definitive gut

The Planarian Anatomoy Ontology (PLANA) is a collection of terms curated from the literature and other organism anatomy ontologies to describe anatomical features, life cycle stages and developmental processes in the regenerative flatworm Schmidtea mediterranea. The latest version of the PLANA Ontology is available through the Open Biological and Biomedical Ontology Foundry (OBO) . PLANA Ontology terms are searchable at the EMBL-EBI Ontology Lookup Service (OLS) and the PLANA Ontology Terms Page.

Below, the Overview Section is populated with infomration from the OLS.

Additional experimental information related to PLANA Ontology terms can be found in the Additional Term Information Section.



    ▻ Planarian Anatomy Ontology Term Overview

    ▻ Additional Term Information

      ▻ In Situ Hybridization Data

      ▻ Sequences




    Planarian Anatomy Ontology Term Overview


    NAME:

      definitive gut


    DEFINITON:

      The planarian triclad gut contains a central anterior gut branch connected to two posterior gut branches arranged around the definitive pharynx. Secondary gut branches extend laterally from the primary gut branches, while tertiary gut branches extend from the secondary branches. Food and waste enter and exit the definitive gut through the defintive pharynx.


    TERM DEFINITION CITATIONS:

      PMID:21664348


    TERM ID:

      PLANA:0000026


    ABOUT THIS TERM:

      definitive gut "is a" organ

      definitive gut "contained in" tail, posterior compartment, copulatory region, parapharyngeal region, anterior compartment, neck and head

      definitive gut "develops from" gamma neoblast

      definitive gut "existence overlaps" Stage 6, juvenile, Stage 5, asexual adult, sexually mature adult, Stage 8 and Stage 7

      definitive gut "existence starts at point" Stage 5

      definitive gut "part of" digestive system


      tertiary gut branch, secondary gut branch, posterior primary gut branch, gastrodermis, enteric musculature, anterior primary gut branch, gastrodermal plexus and lumen of digestive tract "is a" definitive gut


    BROWSE ONTOLOGY TREE (IN OLS):

    Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.


    Planarian Anatomy Ontology


    EXPLORE ONTOLOGY GRAPH:


    Dynamically explore this term by selecting additional relationships to display ( checkboxes on the right ) and by expanding nodes by double clicking on a node. Single click on a node to display the definition below.

     

    back to top


    Additional Term Information


    All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


    IN SITU HYBRIDIZATION DATA:


    Smed IDAccessionNameAliasEnriched during stage(s)Tissue/PatternImages
    SMED30007290AFF18488.1GATA456gata456aStage 2, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, definitive gut, digestive system, temporary embryonic pharynx, gamma neoblast
    SMED30005748AFF18489.1HNF4hnf-4Stage 2, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, definitive gut, digestive system, temporary embryonic pharynx, gamma neoblast
    SMED30025591ABW97518.1porcupine-like proteinporcn-AStage 5, Stage 6, Stage 7, Stage 8definitive gut, digestive system
    Click to see image symbols and abbreviations
    Abbreviation or symbolDefinition
    Ooral hemisphere
    Aaboral hemisphere
    Ddorsal
    Vventral
    Llateral
    black arrowheadembryonic pharynx
    red arrowheaddefinitive pharynx
    black arrowsprimitive gut
    yellow arrowsprimitive ectoderm cells
    cyan arrowsbrain
    cyan arrowheadsnerve cords
    blue arrowheadseye progenitors (trail cells)
    purple arrowheadseyes
    scale bar100 µm

     

    back to top


    SEQUENCES:

    smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

    >SMED30025591 ID=SMED30025591|Name=porcupine-like protein|organism=Schmidtea mediterranea sexual|type=transcript|length=3526bp
    TTCCGATCTTTTCTTTTGAAATTTTTGAAATTTTAAATAAAATTAATGACAAAGGCAGAAAATCAGAGAACTACTAAAGC
    ATCCGACTTCAAATTTGGAAAAGAAATCGGCCATGGCTCGTTCTCAACTGTAATGATAGCTAAGGAAATTTCTACCAATA
    AACATTATGCTGCAAAAATTATTGATAAAGTTTTTATTTCTAAACAGCGAATGGTTAATACTGTTATGATTGAAAAAGAA
    GTTCTCCGAAGAATAAATCACCAGTTTTTTGTATGTCTCAATTATACATTCCAAGATCCAGAGAGATTGTATTTTATTAT
    ATCATATGCCGAACGAGGAGAACTTTTATCTCATTTAACAAGACTTTCGTGTTTTGATTTAACGTGCACACAATTTTATT
    CCGCGGAAATTATTCTTGCATTAGAATATTTACATGGAATTAACGTTGTTCATCGAGATATAAAACCAGAAAATATTTTA
    CTGAGTGAAAATATGCATATAAAAATTTGTGATTTTGGCAGTGCAATTATTATCGATAAACCAGATCTCAAGCCTTCTTC
    TTTTACAGGTACAGCTCAATTCGTTTCTCCAGAAATGCTGGGATTCAGTAAAGAAACACGTGACAATAGCTATTCAGATG
    AACCGAATTCTGATTCAGAGGAACATAGCGAAATTGAAGTTAAACGAACTAGTTCACCTGATAATTCTAGGGAAATATTA
    TATCTAATGGACTTCTGGGCATTAGGATGCATCGTCTATCAAATGTTGTCTGGACGAATGCCATTTCACGTCAGGCATTC
    ACGGCATGAATATGAAATTTTCCAAAAGATCCGAAATTTAAAATATGAGTTTCCGGTTGGGTTTGATGATACTGCTAAAG
    ATTTTGTCTCTAAACTTCTTGTATTGAATCCACTGGAAAGATTAGGCAATCCATCCGATGGAAAGCACGCTGCTTTAAAA
    GCCCACCCCCTTTTCCGTTCAATTGATTTCGAAATTATCGGATCACAAAAACCTCCGCTATTACTTCCAAATATTGAGCC
    CATTGTTCAAAGTAATTGGGACGAAATTCCTGTTGGTTTTGAAGAAGCATGGAAATTCAATATCAAAAAAGAGTTTCAAG
    AAATGGAAAAAGCCGATAAACAAAAATTATTGCAAAACCAAGAAAAACTAAATCCGTTTCATAGATTTGTACGCAATCGA
    TTGATCATAAAACAAGGCATCTTGTACAAACGGCGTGGATTATTTACTCGTAAAAGAATGTTTCTATTAACTGAAGGACC
    TCATTTATTTTATGTCGACCCCGATGCTATGCAATTTAAAAAAGAAGTCAGTCTAAACTTAATTACTGGCATAGAAGTAA
    AAAATGACAAAGTATTTTATATCGTTACTAAAAGGCGAACATATTTTCTCGAAGATCCTTCAGCAAAGGCTGATGAATGG
    CGACAGAGTATTGAATCGATTTGTGTAGAATATTATGGATCATTTAAATTATCCCCTGGCACTTGCACTCAAACGCCTCT
    AGTTACATCATCTGAATCATAACTTTCGGTTTTATTTAAATTTATTTGTCATATAGAAAAAAATGTGAATTTAACGGTTT
    TTAATATAATAATTTAATATTGGTTTGAATTCTTGTTTTTCATTTTAAAATTTAATGGATATAATTTAAATATTTTAATA
    AATAAAAATATTCACATTGTTTTAATATTCTCTTTATGTCGTAATTGATAAATGATGCATTGTAAATGTATTTTACAACT
    GATCTAAATGAAACCAATAGGAAACGAGTGGTTCGATGTCATGTGAATCAGCATGCAACCAATCATAGTTTTGTGATTCA
    TTAAATATATTTTAAATTTTTAAAACAAATTAAATCACTTAATTAATTTTTAGACAATGTCACAATTTTATGGCGGATCC
    ACGATATTGGCACCTCTATCGAACGTTATGGGTATACCAGTGGATCAAATTAATTTTATTGTGTGTAGTTTATTGTCAAT
    CGGACTGGGTCAAATTATGCGACACAAATTCCCTCCTTCTAAATTGTCAGGAAGTACAAGAGGAATCATAGAAGCATTTT
    TTGGAATACTAATTGTTCTTTTCTGCTTCGGATACCAAGTCAAGTATTTGTTACTACAATCAACAGTTTCCTATGTAATA
    CTATTATTTTTGCCTTCACAAATATCAGCGCATTTGGTAACGTATTGGTGTATGGCTTTCATGGCGATAGTCCATTTATA
    CAGGATGCATTACGATTACGGAGGTTATACTCTCGATATATCTGGTCCGGTTATGATTCAAACCCAAAAATTGACCAGCC
    TCGCATTTAATCTTCTAGATGGACATCGAATAAATCAAGGAATAAAACTGCAACAGAGAAATCATGAATCTCACGCTGTG
    AAAAAACTACCAGATGCAATCAAGTTTTTCGGTTACACATTCTACTTTCATGGTGTATTAGCGGGTCCTTTTGTATTCTA
    CAATGAATATAAAGAATATATCACTGGATATGACGACAAGCATATTCCATGCTCCAAAAAGCAATTATCTTCAGCACTTT
    GTTTATCAGTGATCCATGGATTATTAACAGCATATGTCGCACCGCAGTTTCCATATATATTTGTTTGCAGCACCGATTAC
    CAACGGATGCATATGACTCGTAGAATAATGTTCACAATGATTTCATTTTTCCTCGTAAGACAAAAGTATTACTTTGCCTG
    GTCAATGGTTGAAGCTGGTGCTCTTAGTACCGGATTGGGATATTGTGGAAAGGATAAAAACGGAGAGAATAATTGGTCGA
    AAGTGAAAAATTACGATTTCATGGCAATCGAAAGCGGCAGTAGTTTGAAAGTGCTAGTGGACGGATGGAATATTTCCACA
    ACAAGATGGCTCAGAGAATTAATTTATGAACGAGCTCCTTTATTCTGTCGGACAATTCTAGTTTTCACCGTCAGTGCATT
    TTGGCATGGATTCTATCCTGGATATTATTTGATGTTTTTGACATTTTCTCTCTTTACGTTTTGCGCTAGAACCGTTAGGA
    AACACATTCGACCATTGTTCATTGTCAGTCCAATTACACTTCAACTCTATCATGTTCTAACGAAAATATTCACAAATCTG
    GCTTTAAATTACGGACAAGGACCATTTTATTTGCTGGAGTTTCAATCGGGACTTTTGTTTTGGAAGCCATATTACTTTTT
    CGGACACGTTCTAGCAATGTTCTGCGTATTGACCTTGCAATTTCGGCCGATAATCAACGACAAAGTCAACATAATGAACA
    ATGTTTTCACCAGAAAAGCCCAATATCGGTTTCAGAAACTAAAGATCCATTTGCAGAAAAAGTTGAGATGAAATTTTATT
    GATTTTGATAATTTATATAAAATATTATAATTTTGTTTTTCGTTTTATTTTTATATCGATGAATTTATGATAAATGCTAA
    ATATTCGATCCGGAATGAATTATTATTAATCTGGTTTTTATAATTGTTCATTTTTAATAGTTTTGTTTGTTTTTCGAAAA
    TGGCGG
    >SMED30007290 ID=SMED30007290|Name=GATA456|organism=Schmidtea mediterranea sexual|type=transcript|length=2033bp
    AGGTAAGTGTCGTCATCACAAGTGGCTTTATTATTATCATTTAAATTTTTTATCATATTATCATTGATTGCTTGTTTTCC
    TCATTCAAAATTTAACTGATTGTTATCAAGCTCATTTGATAACTCCAAATCTAATTGACACTCATGTAAATATCCCATTC
    GAATTTCCGTTCCCGTCCGTAAGATCCACGATCCGACAATGTTTCTCCCATCGGTATTGTCGAATTCTCACCAGAGAAAC
    TCACCAATAATGGACATTGTATCACCAAAATCCAACACCAGCAATCTGAATGCGTTGATCACGTATTCGAATTGTCCCAA
    CATAGATCTACAGTCGAATGATCTGTCAGTGAACTTGACGAATTCTCAAAACTTCCACGAATTGGATCACAAAACCAATT
    ACGGATACAAAGTTTCAAACAACGAGACAAAACTGAATGCTTTTCCATATTTAGCTCAATCGAACTTAACAGATTGCACA
    ACAGACATCAGTGGAGATCTGAAAAATCCAAATTCACATCTCAACTATGGAAACGGAATTTCGTTCTCGGAATTTTCGAA
    AATGTCCGAAACCAACATCCACGGATATCCGCCATATTGTTTCTCCACTAAACTGTTTCCCATTCCAAATCTACAAGAGA
    AATCAATTATCAACGACAACTATTCCGTGAAATCCACCGCCGGAGGCTTTATCACCGAATCGAATGAGCATCAAAACTCT
    GTAAATACTGGAAATTCCTACAATTCCAATTTAAGCTCATACAGAACGGTAATTCCCGCTCATTTTCATCTCTTCAATCA
    GAATTCACCAGAATCGAACTCGTTTTACAATACGGCTTGGAACAACTATCCGTTTCAAATATCCCCAACTTATCCCATAC
    AAAATCTACCGGATTCAACAATCAACTGGACAACAAACAATCAAATTCCAAGCAGCAATTTAGTTTTTGATCCCTGGAGC
    TGTAAATCAAATCTTAATCTTCCTCCGATTAATGAATTCGGTTCCAATTGCGATGTCAGCAGAGAGTGTGTGAACTGTGG
    AGCTAGCAATACTCAGTTGTGGTCCCGGGATAATTCTGGCTATTATTTGTGTGATGAATGCGACAGGTTCTCTCAAAACA
    ACAGTAGAAACCTCGAAAAACTACCAACGAATCAAGTCTCATCAAGTACCGAAAATGAGTTCATGAAAAAATCCAATGCC
    AACTTTCAACAATATGGAAAAAGATCCGACCTCGAATGCAGCAATTGTAAAATTACCAAGACTTCTTTATGGAGAAGAAA
    CAACGAAGGAGAACCTGTCTGCAATGCTTGCGGCTTGTATTATAAATTACATAAGTCTCTAAGACCTCTTTCAATGAGGA
    AAGAAGGAATACAAACAAGGAAAAGAAAACGGAAAACACAAATGAAACCGGTTTCCACTCATATTGCCAATAATCAAAAG
    GTGCCGTCTTCAGAATCGTCATCAGAACAAAATCAGTTTATAAACACTGTGAAATCAAGTGAAAATTGCTATAACATGAT
    TTCTGAAAATTCTCCAACATATATGCCAAATATATCAGTCCAGCCCTTCAATCACATTCTGAACTCCAGCCAATATCAAT
    TCCAATCTACAGAAAATCCCATTAATCAATCATATTTAAATTCCTCAATCAAAAACAGCAATCCCTTTTACGATTCCGAA
    AGTATACTTTATTCCTACAACAATTCAAACAAAATCAAAGATGAGCCCCTATTATCCATGGACAACGAACCGAAGCCCTA
    TTCCTCAATCAACGAGAAAATTGACGTCAACTCCATAGTGAGAATTAATGAAATCTCAAACAATTCGAATTCGAGTTAAT
    TATTCTGATCTACTTTTTAATTATATATTTAAGAACCGTATATACTTCGAAATATAATTTTAATGATAAAATTTTATATC
    TAAAAAATGTAATTTTTAAGTGCGAATTATTAAGTATGCATTTAAATAGTGCAATTATTGTGGTAGTTATTTTTATTACT
    AAATAAATGTTGTTTGTAAATTCGAGAATTTGT
    >SMED30005748 ID=SMED30005748|Name=HNF4|organism=Schmidtea mediterranea sexual|type=transcript|length=3066bp
    GAAGAATAACAAAGAAATTTATTGCCAAACTAAAATACCCGGCCTATTTCATCAAAAAAAAAACAATCAAAAACACAAAT
    CGCTACGAAAACTTGTATAAAAGATTCACATTAAAAGTCATCAATATTCCTCTTTTTTAAAGACTGATGATTCAGATTCT
    TGGATCCGAATGGGGTGATCTGTTAGGAAGTGAGCTGTTGACGAGATAGCTGAATAGTTTGATCTGGAATTGTGCTGTTG
    GTTCGCTTCCGATGATCTGTTGGCGATTGATTGAATTTGGCAGTTTTCTATCGGCGAGTTTGGAAGCGACTTGGTATAGG
    CCACAAGAAGCGACGGATCAACGACATTTTGAGTGGAATTCACAGAAAGAGCTGGGTGGATTAGGTCATCTGAATTGGAA
    GAATTTGAGCAGTTATGATTTGCGTCACTGTTATAGGCGTATTTTGACTGGTTGATCATGGGGAACCCTTGATCAAGGTT
    GACCAAGAAATGGCTGGTATCCTGTGATAAATTGGAATGCTGATAAAGATTGATGGAATCATTGACGCATGAAAACAGAG
    AAGGAACGCCGACTCTTTCATTTTTCAGCATCATCCCATCGCTGTTGATTATCATACCGAAGTTGCTATTGTCCTGGGAA
    TTTTGCTGCATTATTTCAGTTCCTTGATTAACAAAAGCTCGATATATATTTCCTGAAGGCATCGACGTAGAACTTGGCAA
    ATATGCACTCCATATTTTTGAGGCCGCTTCAGGTGATATGTTTTGGTTGTTGATATTGAGTAGGACACTGTCTGGCATGA
    AAGGGGGAATTCCGTAGCAGTCCTGGTAAGTATATTTCGGTGAGGAAATCCTGTGGGAGTTAATTATATCCATGGAATCG
    TTTTGATTATTGTTATTGTTCCCATCTGTTTCTGGATCTATGCTGAATACCCCTGGTGGATTGTCACCCAATAATGTTTC
    AGATAACAAGCTATCAATCTCGGCTAATCCTGTCATTTTCATGAACTCGACCTTCTTTACCATCAGCTGGGTGACCAATC
    TCAGATCAGGAATTGTCAGCAGCAATTCCCCGAATCTACCCGGCTTGTGGTATTGCTTGTCATTCATGTGGTTCATCAGG
    TCCATTTGTATTTGGTATCGGCATCGTCTCACGAACTCCTTGCCAGACTCGCTGACTCTCGGATCAAAAAATACGATCGC
    TTTCAAACAAGCGAATTCTGCGTCATCCAATTGCAATTCTCGCAGCGGAATGAACAGGTCGTCAAGGATGTGACTGGCTA
    TTTCAGCGAAATGTTTGTCACTGGAGTTCCTACTGATGATAAGATTGTTTCCCAATAATAGCACATCGTCTTCGTCCAAT
    TGAAACGACCGCCTTATTACTCCAAGAATTAGAATTTCTCCCGCGTGTGCTTTTAAAAGGGAAATTTGATCGCTCAAGTT
    TAACTGTGAAAAACAAGGCAAAGACTTTGCCCAATTCACTAGAAGAAATAACTGATTTTTCATGGACTCGCAAACATCAG
    GCACATCGGCATATCTGTTCATGTATTCCTGAGGATTCGGGGGCTTTTGTATTGCAACCCTTTGCTCGGCCTGCATCAAC
    TGAGAAATGGAGAGAATGACATTCGGAGGAATATCATCAAACGACGATCTTCGAGTACTGATCCTATCTCGTTCATTTTG
    AACCGCTGCTCGCTTCATTCCTACAAGAATGCATTTCTTTAGCCGACAATAACGGCATTGGTTTCGTTTATCCTTGTCCA
    TTTTACAATTCCGATTGTACTGGCAAGTGTAGTTATTCTTCTTCCTCACTGACCTCCGAAAAAATCCTTTACAACCGTCA
    CACGAGAAAGCCCCATAATGTTTTCCTGTAGCTTTGTCACTGCAAATGAGACAGAGTTGATTGTTTTCCATTCCTTCTGG
    TCCCGACGCGTTAGACGCATAGACTTCATGTTGTTGCGAGGACACTGAAACGAAAACTATTTGATAATATTTGTACAAAA
    CAACTGACAGATGGTTTCGGAAAAGGTTCAATGTTCAGCCATAGTTCAGCGAAAGGTCAAATTCCTGAACTACTATTTCA
    AGGTATAAATTTGAATATATTGGTTTTGCCTCGTGCTAACAAAGTCCAGAAATATAATAAGCAAAGTCTGAATCGTGTAC
    TTTGGATTTCTAGCCAGGGGCACACAATAACCTATATTTAATAGCAGTTCATTGCGTTCACTCGTTATTTCTCCGACTGA
    ACTGCATTGCAGGAGGATCCGCAACCATGGAGATTTCATAATTATTATCAAAATGATAATAATAATAATTATTATGAGGT
    ATTGTAAAAGAAAACGTAACTCACTTTCACTTTCCAATGGATATTGCATCGAGGAAGCGTTGCTGGAAATGGAAATCGGA
    GCTGAATTGCTAGTCAATAGTTGATAGGAGAATGCTGGATTGAGGTTCGGATGCTGGGTAGACGTCATATAGAATTGGCT
    CGACGGATTCGGTAAAATTATGGTGAAGTTTACAATCGAAGCTCAGATATAACGTATTATAATGAAGTATTATTAATAAA
    CTGCAAGTAACGTGCGCGCATTCTGAAGTGGTTGATTGAGAATAATCAGTTCTTATTCGACAAATTCAGATAAAAAAGGC
    ACCACTCGAATTGTTCAGCTGCGTCATGTGAATGCCGGAACGTTGTGCGTTGGCTGTTGGCAGATCAGCGCTCCGTGTTC
    ACTGCAATCCGGATACACCAGACCACTTGAAATCGTTGCGAATTCAGCGTGTCGAGTGCATTGTGCGAGATCAGTATCGG
    TGTGTATGTGTGTCTGCCTGTGTGCGTGTGGATGTGTGTGCTTGTCGAGTCGGTTGTGTGTTTATGAGTGTAACTGTGTC
    GATTTGGTCGAATGCAGTAGCAGATAGCTGAAATGCGATTGTTCCTATTTTTCATTTAATATTGTTTTATGTTTTGTTTC
    TATTTTTATAATTTAATTTATCAGTTTTTGTTTAGATTATGCAATCATTGTTTAATTTATTTTTGTCAATTTAAAATTTA
    TTATTAATTAAATTATTATAATTATT

     

    back to top