_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30009457reticulocalbin 2 dd_Smed_v6_493_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30021698tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon dd_Smed_v6_36_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30021667receptor for activated C kinase 1 dd_Smed_v6_174_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30013893histocompatibility minor 13 dd_Smed_v6_1203_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30028808Calreticulin; transcript_id=FBtr0082103 dd_Smed_v6_220_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30025931leucine rich repeat containing 59 dd_Smed_v6_2987_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30024839ATP synthase peripheral stalk-membrane subunit b dd_Smed_v6_905_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30020493transcription factor IIA dd_Smed_v6_868_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30023308SCP domain-containing protein dd_Smed_v6_762_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30021635succinate dehydrogenase complex flavoprotein subunit A dd_Smed_v6_897_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30031823translocation associated membrane protein 1 dd_Smed_v6_1740_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30029555serine and arginine rich splicing factor 6 dd_Smed_v6_473_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30021105tubulin alpha 3d dd_Smed_v6_38_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30024309isocitrate dehydrogenase (NADP( )) 2 dd_Smed_v6_449_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30006347small nuclear ribonucleoprotein polypeptide A dd_Smed_v6_2274_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30015672capping actin protein, gelsolin like dd_Smed_v6_1215_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30005014ATP synthase F1 subunit alpha dd_Smed_v6_731_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30016196CCHC-type zinc finger nucleic acid binding protein dd_Smed_v6_62_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30003482heat shock protein dd_Smed_v6_2648_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30021105tubulin alpha 3d dd_Smed_v6_38_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED3000304445 kDa calcium-binding protein dd_Smed_v6_5905_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30030239eukaryotic translation elongation factor 2 dd_Smed_v6_186_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30033302RNA-binding protein MEX3B dd_Smed_v6_1999_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30020996ADP ribosylation factor GTPase activating protein 2 dd_Smed_v6_539_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30032645chromobox 1 dd_Smed_v6_928_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30020317heat shock protein 90 alpha family class A member 1 dd_Smed_v6_678_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30021590spectrin beta, non-erythrocytic 2 dd_Smed_v6_1122_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30019834receptor for activated C kinase 1 dd_Smed_v6_174_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30013168calpain 9 dd_Smed_v6_1971_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30029555RNA-binding protein Musashi homolog 1 dd_Smed_v6_473_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30012869Y-box factor homolog dd_Smed_v6_114_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30002242nucleobindin 2 dd_Smed_v6_6912_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30025522heat shock protein family D (Hsp60) member 1 dd_Smed_v6_141_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30010637DExD-box helicase 50 dd_Smed_v6_283_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30009224ovo like zinc finger 3 dd_Smed_v6_14711_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30009224ovo like zinc finger 3 dd_Smed_v6_12410_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30008553phosphoenolpyruvate carboxykinase GTP dd_Smed_v6_196_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30026364Cellular tumor antigen p53 dd_Smed_v6_5563_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30008505Transcription factor Sox-8 dd_Smed_v6_5942_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30015942threonyl-tRNA synthetase 3 dd_Smed_v6_1476_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30002134 dd_Smed_v6_69_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30014876 dd_Smed_v6_69_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30014876 dd_Smed_v6_61_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30035904 dd_Smed_v6_332_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30009302 dd_Smed_v6_363_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30022628 dd_Smed_v6_361_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30020396 dd_Smed_v6_478_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30026114 dd_Smed_v6_3665_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30011747 dd_Smed_v6_494_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30026539 dd_Smed_v6_421_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30012826 dd_Smed_v6_309_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30003648 dd_Smed_v6_183_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30011419 dd_Smed_v6_183_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30022325 dd_Smed_v6_1683_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30025741 dd_Smed_v6_69_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30017300 dd_Smed_v6_520_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30024860 dd_Smed_v6_520_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30020656 dd_Smed_v6_3935_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30003313 dd_Smed_v6_616_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30005470 dd_Smed_v6_616_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30020948 dd_Smed_v6_409_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30034546 dd_Smed_v6_429_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30017516collagen type XIII alpha 1 dd_Smed_v4_2197_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30022586Putative synaptotagmin-14-like protein dd_Smed_v4_23389_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30010051notum, palmitoleoyl-protein carboxylesterase dd_Smed_v4_24180_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30000562acyl-CoA synthetase short chain family member 3 dd_Smed_v4_2832_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30009269matrilin 1 dd_Smed_v4_2803_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30005837keratin associated protein 4-5 dd_Smed_v4_229_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30031538ALG1 chitobiosyldiphosphodolichol beta- mannosyltransferase dd_Smed_v4_2340_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30012850spondin 1 dd_Smed_v4_2400_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30005670Uncharacterized protein dd_Smed_v4_279_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30027460troponin T3, fast skeletal type dd_Smed_v4_323_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30021888transporter dd_Smed_v4_13596_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30020685ABC-type xenobiotic transporter dd_Smed_v4_13596_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30019720nuclear receptor binding SET domain protein 1b dd_Smed_v4_99_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30021920potassium two pore domain channel subfamily K member 1 dd_Smed_v4_9028_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30023605Peptidase C1A papain C-terminal domain-containing protein dd_Smed_v4_582_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30018991RecQ like helicase dd_Smed_v4_7318_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30021982troponin T3, fast skeletal type dd_Smed_v4_7974_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30021305Mucin 96D; transcript_id=FBtr0084845 dd_Smed_v4_651_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30019060Expressed conserved protein dd_Smed_v4_8717_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30020685ABC transmembrane type-1 domain-containing protein dd_Smed_v4_13596_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30014286ABC transmembrane type-1 domain-containing protein dd_Smed_v4_13596_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30012725EBNA1 binding protein 2 dd_Smed_v4_5945_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30014286ABC-type xenobiotic transporter dd_Smed_v4_13596_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30000955tRNA methyltransferase 2 homolog A dd_Smed_v4_11602_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30007676RING-type E3 ubiquitin transferase cysteine targeting dd_Smed_v4_11478_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30028417Bardet-Biedl syndrome 1 dd_Smed_v4_7298_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult fluorescence in situ hybridization evidence
Category 2 cellSMED30011602kinesin family member 2A dd_Smed_v4_50623_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30017664anosmin 1 dd_Smed_v4_6746_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30023427Carboxylic ester hydrolase dd_Smed_v4_4101_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30022616Mucin 96D; transcript_id=FBtr0084845 dd_Smed_v4_651_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30012544tetraspanin 18 dd_Smed_v4_1003_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30023100Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_15239_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30025164h1SMcT0002430.3 dd_Smed_v4_2911_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30018904Mucin 96D; transcript_id=FBtr0084845 dd_Smed_v4_651_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30019541Mucin 96D; transcript_id=FBtr0084845 dd_Smed_v4_651_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30018709solute carrier family 52 member 3 dd_Smed_v4_5546_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30020015ATP binding cassette subfamily G member 1 dd_Smed_v4_4142_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30029917Mucin 96D; transcript_id=FBtr0084845 dd_Smed_v4_651_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30027987TNF-receptor-associated factor 6 dd_Smed_v4_13061_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult fluorescence in situ hybridization evidence
Category 2 cellSMED30023223Glutamate receptor ionotropic, kainate 2 dd_Smed_v4_11004_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30025370RecQ like helicase dd_Smed_v4_7318_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30027463h1SMcT0002430.3 dd_Smed_v4_2911_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30019130Junctophilin 1 dd_Smed_v4_4752_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30033694elav-like protein dd_Smed_v4_8376_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30014866h1SMcT0006641.1 dd_Smed_v4_5576_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30021606h1SMcT0009531.1 dd_Smed_v4_3346_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30024200transporter dd_Smed_v4_13596_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30035736Mucin 96D; transcript_id=FBtr0084845 dd_Smed_v4_651_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30032818Mucin 96D; transcript_id=FBtr0084845 dd_Smed_v4_651_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30025889mucolipin 2 dd_Smed_v4_3616_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30022769gamma-aminobutyric acid type A receptor subunit pi dd_Smed_v4_8110_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30011506SH2 domain-containing protein dd_Smed_v4_7305_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30028311spectrin beta, erythrocytic dd_Smed_v4_12996_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30007322Major facilitator superfamily MFS profile domain-containing protein dd_Smed_v4_12102_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30004881Discoidin domain-containing receptor 2 dd_Smed_v4_12157_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30034201Delta-like protein C dd_Smed_v4_15985_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30028641sorting nexin 24 dd_Smed_v4_4469_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30009745Flotillin 2 dd_Smed_v4_6436_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30014654h1SMcT0015088.1 dd_Smed_v4_2598_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30032389h1SMcT0020507.4 dd_Smed_v4_5868_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30028321Synaptotagmin-1 dd_Smed_v4_17406_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30004881discoidin domain receptor tyrosine kinase 1 dd_Smed_v4_12157_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30023930slit guidance ligand 2 dd_Smed_v4_12111_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30005737non-specific serine/threonine protein kinase dd_Smed_v4_9475_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30007501C-type lectin domain-containing protein dd_Smed_v4_79_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30031764cofilin 1 dd_Smed_v4_112_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30023672RING-type E3 ubiquitin transferase dd_Smed_v4_12595_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30030155Delta-like protein C dd_Smed_v4_15985_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30026063Tnf receptor-associated factor dd_Smed_v4_11100_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30005038adaptor related protein complex 1 subunit sigma 2 dd_Smed_v4_9393_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30021219dehydrogenase/reductase X-linked dd_Smed_v4_10881_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30013881nuclear receptor binding SET domain protein 1b dd_Smed_v4_99_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30017164Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_15239_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30002242nucleobindin 2 dd_Smed_v4_6912_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30004705Junctophilin 1 dd_Smed_v4_4752_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30002598nuclear receptor binding SET domain protein 1b dd_Smed_v4_99_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30001004Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_15239_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30014877Protein decapentaplegic dd_Smed_v4_17402_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30006136protein disulfide isomerase family A member 5 dd_Smed_v4_821_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30003777Mucin 96D; transcript_id=FBtr0084845 dd_Smed_v4_651_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30008007discoidin domain receptor tyrosine kinase 1 dd_Smed_v4_6578_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30012847RecQ like helicase dd_Smed_v4_7318_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30006033h1SMcT0002430.3 dd_Smed_v4_2911_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30016794Neuropeptide F receptor; transcript_id=FBtr0308318 dd_Smed_v4_16725_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30008505Transcription factor Sox-8 dd_Smed_v4_5942_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30009893RNA-binding protein 24-B dd_Smed_v4_11008_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30007902RecQ like helicase dd_Smed_v4_7318_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30032025Neuropeptide F receptor; transcript_id=FBtr0308318 dd_Smed_v4_16725_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30002983Tropomyosin 2; transcript_id=FBtr0083080 dd_Smed_v4_436_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30007084TNF-receptor-associated factor 6 dd_Smed_v4_13061_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult fluorescence in situ hybridization evidence
Category 2 cellSMED30013494 dd_Smed_v4_49796_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30002134 dd_Smed_v4_69_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30017934 dd_Smed_v4_4417_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30014876 dd_Smed_v4_61_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30015362 dd_Smed_v4_80_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30016016 dd_Smed_v4_8_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30017639 dd_Smed_v4_8_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30011272 dd_Smed_v4_8_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30035904 dd_Smed_v4_332_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30013768 dd_Smed_v4_3761_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30009302 dd_Smed_v4_363_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30031990 dd_Smed_v4_40742_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30031990 dd_Smed_v4_213_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30035648 dd_Smed_v4_3815_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30020396 dd_Smed_v4_478_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30026114 dd_Smed_v4_3665_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30035346 dd_Smed_v4_8628_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30033898 dd_Smed_v4_8628_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30016718 dd_Smed_v4_8628_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30019573 dd_Smed_v4_8812_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30025363 dd_Smed_v4_1754_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30010528 dd_Smed_v4_1754_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30025879 dd_Smed_v4_16619_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30026763 dd_Smed_v4_11575_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30016314 dd_Smed_v4_7855_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30029293 dd_Smed_v4_5527_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30005911 dd_Smed_v4_12_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30012162 dd_Smed_v4_12328_1_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30015635 dd_Smed_v4_12328_1_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30004886 dd_Smed_v4_14717_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30000378 dd_Smed_v4_512_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30012272 dd_Smed_v4_13456_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30001667 dd_Smed_v4_8541_1_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30008778 dd_Smed_v4_13872_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30035924 dd_Smed_v4_11896_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30028141 dd_Smed_v4_9600_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30016772 dd_Smed_v4_17734_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30032290 dd_Smed_v4_185_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30000989 dd_Smed_v4_20486_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30022312 dd_Smed_v4_18958_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30033336 dd_Smed_v4_214_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 2 cellSMED30002134 NB.32.1gsmed_ncbi_20240424PMID:18786419
Eisenhoffer et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
Category 2 cellSMED30002134 NB.32.1gsmed_ncbi_20240424PMID:18786419
Eisenhoffer et al., 2008
whole organism asexual adult cDNA to DNA expression microarray evidence
Category 2 cellSMED30035904 JX122762.1smed_ncbi_20240424PMID:18786419
Eisenhoffer et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
Category 2 cellSMED30035904 JX122762.1smed_ncbi_20240424PMID:18786419
Eisenhoffer et al., 2008
whole organism asexual adult cDNA to DNA expression microarray evidence
Category 2 cellSMED30035904 JX122762.1smed_ncbi_20240424PMID:24415944
Scimone et al., 2014
whole organism asexual adult fluorescence in situ hybridization evidence
Category 2 cellSMED30002134 DN306632smed_ncbi_20240424PMID:23235145
Hubert et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
Category 2 cellSMED30002134 DN298711smed_ncbi_20240424PMID:23235145
Hubert et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
Category 2 cellSMED30013617HECT-type E3 ubiquitin transferase GAKN01016992.1SmedAsxl_pearson_GAKN01PMID:25956527
Henderson et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
Category 2 cellSMED30006629HECT, UBA and WWE domain containing E3 ubiquitin protein ligase 1 GAKN01012244.1SmedAsxl_pearson_GAKN01PMID:25956527
Henderson et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
Category 2 cellSMED30010017circadian trip GAKN01001286.1SmedAsxl_pearson_GAKN01PMID:25956527
Henderson et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
Category 2 cellSMED30006114E3 ubiquitin-protein ligase hecd-1 GAKN01003620.1SmedAsxl_pearson_GAKN01PMID:25956527
Henderson et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
Category 2 cellSMED30032411SMAD specific E3 ubiquitin protein ligase 1 GAKN01002365.1SmedAsxl_pearson_GAKN01PMID:25956527
Henderson et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
Category 2 cellSMED30005288HECT and RLD domain containing E3 ubiquitin protein ligase 3 GAKN01018017.1SmedAsxl_pearson_GAKN01PMID:25956527
Henderson et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
Note: Hover over icons to view figure legend

 

 

back to top