gut

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ In Situ Hybridization Data

  ▻ Sequences

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  gut


DEFINITON:

  The planarian triclad gut contains a central anterior gut branch connected to two posterior gut branches arranged around the pharynx. Secondary gut branches extend laterally from the primary gut branches, while tertiary gut branches extend from the secondary branches. Food and waste enter and exit the gut through the pharynx.


TERM DEFINITION CITATIONS:

  PMID:3490491


TERM CITATIONS:


TERM ID:

  PLANA:0000026


ABOUT THIS TERM:

gut

  ↳is a material entity and organ

  ↳contained in tail region, copulatory region, ventral region of the whole animal, posterior region of the whole animal, parapharyngeal region, prepharyngeal region, head region, dorsal region of the whole animal and anterior region of the whole animal

  ↳develops from gamma neoblast

  ↳existence overlaps Stage 6, Stage 5, juvenile stage, asexual adult, adult hermaphrodite, Stage 8 and Stage 7

  ↳existence starts during or after Stage 5

  ↳part of digestive system


  → digestive tract lumen luminal space of gut


Expand to see terms that part of gut


BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30007290AFF18488.1GATA456gata456aStage 2, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, gut, digestive system, gamma neoblast, embryonic pharynx
SMED30005748AFF18489.1HNF4hnf-4Stage 2, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, gut, digestive system, gamma neoblast, embryonic pharynx
SMED30025591ABW97518.1porcupine-like proteinporcn-AStage 5, Stage 6, Stage 7, Stage 8gut, digestive system
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 ┬Ám

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30025591 ID=SMED30025591|Name=porcupine-like protein|organism=Schmidtea mediterranea sexual|type=transcript|length=3526bp
TTCCGATCTTTTCTTTTGAAATTTTTGAAATTTTAAATAAAATTAATGACAAAGGCAGAAAATCAGAGAACTACTAAAGC
ATCCGACTTCAAATTTGGAAAAGAAATCGGCCATGGCTCGTTCTCAACTGTAATGATAGCTAAGGAAATTTCTACCAATA
AACATTATGCTGCAAAAATTATTGATAAAGTTTTTATTTCTAAACAGCGAATGGTTAATACTGTTATGATTGAAAAAGAA
GTTCTCCGAAGAATAAATCACCAGTTTTTTGTATGTCTCAATTATACATTCCAAGATCCAGAGAGATTGTATTTTATTAT
ATCATATGCCGAACGAGGAGAACTTTTATCTCATTTAACAAGACTTTCGTGTTTTGATTTAACGTGCACACAATTTTATT
CCGCGGAAATTATTCTTGCATTAGAATATTTACATGGAATTAACGTTGTTCATCGAGATATAAAACCAGAAAATATTTTA
CTGAGTGAAAATATGCATATAAAAATTTGTGATTTTGGCAGTGCAATTATTATCGATAAACCAGATCTCAAGCCTTCTTC
TTTTACAGGTACAGCTCAATTCGTTTCTCCAGAAATGCTGGGATTCAGTAAAGAAACACGTGACAATAGCTATTCAGATG
AACCGAATTCTGATTCAGAGGAACATAGCGAAATTGAAGTTAAACGAACTAGTTCACCTGATAATTCTAGGGAAATATTA
TATCTAATGGACTTCTGGGCATTAGGATGCATCGTCTATCAAATGTTGTCTGGACGAATGCCATTTCACGTCAGGCATTC
ACGGCATGAATATGAAATTTTCCAAAAGATCCGAAATTTAAAATATGAGTTTCCGGTTGGGTTTGATGATACTGCTAAAG
ATTTTGTCTCTAAACTTCTTGTATTGAATCCACTGGAAAGATTAGGCAATCCATCCGATGGAAAGCACGCTGCTTTAAAA
GCCCACCCCCTTTTCCGTTCAATTGATTTCGAAATTATCGGATCACAAAAACCTCCGCTATTACTTCCAAATATTGAGCC
CATTGTTCAAAGTAATTGGGACGAAATTCCTGTTGGTTTTGAAGAAGCATGGAAATTCAATATCAAAAAAGAGTTTCAAG
AAATGGAAAAAGCCGATAAACAAAAATTATTGCAAAACCAAGAAAAACTAAATCCGTTTCATAGATTTGTACGCAATCGA
TTGATCATAAAACAAGGCATCTTGTACAAACGGCGTGGATTATTTACTCGTAAAAGAATGTTTCTATTAACTGAAGGACC
TCATTTATTTTATGTCGACCCCGATGCTATGCAATTTAAAAAAGAAGTCAGTCTAAACTTAATTACTGGCATAGAAGTAA
AAAATGACAAAGTATTTTATATCGTTACTAAAAGGCGAACATATTTTCTCGAAGATCCTTCAGCAAAGGCTGATGAATGG
CGACAGAGTATTGAATCGATTTGTGTAGAATATTATGGATCATTTAAATTATCCCCTGGCACTTGCACTCAAACGCCTCT
AGTTACATCATCTGAATCATAACTTTCGGTTTTATTTAAATTTATTTGTCATATAGAAAAAAATGTGAATTTAACGGTTT
TTAATATAATAATTTAATATTGGTTTGAATTCTTGTTTTTCATTTTAAAATTTAATGGATATAATTTAAATATTTTAATA
AATAAAAATATTCACATTGTTTTAATATTCTCTTTATGTCGTAATTGATAAATGATGCATTGTAAATGTATTTTACAACT
GATCTAAATGAAACCAATAGGAAACGAGTGGTTCGATGTCATGTGAATCAGCATGCAACCAATCATAGTTTTGTGATTCA
TTAAATATATTTTAAATTTTTAAAACAAATTAAATCACTTAATTAATTTTTAGACAATGTCACAATTTTATGGCGGATCC
ACGATATTGGCACCTCTATCGAACGTTATGGGTATACCAGTGGATCAAATTAATTTTATTGTGTGTAGTTTATTGTCAAT
CGGACTGGGTCAAATTATGCGACACAAATTCCCTCCTTCTAAATTGTCAGGAAGTACAAGAGGAATCATAGAAGCATTTT
TTGGAATACTAATTGTTCTTTTCTGCTTCGGATACCAAGTCAAGTATTTGTTACTACAATCAACAGTTTCCTATGTAATA
CTATTATTTTTGCCTTCACAAATATCAGCGCATTTGGTAACGTATTGGTGTATGGCTTTCATGGCGATAGTCCATTTATA
CAGGATGCATTACGATTACGGAGGTTATACTCTCGATATATCTGGTCCGGTTATGATTCAAACCCAAAAATTGACCAGCC
TCGCATTTAATCTTCTAGATGGACATCGAATAAATCAAGGAATAAAACTGCAACAGAGAAATCATGAATCTCACGCTGTG
AAAAAACTACCAGATGCAATCAAGTTTTTCGGTTACACATTCTACTTTCATGGTGTATTAGCGGGTCCTTTTGTATTCTA
CAATGAATATAAAGAATATATCACTGGATATGACGACAAGCATATTCCATGCTCCAAAAAGCAATTATCTTCAGCACTTT
GTTTATCAGTGATCCATGGATTATTAACAGCATATGTCGCACCGCAGTTTCCATATATATTTGTTTGCAGCACCGATTAC
CAACGGATGCATATGACTCGTAGAATAATGTTCACAATGATTTCATTTTTCCTCGTAAGACAAAAGTATTACTTTGCCTG
GTCAATGGTTGAAGCTGGTGCTCTTAGTACCGGATTGGGATATTGTGGAAAGGATAAAAACGGAGAGAATAATTGGTCGA
AAGTGAAAAATTACGATTTCATGGCAATCGAAAGCGGCAGTAGTTTGAAAGTGCTAGTGGACGGATGGAATATTTCCACA
ACAAGATGGCTCAGAGAATTAATTTATGAACGAGCTCCTTTATTCTGTCGGACAATTCTAGTTTTCACCGTCAGTGCATT
TTGGCATGGATTCTATCCTGGATATTATTTGATGTTTTTGACATTTTCTCTCTTTACGTTTTGCGCTAGAACCGTTAGGA
AACACATTCGACCATTGTTCATTGTCAGTCCAATTACACTTCAACTCTATCATGTTCTAACGAAAATATTCACAAATCTG
GCTTTAAATTACGGACAAGGACCATTTTATTTGCTGGAGTTTCAATCGGGACTTTTGTTTTGGAAGCCATATTACTTTTT
CGGACACGTTCTAGCAATGTTCTGCGTATTGACCTTGCAATTTCGGCCGATAATCAACGACAAAGTCAACATAATGAACA
ATGTTTTCACCAGAAAAGCCCAATATCGGTTTCAGAAACTAAAGATCCATTTGCAGAAAAAGTTGAGATGAAATTTTATT
GATTTTGATAATTTATATAAAATATTATAATTTTGTTTTTCGTTTTATTTTTATATCGATGAATTTATGATAAATGCTAA
ATATTCGATCCGGAATGAATTATTATTAATCTGGTTTTTATAATTGTTCATTTTTAATAGTTTTGTTTGTTTTTCGAAAA
TGGCGG
>SMED30007290 ID=SMED30007290|Name=GATA456|organism=Schmidtea mediterranea sexual|type=transcript|length=2033bp
AGGTAAGTGTCGTCATCACAAGTGGCTTTATTATTATCATTTAAATTTTTTATCATATTATCATTGATTGCTTGTTTTCC
TCATTCAAAATTTAACTGATTGTTATCAAGCTCATTTGATAACTCCAAATCTAATTGACACTCATGTAAATATCCCATTC
GAATTTCCGTTCCCGTCCGTAAGATCCACGATCCGACAATGTTTCTCCCATCGGTATTGTCGAATTCTCACCAGAGAAAC
TCACCAATAATGGACATTGTATCACCAAAATCCAACACCAGCAATCTGAATGCGTTGATCACGTATTCGAATTGTCCCAA
CATAGATCTACAGTCGAATGATCTGTCAGTGAACTTGACGAATTCTCAAAACTTCCACGAATTGGATCACAAAACCAATT
ACGGATACAAAGTTTCAAACAACGAGACAAAACTGAATGCTTTTCCATATTTAGCTCAATCGAACTTAACAGATTGCACA
ACAGACATCAGTGGAGATCTGAAAAATCCAAATTCACATCTCAACTATGGAAACGGAATTTCGTTCTCGGAATTTTCGAA
AATGTCCGAAACCAACATCCACGGATATCCGCCATATTGTTTCTCCACTAAACTGTTTCCCATTCCAAATCTACAAGAGA
AATCAATTATCAACGACAACTATTCCGTGAAATCCACCGCCGGAGGCTTTATCACCGAATCGAATGAGCATCAAAACTCT
GTAAATACTGGAAATTCCTACAATTCCAATTTAAGCTCATACAGAACGGTAATTCCCGCTCATTTTCATCTCTTCAATCA
GAATTCACCAGAATCGAACTCGTTTTACAATACGGCTTGGAACAACTATCCGTTTCAAATATCCCCAACTTATCCCATAC
AAAATCTACCGGATTCAACAATCAACTGGACAACAAACAATCAAATTCCAAGCAGCAATTTAGTTTTTGATCCCTGGAGC
TGTAAATCAAATCTTAATCTTCCTCCGATTAATGAATTCGGTTCCAATTGCGATGTCAGCAGAGAGTGTGTGAACTGTGG
AGCTAGCAATACTCAGTTGTGGTCCCGGGATAATTCTGGCTATTATTTGTGTGATGAATGCGACAGGTTCTCTCAAAACA
ACAGTAGAAACCTCGAAAAACTACCAACGAATCAAGTCTCATCAAGTACCGAAAATGAGTTCATGAAAAAATCCAATGCC
AACTTTCAACAATATGGAAAAAGATCCGACCTCGAATGCAGCAATTGTAAAATTACCAAGACTTCTTTATGGAGAAGAAA
CAACGAAGGAGAACCTGTCTGCAATGCTTGCGGCTTGTATTATAAATTACATAAGTCTCTAAGACCTCTTTCAATGAGGA
AAGAAGGAATACAAACAAGGAAAAGAAAACGGAAAACACAAATGAAACCGGTTTCCACTCATATTGCCAATAATCAAAAG
GTGCCGTCTTCAGAATCGTCATCAGAACAAAATCAGTTTATAAACACTGTGAAATCAAGTGAAAATTGCTATAACATGAT
TTCTGAAAATTCTCCAACATATATGCCAAATATATCAGTCCAGCCCTTCAATCACATTCTGAACTCCAGCCAATATCAAT
TCCAATCTACAGAAAATCCCATTAATCAATCATATTTAAATTCCTCAATCAAAAACAGCAATCCCTTTTACGATTCCGAA
AGTATACTTTATTCCTACAACAATTCAAACAAAATCAAAGATGAGCCCCTATTATCCATGGACAACGAACCGAAGCCCTA
TTCCTCAATCAACGAGAAAATTGACGTCAACTCCATAGTGAGAATTAATGAAATCTCAAACAATTCGAATTCGAGTTAAT
TATTCTGATCTACTTTTTAATTATATATTTAAGAACCGTATATACTTCGAAATATAATTTTAATGATAAAATTTTATATC
TAAAAAATGTAATTTTTAAGTGCGAATTATTAAGTATGCATTTAAATAGTGCAATTATTGTGGTAGTTATTTTTATTACT
AAATAAATGTTGTTTGTAAATTCGAGAATTTGT
>SMED30005748 ID=SMED30005748|Name=HNF4|organism=Schmidtea mediterranea sexual|type=transcript|length=3066bp
GAAGAATAACAAAGAAATTTATTGCCAAACTAAAATACCCGGCCTATTTCATCAAAAAAAAAACAATCAAAAACACAAAT
CGCTACGAAAACTTGTATAAAAGATTCACATTAAAAGTCATCAATATTCCTCTTTTTTAAAGACTGATGATTCAGATTCT
TGGATCCGAATGGGGTGATCTGTTAGGAAGTGAGCTGTTGACGAGATAGCTGAATAGTTTGATCTGGAATTGTGCTGTTG
GTTCGCTTCCGATGATCTGTTGGCGATTGATTGAATTTGGCAGTTTTCTATCGGCGAGTTTGGAAGCGACTTGGTATAGG
CCACAAGAAGCGACGGATCAACGACATTTTGAGTGGAATTCACAGAAAGAGCTGGGTGGATTAGGTCATCTGAATTGGAA
GAATTTGAGCAGTTATGATTTGCGTCACTGTTATAGGCGTATTTTGACTGGTTGATCATGGGGAACCCTTGATCAAGGTT
GACCAAGAAATGGCTGGTATCCTGTGATAAATTGGAATGCTGATAAAGATTGATGGAATCATTGACGCATGAAAACAGAG
AAGGAACGCCGACTCTTTCATTTTTCAGCATCATCCCATCGCTGTTGATTATCATACCGAAGTTGCTATTGTCCTGGGAA
TTTTGCTGCATTATTTCAGTTCCTTGATTAACAAAAGCTCGATATATATTTCCTGAAGGCATCGACGTAGAACTTGGCAA
ATATGCACTCCATATTTTTGAGGCCGCTTCAGGTGATATGTTTTGGTTGTTGATATTGAGTAGGACACTGTCTGGCATGA
AAGGGGGAATTCCGTAGCAGTCCTGGTAAGTATATTTCGGTGAGGAAATCCTGTGGGAGTTAATTATATCCATGGAATCG
TTTTGATTATTGTTATTGTTCCCATCTGTTTCTGGATCTATGCTGAATACCCCTGGTGGATTGTCACCCAATAATGTTTC
AGATAACAAGCTATCAATCTCGGCTAATCCTGTCATTTTCATGAACTCGACCTTCTTTACCATCAGCTGGGTGACCAATC
TCAGATCAGGAATTGTCAGCAGCAATTCCCCGAATCTACCCGGCTTGTGGTATTGCTTGTCATTCATGTGGTTCATCAGG
TCCATTTGTATTTGGTATCGGCATCGTCTCACGAACTCCTTGCCAGACTCGCTGACTCTCGGATCAAAAAATACGATCGC
TTTCAAACAAGCGAATTCTGCGTCATCCAATTGCAATTCTCGCAGCGGAATGAACAGGTCGTCAAGGATGTGACTGGCTA
TTTCAGCGAAATGTTTGTCACTGGAGTTCCTACTGATGATAAGATTGTTTCCCAATAATAGCACATCGTCTTCGTCCAAT
TGAAACGACCGCCTTATTACTCCAAGAATTAGAATTTCTCCCGCGTGTGCTTTTAAAAGGGAAATTTGATCGCTCAAGTT
TAACTGTGAAAAACAAGGCAAAGACTTTGCCCAATTCACTAGAAGAAATAACTGATTTTTCATGGACTCGCAAACATCAG
GCACATCGGCATATCTGTTCATGTATTCCTGAGGATTCGGGGGCTTTTGTATTGCAACCCTTTGCTCGGCCTGCATCAAC
TGAGAAATGGAGAGAATGACATTCGGAGGAATATCATCAAACGACGATCTTCGAGTACTGATCCTATCTCGTTCATTTTG
AACCGCTGCTCGCTTCATTCCTACAAGAATGCATTTCTTTAGCCGACAATAACGGCATTGGTTTCGTTTATCCTTGTCCA
TTTTACAATTCCGATTGTACTGGCAAGTGTAGTTATTCTTCTTCCTCACTGACCTCCGAAAAAATCCTTTACAACCGTCA
CACGAGAAAGCCCCATAATGTTTTCCTGTAGCTTTGTCACTGCAAATGAGACAGAGTTGATTGTTTTCCATTCCTTCTGG
TCCCGACGCGTTAGACGCATAGACTTCATGTTGTTGCGAGGACACTGAAACGAAAACTATTTGATAATATTTGTACAAAA
CAACTGACAGATGGTTTCGGAAAAGGTTCAATGTTCAGCCATAGTTCAGCGAAAGGTCAAATTCCTGAACTACTATTTCA
AGGTATAAATTTGAATATATTGGTTTTGCCTCGTGCTAACAAAGTCCAGAAATATAATAAGCAAAGTCTGAATCGTGTAC
TTTGGATTTCTAGCCAGGGGCACACAATAACCTATATTTAATAGCAGTTCATTGCGTTCACTCGTTATTTCTCCGACTGA
ACTGCATTGCAGGAGGATCCGCAACCATGGAGATTTCATAATTATTATCAAAATGATAATAATAATAATTATTATGAGGT
ATTGTAAAAGAAAACGTAACTCACTTTCACTTTCCAATGGATATTGCATCGAGGAAGCGTTGCTGGAAATGGAAATCGGA
GCTGAATTGCTAGTCAATAGTTGATAGGAGAATGCTGGATTGAGGTTCGGATGCTGGGTAGACGTCATATAGAATTGGCT
CGACGGATTCGGTAAAATTATGGTGAAGTTTACAATCGAAGCTCAGATATAACGTATTATAATGAAGTATTATTAATAAA
CTGCAAGTAACGTGCGCGCATTCTGAAGTGGTTGATTGAGAATAATCAGTTCTTATTCGACAAATTCAGATAAAAAAGGC
ACCACTCGAATTGTTCAGCTGCGTCATGTGAATGCCGGAACGTTGTGCGTTGGCTGTTGGCAGATCAGCGCTCCGTGTTC
ACTGCAATCCGGATACACCAGACCACTTGAAATCGTTGCGAATTCAGCGTGTCGAGTGCATTGTGCGAGATCAGTATCGG
TGTGTATGTGTGTCTGCCTGTGTGCGTGTGGATGTGTGTGCTTGTCGAGTCGGTTGTGTGTTTATGAGTGTAACTGTGTC
GATTTGGTCGAATGCAGTAGCAGATAGCTGAAATGCGATTGTTCCTATTTTTCATTTAATATTGTTTTATGTTTTGTTTC
TATTTTTATAATTTAATTTATCAGTTTTTGTTTAGATTATGCAATCATTGTTTAATTTATTTTTGTCAATTTAAAATTTA
TTATTAATTAAATTATTATAATTATT

 

back to top



PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in gut. Click this link to learn more about PAGE.


PAGE Curations: 3691


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
gutSMED30021445S-adenosylmethionine synthaseSMESG000053202.1 EG413862ncbi_smed_estsPMID:23318641
Chen et al., 2013
whole organism asexual adult fluorescence in situ hybridization evidence
gutSMED30000459Dynamin-1-like proteinSMESG000044682.1 Contig721GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30000459Dynamin-1-like proteinSMESG000058940.1 Contig721GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30000459Dynamin-1-like proteinSMESG000058940.1 PL030004B10H05ncbi_smed_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013503Tpd52 like 1SMESG000013104.1 Contig988GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013692Small HSP proteinSMESG000055935.1 Contig651GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013692Small HSP proteinSMESG000059879.1 SMESG000059868.1 SMESG000059853.1 Contig651GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007841Nuclear hormone receptor HR96SMESG000079557.1 SMESG000074066.1 Contig5553newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007841Nuclear hormone receptor HR96SMESG000079557.1 SMESG000074066.1 Contig5553uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007841Nuclear hormone receptor HR96SMESG000062111.1 Contig5553newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007841Nuclear hormone receptor HR96SMESG000062111.1 Contig5553uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007241SMED30007241SMESG000077709.1 SMESG000073947.1 SMESG000043656.1 SMESG000043279.1 SMESG000008519.1 SMESG000001897.1 Contig22newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007241SMED30007241SMESG000013795.1 Contig22newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004416SMED30004416SMESG000067412.1 Contig1164newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004416SMED30004416SMESG000067412.1 Contig1164uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004416SMED30004416SMESG000060394.1 Contig1164newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004416SMED30004416SMESG000060394.1 Contig1164uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30003215SMED30003215SMESG000057441.1 Contig2269newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30000639Microtubule-actin cross-linking factor 1-like isoform X28SMESG000017517.1 PL08009A2C06ncbi_smed_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004948Lysosomal Pro-X carboxypeptidaseSMESG000074424.1 Contig1592GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011545E3 ubiquitin-protein ligase XIAPSMESG000081058.1 Contig2302GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019107SMED30019107SMESG000027122.1 Contig1663newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019107SMED30019107SMESG000071278.1 Contig1663newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001360Lipopolysaccharide cholineSMESG000060269.1 Contig2381newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001360Lipopolysaccharide cholineSMESG000060269.1 Contig2381uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001360Lipopolysaccharide cholineSMESG000029882.1 Contig2381newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001360Lipopolysaccharide cholineSMESG000029882.1 Contig2381uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002664SMED30002664SMESG000002943.1 Contig3127GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001668SMED30001668SMESG000033527.1 Contig2307GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030407LipaseSMESG000035248.1 Contig3418GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030407LipaseSMESG000007797.1 Contig3418GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029698Caspase-7SMESG000053168.1 Contig2992GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029603SMED30029603SMESG000027122.1 Contig1663GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029603SMED30029603SMESG000071278.1 Contig1663GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024498SMED30024498SMESG000036544.1 Contig3175newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024498SMED30024498SMESG000036544.1 Contig3175uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024498SMED30024498SMESG000000175.1 Contig3175newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024498SMED30024498SMESG000000175.1 Contig3175uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035642Granulin bSMESG000060269.1 Contig2381GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035642Granulin bSMESG000029882.1 Contig2381GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035642Granulin bSMESG000029882.1 PL06004A1G01ncbi_smed_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001710Vacuolar protein sorting 4SMESG000049145.1 Contig1087GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001710Vacuolar protein sorting 4SMESG000075482.1 Contig1087GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001630Ras-related C3 botulinum toxin substrate 1SMESG000005612.1 Contig594newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001630Ras-related C3 botulinum toxin substrate 1SMESG000005612.1 Contig594uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001630Ras-related C3 botulinum toxin substrate 1SMESG000024968.1 Contig5264GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001630Ras-related C3 botulinum toxin substrate 1SMESG000011575.1 Contig594newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001630Ras-related C3 botulinum toxin substrate 1SMESG000011575.1 Contig594uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001630Ras-related C3 botulinum toxin substrate 1SMESG000024968.1 Contig2195GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014474Tumor susceptibility gene 101 proteinSMESG000049597.1 Contig5044GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014474Tumor susceptibility gene 101 proteinSMESG000004871.1 Contig5044GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005434SMED30005434SMESG000038889.1 Contig2145newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30018354SMED30018354SMESG000015778.1 Contig1955newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016747SMED30016747SMESG000019700.1 Contig701newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012784SEC14-like lipid binding 8SMESG000008338.1 PL05003A1B05ncbi_smed_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30009175Transcription elongation factor spt6SMESG000059332.1 Contig5500newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30009175Transcription elongation factor spt6SMESG000059332.1 Contig5500uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30009175Transcription elongation factor spt6SMESG000024114.1 Contig5500newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30009175Transcription elongation factor spt6SMESG000024114.1 Contig5500uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002200SMED30002200SMESG000015894.1 SMESG000000559.1 Contig1506newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002200SMED30002200SMESG000078978.1 Contig1506newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021511SMED30021511SMESG000038232.1 Contig5776GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028707SMED30028707SMESG000018215.1 Contig6766newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028707SMED30028707SMESG000018215.1 Contig6766uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30025048exportin-1SMESG000045533.1 Contig1156newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30025048exportin-1SMESG000035447.1 Contig1156newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035150TLC domain-containing proteinSMESG000057441.1 Contig2269GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029557SMED30029557SMESG000028899.1 Contig1093newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029557SMED30029557SMESG000071997.1 Contig1093newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029578GGACT domain-containing proteinSMESG000077709.1 SMESG000073947.1 SMESG000043656.1 SMESG000043279.1 SMESG000008519.1 SMESG000001897.1 Contig22newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029578GGACT domain-containing proteinSMESG000013795.1 Contig22newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30025473mxi-2 proteinSMESG000067412.1 Contig1164GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30025473mxi-2 proteinSMESG000060394.1 Contig1164GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034573Tubulin beta chainSMESG000047291.1 SMESG000044907.1 SMESG000044888.1 SMESG000035804.1 SMESG000035755.1 SMESG000047284.1 Contig5821GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034573Tubulin beta chainSMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044907.1 SMESG000044888.1 SMESG000035804.1 SMESG000035755.1 Contig2059GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030227flotillin-2SMESG000059332.1 Contig5500GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030227flotillin-2SMESG000024114.1 Contig5500GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028056tudor-1SMESG000030853.1 Contig1138newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028056tudor-1SMESG000030853.1 Contig1138uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028216RNA polymerase II subunit A C-terminal domain phosphatase Contig6262uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029207SMED30029207 Contig1681newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30025103Actin Contig6807newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30025103Actin Contig6807uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30033807SMED30033807SMESG000076385.1 SMESG000076375.1 SMESG000076363.1 SMESG000076223.1 SMESG000076482.1 SMESG000076470.1 SMESG000076410.1 SMESG000076358.1 Contig1645newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035254Sodium dependent neurotransmitter transporterSMESG000031125.1 Contig153GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035254Sodium dependent neurotransmitter transporterSMESG000031125.1 Contig1620GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027034Aminotran_5 domain-containing proteinSMESG000033958.1 Contig1720GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035190Dimer_Tnp_hAT domain-containing proteinSMESG000074416.1 SMESG000074407.1 Contig1629newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035190Dimer_Tnp_hAT domain-containing proteinSMESG000074416.1 SMESG000074407.1 Contig1629uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30010586Bridging integrator 3SMESG000029355.1 Contig3561GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004991Programmed cell death protein 10SMESG000031167.1 Contig3159GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30000430Ras-related C3 botulinum toxin substrate 1SMESG000005012.1 Contig2853GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005316ADP-ribosylation factor 1SMESG000000945.1 SMESG000000928.1 Contig3270GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023269ANK_REP_REGION domain-containing proteinSMESG000020728.1 Contig2805GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30006119X-box-binding protein 1SMESG000003891.1 Contig1388GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30006119X-box-binding protein 1SMESG000048111.1 Contig1388GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004118Tubulin beta chainSMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044907.1 SMESG000044888.1 SMESG000035804.1 SMESG000035755.1 Contig2059GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016022SMED30016022SMESG000053405.1 Contig1766uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016022SMED30016022SMESG000053405.1 Contig1766newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016022SMED30016022SMESG000046314.1 SMESG000028362.1 Contig1766uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016022SMED30016022SMESG000046314.1 SMESG000028362.1 Contig1766newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011617Actin-related protein 2/3 complex subunit 4SMESG000043420.1 Contig1665GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011617Actin-related protein 2/3 complex subunit 4SMESG000003841.1 Contig1665GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007795Essential myosin light chainSMESG000042179.1 Contig1602GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015161Vacuolar protein sorting-associated protein 45SMESG000053405.1 Contig1766GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015161Vacuolar protein sorting-associated protein 45SMESG000046314.1 SMESG000028362.1 Contig1766GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014246Ras-related protein Rab-5ASMESG000077941.1 Contig1099GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014246Ras-related protein Rab-5ASMESG000064914.1 Contig1099GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005382TYR_PHOSPHATASE_2 domain-containing proteinSMESG000030078.1 Contig1352GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012219Protein disulfide-isomeraseSMESG000076091.1 SMESG000076042.1 SMESG000074857.1 SMESG000069936.1 SMESG000048922.1 SMESG000026530.1 SMESG000022236.1 SMESG000021499.1 SMESG000008351.1 SMESG000006220.1 Contig100GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012219Protein disulfide-isomeraseSMESG000041085.1 Contig100GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED300030531-acyl-sn-glycerol-3-phosphate acyltransferase deltaSMESG000081135.1 Contig3433GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016045Cysteine-rich proteinSMESG000044206.1 Contig353newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016045Cysteine-rich proteinSMESG000044206.1 Contig353uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016045Cysteine-rich proteinSMESG000003375.1 Contig353newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016045Cysteine-rich proteinSMESG000003375.1 Contig353uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30003079Prominin (Prom) protein, putativeSMESG000062666.1 Contig3501newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30003079Prominin (Prom) protein, putativeSMESG000062666.1 Contig3501uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30003079Prominin (Prom) protein, putativeSMESG000015778.1 Contig3501newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30003079Prominin (Prom) protein, putativeSMESG000015778.1 Contig3501uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005082SMED30005082SMESG000009320.1 Contig1862newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001750RanBP-type and C3HC4-type zinc finger containing 1SMESG000047137.1 Contig2730GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001750RanBP-type and C3HC4-type zinc finger containing 1SMESG000069303.1 Contig2730GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012469SMED30012469SMESG000038855.1 Contig2191newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011780Si:ch73-222h13.1SMESG000081135.1 Contig3433newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011780Si:ch73-222h13.1SMESG000081135.1 Contig3433uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30009189KinaseSMESG000044206.1 Contig353GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30009189KinaseSMESG000003375.1 Contig353GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30000409mitfl-2 proteinSMESG000077129.1 Contig2622newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30000409mitfl-2 proteinSMESG000077129.1 Contig2622uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30000409mitfl-2 proteinSMESG000005013.1 Contig2622newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30000409mitfl-2 proteinSMESG000005013.1 Contig2622uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013050SMED30013050SMESG000000175.1 Contig2068newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30003600Ras-like C3 botulinum toxin substrate 1SMESG000077129.1 Contig2622GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30003600Ras-like C3 botulinum toxin substrate 1SMESG000005013.1 Contig2622GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008076Reverse transcriptase domain-containing proteinSMESG000024306.1 Contig631GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008076Reverse transcriptase domain-containing proteinSMESG000008737.1 Contig631GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001490ADF-H domain-containing proteinSMESG000080129.1 Contig513GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011191SMED30011191SMESG000000989.1 SMESG000000988.1 Contig1658newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015967Neurotracting/lsamp/neurotrimin/obcam related cell adhesion moleculeSMESG000019973.1 Contig692GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015967Neurotracting/lsamp/neurotrimin/obcam related cell adhesion moleculeSMESG000068491.1 Contig692GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008586Reverse transcriptase domain-containing proteinSMESG000024306.1 Contig631GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008586Reverse transcriptase domain-containing proteinSMESG000008737.1 Contig631GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007716Ankyrin repeat domain 28bSMESG000060640.1 Contig3408GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007716Ankyrin repeat domain 28bSMESG000074871.1 Contig3408GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013913Adenylate kinaseSMESG000047137.1 Contig2730newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013913Adenylate kinaseSMESG000047137.1 Contig2730uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013913Adenylate kinaseSMESG000069303.1 Contig2730newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013913Adenylate kinaseSMESG000069303.1 Contig2730uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008756SMED30008756SMESG000007049.1 Contig3743newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008756SMED30008756SMESG000007049.1 Contig3743uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008756SMED30008756SMESG000074654.1 Contig3743newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008756SMED30008756SMESG000074654.1 Contig3743uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30006211Transmembrane protease serineSMESG000068156.1 SMESG000043474.1 SMESG000076470.1 SMESG000053533.1 SMESG000015751.1 Contig250GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30006211Transmembrane protease serineSMESG000025034.1 Contig250GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013294SMED30013294SMESG000080433.1 SMESG000010902.1 Contig1818newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30000448Cysteine-rich proteinSMESG000044206.1 Contig353newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021235Tubulin alpha chainSMESG000059785.1 Contig1211GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021235Tubulin alpha chainSMESG000079004.1 Contig1211GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021235Tubulin alpha chainSMESG000079004.1 PL030009A10F06ncbi_smed_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028380Ras-related proteinSMESG000024796.1 Contig3946newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028380Ras-related proteinSMESG000024796.1 Contig3946uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028380Ras-related proteinSMESG000001576.1 Contig3946newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028380Ras-related proteinSMESG000001576.1 Contig3946uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024713Pyruvate carboxylaseSMESG000077941.1 Contig1099newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024713Pyruvate carboxylaseSMESG000077941.1 Contig1099uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024713Pyruvate carboxylaseSMESG000064914.1 Contig1099newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024713Pyruvate carboxylaseSMESG000064914.1 Contig1099uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023460TTF-type domain-containing proteinSMESG000046135.1 Contig1594newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30026190Tubulin beta chainSMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044907.1 SMESG000044888.1 SMESG000035804.1 SMESG000035755.1 Contig2059GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30026690SMED30026690SMESG000076091.1 SMESG000076042.1 SMESG000074857.1 SMESG000069936.1 SMESG000048922.1 SMESG000026530.1 SMESG000022236.1 SMESG000021499.1 SMESG000008351.1 SMESG000006220.1 Contig100newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30026690SMED30026690SMESG000041085.1 Contig100newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035848Tubulin beta chainSMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044907.1 SMESG000044888.1 SMESG000035804.1 SMESG000035755.1 Contig2059GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023220Transmembrane proteinSMESG000046135.1 Contig1594GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019727beta-catenin-like protein 2SMESG000014825.1 Contig3406GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019727beta-catenin-like protein 2SMESG000002541.1 Contig3406GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021390SMED30021390SMESG000033382.1 Contig3395newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027044SMED30027044SMESG000024306.1 Contig631newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027044SMED30027044SMESG000008737.1 Contig631newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027682NAD(P)H-dependent FMN reductaseSMESG000060640.1 Contig3408newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027682NAD(P)H-dependent FMN reductaseSMESG000060640.1 Contig3408uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027682NAD(P)H-dependent FMN reductaseSMESG000074871.1 Contig3408newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027682NAD(P)H-dependent FMN reductaseSMESG000074871.1 Contig3408uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30031903ProsaposinSMESG000019973.1 Contig692newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30031903ProsaposinSMESG000068491.1 Contig692newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032901SMED30032901SMESG000059757.1 Contig3698GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032901SMED30032901SMESG000054316.1 Contig3698GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023199Leucine-zipper-like transcriptional regulator 1SMESG000007049.1 Contig3743GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023199Leucine-zipper-like transcriptional regulator 1SMESG000074654.1 Contig3743GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012021SMED30012021 Contig6139newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002834SMED30002834SMESG000043420.1 Contig1665newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002834SMED30002834SMESG000043420.1 Contig1665uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002834SMED30002834SMESG000003841.1 Contig1665newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002834SMED30002834SMESG000003841.1 Contig1665uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012677Coiled-coil domain-containing protein 51SMESG000058452.1 Contig1190newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012677Coiled-coil domain-containing protein 51SMESG000058452.1 Contig1190uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012677Coiled-coil domain-containing protein 51SMESG000057519.1 Contig1190newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012677Coiled-coil domain-containing protein 51SMESG000057519.1 Contig1190uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005012SMED30005012 Contig1286newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30003680RanBP-type and C3HC4-type zinc finger-containing protein 1SMESG000069298.1 Contig3532GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011242Synaptosomal-associated protein 29SMESG000024796.1 Contig3946GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011242Synaptosomal-associated protein 29SMESG000001576.1 Contig3946GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008147SMED30008147SMESG000053405.1 Contig1766newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008147SMED30008147SMESG000053405.1 Contig1766uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008147SMED30008147SMESG000046314.1 SMESG000028362.1 Contig1766newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008147SMED30008147SMESG000046314.1 SMESG000028362.1 Contig1766uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30010645SMED30010645 Contig1674newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011603Rho guanine nucleotide exchange factorSMESG000003891.1 Contig1388newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011603Rho guanine nucleotide exchange factorSMESG000048111.1 Contig1388newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011603Rho guanine nucleotide exchange factorSMESG000008077.1 Contig5057GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011603Rho guanine nucleotide exchange factorSMESG000017950.1 Contig5057GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004969SMED30004969SMESG000008209.1 Contig1530newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002094SMED30002094SMESG000003117.1 Contig1178GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005235SMED30005235SMESG000036235.1 Contig2568newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30006536SMED30006536SMESG000054351.1 Contig1590newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30006536SMED30006536SMESG000005053.1 SMESG000005050.1 Contig1590newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007912SMED30007912SMESG000059785.1 Contig1211newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007912SMED30007912SMESG000059785.1 Contig1211uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007912SMED30007912SMESG000079004.1 Contig1211newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007912SMED30007912SMESG000079004.1 Contig1211uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001027Cathepsin LSMESG000054075.1 SMESG000034294.1 Contig1264newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001027Cathepsin LSMESG000054075.1 SMESG000034294.1 Contig1264uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001027Cathepsin LSMESG000065264.1 SMESG000065255.1 Contig1264newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001027Cathepsin LSMESG000065264.1 SMESG000065255.1 Contig1264uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032447SMED30032447SMESG000025120.1 Contig1559newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034100SMED30034100 Contig1700newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034100SMED30034100 Contig1700uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30033930Cystathionine beta-synthaseSMESG000054075.1 SMESG000034294.1 Contig1264GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30033930Cystathionine beta-synthaseSMESG000065264.1 SMESG000065255.1 Contig1264GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028854SMED30028854 Contig1674GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027929Tubulin beta chainSMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044907.1 SMESG000044888.1 SMESG000035804.1 SMESG000035755.1 Contig2059GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032408SMED30032408SMESG000027686.1 Contig2364newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032408SMED30032408SMESG000012131.1 SMESG000012127.1 Contig2364newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028216RNA polymerase II subunit A C-terminal domain phosphatase Contig6262newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30025305SMED30025305SMESG000027283.1 Contig1753newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029088SMED30029088SMESG000017135.1 Contig2203newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020801SMED30020801SMESG000075928.1 Contig7205newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020801SMED30020801SMESG000075928.1 Contig7205uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020849SMED30020849SMESG000044682.1 Contig721newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020849SMED30020849SMESG000044682.1 Contig721uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020849SMED30020849SMESG000058940.1 Contig721newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020849SMED30020849SMESG000058940.1 Contig721uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027910Calpain-5SMESG000045063.1 Contig7340newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027910Calpain-5SMESG000045063.1 Contig7340uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035284RING-type domain-containing proteinSMESG000055935.1 Contig651newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035284RING-type domain-containing proteinSMESG000055935.1 Contig651uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035284RING-type domain-containing proteinSMESG000059879.1 SMESG000059868.1 SMESG000059853.1 Contig651newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035284RING-type domain-containing proteinSMESG000059879.1 SMESG000059868.1 SMESG000059853.1 Contig651uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028174TTF-type domain-containing proteinSMESG000003943.1 Contig6476newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028174TTF-type domain-containing proteinSMESG000003943.1 Contig6476uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002222SMED30002222 Contig7536newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002222SMED30002222 Contig7536uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30009357ubiquilin-1SMESG000045386.1 Contig2009GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014226SMED30014226SMESG000074424.1 Contig1592newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004579SMED30004579SMESG000052600.1 Contig1622newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002213Zinc finger, C2H2 typeSMESG000070776.1 SMESG000049855.1 Contig1854GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002213Zinc finger, C2H2 typeSMESG000075102.1 Contig1854GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004187SMED30004187SMESG000043423.1 Contig1792newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004187SMED30004187SMESG000043423.1 Contig1792uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004187SMED30004187SMESG000072544.1 Contig1792newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004187SMED30004187SMESG000072544.1 Contig1792uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014729SMED30014729SMESG000050509.1 Contig1785newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014822Moesin/ezrin/radixin homolog 1SMESG000056380.1 Contig1780GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019729Bestrophin homologSMESG000080433.1 SMESG000010902.1 Contig1818GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017347Acetyl-CoA carboxylase 1SMESG000065082.1 Contig5150newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017347Acetyl-CoA carboxylase 1SMESG000065082.1 Contig5150uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017347Acetyl-CoA carboxylase 1SMESG000032321.1 Contig5150newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017347Acetyl-CoA carboxylase 1SMESG000032321.1 Contig5150uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007246SMED30007246SMESG000045656.1 Contig3259GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014527SMED30014527SMESG000003891.1 Contig1388newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014527SMED30014527SMESG000048111.1 Contig1388newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30003127SMED30003127SMESG000027140.1 Contig1248newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019441SMED30019441SMESG000070776.1 SMESG000049855.1 Contig1854newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019441SMED30019441SMESG000075102.1 Contig1854newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30000758SMED30000758SMESG000050509.1 Contig1785GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30006486SMED30006486SMESG000033958.1 Contig1720newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30000579SMED30000579SMESG000022913.1 Contig1890newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30006887Gelsolin-like proteinSMESG000001429.1 Contig4707GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30006887Gelsolin-like proteinSMESG000015927.1 Contig4707GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002079SMED30002079SMESG000043462.1 Contig210newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002079SMED30002079SMESG000043462.1 Contig210uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002079SMED30002079SMESG000049099.1 Contig210newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002079SMED30002079SMESG000049099.1 Contig210uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004302SMED30004302SMESG000069298.1 Contig3532newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015783O-acyltransferaseSMESG000000989.1 SMESG000000988.1 Contig1658GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032422SynaptogyrinSMESG000031799.1 Contig1892GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035917SMED30035917SMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044907.1 SMESG000044888.1 SMESG000035804.1 SMESG000035755.1 Contig2059newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30022956Regulator of microtubule dynamics protein 1SMESG000038855.1 Contig2191GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023243SMED30023243SMESG000009320.1 Contig1862GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035805RING-type domain-containing proteinSMESG000043462.1 Contig210newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035805RING-type domain-containing proteinSMESG000043462.1 Contig210uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035805RING-type domain-containing proteinSMESG000049099.1 Contig210newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035805RING-type domain-containing proteinSMESG000049099.1 Contig210uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30033842SMED30033842SMESG000030078.1 Contig1352newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021685Bestrophin homologSMESG000080433.1 SMESG000010902.1 Contig1818GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30025582SMED30025582SMESG000057502.1 Contig1846GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019715Tumor protein p63-regulated gene 1 proteinSMESG000038153.1 SMESG000018862.1 Contig1GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019715Tumor protein p63-regulated gene 1 proteinSMESG000033840.1 Contig1GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019006Tubulin beta chainSMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044907.1 SMESG000044888.1 SMESG000035804.1 SMESG000035755.1 Contig2059GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30031918SMED30031918SMESG000043420.1 Contig1665newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30031918SMED30031918SMESG000043420.1 Contig1665uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30031918SMED30031918SMESG000003841.1 Contig1665newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30031918SMED30031918SMESG000003841.1 Contig1665uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED3002169814-3-3 protein epsilonSMESG000047644.1 Contig5316GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029116Gamma-secretase subunit PEN-2SMESG000067691.1 Contig138GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029116Gamma-secretase subunit PEN-2SMESG000035771.1 Contig138GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034570SMED30034570SMESG000067691.1 Contig138newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034570SMED30034570SMESG000067691.1 Contig138uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034570SMED30034570SMESG000035771.1 Contig138newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034570SMED30034570SMESG000035771.1 Contig138uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30025543Coiled-coil domain-containing protein 93SMESG000022913.1 Contig1890GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30000448Cysteine-rich proteinSMESG000044206.1 Contig353uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30000448Cysteine-rich proteinSMESG000003375.1 Contig353newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30000448Cysteine-rich proteinSMESG000003375.1 Contig353uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015345TropomyosinSMESG000066854.1 Contig3688newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015345TropomyosinSMESG000066854.1 Contig3688uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015345TropomyosinSMESG000026500.1 Contig3688newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015345TropomyosinSMESG000026500.1 Contig3688uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30006484EGF-like domain-containing proteinSMESG000032835.1 SMESG000032829.1 Contig2869GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30006484EGF-like domain-containing proteinSMESG000034231.1 Contig2869GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30003493Telomerase protein component 1SMESG000032835.1 SMESG000032829.1 Contig2869newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30003493Telomerase protein component 1SMESG000032835.1 SMESG000032829.1 Contig2869uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30003493Telomerase protein component 1SMESG000034231.1 Contig2869newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30003493Telomerase protein component 1SMESG000034231.1 Contig2869uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023334Partitioning defective 6SMESG000066854.1 Contig3688GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023334Partitioning defective 6SMESG000026500.1 Contig3688GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032562SMED30032562SMESG000014825.1 Contig3406newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032562SMED30032562SMESG000014825.1 Contig3406uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032562SMED30032562SMESG000002541.1 Contig3406newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032562SMED30032562SMESG000002541.1 Contig3406uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020544SMED30020544SMESG000031799.1 Contig1892newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023611SMED30023611SMESG000031125.1 Contig1620newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024871SMED30024871SMESG000056380.1 Contig1780newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30031811SMED30031811SMESG000057502.1 Contig1846newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015409cAMP-responsive element modulatorSMESG000016695.1 Contig4585GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015409cAMP-responsive element modulatorSMESG000033655.1 Contig4585GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013863Rac-1SMESG000024961.1 Contig5482GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013289SMED30013289SMESG000045568.1 Contig4881newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013289SMED30013289SMESG000045568.1 Contig4881uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008591Zinc finger MYM-type protein 1SMESG000053671.1 SMESG000053667.1 Contig5414newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008591Zinc finger MYM-type protein 1SMESG000053671.1 SMESG000053667.1 Contig5414uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017930SMED30017930SMESG000049597.1 Contig5044newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017930SMED30017930SMESG000004871.1 Contig5044newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30000575SMED30000575SMESG000064050.1 Contig4890newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30000575SMED30000575SMESG000069596.1 Contig4890newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30003996Tubulin alpha chainSMESG000074897.1 PL08001A1E08ncbi_smed_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007555GCR098SMESG000016695.1 Contig4585newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007555GCR098SMESG000016695.1 Contig4585uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007555GCR098SMESG000033655.1 Contig4585newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007555GCR098SMESG000033655.1 Contig4585uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013477MAU2 chromatid cohesion factorSMESG000008077.1 Contig5057newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013477MAU2 chromatid cohesion factorSMESG000008077.1 Contig5057uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013477MAU2 chromatid cohesion factorSMESG000017950.1 Contig5057newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013477MAU2 chromatid cohesion factorSMESG000017950.1 Contig5057uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017140Ras-related protein Rap-1bSMESG000008077.1 Contig5057GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017140Ras-related protein Rap-1bSMESG000017950.1 Contig5057GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027768SMED30027768SMESG000045568.1 Contig4881newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027768SMED30027768SMESG000045568.1 Contig4881uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020064Membrane-bound transcription factor site-2 proteaseSMESG000064743.1 Contig4698newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020064Membrane-bound transcription factor site-2 proteaseSMESG000064743.1 Contig4698uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021405Neurogenic locus notch-like protein protein 1SMESG000041513.1 Contig7665newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021405Neurogenic locus notch-like protein protein 1SMESG000041513.1 Contig7665uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30022579SMED30022579SMESG000001429.1 Contig4707newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30022579SMED30022579SMESG000015927.1 Contig4707newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020582SMED30020582SMESG000074897.1 PL08001A1E08ncbi_smed_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032393SMED30032393SMESG000036683.1 Contig4572newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032393SMED30032393SMESG000074788.1 Contig4572newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30022944SMED30022944SMESG000049597.1 Contig5044newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30022944SMED30022944SMESG000004871.1 Contig5044newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001350SMED30001350SMESG000045656.1 Contig3259newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014058SMED30014058SMESG000000945.1 SMESG000000928.1 Contig3270newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016832SH3 domain-binding protein 5-likeSMESG000061052.1 Contig4742newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016832SH3 domain-binding protein 5-likeSMESG000061052.1 Contig4742uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016832SH3 domain-binding protein 5-likeSMESG000022856.1 Contig4742newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016832SH3 domain-binding protein 5-likeSMESG000022856.1 Contig4742uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012378Clathrin heavy chainSMESG000040592.1 Contig5422GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012378Clathrin heavy chainSMESG000035457.1 Contig5422GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012378Clathrin heavy chainSMESG000072345.1 Contig4452GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012378Clathrin heavy chainSMESG000035457.1 Contig4452GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30000118Leucine-rich repeat flightless-interacting protein 2SMESG000041553.1 Contig4772newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30000118Leucine-rich repeat flightless-interacting protein 2SMESG000041553.1 Contig4772uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30000118Leucine-rich repeat flightless-interacting protein 2SMESG000068232.1 Contig4772newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30000118Leucine-rich repeat flightless-interacting protein 2SMESG000068232.1 Contig4772uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012869Y-box-binding protein 1SMESG000032189.1 Contig3807GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017833SMED30017833SMESG000053168.1 Contig2992newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016164SMED30016164SMESG000064161.1 Contig2672newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007986SMED30007986SMESG000029355.1 Contig3561newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032050Cell division control protein 42 homologSMESG000064161.1 Contig2672GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024174Programmed cell death 6-interacting proteinSMESG000051593.1 Contig4912GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024174Programmed cell death 6-interacting proteinSMESG000019014.1 Contig4912GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027751SMED30027751SMESG000014111.1 Contig4084newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023862SMED30023862SMESG000009332.1 SMESG000009320.1 Contig505newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023862SMED30023862SMESG000009332.1 SMESG000009320.1 Contig505uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023862SMED30023862SMESG000041448.1 Contig505newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023862SMED30023862SMESG000041448.1 Contig505uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029022SMED30029022SMESG000031167.1 Contig3159newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020068Protein rolling stone Contig174GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30022992Myosin heavy chainSMESG000062420.1 PL08009A2H09ncbi_smed_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30022992Myosin heavy chainSMESG000062420.1 PL06023A2A10ncbi_smed_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034050Transmembrane proteinSMESG000058746.1 PL04021A1B12ncbi_smed_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030294SMED30030294SMESG000026870.1 PL04016B2E04ncbi_smed_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014138LIM homeobox 1bSMESG000061052.1 Contig4742GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014138LIM homeobox 1bSMESG000022856.1 Contig4742GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001526SMED30001526SMESG000078478.1 Contig4368newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001526SMED30001526SMESG000078478.1 Contig4368uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001526SMED30001526SMESG000017249.1 Contig4368newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001526SMED30001526SMESG000017249.1 Contig4368uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002579SMED30002579SMESG000064050.1 Contig4890GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002579SMED30002579SMESG000069596.1 Contig4890GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005889LPTSMESG000040592.1 Contig5422newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005889LPTSMESG000040592.1 Contig5422uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005889LPTSMESG000035457.1 Contig5422newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005889LPTSMESG000035457.1 Contig5422uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017937WASP like actin nucleation promoting factor bSMESG000036683.1 Contig4572GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017937WASP like actin nucleation promoting factor bSMESG000074788.1 Contig4572GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021941SMED30021941SMESG000051593.1 Contig4912newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021941SMED30021941SMESG000051593.1 Contig4912uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021941SMED30021941SMESG000019014.1 Contig4912newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021941SMED30021941SMESG000019014.1 Contig4912uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034412E3 ubiquitin-protein ligase CBLSMESG000039019.1 Contig3731GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034412E3 ubiquitin-protein ligase CBLSMESG000056433.1 Contig3731GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035239Forkhead box proteinSMESG000061695.1 Contig4822newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035239Forkhead box proteinSMESG000061695.1 Contig4822uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035239Forkhead box proteinSMESG000041562.1 Contig4822newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035239Forkhead box proteinSMESG000041562.1 Contig4822uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035485low density lipoprotein receptor related-2SMESG000009332.1 SMESG000009320.1 Contig505GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035485low density lipoprotein receptor related-2SMESG000041448.1 Contig505GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30031091activin 1SMESG000072407.1 Contig4428GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30031091activin 1SMESG000024833.1 Contig4428GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021001Protein kinaseSMESG000078478.1 Contig4368GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021001Protein kinaseSMESG000017249.1 Contig4368GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034838Casein kinase II subunit alphaSMESG000039019.1 Contig3731newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034838Casein kinase II subunit alphaSMESG000056433.1 Contig3731newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034315Adenylyl cyclase-associated proteinSMESG000065082.1 Contig5150GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034315Adenylyl cyclase-associated proteinSMESG000032321.1 Contig5150GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034430Arp2/3 complex 34 kDa subunitSMESG000060573.1 Contig5379GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034430Arp2/3 complex 34 kDa subunitSMESG000073809.1 Contig5379GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029111Chloride channel proteinSMESG000059757.1 Contig3698newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029111Chloride channel proteinSMESG000059757.1 Contig3698uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029111Chloride channel proteinSMESG000054316.1 Contig3698newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029111Chloride channel proteinSMESG000054316.1 Contig3698uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020244Protein kinase domain containing proteinSMESG000078478.1 Contig4368GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020244Protein kinase domain containing proteinSMESG000017249.1 Contig4368GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029573GFO_IDH_MocA domain-containing proteinSMESG000072407.1 Contig4428newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029573GFO_IDH_MocA domain-containing proteinSMESG000072407.1 Contig4428uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029573GFO_IDH_MocA domain-containing proteinSMESG000024833.1 Contig4428newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029573GFO_IDH_MocA domain-containing proteinSMESG000024833.1 Contig4428uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021080SMED30021080SMESG000060573.1 Contig5379newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021080SMED30021080SMESG000060573.1 Contig5379uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021080SMED30021080SMESG000073809.1 Contig5379newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021080SMED30021080SMESG000073809.1 Contig5379uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30033999Zinc finger MYM-type protein 1SMESG000060573.1 Contig5379newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30033999Zinc finger MYM-type protein 1SMESG000060573.1 Contig5379uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30033999Zinc finger MYM-type protein 1SMESG000073809.1 Contig5379newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30033999Zinc finger MYM-type protein 1SMESG000073809.1 Contig5379uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034775Ras-associating domain-containing proteinSMESG000002146.1 Contig5459GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30026950terminal uridylyltransferase 4SMESG000061695.1 Contig4822GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30026950terminal uridylyltransferase 4SMESG000041562.1 Contig4822GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030780SMED30030780SMESG000008077.1 Contig5057GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020100SMED30020100SMESG000013936.1 Contig1935uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020100SMED30020100SMESG000039535.1 Contig1935newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020100SMED30020100SMESG000039535.1 Contig1935uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027595DUF3421 domain-containing proteinSMESG000020792.1 Contig1106GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027595DUF3421 domain-containing proteinSMESG000027124.1 Contig1106GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021196SMED30021196SMESG000015163.1 Contig1173newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028080SMED30028080SMESG000037355.1 Contig5533GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028080SMED30028080SMESG000024479.1 Contig5533GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028080SMED30028080SMESG000024479.1 PL030011B10G11ncbi_smed_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002704Cathepsin L2SMESG000013992.1 SMESG000013980.1 Contig1337GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011793Homeobox protein DTH-1SMESG000028338.1 Contig5669GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011793Homeobox protein DTH-1SMESG000079512.1 Contig5669GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016492B-cell receptor-associated protein 31SMESG000017490.1 Contig1500GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016492B-cell receptor-associated protein 31SMESG000064614.1 Contig1500GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014717WD repeat and FYVE domain-containing protein 3SMESG000043973.1 SMESG000011278.1 Contig1351GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014717WD repeat and FYVE domain-containing protein 3SMESG000039846.1 Contig1351GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015706Twinfilin-1SMESG000041071.1 Contig2453GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015354Tubby-like proteinSMESG000043973.1 SMESG000011278.1 Contig1351newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015354Tubby-like proteinSMESG000043973.1 SMESG000011278.1 Contig1351uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015354Tubby-like proteinSMESG000039846.1 Contig1351newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015354Tubby-like proteinSMESG000039846.1 Contig1351uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028574Cytochrome P450 2K1-like proteinSMESG000073604.1 Contig1511GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028574Cytochrome P450 2K1-like proteinSMESG000078091.1 SMESG000078098.1 SMESG000078094.1 SMESG000078092.1 Contig1511GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034544Disrupted in renal carcinoma protein 2-likeSMESG000017031.1 Contig2590GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029546Tektin 3SMESG000020792.1 Contig1106newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029546Tektin 3SMESG000020792.1 Contig1106uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029546Tektin 3SMESG000027124.1 Contig1106newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029546Tektin 3SMESG000027124.1 Contig1106uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021752Cytochrome P450 2K1-like proteinSMESG000073604.1 Contig1511GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021752Cytochrome P450 2K1-like proteinSMESG000078091.1 SMESG000078098.1 SMESG000078094.1 SMESG000078092.1 Contig1511GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016368Endoribonuclease DicerSMESG000073604.1 Contig1511newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016368Endoribonuclease DicerSMESG000073604.1 Contig1511uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016368Endoribonuclease DicerSMESG000078091.1 SMESG000078098.1 SMESG000078094.1 SMESG000078092.1 Contig1511newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016368Endoribonuclease DicerSMESG000078091.1 SMESG000078098.1 SMESG000078094.1 SMESG000078092.1 Contig1511uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017270H2A histone family, member YSMESG000059652.1 Contig2797GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017270H2A histone family, member YSMESG000012903.1 Contig2797GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011935SMED30011935SMESG000059652.1 Contig2797newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011935SMED30011935SMESG000012903.1 Contig2797newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005336Phtf-FEM1B_bdg domain-containing proteinSMESG000058788.1 Contig2701GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016048VPS37C subunit of ESCRT-ISMESG000028338.1 Contig5669newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016048VPS37C subunit of ESCRT-ISMESG000028338.1 Contig5669uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016048VPS37C subunit of ESCRT-ISMESG000079512.1 Contig5669newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016048VPS37C subunit of ESCRT-ISMESG000079512.1 Contig5669uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011519Mediator of RNA polymerase II transcription subunit 21SMESG000036235.1 Contig2568GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016150RUN and FYVE domain-containing protein 2-likeSMESG000050873.1 Contig2383GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011534Nucleobindin-2SMESG000022270.1 Contig2769GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014928Formin-like proteinSMESG000044336.1 Contig1407newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014928Formin-like proteinSMESG000015063.1 Contig1407newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019261SMED30019261SMESG000022691.1 SMESG000022690.1 Contig229newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30006144Helicase with zinc finger domain 2SMESG000022691.1 SMESG000022690.1 Contig229GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011909SMED30011909SMESG000027686.1 Contig2364GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011909SMED30011909SMESG000012131.1 SMESG000012127.1 Contig2364GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019300Histone deacetylase,putativeSMESG000006246.1 Contig3291GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015801SMED30015801SMESG000079303.1 Contig2289newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015801SMED30015801SMESG000017260.1 Contig2289newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012113SMED30012113SMESG000017135.1 Contig2203GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30010792Protein kinaseSMESG000074416.1 SMESG000074407.1 Contig1629GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019325Myosin regulatory light chainSMESG000036544.1 Contig3175GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019325Myosin regulatory light chainSMESG000000175.1 Contig3175GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019325Myosin regulatory light chainSMESG000068156.1 SMESG000064685.1 SMESG000043474.1 SMESG000010609.1 SMESG000076470.1 SMESG000073857.1 SMESG000062429.1 SMESG000058575.1 SMESG000053533.1 SMESG000020635.1 SMESG000015751.1 SMESG000005260.1 Contig246GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019325Myosin regulatory light chainSMESG000000175.1 Contig246GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019325Myosin regulatory light chainSMESG000000175.1 Contig2068GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020153SMED30020153SMESG000025120.1 Contig1559GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30022703dual specificity protein phosphatase 12SMESG000014789.1 Contig1758GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029880Tigger transposable element derived 1SMESG000024822.1 Contig1490newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020317Heat shock protein 90SMESG000024822.1 Contig1490GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30022535GTPase activating proteinSMESG000068156.1 SMESG000010609.1 SMESG000076470.1 SMESG000073857.1 SMESG000062429.1 SMESG000060487.1 SMESG000058575.1 SMESG000053533.1 SMESG000026676.1 SMESG000020635.1 SMESG000015751.1 SMESG000005260.1 Contig236GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30022535GTPase activating proteinSMESG000037949.1 Contig236GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30031780Ras-related protein Rab-5ASMESG000065500.1 Contig1027GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027012slc24a-7SMESG000022806.1 SMESG000022803.1 Contig7328newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027012slc24a-7SMESG000022806.1 SMESG000022803.1 Contig7328uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023751Coactosin-like proteinSMESG000073127.1 PL06005B1H09ncbi_smed_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032067TRAF-4SMESG000044336.1 Contig1407GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032067TRAF-4SMESG000015063.1 Contig1407GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023739SMED30023739SMESG000058452.1 Contig1190GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023739SMED30023739SMESG000057519.1 Contig1190GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008091Serine/threonine-protein kinase PLKSMESG000027686.1 Contig2364GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008091Serine/threonine-protein kinase PLKSMESG000012131.1 SMESG000012127.1 Contig2364GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008091Serine/threonine-protein kinase PLKSMESG000012131.1 SMESG000012127.1 Contig809GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001281SMED30001281SMESG000031561.1 SMESG000018862.1 Contig8newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001281SMED30001281SMESG000067743.1 Contig8newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30000059hypothetical proteinSMESG000066598.1 dd_Smed_v4_6448_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30004082NIPSNAP domain-containing proteinSMESG000043687.1 dd_Smed_v4_2078_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30013080G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000001813.1 dd_Smed_v4_19933_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30002274SMED30002274SMESG000057505.1 SMESG000057504.1 dd_Smed_v4_8804_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30002133PolyubiquitinSMESG000039444.1 SMESG000014081.1 dd_Smed_v4_34_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30017439SMED30017439SMESG000000381.1 SMESG000000382.1 dd_Smed_v4_2318_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30005428CIP29SMESG000073815.1 dd_Smed_v4_2297_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30000065SMED30000065SMESG000049103.1 dd_Smed_v4_397_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30011381HORMA domain-containing proteinSMESG000066514.1 dd_Smed_v4_2201_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30008108SMED30008108SMESG000025456.1 dd_Smed_v4_72642_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30019378Exocyst complex componentSMESG000065870.1 dd_Smed_v4_2186_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30007824WASH complex subunit 4SMESG000003631.1 dd_Smed_v4_4183_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30010360Leucine Rich repeat-containing domain proteinSMESG000047911.1 SMESG000045664.1 dd_Smed_v4_2769_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30004783DnaJ heat shock protein family (Hsp40) member C13SMESG000061705.1 dd_Smed_v4_2579_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30014032SMED30014032SMESG000000381.1 SMESG000000382.1 dd_Smed_v4_2318_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30014117protein SEC13 homologSMESG000013191.1 dd_Smed_v4_836_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30012514Beta-hexosaminidase subunit betaSMESG000002681.1 dd_Smed_v4_3964_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30012514Beta-hexosaminidase subunit betaSMESG000066985.1 dd_Smed_v4_2271_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30010520SMED30010520SMESG000066861.1 SMESG000059630.1 SMESG000066862.1 dd_Smed_v4_6647_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30026906SMED30026906SMESG000021439.1 dd_Smed_v4_14418_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30022249Clathrin interactor 1SMESG000032527.1 SMESG000022725.1 dd_Smed_v4_1563_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30030413epiregulin-1SMESG000022749.1 dd_Smed_v4_10923_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30031646SMED30031646SMESG000010156.1 dd_Smed_v4_105_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30031407Coiled-coil-helix-coiled-coil-helix domain-containing protein 10 mitochondrialSMESG000003969.1 dd_Smed_v4_225_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30035597SMED30035597SMESG000029469.1 dd_Smed_v4_1765_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30028453Lysosomal alpha-glucosidaseSMESG000005050.1 dd_Smed_v4_1062_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30028453Lysosomal alpha-glucosidaseSMESG000005054.1 dd_Smed_v4_5392_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30029652Ribosomal protein L24SMESG000047956.1 SMESG000045302.1 dd_Smed_v4_1059_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED3002420240S ribosomal protein S14SMESG000036550.1 dd_Smed_v4_139_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30031180SMED30031180SMESG000016699.1 dd_Smed_v4_10468_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30031134slc13a-3SMESG000050959.1 dd_Smed_v4_1171_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30032879Selenide, water dikinase 1SMESG000075106.1 dd_Smed_v4_1918_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED3002954297 kDa heat shock proteinSMESG000019478.1 dd_Smed_v4_1087_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30035143PiggyBac transposable element-derived protein 2SMESG000052698.1 SMESG000027142.1 SMESG000059994.1 dd_Smed_v4_1029_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30028420Nucleotide-binding oligomerization domain-containing protein 2SMESG000018415.1 dd_Smed_v4_10594_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30034644SMED30034644SMESG000040931.1 dd_Smed_v4_10855_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30025309Dimer_Tnp_hAT domain-containing proteinSMESG000066861.1 SMESG000059630.1 SMESG000066862.1 dd_Smed_v4_6647_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED3003415260S ribosomal protein L11SMESG000012668.1 SMESG000012475.1 dd_Smed_v4_144_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30023411slc42a-1SMESG000048384.1 dd_Smed_v4_1882_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30035145Syntaxin binding proteinSMESG000060160.1 dd_Smed_v4_10167_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30021037RibonucloproteinSMESG000027962.1 dd_Smed_v4_1928_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30030824ENTH domain-containing proteinSMESG000019746.1 dd_Smed_v4_1065_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30029442epidermal growth factor receptor 2SMESG000004201.1 SMESG000004200.1 dd_Smed_v4_10499_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30034953SMED30034953SMESG000065075.1 dd_Smed_v4_102_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30034193Phospholipase D family member 3SMESG000003419.1 dd_Smed_v4_1894_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30035963SMED30035963SMESG000071278.1 dd_Smed_v4_1649_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30035231SMED30035231SMESG000066861.1 SMESG000059630.1 SMESG000066862.1 dd_Smed_v4_6647_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30026528slc37a-1SMESG000016731.1 dd_Smed_v4_1048_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30030270Proteasome subunit betaSMESG000016299.1 dd_Smed_v4_1771_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30031354ATP synthase-coupling factor 6, mitochondrialSMESG000038869.1 dd_Smed_v4_1046_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30035769Four and a half LIM domains proteinSMESG000023063.1 dd_Smed_v4_1251_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30024473hydroxyacyl dehydrogenase bSMESG000070850.1 dd_Smed_v4_1593_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30024368chromodomain helicase DNA-binding protein 4SMESG000068192.1 dd_Smed_v4_2331_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30032420SMED30032420SMESG000050229.1 SMESG000050221.1 dd_Smed_v4_1219_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30027596RNA-binding protein pno1SMESG000015341.1 dd_Smed_v4_1077_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30026242Secretory carrier-associated membrane proteinSMESG000060788.1 dd_Smed_v4_1544_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30035307Forkhead box C1SMESG000015673.1 dd_Smed_v4_16297_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30026110Acetolactate synthase, putativeSMESG000026596.1 dd_Smed_v4_1784_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30024121TetraspaninSMESG000023248.1 dd_Smed_v4_1808_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30035627GRIP domain-containing proteinSMESG000017888.1 dd_Smed_v4_10306_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30031930S-like RNaseSMESG000016389.1 dd_Smed_v4_1008_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30030459SMED30030459SMESG000041220.1 dd_Smed_v4_14151_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30002911LipaseSMESG000074187.1 dd_Smed_v4_122_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30010974InnexinSMESG000055742.1 SMESG000055733.1 dd_Smed_v4_1120_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30006689Leucine-rich repeat serine/threonine-protein kinase 2-like proteinSMESG000056130.1 dd_Smed_v4_7343_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30007348SMED30007348SMESG000043828.1 dd_Smed_v4_10959_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30003859SMED30003859SMESG000018217.1 dd_Smed_v4_1350_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30008917Tubulin alpha chainSMESG000079650.1 SMESG000010171.1 dd_Smed_v4_124_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30010632E3 ubiquitin-protein ligase RGLG4SMESG000076482.1 SMESG000076409.1 SMESG000076405.1 SMESG000076390.1 SMESG000076375.1 SMESG000076364.1 SMESG000076223.1 SMESG000040665.1 SMESG000019753.1 dd_Smed_v4_1097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED3001850460S ribosomal protein L30SMESG000022893.1 dd_Smed_v4_111_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30008709ERO1-like protein betaSMESG000020490.1 dd_Smed_v4_6558_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30012357SMED30012357SMESG000041431.1 dd_Smed_v4_12848_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30005772vault protein inter alpha trypsin-1SMESG000053671.1 SMESG000053669.1 SMESG000053667.1 SMESG000053664.1 SMESG000053657.1 SMESG000053638.1 dd_Smed_v4_1027_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30007305SMED30007305SMESG000007145.1 dd_Smed_v4_608_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30019298Heterogeneous nuclear ribonucleoprotein LSMESG000005298.1 dd_Smed_v4_1327_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED3000905260S ribosomal protein L18SMESG000017166.1 dd_Smed_v4_128_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30009281Netrin-4SMESG000062589.1 dd_Smed_v4_6093_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30018755Small ubiquitin-related modifierSMESG000018835.1 dd_Smed_v4_1253_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30007143Nucleolar GTP-binding protein 2SMESG000026847.1 dd_Smed_v4_1134_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30011250Granulin precursorSMESG000029882.1 dd_Smed_v4_442_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30005457SMED30005457SMESG000035312.1 dd_Smed_v4_131_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30005457SMED30005457SMESG000035312.1 SMESG000035313.1 dd_131dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
gutSMED30002592NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 3SMESG000016331.1 dd_Smed_v4_1078_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30001419Xaa-Pro dipeptidaseSMESG000012999.1 dd_Smed_v4_1297_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30014348Four and a half LIM domains protein 1SMESG000018217.1 dd_Smed_v4_1350_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30002428Gamma-aminobutyric acid receptor-associated proteinSMESG000026465.1 dd_Smed_v4_600_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30010526SMED30010526SMESG000072556.1 dd_Smed_v4_10620_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30019518SMED30019518SMESG000073002.1 SMESG000072984.1 dd_Smed_v4_12680_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30004505START domain-containing proteinSMESG000048192.1 dd_Smed_v4_498_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30002332TNF receptor associated factor-2SMESG000070267.1 dd_Smed_v4_2599_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30010940TetraspaninSMESG000021642.1 dd_Smed_v4_1257_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED3000109640S ribosomal protein S23SMESG000017264.1 dd_Smed_v4_290_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30001195da proteinSMESG000032044.1 dd_Smed_v4_5579_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30009861slc26a-3SMESG000064565.1 dd_Smed_v4_11142_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30005206Serine/arginine-rich splicing factor 1SMESG000075205.1 dd_Smed_v4_1192_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30017379DJ-1SMESG000003454.1 dd_Smed_v4_1223_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30008579ST13 Hsp70 interacting proteinSMESG000071677.1 SMESG000069228.1 SMESG000017570.1 SMESG000017358.1 SMESG000017347.1 SMESG000013728.1 SMESG000001430.1 dd_Smed_v4_668_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED3000832026S proteasome regulatory subunit 8SMESG000066841.1 dd_Smed_v4_1176_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30002074GM26448SMESG000026134.1 dd_Smed_v4_12063_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30014151Glutamine synthetaseSMESG000003831.1 dd_Smed_v4_1275_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30001281SMED30001281SMESG000038153.1 SMESG000018862.1 Contig1newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001281SMED30001281SMESG000033840.1 Contig1newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017013Vesicle-associated membrane protein 3SMESG000079659.1 SMESG000079651.1 Contig154GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017013Vesicle-associated membrane protein 3SMESG000033382.1 Contig154GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017013Vesicle-associated membrane protein 3SMESG000033382.1 Contig3395GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30010541F-actin-capping protein subunit betaSMESG000008209.1 Contig1530GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30000967DUF3421 domain-containing proteinSMESG000068156.1 SMESG000064685.1 SMESG000010609.1 SMESG000076470.1 SMESG000073857.1 SMESG000062429.1 SMESG000060487.1 SMESG000058575.1 SMESG000053533.1 SMESG000026676.1 SMESG000020635.1 SMESG000015751.1 SMESG000005260.1 Contig239GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30000967DUF3421 domain-containing proteinSMESG000057816.1 Contig239GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30003773SMED30003773SMESG000024822.1 Contig1490newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005549DDE_Tnp_1_7 domain-containing proteinSMESG000080555.1 SMESG000049002.1 SMESG000075946.1 SMESG000067287.1 SMESG000064983.1 SMESG000064843.1 SMESG000062987.1 SMESG000047155.1 SMESG000013953.1 Contig927newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005549DDE_Tnp_1_7 domain-containing proteinSMESG000080555.1 SMESG000049002.1 SMESG000075946.1 SMESG000067287.1 SMESG000064983.1 SMESG000064843.1 SMESG000062987.1 SMESG000047155.1 SMESG000013953.1 Contig927uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005549DDE_Tnp_1_7 domain-containing proteinSMESG000076100.1 Contig927newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005549DDE_Tnp_1_7 domain-containing proteinSMESG000076100.1 Contig927uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002973Mitochondrial sodium/calcium exchanger proteinSMESG000022806.1 SMESG000022803.1 Contig7328newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002973Mitochondrial sodium/calcium exchanger proteinSMESG000022806.1 SMESG000022803.1 Contig7328uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014901ATP-binding cassette sub-family A member 3-like ProteinSMESG000080870.1 Contig6189newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014901ATP-binding cassette sub-family A member 3-like ProteinSMESG000080870.1 Contig6189uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30009611Str_synth domain-containing proteinSMESG000052600.1 Contig1622GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001306SMED30001306SMESG000068156.1 SMESG000010609.1 SMESG000076470.1 SMESG000073857.1 SMESG000062429.1 SMESG000060487.1 SMESG000058575.1 SMESG000053533.1 SMESG000026676.1 SMESG000020635.1 SMESG000015751.1 SMESG000005260.1 Contig236newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001306SMED30001306SMESG000068156.1 SMESG000064685.1 SMESG000010609.1 SMESG000076470.1 SMESG000073857.1 SMESG000062429.1 SMESG000060487.1 SMESG000058575.1 SMESG000053533.1 SMESG000026676.1 SMESG000020635.1 SMESG000015751.1 SMESG000005260.1 Contig239newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001306SMED30001306SMESG000057816.1 Contig239newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001306SMED30001306SMESG000037949.1 Contig236newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002317Helicase with zinc finger domain 2SMESG000017490.1 Contig1500newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002317Helicase with zinc finger domain 2SMESG000017490.1 Contig1500uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002317Helicase with zinc finger domain 2SMESG000064614.1 Contig1500newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002317Helicase with zinc finger domain 2SMESG000064614.1 Contig1500uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004193MACPF domain-containing protein 3SMESG000044682.1 Contig721newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004193MACPF domain-containing protein 3SMESG000044682.1 Contig721uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004193MACPF domain-containing protein 3SMESG000058940.1 Contig721newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004193MACPF domain-containing protein 3SMESG000058940.1 Contig721uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019321TIR domain-containing proteinSMESG000079659.1 SMESG000079651.1 Contig154newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019321TIR domain-containing proteinSMESG000079659.1 SMESG000079651.1 Contig154uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019321TIR domain-containing proteinSMESG000033382.1 Contig154newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019321TIR domain-containing proteinSMESG000033382.1 Contig154uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED300172003'(2'),5'-bisphosphate nucleotidase 1SMESG000014111.1 Contig4084GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002822RING-type domain-containing proteinSMESG000076385.1 SMESG000076375.1 SMESG000076363.1 SMESG000076223.1 SMESG000076482.1 SMESG000076470.1 SMESG000076410.1 SMESG000076358.1 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005745Protein kinaseSMESG000079303.1 Contig2289GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005745Protein kinaseSMESG000017260.1 Contig2289GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30009287Protein kinase, putativeSMESG000074416.1 SMESG000074407.1 Contig1629GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008999Voltage-dependent N-type calcium channel subunit alphaSMESG000019873.1 Contig6657newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008999Voltage-dependent N-type calcium channel subunit alphaSMESG000019873.1 Contig6657uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007434NADPH:adrenodoxin oxidoreductase, mitochondrialSMESG000050975.1 Contig7307newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007434NADPH:adrenodoxin oxidoreductase, mitochondrialSMESG000050975.1 Contig7307uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012651Retrovirus-related Pol polyprotein from transposonSMESG000034282.1 Contig7503newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012651Retrovirus-related Pol polyprotein from transposonSMESG000034282.1 Contig7503uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017714Basement membrane-specific heparan sulfate proteoglycan core proteinSMESG000075928.1 Contig7205newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017714Basement membrane-specific heparan sulfate proteoglycan core proteinSMESG000075928.1 Contig7205uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30025964SMED30025964SMESG000041071.1 Contig2453newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024204SMED30024204SMESG000027140.1 Contig1248GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030940SMED30030940SMESG000013104.1 Contig988newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029077Macrophage-expressed gene 1 proteinSMESG000044682.1 Contig721newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029077Macrophage-expressed gene 1 proteinSMESG000044682.1 Contig721uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029077Macrophage-expressed gene 1 proteinSMESG000058940.1 Contig721newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029077Macrophage-expressed gene 1 proteinSMESG000058940.1 Contig721uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030705SMED30030705SMESG000068156.1 SMESG000010609.1 SMESG000076470.1 SMESG000073857.1 SMESG000062429.1 SMESG000060487.1 SMESG000058575.1 SMESG000053533.1 SMESG000026676.1 SMESG000020635.1 SMESG000015751.1 SMESG000005260.1 Contig236newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030705SMED30030705SMESG000068156.1 SMESG000064685.1 SMESG000010609.1 SMESG000076470.1 SMESG000073857.1 SMESG000062429.1 SMESG000060487.1 SMESG000058575.1 SMESG000053533.1 SMESG000026676.1 SMESG000020635.1 SMESG000015751.1 SMESG000005260.1 Contig239newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030705SMED30030705SMESG000057816.1 Contig239newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030705SMED30030705SMESG000037949.1 Contig236newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030705SMED30030705SMESG000068156.1 SMESG000043474.1 SMESG000076470.1 SMESG000053533.1 SMESG000015751.1 Contig250newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030705SMED30030705SMESG000025034.1 Contig250newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021281TIR domain-containing proteinSMESG000079659.1 SMESG000079651.1 Contig154newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021281TIR domain-containing proteinSMESG000079659.1 SMESG000079651.1 Contig154uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021281TIR domain-containing proteinSMESG000033382.1 Contig154newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021281TIR domain-containing proteinSMESG000033382.1 Contig154uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30026637MATH domain-containing proteinSMESG000080555.1 SMESG000049002.1 SMESG000075946.1 SMESG000067287.1 SMESG000064983.1 SMESG000064843.1 SMESG000062987.1 SMESG000047155.1 SMESG000013953.1 Contig927newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30026637MATH domain-containing proteinSMESG000080555.1 SMESG000049002.1 SMESG000075946.1 SMESG000067287.1 SMESG000064983.1 SMESG000064843.1 SMESG000062987.1 SMESG000047155.1 SMESG000013953.1 Contig927uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30026637MATH domain-containing proteinSMESG000076100.1 Contig927newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30026637MATH domain-containing proteinSMESG000076100.1 Contig927uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024282Synaptosomal-associated proteinSMESG000034282.1 Contig7503newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024282Synaptosomal-associated proteinSMESG000034282.1 Contig7503uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032354EOG090X01A3SMESG000068156.1 SMESG000010609.1 SMESG000076470.1 SMESG000073857.1 SMESG000062429.1 SMESG000060487.1 SMESG000058575.1 SMESG000053533.1 SMESG000026676.1 SMESG000020635.1 SMESG000015751.1 SMESG000005260.1 Contig236newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032354EOG090X01A3SMESG000068156.1 SMESG000064685.1 SMESG000043474.1 SMESG000010609.1 SMESG000076470.1 SMESG000073857.1 SMESG000062429.1 SMESG000058575.1 SMESG000053533.1 SMESG000020635.1 SMESG000015751.1 SMESG000005260.1 Contig246newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032354EOG090X01A3SMESG000068156.1 SMESG000064685.1 SMESG000010609.1 SMESG000076470.1 SMESG000073857.1 SMESG000062429.1 SMESG000060487.1 SMESG000058575.1 SMESG000053533.1 SMESG000026676.1 SMESG000020635.1 SMESG000015751.1 SMESG000005260.1 Contig239newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032354EOG090X01A3SMESG000000175.1 Contig246newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032354EOG090X01A3SMESG000057816.1 Contig239newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032354EOG090X01A3SMESG000037949.1 Contig236newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032354EOG090X01A3SMESG000068156.1 SMESG000043474.1 SMESG000076470.1 SMESG000053533.1 SMESG000015751.1 Contig250newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032354EOG090X01A3SMESG000025034.1 Contig250newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007156OxidoreductaseSMESG000002835.1 Contig5582GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007156OxidoreductaseSMESG000016829.1 Contig5582GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007704ActinSMESG000036432.1 Contig450GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007704ActinSMESG000051672.1 SMESG000051670.1 Contig450GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007704ActinSMESG000030853.1 Contig1138GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007704ActinSMESG000051672.1 SMESG000051670.1 Contig1138GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30018122MADS-box domain-containing proteinSMESG000005612.1 Contig594GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30018122MADS-box domain-containing proteinSMESG000011575.1 Contig594GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005741Actin-related protein 2/3 complex subunitSMESG000015778.1 Contig1955GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005741Actin-related protein 2/3 complex subunitSMESG000062666.1 Contig3501GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005741Actin-related protein 2/3 complex subunitSMESG000015778.1 Contig3501GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002600ATPase_AAA_core domain-containing proteinSMESG000072345.1 Contig4452newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002600ATPase_AAA_core domain-containing proteinSMESG000072345.1 Contig4452uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002600ATPase_AAA_core domain-containing proteinSMESG000035457.1 Contig4452newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002600ATPase_AAA_core domain-containing proteinSMESG000035457.1 Contig4452uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005274Tripeptidyl peptidase 2SMESG000074726.1 Contig6326newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005274Tripeptidyl peptidase 2SMESG000074726.1 Contig6326uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016267beta-secretase 1SMESG000074842.1 Contig1168GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016267beta-secretase 1SMESG000037819.1 Contig1168GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008812AP complex subunit sigmaSMESG000038889.1 Contig2145GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001294Phosphatidylinositol-binding clathrin assembly proteinSMESG000043423.1 Contig1792GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001294Phosphatidylinositol-binding clathrin assembly proteinSMESG000072544.1 Contig1792GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008645Endophilin-A3SMESG000043383.1 Contig1883GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013976SMED30013976SMESG000003513.1 Contig59newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013976SMED30013976SMESG000003513.1 Contig59uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013976SMED30013976SMESG000068232.1 Contig59newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013976SMED30013976SMESG000068232.1 Contig59uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30006740SJCHGC04139 proteinSMESG000045533.1 Contig1156GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30006740SJCHGC04139 proteinSMESG000035447.1 Contig1156GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30010493MATS2SMESG000015163.1 Contig1173GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011213Osteoclast-stimulating factor 1SMESG000004952.1 Contig516GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001296Actin-related protein 2SMESG000019700.1 Contig701GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017878RING finger protein unkempt homologSMESG000001908.1 SMESG000001895.1 SMESG000054185.1 SMESG000003953.1 Contig32newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017878RING finger protein unkempt homologSMESG000001908.1 SMESG000001895.1 SMESG000054185.1 SMESG000003953.1 Contig32uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017878RING finger protein unkempt homologSMESG000003941.1 Contig32newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017878RING finger protein unkempt homologSMESG000003941.1 Contig32uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016943slc15a-6SMESG000064204.1 Contig1439GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016943slc15a-6SMESG000030835.1 Contig1439GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002941Actin-related protein 2/3 complex subunit 3SMESG000001908.1 SMESG000001895.1 SMESG000054185.1 SMESG000003953.1 Contig32GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002941Actin-related protein 2/3 complex subunit 3SMESG000003941.1 Contig32GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30033014Phosphatidylinositol-4,5-bisphosphate 4-phosphataseSMESG000063221.1 Contig1068GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30033333SMED30033333SMESG000004952.1 Contig516newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021127SMED30021127SMESG000037626.1 Contig1315newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021127SMED30021127SMESG000037626.1 Contig1315uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021127SMED30021127SMESG000048042.1 Contig1315newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021127SMED30021127SMESG000048042.1 Contig1315uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020811SMED30020811SMESG000005612.1 Contig594newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020811SMED30020811SMESG000005612.1 Contig594uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020811SMED30020811SMESG000011575.1 Contig594newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020811SMED30020811SMESG000011575.1 Contig594uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30022370Calcium-activated potassium channel slo-1, putativeSMESG000049145.1 Contig1087newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30022370Calcium-activated potassium channel slo-1, putativeSMESG000075482.1 Contig1087newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012477SMED30012477SMESG000081058.1 Contig2302newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016397Transforming acidic coiled-coil-containing protein 3SMESG000056367.1 PL08003B2C03ncbi_smed_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001674SMED30001674SMESG000002943.1 Contig3127newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004652SMED30004652SMESG000033527.1 Contig2307newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015319SMED30015319SMESG000014789.1 Contig1758newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019591SMED30019591SMESG000050873.1 Contig2383newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012769SMED30012769SMESG000058788.1 Contig2701newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012769SMED30012769SMESG000058788.1 Contig2701uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002229SMED30002229SMESG000032180.1 Contig1715newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011718SMED30011718SMESG000070267.1 Contig1736newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032850SMED30032850SMESG000035248.1 Contig3418newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032850SMED30032850SMESG000035248.1 Contig3418uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032850SMED30032850SMESG000007797.1 Contig3418newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032850SMED30032850SMESG000007797.1 Contig3418uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30022483CGG triplet repeat-binding protein 1SMESG000020470.1 Contig1680newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30022483CGG triplet repeat-binding protein 1SMESG000020470.1 Contig1680uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027273SMED30027273SMESG000017031.1 Contig2590newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030829Y-box proteinSMESG000032180.1 Contig1715GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30026411Ectonucleotide pyrophosphatase/phosphodiesterase family member 5SMESG000023047.1 dd_Smed_v4_973_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30034544Disrupted in renal carcinoma protein 2-likeSMESG000017031.1 dd_Smed_v4_4596_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30023854Carbonic anhydraseSMESG000017178.1 dd_Smed_v4_9270_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30024748SIN3-HDAC complex-associated factorSMESG000033706.1 dd_Smed_v4_8876_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30022938SMED30022938SMESG000057519.1 SMESG000057514.1 dd_Smed_v4_3277_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30025105Plastin 3SMESG000081126.1 SMESG000081113.1 dd_Smed_v4_749_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30030079SMED30030079SMESG000042010.1 dd_Smed_v4_8745_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30028401InnexinSMESG000056430.1 dd_Smed_v4_734_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30028664two pore calcium channel protein 1SMESG000045181.1 SMESG000045178.1 SMESG000045168.1 dd_Smed_v4_8333_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30025272Laminin subunit gamma-1SMESG000019909.1 dd_Smed_v4_7359_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30025910Microtubule-associated protein futschSMESG000044270.1 SMESG000030021.1 SMESG000025422.1 dd_Smed_v4_1999_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30026736S-methyl-5'-thioadenosine phosphorylaseSMESG000016252.1 dd_Smed_v4_2328_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30034180Alpha-int-4SMESG000018926.1 dd_Smed_v4_11948_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30035470SMED30035470SMESG000076482.1 SMESG000076409.1 SMESG000076405.1 SMESG000076390.1 SMESG000076375.1 SMESG000076364.1 SMESG000076223.1 SMESG000040665.1 SMESG000019753.1 dd_Smed_v4_1097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30024770SMED30024770SMESG000035481.1 dd_Smed_v4_7894_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30027451PMP-22/EMP/MP20/Claudin tight junctionSMESG000029752.1 dd_Smed_v4_2731_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30033302RNA-binding protein MEX3BSMESG000044270.1 SMESG000030021.1 SMESG000025422.1 dd_Smed_v4_1999_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30030027Ast8 proteinSMESG000073667.1 dd_Smed_v4_254_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30022385Hyaluronan binding protein 2SMESG000061109.1 dd_Smed_v4_2031_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30025809Cytochrome c oxidase subunit 4SMESG000071294.1 dd_Smed_v4_845_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30033810DLH domain-containing proteinSMESG000077560.1 dd_Smed_v4_2062_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30032475DUF89 domain-containing proteinSMESG000008042.1 dd_Smed_v4_2075_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30025303Glutamine--fructose-6-phosphate aminotransferase [isomerizing] 2SMESG000073848.1 dd_Smed_v4_7522_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30035074SMED30035074SMESG000068982.1 dd_Smed_v4_1190_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30026529DnaJ homolog subfamily C member 5SMESG000064231.1 dd_Smed_v4_2840_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30023180slc6a-12SMESG000055640.1 dd_Smed_v4_8727_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30032591arf-GAP with Rho-GAP domain, ANK repeat and PH domain-containing protein 1-likeSMESG000006535.1 dd_Smed_v4_4332_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30024236InnexinSMESG000056430.1 dd_Smed_v4_734_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30029741SMED30029741SMESG000056346.1 dd_Smed_v4_2250_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30018716Acidic leucine-rich nuclear phosphoprotein 32 family member ASMESG000065271.1 dd_Smed_v4_1396_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30016464Cytochrome P450SMESG000060680.1 dd_Smed_v4_9863_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30013233Expressed conserved proteinSMESG000062284.1 dd_Smed_v4_565_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30009199Histone-lysine N-methyltransferase SETMARSMESG000031104.1 SMESG000031101.1 dd_Smed_v4_6221_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30017270H2A histone family, member YSMESG000012903.1 dd_Smed_v4_4487_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30011798E3 ubiquitin-protein ligase MIB2SMESG000043477.1 SMESG000010549.1 SMESG000010347.1 SMESG000010327.1 dd_Smed_v4_593_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30001540Hydroxyacid-oxoacid transhydrogenase, mitochondrialSMESG000009985.1 dd_Smed_v4_4554_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30005546Coronin-1BSMESG000037126.1 SMESG000026646.1 dd_Smed_v4_448_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30007442SMED30007442SMESG000069832.1 dd_Smed_v4_5530_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30015116SMED30015116SMESG000012426.1 dd_Smed_v4_5552_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30018984prefoldin subunit 2SMESG000075156.1 SMESG000075150.1 dd_Smed_v4_1368_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30012974slc25a-27SMESG000061901.1 dd_Smed_v4_543_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30002267CystinosinSMESG000079054.1 dd_Smed_v4_4571_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30009673SMED30009673SMESG000040843.1 dd_Smed_v4_5502_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30004957AnoctaminSMESG000033730.1 SMESG000033728.1 dd_Smed_v4_6514_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30002513Histidine ammonia-lyaseSMESG000002694.1 SMESG000002559.1 dd_Smed_v4_2219_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30002513Histidine ammonia-lyaseSMESG000002694.1 SMESG000002559.1 dd_Smed_v4_2970_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30000808Zinc finger MYM-type protein 1SMESG000038481.1 dd_Smed_v4_6644_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30019393protocadherin-1SMESG000033799.1 dd_Smed_v4_16629_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED3000317640S ribosomal protein S2SMESG000051503.1 dd_Smed_v4_226_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30016769Protein kinase domain-containing proteinSMESG000031104.1 SMESG000031101.1 dd_Smed_v4_6221_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30012464SMED30012464SMESG000035411.1 dd_Smed_v4_49258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30011695Alpha-galactosidaseSMESG000009912.1 dd_Smed_v4_606_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30000562Acyl-CoA synthetase short chain family member 3SMESG000043630.1 dd_Smed_v4_2832_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30011534Nucleobindin-2SMESG000022270.1 dd_Smed_v4_4003_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30005661Ras-related protein Rab-7aSMESG000068863.1 dd_Smed_v4_491_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30004809TNF receptor-associated factorSMESG000038724.1 dd_Smed_v4_7950_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30008213U8 snoRNA-decapping enzymeSMESG000028470.1 dd_Smed_v4_5872_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30003430SMED30003430SMESG000001786.1 SMESG000001778.1 dd_Smed_v4_5241_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30004594Dynamin 2SMESG000027378.1 SMESG000027377.1 dd_Smed_v4_2583_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30016964AnoctaminSMESG000033730.1 SMESG000033728.1 dd_Smed_v4_6514_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30013960slc39a-13SMESG000069905.1 dd_Smed_v4_5702_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30017862Jagged 2-1SMESG000025147.1 dd_Smed_v4_4792_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30000270Histone H3SMESG000049112.1 SMESG000049109.1 dd_Smed_v4_532_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30008079WD repeat-containing protein 7SMESG000032157.1 dd_Smed_v4_6105_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30004576Dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit 2SMESG000027526.1 dd_Smed_v4_538_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30001329SMED30001329SMESG000074416.1 SMESG000074409.1 SMESG000074407.1 dd_Smed_v4_7011_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30001279Methyltransf_25 domain-containing proteinSMESG000018708.1 dd_Smed_v4_5408_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30005783Tafazzin family proteinSMESG000048217.1 dd_Smed_v4_6026_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED3001100360S ribosomal protein L44SMESG000026827.1 dd_Smed_v4_64_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30000132SMED30000132SMESG000017239.1 dd_Smed_v4_4431_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30002251non-canonical poly(A) RNA polymerase PAPD5-likeSMESG000017326.1 dd_Smed_v4_5011_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30012447FilaminSMESG000064795.1 dd_Smed_v4_2272_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30008425PI-PLC X domain-containing protein 3SMESG000075551.1 dd_Smed_v4_5433_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30019300Histone deacetylase,putativeSMESG000006246.1 dd_Smed_v4_1997_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30018953SMED30018953SMESG000030062.1 dd_Smed_v4_6172_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30010792Protein kinaseSMESG000074416.1 SMESG000074407.1 dd_Smed_v4_3361_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30014667SMED30014667SMESG000004032.1 dd_Smed_v4_6955_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30014485Protein VAC14 homologSMESG000048581.1 dd_Smed_v4_4616_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30006352SMED30006352SMESG000056375.1 dd_Smed_v4_5993_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30024655Ligand of Numb protein X 2SMESG000067101.1 dd_Smed_v4_4763_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30027683Golgi phosphoprotein 3SMESG000073543.1 SMESG000073542.1 dd_Smed_v4_1770_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30020153SMED30020153SMESG000025120.1 dd_Smed_v4_5510_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30035852Ubiquitin-60S ribosomal protein L40SMESG000035681.1 dd_Smed_v4_176_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30027991L-2-hydroxyglutarate dehydrogenase, mitochondrialSMESG000046453.1 SMESG000024353.1 dd_Smed_v4_1758_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30034004SMED30034004SMESG000004927.1 dd_Smed_v4_1659_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30020317Heat shock protein 90SMESG000024822.1 dd_Smed_v4_678_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30020423Cystinosin homolog-like ProteinSMESG000079054.1 dd_Smed_v4_4571_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30023751Coactosin-like proteinSMESG000073127.1 dd_Smed_v4_63_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30035360Peptidyl-prolyl cis-trans isomeraseSMESG000006589.1 dd_Smed_v4_133_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30023739SMED30023739SMESG000057519.1 SMESG000057514.1 dd_Smed_v4_3277_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30024671SMED30024671SMESG000017034.1 dd_Smed_v4_1516_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30025807RuvB-like helicaseSMESG000033997.1 SMESG000018207.1 dd_Smed_v4_2547_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30023642Acyl-CoA dehydrogenase family member 9, mitochondrialSMESG000048318.1 dd_Smed_v4_6056_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30018061Ribose-5-phosphate isomeraseSMESG000004984.1 dd_Smed_v4_12956_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30017013Vesicle-associated membrane protein 3SMESG000033382.1 dd_Smed_v4_1311_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30010205pim-2SMESG000027798.1 dd_Smed_v4_4435_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30010541F-actin-capping protein subunit betaSMESG000008209.1 dd_Smed_v4_1165_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30006092SMED30006092SMESG000020731.1 SMESG000020729.1 dd_Smed_v4_11220_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED300051503' histone mRNA exonuclease 1SMESG000058668.1 dd_Smed_v4_1266_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30000967DUF3421 domain-containing proteinSMESG000057816.1 dd_Smed_v4_87_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30009071SMED30009071SMESG000017123.1 dd_Smed_v4_10551_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30010364SMED30010364SMESG000056847.1 SMESG000056843.1 SMESG000056838.1 SMESG000044770.1 SMESG000044762.1 SMESG000007140.1 dd_Smed_v4_1137_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30011562Leishmanolysin-like peptidaseSMESG000063815.1 dd_Smed_v4_10609_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30009279DystoninSMESG000043809.1 SMESG000043799.1 dd_Smed_v4_1205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30014496Ribosome biogenesis protein NSA2SMESG000028599.1 dd_Smed_v4_1012_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30011190Cytosolic Fe-S cluster assembly factor NUBP2 homologSMESG000019851.1 SMESG000019820.1 dd_Smed_v4_1094_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30016347SMED30016347SMESG000033615.1 dd_Smed_v4_10981_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30013779Tubulin monoglycylase TTLL3SMESG000029205.1 dd_Smed_v4_10244_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30017626Cysteine rich secretory protein LCCL domain containing 2SMESG000031543.1 dd_Smed_v4_11957_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30012914SMED30012914SMESG000028186.1 dd_Smed_v4_2368_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30008017Usp domain-containing proteinSMESG000020955.1 dd_Smed_v4_1068_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30015359Ubiquitin carboxyl-terminal hydrolaseSMESG000040010.1 dd_Smed_v4_4869_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30012806Rho guanine nucleotide exchange factor 38SMESG000056121.1 SMESG000056110.1 dd_Smed_v4_7179_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30019485SMED30019485SMESG000075557.1 dd_Smed_v4_10583_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30003676C-type lectin domain-containing proteinSMESG000028261.1 SMESG000028260.1 SMESG000028258.1 dd_Smed_v4_10_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30005403SMED30005403SMESG000074208.1 dd_Smed_v4_10446_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30013651SMED30013651SMESG000004219.1 dd_Smed_v4_5288_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30011205SMED30011205SMESG000056922.1 dd_Smed_v4_11352_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30022101Down syndrome cell adhesion moleculeSMESG000048977.1 dd_Smed_v4_5856_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30027355Sorbitol dehydrogenase-like proteinSMESG000042474.1 dd_Smed_v4_1002_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30023223Glutamate receptor ionotropicSMESG000005067.1 dd_Smed_v4_11004_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30022501Fatty acid-binding protein, heartSMESG000029500.1 dd_Smed_v4_599_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30022955Transmembrane protein 72SMESG000039568.1 dd_Smed_v4_6789_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30026417SMED30026417SMESG000006455.1 dd_Smed_v4_11785_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED3002797940S ribosomal protein S27SMESG000066109.1 SMESG000052687.1 SMESG000014240.1 SMESG000069832.1 SMESG000037642.1 dd_Smed_v4_106_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30026585UbiquitinSMESG000003212.1 dd_Smed_v4_104_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30021906SMED30021906SMESG000038869.1 dd_Smed_v4_1046_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30027932SMED30027932SMESG000043629.1 dd_Smed_v4_1216_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30028184Ras-related protein Rab-32SMESG000060723.1 dd_Smed_v4_1037_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30020421slc15a-8SMESG000009956.1 dd_Smed_v4_11818_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30024958VAMP (vesicle-associated membrane protein)-associated protein A, likeSMESG000062111.1 dd_Smed_v4_1433_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30025753SMED30025753SMESG000016791.1 dd_Smed_v4_10_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30026121Ectonucleotide pyrophosphatase/phosphodiesterase family member 6SMESG000040292.1 dd_Smed_v4_1269_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED3002074960S acidic ribosomal protein P2SMESG000057890.1 dd_Smed_v4_556_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30026565FLYWCH-type zinc finger-containing protein 1SMESG000028417.1 dd_Smed_v4_11413_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30021884Purple acid phosphataseSMESG000074506.1 dd_Smed_v4_1053_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30022511SMED30022511SMESG000019851.1 SMESG000019820.1 dd_Smed_v4_1094_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30020070High mobility group protein B1SMESG000034017.1 dd_Smed_v4_1095_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30029849slc24a-5SMESG000022809.1 dd_Smed_v4_1009_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30029849slc24a-5SMESG000022809.1 dd_Smed_v4_9846_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30022614T-complex protein 1 subunit alphaSMESG000067696.1 dd_Smed_v4_1025_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30030557Transmembrane channel-like proteinSMESG000002416.1 dd_Smed_v4_11686_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30020296Vitellogenin domain-containing proteinSMESG000037978.1 SMESG000037977.1 dd_Smed_v4_194_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30021860Phosphorylase kinase gamma subunitSMESG000023567.1 SMESG000038340.1 dd_Smed_v4_1020_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30028403Voltage dependent L type calcium channel subunitSMESG000047442.1 SMESG000028290.1 SMESG000028279.1 dd_Smed_v4_13295_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30020956Lysosomal alpha-glucosidaseSMESG000005050.1 dd_Smed_v4_1062_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30026073NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 13SMESG000081249.1 dd_Smed_v4_1256_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30021535slc31a-3SMESG000020554.1 dd_Smed_v4_6792_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30022080HexosyltransferaseSMESG000020856.1 dd_Smed_v4_6652_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED300226652-acylglycerol O-acyltransferase 2SMESG000021419.1 dd_Smed_v4_4947_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30021161MARVEL domain-containing proteinSMESG000013795.1 dd_Smed_v4_1798_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED3002418960S ribosomal protein L31SMESG000017099.1 dd_Smed_v4_113_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30021154Calmodulin, putativeSMESG000040933.1 SMESG000040932.1 dd_Smed_v4_603_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30027595DUF3421 domain-containing proteinSMESG000027124.1 dd_Smed_v4_1333_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30022329Glutamate receptor NMDASMESG000008774.1 dd_Smed_v4_10043_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30025696Carbonic anhydraseSMESG000035022.1 dd_Smed_v4_10041_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30029216Calcium-transporting ATPaseSMESG000010260.1 dd_Smed_v4_1006_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30020834SMED30020834SMESG000060160.1 dd_Smed_v4_10167_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30023369ATP dependent RNA helicase DDX6SMESG000027870.1 dd_Smed_v4_11802_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30028080SMED30028080SMESG000024479.1 dd_Smed_v4_1163_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
gutSMED30021162Ribonuclease kappa