gut

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ In Situ Hybridization Data

  ▻ Sequences

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  gut


DEFINITON:

  The planarian triclad gut contains a central anterior gut branch connected to two posterior gut branches arranged around the pharynx. Secondary gut branches extend laterally from the primary gut branches, while tertiary gut branches extend from the secondary branches. Food and waste enter and exit the gut through the pharynx.


TERM DEFINITION CITATIONS:

  PMID:3490491


TERM CITATIONS:


TERM ID:

  PLANA:0000026


ABOUT THIS TERM:

gut

  ↳is a material entity and organ

  ↳contained in tail region, copulatory region, ventral region of the whole animal, posterior region of the whole animal, parapharyngeal region, prepharyngeal region, head region, dorsal region of the whole animal and anterior region of the whole animal

  ↳develops from gamma neoblast

  ↳existence overlaps Stage 6, Stage 5, juvenile stage, asexual adult, adult hermaphrodite, Stage 8 and Stage 7

  ↳existence starts during or after Stage 5

  ↳part of digestive system


  → digestive tract lumen luminal space of gut


Expand to see terms that part of gut


BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30007290AFF18488.1GATA456gata456aStage 2, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, gut, digestive system, gamma neoblast, embryonic pharynx
SMED30005748AFF18489.1HNF4hnf-4Stage 2, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, gut, digestive system, gamma neoblast, embryonic pharynx
SMED30025591ABW97518.1porcupine-like proteinporcn-AStage 5, Stage 6, Stage 7, Stage 8gut, digestive system
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30025591 ID=SMED30025591|Name=porcupine-like protein|organism=Schmidtea mediterranea sexual|type=transcript|length=3526bp
TTCCGATCTTTTCTTTTGAAATTTTTGAAATTTTAAATAAAATTAATGACAAAGGCAGAAAATCAGAGAACTACTAAAGC
ATCCGACTTCAAATTTGGAAAAGAAATCGGCCATGGCTCGTTCTCAACTGTAATGATAGCTAAGGAAATTTCTACCAATA
AACATTATGCTGCAAAAATTATTGATAAAGTTTTTATTTCTAAACAGCGAATGGTTAATACTGTTATGATTGAAAAAGAA
GTTCTCCGAAGAATAAATCACCAGTTTTTTGTATGTCTCAATTATACATTCCAAGATCCAGAGAGATTGTATTTTATTAT
ATCATATGCCGAACGAGGAGAACTTTTATCTCATTTAACAAGACTTTCGTGTTTTGATTTAACGTGCACACAATTTTATT
CCGCGGAAATTATTCTTGCATTAGAATATTTACATGGAATTAACGTTGTTCATCGAGATATAAAACCAGAAAATATTTTA
CTGAGTGAAAATATGCATATAAAAATTTGTGATTTTGGCAGTGCAATTATTATCGATAAACCAGATCTCAAGCCTTCTTC
TTTTACAGGTACAGCTCAATTCGTTTCTCCAGAAATGCTGGGATTCAGTAAAGAAACACGTGACAATAGCTATTCAGATG
AACCGAATTCTGATTCAGAGGAACATAGCGAAATTGAAGTTAAACGAACTAGTTCACCTGATAATTCTAGGGAAATATTA
TATCTAATGGACTTCTGGGCATTAGGATGCATCGTCTATCAAATGTTGTCTGGACGAATGCCATTTCACGTCAGGCATTC
ACGGCATGAATATGAAATTTTCCAAAAGATCCGAAATTTAAAATATGAGTTTCCGGTTGGGTTTGATGATACTGCTAAAG
ATTTTGTCTCTAAACTTCTTGTATTGAATCCACTGGAAAGATTAGGCAATCCATCCGATGGAAAGCACGCTGCTTTAAAA
GCCCACCCCCTTTTCCGTTCAATTGATTTCGAAATTATCGGATCACAAAAACCTCCGCTATTACTTCCAAATATTGAGCC
CATTGTTCAAAGTAATTGGGACGAAATTCCTGTTGGTTTTGAAGAAGCATGGAAATTCAATATCAAAAAAGAGTTTCAAG
AAATGGAAAAAGCCGATAAACAAAAATTATTGCAAAACCAAGAAAAACTAAATCCGTTTCATAGATTTGTACGCAATCGA
TTGATCATAAAACAAGGCATCTTGTACAAACGGCGTGGATTATTTACTCGTAAAAGAATGTTTCTATTAACTGAAGGACC
TCATTTATTTTATGTCGACCCCGATGCTATGCAATTTAAAAAAGAAGTCAGTCTAAACTTAATTACTGGCATAGAAGTAA
AAAATGACAAAGTATTTTATATCGTTACTAAAAGGCGAACATATTTTCTCGAAGATCCTTCAGCAAAGGCTGATGAATGG
CGACAGAGTATTGAATCGATTTGTGTAGAATATTATGGATCATTTAAATTATCCCCTGGCACTTGCACTCAAACGCCTCT
AGTTACATCATCTGAATCATAACTTTCGGTTTTATTTAAATTTATTTGTCATATAGAAAAAAATGTGAATTTAACGGTTT
TTAATATAATAATTTAATATTGGTTTGAATTCTTGTTTTTCATTTTAAAATTTAATGGATATAATTTAAATATTTTAATA
AATAAAAATATTCACATTGTTTTAATATTCTCTTTATGTCGTAATTGATAAATGATGCATTGTAAATGTATTTTACAACT
GATCTAAATGAAACCAATAGGAAACGAGTGGTTCGATGTCATGTGAATCAGCATGCAACCAATCATAGTTTTGTGATTCA
TTAAATATATTTTAAATTTTTAAAACAAATTAAATCACTTAATTAATTTTTAGACAATGTCACAATTTTATGGCGGATCC
ACGATATTGGCACCTCTATCGAACGTTATGGGTATACCAGTGGATCAAATTAATTTTATTGTGTGTAGTTTATTGTCAAT
CGGACTGGGTCAAATTATGCGACACAAATTCCCTCCTTCTAAATTGTCAGGAAGTACAAGAGGAATCATAGAAGCATTTT
TTGGAATACTAATTGTTCTTTTCTGCTTCGGATACCAAGTCAAGTATTTGTTACTACAATCAACAGTTTCCTATGTAATA
CTATTATTTTTGCCTTCACAAATATCAGCGCATTTGGTAACGTATTGGTGTATGGCTTTCATGGCGATAGTCCATTTATA
CAGGATGCATTACGATTACGGAGGTTATACTCTCGATATATCTGGTCCGGTTATGATTCAAACCCAAAAATTGACCAGCC
TCGCATTTAATCTTCTAGATGGACATCGAATAAATCAAGGAATAAAACTGCAACAGAGAAATCATGAATCTCACGCTGTG
AAAAAACTACCAGATGCAATCAAGTTTTTCGGTTACACATTCTACTTTCATGGTGTATTAGCGGGTCCTTTTGTATTCTA
CAATGAATATAAAGAATATATCACTGGATATGACGACAAGCATATTCCATGCTCCAAAAAGCAATTATCTTCAGCACTTT
GTTTATCAGTGATCCATGGATTATTAACAGCATATGTCGCACCGCAGTTTCCATATATATTTGTTTGCAGCACCGATTAC
CAACGGATGCATATGACTCGTAGAATAATGTTCACAATGATTTCATTTTTCCTCGTAAGACAAAAGTATTACTTTGCCTG
GTCAATGGTTGAAGCTGGTGCTCTTAGTACCGGATTGGGATATTGTGGAAAGGATAAAAACGGAGAGAATAATTGGTCGA
AAGTGAAAAATTACGATTTCATGGCAATCGAAAGCGGCAGTAGTTTGAAAGTGCTAGTGGACGGATGGAATATTTCCACA
ACAAGATGGCTCAGAGAATTAATTTATGAACGAGCTCCTTTATTCTGTCGGACAATTCTAGTTTTCACCGTCAGTGCATT
TTGGCATGGATTCTATCCTGGATATTATTTGATGTTTTTGACATTTTCTCTCTTTACGTTTTGCGCTAGAACCGTTAGGA
AACACATTCGACCATTGTTCATTGTCAGTCCAATTACACTTCAACTCTATCATGTTCTAACGAAAATATTCACAAATCTG
GCTTTAAATTACGGACAAGGACCATTTTATTTGCTGGAGTTTCAATCGGGACTTTTGTTTTGGAAGCCATATTACTTTTT
CGGACACGTTCTAGCAATGTTCTGCGTATTGACCTTGCAATTTCGGCCGATAATCAACGACAAAGTCAACATAATGAACA
ATGTTTTCACCAGAAAAGCCCAATATCGGTTTCAGAAACTAAAGATCCATTTGCAGAAAAAGTTGAGATGAAATTTTATT
GATTTTGATAATTTATATAAAATATTATAATTTTGTTTTTCGTTTTATTTTTATATCGATGAATTTATGATAAATGCTAA
ATATTCGATCCGGAATGAATTATTATTAATCTGGTTTTTATAATTGTTCATTTTTAATAGTTTTGTTTGTTTTTCGAAAA
TGGCGG
>SMED30007290 ID=SMED30007290|Name=GATA456|organism=Schmidtea mediterranea sexual|type=transcript|length=2033bp
AGGTAAGTGTCGTCATCACAAGTGGCTTTATTATTATCATTTAAATTTTTTATCATATTATCATTGATTGCTTGTTTTCC
TCATTCAAAATTTAACTGATTGTTATCAAGCTCATTTGATAACTCCAAATCTAATTGACACTCATGTAAATATCCCATTC
GAATTTCCGTTCCCGTCCGTAAGATCCACGATCCGACAATGTTTCTCCCATCGGTATTGTCGAATTCTCACCAGAGAAAC
TCACCAATAATGGACATTGTATCACCAAAATCCAACACCAGCAATCTGAATGCGTTGATCACGTATTCGAATTGTCCCAA
CATAGATCTACAGTCGAATGATCTGTCAGTGAACTTGACGAATTCTCAAAACTTCCACGAATTGGATCACAAAACCAATT
ACGGATACAAAGTTTCAAACAACGAGACAAAACTGAATGCTTTTCCATATTTAGCTCAATCGAACTTAACAGATTGCACA
ACAGACATCAGTGGAGATCTGAAAAATCCAAATTCACATCTCAACTATGGAAACGGAATTTCGTTCTCGGAATTTTCGAA
AATGTCCGAAACCAACATCCACGGATATCCGCCATATTGTTTCTCCACTAAACTGTTTCCCATTCCAAATCTACAAGAGA
AATCAATTATCAACGACAACTATTCCGTGAAATCCACCGCCGGAGGCTTTATCACCGAATCGAATGAGCATCAAAACTCT
GTAAATACTGGAAATTCCTACAATTCCAATTTAAGCTCATACAGAACGGTAATTCCCGCTCATTTTCATCTCTTCAATCA
GAATTCACCAGAATCGAACTCGTTTTACAATACGGCTTGGAACAACTATCCGTTTCAAATATCCCCAACTTATCCCATAC
AAAATCTACCGGATTCAACAATCAACTGGACAACAAACAATCAAATTCCAAGCAGCAATTTAGTTTTTGATCCCTGGAGC
TGTAAATCAAATCTTAATCTTCCTCCGATTAATGAATTCGGTTCCAATTGCGATGTCAGCAGAGAGTGTGTGAACTGTGG
AGCTAGCAATACTCAGTTGTGGTCCCGGGATAATTCTGGCTATTATTTGTGTGATGAATGCGACAGGTTCTCTCAAAACA
ACAGTAGAAACCTCGAAAAACTACCAACGAATCAAGTCTCATCAAGTACCGAAAATGAGTTCATGAAAAAATCCAATGCC
AACTTTCAACAATATGGAAAAAGATCCGACCTCGAATGCAGCAATTGTAAAATTACCAAGACTTCTTTATGGAGAAGAAA
CAACGAAGGAGAACCTGTCTGCAATGCTTGCGGCTTGTATTATAAATTACATAAGTCTCTAAGACCTCTTTCAATGAGGA
AAGAAGGAATACAAACAAGGAAAAGAAAACGGAAAACACAAATGAAACCGGTTTCCACTCATATTGCCAATAATCAAAAG
GTGCCGTCTTCAGAATCGTCATCAGAACAAAATCAGTTTATAAACACTGTGAAATCAAGTGAAAATTGCTATAACATGAT
TTCTGAAAATTCTCCAACATATATGCCAAATATATCAGTCCAGCCCTTCAATCACATTCTGAACTCCAGCCAATATCAAT
TCCAATCTACAGAAAATCCCATTAATCAATCATATTTAAATTCCTCAATCAAAAACAGCAATCCCTTTTACGATTCCGAA
AGTATACTTTATTCCTACAACAATTCAAACAAAATCAAAGATGAGCCCCTATTATCCATGGACAACGAACCGAAGCCCTA
TTCCTCAATCAACGAGAAAATTGACGTCAACTCCATAGTGAGAATTAATGAAATCTCAAACAATTCGAATTCGAGTTAAT
TATTCTGATCTACTTTTTAATTATATATTTAAGAACCGTATATACTTCGAAATATAATTTTAATGATAAAATTTTATATC
TAAAAAATGTAATTTTTAAGTGCGAATTATTAAGTATGCATTTAAATAGTGCAATTATTGTGGTAGTTATTTTTATTACT
AAATAAATGTTGTTTGTAAATTCGAGAATTTGT
>SMED30005748 ID=SMED30005748|Name=HNF4|organism=Schmidtea mediterranea sexual|type=transcript|length=3066bp
GAAGAATAACAAAGAAATTTATTGCCAAACTAAAATACCCGGCCTATTTCATCAAAAAAAAAACAATCAAAAACACAAAT
CGCTACGAAAACTTGTATAAAAGATTCACATTAAAAGTCATCAATATTCCTCTTTTTTAAAGACTGATGATTCAGATTCT
TGGATCCGAATGGGGTGATCTGTTAGGAAGTGAGCTGTTGACGAGATAGCTGAATAGTTTGATCTGGAATTGTGCTGTTG
GTTCGCTTCCGATGATCTGTTGGCGATTGATTGAATTTGGCAGTTTTCTATCGGCGAGTTTGGAAGCGACTTGGTATAGG
CCACAAGAAGCGACGGATCAACGACATTTTGAGTGGAATTCACAGAAAGAGCTGGGTGGATTAGGTCATCTGAATTGGAA
GAATTTGAGCAGTTATGATTTGCGTCACTGTTATAGGCGTATTTTGACTGGTTGATCATGGGGAACCCTTGATCAAGGTT
GACCAAGAAATGGCTGGTATCCTGTGATAAATTGGAATGCTGATAAAGATTGATGGAATCATTGACGCATGAAAACAGAG
AAGGAACGCCGACTCTTTCATTTTTCAGCATCATCCCATCGCTGTTGATTATCATACCGAAGTTGCTATTGTCCTGGGAA
TTTTGCTGCATTATTTCAGTTCCTTGATTAACAAAAGCTCGATATATATTTCCTGAAGGCATCGACGTAGAACTTGGCAA
ATATGCACTCCATATTTTTGAGGCCGCTTCAGGTGATATGTTTTGGTTGTTGATATTGAGTAGGACACTGTCTGGCATGA
AAGGGGGAATTCCGTAGCAGTCCTGGTAAGTATATTTCGGTGAGGAAATCCTGTGGGAGTTAATTATATCCATGGAATCG
TTTTGATTATTGTTATTGTTCCCATCTGTTTCTGGATCTATGCTGAATACCCCTGGTGGATTGTCACCCAATAATGTTTC
AGATAACAAGCTATCAATCTCGGCTAATCCTGTCATTTTCATGAACTCGACCTTCTTTACCATCAGCTGGGTGACCAATC
TCAGATCAGGAATTGTCAGCAGCAATTCCCCGAATCTACCCGGCTTGTGGTATTGCTTGTCATTCATGTGGTTCATCAGG
TCCATTTGTATTTGGTATCGGCATCGTCTCACGAACTCCTTGCCAGACTCGCTGACTCTCGGATCAAAAAATACGATCGC
TTTCAAACAAGCGAATTCTGCGTCATCCAATTGCAATTCTCGCAGCGGAATGAACAGGTCGTCAAGGATGTGACTGGCTA
TTTCAGCGAAATGTTTGTCACTGGAGTTCCTACTGATGATAAGATTGTTTCCCAATAATAGCACATCGTCTTCGTCCAAT
TGAAACGACCGCCTTATTACTCCAAGAATTAGAATTTCTCCCGCGTGTGCTTTTAAAAGGGAAATTTGATCGCTCAAGTT
TAACTGTGAAAAACAAGGCAAAGACTTTGCCCAATTCACTAGAAGAAATAACTGATTTTTCATGGACTCGCAAACATCAG
GCACATCGGCATATCTGTTCATGTATTCCTGAGGATTCGGGGGCTTTTGTATTGCAACCCTTTGCTCGGCCTGCATCAAC
TGAGAAATGGAGAGAATGACATTCGGAGGAATATCATCAAACGACGATCTTCGAGTACTGATCCTATCTCGTTCATTTTG
AACCGCTGCTCGCTTCATTCCTACAAGAATGCATTTCTTTAGCCGACAATAACGGCATTGGTTTCGTTTATCCTTGTCCA
TTTTACAATTCCGATTGTACTGGCAAGTGTAGTTATTCTTCTTCCTCACTGACCTCCGAAAAAATCCTTTACAACCGTCA
CACGAGAAAGCCCCATAATGTTTTCCTGTAGCTTTGTCACTGCAAATGAGACAGAGTTGATTGTTTTCCATTCCTTCTGG
TCCCGACGCGTTAGACGCATAGACTTCATGTTGTTGCGAGGACACTGAAACGAAAACTATTTGATAATATTTGTACAAAA
CAACTGACAGATGGTTTCGGAAAAGGTTCAATGTTCAGCCATAGTTCAGCGAAAGGTCAAATTCCTGAACTACTATTTCA
AGGTATAAATTTGAATATATTGGTTTTGCCTCGTGCTAACAAAGTCCAGAAATATAATAAGCAAAGTCTGAATCGTGTAC
TTTGGATTTCTAGCCAGGGGCACACAATAACCTATATTTAATAGCAGTTCATTGCGTTCACTCGTTATTTCTCCGACTGA
ACTGCATTGCAGGAGGATCCGCAACCATGGAGATTTCATAATTATTATCAAAATGATAATAATAATAATTATTATGAGGT
ATTGTAAAAGAAAACGTAACTCACTTTCACTTTCCAATGGATATTGCATCGAGGAAGCGTTGCTGGAAATGGAAATCGGA
GCTGAATTGCTAGTCAATAGTTGATAGGAGAATGCTGGATTGAGGTTCGGATGCTGGGTAGACGTCATATAGAATTGGCT
CGACGGATTCGGTAAAATTATGGTGAAGTTTACAATCGAAGCTCAGATATAACGTATTATAATGAAGTATTATTAATAAA
CTGCAAGTAACGTGCGCGCATTCTGAAGTGGTTGATTGAGAATAATCAGTTCTTATTCGACAAATTCAGATAAAAAAGGC
ACCACTCGAATTGTTCAGCTGCGTCATGTGAATGCCGGAACGTTGTGCGTTGGCTGTTGGCAGATCAGCGCTCCGTGTTC
ACTGCAATCCGGATACACCAGACCACTTGAAATCGTTGCGAATTCAGCGTGTCGAGTGCATTGTGCGAGATCAGTATCGG
TGTGTATGTGTGTCTGCCTGTGTGCGTGTGGATGTGTGTGCTTGTCGAGTCGGTTGTGTGTTTATGAGTGTAACTGTGTC
GATTTGGTCGAATGCAGTAGCAGATAGCTGAAATGCGATTGTTCCTATTTTTCATTTAATATTGTTTTATGTTTTGTTTC
TATTTTTATAATTTAATTTATCAGTTTTTGTTTAGATTATGCAATCATTGTTTAATTTATTTTTGTCAATTTAAAATTTA
TTATTAATTAAATTATTATAATTATT

 

back to top



PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in gut. Click this link to learn more about PAGE.


PAGE Curations: 3691


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
gutSMED30021445S-adenosylmethionine synthaseSMESG000053202.1 EG413862ncbi_smed_estsPMID:23318641
Chen et al., 2013
whole organism asexual adult fluorescence in situ hybridization evidence
gutSMED30000459Dynamin-1-like proteinSMESG000044682.1 Contig721GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30000459Dynamin-1-like proteinSMESG000058940.1 Contig721GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30000459Dynamin-1-like proteinSMESG000058940.1 PL030004B10H05ncbi_smed_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013503Tpd52 like 1SMESG000013104.1 Contig988GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013692Small HSP proteinSMESG000055935.1 Contig651GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013692Small HSP proteinSMESG000059879.1 SMESG000059868.1 SMESG000059853.1 Contig651GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028574Cytochrome P450 2K1-like proteinSMESG000073604.1 Contig1511GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028574Cytochrome P450 2K1-like proteinSMESG000078091.1 SMESG000078098.1 SMESG000078094.1 SMESG000078092.1 Contig1511GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002332TNF receptor associated factor-2SMESG000070267.1 Contig1736GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030705SMED30030705SMESG000068156.1 SMESG000010609.1 SMESG000076470.1 SMESG000073857.1 SMESG000062429.1 SMESG000060487.1 SMESG000058575.1 SMESG000053533.1 SMESG000026676.1 SMESG000020635.1 SMESG000015751.1 SMESG000005260.1 Contig236newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030705SMED30030705SMESG000037949.1 Contig236newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030705SMED30030705SMESG000068156.1 SMESG000043474.1 SMESG000076470.1 SMESG000053533.1 SMESG000015751.1 Contig250newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030705SMED30030705SMESG000068156.1 SMESG000064685.1 SMESG000010609.1 SMESG000076470.1 SMESG000073857.1 SMESG000062429.1 SMESG000060487.1 SMESG000058575.1 SMESG000053533.1 SMESG000026676.1 SMESG000020635.1 SMESG000015751.1 SMESG000005260.1 Contig239newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030705SMED30030705SMESG000057816.1 Contig239newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030705SMED30030705SMESG000025034.1 Contig250newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032354EOG090X01A3SMESG000068156.1 SMESG000010609.1 SMESG000076470.1 SMESG000073857.1 SMESG000062429.1 SMESG000060487.1 SMESG000058575.1 SMESG000053533.1 SMESG000026676.1 SMESG000020635.1 SMESG000015751.1 SMESG000005260.1 Contig236newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032354EOG090X01A3SMESG000037949.1 Contig236newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032354EOG090X01A3SMESG000068156.1 SMESG000043474.1 SMESG000076470.1 SMESG000053533.1 SMESG000015751.1 Contig250newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032354EOG090X01A3SMESG000068156.1 SMESG000064685.1 SMESG000043474.1 SMESG000010609.1 SMESG000076470.1 SMESG000073857.1 SMESG000062429.1 SMESG000058575.1 SMESG000053533.1 SMESG000020635.1 SMESG000015751.1 SMESG000005260.1 Contig246newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032354EOG090X01A3SMESG000068156.1 SMESG000064685.1 SMESG000010609.1 SMESG000076470.1 SMESG000073857.1 SMESG000062429.1 SMESG000060487.1 SMESG000058575.1 SMESG000053533.1 SMESG000026676.1 SMESG000020635.1 SMESG000015751.1 SMESG000005260.1 Contig239newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032354EOG090X01A3SMESG000000175.1 Contig246newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032354EOG090X01A3SMESG000057816.1 Contig239newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032354EOG090X01A3SMESG000025034.1 Contig250newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029603SMED30029603SMESG000027122.1 Contig1663GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029603SMED30029603SMESG000071278.1 Contig1663GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008091Serine/threonine-protein kinase PLKSMESG000027686.1 Contig2364GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008091Serine/threonine-protein kinase PLKSMESG000012131.1 SMESG000012127.1 Contig2364GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008091Serine/threonine-protein kinase PLKSMESG000012131.1 SMESG000012127.1 Contig809GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001710Vacuolar protein sorting 4SMESG000049145.1 Contig1087GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001710Vacuolar protein sorting 4SMESG000075482.1 Contig1087GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012260Dual specificity tyrosine-phosphorylation-regulated kinase 1ASMESG000001908.1 SMESG000001895.1 SMESG000054185.1 SMESG000003953.1 Contig32newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012260Dual specificity tyrosine-phosphorylation-regulated kinase 1ASMESG000001908.1 SMESG000001895.1 SMESG000054185.1 SMESG000003953.1 Contig32uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012260Dual specificity tyrosine-phosphorylation-regulated kinase 1ASMESG000003941.1 Contig32newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012260Dual specificity tyrosine-phosphorylation-regulated kinase 1ASMESG000003941.1 Contig32uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021161MARVEL domain-containing proteinSMESG000077709.1 SMESG000073947.1 SMESG000043656.1 SMESG000043279.1 SMESG000008519.1 SMESG000001897.1 Contig22GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021161MARVEL domain-containing proteinSMESG000013795.1 Contig22GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011545E3 ubiquitin-protein ligase XIAPSMESG000081058.1 Contig2302GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30009357ubiquilin-1SMESG000045386.1 Contig2009GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30010541F-actin-capping protein subunit betaSMESG000008209.1 Contig1530GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011519Mediator of RNA polymerase II transcription subunit 21SMESG000036235.1 Contig2568GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30006144Helicase with zinc finger domain 2SMESG000022691.1 SMESG000022690.1 Contig229GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012113SMED30012113SMESG000017135.1 Contig2203GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30025964SMED30025964SMESG000041071.1 Contig2453newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30033014Phosphatidylinositol-4,5-bisphosphate 4-phosphataseSMESG000063221.1 Contig1068GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035642Granulin bSMESG000060269.1 Contig2381GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035642Granulin bSMESG000029882.1 Contig2381GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035642Granulin bSMESG000029882.1 PL06004A1G01ncbi_smed_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015967Neurotracting/lsamp/neurotrimin/obcam related cell adhesion moleculeSMESG000019973.1 Contig692GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015967Neurotracting/lsamp/neurotrimin/obcam related cell adhesion moleculeSMESG000068491.1 Contig692GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011603Rho guanine nucleotide exchange factorSMESG000003891.1 Contig1388newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011603Rho guanine nucleotide exchange factorSMESG000048111.1 Contig1388newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011603Rho guanine nucleotide exchange factorSMESG000008077.1 Contig5057GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011603Rho guanine nucleotide exchange factorSMESG000017950.1 Contig5057GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001630Ras-related C3 botulinum toxin substrate 1SMESG000005612.1 Contig594newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001630Ras-related C3 botulinum toxin substrate 1SMESG000005612.1 Contig594uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001630Ras-related C3 botulinum toxin substrate 1SMESG000011575.1 Contig594newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001630Ras-related C3 botulinum toxin substrate 1SMESG000011575.1 Contig594uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001630Ras-related C3 botulinum toxin substrate 1SMESG000024968.1 Contig2195GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001630Ras-related C3 botulinum toxin substrate 1SMESG000024968.1 Contig5264GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30006211Transmembrane protease serineSMESG000068156.1 SMESG000043474.1 SMESG000076470.1 SMESG000053533.1 SMESG000015751.1 Contig250GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30006211Transmembrane protease serineSMESG000025034.1 Contig250GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30025543Coiled-coil domain-containing protein 93SMESG000022913.1 Contig1890GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035485low density lipoprotein receptor related-2SMESG000009332.1 SMESG000009320.1 Contig505GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035485low density lipoprotein receptor related-2SMESG000041448.1 Contig505GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016045Cysteine-rich proteinSMESG000044206.1 Contig353newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016045Cysteine-rich proteinSMESG000044206.1 Contig353uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016045Cysteine-rich proteinSMESG000003375.1 Contig353newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016045Cysteine-rich proteinSMESG000003375.1 Contig353uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001350SMED30001350SMESG000045656.1 Contig3259newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014058SMED30014058SMESG000000945.1 SMESG000000928.1 Contig3270newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017013Vesicle-associated membrane protein 3SMESG000033382.1 Contig3395GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017013Vesicle-associated membrane protein 3SMESG000079659.1 SMESG000079651.1 Contig154GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017013Vesicle-associated membrane protein 3SMESG000033382.1 Contig154GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007246SMED30007246SMESG000045656.1 Contig3259GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30010586Bridging integrator 3SMESG000029355.1 Contig3561GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019727beta-catenin-like protein 2SMESG000014825.1 Contig3406GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019727beta-catenin-like protein 2SMESG000002541.1 Contig3406GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004991Programmed cell death protein 10SMESG000031167.1 Contig3159GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005316ADP-ribosylation factor 1SMESG000000945.1 SMESG000000928.1 Contig3270GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007716Ankyrin repeat domain 28bSMESG000060640.1 Contig3408GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007716Ankyrin repeat domain 28bSMESG000074871.1 Contig3408GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013976SMED30013976SMESG000003513.1 Contig59newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013976SMED30013976SMESG000003513.1 Contig59uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024498SMED30024498SMESG000036544.1 Contig3175newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024498SMED30024498SMESG000036544.1 Contig3175uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024498SMED30024498SMESG000000175.1 Contig3175newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024498SMED30024498SMESG000000175.1 Contig3175uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014729SMED30014729SMESG000050509.1 Contig1785newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012469SMED30012469SMESG000038855.1 Contig2191newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30018122MADS-box domain-containing proteinSMESG000005612.1 Contig594GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30018122MADS-box domain-containing proteinSMESG000011575.1 Contig594GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016048VPS37C subunit of ESCRT-ISMESG000028338.1 Contig5669newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016048VPS37C subunit of ESCRT-ISMESG000028338.1 Contig5669uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016048VPS37C subunit of ESCRT-ISMESG000079512.1 Contig5669newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016048VPS37C subunit of ESCRT-ISMESG000079512.1 Contig5669uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014527SMED30014527SMESG000003891.1 Contig1388newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014527SMED30014527SMESG000048111.1 Contig1388newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013050SMED30013050SMESG000000175.1 Contig2068newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30006486SMED30006486SMESG000033958.1 Contig1720newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004193MACPF domain-containing protein 3SMESG000044682.1 Contig721newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004193MACPF domain-containing protein 3SMESG000044682.1 Contig721uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004193MACPF domain-containing protein 3SMESG000058940.1 Contig721newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004193MACPF domain-containing protein 3SMESG000058940.1 Contig721uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008586Reverse transcriptase domain-containing proteinSMESG000024306.1 Contig631GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008586Reverse transcriptase domain-containing proteinSMESG000008737.1 Contig631GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30000579SMED30000579SMESG000022913.1 Contig1890newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008999Voltage-dependent N-type calcium channel subunit alphaSMESG000019873.1 Contig6657newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008999Voltage-dependent N-type calcium channel subunit alphaSMESG000019873.1 Contig6657uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019591SMED30019591SMESG000050873.1 Contig2383newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019300Histone deacetylase,putativeSMESG000006246.1 Contig3291GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002079SMED30002079SMESG000043462.1 Contig210newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002079SMED30002079SMESG000043462.1 Contig210uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002079SMED30002079SMESG000049099.1 Contig210newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002079SMED30002079SMESG000049099.1 Contig210uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012769SMED30012769SMESG000058788.1 Contig2701newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012769SMED30012769SMESG000058788.1 Contig2701uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017714Basement membrane-specific heparan sulfate proteoglycan core proteinSMESG000075928.1 Contig7205newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017714Basement membrane-specific heparan sulfate proteoglycan core proteinSMESG000075928.1 Contig7205uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032447SMED30032447SMESG000025120.1 Contig1559newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030940SMED30030940SMESG000013104.1 Contig988newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032422SynaptogyrinSMESG000031799.1 Contig1892GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034412E3 ubiquitin-protein ligase CBLSMESG000039019.1 Contig3731GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034412E3 ubiquitin-protein ligase CBLSMESG000056433.1 Contig3731GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020153SMED30020153SMESG000025120.1 Contig1559GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021405Neurogenic locus notch-like protein protein 1SMESG000041513.1 Contig7665newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021405Neurogenic locus notch-like protein protein 1SMESG000041513.1 Contig7665uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED3002169814-3-3 protein epsilonSMESG000047644.1 Contig5316GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029116Gamma-secretase subunit PEN-2SMESG000067691.1 Contig138GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029116Gamma-secretase subunit PEN-2SMESG000035771.1 Contig138GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029077Macrophage-expressed gene 1 proteinSMESG000044682.1 Contig721newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029077Macrophage-expressed gene 1 proteinSMESG000044682.1 Contig721uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029077Macrophage-expressed gene 1 proteinSMESG000058940.1 Contig721newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029077Macrophage-expressed gene 1 proteinSMESG000058940.1 Contig721uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034570SMED30034570SMESG000067691.1 Contig138newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034570SMED30034570SMESG000067691.1 Contig138uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034570SMED30034570SMESG000035771.1 Contig138newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034570SMED30034570SMESG000035771.1 Contig138uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027044SMED30027044SMESG000024306.1 Contig631newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027044SMED30027044SMESG000008737.1 Contig631newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027273SMED30027273SMESG000017031.1 Contig2590newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034544Disrupted in renal carcinoma protein 2-likeSMESG000017031.1 Contig2590GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029880Tigger transposable element derived 1SMESG000024822.1 Contig1490newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034838Casein kinase II subunit alphaSMESG000039019.1 Contig3731newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034838Casein kinase II subunit alphaSMESG000056433.1 Contig3731newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30031903ProsaposinSMESG000019973.1 Contig692newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30031903ProsaposinSMESG000068491.1 Contig692newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020317Heat shock protein 90SMESG000024822.1 Contig1490GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30026637MATH domain-containing proteinSMESG000080555.1 SMESG000049002.1 SMESG000075946.1 SMESG000067287.1 SMESG000064983.1 SMESG000064843.1 SMESG000062987.1 SMESG000047155.1 SMESG000013953.1 Contig927newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30026637MATH domain-containing proteinSMESG000080555.1 SMESG000049002.1 SMESG000075946.1 SMESG000067287.1 SMESG000064983.1 SMESG000064843.1 SMESG000062987.1 SMESG000047155.1 SMESG000013953.1 Contig927uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30026637MATH domain-containing proteinSMESG000076100.1 Contig927newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30026637MATH domain-containing proteinSMESG000076100.1 Contig927uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020801SMED30020801SMESG000075928.1 Contig7205newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020801SMED30020801SMESG000075928.1 Contig7205uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020849SMED30020849SMESG000044682.1 Contig721newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020849SMED30020849SMESG000044682.1 Contig721uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020849SMED30020849SMESG000058940.1 Contig721newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020849SMED30020849SMESG000058940.1 Contig721uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011242Synaptosomal-associated protein 29SMESG000024796.1 Contig3946GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011242Synaptosomal-associated protein 29SMESG000001576.1 Contig3946GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008321SMED30008321SMESG000068172.1 Contig3306newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008321SMED30008321SMESG000068172.1 Contig3306uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008321SMED30008321SMESG000025870.1 Contig3306newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008321SMED30008321SMESG000025870.1 Contig3306uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008076Reverse transcriptase domain-containing proteinSMESG000024306.1 Contig631GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008076Reverse transcriptase domain-containing proteinSMESG000008737.1 Contig631GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007326otxASMESG000006246.1 Contig3291newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007555GCR098SMESG000016695.1 Contig4585newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007555GCR098SMESG000016695.1 Contig4585uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007555GCR098SMESG000033655.1 Contig4585newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007555GCR098SMESG000033655.1 Contig4585uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005382TYR_PHOSPHATASE_2 domain-containing proteinSMESG000030078.1 Contig1352GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30006887Gelsolin-like proteinSMESG000001429.1 Contig4707GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30006887Gelsolin-like proteinSMESG000015927.1 Contig4707GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001526SMED30001526SMESG000078478.1 Contig4368newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001526SMED30001526SMESG000078478.1 Contig4368uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001526SMED30001526SMESG000017249.1 Contig4368newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001526SMED30001526SMESG000017249.1 Contig4368uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002579SMED30002579SMESG000064050.1 Contig4890GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002579SMED30002579SMESG000069596.1 Contig4890GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008052SMED30008052SMESG000074907.1 Contig4797GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30009175Transcription elongation factor spt6SMESG000059332.1 Contig5500newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30009175Transcription elongation factor spt6SMESG000059332.1 Contig5500uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30009175Transcription elongation factor spt6SMESG000024114.1 Contig5500newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30009175Transcription elongation factor spt6SMESG000024114.1 Contig5500uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005889LPTSMESG000040592.1 Contig5422newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005889LPTSMESG000040592.1 Contig5422uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005889LPTSMESG000035457.1 Contig5422newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005889LPTSMESG000035457.1 Contig5422uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30022579SMED30022579SMESG000001429.1 Contig4707newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30022579SMED30022579SMESG000015927.1 Contig4707newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024958VAMP (vesicle-associated membrane protein)-associated protein A, likeSMESG000079557.1 SMESG000074066.1 Contig5553GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024958VAMP (vesicle-associated membrane protein)-associated protein A, likeSMESG000062111.1 Contig5553GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024174Programmed cell death 6-interacting proteinSMESG000051593.1 Contig4912GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024174Programmed cell death 6-interacting proteinSMESG000019014.1 Contig4912GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020872Myosin IESMESG000041553.1 Contig4772GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020872Myosin IESMESG000068232.1 Contig4772GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020872Myosin IESMESG000003513.1 Contig59GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020872Myosin IESMESG000068232.1 Contig59GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030407LipaseSMESG000035248.1 Contig3418GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030407LipaseSMESG000007797.1 Contig3418GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023862SMED30023862SMESG000009332.1 SMESG000009320.1 Contig505newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023862SMED30023862SMESG000009332.1 SMESG000009320.1 Contig505uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013976SMED30013976SMESG000068232.1 Contig59newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013976SMED30013976SMESG000068232.1 Contig59uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007986SMED30007986SMESG000029355.1 Contig3561newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001367ADP-ribosylation factor 1SMESG000031561.1 SMESG000018862.1 Contig8GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001367ADP-ribosylation factor 1SMESG000067743.1 Contig8GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012651Retrovirus-related Pol polyprotein from transposonSMESG000034282.1 Contig7503newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012651Retrovirus-related Pol polyprotein from transposonSMESG000034282.1 Contig7503uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30000448Cysteine-rich proteinSMESG000044206.1 Contig353newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30000448Cysteine-rich proteinSMESG000044206.1 Contig353uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30000448Cysteine-rich proteinSMESG000003375.1 Contig353newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30000448Cysteine-rich proteinSMESG000003375.1 Contig353uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021511SMED30021511SMESG000038232.1 Contig5776GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021390SMED30021390SMESG000033382.1 Contig3395newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027682NAD(P)H-dependent FMN reductaseSMESG000060640.1 Contig3408newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027682NAD(P)H-dependent FMN reductaseSMESG000060640.1 Contig3408uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027682NAD(P)H-dependent FMN reductaseSMESG000074871.1 Contig3408newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027682NAD(P)H-dependent FMN reductaseSMESG000074871.1 Contig3408uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032562SMED30032562SMESG000014825.1 Contig3406newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032562SMED30032562SMESG000014825.1 Contig3406uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032562SMED30032562SMESG000002541.1 Contig3406newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032562SMED30032562SMESG000002541.1 Contig3406uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024282Synaptosomal-associated proteinSMESG000034282.1 Contig7503newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024282Synaptosomal-associated proteinSMESG000034282.1 Contig7503uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027910Calpain-5SMESG000045063.1 Contig7340newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027910Calpain-5SMESG000045063.1 Contig7340uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029022SMED30029022SMESG000031167.1 Contig3159newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034467Protein tyrosine phosphatase type IVASMESG000015894.1 SMESG000000559.1 Contig1506GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034467Protein tyrosine phosphatase type IVASMESG000078978.1 Contig1506GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028174TTF-type domain-containing proteinSMESG000003943.1 Contig6476newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028174TTF-type domain-containing proteinSMESG000003943.1 Contig6476uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014474Tumor susceptibility gene 101 proteinSMESG000049597.1 Contig5044GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014474Tumor susceptibility gene 101 proteinSMESG000004871.1 Contig5044GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002704Cathepsin L2SMESG000013992.1 SMESG000013980.1 Contig1337GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001281SMED30001281SMESG000038153.1 SMESG000018862.1 Contig1newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001281SMED30001281SMESG000033840.1 Contig1newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001281SMED30001281SMESG000031561.1 SMESG000018862.1 Contig8newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001281SMED30001281SMESG000067743.1 Contig8newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005336Phtf-FEM1B_bdg domain-containing proteinSMESG000058788.1 Contig2701GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014717WD repeat and FYVE domain-containing protein 3SMESG000043973.1 SMESG000011278.1 Contig1351GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014717WD repeat and FYVE domain-containing protein 3SMESG000039846.1 Contig1351GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019715Tumor protein p63-regulated gene 1 proteinSMESG000038153.1 SMESG000018862.1 Contig1GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019715Tumor protein p63-regulated gene 1 proteinSMESG000033840.1 Contig1GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30003127SMED30003127SMESG000027140.1 Contig1248newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30009611Str_synth domain-containing proteinSMESG000052600.1 Contig1622GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004948Lysosomal Pro-X carboxypeptidaseSMESG000074424.1 Contig1592GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014246Ras-related protein Rab-5ASMESG000077941.1 Contig1099GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014246Ras-related protein Rab-5ASMESG000064914.1 Contig1099GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001027Cathepsin LSMESG000054075.1 SMESG000034294.1 Contig1264newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001027Cathepsin LSMESG000054075.1 SMESG000034294.1 Contig1264uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001027Cathepsin LSMESG000065264.1 SMESG000065255.1 Contig1264newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001027Cathepsin LSMESG000065264.1 SMESG000065255.1 Contig1264uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015354Tubby-like proteinSMESG000043973.1 SMESG000011278.1 Contig1351newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015354Tubby-like proteinSMESG000043973.1 SMESG000011278.1 Contig1351uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015354Tubby-like proteinSMESG000039846.1 Contig1351newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015354Tubby-like proteinSMESG000039846.1 Contig1351uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024204SMED30024204SMESG000027140.1 Contig1248GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30033930Cystathionine beta-synthaseSMESG000054075.1 SMESG000034294.1 Contig1264GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30033930Cystathionine beta-synthaseSMESG000065264.1 SMESG000065255.1 Contig1264GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029546Tektin 3SMESG000020792.1 Contig1106newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029546Tektin 3SMESG000020792.1 Contig1106uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029546Tektin 3SMESG000027124.1 Contig1106newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029546Tektin 3SMESG000027124.1 Contig1106uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024713Pyruvate carboxylaseSMESG000077941.1 Contig1099newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024713Pyruvate carboxylaseSMESG000077941.1 Contig1099uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024713Pyruvate carboxylaseSMESG000064914.1 Contig1099newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024713Pyruvate carboxylaseSMESG000064914.1 Contig1099uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023739SMED30023739SMESG000058452.1 Contig1190GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023739SMED30023739SMESG000057519.1 Contig1190GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032901SMED30032901SMESG000059757.1 Contig3698GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032901SMED30032901SMESG000054316.1 Contig3698GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002600ATPase_AAA_core domain-containing proteinSMESG000072345.1 Contig4452newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002600ATPase_AAA_core domain-containing proteinSMESG000072345.1 Contig4452uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034597PeriostinSMESG000070985.1 dd_Smed_v4_1505_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30033401SMED30033401SMESG000076072.1 dd_Smed_v4_17134_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30024473hydroxyacyl dehydrogenase bSMESG000070850.1 dd_Smed_v4_1593_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30020409SMED30020409SMESG000045132.1 dd_Smed_v4_182_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30031823Translocating chain-associated membrane proteinSMESG000051052.1 dd_Smed_v4_1740_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30035642Granulin bSMESG000029882.1 dd_Smed_v4_162_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30035642Granulin bSMESG000029882.1 dd_Smed_v4_442_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30026110Acetolactate synthase, putativeSMESG000026596.1 dd_Smed_v4_1784_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30031300Ras-related protein Rap-2cSMESG000047012.1 SMESG000047013.1 dd_Smed_v4_1450_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30024160SMED30024160SMESG000046560.1 dd_Smed_v4_1394_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30024160SMED30024160SMESG000046560.1 SMESG000010944.1 dd_Smed_v4_142_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30027707S-adenosylmethionine synthaseSMESG000027587.1 dd_Smed_v4_1580_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30023339SMED30023339SMESG000045132.1 dd_Smed_v4_182_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30029500Phosphoserine aminotransferaseSMESG000019836.1 dd_Smed_v4_1653_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30020778slc22a-6SMESG000020910.1 dd_Smed_v4_1159_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30013487SMED30013487SMESG000001727.1 dd_Smed_v4_2615_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30019982SMED30019982SMESG000016757.1 dd_Smed_v4_2775_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30016101SMED30016101SMESG000080786.1 dd_Smed_v4_14195_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30005698SMED30005698SMESG000052123.1 dd_Smed_v4_2845_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30003859SMED30003859SMESG000018217.1 dd_Smed_v4_1350_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30012966SMED30012966SMESG000052698.1 SMESG000027142.1 SMESG000059994.1 dd_Smed_v4_1029_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30012966SMED30012966SMESG000079607.1 SMESG000072955.1 SMESG000049847.1 SMESG000049844.1 SMESG000049832.1 SMESG000049812.1 SMESG000049806.1 SMESG000049805.1 SMESG000049772.1 SMESG000049767.1 SMESG000049756.1 SMESG000049745.1 SMESG000049740.1 SMESG000049739.1 SMESG000049695.1 SMESG000049688.1 SMESG000049683.1 SMESG000049676.1 SMESG000049665.1 SMESG000049663.1 SMESG000049647.1 SMESG000049621.1 SMESG000049614.1 SMESG000049601.1 SMESG000049567.1 SMESG000049548.1 SMESG000040301.1 SMESG000040257.1 SMESG000032755.1 SMESG000032715.1 SMESG000022696.1 SMESG000022691.1 SMESG000022676.1 SMESG000022665.1 SMESG000022640.1 SMESG000022619.1 SMESG000022612.1 dd_Smed_v4_490_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30006337Glycine amidinotransferase mitochondrialSMESG000051929.1 dd_Smed_v4_11843_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30017322E3 ubiquitin-protein ligase TRAF7SMESG000069927.1 dd_Smed_v4_14318_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30003716Glucose-6-phosphate isomeraseSMESG000067583.1 dd_Smed_v4_1398_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30017418Casein kinase II subunit alphaSMESG000024545.1 dd_Smed_v4_1000_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30018755Small ubiquitin-related modifierSMESG000018835.1 dd_Smed_v4_1253_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30015780slc39a-2SMESG000009337.1 dd_Smed_v4_2793_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30019939slc47a-6SMESG000033095.1 dd_Smed_v4_10595_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30005457SMED30005457SMESG000035312.1 SMESG000035313.1 dd_131dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
gutSMED30005457SMED30005457SMESG000035312.1 dd_Smed_v4_131_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30014348Four and a half LIM domains protein 1SMESG000018217.1 dd_Smed_v4_1350_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30001652SMED30001652SMESG000052698.1 SMESG000027142.1 SMESG000059994.1 dd_Smed_v4_1029_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30011300PHD-type domain-containing proteinSMESG000047306.1 dd_Smed_v4_3984_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30001853Protein kinase domain-containing proteinSMESG000003859.1 dd_Smed_v4_1897_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30003899SMP-LTD domain-containing proteinSMESG000022335.1 dd_Smed_v4_4286_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30000689SMED30000689SMESG000001727.1 dd_Smed_v4_2615_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30000689SMED30000689SMESG000001726.1 dd_Smed_v4_2615_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30012356SMED30012356SMESG000035312.1 SMESG000035313.1 dd_131dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
gutSMED30012356SMED30012356SMESG000035313.1 dd_Smed_v4_2506_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30014756SMED30014756SMESG000035312.1 SMESG000035313.1 dd_131dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
gutSMED30016251E3 ubiquitin-protein ligase TRAF7SMESG000069927.1 dd_Smed_v4_14318_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30012389SMED30012389SMESG000013786.1 SMESG000013783.1 SMESG000011362.1 dd_Smed_v4_2257_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30019834Guanine nucleotide-binding protein subunit beta-2-like 1SMESG000076568.1 dd_Smed_v4_174_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30005206Serine/arginine-rich splicing factor 1SMESG000075205.1 dd_Smed_v4_1192_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30009071SMED30009071SMESG000017123.1 dd_Smed_v4_10551_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30018542slc4a-1SMESG000024335.1 dd_Smed_v4_3003_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30011562Leishmanolysin-like peptidaseSMESG000063815.1 dd_Smed_v4_10609_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30019745Macrophage-expressed gene 1 proteinSMESG000044678.1 dd_Smed_v4_12605_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30014469DUF862 domain-containing proteinSMESG000007684.1 dd_Smed_v4_1938_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30010476Cytochrome P450 2K1-like proteinSMESG000003402.1 dd_Smed_v4_2394_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30015967Neurotracting/lsamp/neurotrimin/obcam related cell adhesion moleculeSMESG000068491.1 dd_Smed_v4_2826_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30014496Ribosome biogenesis protein NSA2SMESG000028599.1 dd_Smed_v4_1012_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30007503SMED30007503SMESG000039907.1 dd_Smed_v4_13316_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30010515FR47 domain-containing proteinSMESG000035878.1 dd_Smed_v4_1705_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30007742Protein transport protein Sec61 subunit alphaSMESG000003007.1 dd_Smed_v4_282_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30009405Phospholipid-transporting ATPaseSMESG000000504.1 dd_Smed_v4_1372_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED3001360660S ribosomal protein L7SMESG000022296.1 dd_Smed_v4_276_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30014047SMED30014047SMESG000025950.1 dd_Smed_v4_1574_6_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED3001990360S ribosomal protein L13aSMESG000041483.1 dd_Smed_v4_287_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30008744Cyclin-KSMESG000004055.1 dd_Smed_v4_2558_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED3000270360S ribosomal protein L23aSMESG000074545.1 dd_Smed_v4_281_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30011053SMED30011053SMESG000065433.1 dd_Smed_v4_2625_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30001630Ras-related C3 botulinum toxin substrate 1SMESG000024968.1 SMESG000005612.1 dd_Smed_v4_1050_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30006211Transmembrane protease serineSMESG000025034.1 dd_Smed_v4_4090_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30007622U1 small nuclear ribonucleoprotein CSMESG000005764.1 dd_Smed_v4_3504_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30003676C-type lectin domain-containing proteinSMESG000028261.1 SMESG000028260.1 SMESG000028258.1 dd_Smed_v4_10_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30008762SMED30008762SMESG000006038.1 SMESG000005903.1 dd_Smed_v4_1785_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30001895Very-long-chain 3-oxoacyl-CoA reductaseSMESG000077527.1 dd_Smed_v4_2464_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30011819SMED30011819SMESG000017281.1 SMESG000068502.1 dd_Smed_v4_1704_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30035805RING-type domain-containing proteinSMESG000043462.1 Contig210newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035805RING-type domain-containing proteinSMESG000043462.1 Contig210uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035805RING-type domain-containing proteinSMESG000049099.1 Contig210newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035805RING-type domain-containing proteinSMESG000049099.1 Contig210uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020544SMED30020544SMESG000031799.1 Contig1892newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027012slc24a-7SMESG000022806.1 SMESG000022803.1 Contig7328newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027012slc24a-7SMESG000022806.1 SMESG000022803.1 Contig7328uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035284RING-type domain-containing proteinSMESG000055935.1 Contig651newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035284RING-type domain-containing proteinSMESG000055935.1 Contig651uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035284RING-type domain-containing proteinSMESG000059879.1 SMESG000059868.1 SMESG000059853.1 Contig651newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035284RING-type domain-containing proteinSMESG000059879.1 SMESG000059868.1 SMESG000059853.1 Contig651uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023199Leucine-zipper-like transcriptional regulator 1SMESG000007049.1 Contig3743GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023199Leucine-zipper-like transcriptional regulator 1SMESG000074654.1 Contig3743GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020811SMED30020811SMESG000005612.1 Contig594newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020811SMED30020811SMESG000005612.1 Contig594uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020811SMED30020811SMESG000011575.1 Contig594newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020811SMED30020811SMESG000011575.1 Contig594uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012677Coiled-coil domain-containing protein 51SMESG000058452.1 Contig1190newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012677Coiled-coil domain-containing protein 51SMESG000058452.1 Contig1190uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012677Coiled-coil domain-containing protein 51SMESG000057519.1 Contig1190newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012677Coiled-coil domain-containing protein 51SMESG000057519.1 Contig1190uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019321TIR domain-containing proteinSMESG000079659.1 SMESG000079651.1 Contig154newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019321TIR domain-containing proteinSMESG000079659.1 SMESG000079651.1 Contig154uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019321TIR domain-containing proteinSMESG000033382.1 Contig154newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019321TIR domain-containing proteinSMESG000033382.1 Contig154uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008756SMED30008756SMESG000007049.1 Contig3743newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008756SMED30008756SMESG000007049.1 Contig3743uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008756SMED30008756SMESG000074654.1 Contig3743newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008756SMED30008756SMESG000074654.1 Contig3743uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007912SMED30007912SMESG000059785.1 Contig1211newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007912SMED30007912SMESG000059785.1 Contig1211uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007912SMED30007912SMESG000079004.1 Contig1211newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007912SMED30007912SMESG000079004.1 Contig1211uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015345TropomyosinSMESG000066854.1 Contig3688newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015345TropomyosinSMESG000066854.1 Contig3688uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015345TropomyosinSMESG000026500.1 Contig3688newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015345TropomyosinSMESG000026500.1 Contig3688uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020784SMED30020784SMESG000011782.1 Contig1076GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023334Partitioning defective 6SMESG000066854.1 Contig3688GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023334Partitioning defective 6SMESG000026500.1 Contig3688GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027595DUF3421 domain-containing proteinSMESG000020792.1 Contig1106GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027595DUF3421 domain-containing proteinSMESG000027124.1 Contig1106GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007156OxidoreductaseSMESG000002835.1 Contig5582GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007156OxidoreductaseSMESG000016829.1 Contig5582GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30006119X-box-binding protein 1SMESG000003891.1 Contig1388GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30006119X-box-binding protein 1SMESG000048111.1 Contig1388GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30000639Microtubule-actin cross-linking factor 1-like isoform X28SMESG000017517.1 PL08009A2C06ncbi_smed_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30003773SMED30003773SMESG000024822.1 Contig1490newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005549DDE_Tnp_1_7 domain-containing proteinSMESG000080555.1 SMESG000049002.1 SMESG000075946.1 SMESG000067287.1 SMESG000064983.1 SMESG000064843.1 SMESG000062987.1 SMESG000047155.1 SMESG000013953.1 Contig927newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005549DDE_Tnp_1_7 domain-containing proteinSMESG000080555.1 SMESG000049002.1 SMESG000075946.1 SMESG000067287.1 SMESG000064983.1 SMESG000064843.1 SMESG000062987.1 SMESG000047155.1 SMESG000013953.1 Contig927uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005549DDE_Tnp_1_7 domain-containing proteinSMESG000076100.1 Contig927newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005549DDE_Tnp_1_7 domain-containing proteinSMESG000076100.1 Contig927uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004461Lateral signaling target protein 2 homologSMESG000080555.1 SMESG000049002.1 SMESG000075946.1 SMESG000067287.1 SMESG000064983.1 SMESG000064843.1 SMESG000062987.1 SMESG000047155.1 SMESG000013953.1 Contig927GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004461Lateral signaling target protein 2 homologSMESG000076100.1 Contig927GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016150RUN and FYVE domain-containing protein 2-likeSMESG000050873.1 Contig2383GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011534Nucleobindin-2SMESG000022270.1 Contig2769GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014901ATP-binding cassette sub-family A member 3-like ProteinSMESG000080870.1 Contig6189newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014901ATP-binding cassette sub-family A member 3-like ProteinSMESG000080870.1 Contig6189uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001490ADF-H domain-containing proteinSMESG000080129.1 Contig513GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004606Cytochrome P450 2K1-like proteinSMESG000020470.1 Contig1680GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007434NADPH:adrenodoxin oxidoreductase, mitochondrialSMESG000050975.1 Contig7307newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007434NADPH:adrenodoxin oxidoreductase, mitochondrialSMESG000050975.1 Contig7307uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019325Myosin regulatory light chainSMESG000000175.1 Contig2068GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019325Myosin regulatory light chainSMESG000036544.1 Contig3175GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019325Myosin regulatory light chainSMESG000068156.1 SMESG000064685.1 SMESG000043474.1 SMESG000010609.1 SMESG000076470.1 SMESG000073857.1 SMESG000062429.1 SMESG000058575.1 SMESG000053533.1 SMESG000020635.1 SMESG000015751.1 SMESG000005260.1 Contig246GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019325Myosin regulatory light chainSMESG000000175.1 Contig246GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019325Myosin regulatory light chainSMESG000000175.1 Contig3175GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30022956Regulator of microtubule dynamics protein 1SMESG000038855.1 Contig2191GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030127bcl2-like proteinSMESG000043462.1 Contig210GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014613Cytochrome P450 3A31SMESG000013752.1 dd_Smed_v4_4319_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30012447FilaminSMESG000064795.1 dd_Smed_v4_2272_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30018632Protein kinase domain-containing proteinSMESG000017261.1 dd_Smed_v4_2030_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30004634Mitochondrial processing peptidase beta subunitSMESG000037024.1 dd_Smed_v4_729_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30013161SMED30013161SMESG000051379.1 dd_Smed_v4_2630_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30007434NADPH:adrenodoxin oxidoreductase, mitochondrialSMESG000050975.1 dd_Smed_v4_8668_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30008044Coiled-coil domain-containing protein 22 homologSMESG000036456.1 dd_Smed_v4_5400_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30005762Contactin/TAG-1 cell adhesion moleculeSMESG000036495.1 dd_Smed_v4_2673_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30006469TNF receptor-associated factorSMESG000067216.1 dd_Smed_v4_2669_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30021774NADH dehydrogenase ubiquinone 1 beta subcomplex subunit 6SMESG000026865.1 dd_Smed_v4_1994_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30029426Baculoviral IAP repeat-containing protein 7SMESG000067789.1 dd_Smed_v4_1187_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30035569Phospholipid-transporting ATPaseSMESG000000504.1 dd_Smed_v4_1372_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30030498DUF862 domain-containing proteinSMESG000024663.1 dd_Smed_v4_1296_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30032374SMED30032374SMESG000048179.1 dd_Smed_v4_9300_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30029626SMED30029626SMESG000034921.1 dd_Smed_v4_122_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30028890Bravo_FIGEY domain-containing proteinSMESG000065363.1 SMESG000043141.1 dd_Smed_v4_1294_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30034681cAMP-dependent protein kinase catalytic subunitSMESG000016651.1 dd_Smed_v4_911_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30031345Pyruvate dehydrogenase E1 component subunit alphaSMESG000073271.1 dd_Smed_v4_1310_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30029249Serine/threonine-protein kinase NIM1SMESG000005159.1 dd_Smed_v4_15794_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30031134slc13a-3SMESG000050959.1 dd_Smed_v4_1171_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30028526SMED30028526SMESG000027404.1 dd_Smed_v4_11845_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30035143PiggyBac transposable element-derived protein 2SMESG000052698.1 SMESG000027142.1 SMESG000059994.1 dd_Smed_v4_1029_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30034590Post-GPI attachment to proteins factor 2-likeSMESG000044614.1 dd_Smed_v4_10182_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30028921SMED30028921SMESG000024592.1 SMESG000013347.1 dd_Smed_v4_1308_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED3003581640S ribosomal protein S13SMESG000042470.1 SMESG000042447.1 dd_Smed_v4_360_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30031980Neuropeptide-18SMESG000034720.1 dd_Smed_v4_1117_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30031654SMED30031654SMESG000064362.1 dd_Smed_v4_3795_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30022956Regulator of microtubule dynamics protein 1SMESG000038855.1 dd_Smed_v4_502_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30034862SMED30034862SMESG000049533.1 dd_Smed_v4_3835_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30028431Transmembrane protein 62SMESG000026204.1 dd_Smed_v4_11926_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30029442epidermal growth factor receptor 2SMESG000004201.1 SMESG000004200.1 dd_Smed_v4_10499_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30021940SMED30021940SMESG000017261.1 dd_Smed_v4_2030_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30034045N(G),N(G)-dimethylarginine dimethylaminohydrolaseSMESG000056249.1 dd_Smed_v4_1460_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30029738Cytochrome b-c1 complex subunit Rieske, mitochondrialSMESG000009447.1 dd_Smed_v4_1515_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30029587V-type proton ATPase subunit HSMESG000014341.1 dd_Smed_v4_1452_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30033568Non-specific serine/threonine protein kinaseSMESG000022857.1 dd_Smed_v4_4198_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30035692Long-chain specific acyl-CoA dehydrogenase, mitochondrialSMESG000081273.1 SMESG000081269.1 dd_Smed_v4_1458_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30035909WD_REPEATS_REGION domain-containing proteinSMESG000073045.1 dd_Smed_v4_3294_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30021479SMED30021479SMESG000017261.1 dd_Smed_v4_2030_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30035769Four and a half LIM domains proteinSMESG000023063.1 dd_Smed_v4_1251_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30032420SMED30032420SMESG000050229.1 SMESG000050221.1 dd_Smed_v4_1219_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30033302RNA-binding protein MEX3BSMESG000044270.1 SMESG000030021.1 SMESG000025422.1 dd_Smed_v4_1999_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30030027Ast8 proteinSMESG000073667.1 dd_Smed_v4_254_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30033810DLH domain-containing proteinSMESG000077560.1 dd_Smed_v4_2062_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30032475DUF89 domain-containing proteinSMESG000008042.1 dd_Smed_v4_2075_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30032334SMED30032334SMESG000025704.1 dd_Smed_v4_425_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30035808Serine/threonine-protein kinase fusedSMESG000078509.1 SMESG000078507.1 dd_Smed_v4_4259_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30032448Expressed conserved proteinSMESG000064362.1 dd_Smed_v4_3795_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30031930S-like RNaseSMESG000016389.1 dd_Smed_v4_1008_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30028080SMED30028080SMESG000024479.1 dd_Smed_v4_1163_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30012087SMED30012087 dd_Smed_v4_13997_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30005396SMED30005396 dd_Smed_v4_14268_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30016330SMED30016330 dd_Smed_v4_12993_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30011607SMED30011607 dd_Smed_v4_15559_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30014164Vacuolar protein sorting-associated protein 29 dd_Smed_v4_1727_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30013591Fructose-bisphosphate aldolaseSMESG000027545.1 dd_Smed_v4_398_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30005911SMED30005911 dd_Smed_v4_12_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30002807Retrovirus-related Pol polyprotein from transposon dd_Smed_v4_12993_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30014307SMED30014307SMESG000064621.1 dd_Smed_v4_5431_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30006764Phosphatidylinositol 3-kinase regulatory subunit alphaSMESG000078199.1 dd_Smed_v4_4794_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30005661Ras-related protein Rab-7aSMESG000068863.1 dd_Smed_v4_491_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30011313Acyl-protein thioesterase 1SMESG000058272.1 dd_Smed_v4_638_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30009430Fructose-bisphosphate aldolaseSMESG000006056.1 dd_Smed_v4_591_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30015350C2H2-type domain-containing protein dd_Smed_v4_17318_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30008411Aldo_ket_red domain-containing proteinSMESG000053228.1 dd_Smed_v4_487_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30015391SMED30015391 dd_Smed_v4_17553_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30001449Propionyl-CoA carboxylase subunit beta dd_Smed_v4_513_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30013592SMED30013592 dd_Smed_v4_1287_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30012725Arf-GAP with dual PH domain-containing 1 isoform X2SMESG000016864.1 dd_Smed_v4_5945_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30015291SMED30015291SMESG000014369.1 dd_Smed_v4_470_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30008318Importin N-terminal domain-containing proteinSMESG000039950.1 dd_Smed_v4_6036_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30013454Bromodomain-containing protein 2SMESG000015058.1 dd_Smed_v4_4933_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30013177Importin subunit alphaSMESG000058125.1 SMESG000055942.1 dd_Smed_v4_590_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30012358Cytochrome b5SMESG000023205.1 dd_Smed_v4_567_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30004616Lipopolysaccharide choline phosphotransferase proteinSMESG000025873.1 dd_Smed_v4_5971_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30012152Lysine-specific demethylase 5ASMESG000015058.1 dd_Smed_v4_4933_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30008458Lysosomal alpha-glucosidase-likeSMESG000005069.1 dd_Smed_v4_4668_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30017937WASP like actin nucleation promoting factor bSMESG000074788.1 dd_Smed_v4_1987_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30004319Coiled-coil domain containing 88CSMESG000066575.1 SMESG000066583.1 dd_Smed_v4_5291_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30019383G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000079764.1 dd_Smed_v4_5388_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30034477Transducer of ERBB2, 1bSMESG000063539.1 dd_Smed_v4_7444_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30028497AdenosylhomocysteinaseSMESG000012954.1 SMESG000012950.1 dd_Smed_v4_526_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30024140Epithelial discoidin domain-containing receptorSMESG000070377.1 dd_Smed_v4_7988_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30033886Slc15a-7SMESG000009945.1 dd_Smed_v4_7909_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30029745SMED30029745SMESG000003948.1 dd_Smed_v4_5093_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30027303Methylcrotonoyl-CoA carboxylase 2 (beta)SMESG000035087.1 dd_Smed_v4_5574_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30023889SMED30023889SMESG000055805.1 dd_Smed_v4_857_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30032489SMED30032489SMESG000078525.1 dd_Smed_v4_7485_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30026845SMED30026845SMESG000038704.1 dd_Smed_v4_555_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30026845SMED30026845SMESG000038702.1 SMESG000038692.1 dd_Smed_v4_637_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30029272slc6a-1SMESG000018924.1 dd_Smed_v4_8169_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30030499Chromosome X CXorf58 homologSMESG000061012.1 dd_Smed_v4_8151_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30020433Oxalate:formate antiporterSMESG000061390.1 dd_Smed_v4_4769_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30024316RibokinaseSMESG000024727.1 dd_Smed_v4_3352_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30035725Betaine--homocysteine S-methyltransferase 1SMESG000019342.1 dd_Smed_v4_873_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30031091activin 1SMESG000024833.1 SMESG000024831.1 dd_Smed_v4_4120_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30029763histone H1SMESG000024348.1 SMESG000010800.1 dd_Smed_v4_601_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30035469activin 2SMESG000078459.1 dd_Smed_v4_3324_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30031252SMED30031252SMESG000017120.1 dd_Smed_v4_6865_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30023015LIM/homeobox proteinSMESG000001774.1 dd_Smed_v4_8190_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30032354EOG090X01A3SMESG000003246.1 dd_Smed_v4_5932_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30025363SMED30025363SMESG000014711.1 dd_Smed_v4_1754_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30030270Proteasome subunit betaSMESG000016299.1 dd_Smed_v4_1771_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30032233SMED30032233SMESG000080577.1 dd_Smed_v4_19517_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30029603SMED30029603SMESG000071278.1 dd_Smed_v4_1649_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30027349CLUMA_CG020609, isoform ASMESG000019984.1 dd_Smed_v4_396_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30027349CLUMA_CG020609, isoform ASMESG000019986.1 dd_Smed_v4_1706_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30035307Forkhead box C1SMESG000015673.1 dd_Smed_v4_16297_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30034290Ribosomal protein L24SMESG000014001.1 dd_Smed_v4_1638_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30030459SMED30030459SMESG000041220.1 dd_Smed_v4_14151_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30011865Serine/threonine-protein kinase Nek10SMESG000037692.1 SMESG000037689.1 dd_Smed_v4_17530_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30014491Aldehyde dehydrogenaseSMESG000010552.1 dd_Smed_v4_1680_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30008405Scavenger receptor class B, member 2SMESG000058915.1 dd_Smed_v4_2304_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30005820SMED30005820SMESG000080577.1 dd_Smed_v4_19517_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED3000412414-3-3 protein beta/alphaSMESG000055903.1 dd_Smed_v4_138_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30001408Tyrosine-protein phosphatase Lar-likeSMESG000042151.1 dd_Smed_v4_16093_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30007718Flotillin-1SMESG000063612.1 dd_Smed_v4_1887_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30001710Vacuolar protein sorting 4SMESG000075482.1 dd_Smed_v4_1556_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30015674TAR DNA-binding protein 43SMESG000032661.1 SMESG000006486.1 dd_Smed_v4_1408_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED3002420240S ribosomal protein S14SMESG000036550.1 dd_Smed_v4_139_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30022209ATPase family AAA domain containing proteinSMESG000003318.1 dd_Smed_v4_1807_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30029098Oxygen-dependent coproporphyrinogen-III oxidaseSMESG000039696.1 dd_Smed_v4_2002_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30021037RibonucloproteinSMESG000027962.1 dd_Smed_v4_1928_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30021161MARVEL domain-containing proteinSMESG000013795.1 dd_Smed_v4_1798_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30006378PRELI/MSF1 domain-containing proteinSMESG000034043.1 dd_Smed_v4_922_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30017941Clustered mitochondria protein homologSMESG000033500.1 dd_Smed_v4_1597_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30019784Oxalate:formate antiporterSMESG000069668.1 dd_Smed_v4_10829_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30007348SMED30007348SMESG000043828.1 dd_Smed_v4_10959_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30002471Peptidase inhibitor 16SMESG000066259.1 dd_Smed_v4_2021_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30007199IlvB (bacterial acetolactate synthase)-likeSMESG000026596.1 dd_Smed_v4_1784_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30011475Glycosylated lysosomal membrane-like proteinSMESG000062685.1 dd_Smed_v4_2685_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30007750Very-long-chain enoyl-CoA reductaseSMESG000020075.1 dd_Smed_v4_2085_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30010541F-actin-capping protein subunit betaSMESG000008209.1 dd_Smed_v4_1165_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30006092SMED30006092SMESG000020731.1 SMESG000020729.1 dd_Smed_v4_11220_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30018460Charged multivesicular body protein 2bSMESG000054476.1 dd_Smed_v4_1514_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30003335LipaseSMESG000014678.1 dd_Smed_v4_257_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30005665SMED30005665SMESG000074689.1 dd_Smed_v4_2429_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30012386Alpha-1,4 glucan phosphorylaseSMESG000061417.1 dd_Smed_v4_1532_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30009119Ankyrin-2SMESG000058557.1 dd_Smed_v4_1432_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30005631SMED30005631SMESG000047012.1 SMESG000047013.1 dd_Smed_v4_1450_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30008070DAO domain-containing proteinSMESG000037253.1 dd_Smed_v4_10791_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30019288Reticulocalbin 3SMESG000012033.1 dd_Smed_v4_1417_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30019023SMED30019023SMESG000044672.1 dd_Smed_v4_17465_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED300116841-phosphatidylinositol 4,5-bisphosphate phosphodiesteraseSMESG000049234.1 dd_Smed_v4_3221_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30012379SMED30012379SMESG000058557.1 dd_Smed_v4_1432_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30018688TNF receptor-associated factorSMESG000070130.1 SMESG000070126.1 dd_Smed_v4_1439_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30017811Alpha actininSMESG000047739.1 dd_Smed_v4_1492_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30017042V-type proton ATPase subunit ESMESG000064093.1 dd_Smed_v4_1494_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30011014acetolactate synthase-like proteinSMESG000026596.1 dd_Smed_v4_1784_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30010124protein arginine methyltransferase 1-like proteinSMESG000038804.1 dd_Smed_v4_1755_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30014724Tetraspanin-CD63 receptorSMESG000041117.1 dd_Smed_v4_1378_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30009861slc26a-3SMESG000064565.1 dd_Smed_v4_11142_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30009385SMED30009385SMESG000031786.1 dd_Smed_v4_1365_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30007550SMED30007550SMESG000031950.1 dd_Smed_v4_10910_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30019975E3 ubiquitin-protein ligaseSMESG000008708.1 dd_Smed_v4_1444_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30019094Protein flightless-1SMESG000020935.1 dd_Smed_v4_1781_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30003788Mitochondrial import receptor subunit TOM70SMESG000070017.1 dd_Smed_v4_2190_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30019306Pyridoxal 5'-phosphate synthase subunit PdxTSMESG000058074.1 dd_Smed_v4_1595_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30002262Heat shock cognate 71 kDa proteinSMESG000051570.1 SMESG000051567.1 SMESG000051541.1 SMESG000051540.1 dd_Smed_v4_320_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30011190Cytosolic Fe-S cluster assembly factor NUBP2 homologSMESG000019851.1 SMESG000019820.1 dd_Smed_v4_1094_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30002034SMED30002034SMESG000001789.1 dd_Smed_v4_3076_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30008163Usp domain-containing proteinSMESG000039918.1 dd_Smed_v4_2433_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30019477Glucosidase 2 subunit betaSMESG000051850.1 dd_Smed_v4_1730_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30000289SMED30000289SMESG000076644.1 SMESG000076643.1 dd_Smed_v4_227_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30012914SMED30012914SMESG000028186.1 dd_Smed_v4_2368_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30008017Usp domain-containing proteinSMESG000020955.1 dd_Smed_v4_1068_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30005161Failed axon connections homologSMESG000039746.1 dd_Smed_v4_1736_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30010208Malate dehydrogenaseSMESG000035456.1 dd_Smed_v4_1954_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED3000448460S ribosomal protein L8SMESG000017087.1 dd_Smed_v4_108_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30006150HTH CENPB-type domain-containing proteinSMESG000047012.1 SMESG000047013.1 dd_Smed_v4_1450_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30006150HTH CENPB-type domain-containing proteinSMESG000081298.1 SMESG000023765.1 SMESG000016276.1 SMESG000004841.1 dd_Smed_v4_8652_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30015373SMED30015373SMESG000000625.1 dd_Smed_v4_1629_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED3000665560S ribosomal protein L32SMESG000060036.1 dd_Smed_v4_149_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30010203C2H2-type domain-containing proteinSMESG000067728.1 dd_Smed_v4_1455_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30008063SMED30008063SMESG000043378.1 dd_Smed_v4_1685_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30005603TIR domain-containing proteinSMESG000065938.1 dd_Smed_v4_13709_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30013396perilipin-2 isoform X1SMESG000075481.1 dd_Smed_v4_154_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30008295Heat shock cognate 71 kDa proteinSMESG000051570.1 SMESG000051567.1 SMESG000051541.1 SMESG000051540.1 dd_Smed_v4_320_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30009566SMED30009566SMESG000015985.1 dd_Smed_v4_4240_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30011205SMED30011205SMESG000056922.1 dd_Smed_v4_11352_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30019103TetraspaninSMESG000021627.1 dd_Smed_v4_1650_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30023223Glutamate receptor ionotropicSMESG000005067.1 dd_Smed_v4_11004_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30033014Phosphatidylinositol-4,5-bisphosphate 4-phosphataseSMESG000063221.1 dd_Smed_v4_1079_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30027683Golgi phosphoprotein 3SMESG000073543.1 SMESG000073542.1 dd_Smed_v4_1770_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30020355SH3 domain-containing kinase-binding protein 1SMESG000079662.1 dd_Smed_v4_1522_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30021335G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000016714.1 dd_Smed_v4_11488_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED3002728060S acidic ribosomal protein P0SMESG000079482.1 dd_Smed_v4_161_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30027991L-2-hydroxyglutarate dehydrogenase, mitochondrialSMESG000046453.1 SMESG000024353.1 dd_Smed_v4_1758_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30023558Autophagy-related protein 3SMESG000062512.1 dd_Smed_v4_1915_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30022089heterogeneous nuclear ribonucleoprotein KSMESG000033971.1 dd_Smed_v4_1569_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30024429SMED30024429SMESG000037418.1 dd_Smed_v4_1471_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30022511SMED30022511SMESG000019851.1 SMESG000019820.1 dd_Smed_v4_1094_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30020683V-type proton ATPase proteolipid subunitSMESG000042238.1 dd_Smed_v4_1622_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED3002930240S ribosomal protein S16SMESG000018349.1 SMESG000018333.1 dd_Smed_v4_170_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30033164Heat shock 70 kDa proteinSMESG000041117.1 dd_Smed_v4_1378_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30034751Elongation factor G, mitochondrialSMESG000035436.1 dd_Smed_v4_1879_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30034004SMED30034004SMESG000004927.1 dd_Smed_v4_1659_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30021613Nesprin-1SMESG000077685.1 SMESG000072345.1 dd_Smed_v4_11466_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30024185slc10a-5SMESG000064830.1 dd_Smed_v4_11330_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30024210BRO1 domain-containing protein BROXSMESG000055804.1 dd_Smed_v4_1658_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30010350SMED30010350SMESG000017804.1 SMESG000017801.1 dd_Smed_v4_1_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007383GCR103SMESG000061776.1 dd_Smed_v4_7534_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019378Exocyst complex componentSMESG000065870.1 dd_Smed_v4_2186_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30033902sec1 family domain-containing protein 1SMESG000044570.1 dd_Smed_v4_2992_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017862Jagged 2-1SMESG000025147.1 dd_Smed_v4_4792_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30009281Netrin-4SMESG000062589.1 dd_Smed_v4_6093_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028401InnexinSMESG000056430.1 AY967558smed_ncbi_20200123PMID:17670787
Oviedo et al., 2007
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024236InnexinSMESG000056430.1 AY967558smed_ncbi_20200123PMID:17670787
Oviedo et al., 2007
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30006752TorSMESG000025384.1 JF894291.2smed_ncbi_20200123PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30006752TorSMESG000025384.1 JF894291.2smed_ncbi_20200123PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult fluorescence in situ hybridization evidence
gutSMED30014131RPTOR independent companion of MTOR, complex 2 aSMESG000033571.1 SMESG000033570.1 JN815259.1smed_ncbi_20200123PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30022631Dimer_Tnp_hAT domain-containing proteinSMESG000049778.1 SMESG000048378.1 SMESG000039423.1 SMESG000039024.1 SMESG000024543.1 SMESG000022136.1 SMESG000002434.1 JF894290.2smed_ncbi_20200123PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult fluorescence in situ hybridization evidence
gutSMED30022631Dimer_Tnp_hAT domain-containing proteinSMESG000049778.1 SMESG000048378.1 SMESG000039423.1 SMESG000039024.1 SMESG000024543.1 SMESG000022136.1 SMESG000002434.1 JF894290.2smed_ncbi_20200123PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001723HTH CENPB-type domain-containing proteinSMESG000049778.1 SMESG000048378.1 SMESG000039423.1 SMESG000039024.1 SMESG000024543.1 SMESG000022136.1 SMESG000002434.1 JF894290.2smed_ncbi_20200123PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult fluorescence in situ hybridization evidence
gutSMED30001723HTH CENPB-type domain-containing proteinSMESG000049778.1 SMESG000048378.1 SMESG000039423.1 SMESG000039024.1 SMESG000024543.1 SMESG000022136.1 SMESG000002434.1 JF894290.2smed_ncbi_20200123PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028047Regulatory-associated protein of mTORSMESG000049778.1 SMESG000048378.1 SMESG000039423.1 SMESG000039024.1 SMESG000024543.1 SMESG000022136.1 SMESG000002434.1 JF894290.2smed_ncbi_20200123PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult fluorescence in situ hybridization evidence
gutSMED30028047Regulatory-associated protein of mTORSMESG000049778.1 SMESG000048378.1 SMESG000039423.1 SMESG000039024.1 SMESG000024543.1 SMESG000022136.1 SMESG000002434.1 JF894290.2smed_ncbi_20200123PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30003448Glycine N-methyltransferaseSMESG000037719.1 SmedASXL_008095SmedAsxl_ww_GCZZ01PMID:29158443
He et al., 2017
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007461Ubiquitin-60S ribosomal protein L40SMESG000066595.1 SmedASXL_002380SmedAsxl_ww_GCZZ01PMID:29158443
He et al., 2017
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002437SMED30002437 SmedASXL_052019SmedAsxl_ww_GCZZ01PMID:29158443
He et al., 2017
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30031208Histone-lysine N-methyltransferase SETMAR SmedASXL_077649SmedAsxl_ww_GCZZ01PMID:29158443
He et al., 2017
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30018398Superoxide dismutase [Cu-Zn]SMESG000005021.1 SmedASXL_019073SmedAsxl_ww_GCZZ01PMID:29158443
He et al., 2017
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032008PhosphodiesteraseSMESG000056509.1 SmedASXL_014050SmedAsxl_ww_GCZZ01PMID:29158443
He et al., 2017
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013673SMED30013673SMESG000035327.1 SmedASXL_016646SmedAsxl_ww_GCZZ01PMID:29158443
He et al., 2017
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020231DUF3421 domain-containing proteinSMESG000046728.1 SmedASXL_004676SmedAsxl_ww_GCZZ01PMID:29158443
He et al., 2017
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001319slc24a-8SMESG000030115.1 SmedASXL_015989SmedAsxl_ww_GCZZ01PMID:29158443
He et al., 2017
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029625slc39a-1SMESG000016191.1 SmedASXL_003002SmedAsxl_ww_GCZZ01PMID:29158443
He et al., 2017
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30003196Adenosine kinaseSMESG000027213.1 tr5_1296mu_Smed_v1PMID:25558068
Reuter et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
gutSMED30008875SMED30008875SMESG000027213.1 tr5_1296mu_Smed_v1PMID:25558068
Reuter et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
gutSMED30034772Fibrillar collagen NC1 domain-containing proteinSMESG000077977.1 tr5_2051mu_Smed_v1PMID:25558068
Reuter et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004928phosphatidylinositol 4-kinase betaSMESG000061430.1 tr5_4416mu_Smed_v1PMID:25558068
Reuter et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015406TNF receptor-associated factorSMESG000035446.1 tr5_1521mu_Smed_v1PMID:25558068
Reuter et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
gutSMED30010096TPA_inf: prohormone convertase 2SMESG000008070.1 tr5_785mu_Smed_v1PMID:25558068
Reuter et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012449ralBP1-associated Eps domain-containing protein 1 isoform X8SMESG000023078.1 tr5_3835mu_Smed_v1PMID:25558068
Reuter et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030074Mothers against decapentaplegic homologSMESG000029614.1 SMED30030074smed_20140614PMID:25558068
Reuter et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016511SMED30016511SMESG000072006.1 tr5_6444mu_Smed_v1PMID:25558068
Reuter et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30025591porcupine-like proteinSMESG000051516.1 EU130791.1smed_ncbi_20200123PMID:29557542
Han et al., 2019
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015041Retinoic acid receptor betaSMESG000054304.1 SMED30015041smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
gutSMED30000459Dynamin-1-like proteinSMESG000058940.1 dd_Smed_v4_388_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30010986Lysyl oxidase-likeSMESG000078255.1 dd_Smed_v4_10591_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30007255Ras responsive element binding protein 1SMESG000059614.1 dd_Smed_v4_10103_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30005717BAR domain-containing proteinSMESG000000639.1 dd_Smed_v4_1387_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30001121Metabotropic glutamate receptor-likeSMESG000058947.1 dd_Smed_v4_10130_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30028574Cytochrome P450 2K1-like proteinSMESG000078092.1 SMESG000078091.1 dd_Smed_v4_2351_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30030007RootletinSMESG000071494.1 dd_Smed_v4_1404_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30025807RuvB-like helicaseSMESG000033997.1 SMESG000018207.1 dd_Smed_v4_2547_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30005523Alpha-actininSMESG000026000.1 dd_Smed_v4_1951_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30000690Protocadherin 1bSMESG000043679.1 dd_Smed_v4_2654_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30004747Cytochrome P450SMESG000013786.1 SMESG000013783.1 SMESG000011362.1 dd_Smed_v4_2257_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30003360LipaseSMESG000002840.1 dd_Smed_v4_1565_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30017430Protein disulfide-isomeraseSMESG000023147.1 dd_Smed_v4_250_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30002332TNF receptor associated factor-2SMESG000070267.1 dd_Smed_v4_2599_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30003929Pyridoxal 5'-phosphate synthase subunit PdxSSMESG000026036.1 dd_Smed_v4_1240_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30016829Canalicular multispecific organic anion transporter 2SMESG000039911.1 SMESG000039910.1 dd_Smed_v4_3982_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30001366SMED30001366SMESG000014648.1 dd_Smed_v4_1227_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30005074Protein kinase domain-containing proteinSMESG000014619.1 dd_Smed_v4_1212_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED3002552260 kDa heat shock protein, mitochondrialSMESG000065325.1 dd_Smed_v4_141_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30028938Protein disulfide-isomerase A6SMESG000023147.1 dd_Smed_v4_250_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30022232Glutathione s-transferaseSMESG000016846.1 dd_Smed_v4_1206_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30007637SMED30007637SMESG000066417.1 SMESG000066414.1 dd_Smed_v4_132_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30007637SMED30007637SMESG000066417.1 SMESG000066414.1 dd_132dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
gutSMED30012357SMED30012357SMESG000041431.1 dd_Smed_v4_12848_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30006386Ceroid-lipofuscinosis neuronal protein 5SMESG000027389.1 dd_Smed_v4_3125_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30010860SMED30010860SMESG000022836.1 SMESG000013870.1 dd_Smed_v4_17481_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30008388slc1a-4SMESG000064122.1 dd_Smed_v4_11206_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30010103Splicing factor arginine:serine richSMESG000041611.1 dd_Smed_v4_1935_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30007161SMED30007161SMESG000070072.1 dd_Smed_v4_1789_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30009255Solute carrier family 12 member 9SMESG000033021.1 dd_Smed_v4_1738_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED3000985940S ribosomal protein S24SMESG000035929.1 dd_Smed_v4_164_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30010687Serine/threonine-protein kinase STE20SMESG000014619.1 dd_Smed_v4_1212_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30006247SMED30006247SMESG000070072.1 dd_Smed_v4_1789_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30008385Solute carrier family 13 member 2SMESG000041335.1 dd_Smed_v4_12964_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30008856SMED30008856SMESG000025888.1 dd_Smed_v4_1422_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30013155SMED30013155SMESG000019927.1 SMESG000019926.1 dd_Smed_v4_1347_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30015414G_PROTEIN_RECEP_F2_4 domain-containing proteinSMESG000070072.1 dd_Smed_v4_1789_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30015414G_PROTEIN_RECEP_F2_4 domain-containing proteinSMESG000033615.1 dd_Smed_v4_10981_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30017135Dual specificity mitogen-activated protein kinase kinase 6SMESG000040748.1 dd_Smed_v4_2106_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30017135Dual specificity mitogen-activated protein kinase kinase 6SMESG000017824.1 dd_Smed_v4_1568_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30016220Heparan-alpha-glucosaminide N-acetyltransferaseSMESG000032702.1 dd_Smed_v4_1884_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30019298Heterogeneous nuclear ribonucleoprotein LSMESG000005298.1 dd_Smed_v4_1327_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30019518SMED30019518SMESG000073002.1 SMESG000072984.1 dd_Smed_v4_12680_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30018812protein kinase C-binding protein NELL1-likeSMESG000066109.1 dd_Smed_v4_11653_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30017554FerritinSMESG000030981.1 dd_Smed_v4_1261_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30017337Serine/threonine kinaseSMESG000014619.1 dd_Smed_v4_1212_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30019280SMED30019280SMESG000050162.1 dd_Smed_v4_1101_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30019226SMED30019226SMESG000047314.1 dd_Smed_v4_12313_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30021896SMED30021896SMESG000041611.1 dd_Smed_v4_1935_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30022453AquaporinSMESG000023352.1 dd_Smed_v4_1224_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30020825Protein I'm not dead yetSMESG000041335.1 dd_Smed_v4_12964_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30020035DNA polymerase subunit gammaSMESG000050799.1 dd_Smed_v4_13411_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30026298Protein kinase domain-containing proteinSMESG000014619.1 dd_Smed_v4_1212_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30021516MICOS complex subunit MIC60SMESG000066687.1 dd_Smed_v4_1605_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30020538Ss-alanyl conjugating enzymeSMESG000023215.1 dd_Smed_v4_17289_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30025874SMED30025874SMESG000014644.1 dd_Smed_v4_1924_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30026906SMED30026906SMESG000021439.1 dd_Smed_v4_14418_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30035852Ubiquitin-60S ribosomal protein L40SMESG000035681.1 dd_Smed_v4_176_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30028172Serine palmitoyltransferase 2SMESG000016646.1 dd_Smed_v4_1633_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30032290SMED30032290SMESG000014241.1 SMESG000014240.1 dd_Smed_v4_185_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30026166SMED30026166SMESG000017270.1 dd_Smed_v4_13958_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30026225SMED30026225SMESG000059698.1 dd_Smed_v4_188_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30024778SMB domain-containing proteinSMESG000022577.1 dd_Smed_v4_5786_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30026136Nad dependent epimerase dehydrataseSMESG000035068.1 dd_Smed_v4_3452_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30030055Protocadherin-9SMESG000033582.1 dd_Smed_v4_5930_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30030323Purine nucleoside phosphorylaseSMESG000078773.1 dd_Smed_v4_786_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30024035Serine/Threonine kinase domain proteinSMESG000071539.1 dd_Smed_v4_5501_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30023981SMED30023981SMESG000026344.1 SMESG000026343.1 dd_Smed_v4_5515_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30029203SMED30029203SMESG000026183.1 dd_Smed_v4_4644_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30027689LipaseSMESG000074185.1 dd_Smed_v4_4693_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30027566SMED30027566SMESG000075236.1 dd_Smed_v4_7519_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30030151T-complex protein 1 subunit zetaSMESG000049015.1 dd_Smed_v4_527_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30023228SMED30023228SMESG000058720.1 dd_Smed_v4_7931_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30023289Lysocardiolipin acyltransferase 1SMESG000041961.1 dd_Smed_v4_8322_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30028073Mitochondrial import inner membrane translocase subunit TIM23SMESG000041020.1 dd_Smed_v4_825_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED3003151240S ribosomal protein S21SMESG000004954.1 dd_Smed_v4_84_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30027070protein FAM136ASMESG000021181.1 dd_Smed_v4_6009_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30025547Ganglioside-induced differentiation-associated-protein 2SMESG000047156.1 SMESG000047127.1 SMESG000037456.1 SMESG000037449.1 dd_Smed_v4_8031_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30024849SMED30024849SMESG000027221.1 dd_Smed_v4_6047_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30028602SMED30028602SMESG000000283.1 dd_Smed_v4_8424_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30035683V-type proton ATPase subunit aSMESG000044136.1 SMESG000037609.1 dd_Smed_v4_833_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30028902DNA-directed RNA polymeraseSMESG000026344.1 SMESG000026343.1 dd_Smed_v4_5515_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30030386SMED30030386SMESG000026344.1 SMESG000026343.1 dd_Smed_v4_5515_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30024637SMED30024637SMESG000000222.1 dd_Smed_v4_3200_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30030190Epidermal growth factor Smed-egf-2SMESG000022750.1 dd_Smed_v4_4666_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30031209Calcium release-activated calcium channel protein 1SMESG000032795.1 SMESG000032781.1 dd_Smed_v4_8774_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED300212652-acylglycerol O-acyltransferase 2SMESG000052656.1 dd_Smed_v4_6550_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30026133BTB domain-containing proteinSMESG000073620.1 dd_Smed_v4_6327_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30035373histone deacetylase 1SMESG000060876.1 dd_Smed_v4_695_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30007734U2 snRNP auxiliary factor large subunitSMESG000018652.1 SMESG000018647.1 dd_Smed_v4_3025_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30016094SMED30016094 dd_Smed_v4_2212_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30019959NADH dehydrogenase subunit 4 dd_Smed_v4_292_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30019959NADH dehydrogenase subunit 4 dd_Smed_v4_344_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30018984prefoldin subunit 2SMESG000075156.1 SMESG000075150.1 dd_Smed_v4_1368_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30008954slc13a-1SMESG000024526.1 SMESG000024525.1 dd_Smed_v4_5476_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30011303Syndecan binding protein (Syntenin) dd_Smed_v4_387_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30006820cilia- and flagella-associated protein 57SMESG000072029.1 dd_Smed_v4_3323_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30000190SMED30000190SMESG000043124.1 dd_Smed_v4_3018_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30007460SMED30007460 dd_Smed_v4_7907_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30012451SMED30012451 dd_Smed_v4_215_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30002394Dehydrogenase/reductase SDR family member 7BSMESG000047014.1 dd_Smed_v4_3512_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30004495SMED30004495 dd_Smed_v4_34917_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30014243Lysosomal aspartic proteaseSMESG000035344.1 dd_Smed_v4_329_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30017863SMED30017863 dd_Smed_v4_3302_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30001174SMED30001174 dd_Smed_v4_4983_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30012212NADH dehydrogenase subunit 1 dd_Smed_v4_258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30009030Selenoprotein W dd_Smed_v4_572_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30010253NADH dehydrogenase subunit 6 dd_Smed_v4_957_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30001962Protein kinase domain-containing proteinSMESG000017252.1 SMESG000017249.1 SMESG000017248.1 dd_Smed_v4_311_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30001962Protein kinase domain-containing proteinSMESG000017248.1 dd_Smed_v4_787_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30011479GGACT domain-containing protein dd_Smed_v4_7000_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30000753SMED30000753 dd_Smed_v4_4529_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30013571NADH dehydrogenase subunit 4L dd_Smed_v4_344_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30000702cytochrome b dd_Smed_v4_344_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30018956SMED30018956 dd_Smed_v4_2990_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30005334SMED30005334 dd_Smed_v4_344_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30016430SMED30016430 dd_Smed_v4_275_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30007563SulfotransferaseSMESG000046103.1 dd_Smed_v4_4622_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30016351SMED30016351 dd_Smed_v4_2295_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30000781SMED30000781SMESG000036926.1 SMESG000036919.1 dd_Smed_v4_4876_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30009147SMED30009147 dd_Smed_v4_782_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30017733E3 ubiquitin-protein ligase RNF13 dd_Smed_v4_4529_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30010015SMED30010015 dd_Smed_v4_34492_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30005937P2X purinoceptor dd_Smed_v4_16290_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED3000398760S ribosomal protein L29 dd_Smed_v4_481_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30005188Venom allergen 5 dd_Smed_v4_607_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30016928SMED30016928 dd_Smed_v4_37079_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30006347U2 small nuclear ribonucleoprotein B dd_Smed_v4_2274_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30019341ATP synthase subunit epsilon mitochondrial dd_Smed_v4_710_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30003196Adenosine kinaseSMESG000062286.1 SMESG000027213.1 dd_Smed_v4_627_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30013798Dual specificity phosphatase 10 dd_Smed_v4_653_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30011969SMED30011969 dd_Smed_v4_7907_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30004246SMED30004246 dd_Smed_v4_344_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30013373SMED30013373 dd_Smed_v4_34847_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30007461Ubiquitin-60S ribosomal protein L40SMESG000066595.1 dd_Smed_v4_338_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED3000651260S ribosomal protein L29 dd_Smed_v4_481_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30009609SMED30009609 dd_Smed_v4_4983_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30016139BPTI/Kunitz domain-containing protein 1 dd_Smed_v4_28_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30011412Ribosomal protein L37 dd_Smed_v4_97_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30019597Heterogeneous nuclear ribonucleoprotein,putative dd_Smed_v4_757_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30010375cytochrome c oxidase subunit I dd_Smed_v4_753_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30010732SMED30010732 dd_Smed_v4_7149_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30026119Histone-lysine N-methyltransferase SETMAR dd_Smed_v4_20619_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30033594Microtubule-associated protein 1ASMESG000014298.1 dd_Smed_v4_3654_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30023370Electron transfer flavoprotein-ubiquinone oxidoreductase dd_Smed_v4_3785_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30029849slc24a-5SMESG000022809.1 dd_Smed_v4_1009_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30029849slc24a-5SMESG000022809.1 dd_Smed_v4_9846_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED3002143360S ribosomal protein L39 dd_Smed_v4_394_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30021616Rho GTPase-activating proteinSMESG000060252.1 dd_Smed_v4_3376_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30033234SMED30033234 dd_Smed_v4_37328_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30021712SMED30021712 dd_Smed_v4_27887_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30031308ATP synthase F0 subunit 6 dd_Smed_v4_258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30032794SMED30032794 dd_Smed_v4_33896_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30034623cytochrome c oxidase subunit III dd_Smed_v4_258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED3003333640S ribosomal protein S29 dd_Smed_v4_214_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30034547SMED30034547 dd_Smed_v4_4369_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30020701Long-chain specific acyl-CoA dehydrogenaseSMESG000081273.1 SMESG000081269.1 dd_Smed_v4_1458_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30035298SMED30035298 dd_Smed_v4_4369_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30029216Calcium-transporting ATPaseSMESG000010260.1 dd_Smed_v4_1006_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30033740SMED30033740 dd_Smed_v4_258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30033740SMED30033740 dd_Smed_v4_957_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30028513Transcriptional activator protein Pur-beta dd_Smed_v4_346_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30031607Histone-lysine N-methyltransferaseSMESG000074842.1 Contig1168newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30031607Histone-lysine N-methyltransferaseSMESG000074842.1 Contig1168uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30031607Histone-lysine N-methyltransferaseSMESG000037819.1 Contig1168newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30031607Histone-lysine N-methyltransferaseSMESG000037819.1 Contig1168uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014645HP domain-containing proteinSMESG000075965.1 PL04009A1F04ncbi_smed_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011617Actin-related protein 2/3 complex subunit 4SMESG000043420.1 Contig1665GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011617Actin-related protein 2/3 complex subunit 4SMESG000003841.1 Contig1665GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016267beta-secretase 1SMESG000074842.1 Contig1168GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016267beta-secretase 1SMESG000037819.1 Contig1168GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30010792Protein kinaseSMESG000074416.1 SMESG000074407.1 Contig1629GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015783O-acyltransferaseSMESG000000989.1 SMESG000000988.1 Contig1658GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029578GGACT domain-containing proteinSMESG000077709.1 SMESG000073947.1 SMESG000043656.1 SMESG000043279.1 SMESG000008519.1 SMESG000001897.1 Contig22newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029578GGACT domain-containing proteinSMESG000013795.1 Contig22newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028347Engulfment and cell motility 3SMESG000013936.1 Contig1935GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028347Engulfment and cell motility 3SMESG000039535.1 Contig1935GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029111Chloride channel proteinSMESG000059757.1 Contig3698newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029111Chloride channel proteinSMESG000059757.1 Contig3698uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029111Chloride channel proteinSMESG000054316.1 Contig3698newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029111Chloride channel proteinSMESG000054316.1 Contig3698uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023460TTF-type domain-containing proteinSMESG000046135.1 Contig1594newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023220Transmembrane proteinSMESG000046135.1 Contig1594GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021127SMED30021127SMESG000037626.1 Contig1315newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021127SMED30021127SMESG000037626.1 Contig1315uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021127SMED30021127SMESG000048042.1 Contig1315newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021127SMED30021127SMESG000048042.1 Contig1315uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED300030531-acyl-sn-glycerol-3-phosphate acyltransferase deltaSMESG000081135.1 Contig3433GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017270H2A histone family, member YSMESG000059652.1 Contig2797GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017270H2A histone family, member YSMESG000012903.1 Contig2797GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011935SMED30011935SMESG000059652.1 Contig2797newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011935SMED30011935SMESG000012903.1 Contig2797newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007704ActinSMESG000036432.1 Contig450GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007704ActinSMESG000051672.1 SMESG000051670.1 Contig450GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007704ActinSMESG000030853.1 Contig1138GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007704ActinSMESG000051672.1 SMESG000051670.1 Contig1138GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016022SMED30016022SMESG000053405.1 Contig1766newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016022SMED30016022SMESG000053405.1 Contig1766uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016022SMED30016022SMESG000046314.1 SMESG000028362.1 Contig1766newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016022SMED30016022SMESG000046314.1 SMESG000028362.1 Contig1766uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012378Clathrin heavy chainSMESG000040592.1 Contig5422GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012378Clathrin heavy chainSMESG000035457.1 Contig5422GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012378Clathrin heavy chainSMESG000072345.1 Contig4452GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012378Clathrin heavy chainSMESG000035457.1 Contig4452GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015161Vacuolar protein sorting-associated protein 45SMESG000053405.1 Contig1766GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015161Vacuolar protein sorting-associated protein 45SMESG000046314.1 SMESG000028362.1 Contig1766GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002822RING-type domain-containing proteinSMESG000076385.1 SMESG000076375.1 SMESG000076363.1 SMESG000076223.1 SMESG000076482.1 SMESG000076470.1 SMESG000076410.1 SMESG000076358.1 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011213Osteoclast-stimulating factor 1SMESG000004952.1 Contig516GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001296Actin-related protein 2SMESG000019700.1 Contig701GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30022703dual specificity protein phosphatase 12SMESG000014789.1 Contig1758GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030829Y-box proteinSMESG000032180.1 Contig1715GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30033333SMED30033333SMESG000004952.1 Contig516newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023751Coactosin-like proteinSMESG000073127.1 PL06005B1H09ncbi_smed_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30033380Beta-hexosaminidaseSMESG000037355.1 Contig5533newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30033380Beta-hexosaminidaseSMESG000037355.1 Contig5533uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30033380Beta-hexosaminidaseSMESG000024479.1 Contig5533newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30033380Beta-hexosaminidaseSMESG000024479.1 Contig5533uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021685Bestrophin homologSMESG000080433.1 SMESG000010902.1 Contig1818GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019729Bestrophin homologSMESG000080433.1 SMESG000010902.1 Contig1818GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019441SMED30019441SMESG000070776.1 SMESG000049855.1 Contig1854newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019441SMED30019441SMESG000075102.1 Contig1854newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015319SMED30015319SMESG000014789.1 Contig1758newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002229SMED30002229SMESG000032180.1 Contig1715newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011718SMED30011718SMESG000070267.1 Contig1736newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013294SMED30013294SMESG000080433.1 SMESG000010902.1 Contig1818newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030227flotillin-2SMESG000059332.1 Contig5500GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030227flotillin-2SMESG000024114.1 Contig5500GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30025305SMED30025305SMESG000027283.1 Contig1753newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30022398C2H2-type domain-containing proteinSMESG000032119.1 Contig3970GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30026747Metallophos domain-containing proteinSMESG000036432.1 Contig450newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30026747Metallophos domain-containing proteinSMESG000036432.1 Contig450uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30026747Metallophos domain-containing proteinSMESG000051672.1 SMESG000051670.1 Contig450newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30026747Metallophos domain-containing proteinSMESG000051672.1 SMESG000051670.1 Contig450uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30031811SMED30031811SMESG000057502.1 Contig1846newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007841Nuclear hormone receptor HR96SMESG000079557.1 SMESG000074066.1 Contig5553newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007841Nuclear hormone receptor HR96SMESG000079557.1 SMESG000074066.1 Contig5553uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007841Nuclear hormone receptor HR96SMESG000062111.1 Contig5553newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007841Nuclear hormone receptor HR96SMESG000062111.1 Contig5553uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30003079Prominin (Prom) protein, putativeSMESG000062666.1 Contig3501newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30003079Prominin (Prom) protein, putativeSMESG000062666.1 Contig3501uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30003079Prominin (Prom) protein, putativeSMESG000015778.1 Contig3501newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30003079Prominin (Prom) protein, putativeSMESG000015778.1 Contig3501uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016832SH3 domain-binding protein 5-likeSMESG000061052.1 Contig4742newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016832SH3 domain-binding protein 5-likeSMESG000061052.1 Contig4742uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016832SH3 domain-binding protein 5-likeSMESG000022856.1 Contig4742newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016832SH3 domain-binding protein 5-likeSMESG000022856.1 Contig4742uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017520WD repeat domain 7SMESG000002835.1 Contig5582newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017520WD repeat domain 7SMESG000002835.1 Contig5582uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017520WD repeat domain 7SMESG000016829.1 Contig5582newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017520WD repeat domain 7SMESG000016829.1 Contig5582uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011780Si:ch73-222h13.1SMESG000081135.1 Contig3433newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011780Si:ch73-222h13.1SMESG000081135.1 Contig3433uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005741Actin-related protein 2/3 complex subunitSMESG000062666.1 Contig3501GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005741Actin-related protein 2/3 complex subunitSMESG000015778.1 Contig3501GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005741Actin-related protein 2/3 complex subunitSMESG000015778.1 Contig1955GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005274Tripeptidyl peptidase 2SMESG000074726.1 Contig6326newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005274Tripeptidyl peptidase 2SMESG000074726.1 Contig6326uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30000118Leucine-rich repeat flightless-interacting protein 2SMESG000041553.1 Contig4772newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30000118Leucine-rich repeat flightless-interacting protein 2SMESG000041553.1 Contig4772uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30000118Leucine-rich repeat flightless-interacting protein 2SMESG000068232.1 Contig4772newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30000118Leucine-rich repeat flightless-interacting protein 2SMESG000068232.1 Contig4772uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30003680RanBP-type and C3HC4-type zinc finger-containing protein 1SMESG000069298.1 Contig3532GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30026477SMED30026477 dd_Smed_v4_275_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30022813Serine/threonine protein kinase, putativeSMESG000003862.1 dd_Smed_v4_3667_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30035671NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 8, mitochondrial dd_Smed_v4_2378_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30034274G_PROTEIN_RECEP_F1_2 domain-containing protein dd_Smed_v4_79416_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30002297PhosphodiesteraseSMESG000023094.1 dd_Smed_v4_6991_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30000201HTH CENPB-type domain-containing proteinSMESG000073620.1 dd_Smed_v4_6327_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30004975Hypoxanthine phosphoribosyltransferaseSMESG000007399.1 dd_Smed_v4_7763_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30012495SMED30012495SMESG000041422.1 dd_Smed_v4_7693_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30009787Laminin subunit alpha-2SMESG000056016.1 SMESG000056013.1 dd_Smed_v4_7924_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30011250Granulin precursorSMESG000029882.1 dd_Smed_v4_442_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30008806slc26a-1SMESG000035953.1 dd_Smed_v4_8150_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30005465Ras-related protein Rab-11ASMESG000073334.1 dd_Smed_v4_867_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30012777Usp domain-containing proteinSMESG000035960.1 dd_Smed_v4_7254_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30004147CarboxypeptidaseSMESG000029164.1 dd_Smed_v4_785_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30011601Zinc finger MYM-type protein 1SMESG000008616.1 dd_Smed_v4_7892_3_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30013845Phosphoglucomutase-1SMESG000046578.1 dd_Smed_v4_3503_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30011727Dedicator of cytokinesis 4bSMESG000063593.1 SMESG000063592.1 SMESG000063595.1 dd_Smed_v4_6156_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30006638Elongation factor TuSMESG000068535.1 dd_Smed_v4_818_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30010045SMED30010045SMESG000058295.1 dd_Smed_v4_6917_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30010947SMED30010947SMESG000007159.1 dd_Smed_v4_7115_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30004214SMED30004214SMESG000055805.1 dd_Smed_v4_857_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30006777Collagen alpha-1(XV) chainSMESG000081921.1 dd_Smed_v4_3516_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30002002GRAM domain-containing proteinSMESG000004908.1 dd_Smed_v4_8544_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30004608Protein kinase domain-containing proteinSMESG000030766.1 dd_Smed_v4_85086_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30023307TNF receptor-associated factor-2-like protein BSMESG000024592.1 SMESG000013347.1 dd_Smed_v4_1308_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30033402Nascent polypeptide-associated complex subunit betaSMESG000026176.1 dd_Smed_v4_358_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30034127Peptidase S1 domain-containing proteinSMESG000076526.1 dd_Smed_v4_7541_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30033774CatalaseSMESG000055572.1 dd_Smed_v4_859_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30029190X1.D.H1.3SMESG000052463.1 dd_Smed_v4_5161_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30028430Secretory carrier-associated membrane proteinSMESG000035622.1 dd_Smed_v4_2702_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30024863Transcription activator BRG1SMESG000076666.1 dd_Smed_v4_4141_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED3002669640S ribosomal protein S19SMESG000023987.1 SMESG000009719.1 dd_Smed_v4_202_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30032436Adipocyte plasma membrane-associated proteinSMESG000052602.1 dd_Smed_v4_3602_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30026364SMED-P53SMESG000078256.1 SMESG000078255.1 dd_Smed_v4_5563_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30032573Group XV phospholipase A2SMESG000037734.1 dd_Smed_v4_8328_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30033476Zinc finger protein, putativeSMESG000025870.1 dd_Smed_v4_3821_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30024680Histone-lysine N-methyltransferase SETMAR-like proteinSMESG000015199.1 dd_Smed_v4_4318_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30029561SMED30029561SMESG000041756.1 dd_Smed_v4_3569_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30026812SMED30026812SMESG000055072.1 dd_Smed_v4_4091_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence