gut

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ In Situ Hybridization Data

  ▻ Sequences

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  gut


DEFINITON:

  The planarian triclad gut contains a central anterior gut branch connected to two posterior gut branches arranged around the pharynx. Secondary gut branches extend laterally from the primary gut branches, while tertiary gut branches extend from the secondary branches. Food and waste enter and exit the gut through the pharynx.


TERM DEFINITION CITATIONS:

  PMID:3490491


TERM CITATIONS:


TERM ID:

  PLANA:0000026


ABOUT THIS TERM:

gut

  ↳is a material entity and organ

  ↳contained in tail, copulatory region, ventral region of the whole animal, posterior region of the whole animal, parapharyngeal region, prepharyngeal region, head, dorsal region of the whole animal and anterior region of the whole animal

  ↳develops from gamma neoblast

  ↳existence overlaps Stage 6, juvenile, Stage 5, asexual adult, adult hermaphrodite, Stage 8 and Stage 7

  ↳existence starts during or after Stage 5

  ↳part of digestive system


Expand to see terms that part of gut


BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30007290AFF18488.1GATA456gata456aStage 2, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, gut, digestive system, gamma neoblast, embryonic pharynx
SMED30005748AFF18489.1HNF4hnf-4Stage 2, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, gut, digestive system, gamma neoblast, embryonic pharynx
SMED30025591ABW97518.1porcupine-like proteinporcn-AStage 5, Stage 6, Stage 7, Stage 8gut, digestive system
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30025591 ID=SMED30025591|Name=porcupine-like protein|organism=Schmidtea mediterranea sexual|type=transcript|length=3526bp
TTCCGATCTTTTCTTTTGAAATTTTTGAAATTTTAAATAAAATTAATGACAAAGGCAGAAAATCAGAGAACTACTAAAGC
ATCCGACTTCAAATTTGGAAAAGAAATCGGCCATGGCTCGTTCTCAACTGTAATGATAGCTAAGGAAATTTCTACCAATA
AACATTATGCTGCAAAAATTATTGATAAAGTTTTTATTTCTAAACAGCGAATGGTTAATACTGTTATGATTGAAAAAGAA
GTTCTCCGAAGAATAAATCACCAGTTTTTTGTATGTCTCAATTATACATTCCAAGATCCAGAGAGATTGTATTTTATTAT
ATCATATGCCGAACGAGGAGAACTTTTATCTCATTTAACAAGACTTTCGTGTTTTGATTTAACGTGCACACAATTTTATT
CCGCGGAAATTATTCTTGCATTAGAATATTTACATGGAATTAACGTTGTTCATCGAGATATAAAACCAGAAAATATTTTA
CTGAGTGAAAATATGCATATAAAAATTTGTGATTTTGGCAGTGCAATTATTATCGATAAACCAGATCTCAAGCCTTCTTC
TTTTACAGGTACAGCTCAATTCGTTTCTCCAGAAATGCTGGGATTCAGTAAAGAAACACGTGACAATAGCTATTCAGATG
AACCGAATTCTGATTCAGAGGAACATAGCGAAATTGAAGTTAAACGAACTAGTTCACCTGATAATTCTAGGGAAATATTA
TATCTAATGGACTTCTGGGCATTAGGATGCATCGTCTATCAAATGTTGTCTGGACGAATGCCATTTCACGTCAGGCATTC
ACGGCATGAATATGAAATTTTCCAAAAGATCCGAAATTTAAAATATGAGTTTCCGGTTGGGTTTGATGATACTGCTAAAG
ATTTTGTCTCTAAACTTCTTGTATTGAATCCACTGGAAAGATTAGGCAATCCATCCGATGGAAAGCACGCTGCTTTAAAA
GCCCACCCCCTTTTCCGTTCAATTGATTTCGAAATTATCGGATCACAAAAACCTCCGCTATTACTTCCAAATATTGAGCC
CATTGTTCAAAGTAATTGGGACGAAATTCCTGTTGGTTTTGAAGAAGCATGGAAATTCAATATCAAAAAAGAGTTTCAAG
AAATGGAAAAAGCCGATAAACAAAAATTATTGCAAAACCAAGAAAAACTAAATCCGTTTCATAGATTTGTACGCAATCGA
TTGATCATAAAACAAGGCATCTTGTACAAACGGCGTGGATTATTTACTCGTAAAAGAATGTTTCTATTAACTGAAGGACC
TCATTTATTTTATGTCGACCCCGATGCTATGCAATTTAAAAAAGAAGTCAGTCTAAACTTAATTACTGGCATAGAAGTAA
AAAATGACAAAGTATTTTATATCGTTACTAAAAGGCGAACATATTTTCTCGAAGATCCTTCAGCAAAGGCTGATGAATGG
CGACAGAGTATTGAATCGATTTGTGTAGAATATTATGGATCATTTAAATTATCCCCTGGCACTTGCACTCAAACGCCTCT
AGTTACATCATCTGAATCATAACTTTCGGTTTTATTTAAATTTATTTGTCATATAGAAAAAAATGTGAATTTAACGGTTT
TTAATATAATAATTTAATATTGGTTTGAATTCTTGTTTTTCATTTTAAAATTTAATGGATATAATTTAAATATTTTAATA
AATAAAAATATTCACATTGTTTTAATATTCTCTTTATGTCGTAATTGATAAATGATGCATTGTAAATGTATTTTACAACT
GATCTAAATGAAACCAATAGGAAACGAGTGGTTCGATGTCATGTGAATCAGCATGCAACCAATCATAGTTTTGTGATTCA
TTAAATATATTTTAAATTTTTAAAACAAATTAAATCACTTAATTAATTTTTAGACAATGTCACAATTTTATGGCGGATCC
ACGATATTGGCACCTCTATCGAACGTTATGGGTATACCAGTGGATCAAATTAATTTTATTGTGTGTAGTTTATTGTCAAT
CGGACTGGGTCAAATTATGCGACACAAATTCCCTCCTTCTAAATTGTCAGGAAGTACAAGAGGAATCATAGAAGCATTTT
TTGGAATACTAATTGTTCTTTTCTGCTTCGGATACCAAGTCAAGTATTTGTTACTACAATCAACAGTTTCCTATGTAATA
CTATTATTTTTGCCTTCACAAATATCAGCGCATTTGGTAACGTATTGGTGTATGGCTTTCATGGCGATAGTCCATTTATA
CAGGATGCATTACGATTACGGAGGTTATACTCTCGATATATCTGGTCCGGTTATGATTCAAACCCAAAAATTGACCAGCC
TCGCATTTAATCTTCTAGATGGACATCGAATAAATCAAGGAATAAAACTGCAACAGAGAAATCATGAATCTCACGCTGTG
AAAAAACTACCAGATGCAATCAAGTTTTTCGGTTACACATTCTACTTTCATGGTGTATTAGCGGGTCCTTTTGTATTCTA
CAATGAATATAAAGAATATATCACTGGATATGACGACAAGCATATTCCATGCTCCAAAAAGCAATTATCTTCAGCACTTT
GTTTATCAGTGATCCATGGATTATTAACAGCATATGTCGCACCGCAGTTTCCATATATATTTGTTTGCAGCACCGATTAC
CAACGGATGCATATGACTCGTAGAATAATGTTCACAATGATTTCATTTTTCCTCGTAAGACAAAAGTATTACTTTGCCTG
GTCAATGGTTGAAGCTGGTGCTCTTAGTACCGGATTGGGATATTGTGGAAAGGATAAAAACGGAGAGAATAATTGGTCGA
AAGTGAAAAATTACGATTTCATGGCAATCGAAAGCGGCAGTAGTTTGAAAGTGCTAGTGGACGGATGGAATATTTCCACA
ACAAGATGGCTCAGAGAATTAATTTATGAACGAGCTCCTTTATTCTGTCGGACAATTCTAGTTTTCACCGTCAGTGCATT
TTGGCATGGATTCTATCCTGGATATTATTTGATGTTTTTGACATTTTCTCTCTTTACGTTTTGCGCTAGAACCGTTAGGA
AACACATTCGACCATTGTTCATTGTCAGTCCAATTACACTTCAACTCTATCATGTTCTAACGAAAATATTCACAAATCTG
GCTTTAAATTACGGACAAGGACCATTTTATTTGCTGGAGTTTCAATCGGGACTTTTGTTTTGGAAGCCATATTACTTTTT
CGGACACGTTCTAGCAATGTTCTGCGTATTGACCTTGCAATTTCGGCCGATAATCAACGACAAAGTCAACATAATGAACA
ATGTTTTCACCAGAAAAGCCCAATATCGGTTTCAGAAACTAAAGATCCATTTGCAGAAAAAGTTGAGATGAAATTTTATT
GATTTTGATAATTTATATAAAATATTATAATTTTGTTTTTCGTTTTATTTTTATATCGATGAATTTATGATAAATGCTAA
ATATTCGATCCGGAATGAATTATTATTAATCTGGTTTTTATAATTGTTCATTTTTAATAGTTTTGTTTGTTTTTCGAAAA
TGGCGG
>SMED30007290 ID=SMED30007290|Name=GATA456|organism=Schmidtea mediterranea sexual|type=transcript|length=2033bp
AGGTAAGTGTCGTCATCACAAGTGGCTTTATTATTATCATTTAAATTTTTTATCATATTATCATTGATTGCTTGTTTTCC
TCATTCAAAATTTAACTGATTGTTATCAAGCTCATTTGATAACTCCAAATCTAATTGACACTCATGTAAATATCCCATTC
GAATTTCCGTTCCCGTCCGTAAGATCCACGATCCGACAATGTTTCTCCCATCGGTATTGTCGAATTCTCACCAGAGAAAC
TCACCAATAATGGACATTGTATCACCAAAATCCAACACCAGCAATCTGAATGCGTTGATCACGTATTCGAATTGTCCCAA
CATAGATCTACAGTCGAATGATCTGTCAGTGAACTTGACGAATTCTCAAAACTTCCACGAATTGGATCACAAAACCAATT
ACGGATACAAAGTTTCAAACAACGAGACAAAACTGAATGCTTTTCCATATTTAGCTCAATCGAACTTAACAGATTGCACA
ACAGACATCAGTGGAGATCTGAAAAATCCAAATTCACATCTCAACTATGGAAACGGAATTTCGTTCTCGGAATTTTCGAA
AATGTCCGAAACCAACATCCACGGATATCCGCCATATTGTTTCTCCACTAAACTGTTTCCCATTCCAAATCTACAAGAGA
AATCAATTATCAACGACAACTATTCCGTGAAATCCACCGCCGGAGGCTTTATCACCGAATCGAATGAGCATCAAAACTCT
GTAAATACTGGAAATTCCTACAATTCCAATTTAAGCTCATACAGAACGGTAATTCCCGCTCATTTTCATCTCTTCAATCA
GAATTCACCAGAATCGAACTCGTTTTACAATACGGCTTGGAACAACTATCCGTTTCAAATATCCCCAACTTATCCCATAC
AAAATCTACCGGATTCAACAATCAACTGGACAACAAACAATCAAATTCCAAGCAGCAATTTAGTTTTTGATCCCTGGAGC
TGTAAATCAAATCTTAATCTTCCTCCGATTAATGAATTCGGTTCCAATTGCGATGTCAGCAGAGAGTGTGTGAACTGTGG
AGCTAGCAATACTCAGTTGTGGTCCCGGGATAATTCTGGCTATTATTTGTGTGATGAATGCGACAGGTTCTCTCAAAACA
ACAGTAGAAACCTCGAAAAACTACCAACGAATCAAGTCTCATCAAGTACCGAAAATGAGTTCATGAAAAAATCCAATGCC
AACTTTCAACAATATGGAAAAAGATCCGACCTCGAATGCAGCAATTGTAAAATTACCAAGACTTCTTTATGGAGAAGAAA
CAACGAAGGAGAACCTGTCTGCAATGCTTGCGGCTTGTATTATAAATTACATAAGTCTCTAAGACCTCTTTCAATGAGGA
AAGAAGGAATACAAACAAGGAAAAGAAAACGGAAAACACAAATGAAACCGGTTTCCACTCATATTGCCAATAATCAAAAG
GTGCCGTCTTCAGAATCGTCATCAGAACAAAATCAGTTTATAAACACTGTGAAATCAAGTGAAAATTGCTATAACATGAT
TTCTGAAAATTCTCCAACATATATGCCAAATATATCAGTCCAGCCCTTCAATCACATTCTGAACTCCAGCCAATATCAAT
TCCAATCTACAGAAAATCCCATTAATCAATCATATTTAAATTCCTCAATCAAAAACAGCAATCCCTTTTACGATTCCGAA
AGTATACTTTATTCCTACAACAATTCAAACAAAATCAAAGATGAGCCCCTATTATCCATGGACAACGAACCGAAGCCCTA
TTCCTCAATCAACGAGAAAATTGACGTCAACTCCATAGTGAGAATTAATGAAATCTCAAACAATTCGAATTCGAGTTAAT
TATTCTGATCTACTTTTTAATTATATATTTAAGAACCGTATATACTTCGAAATATAATTTTAATGATAAAATTTTATATC
TAAAAAATGTAATTTTTAAGTGCGAATTATTAAGTATGCATTTAAATAGTGCAATTATTGTGGTAGTTATTTTTATTACT
AAATAAATGTTGTTTGTAAATTCGAGAATTTGT
>SMED30005748 ID=SMED30005748|Name=HNF4|organism=Schmidtea mediterranea sexual|type=transcript|length=3066bp
GAAGAATAACAAAGAAATTTATTGCCAAACTAAAATACCCGGCCTATTTCATCAAAAAAAAAACAATCAAAAACACAAAT
CGCTACGAAAACTTGTATAAAAGATTCACATTAAAAGTCATCAATATTCCTCTTTTTTAAAGACTGATGATTCAGATTCT
TGGATCCGAATGGGGTGATCTGTTAGGAAGTGAGCTGTTGACGAGATAGCTGAATAGTTTGATCTGGAATTGTGCTGTTG
GTTCGCTTCCGATGATCTGTTGGCGATTGATTGAATTTGGCAGTTTTCTATCGGCGAGTTTGGAAGCGACTTGGTATAGG
CCACAAGAAGCGACGGATCAACGACATTTTGAGTGGAATTCACAGAAAGAGCTGGGTGGATTAGGTCATCTGAATTGGAA
GAATTTGAGCAGTTATGATTTGCGTCACTGTTATAGGCGTATTTTGACTGGTTGATCATGGGGAACCCTTGATCAAGGTT
GACCAAGAAATGGCTGGTATCCTGTGATAAATTGGAATGCTGATAAAGATTGATGGAATCATTGACGCATGAAAACAGAG
AAGGAACGCCGACTCTTTCATTTTTCAGCATCATCCCATCGCTGTTGATTATCATACCGAAGTTGCTATTGTCCTGGGAA
TTTTGCTGCATTATTTCAGTTCCTTGATTAACAAAAGCTCGATATATATTTCCTGAAGGCATCGACGTAGAACTTGGCAA
ATATGCACTCCATATTTTTGAGGCCGCTTCAGGTGATATGTTTTGGTTGTTGATATTGAGTAGGACACTGTCTGGCATGA
AAGGGGGAATTCCGTAGCAGTCCTGGTAAGTATATTTCGGTGAGGAAATCCTGTGGGAGTTAATTATATCCATGGAATCG
TTTTGATTATTGTTATTGTTCCCATCTGTTTCTGGATCTATGCTGAATACCCCTGGTGGATTGTCACCCAATAATGTTTC
AGATAACAAGCTATCAATCTCGGCTAATCCTGTCATTTTCATGAACTCGACCTTCTTTACCATCAGCTGGGTGACCAATC
TCAGATCAGGAATTGTCAGCAGCAATTCCCCGAATCTACCCGGCTTGTGGTATTGCTTGTCATTCATGTGGTTCATCAGG
TCCATTTGTATTTGGTATCGGCATCGTCTCACGAACTCCTTGCCAGACTCGCTGACTCTCGGATCAAAAAATACGATCGC
TTTCAAACAAGCGAATTCTGCGTCATCCAATTGCAATTCTCGCAGCGGAATGAACAGGTCGTCAAGGATGTGACTGGCTA
TTTCAGCGAAATGTTTGTCACTGGAGTTCCTACTGATGATAAGATTGTTTCCCAATAATAGCACATCGTCTTCGTCCAAT
TGAAACGACCGCCTTATTACTCCAAGAATTAGAATTTCTCCCGCGTGTGCTTTTAAAAGGGAAATTTGATCGCTCAAGTT
TAACTGTGAAAAACAAGGCAAAGACTTTGCCCAATTCACTAGAAGAAATAACTGATTTTTCATGGACTCGCAAACATCAG
GCACATCGGCATATCTGTTCATGTATTCCTGAGGATTCGGGGGCTTTTGTATTGCAACCCTTTGCTCGGCCTGCATCAAC
TGAGAAATGGAGAGAATGACATTCGGAGGAATATCATCAAACGACGATCTTCGAGTACTGATCCTATCTCGTTCATTTTG
AACCGCTGCTCGCTTCATTCCTACAAGAATGCATTTCTTTAGCCGACAATAACGGCATTGGTTTCGTTTATCCTTGTCCA
TTTTACAATTCCGATTGTACTGGCAAGTGTAGTTATTCTTCTTCCTCACTGACCTCCGAAAAAATCCTTTACAACCGTCA
CACGAGAAAGCCCCATAATGTTTTCCTGTAGCTTTGTCACTGCAAATGAGACAGAGTTGATTGTTTTCCATTCCTTCTGG
TCCCGACGCGTTAGACGCATAGACTTCATGTTGTTGCGAGGACACTGAAACGAAAACTATTTGATAATATTTGTACAAAA
CAACTGACAGATGGTTTCGGAAAAGGTTCAATGTTCAGCCATAGTTCAGCGAAAGGTCAAATTCCTGAACTACTATTTCA
AGGTATAAATTTGAATATATTGGTTTTGCCTCGTGCTAACAAAGTCCAGAAATATAATAAGCAAAGTCTGAATCGTGTAC
TTTGGATTTCTAGCCAGGGGCACACAATAACCTATATTTAATAGCAGTTCATTGCGTTCACTCGTTATTTCTCCGACTGA
ACTGCATTGCAGGAGGATCCGCAACCATGGAGATTTCATAATTATTATCAAAATGATAATAATAATAATTATTATGAGGT
ATTGTAAAAGAAAACGTAACTCACTTTCACTTTCCAATGGATATTGCATCGAGGAAGCGTTGCTGGAAATGGAAATCGGA
GCTGAATTGCTAGTCAATAGTTGATAGGAGAATGCTGGATTGAGGTTCGGATGCTGGGTAGACGTCATATAGAATTGGCT
CGACGGATTCGGTAAAATTATGGTGAAGTTTACAATCGAAGCTCAGATATAACGTATTATAATGAAGTATTATTAATAAA
CTGCAAGTAACGTGCGCGCATTCTGAAGTGGTTGATTGAGAATAATCAGTTCTTATTCGACAAATTCAGATAAAAAAGGC
ACCACTCGAATTGTTCAGCTGCGTCATGTGAATGCCGGAACGTTGTGCGTTGGCTGTTGGCAGATCAGCGCTCCGTGTTC
ACTGCAATCCGGATACACCAGACCACTTGAAATCGTTGCGAATTCAGCGTGTCGAGTGCATTGTGCGAGATCAGTATCGG
TGTGTATGTGTGTCTGCCTGTGTGCGTGTGGATGTGTGTGCTTGTCGAGTCGGTTGTGTGTTTATGAGTGTAACTGTGTC
GATTTGGTCGAATGCAGTAGCAGATAGCTGAAATGCGATTGTTCCTATTTTTCATTTAATATTGTTTTATGTTTTGTTTC
TATTTTTATAATTTAATTTATCAGTTTTTGTTTAGATTATGCAATCATTGTTTAATTTATTTTTGTCAATTTAAAATTTA
TTATTAATTAAATTATTATAATTATT

 

back to top



PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in gut. Click this link to learn more about PAGE.


PAGE Curations: 3664


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
gutSMED30021445S-adenosylmethionine synthaseSMESG000053202.1 EG413862ncbi_smed_estsPMID:23318641
Chen et al., 2013
whole organism asexual adult fluorescence in situ hybridization evidence
gutSMED30000459Dynamin-1-like proteinSMESG000044682.1 Contig721GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30000459Dynamin-1-like proteinSMESG000058940.1 Contig721GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30000459Dynamin-1-like proteinSMESG000058940.1 PL030004B10H05ncbi_smed_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002213Zinc finger, C2H2 typeSMESG000070776.1 SMESG000049855.1 Contig1854GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002213Zinc finger, C2H2 typeSMESG000075102.1 Contig1854GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013692Small HSP proteinSMESG000055935.1 Contig651GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013692Small HSP proteinSMESG000059879.1 SMESG000059868.1 SMESG000059853.1 Contig651GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001630Ras-related C3 botulinum toxin substrate 1SMESG000005612.1 Contig594newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001630Ras-related C3 botulinum toxin substrate 1SMESG000005612.1 Contig594uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001630Ras-related C3 botulinum toxin substrate 1SMESG000011575.1 Contig594newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001630Ras-related C3 botulinum toxin substrate 1SMESG000011575.1 Contig594uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001630Ras-related C3 botulinum toxin substrate 1SMESG000024968.1 Contig2195GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001630Ras-related C3 botulinum toxin substrate 1SMESG000024968.1 Contig5264GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002600ATPase_AAA_core domain-containing proteinSMESG000072345.1 Contig4452newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002600ATPase_AAA_core domain-containing proteinSMESG000072345.1 Contig4452uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002600ATPase_AAA_core domain-containing proteinSMESG000035457.1 Contig4452newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002600ATPase_AAA_core domain-containing proteinSMESG000035457.1 Contig4452uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012677Coiled-coil domain-containing protein 51SMESG000058452.1 Contig1190newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012677Coiled-coil domain-containing protein 51SMESG000058452.1 Contig1190uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012677Coiled-coil domain-containing protein 51SMESG000057519.1 Contig1190newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012677Coiled-coil domain-containing protein 51SMESG000057519.1 Contig1190uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013289SMED30013289SMESG000045568.1 Contig4881newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013289SMED30013289SMESG000045568.1 Contig4881uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007241SMED30007241SMESG000077709.1 SMESG000073947.1 SMESG000043656.1 SMESG000043279.1 SMESG000008519.1 SMESG000001897.1 Contig22newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007241SMED30007241SMESG000013795.1 Contig22newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004416SMED30004416SMESG000067412.1 Contig1164newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004416SMED30004416SMESG000067412.1 Contig1164uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004416SMED30004416SMESG000060394.1 Contig1164newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004416SMED30004416SMESG000060394.1 Contig1164uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008321SMED30008321SMESG000068172.1 Contig3306newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008321SMED30008321SMESG000068172.1 Contig3306uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008321SMED30008321SMESG000025870.1 Contig3306newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008321SMED30008321SMESG000025870.1 Contig3306uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012869Y-box-binding protein 1SMESG000032189.1 Contig3807GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012784SEC14-like lipid binding 8SMESG000008338.1 PL05003A1B05ncbi_smed_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30033476Zinc finger protein, putativeSMESG000068172.1 Contig3306GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30033476Zinc finger protein, putativeSMESG000025870.1 Contig3306GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027034Aminotran_5 domain-containing proteinSMESG000033958.1 Contig1720GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016832SH3 domain-binding protein 5-likeSMESG000061052.1 Contig4742newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016832SH3 domain-binding protein 5-likeSMESG000061052.1 Contig4742uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016832SH3 domain-binding protein 5-likeSMESG000022856.1 Contig4742newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016832SH3 domain-binding protein 5-likeSMESG000022856.1 Contig4742uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019261SMED30019261SMESG000022691.1 SMESG000022690.1 Contig229newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017140Ras-related protein Rap-1bSMESG000008077.1 Contig5057GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017140Ras-related protein Rap-1bSMESG000017950.1 Contig5057GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027768SMED30027768SMESG000045568.1 Contig4881newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027768SMED30027768SMESG000045568.1 Contig4881uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30022579SMED30022579SMESG000001429.1 Contig4707newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30022579SMED30022579SMESG000015927.1 Contig4707newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021390SMED30021390SMESG000033382.1 Contig3395newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024174Programmed cell death 6-interacting proteinSMESG000051593.1 Contig4912GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024174Programmed cell death 6-interacting proteinSMESG000019014.1 Contig4912GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032562SMED30032562SMESG000014825.1 Contig3406newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032562SMED30032562SMESG000014825.1 Contig3406uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032562SMED30032562SMESG000002541.1 Contig3406newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032562SMED30032562SMESG000002541.1 Contig3406uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30031764ADF-H domain-containing proteinSMESG000022423.1 Contig1245GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020956Lysosomal alpha-glucosidaseSMESG000054351.1 Contig1590GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020956Lysosomal alpha-glucosidaseSMESG000005053.1 SMESG000005050.1 Contig1590GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023862SMED30023862SMESG000009332.1 SMESG000009320.1 Contig505newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023862SMED30023862SMESG000009332.1 SMESG000009320.1 Contig505uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023862SMED30023862SMESG000041448.1 Contig505newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023862SMED30023862SMESG000041448.1 Contig505uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021161MARVEL domain-containing proteinSMESG000077709.1 SMESG000073947.1 SMESG000043656.1 SMESG000043279.1 SMESG000008519.1 SMESG000001897.1 Contig22GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021161MARVEL domain-containing proteinSMESG000013795.1 Contig22GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027595DUF3421 domain-containing proteinSMESG000020792.1 Contig1106GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027595DUF3421 domain-containing proteinSMESG000027124.1 Contig1106GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021196SMED30021196SMESG000015163.1 Contig1173newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034467Protein tyrosine phosphatase type IVASMESG000015894.1 SMESG000000559.1 Contig1506GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034467Protein tyrosine phosphatase type IVASMESG000078978.1 Contig1506GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035190Dimer_Tnp_hAT domain-containing proteinSMESG000074416.1 SMESG000074407.1 Contig1629newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035190Dimer_Tnp_hAT domain-containing proteinSMESG000074416.1 SMESG000074407.1 Contig1629uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008091Serine/threonine-protein kinase PLKSMESG000012131.1 SMESG000012127.1 Contig809GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008091Serine/threonine-protein kinase PLKSMESG000027686.1 Contig2364GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008091Serine/threonine-protein kinase PLKSMESG000012131.1 SMESG000012127.1 Contig2364GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011793Homeobox protein DTH-1SMESG000028338.1 Contig5669GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30026637MATH domain-containing proteinSMESG000076100.1 Contig927newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30026637MATH domain-containing proteinSMESG000076100.1 Contig927uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30022398C2H2-type domain-containing proteinSMESG000032119.1 Contig3970GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020801SMED30020801SMESG000075928.1 Contig7205newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020801SMED30020801SMESG000075928.1 Contig7205uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024044ADP-ribosylation factor-like protein 8BSMESG000001053.1 Contig525GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024044ADP-ribosylation factor-like protein 8BSMESG000033211.1 Contig525GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028347Engulfment and cell motility 3SMESG000013936.1 Contig1935GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028347Engulfment and cell motility 3SMESG000039535.1 Contig1935GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30031780Ras-related protein Rab-5ASMESG000065500.1 Contig1027GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027910Calpain-5SMESG000045063.1 Contig7340newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027910Calpain-5SMESG000045063.1 Contig7340uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034430Arp2/3 complex 34 kDa subunitSMESG000060573.1 Contig5379GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034430Arp2/3 complex 34 kDa subunitSMESG000073809.1 Contig5379GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30031385SMED30031385SMESG000045568.1 Contig4881newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30031385SMED30031385SMESG000045568.1 Contig4881uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30033999Zinc finger MYM-type protein 1SMESG000060573.1 Contig5379newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30033999Zinc finger MYM-type protein 1SMESG000060573.1 Contig5379uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30033999Zinc finger MYM-type protein 1SMESG000073809.1 Contig5379newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30033999Zinc finger MYM-type protein 1SMESG000073809.1 Contig5379uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020544SMED30020544SMESG000031799.1 Contig1892newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032067TRAF-4SMESG000044336.1 Contig1407GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032067TRAF-4SMESG000015063.1 Contig1407GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035284RING-type domain-containing proteinSMESG000055935.1 Contig651newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035284RING-type domain-containing proteinSMESG000055935.1 Contig651uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035284RING-type domain-containing proteinSMESG000059879.1 SMESG000059868.1 SMESG000059853.1 Contig651newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035284RING-type domain-containing proteinSMESG000059879.1 SMESG000059868.1 SMESG000059853.1 Contig651uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30026747Metallophos domain-containing proteinSMESG000036432.1 Contig450newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30026747Metallophos domain-containing proteinSMESG000036432.1 Contig450uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30026747Metallophos domain-containing proteinSMESG000051672.1 SMESG000051670.1 Contig450newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30026747Metallophos domain-containing proteinSMESG000051672.1 SMESG000051670.1 Contig450uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30031811SMED30031811SMESG000057502.1 Contig1846newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021752Cytochrome P450 2K1-like proteinSMESG000073604.1 Contig1511GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021752Cytochrome P450 2K1-like proteinSMESG000078091.1 SMESG000078098.1 SMESG000078094.1 SMESG000078092.1 Contig1511GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30026133BTB domain-containing proteinSMESG000001053.1 Contig525newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30026133BTB domain-containing proteinSMESG000001053.1 Contig525uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30026133BTB domain-containing proteinSMESG000033211.1 Contig525newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30026133BTB domain-containing proteinSMESG000033211.1 Contig525uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014058SMED30014058SMESG000000945.1 SMESG000000928.1 Contig3270newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001281SMED30001281SMESG000038153.1 SMESG000018862.1 Contig1newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001281SMED30001281SMESG000033840.1 Contig1newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001281SMED30001281SMESG000031561.1 SMESG000018862.1 Contig8newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001281SMED30001281SMESG000067743.1 Contig8newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30000639Microtubule-actin cross-linking factor 1-like isoform X28SMESG000017517.1 PL08009A2C06ncbi_smed_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014226SMED30014226SMESG000074424.1 Contig1592newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004579SMED30004579SMESG000052600.1 Contig1622newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014527SMED30014527SMESG000003891.1 Contig1388newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014527SMED30014527SMESG000048111.1 Contig1388newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011191SMED30011191SMESG000000989.1 SMESG000000988.1 Contig1658newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017833SMED30017833SMESG000053168.1 Contig2992newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016164SMED30016164SMESG000064161.1 Contig2672newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015319SMED30015319SMESG000014789.1 Contig1758newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008999Voltage-dependent N-type calcium channel subunit alphaSMESG000019873.1 Contig6657newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008999Voltage-dependent N-type calcium channel subunit alphaSMESG000019873.1 Contig6657uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004969SMED30004969SMESG000008209.1 Contig1530newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011718SMED30011718SMESG000070267.1 Contig1736newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032447SMED30032447SMESG000025120.1 Contig1559newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30031918SMED30031918SMESG000043420.1 Contig1665newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30031918SMED30031918SMESG000043420.1 Contig1665uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30031918SMED30031918SMESG000003841.1 Contig1665newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30031918SMED30031918SMESG000003841.1 Contig1665uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035239Forkhead box proteinSMESG000061695.1 Contig4822newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035239Forkhead box proteinSMESG000061695.1 Contig4822uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035239Forkhead box proteinSMESG000041562.1 Contig4822newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035239Forkhead box proteinSMESG000041562.1 Contig4822uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032050Cell division control protein 42 homologSMESG000064161.1 Contig2672GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30022483CGG triplet repeat-binding protein 1SMESG000020470.1 Contig1680newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30022483CGG triplet repeat-binding protein 1SMESG000020470.1 Contig1680uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30031091activin 1SMESG000072407.1 Contig4428GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30031091activin 1SMESG000024833.1 Contig4428GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029880Tigger transposable element derived 1SMESG000024822.1 Contig1490newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032814SMED30032814SMESG000064204.1 Contig1439newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032814SMED30032814SMESG000064204.1 Contig1439uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032814SMED30032814SMESG000030835.1 Contig1439newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032814SMED30032814SMESG000030835.1 Contig1439uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30025305SMED30025305SMESG000027283.1 Contig1753newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029573GFO_IDH_MocA domain-containing proteinSMESG000072407.1 Contig4428newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029573GFO_IDH_MocA domain-containing proteinSMESG000072407.1 Contig4428uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029573GFO_IDH_MocA domain-containing proteinSMESG000024833.1 Contig4428newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029573GFO_IDH_MocA domain-containing proteinSMESG000024833.1 Contig4428uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035254Sodium dependent neurotransmitter transporterSMESG000031125.1 Contig153GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035254Sodium dependent neurotransmitter transporterSMESG000031125.1 Contig1620GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30031607Histone-lysine N-methyltransferaseSMESG000074842.1 Contig1168newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30031607Histone-lysine N-methyltransferaseSMESG000074842.1 Contig1168uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30031607Histone-lysine N-methyltransferaseSMESG000037819.1 Contig1168newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30031607Histone-lysine N-methyltransferaseSMESG000037819.1 Contig1168uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032393SMED30032393SMESG000036683.1 Contig4572newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032393SMED30032393SMESG000074788.1 Contig4572newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30033842SMED30033842SMESG000030078.1 Contig1352newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034775Ras-associating domain-containing proteinSMESG000002146.1 Contig5459GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011242Synaptosomal-associated protein 29SMESG000024796.1 Contig3946GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011242Synaptosomal-associated protein 29SMESG000001576.1 Contig3946GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019321TIR domain-containing proteinSMESG000079659.1 SMESG000079651.1 Contig154newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019321TIR domain-containing proteinSMESG000079659.1 SMESG000079651.1 Contig154uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019321TIR domain-containing proteinSMESG000033382.1 Contig154newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019321TIR domain-containing proteinSMESG000033382.1 Contig154uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED300172003'(2'),5'-bisphosphate nucleotidase 1SMESG000014111.1 Contig4084GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013503Tpd52 like 1SMESG000013104.1 Contig988GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011603Rho guanine nucleotide exchange factorSMESG000003891.1 Contig1388newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011603Rho guanine nucleotide exchange factorSMESG000048111.1 Contig1388newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007704ActinSMESG000051672.1 SMESG000051670.1 Contig450GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30018122MADS-box domain-containing proteinSMESG000005612.1 Contig594GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30018122MADS-box domain-containing proteinSMESG000011575.1 Contig594GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014717WD repeat and FYVE domain-containing protein 3SMESG000043973.1 SMESG000011278.1 Contig1351GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014717WD repeat and FYVE domain-containing protein 3SMESG000039846.1 Contig1351GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016022SMED30016022SMESG000053405.1 Contig1766newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016022SMED30016022SMESG000053405.1 Contig1766uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016022SMED30016022SMESG000046314.1 SMESG000028362.1 Contig1766newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016022SMED30016022SMESG000046314.1 SMESG000028362.1 Contig1766uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019729Bestrophin homologSMESG000080433.1 SMESG000010902.1 Contig1818GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005549DDE_Tnp_1_7 domain-containing proteinSMESG000080555.1 SMESG000049002.1 SMESG000075946.1 SMESG000067287.1 SMESG000064983.1 SMESG000064843.1 SMESG000062987.1 SMESG000047155.1 SMESG000013953.1 Contig927newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005549DDE_Tnp_1_7 domain-containing proteinSMESG000080555.1 SMESG000049002.1 SMESG000075946.1 SMESG000067287.1 SMESG000064983.1 SMESG000064843.1 SMESG000062987.1 SMESG000047155.1 SMESG000013953.1 Contig927uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005549DDE_Tnp_1_7 domain-containing proteinSMESG000076100.1 Contig927newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005549DDE_Tnp_1_7 domain-containing proteinSMESG000076100.1 Contig927uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016048VPS37C subunit of ESCRT-ISMESG000028338.1 Contig5669newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016048VPS37C subunit of ESCRT-ISMESG000028338.1 Contig5669uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016048VPS37C subunit of ESCRT-ISMESG000079512.1 Contig5669newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016048VPS37C subunit of ESCRT-ISMESG000079512.1 Contig5669uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011519Mediator of RNA polymerase II transcription subunit 21SMESG000036235.1 Contig2568GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004461Lateral signaling target protein 2 homologSMESG000080555.1 SMESG000049002.1 SMESG000075946.1 SMESG000067287.1 SMESG000064983.1 SMESG000064843.1 SMESG000062987.1 SMESG000047155.1 SMESG000013953.1 Contig927GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004461Lateral signaling target protein 2 homologSMESG000076100.1 Contig927GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019727beta-catenin-like protein 2SMESG000014825.1 Contig3406GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019727beta-catenin-like protein 2SMESG000002541.1 Contig3406GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015161Vacuolar protein sorting-associated protein 45SMESG000053405.1 Contig1766GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015161Vacuolar protein sorting-associated protein 45SMESG000046314.1 SMESG000028362.1 Contig1766GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014928Formin-like proteinSMESG000044336.1 Contig1407newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014928Formin-like proteinSMESG000015063.1 Contig1407newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014246Ras-related protein Rab-5ASMESG000077941.1 Contig1099GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014246Ras-related protein Rab-5ASMESG000064914.1 Contig1099GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015967Neurotracting/lsamp/neurotrimin/obcam related cell adhesion moleculeSMESG000019973.1 Contig692GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015967Neurotracting/lsamp/neurotrimin/obcam related cell adhesion moleculeSMESG000068491.1 Contig692GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013913Adenylate kinaseSMESG000047137.1 Contig2730newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013913Adenylate kinaseSMESG000047137.1 Contig2730uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013913Adenylate kinaseSMESG000069303.1 Contig2730newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013913Adenylate kinaseSMESG000069303.1 Contig2730uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013477MAU2 chromatid cohesion factorSMESG000008077.1 Contig5057newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013477MAU2 chromatid cohesion factorSMESG000008077.1 Contig5057uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013477MAU2 chromatid cohesion factorSMESG000017950.1 Contig5057newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013477MAU2 chromatid cohesion factorSMESG000017950.1 Contig5057uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011909SMED30011909SMESG000027686.1 Contig2364GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011909SMED30011909SMESG000012131.1 SMESG000012127.1 Contig2364GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002094SMED30002094SMESG000003117.1 Contig1178GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014138LIM homeobox 1bSMESG000061052.1 Contig4742GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014138LIM homeobox 1bSMESG000022856.1 Contig4742GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015801SMED30015801SMESG000079303.1 Contig2289newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015801SMED30015801SMESG000017260.1 Contig2289newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30010792Protein kinaseSMESG000074416.1 SMESG000074407.1 Contig1629GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019325Myosin regulatory light chainSMESG000000175.1 Contig2068GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019325Myosin regulatory light chainSMESG000036544.1 Contig3175GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019325Myosin regulatory light chainSMESG000068156.1 SMESG000064685.1 SMESG000043474.1 SMESG000010609.1 SMESG000076470.1 SMESG000073857.1 SMESG000062429.1 SMESG000058575.1 SMESG000053533.1 SMESG000020635.1 SMESG000015751.1 SMESG000005260.1 Contig246GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019325Myosin regulatory light chainSMESG000000175.1 Contig246GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019325Myosin regulatory light chainSMESG000000175.1 Contig3175GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001668SMED30001668SMESG000033527.1 Contig2307GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012219Protein disulfide-isomeraseSMESG000076091.1 SMESG000076042.1 SMESG000074857.1 SMESG000069936.1 SMESG000048922.1 SMESG000026530.1 SMESG000022236.1 SMESG000021499.1 SMESG000008351.1 SMESG000006220.1 Contig100GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012219Protein disulfide-isomeraseSMESG000041085.1 Contig100GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012651Retrovirus-related Pol polyprotein from transposonSMESG000034282.1 Contig7503newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012651Retrovirus-related Pol polyprotein from transposonSMESG000034282.1 Contig7503uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015354Tubby-like proteinSMESG000043973.1 SMESG000011278.1 Contig1351newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015354Tubby-like proteinSMESG000043973.1 SMESG000011278.1 Contig1351uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015354Tubby-like proteinSMESG000039846.1 Contig1351newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015354Tubby-like proteinSMESG000039846.1 Contig1351uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017714Basement membrane-specific heparan sulfate proteoglycan core proteinSMESG000075928.1 Contig7205newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017714Basement membrane-specific heparan sulfate proteoglycan core proteinSMESG000075928.1 Contig7205uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021941SMED30021941SMESG000051593.1 Contig4912newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021941SMED30021941SMESG000051593.1 Contig4912uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021941SMED30021941SMESG000019014.1 Contig4912newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021941SMED30021941SMESG000019014.1 Contig4912uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024204SMED30024204SMESG000027140.1 Contig1248GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30033014Phosphatidylinositol-4,5-bisphosphate 4-phosphataseSMESG000063221.1 Contig1068GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021405Neurogenic locus notch-like protein protein 1SMESG000041513.1 Contig7665newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021405Neurogenic locus notch-like protein protein 1SMESG000041513.1 Contig7665uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024411Protein kinase domain-containing proteinSMESG000028899.1 Contig1093GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024871SMED30024871SMESG000056380.1 Contig1780newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023460TTF-type domain-containing proteinSMESG000046135.1 Contig1594newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30026950terminal uridylyltransferase 4SMESG000061695.1 Contig4822GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30026950terminal uridylyltransferase 4SMESG000041562.1 Contig4822GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023220Transmembrane proteinSMESG000046135.1 Contig1594GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30022944SMED30022944SMESG000049597.1 Contig5044newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30022944SMED30022944SMESG000004871.1 Contig5044newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021127SMED30021127SMESG000037626.1 Contig1315newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021127SMED30021127SMESG000037626.1 Contig1315uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021127SMED30021127SMESG000048042.1 Contig1315newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021127SMED30021127SMESG000048042.1 Contig1315uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023199Leucine-zipper-like transcriptional regulator 1SMESG000007049.1 Contig3743GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023199Leucine-zipper-like transcriptional regulator 1SMESG000074654.1 Contig3743GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30025964SMED30025964SMESG000041071.1 Contig2453newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030940SMED30030940SMESG000013104.1 Contig988newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020064Membrane-bound transcription factor site-2 proteaseSMESG000064743.1 Contig4698newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020064Membrane-bound transcription factor site-2 proteaseSMESG000064743.1 Contig4698uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023751Coactosin-like proteinSMESG000073127.1 PL06005B1H09ncbi_smed_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011545E3 ubiquitin-protein ligase XIAPSMESG000081058.1 Contig2302GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30009357ubiquilin-1SMESG000045386.1 Contig2009GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016397Transforming acidic coiled-coil-containing protein 3SMESG000056367.1 PL08003B2C03ncbi_smed_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014645HP domain-containing proteinSMESG000075965.1 PL04009A1F04ncbi_smed_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015310DUF3421 domain-containing proteinSMESG000046710.1 SMESG000046697.1 PL020001000E05ncbi_smed_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001490ADF-H domain-containing proteinSMESG000080129.1 Contig513GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30003996Tubulin alpha chainSMESG000074897.1 PL08001A1E08ncbi_smed_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007555GCR098SMESG000016695.1 Contig4585newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007555GCR098SMESG000016695.1 Contig4585uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007555GCR098SMESG000033655.1 Contig4585newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007555GCR098SMESG000033655.1 Contig4585uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30003215SMED30003215SMESG000057441.1 Contig2269newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008052SMED30008052SMESG000074907.1 Contig4797GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012113SMED30012113SMESG000017135.1 Contig2203GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027929Tubulin beta chainSMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044907.1 SMESG000044888.1 SMESG000035804.1 SMESG000035755.1 Contig2059GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020582SMED30020582SMESG000074897.1 PL08001A1E08ncbi_smed_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030294SMED30030294SMESG000026870.1 PL04016B2E04ncbi_smed_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015409cAMP-responsive element modulatorSMESG000016695.1 Contig4585GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015409cAMP-responsive element modulatorSMESG000033655.1 Contig4585GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001350SMED30001350SMESG000045656.1 Contig3259newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004118Tubulin beta chainSMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044907.1 SMESG000044888.1 SMESG000035804.1 SMESG000035755.1 Contig2059GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30000967DUF3421 domain-containing proteinSMESG000068156.1 SMESG000064685.1 SMESG000010609.1 SMESG000076470.1 SMESG000073857.1 SMESG000062429.1 SMESG000060487.1 SMESG000058575.1 SMESG000053533.1 SMESG000026676.1 SMESG000020635.1 SMESG000015751.1 SMESG000005260.1 Contig239GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30000967DUF3421 domain-containing proteinSMESG000057816.1 Contig239GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007246SMED30007246SMESG000045656.1 Contig3259GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015706Twinfilin-1SMESG000041071.1 Contig2453GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016150RUN and FYVE domain-containing protein 2-likeSMESG000050873.1 Contig2383GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001674SMED30001674SMESG000002943.1 Contig3127newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019006Tubulin beta chainSMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044907.1 SMESG000044888.1 SMESG000035804.1 SMESG000035755.1 Contig2059GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008812AP complex subunit sigmaSMESG000038889.1 Contig2145GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002664SMED30002664SMESG000002943.1 Contig3127GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30009175Transcription elongation factor spt6SMESG000059332.1 Contig5500newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30009175Transcription elongation factor spt6SMESG000059332.1 Contig5500uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30009175Transcription elongation factor spt6SMESG000024114.1 Contig5500newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30009175Transcription elongation factor spt6SMESG000024114.1 Contig5500uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035150TLC domain-containing proteinSMESG000057441.1 Contig2269GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034573Tubulin beta chainSMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044907.1 SMESG000044888.1 SMESG000035804.1 SMESG000035755.1 Contig2059GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034573Tubulin beta chainSMESG000047291.1 SMESG000044907.1 SMESG000044888.1 SMESG000035804.1 SMESG000035755.1 SMESG000047284.1 Contig5821GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED3002169814-3-3 protein epsilonSMESG000047644.1 Contig5316GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030227flotillin-2SMESG000059332.1 Contig5500GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030227flotillin-2SMESG000024114.1 Contig5500GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034544Disrupted in renal carcinoma protein 2-likeSMESG000017031.1 Contig2590GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30022956Regulator of microtubule dynamics protein 1SMESG000038855.1 Contig2191GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021956Actin-related protein 3SMESG000078631.1 Contig5723GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030115ATP-dependent RNA helicase DDX3XSMESG000064743.1 Contig4698GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030127bcl2-like proteinSMESG000043462.1 Contig210GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030127bcl2-like proteinSMESG000049099.1 Contig210GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029111Chloride channel proteinSMESG000059757.1 Contig3698newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029111Chloride channel proteinSMESG000059757.1 Contig3698uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029111Chloride channel proteinSMESG000054316.1 Contig3698newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029111Chloride channel proteinSMESG000054316.1 Contig3698uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035805RING-type domain-containing proteinSMESG000043462.1 Contig210newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035805RING-type domain-containing proteinSMESG000043462.1 Contig210uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035805RING-type domain-containing proteinSMESG000049099.1 Contig210newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035805RING-type domain-containing proteinSMESG000049099.1 Contig210uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30026190Tubulin beta chainSMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044907.1 SMESG000044888.1 SMESG000035804.1 SMESG000035755.1 Contig2059GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035848Tubulin beta chainSMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044907.1 SMESG000044888.1 SMESG000035804.1 SMESG000035755.1 Contig2059GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032901SMED30032901SMESG000059757.1 Contig3698GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032901SMED30032901SMESG000054316.1 Contig3698GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012477SMED30012477SMESG000081058.1 Contig2302newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012469SMED30012469SMESG000038855.1 Contig2191newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005434SMED30005434SMESG000038889.1 Contig2145newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019591SMED30019591SMESG000050873.1 Contig2383newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002079SMED30002079SMESG000043462.1 Contig210newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002079SMED30002079SMESG000043462.1 Contig210uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002079SMED30002079SMESG000049099.1 Contig210newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002079SMED30002079SMESG000049099.1 Contig210uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035917SMED30035917SMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044907.1 SMESG000044888.1 SMESG000035804.1 SMESG000035755.1 Contig2059newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027273SMED30027273SMESG000017031.1 Contig2590newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029088SMED30029088SMESG000017135.1 Contig2203newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012021SMED30012021 Contig6139newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005012SMED30005012 Contig1286newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002222SMED30002222 Contig7536newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002222SMED30002222 Contig7536uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30010645SMED30010645 Contig1674newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034100SMED30034100 Contig1700newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034100SMED30034100 Contig1700uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028216RNA polymerase II subunit A C-terminal domain phosphatase Contig6262newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028216RNA polymerase II subunit A C-terminal domain phosphatase Contig6262uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029207SMED30029207 Contig1681newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028854SMED30028854 Contig1674GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30025103Actin Contig6807newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30025103Actin Contig6807uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020068Protein rolling stone Contig174GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED300097175-aminolevulinate synthaseSMESG000078664.1 SMED30009717smed_20140614PMID:27551436
Wang et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30025591porcupine-like proteinSMESG000051516.1 ABW97518.1smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult fluorescence in situ hybridization evidence
gutSMED30025591porcupine-like proteinSMESG000051516.1 EU130791.1smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult fluorescence in situ hybridization evidence
gutSMED30016141lissencephaly-1SMESG000054739.1 SMESG000035997.1 JQ650355.1smed_ncbi_20200123PMID:22411224
Cowles et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001081NudC nuclear distribution proteinSMESG000036795.1 DN303982.1ncbi_smed_estsPMID:22411224
Cowles et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020436Nuclear distribution protein nudE-like 1SMESG000016071.1 HO006501.1ncbi_smed_estsPMID:22411224
Cowles et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002213Zinc finger, C2H2 typeSMESG000075102.1 dd_Smed_v4_3443_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30009281Netrin-4SMESG000062589.1 dd_Smed_v4_6093_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013891Ig-like domain-containing proteinSMESG000075643.1 dd_Smed_v4_19460_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017231NEPH-3SMESG000022777.1 dd_Smed_v4_11280_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005706SMED30005706SMESG000021036.1 SMESG000021035.1 SMESG000021034.1 dd_Smed_v4_5445_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019378Exocyst complex componentSMESG000065870.1 dd_Smed_v4_2186_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007383GCR103SMESG000061776.1 dd_Smed_v4_7534_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30033902sec1 family domain-containing protein 1SMESG000044570.1 dd_Smed_v4_2992_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30022844NEPH-3SMESG000022777.1 dd_Smed_v4_11280_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008405Scavenger receptor class B, member 2SMESG000058915.1 dd_Smed_v4_2304_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017862Jagged 2-1SMESG000025147.1 dd_Smed_v4_4792_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30010350SMED30010350SMESG000017804.1 SMESG000017801.1 dd_Smed_v4_1_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024185slc10a-5SMESG000064830.1 dd_Smed_v4_11330_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023831Phosphatase 1 regulatory subunit 37-like proteinSMESG000078284.1 dd_Smed_v4_5089_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024236InnexinSMESG000056430.1 AY967558smed_ncbi_20200123PMID:17670787
Oviedo et al., 2007
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028401InnexinSMESG000056430.1 AY967558smed_ncbi_20200123PMID:17670787
Oviedo et al., 2007
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001723HTH CENPB-type domain-containing proteinSMESG000049778.1 SMESG000048378.1 SMESG000039423.1 SMESG000039024.1 SMESG000024543.1 SMESG000022136.1 SMESG000002434.1 JF894290.2smed_ncbi_20200123PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult fluorescence in situ hybridization evidence
gutSMED30001723HTH CENPB-type domain-containing proteinSMESG000049778.1 SMESG000048378.1 SMESG000039423.1 SMESG000039024.1 SMESG000024543.1 SMESG000022136.1 SMESG000002434.1 JF894290.2smed_ncbi_20200123PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30006752TorSMESG000025384.1 JF894291.2smed_ncbi_20200123PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30006752TorSMESG000025384.1 JF894291.2smed_ncbi_20200123PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult fluorescence in situ hybridization evidence
gutSMED30028047Regulatory-associated protein of mTORSMESG000049778.1 SMESG000048378.1 SMESG000039423.1 SMESG000039024.1 SMESG000024543.1 SMESG000022136.1 SMESG000002434.1 JF894290.2smed_ncbi_20200123PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult fluorescence in situ hybridization evidence
gutSMED30028047Regulatory-associated protein of mTORSMESG000049778.1 SMESG000048378.1 SMESG000039423.1 SMESG000039024.1 SMESG000024543.1 SMESG000022136.1 SMESG000002434.1 JF894290.2smed_ncbi_20200123PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30022631Dimer_Tnp_hAT domain-containing proteinSMESG000049778.1 SMESG000048378.1 SMESG000039423.1 SMESG000039024.1 SMESG000024543.1 SMESG000022136.1 SMESG000002434.1 JF894290.2smed_ncbi_20200123PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult fluorescence in situ hybridization evidence
gutSMED30022631Dimer_Tnp_hAT domain-containing proteinSMESG000049778.1 SMESG000048378.1 SMESG000039423.1 SMESG000039024.1 SMESG000024543.1 SMESG000022136.1 SMESG000002434.1 JF894290.2smed_ncbi_20200123PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014131RPTOR independent companion of MTOR, complex 2 aSMESG000033571.1 SMESG000033570.1 JN815259.1smed_ncbi_20200123PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007461Ubiquitin-60S ribosomal protein L40SMESG000066595.1 SmedASXL_002380SmedAsxl_ww_GCZZ01PMID:29158443
He et al., 2017
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013673SMED30013673SMESG000035327.1 SmedASXL_016646SmedAsxl_ww_GCZZ01PMID:29158443
He et al., 2017
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30018398Superoxide dismutase [Cu-Zn]SMESG000005021.1 SmedASXL_019073SmedAsxl_ww_GCZZ01PMID:29158443
He et al., 2017
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020231DUF3421 domain-containing proteinSMESG000046728.1 SmedASXL_004676SmedAsxl_ww_GCZZ01PMID:29158443
He et al., 2017
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029625slc39a-1SMESG000016191.1 SmedASXL_003002SmedAsxl_ww_GCZZ01PMID:29158443
He et al., 2017
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30003448Glycine N-methyltransferaseSMESG000037719.1 SmedASXL_008095SmedAsxl_ww_GCZZ01PMID:29158443
He et al., 2017
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001319slc24a-8SMESG000030115.1 SmedASXL_015989SmedAsxl_ww_GCZZ01PMID:29158443
He et al., 2017
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032008PhosphodiesteraseSMESG000056509.1 SmedASXL_014050SmedAsxl_ww_GCZZ01PMID:29158443
He et al., 2017
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002437SMED30002437 SmedASXL_052019SmedAsxl_ww_GCZZ01PMID:29158443
He et al., 2017
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30031208Histone-lysine N-methyltransferase SETMAR SmedASXL_077649SmedAsxl_ww_GCZZ01PMID:29158443
He et al., 2017
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015406TNF receptor-associated factorSMESG000035446.1 tr5_1521mu_Smed_v1PMID:25558068
Reuter et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
gutSMED30010096TPA_inf: prohormone convertase 2SMESG000008070.1 tr5_785mu_Smed_v1PMID:25558068
Reuter et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030074Mothers against decapentaplegic homologSMESG000029614.1 SMED30030074smed_20140614PMID:25558068
Reuter et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004928phosphatidylinositol 4-kinase betaSMESG000061430.1 tr5_4416mu_Smed_v1PMID:25558068
Reuter et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016511SMED30016511SMESG000072006.1 tr5_6444mu_Smed_v1PMID:25558068
Reuter et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008875SMED30008875SMESG000027213.1 tr5_1296mu_Smed_v1PMID:25558068
Reuter et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
gutSMED30003196Adenosine kinaseSMESG000027213.1 tr5_1296mu_Smed_v1PMID:25558068
Reuter et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
gutSMED30012449ralBP1-associated Eps domain-containing protein 1 isoform X8SMESG000023078.1 tr5_3835mu_Smed_v1PMID:25558068
Reuter et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034772Fibrillar collagen NC1 domain-containing proteinSMESG000077977.1 tr5_2051mu_Smed_v1PMID:25558068
Reuter et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30025591porcupine-like proteinSMESG000051516.1 EU130791.1smed_ncbi_20200123PMID:29557542
Han et al., 2019
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015041Retinoic acid receptor betaSMESG000054304.1 SMED30015041smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
gutSMED30010986Lysyl oxidase-likeSMESG000078255.1 dd_Smed_v4_10591_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30005748HNF4SMESG000014588.1 dd_Smed_v4_1694_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30008855Copper-transporting ATPase 1SMESG000058134.1 dd_Smed_v4_8956_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30010528SMED30010528SMESG000014705.1 dd_Smed_v4_1473_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30000459Dynamin-1-like proteinSMESG000058940.1 dd_Smed_v4_388_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30002213Zinc finger, C2H2 typeSMESG000075102.1 dd_Smed_v4_3443_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30003172Adenylosuccinate synthetaseSMESG000078697.1 dd_Smed_v4_2154_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30005508Long-chain-fatty-acid--CoA ligaseSMESG000024739.1 dd_Smed_v4_2009_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30003947transient receptor potential cation channel subfamily M member 3SMESG000005077.1 SMESG000004900.1 dd_Smed_v4_10485_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30032645Heterochromatin protein 1-1SMESG000004606.1 SMESG000004604.1 dd_Smed_v4_928_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30007290GATA456SMESG000039559.1 SMESG000037031.1 dd_Smed_v4_4075_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30005802SMED30005802SMESG000072483.1 dd_Smed_v4_5611_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30001630Ras-related C3 botulinum toxin substrate 1SMESG000024968.1 SMESG000005612.1 dd_Smed_v4_1050_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30021063SMED30021063SMESG000025889.1 dd_Smed_v4_17_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30030835RING-CH-type domain-containing proteinSMESG000056612.1 dd_Smed_v4_4997_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30035424NLK-1SMESG000023289.1 SMESG000023149.1 dd_Smed_v4_4172_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30007637SMED30007637SMESG000066417.1 SMESG000066414.1 dd_132dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
gutSMED30007637SMED30007637SMESG000066417.1 SMESG000066414.1 dd_Smed_v4_132_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30002600ATPase_AAA_core domain-containing proteinSMESG000077685.1 SMESG000072345.1 dd_Smed_v4_11466_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30005457SMED30005457SMESG000035312.1 SMESG000035313.1 dd_131dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
gutSMED30005457SMED30005457SMESG000035312.1 dd_Smed_v4_131_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30012356SMED30012356SMESG000035312.1 SMESG000035313.1 dd_131dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
gutSMED30012356SMED30012356SMESG000035313.1 dd_Smed_v4_2506_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30014756SMED30014756SMESG000035312.1 SMESG000035313.1 dd_131dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
gutSMED30012869Y-box-binding protein 1SMESG000032189.1 dd_Smed_v4_114_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30003676C-type lectin domain-containing proteinSMESG000028261.1 SMESG000028260.1 SMESG000028258.1 dd_Smed_v4_10_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30033476Zinc finger protein, putativeSMESG000025870.1 dd_Smed_v4_3821_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30027034Aminotran_5 domain-containing proteinSMESG000033958.1 dd_Smed_v4_6547_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30015498SMED30015498SMESG000066416.1 SMESG000066413.1 dd_115dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
gutSMED30015498SMED30015498SMESG000066416.1 SMESG000066413.1 dd_Smed_v4_115_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30029442epidermal growth factor receptor 2SMESG000004201.1 SMESG000004200.1 dd_Smed_v4_10499_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30020956Lysosomal alpha-glucosidaseSMESG000005050.1 dd_Smed_v4_1062_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30021161MARVEL domain-containing proteinSMESG000013795.1 dd_Smed_v4_1798_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30027595DUF3421 domain-containing proteinSMESG000027124.1 dd_Smed_v4_1333_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30034467Protein tyrosine phosphatase type IVASMESG000078978.1 SMESG000078867.1 SMESG000010171.1 dd_Smed_v4_2239_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30011793Homeobox protein DTH-1SMESG000079512.1 dd_Smed_v4_2716_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30000758SMED30000758SMESG000050509.1 dd_Smed_v4_1451_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30011727Dedicator of cytokinesis 4bSMESG000063593.1 SMESG000063592.1 SMESG000063595.1 dd_Smed_v4_6156_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30001294Phosphatidylinositol-binding clathrin assembly proteinSMESG000072544.1 dd_Smed_v4_1463_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30012447FilaminSMESG000064795.1 dd_Smed_v4_2272_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30020784SMED30020784SMESG000011782.1 dd_Smed_v4_10359_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30025591porcupine-like proteinSMESG000051516.1 dd_Smed_v4_413_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30020296Vitellogenin domain-containing proteinSMESG000037978.1 SMESG000037977.1 dd_Smed_v4_194_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30021685Bestrophin homologSMESG000070057.1 dd_Smed_v4_8073_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30025582SMED30025582SMESG000057502.1 dd_Smed_v4_13694_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30000194Alpha-adducinSMESG000012838.1 dd_Smed_v4_3469_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30019205Neur_chan_LBD domain-containing proteinSMESG000039749.1 dd_Smed_v4_15962_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30000064GCR153SMESG000035163.1 dd_Smed_v4_3051_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30012889Family S33 non-peptidase homologue (S33 family)SMESG000021236.1 dd_Smed_v4_1414_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30016234General transcription factor II-I repeat domain-containing protein 2ASMESG000039749.1 dd_Smed_v4_15962_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30000108Glycerol-3-phosphate dehydrogenase [NAD( )]SMESG000008767.1 dd_Smed_v4_4661_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30001852CD109 antigenSMESG000016163.1 dd_Smed_v4_3070_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30033332Beta-adducinSMESG000059133.1 dd_Smed_v4_1425_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30020414SMED30020414SMESG000017203.1 dd_Smed_v4_391_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30034597PeriostinSMESG000070985.1 dd_Smed_v4_1505_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30024121TetraspaninSMESG000023248.1 dd_Smed_v4_1808_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30007156OxidoreductaseSMESG000016829.1 dd_Smed_v4_2290_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30005280SMED30005280SMESG000077104.1 dd_Smed_v4_4063_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30005546Coronin-1BSMESG000037126.1 SMESG000026646.1 dd_Smed_v4_448_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30005489AP-3 complex subunit mu-1SMESG000025662.1 dd_Smed_v4_4846_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30004963F-actin-capping protein subunit alphaSMESG000012977.1 dd_Smed_v4_2399_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30006764Phosphatidylinositol 3-kinase regulatory subunit alphaSMESG000078199.1 dd_Smed_v4_4794_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30000430Ras-related C3 botulinum toxin substrate 1SMESG000005012.1 dd_Smed_v4_3362_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30002344Bax inhibitor-1 proteinSMESG000038559.1 dd_Smed_v4_319_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30008076Reverse transcriptase domain-containing proteinSMESG000008737.1 dd_Smed_v4_540_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30002133PolyubiquitinSMESG000039444.1 SMESG000014081.1 dd_Smed_v4_34_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30009287Protein kinase, putativeSMESG000074416.1 SMESG000074407.1 dd_Smed_v4_3361_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30009287Protein kinase, putativeSMESG000074416.1 SMESG000074409.1 SMESG000074407.1 dd_Smed_v4_7011_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30004031Cyclin-dependent kinase 16SMESG000023289.1 SMESG000023149.1 dd_Smed_v4_4172_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30006887Gelsolin-like proteinSMESG000015927.1 dd_Smed_v4_929_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30001296Actin-related protein 2SMESG000019700.1 dd_Smed_v4_623_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30007461Ubiquitin-60S ribosomal protein L40SMESG000066595.1 dd_Smed_v4_338_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30007434NADPH:adrenodoxin oxidoreductase, mitochondrialSMESG000050975.1 dd_Smed_v4_8668_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30010816SH3 and multiple ankyrin repeat domains protein 3SMESG000018129.1 dd_Smed_v4_4371_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30002547Peptidyl-prolyl cis-trans isomeraseSMESG000052204.1 SMESG000006596.1 dd_Smed_v4_457_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30004319Coiled-coil domain containing 88CSMESG000066575.1 SMESG000066583.1 dd_Smed_v4_5291_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30035642Granulin bSMESG000029882.1 dd_Smed_v4_162_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30035642Granulin bSMESG000029882.1 dd_Smed_v4_442_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30014374Low affinity cationic amino acid transporterSMESG000049007.1 dd_Smed_v4_2552_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30007704ActinSMESG000051672.1 SMESG000051670.1 dd_Smed_v4_3_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30018404SMED30018404SMESG000032486.1 dd_Smed_v4_4574_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30011227Decapping enzyme like-1 proteinSMESG000037126.1 SMESG000026646.1 dd_Smed_v4_448_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30011227Decapping enzyme like-1 proteinSMESG000029986.1 dd_Smed_v4_2353_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30019729Bestrophin homologSMESG000080433.1 SMESG000010902.1 dd_Smed_v4_8882_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30019729Bestrophin homologSMESG000070057.1 dd_Smed_v4_8073_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30013591Fructose-bisphosphate aldolaseSMESG000027545.1 dd_Smed_v4_398_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30017004Kunitz-type serine protease inhibitorSMESG000037995.1 dd_Smed_v4_300_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30001799NADH dehydrogenase subunit 5 dd_Smed_v4_258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30001799NADH dehydrogenase subunit 5 dd_Smed_v4_957_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30014246Ras-related protein Rab-5ASMESG000064914.1 dd_Smed_v4_796_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30015967Neurotracting/lsamp/neurotrimin/obcam related cell adhesion moleculeSMESG000068491.1 dd_Smed_v4_2826_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30013787SMED30013787SMESG000017258.1 dd_Smed_v4_5255_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED3000844110-formyltetrahydrofolate dehydrogenaseSMESG000005275.1 dd_Smed_v4_5787_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30014138LIM homeobox 1bSMESG000022856.1 dd_Smed_v4_8252_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30015243Kinase-like proteinSMESG000053627.1 dd_Smed_v4_3194_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30010792Protein kinaseSMESG000074416.1 SMESG000074407.1 dd_Smed_v4_3361_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30012219Protein disulfide-isomeraseSMESG000041085.1 dd_Smed_v4_426_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30020521Glycerol-3-phosphate acyltransferase 3SMESG000061821.1 dd_Smed_v4_2445_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30028497AdenosylhomocysteinaseSMESG000012954.1 SMESG000012950.1 dd_Smed_v4_526_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30028521Cadmium metallothionein (MT-Cd) (Cd-MT)SMESG000013781.1 dd_Smed_v4_3412_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30024204SMED30024204SMESG000027140.1 dd_75dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
gutSMED30024204SMED30024204SMESG000027140.1 dd_Smed_v4_75_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30033014Phosphatidylinositol-4,5-bisphosphate 4-phosphataseSMESG000063221.1 dd_Smed_v4_1079_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30024805Ubiquitin carboxyl-terminal hydrolaseSMESG000057601.1 dd_Smed_v4_4760_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30025543Coiled-coil domain-containing protein 93SMESG000022913.1 dd_Smed_v4_2519_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30021001Protein kinaseSMESG000017252.1 SMESG000017249.1 SMESG000017248.1 dd_Smed_v4_311_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30024778SMB domain-containing proteinSMESG000022577.1 dd_Smed_v4_5786_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30026136Nad dependent epimerase dehydrataseSMESG000035068.1 dd_Smed_v4_3452_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30034849Kyphoscoliosis peptidaseSMESG000061907.1 dd_Smed_v4_1109_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30024358Protein 4.1SMESG000029732.1 dd_Smed_v4_2825_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30024358Protein 4.1SMESG000029732.1 dd_Smed_v4_5331_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30020269MyophilinSMESG000081505.1 SMESG000049198.1 SMESG000047694.1 SMESG000035451.1 SMESG000035348.1 dd_Smed_v4_395_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30024035Serine/Threonine kinase domain proteinSMESG000071539.1 dd_Smed_v4_5501_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30027689LipaseSMESG000074185.1 dd_Smed_v4_4693_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30023057Polypyrimidine tract-binding protein 1SMESG000018057.1 dd_Smed_v4_2799_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30020244Protein kinase domain containing proteinSMESG000017252.1 SMESG000017249.1 SMESG000017248.1 dd_Smed_v4_311_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30020807Phosphatase and actin regulatorSMESG000077760.1 dd_Smed_v4_4162_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30028019Phospholipid-transporting ATPaseSMESG000013933.1 dd_Smed_v4_5121_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30025294rRNA 2'-O-methyltransferase fibrillarinSMESG000051648.1 dd_Smed_v4_2811_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30020124Ribosome biogenesis regulatory proteinSMESG000071880.1 dd_Smed_v4_2458_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30023739SMED30023739SMESG000057519.1 SMESG000057514.1 dd_Smed_v4_3277_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30021332Cytochrome cSMESG000045852.1 dd_Smed_v4_464_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30024236InnexinSMESG000056430.1 dd_Smed_v4_734_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30020811SMED30020811SMESG000005612.1 dd_Smed_v4_7446_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30020811SMED30020811SMESG000005612.1 dd_Smed_v4_2483_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30018252Cathepsin L2SMESG000049723.1 dd_Smed_v4_48_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30016492B-cell receptor-associated protein 31SMESG000064614.1 dd_Smed_v4_1559_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30017013Vesicle-associated membrane protein 3SMESG000033382.1 dd_Smed_v4_1311_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30010541F-actin-capping protein subunit betaSMESG000008209.1 dd_Smed_v4_1165_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30002332TNF receptor associated factor-2SMESG000070267.1 dd_Smed_v4_2599_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30009611Str_synth domain-containing proteinSMESG000052600.1 dd_Smed_v4_1480_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30003809Vitellogenin domain-containing proteinSMESG000073666.1 dd_Smed_v4_636_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30004948Lysosomal Pro-X carboxypeptidaseSMESG000074424.1 dd_Smed_v4_1351_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30001710Vacuolar protein sorting 4SMESG000075482.1 dd_Smed_v4_1556_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30028574Cytochrome P450 2K1-like proteinSMESG000078092.1 SMESG000078091.1 dd_Smed_v4_2351_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30031423ATP synthase subunitSMESG000021514.1 dd_Smed_v4_428_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30032422SynaptogyrinSMESG000031799.1 dd_Smed_v4_5946_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30034127Peptidase S1 domain-containing proteinSMESG000076526.1 dd_Smed_v4_7541_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30033585Elongation of very long chain fatty acids proteinSMESG000021565.1 dd_Smed_v4_523_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30029077Macrophage-expressed gene 1 proteinSMESG000044681.1 dd_Smed_v4_983_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30035485low density lipoprotein receptor related-2SMESG000041448.1 dd_Smed_v4_3632_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30022992Myosin heavy chainSMESG000062420.1 dd_Smed_v4_791_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30033686TNF receptor associated factor-2SMESG000027283.1 dd_Smed_v4_6768_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30028401InnexinSMESG000056430.1 dd_Smed_v4_734_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30034296Protein kinase domain-containing proteinSMESG000017258.1 dd_Smed_v4_5255_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30030662SMED30030662SMESG000024141.1 dd_Smed_v4_2719_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30034430Arp2/3 complex 34 kDa subunitSMESG000073809.1 dd_Smed_v4_693_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30017878RING finger protein unkempt homologSMESG000001908.1 SMESG000001895.1 SMESG000054185.1 SMESG000003953.1 Contig32newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017878RING finger protein unkempt homologSMESG000001908.1 SMESG000001895.1 SMESG000054185.1 SMESG000003953.1 Contig32uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017878RING finger protein unkempt homologSMESG000003941.1 Contig32newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017878RING finger protein unkempt homologSMESG000003941.1 Contig32uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002941Actin-related protein 2/3 complex subunit 3SMESG000001908.1 SMESG000001895.1 SMESG000054185.1 SMESG000003953.1 Contig32GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002941Actin-related protein 2/3 complex subunit 3SMESG000003941.1 Contig32GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30006484EGF-like domain-containing proteinSMESG000032835.1 SMESG000032829.1 Contig2869GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30006484EGF-like domain-containing proteinSMESG000034231.1 Contig2869GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30003493Telomerase protein component 1SMESG000032835.1 SMESG000032829.1 Contig2869newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30003493Telomerase protein component 1SMESG000032835.1 SMESG000032829.1 Contig2869uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30003493Telomerase protein component 1SMESG000034231.1 Contig2869newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30003493Telomerase protein component 1SMESG000034231.1 Contig2869uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035887TNF receptor associated factor-2SMESG000020851.1 Contig1182GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032850SMED30032850SMESG000035248.1 Contig3418newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032850SMED30032850SMESG000035248.1 Contig3418uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032850SMED30032850SMESG000007797.1 Contig3418newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032850SMED30032850SMESG000007797.1 Contig3418uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30033930Cystathionine beta-synthaseSMESG000054075.1 SMESG000034294.1 Contig1264GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30033930Cystathionine beta-synthaseSMESG000065264.1 SMESG000065255.1 Contig1264GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024958VAMP (vesicle-associated membrane protein)-associated protein A, likeSMESG000079557.1 SMESG000074066.1 Contig5553GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024958VAMP (vesicle-associated membrane protein)-associated protein A, likeSMESG000062111.1 Contig5553GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030705SMED30030705SMESG000068156.1 SMESG000010609.1 SMESG000076470.1 SMESG000073857.1 SMESG000062429.1 SMESG000060487.1 SMESG000058575.1 SMESG000053533.1 SMESG000026676.1 SMESG000020635.1 SMESG000015751.1 SMESG000005260.1 Contig236newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030705SMED30030705SMESG000068156.1 SMESG000043474.1 SMESG000076470.1 SMESG000053533.1 SMESG000015751.1 Contig250newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030705SMED30030705SMESG000068156.1 SMESG000064685.1 SMESG000010609.1 SMESG000076470.1 SMESG000073857.1 SMESG000062429.1 SMESG000060487.1 SMESG000058575.1 SMESG000053533.1 SMESG000026676.1 SMESG000020635.1 SMESG000015751.1 SMESG000005260.1 Contig239newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030705SMED30030705SMESG000057816.1 Contig239newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030705SMED30030705SMESG000025034.1 Contig250newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030705SMED30030705SMESG000037949.1 Contig236newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027682NAD(P)H-dependent FMN reductaseSMESG000060640.1 Contig3408newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027682NAD(P)H-dependent FMN reductaseSMESG000060640.1 Contig3408uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027682NAD(P)H-dependent FMN reductaseSMESG000074871.1 Contig3408newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027682NAD(P)H-dependent FMN reductaseSMESG000074871.1 Contig3408uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030829Y-box proteinSMESG000032180.1 Contig1715GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030407LipaseSMESG000035248.1 Contig3418GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030407LipaseSMESG000007797.1 Contig3418GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30022535GTPase activating proteinSMESG000068156.1 SMESG000010609.1 SMESG000076470.1 SMESG000073857.1 SMESG000062429.1 SMESG000060487.1 SMESG000058575.1 SMESG000053533.1 SMESG000026676.1 SMESG000020635.1 SMESG000015751.1 SMESG000005260.1 Contig236GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30022535GTPase activating proteinSMESG000037949.1 Contig236GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034315Adenylyl cyclase-associated proteinSMESG000065082.1 Contig5150GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034315Adenylyl cyclase-associated proteinSMESG000032321.1 Contig5150GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032354EOG090X01A3SMESG000068156.1 SMESG000010609.1 SMESG000076470.1 SMESG000073857.1 SMESG000062429.1 SMESG000060487.1 SMESG000058575.1 SMESG000053533.1 SMESG000026676.1 SMESG000020635.1 SMESG000015751.1 SMESG000005260.1 Contig236newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032354EOG090X01A3SMESG000068156.1 SMESG000043474.1 SMESG000076470.1 SMESG000053533.1 SMESG000015751.1 Contig250newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032354EOG090X01A3SMESG000068156.1 SMESG000064685.1 SMESG000043474.1 SMESG000010609.1 SMESG000076470.1 SMESG000073857.1 SMESG000062429.1 SMESG000058575.1 SMESG000053533.1 SMESG000020635.1 SMESG000015751.1 SMESG000005260.1 Contig246newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032354EOG090X01A3SMESG000068156.1 SMESG000064685.1 SMESG000010609.1 SMESG000076470.1 SMESG000073857.1 SMESG000062429.1 SMESG000060487.1 SMESG000058575.1 SMESG000053533.1 SMESG000026676.1 SMESG000020635.1 SMESG000015751.1 SMESG000005260.1 Contig239newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032354EOG090X01A3SMESG000000175.1 Contig246newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032354EOG090X01A3SMESG000057816.1 Contig239newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032354EOG090X01A3SMESG000025034.1 Contig250newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032354EOG090X01A3SMESG000037949.1 Contig236newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024498SMED30024498SMESG000036544.1 Contig3175newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024498SMED30024498SMESG000036544.1 Contig3175uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024498SMED30024498SMESG000000175.1 Contig3175newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024498SMED30024498SMESG000000175.1 Contig3175uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30033380Beta-hexosaminidaseSMESG000037355.1 Contig5533newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30033380Beta-hexosaminidaseSMESG000037355.1 Contig5533uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30033380Beta-hexosaminidaseSMESG000024479.1 Contig5533newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30033380Beta-hexosaminidaseSMESG000024479.1 Contig5533uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028080SMED30028080SMESG000037355.1 Contig5533GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028080SMED30028080SMESG000024479.1 Contig5533GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028080SMED30028080SMESG000024479.1 PL030011B10G11ncbi_smed_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013863Rac-1SMESG000024961.1 Contig5482GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016368Endoribonuclease DicerSMESG000073604.1 Contig1511newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016368Endoribonuclease DicerSMESG000073604.1 Contig1511uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016368Endoribonuclease DicerSMESG000078091.1 SMESG000078098.1 SMESG000078094.1 SMESG000078092.1 Contig1511newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016368Endoribonuclease DicerSMESG000078091.1 SMESG000078098.1 SMESG000078094.1 SMESG000078092.1 Contig1511uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011617Actin-related protein 2/3 complex subunit 4SMESG000043420.1 Contig1665GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011617Actin-related protein 2/3 complex subunit 4SMESG000003841.1 Contig1665GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014901ATP-binding cassette sub-family A member 3-like ProteinSMESG000080870.1 Contig6189newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014901ATP-binding cassette sub-family A member 3-like ProteinSMESG000080870.1 Contig6189uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012378Clathrin heavy chainSMESG000040592.1 Contig5422GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012378Clathrin heavy chainSMESG000035457.1 Contig5422GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012378Clathrin heavy chainSMESG000072345.1 Contig4452GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012378Clathrin heavy chainSMESG000035457.1 Contig4452GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016267beta-secretase 1SMESG000074842.1 Contig1168GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016267beta-secretase 1SMESG000037819.1 Contig1168GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017930SMED30017930SMESG000049597.1 Contig5044newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017930SMED30017930SMESG000004871.1 Contig5044newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015783O-acyltransferaseSMESG000000989.1 SMESG000000988.1 Contig1658GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016943slc15a-6SMESG000064204.1 Contig1439GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016943slc15a-6SMESG000030835.1 Contig1439GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021511SMED30021511SMESG000038232.1 Contig5776GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30025048exportin-1SMESG000045533.1 Contig1156newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30025048exportin-1SMESG000035447.1 Contig1156newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020153SMED30020153SMESG000025120.1 Contig1559GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30022703dual specificity protein phosphatase 12SMESG000014789.1 Contig1758GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021235Tubulin alpha chainSMESG000059785.1 Contig1211GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021235Tubulin alpha chainSMESG000079004.1 Contig1211GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021235Tubulin alpha chainSMESG000079004.1 PL030009A10F06ncbi_smed_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028380Ras-related proteinSMESG000024796.1 Contig3946newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028380Ras-related proteinSMESG000024796.1 Contig3946uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028380Ras-related proteinSMESG000001576.1 Contig3946newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028380Ras-related proteinSMESG000001576.1 Contig3946uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30033333SMED30033333SMESG000004952.1 Contig516newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020317Heat shock protein 90SMESG000024822.1 Contig1490GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029022SMED30029022SMESG000031167.1 Contig3159newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30033807SMED30033807SMESG000076385.1 SMESG000076375.1 SMESG000076363.1 SMESG000076223.1 SMESG000076482.1 SMESG000076470.1 SMESG000076410.1 SMESG000076358.1 Contig1645newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030305Peptidase_M14 domain-containing proteinSMESG000037626.1 Contig1315GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030305Peptidase_M14 domain-containing proteinSMESG000048042.1 Contig1315GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029698Caspase-7SMESG000053168.1 Contig2992GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30022486SMED30022486SMESG000043383.1 Contig1883newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023611SMED30023611SMESG000031125.1 Contig1620newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028174TTF-type domain-containing proteinSMESG000003943.1 Contig6476newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028174TTF-type domain-containing proteinSMESG000003943.1 Contig6476uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007290GATA456SMESG000039559.1 SMESG000037031.1 AFF18488.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
gutSMED30007290GATA456SMESG000039559.1 SMESG000037031.1 AFF18488.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
gutSMED30007290GATA456SMESG000039559.1 SMESG000037031.1 AFF18488.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
gutSMED30025591porcupine-like proteinSMESG000051516.1 SMESG000051515.1 SMED30025591smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
gutSMED30025591porcupine-like proteinSMESG000051516.1 SMESG000051515.1 SMED30025591smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
gutSMED30025591porcupine-like proteinSMESG000051516.1 SMESG000051515.1 SMED30025591smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
gutSMED30025591porcupine-like proteinSMESG000051516.1 EU130791.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
gutSMED30025591porcupine-like proteinSMESG000051516.1 EU130791.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
gutSMED30025591porcupine-like proteinSMESG000051516.1 EU130791.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
gutSMED30025591porcupine-like proteinSMESG000051516.1 EU130791smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
gutSMED30025591porcupine-like proteinSMESG000051516.1 EU130791smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
gutSMED30025591porcupine-like proteinSMESG000051516.1 EU130791smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
gutSMED30029442epidermal growth factor receptor 2SMESG000004201.1 SMESG000004200.1 HM777017smed_ncbi_20200123PMID:21458439
Fraguas et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30009712epidermal growth factor receptor 1SMESG000070834.1 HM777018smed_ncbi_20200123PMID:21458439
Fraguas et al., 2011
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005748HNF4SMESG000014588.1 hnf4smed_ncbi_20200123PMID:25254346
Scimone et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007290GATA456SMESG000039559.1 SMESG000037031.1 JF802198.1smed_ncbi_20200123PMID:25254346
Scimone et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005508Long-chain-fatty-acid--CoA ligaseSMESG000024739.1 Contig35360newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005508Long-chain-fatty-acid--CoA ligaseSMESG000024739.1 Contig35360uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013605SMED30013605SMESG000048192.1 Contig26075newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013605SMED30013605SMESG000048192.1 Contig26075uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012447FilaminSMESG000064795.1 Contig38577newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012447FilaminSMESG000064795.1 Contig38577uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012447FilaminSMESG000064795.1 Contig18792newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012447FilaminSMESG000064795.1 Contig18792uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020784SMED30020784SMESG000011782.1 Contig32583newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020784SMED30020784SMESG000011782.1 Contig32583uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020296Vitellogenin domain-containing proteinSMESG000037978.1 SMESG000037977.1 Contig38414newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020296Vitellogenin domain-containing proteinSMESG000037978.1 SMESG000037977.1 Contig38414uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020296Vitellogenin domain-containing proteinSMESG000037978.1 Contig54872newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020296Vitellogenin domain-containing proteinSMESG000037978.1 Contig54872uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014474Tumor susceptibility gene 101 proteinSMESG000019745.1 SMESG000004871.1 Contig36279newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014474Tumor susceptibility gene 101 proteinSMESG000019745.1 SMESG000004871.1 Contig36279uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017805CRAL-TRIO domain-containing proteinSMESG000009872.1 Contig54399newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017805CRAL-TRIO domain-containing proteinSMESG000009872.1 Contig54399uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020602carboxypeptidase B-likeSMESG000066311.1 Contig47029newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020602carboxypeptidase B-likeSMESG000066311.1 Contig47029uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002497Neuronal acetylcholine receptor subunit alpha-4SMESG000005358.1 Contig36571newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002497Neuronal acetylcholine receptor subunit alpha-4SMESG000005358.1 Contig36571uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005935TNF receptor-associated factor 2SMESG000070131.1 SMESG000070129.1 Contig51373newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005935TNF receptor-associated factor 2SMESG000070131.1 SMESG000070129.1 Contig51373uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30009712epidermal growth factor receptor 1SMESG000070834.1 Contig29100newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30009712epidermal growth factor receptor 1SMESG000070834.1 Contig29100uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001799NADH dehydrogenase subunit 5SMESG000061907.1 Contig47838newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001799NADH dehydrogenase subunit 5SMESG000061907.1 Contig47838uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED3000844110-formyltetrahydrofolate dehydrogenaseSMESG000005275.1 Contig10102newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED3000844110-formyltetrahydrofolate dehydrogenaseSMESG000005275.1 Contig10102uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015235Amyloid-beta A4 precursor protein-binding family A member 2SMESG000028901.1 Contig30620newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015235Amyloid-beta A4 precursor protein-binding family A member 2SMESG000028901.1 Contig30620uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015243Kinase-like proteinSMESG000053627.1 Contig48300newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015243Kinase-like proteinSMESG000053627.1 Contig48300uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012555Ras-related protein Rab-39BSMESG000056866.1 Contig15474newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012555Ras-related protein Rab-39BSMESG000056866.1 Contig15474uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011526SMED30011526SMESG000064795.1 Contig38577newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011526SMED30011526SMESG000064795.1 Contig38577uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011526SMED30011526SMESG000064795.1 Contig18792newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011526SMED30011526SMESG000064795.1 Contig18792uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028497AdenosylhomocysteinaseSMESG000012954.1 SMESG000012950.1 Contig41958newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028497AdenosylhomocysteinaseSMESG000012954.1 SMESG000012950.1 Contig41958uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032932Protein kinase domain-containing proteinSMESG000066720.1 SMESG000065914.1 SMESG000065913.1 SMESG000044801.1 SMESG000021895.1 Contig36405newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032932Protein kinase domain-containing proteinSMESG000066720.1 SMESG000065914.1 SMESG000065913.1 SMESG000044801.1 SMESG000021895.1 Contig36405uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024778SMB domain-containing proteinSMESG000022577.1 Contig50773newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024778SMB domain-containing proteinSMESG000022577.1 Contig50773uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034849Kyphoscoliosis peptidaseSMESG000061907.1 Contig47838newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034849Kyphoscoliosis peptidaseSMESG000061907.1 Contig47838uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023739SMED30023739SMESG000057519.1 Contig30434newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023739SMED30023739SMESG000057519.1 Contig30434uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30022004SMED30022004SMESG000066720.1 SMESG000065914.1 SMESG000065913.1 SMESG000044801.1 SMESG000021895.1 Contig36405newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30022004SMED30022004SMESG000066720.1 SMESG000065914.1 SMESG000065913.1 SMESG000044801.1 SMESG000021895.1 Contig36405uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008066MTS domain-containing proteinSMESG000070491.1 Contig51955newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008066MTS domain-containing proteinSMESG000070491.1 Contig51955uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034127Peptidase S1 domain-containing proteinSMESG000076526.1 Contig49240newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034127Peptidase S1 domain-containing proteinSMESG000076526.1 Contig49240uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035485low density lipoprotein receptor related-2SMESG000041448.1 Contig42571newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002355Microtubule-associated protein RP/EB family member 1SMESG000069153.1 Contig19711newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002355Microtubule-associated protein RP/EB family member 1SMESG000069153.1 Contig19711uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30026747Metallophos domain-containing proteinSMESG000036432.1 dd_Smed_v4_3484_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30030925SMED30030925SMESG000038398.1 dd_Smed_v4_4195_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30034887RRM domain-containing proteinSMESG000017203.1 dd_Smed_v4_391_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30027178Multidrug resistance-associated protein 1SMESG000000275.1 SMESG000000273.1 SMESG000000262.1 SMESG000000250.1 SMESG000000247.1 SMESG000000245.1 dd_Smed_v4_9208_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30029727Zinc finger, C2H2 typeSMESG000073676.1 dd_Smed_v4_5177_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30026133BTB domain-containing proteinSMESG000073620.1 dd_Smed_v4_6327_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30031138Heterogeneous nuclear ribonucleoprotein A2SMESG000038668.1 dd_Smed_v4_3625_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30005523Alpha-actininSMESG000026000.1 dd_Smed_v4_1951_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30005885RanBP-type and C3HC4-type zinc finger containing 1SMESG000061945.1 dd_Smed_v4_1802_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30012043Calcium-transporting ATPaseSMESG000063816.1 SMESG000010536.1 SMESG000045280.1 SMESG000029730.1 dd_Smed_v4_4145_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30005425Leucine rich melanocyte differentiation associatedSMESG000076354.1 dd_Smed_v4_1865_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30013766Matrin-type domain-containing proteinSMESG000072403.1 dd_Smed_v4_1859_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30004654Triosephosphate isomeraseSMESG000027305.1 dd_Smed_v4_1402_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30011615SMED30011615SMESG000036524.1 dd_Smed_v4_11034_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30007199IlvB (bacterial acetolactate synthase)-likeSMESG000026596.1 dd_Smed_v4_1784_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30012966SMED30012966SMESG000052698.1 SMESG000027142.1 SMESG000059994.1 dd_Smed_v4_1029_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30012966SMED30012966SMESG000079607.1 SMESG000072955.1 SMESG000049847.1 SMESG000049844.1 SMESG000049832.1 SMESG000049812.1 SMESG000049806.1 SMESG000049805.1 SMESG000049772.1 SMESG000049767.1 SMESG000049756.1 SMESG000049745.1 SMESG000049740.1 SMESG000049739.1 SMESG000049695.1 SMESG000049688.1 SMESG000049683.1 SMESG000049676.1 SMESG000049665.1 SMESG000049663.1 SMESG000049647.1 SMESG000049621.1 SMESG000049614.1 SMESG000049601.1 SMESG000049567.1 SMESG000049548.1 SMESG000040301.1 SMESG000040257.1 SMESG000032755.1 SMESG000032715.1 SMESG000022696.1 SMESG000022691.1 SMESG000022676.1 SMESG000022665.1 SMESG000022640.1 SMESG000022619.1 SMESG000022612.1 dd_Smed_v4_490_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30010632E3 ubiquitin-protein ligase RGLG4SMESG000076482.1 SMESG000076409.1 SMESG000076405.1 SMESG000076390.1 SMESG000076375.1 SMESG000076364.1 SMESG000076223.1 SMESG000040665.1 SMESG000019753.1 dd_Smed_v4_1097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30015414G_PROTEIN_RECEP_F2_4 domain-containing proteinSMESG000070072.1 dd_Smed_v4_1789_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30015414G_PROTEIN_RECEP_F2_4 domain-containing proteinSMESG000033615.1 dd_Smed_v4_10981_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30008050TRAF-5SMESG000014795.1 dd_Smed_v4_15545_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30011690Heterogeneous nuclear ribonucleoprotein A2SMESG000050993.1 SMESG000050994.1 dd_Smed_v4_1194_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30000477Protein lifeguard 1SMESG000014373.1 dd_Smed_v4_16271_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30005772vault protein inter alpha trypsin-1SMESG000053671.1 SMESG000053669.1 SMESG000053667.1 SMESG000053664.1 SMESG000053657.1 SMESG000053638.1 dd_Smed_v4_1027_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30000639Microtubule-actin cross-linking factor 1-like isoform X28SMESG000017517.1 SMESG000017520.1 SMESG000017519.1 dd_Smed_v4_6577_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30013497Ribosome assembly factor mrt4SMESG000020510.1 dd_Smed_v4_1609_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30010860SMED30010860SMESG000022836.1 SMESG000013870.1 dd_Smed_v4_17481_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED3001818660S ribosomal protein L10SMESG000079023.1 SMESG000034764.1 SMESG000008177.1 SMESG000008153.1 dd_Smed_v4_130_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30003469FerritinSMESG000068032.1 SMESG000068030.1 SMESG000068027.1 dd_Smed_v4_1033_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30010103Splicing factor arginine:serine richSMESG000041611.1 dd_Smed_v4_1935_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30015791SMED30015791SMESG000023332.1 dd_Smed_v4_12418_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30007161SMED30007161SMESG000070072.1 dd_Smed_v4_1789_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30003360LipaseSMESG000002840.1 dd_Smed_v4_1565_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30001706C2H2-type domain-containing proteinSMESG000043342.1 dd_Smed_v4_11532_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED3000598860S ribosomal protein L24SMESG000007869.1 SMESG000007858.1 SMESG000007847.1 dd_Smed_v4_172_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED3000317640S ribosomal protein S2SMESG000051503.1 dd_Smed_v4_226_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED3000013460S ribosomal protein L4SMESG000009479.1 dd_Smed_v4_211_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30000901ThioredoxinSMESG000069662.1 SMESG000030342.1 dd_Smed_v4_89_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30005982delta-1SMESG000069662.1 SMESG000030342.1 dd_Smed_v4_89_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30010654SMED30010654SMESG000022832.1 SMESG000022828.1 dd_Smed_v4_3053_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30009281Netrin-4SMESG000062589.1 dd_Smed_v4_6093_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED300113944-aminobutyrate aminotransferaseSMESG000037567.1 dd_Smed_v4_4367_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30005631SMED30005631SMESG000047012.1 SMESG000047013.1 dd_Smed_v4_1450_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30006125C2H2-type domain-containing proteinSMESG000020158.1 dd_Smed_v4_14413_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30007277Tryptophan-2,3-dioxygenaseSMESG000075109.1 dd_Smed_v4_3550_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30015020E3 ubiquitin-protein ligase XIAPSMESG000031958.1 dd_Smed_v4_2104_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30010830Folylpolyglutamate synthaseSMESG000027911.1 dd_Smed_v4_6956_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED300196972-amino-3-carboxymuconate-6-semialdehyde decarboxylaseSMESG000077491.1 dd_Smed_v4_8766_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30018245serine/threonine-protein kinase MARK2-likeSMESG000024843.1 dd_Smed_v4_5670_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30016398Piezo-type mechanosensitive ion channel componentSMESG000051188.1 SMESG000002890.1 dd_Smed_v4_1447_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30016491SMED30016491SMESG000043799.1 dd_Smed_v4_3767_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30017847Protein kinase domain-containing proteinSMESG000056697.1 dd_Smed_v4_1371_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30012364Sorting nexinSMESG000066985.1 dd_Smed_v4_2271_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30014558SMED30014558SMESG000023649.1 dd_Smed_v4_184_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30015820Dual specificity tyrosine-phosphorylation-regulated kinase 4SMESG000042374.1 dd_Smed_v4_12591_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED300197111,4-alpha-glucan-branching enzymeSMESG000060455.1 dd_Smed_v4_2161_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30019057SMED30019057SMESG000016216.1 dd_Smed_v4_2283_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30014008MBOAT2SMESG000066852.1 dd_Smed_v4_3131_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30002034SMED30002034SMESG000001789.1 dd_Smed_v4_3076_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30016571Thimet oligopeptidaseSMESG000014736.1 dd_Smed_v4_3546_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30010270Alkylglycerone-phosphate synthaseSMESG000016832.1 dd_Smed_v4_2115_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30003196Adenosine kinaseSMESG000062286.1 SMESG000027213.1 dd_Smed_v4_627_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30010048SMED30010048SMESG000000602.1 SMESG000000601.1 dd_Smed_v4_7042_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30009337SMED30009337SMESG000045673.1 dd_Smed_v4_1022_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30014241SMED30014241SMESG000003392.1 dd_Smed_v4_2564_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30008540O-acyltransferaseSMESG000037749.1 dd_Smed_v4_4278_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30019378Exocyst complex componentSMESG000065870.1 dd_Smed_v4_2186_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30006150HTH CENPB-type domain-containing proteinSMESG000047012.1 SMESG000047013.1 dd_Smed_v4_1450_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30006150HTH CENPB-type domain-containing proteinSMESG000081298.1 SMESG000023765.1 SMESG000016276.1 SMESG000004841.1 dd_Smed_v4_8652_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30008044Coiled-coil domain-containing protein 22 homologSMESG000036456.1 dd_Smed_v4_5400_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30014896Small nuclear ribonucleoprotein ESMESG000036643.1 dd_Smed_v4_741_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30009566SMED30009566SMESG000015985.1 dd_Smed_v4_4240_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30012514Beta-hexosaminidase subunit betaSMESG000066985.1 dd_Smed_v4_2271_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30012514Beta-hexosaminidase subunit betaSMESG000002681.1 dd_Smed_v4_3964_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30023223Glutamate receptor ionotropicSMESG000005067.1 dd_Smed_v4_11004_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30027610SMED30027610SMESG000001789.1 dd_Smed_v4_3076_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30022955Transmembrane protein 72SMESG000039568.1 dd_Smed_v4_6789_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30027303Methylcrotonoyl-CoA carboxylase 2 (beta)SMESG000035087.1 dd_Smed_v4_5574_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30033667SMED30033667SMESG000030621.1 dd_Smed_v4_2917_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30025757JUNLI-1SMESG000067959.1 dd_Smed_v4_4878_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30031875SMED30031875SMESG000081251.1 dd_Smed_v4_604_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30029036SMED30029036SMESG000023959.1 dd_Smed_v4_24743_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30032157SMED30032157SMESG000032745.1 dd_Smed_v4_2208_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30021019CYTOSOL_AP domain-containing proteinSMESG000037599.1 dd_Smed_v4_181_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30028184Ras-related protein Rab-32SMESG000060723.1 dd_Smed_v4_1037_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30028453Lysosomal alpha-glucosidaseSMESG000005054.1 dd_Smed_v4_5392_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30028453Lysosomal alpha-glucosidaseSMESG000005050.1 dd_Smed_v4_1062_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30028430Secretory carrier-associated membrane proteinSMESG000035622.1 dd_Smed_v4_2702_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30021123N-acetyltransferaseSMESG000064458.1 dd_Smed_v4_4567_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30016094SMED30016094 dd_Smed_v4_2212_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30004921SMED30004921 dd_72dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
gutSMED30004921SMED30004921 dd_Smed_v4_72_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30019959NADH dehydrogenase subunit 4 dd_Smed_v4_292_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30019959NADH dehydrogenase subunit 4 dd_Smed_v4_344_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30005396SMED30005396 dd_Smed_v4_14268_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30011303Syndecan binding protein (Syntenin) dd_Smed_v4_387_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30000198Transformer 2 alpha homologSMESG000052838.1 dd_Smed_v4_6379_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30016330SMED30016330 dd_Smed_v4_12993_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30006810Pancreatic trypsin inhibitor dd_Smed_v4_370_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30007460SMED30007460 dd_Smed_v4_7907_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30012451SMED30012451 dd_Smed_v4_215_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30005911SMED30005911 dd_Smed_v4_12_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30002807Retrovirus-related Pol polyprotein from transposon dd_Smed_v4_12993_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30003086GTP-binding protein-like proteinSMESG000018556.1 dd_Smed_v4_589_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30004495SMED30004495 dd_Smed_v4_34917_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30001542CaveolinSMESG000063380.1 SMESG000001725.1 dd_Smed_v4_6535_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30001174SMED30001174 dd_Smed_v4_4983_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30009369SMED30009369 dd_Smed_v4_710_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30012212NADH dehydrogenase subunit 1 dd_Smed_v4_258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30009030Selenoprotein W dd_Smed_v4_572_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30010253NADH dehydrogenase subunit 6 dd_Smed_v4_957_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30001962Protein kinase domain-containing proteinSMESG000017252.1 SMESG000017249.1 SMESG000017248.1 dd_Smed_v4_311_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30001962Protein kinase domain-containing proteinSMESG000017248.1 dd_Smed_v4_787_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30011479GGACT domain-containing protein dd_Smed_v4_7000_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30015350C2H2-type domain-containing protein dd_Smed_v4_17318_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30001449Propionyl-CoA carboxylase subunit beta dd_Smed_v4_513_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30013592SMED30013592 dd_Smed_v4_1287_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30004673SMED30004673 dd_Smed_v4_12181_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30010704SMED30010704 dd_Smed_v4_14348_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30016351SMED30016351 dd_Smed_v4_2295_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30001329SMED30001329SMESG000074416.1 SMESG000074409.1 SMESG000074407.1 dd_Smed_v4_7011_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30000059hypothetical proteinSMESG000066598.1 dd_Smed_v4_6448_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30010015SMED30010015 dd_Smed_v4_34492_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30005937P2X purinoceptor dd_Smed_v4_16290_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED3000398760S ribosomal protein L29 dd_Smed_v4_481_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30005188Venom allergen 5 dd_Smed_v4_607_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30008414NADH-ubiquinone oxidoreductase chain 3 dd_Smed_v4_289_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30015166SMED30015166 dd_Smed_v4_14241_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30002262Heat shock cognate 71 kDa proteinSMESG000051570.1 SMESG000051567.1 SMESG000051541.1 SMESG000051540.1 dd_Smed_v4_320_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30005555Tigger transposable element-derived protein 1 dd_Smed_v4_20966_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30002863Charged multivesicular body protein 5 dd_Smed_v4_1158_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30000754SMED30000754 dd_Smed_v4_29067_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30005796Transposon Ty3-G Gag-Pol polyprotein dd_Smed_v4_12993_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30013798Dual specificity phosphatase 10 dd_Smed_v4_653_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30011969SMED30011969 dd_Smed_v4_7907_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30009237SMED30009237 dd_Smed_v4_19378_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED3000651260S ribosomal protein L29 dd_Smed_v4_481_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30009609SMED30009609 dd_Smed_v4_4983_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30016139BPTI/Kunitz domain-containing protein 1 dd_Smed_v4_28_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30000705Serine/threonine-protein kinase OSR1SMESG000066296.1 dd_Smed_v4_1366_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30019518SMED30019518SMESG000073002.1 SMESG000072984.1 dd_Smed_v4_12680_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30017811Alpha actininSMESG000047739.1 dd_Smed_v4_1492_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30004809TNF receptor-associated factorSMESG000038724.1 dd_Smed_v4_7950_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30010457cell division cycle and apoptosis regulator protein 1SMESG000052430.1 dd_Smed_v4_1608_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30014724Tetraspanin-CD63 receptorSMESG000041117.1 dd_Smed_v4_1378_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30006354SMED30006354SMESG000011239.1 SMESG000011238.1 dd_Smed_v4_6615_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30008487Peptidylprolyl isomeraseSMESG000019381.1 dd_Smed_v4_870_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30010777Lysosomal-associated transmembrane protein 4ASMESG000042736.1 SMESG000032757.1 SMESG000017350.1 SMESG000010536.1 SMESG000042735.1 SMESG000012070.1 dd_Smed_v4_495_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED3001198260S ribosomal protein L17SMESG000009564.1 dd_Smed_v4_95_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30012725Arf-GAP with dual PH domain-containing 1 isoform X2SMESG000016864.1 dd_Smed_v4_5945_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30008513SMED30008513SMESG000008541.1 dd_Smed_v4_8116_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30008782Monoglyceride lipase isoform 2SMESG000004815.1 dd_Smed_v4_9173_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30019094Protein flightless-1SMESG000020935.1 dd_Smed_v4_1781_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30013744SMED30013744SMESG000001468.1 dd_Smed_v4_5675_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30003788Mitochondrial import receptor subunit TOM70SMESG000070017.1 dd_Smed_v4_2190_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30006638Elongation factor TuSMESG000068535.1 dd_Smed_v4_818_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30014842TYR_PHOSPHATASE_2 domain-containing proteinSMESG000055800.1 dd_Smed_v4_8366_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30015436SMED30015436SMESG000011239.1 SMESG000011238.1 dd_Smed_v4_6615_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30002377DNA-binding proteinSMESG000062714.1 dd_Smed_v4_12317_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30007804Immunoglobulin-like domain-containing proteinSMESG000010356.1 dd_Smed_v4_1827_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30005168Alpha-L-fucosidaseSMESG000024118.1 dd_Smed_v4_8422_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED3000412414-3-3 protein beta/alphaSMESG000055903.1 dd_Smed_v4_138_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30006606Alpha-mannosidaseSMESG000045085.1 SMESG000045072.1 dd_Smed_v4_1942_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30017098Chaperone protein DnaJSMESG000015446.1 dd_Smed_v4_9791_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30019477Glucosidase 2 subunit betaSMESG000051850.1 dd_Smed_v4_1730_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30015939IQ motif containing GSMESG000055124.1 dd_Smed_v4_9650_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30006161slc24a-4SMESG000036251.1 dd_Smed_v4_9736_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30006114E3 ubiquitin-protein ligase HECTD1SMESG000022351.1 SMESG000022345.1 dd_Smed_v4_17106_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30003577Enhancer of yellow 2 transcription factorSMESG000004606.1 SMESG000004604.1 dd_Smed_v4_928_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30010405SMED30010405SMESG000043444.1 SMESG000043435.1 dd_Smed_v4_18_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30010772slc25a-32SMESG000010598.1 dd_Smed_v4_1662_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30011623SMED30011623SMESG000043444.1 SMESG000043435.1 dd_Smed_v4_18_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30007622U1 small nuclear ribonucleoprotein CSMESG000005764.1 dd_Smed_v4_3504_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30003036SMED30003036SMESG000076482.1 SMESG000076470.1 SMESG000076469.1 SMESG000076410.1 SMESG000076409.1 SMESG000076408.1 SMESG000076407.1 SMESG000076406.1 SMESG000076390.1 SMESG000076389.1 SMESG000076385.1 SMESG000076375.1 SMESG000076371.1 SMESG000076363.1 SMESG000076358.1 SMESG000076223.1 SMESG000040665.1 dd_Smed_v4_645_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30011710Mitogen-activated protein kinase kinase kinase 3SMESG000009509.1 SMESG000009500.1 dd_Smed_v4_5138_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30001810Protein NDRG3SMESG000005122.1 dd_Smed_v4_3896_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30024140Epithelial discoidin domain-containing receptorSMESG000070377.1 dd_Smed_v4_7988_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30023752RING-type domain-containing proteinSMESG000015149.1 dd_Smed_v4_9317_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30032374SMED30032374SMESG000048179.1 dd_Smed_v4_9300_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30029626SMED30029626SMESG000034921.1 dd_Smed_v4_122_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30030289Actin-1SMESG000066035.1 SMESG000066029.1 SMESG000066027.1 SMESG000066020.1 dd_Smed_v4_90_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED3002077640S ribosomal protein S21SMESG000004954.1 dd_Smed_v4_84_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30029013P2X purinoceptorSMESG000046807.1 dd_Smed_v4_17645_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30025329F-box and leucine rich repeat protein 4SMESG000056281.1 dd_Smed_v4_9358_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30033257Cytochrome c oxidase subunit 5BSMESG000050948.1 dd_Smed_v4_861_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30020035DNA polymerase subunit gammaSMESG000050799.1 dd_Smed_v4_13411_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30029100ras-related protein Rab-32SMESG000060721.1 dd_Smed_v4_6128_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED3002950160S acidic ribosomal protein P1SMESG000062259.1 dd_Smed_v4_224_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30028552SMED30028552SMESG000035329.1 SMESG000035328.1 SMESG000035326.1 dd_Smed_v4_19_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30031142Protein kinase domain-containing proteinSMESG000073002.1 SMESG000072984.1 dd_Smed_v4_12680_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30024295Mitogen-activated protein kinaseSMESG000032743.1 dd_Smed_v4_1319_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30026411Ectonucleotide pyrophosphatase/phosphodiesterase family member 5SMESG000023047.1 dd_Smed_v4_973_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30027361Adenylate kinaseSMESG000039607.1 SMESG000006671.1 dd_Smed_v4_9001_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30026722SMED30026722SMESG000069782.1 dd_Smed_v4_17976_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30023444SMED30023444SMESG000049359.1 dd_Smed_v4_1815_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30020683V-type proton ATPase proteolipid subunitSMESG000042238.1 dd_Smed_v4_1622_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30011603Rho guanine nucleotide exchange factorSMESG000008077.1 Contig5057GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011603Rho guanine nucleotide exchange factorSMESG000017950.1 Contig5057GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019300Histone deacetylase,putativeSMESG000006246.1 Contig3291GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011213Osteoclast-stimulating factor 1SMESG000004952.1 Contig516GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017937WASP like actin nucleation promoting factor bSMESG000036683.1 Contig4572GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017937WASP like actin nucleation promoting factor bSMESG000074788.1 Contig4572GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023334Partitioning defective 6SMESG000066854.1 Contig3688GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023334Partitioning defective 6SMESG000026500.1 Contig3688GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021281TIR domain-containing proteinSMESG000079659.1 SMESG000079651.1 Contig154newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021281TIR domain-containing proteinSMESG000079659.1 SMESG000079651.1 Contig154uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021281TIR domain-containing proteinSMESG000033382.1 Contig154newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021281TIR domain-containing proteinSMESG000033382.1 Contig154uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027751SMED30027751SMESG000014111.1 Contig4084newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020872Myosin IESMESG000041553.1 Contig4772GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020872Myosin IESMESG000068232.1 Contig4772GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020872Myosin IESMESG000003513.1 Contig59GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020872Myosin IESMESG000068232.1 Contig59GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30026256vault protein inter alpha trypsin-1SMESG000053671.1 SMESG000053667.1 Contig5414GPL15192PMID:23079596
Forsthoefel et al., 2012