gut

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ In Situ Hybridization Data

  ▻ Sequences

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  gut


DEFINITON:

  The planarian triclad gut contains a central anterior gut branch connected to two posterior gut branches arranged around the pharynx. Secondary gut branches extend laterally from the primary gut branches, while tertiary gut branches extend from the secondary branches. Food and waste enter and exit the gut through the pharynx.


TERM DEFINITION CITATIONS:

  PMID:3490491


TERM CITATIONS:


TERM ID:

  PLANA:0000026


ABOUT THIS TERM:

gut

  ↳is a material entity and organ

  ↳contained in tail, copulatory region, posterior region of the whole animal, parapharyngeal region, prepharyngeal region, head, dorsal region of the whole animal and anterior region of the whole animal

  ↳develops from gamma neoblast

  ↳existence overlaps Stage 6, juvenile, Stage 5, asexual adult, adult hermaphrodite, Stage 8 and Stage 7

  ↳existence starts during or after Stage 5

  ↳part of digestive system


Expand to see terms that part of gut


BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30007290AFF18488.1GATA456gata456aStage 2, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, gut, digestive system, gamma neoblast, embryonic pharynx
SMED30005748AFF18489.1HNF4hnf-4Stage 2, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, gut, digestive system, gamma neoblast, embryonic pharynx
SMED30025591ABW97518.1porcupine-like proteinporcn-AStage 5, Stage 6, Stage 7, Stage 8gut, digestive system
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30025591 ID=SMED30025591|Name=porcupine-like protein|organism=Schmidtea mediterranea sexual|type=transcript|length=3526bp
TTCCGATCTTTTCTTTTGAAATTTTTGAAATTTTAAATAAAATTAATGACAAAGGCAGAAAATCAGAGAACTACTAAAGC
ATCCGACTTCAAATTTGGAAAAGAAATCGGCCATGGCTCGTTCTCAACTGTAATGATAGCTAAGGAAATTTCTACCAATA
AACATTATGCTGCAAAAATTATTGATAAAGTTTTTATTTCTAAACAGCGAATGGTTAATACTGTTATGATTGAAAAAGAA
GTTCTCCGAAGAATAAATCACCAGTTTTTTGTATGTCTCAATTATACATTCCAAGATCCAGAGAGATTGTATTTTATTAT
ATCATATGCCGAACGAGGAGAACTTTTATCTCATTTAACAAGACTTTCGTGTTTTGATTTAACGTGCACACAATTTTATT
CCGCGGAAATTATTCTTGCATTAGAATATTTACATGGAATTAACGTTGTTCATCGAGATATAAAACCAGAAAATATTTTA
CTGAGTGAAAATATGCATATAAAAATTTGTGATTTTGGCAGTGCAATTATTATCGATAAACCAGATCTCAAGCCTTCTTC
TTTTACAGGTACAGCTCAATTCGTTTCTCCAGAAATGCTGGGATTCAGTAAAGAAACACGTGACAATAGCTATTCAGATG
AACCGAATTCTGATTCAGAGGAACATAGCGAAATTGAAGTTAAACGAACTAGTTCACCTGATAATTCTAGGGAAATATTA
TATCTAATGGACTTCTGGGCATTAGGATGCATCGTCTATCAAATGTTGTCTGGACGAATGCCATTTCACGTCAGGCATTC
ACGGCATGAATATGAAATTTTCCAAAAGATCCGAAATTTAAAATATGAGTTTCCGGTTGGGTTTGATGATACTGCTAAAG
ATTTTGTCTCTAAACTTCTTGTATTGAATCCACTGGAAAGATTAGGCAATCCATCCGATGGAAAGCACGCTGCTTTAAAA
GCCCACCCCCTTTTCCGTTCAATTGATTTCGAAATTATCGGATCACAAAAACCTCCGCTATTACTTCCAAATATTGAGCC
CATTGTTCAAAGTAATTGGGACGAAATTCCTGTTGGTTTTGAAGAAGCATGGAAATTCAATATCAAAAAAGAGTTTCAAG
AAATGGAAAAAGCCGATAAACAAAAATTATTGCAAAACCAAGAAAAACTAAATCCGTTTCATAGATTTGTACGCAATCGA
TTGATCATAAAACAAGGCATCTTGTACAAACGGCGTGGATTATTTACTCGTAAAAGAATGTTTCTATTAACTGAAGGACC
TCATTTATTTTATGTCGACCCCGATGCTATGCAATTTAAAAAAGAAGTCAGTCTAAACTTAATTACTGGCATAGAAGTAA
AAAATGACAAAGTATTTTATATCGTTACTAAAAGGCGAACATATTTTCTCGAAGATCCTTCAGCAAAGGCTGATGAATGG
CGACAGAGTATTGAATCGATTTGTGTAGAATATTATGGATCATTTAAATTATCCCCTGGCACTTGCACTCAAACGCCTCT
AGTTACATCATCTGAATCATAACTTTCGGTTTTATTTAAATTTATTTGTCATATAGAAAAAAATGTGAATTTAACGGTTT
TTAATATAATAATTTAATATTGGTTTGAATTCTTGTTTTTCATTTTAAAATTTAATGGATATAATTTAAATATTTTAATA
AATAAAAATATTCACATTGTTTTAATATTCTCTTTATGTCGTAATTGATAAATGATGCATTGTAAATGTATTTTACAACT
GATCTAAATGAAACCAATAGGAAACGAGTGGTTCGATGTCATGTGAATCAGCATGCAACCAATCATAGTTTTGTGATTCA
TTAAATATATTTTAAATTTTTAAAACAAATTAAATCACTTAATTAATTTTTAGACAATGTCACAATTTTATGGCGGATCC
ACGATATTGGCACCTCTATCGAACGTTATGGGTATACCAGTGGATCAAATTAATTTTATTGTGTGTAGTTTATTGTCAAT
CGGACTGGGTCAAATTATGCGACACAAATTCCCTCCTTCTAAATTGTCAGGAAGTACAAGAGGAATCATAGAAGCATTTT
TTGGAATACTAATTGTTCTTTTCTGCTTCGGATACCAAGTCAAGTATTTGTTACTACAATCAACAGTTTCCTATGTAATA
CTATTATTTTTGCCTTCACAAATATCAGCGCATTTGGTAACGTATTGGTGTATGGCTTTCATGGCGATAGTCCATTTATA
CAGGATGCATTACGATTACGGAGGTTATACTCTCGATATATCTGGTCCGGTTATGATTCAAACCCAAAAATTGACCAGCC
TCGCATTTAATCTTCTAGATGGACATCGAATAAATCAAGGAATAAAACTGCAACAGAGAAATCATGAATCTCACGCTGTG
AAAAAACTACCAGATGCAATCAAGTTTTTCGGTTACACATTCTACTTTCATGGTGTATTAGCGGGTCCTTTTGTATTCTA
CAATGAATATAAAGAATATATCACTGGATATGACGACAAGCATATTCCATGCTCCAAAAAGCAATTATCTTCAGCACTTT
GTTTATCAGTGATCCATGGATTATTAACAGCATATGTCGCACCGCAGTTTCCATATATATTTGTTTGCAGCACCGATTAC
CAACGGATGCATATGACTCGTAGAATAATGTTCACAATGATTTCATTTTTCCTCGTAAGACAAAAGTATTACTTTGCCTG
GTCAATGGTTGAAGCTGGTGCTCTTAGTACCGGATTGGGATATTGTGGAAAGGATAAAAACGGAGAGAATAATTGGTCGA
AAGTGAAAAATTACGATTTCATGGCAATCGAAAGCGGCAGTAGTTTGAAAGTGCTAGTGGACGGATGGAATATTTCCACA
ACAAGATGGCTCAGAGAATTAATTTATGAACGAGCTCCTTTATTCTGTCGGACAATTCTAGTTTTCACCGTCAGTGCATT
TTGGCATGGATTCTATCCTGGATATTATTTGATGTTTTTGACATTTTCTCTCTTTACGTTTTGCGCTAGAACCGTTAGGA
AACACATTCGACCATTGTTCATTGTCAGTCCAATTACACTTCAACTCTATCATGTTCTAACGAAAATATTCACAAATCTG
GCTTTAAATTACGGACAAGGACCATTTTATTTGCTGGAGTTTCAATCGGGACTTTTGTTTTGGAAGCCATATTACTTTTT
CGGACACGTTCTAGCAATGTTCTGCGTATTGACCTTGCAATTTCGGCCGATAATCAACGACAAAGTCAACATAATGAACA
ATGTTTTCACCAGAAAAGCCCAATATCGGTTTCAGAAACTAAAGATCCATTTGCAGAAAAAGTTGAGATGAAATTTTATT
GATTTTGATAATTTATATAAAATATTATAATTTTGTTTTTCGTTTTATTTTTATATCGATGAATTTATGATAAATGCTAA
ATATTCGATCCGGAATGAATTATTATTAATCTGGTTTTTATAATTGTTCATTTTTAATAGTTTTGTTTGTTTTTCGAAAA
TGGCGG
>SMED30007290 ID=SMED30007290|Name=GATA456|organism=Schmidtea mediterranea sexual|type=transcript|length=2033bp
AGGTAAGTGTCGTCATCACAAGTGGCTTTATTATTATCATTTAAATTTTTTATCATATTATCATTGATTGCTTGTTTTCC
TCATTCAAAATTTAACTGATTGTTATCAAGCTCATTTGATAACTCCAAATCTAATTGACACTCATGTAAATATCCCATTC
GAATTTCCGTTCCCGTCCGTAAGATCCACGATCCGACAATGTTTCTCCCATCGGTATTGTCGAATTCTCACCAGAGAAAC
TCACCAATAATGGACATTGTATCACCAAAATCCAACACCAGCAATCTGAATGCGTTGATCACGTATTCGAATTGTCCCAA
CATAGATCTACAGTCGAATGATCTGTCAGTGAACTTGACGAATTCTCAAAACTTCCACGAATTGGATCACAAAACCAATT
ACGGATACAAAGTTTCAAACAACGAGACAAAACTGAATGCTTTTCCATATTTAGCTCAATCGAACTTAACAGATTGCACA
ACAGACATCAGTGGAGATCTGAAAAATCCAAATTCACATCTCAACTATGGAAACGGAATTTCGTTCTCGGAATTTTCGAA
AATGTCCGAAACCAACATCCACGGATATCCGCCATATTGTTTCTCCACTAAACTGTTTCCCATTCCAAATCTACAAGAGA
AATCAATTATCAACGACAACTATTCCGTGAAATCCACCGCCGGAGGCTTTATCACCGAATCGAATGAGCATCAAAACTCT
GTAAATACTGGAAATTCCTACAATTCCAATTTAAGCTCATACAGAACGGTAATTCCCGCTCATTTTCATCTCTTCAATCA
GAATTCACCAGAATCGAACTCGTTTTACAATACGGCTTGGAACAACTATCCGTTTCAAATATCCCCAACTTATCCCATAC
AAAATCTACCGGATTCAACAATCAACTGGACAACAAACAATCAAATTCCAAGCAGCAATTTAGTTTTTGATCCCTGGAGC
TGTAAATCAAATCTTAATCTTCCTCCGATTAATGAATTCGGTTCCAATTGCGATGTCAGCAGAGAGTGTGTGAACTGTGG
AGCTAGCAATACTCAGTTGTGGTCCCGGGATAATTCTGGCTATTATTTGTGTGATGAATGCGACAGGTTCTCTCAAAACA
ACAGTAGAAACCTCGAAAAACTACCAACGAATCAAGTCTCATCAAGTACCGAAAATGAGTTCATGAAAAAATCCAATGCC
AACTTTCAACAATATGGAAAAAGATCCGACCTCGAATGCAGCAATTGTAAAATTACCAAGACTTCTTTATGGAGAAGAAA
CAACGAAGGAGAACCTGTCTGCAATGCTTGCGGCTTGTATTATAAATTACATAAGTCTCTAAGACCTCTTTCAATGAGGA
AAGAAGGAATACAAACAAGGAAAAGAAAACGGAAAACACAAATGAAACCGGTTTCCACTCATATTGCCAATAATCAAAAG
GTGCCGTCTTCAGAATCGTCATCAGAACAAAATCAGTTTATAAACACTGTGAAATCAAGTGAAAATTGCTATAACATGAT
TTCTGAAAATTCTCCAACATATATGCCAAATATATCAGTCCAGCCCTTCAATCACATTCTGAACTCCAGCCAATATCAAT
TCCAATCTACAGAAAATCCCATTAATCAATCATATTTAAATTCCTCAATCAAAAACAGCAATCCCTTTTACGATTCCGAA
AGTATACTTTATTCCTACAACAATTCAAACAAAATCAAAGATGAGCCCCTATTATCCATGGACAACGAACCGAAGCCCTA
TTCCTCAATCAACGAGAAAATTGACGTCAACTCCATAGTGAGAATTAATGAAATCTCAAACAATTCGAATTCGAGTTAAT
TATTCTGATCTACTTTTTAATTATATATTTAAGAACCGTATATACTTCGAAATATAATTTTAATGATAAAATTTTATATC
TAAAAAATGTAATTTTTAAGTGCGAATTATTAAGTATGCATTTAAATAGTGCAATTATTGTGGTAGTTATTTTTATTACT
AAATAAATGTTGTTTGTAAATTCGAGAATTTGT
>SMED30005748 ID=SMED30005748|Name=HNF4|organism=Schmidtea mediterranea sexual|type=transcript|length=3066bp
GAAGAATAACAAAGAAATTTATTGCCAAACTAAAATACCCGGCCTATTTCATCAAAAAAAAAACAATCAAAAACACAAAT
CGCTACGAAAACTTGTATAAAAGATTCACATTAAAAGTCATCAATATTCCTCTTTTTTAAAGACTGATGATTCAGATTCT
TGGATCCGAATGGGGTGATCTGTTAGGAAGTGAGCTGTTGACGAGATAGCTGAATAGTTTGATCTGGAATTGTGCTGTTG
GTTCGCTTCCGATGATCTGTTGGCGATTGATTGAATTTGGCAGTTTTCTATCGGCGAGTTTGGAAGCGACTTGGTATAGG
CCACAAGAAGCGACGGATCAACGACATTTTGAGTGGAATTCACAGAAAGAGCTGGGTGGATTAGGTCATCTGAATTGGAA
GAATTTGAGCAGTTATGATTTGCGTCACTGTTATAGGCGTATTTTGACTGGTTGATCATGGGGAACCCTTGATCAAGGTT
GACCAAGAAATGGCTGGTATCCTGTGATAAATTGGAATGCTGATAAAGATTGATGGAATCATTGACGCATGAAAACAGAG
AAGGAACGCCGACTCTTTCATTTTTCAGCATCATCCCATCGCTGTTGATTATCATACCGAAGTTGCTATTGTCCTGGGAA
TTTTGCTGCATTATTTCAGTTCCTTGATTAACAAAAGCTCGATATATATTTCCTGAAGGCATCGACGTAGAACTTGGCAA
ATATGCACTCCATATTTTTGAGGCCGCTTCAGGTGATATGTTTTGGTTGTTGATATTGAGTAGGACACTGTCTGGCATGA
AAGGGGGAATTCCGTAGCAGTCCTGGTAAGTATATTTCGGTGAGGAAATCCTGTGGGAGTTAATTATATCCATGGAATCG
TTTTGATTATTGTTATTGTTCCCATCTGTTTCTGGATCTATGCTGAATACCCCTGGTGGATTGTCACCCAATAATGTTTC
AGATAACAAGCTATCAATCTCGGCTAATCCTGTCATTTTCATGAACTCGACCTTCTTTACCATCAGCTGGGTGACCAATC
TCAGATCAGGAATTGTCAGCAGCAATTCCCCGAATCTACCCGGCTTGTGGTATTGCTTGTCATTCATGTGGTTCATCAGG
TCCATTTGTATTTGGTATCGGCATCGTCTCACGAACTCCTTGCCAGACTCGCTGACTCTCGGATCAAAAAATACGATCGC
TTTCAAACAAGCGAATTCTGCGTCATCCAATTGCAATTCTCGCAGCGGAATGAACAGGTCGTCAAGGATGTGACTGGCTA
TTTCAGCGAAATGTTTGTCACTGGAGTTCCTACTGATGATAAGATTGTTTCCCAATAATAGCACATCGTCTTCGTCCAAT
TGAAACGACCGCCTTATTACTCCAAGAATTAGAATTTCTCCCGCGTGTGCTTTTAAAAGGGAAATTTGATCGCTCAAGTT
TAACTGTGAAAAACAAGGCAAAGACTTTGCCCAATTCACTAGAAGAAATAACTGATTTTTCATGGACTCGCAAACATCAG
GCACATCGGCATATCTGTTCATGTATTCCTGAGGATTCGGGGGCTTTTGTATTGCAACCCTTTGCTCGGCCTGCATCAAC
TGAGAAATGGAGAGAATGACATTCGGAGGAATATCATCAAACGACGATCTTCGAGTACTGATCCTATCTCGTTCATTTTG
AACCGCTGCTCGCTTCATTCCTACAAGAATGCATTTCTTTAGCCGACAATAACGGCATTGGTTTCGTTTATCCTTGTCCA
TTTTACAATTCCGATTGTACTGGCAAGTGTAGTTATTCTTCTTCCTCACTGACCTCCGAAAAAATCCTTTACAACCGTCA
CACGAGAAAGCCCCATAATGTTTTCCTGTAGCTTTGTCACTGCAAATGAGACAGAGTTGATTGTTTTCCATTCCTTCTGG
TCCCGACGCGTTAGACGCATAGACTTCATGTTGTTGCGAGGACACTGAAACGAAAACTATTTGATAATATTTGTACAAAA
CAACTGACAGATGGTTTCGGAAAAGGTTCAATGTTCAGCCATAGTTCAGCGAAAGGTCAAATTCCTGAACTACTATTTCA
AGGTATAAATTTGAATATATTGGTTTTGCCTCGTGCTAACAAAGTCCAGAAATATAATAAGCAAAGTCTGAATCGTGTAC
TTTGGATTTCTAGCCAGGGGCACACAATAACCTATATTTAATAGCAGTTCATTGCGTTCACTCGTTATTTCTCCGACTGA
ACTGCATTGCAGGAGGATCCGCAACCATGGAGATTTCATAATTATTATCAAAATGATAATAATAATAATTATTATGAGGT
ATTGTAAAAGAAAACGTAACTCACTTTCACTTTCCAATGGATATTGCATCGAGGAAGCGTTGCTGGAAATGGAAATCGGA
GCTGAATTGCTAGTCAATAGTTGATAGGAGAATGCTGGATTGAGGTTCGGATGCTGGGTAGACGTCATATAGAATTGGCT
CGACGGATTCGGTAAAATTATGGTGAAGTTTACAATCGAAGCTCAGATATAACGTATTATAATGAAGTATTATTAATAAA
CTGCAAGTAACGTGCGCGCATTCTGAAGTGGTTGATTGAGAATAATCAGTTCTTATTCGACAAATTCAGATAAAAAAGGC
ACCACTCGAATTGTTCAGCTGCGTCATGTGAATGCCGGAACGTTGTGCGTTGGCTGTTGGCAGATCAGCGCTCCGTGTTC
ACTGCAATCCGGATACACCAGACCACTTGAAATCGTTGCGAATTCAGCGTGTCGAGTGCATTGTGCGAGATCAGTATCGG
TGTGTATGTGTGTCTGCCTGTGTGCGTGTGGATGTGTGTGCTTGTCGAGTCGGTTGTGTGTTTATGAGTGTAACTGTGTC
GATTTGGTCGAATGCAGTAGCAGATAGCTGAAATGCGATTGTTCCTATTTTTCATTTAATATTGTTTTATGTTTTGTTTC
TATTTTTATAATTTAATTTATCAGTTTTTGTTTAGATTATGCAATCATTGTTTAATTTATTTTTGTCAATTTAAAATTTA
TTATTAATTAAATTATTATAATTATT

 

back to top





PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in gut. Click this link to learn more about PAGE.


PAGE Curations: 3008


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
gutSMED30008091Serine/threonine-protein kinase PLKSMESG000012131.1 SMESG000012127.1 Contig809GPL15192PMID:23079596
gutSMED30008091Serine/threonine-protein kinase PLKSMESG000027686.1 Contig2364GPL15192PMID:23079596
gutSMED30008091Serine/threonine-protein kinase PLKSMESG000012131.1 SMESG000012127.1 Contig2364GPL15192PMID:23079596
gutSMED30007290GATA456SMESG000039559.1 SMESG000037031.1 dd_Smed_v4_4075_0_1dd_Smed_v4PMID:29674431
gutSMED30007290GATA456SMESG000039559.1 SMESG000037031.1 JF802198.1smed_ncbi_20200123PMID:21566185
gutSMED30007290GATA456SMESG000039559.1 SMESG000037031.1 JF802198.1smed_ncbi_20200123PMID:28072387
gutSMED30007290GATA456SMESG000039559.1 SMESG000037031.1 JF802198.1smed_ncbi_20200123PMID:25254346
gutSMED30007290GATA456SMESG000039559.1 SMESG000037031.1 JF802198.1smed_ncbi_20200123PMID:28072387
gutSMED30007290GATA456SMESG000039559.1 SMESG000037031.1 JF802198.1smed_ncbi_20200123PMID:28072387
gutSMED30007290GATA456SMESG000039559.1 SMESG000037031.1 JF802198.1smed_ncbi_20200123PMID:28072387
gutSMED30007290GATA456SMESG000039559.1 SMESG000037031.1 AFF18488.1smed_ncbi_20200123PMID:28072387
gutSMED30007290GATA456SMESG000039559.1 SMESG000037031.1 AFF18488.1smed_ncbi_20200123PMID:28072387
gutSMED30007290GATA456SMESG000039559.1 SMESG000037031.1 AFF18488.1smed_ncbi_20200123PMID:28072387
gutSMED30007290GATA456SMESG000039559.1 SMESG000037031.1 AFF18488.1smed_ncbi_20200123PMID:28072387
gutSMED30007290GATA456SMESG000039559.1 SMESG000037031.1 SMED30007290smed_20140614PMID:28072387
gutSMED30007290GATA456SMESG000039559.1 SMESG000037031.1 SMED30007290smed_20140614PMID:28072387
gutSMED30007290GATA456SMESG000039559.1 SMESG000037031.1 SMED30007290smed_20140614PMID:28072387
gutSMED30007290GATA456SMESG000039559.1 SMESG000037031.1 SMED30007290smed_20140614PMID:28072387
gutSMED30007290GATA456SMESG000039559.1 SMESG000037031.1 JF802198smed_ncbi_20200123PMID:27542689
gutSMED30007290GATA456SMESG000039559.1 SMESG000037031.1 JF802198smed_ncbi_20200123PMID:21566185
gutSMED30001723HTH CENPB-type domain-containing proteinSMESG000049778.1 SMESG000048378.1 SMESG000039423.1 SMESG000039024.1 SMESG000024543.1 SMESG000022136.1 SMESG000002434.1 JF894290.2smed_ncbi_20200123PMID:22451003
gutSMED30001723HTH CENPB-type domain-containing proteinSMESG000049778.1 SMESG000048378.1 SMESG000039423.1 SMESG000039024.1 SMESG000024543.1 SMESG000022136.1 SMESG000002434.1 JF894290.2smed_ncbi_20200123PMID:22451003
gutSMED30004408noggin-like protein 5SMESG000034704.1 SMESG000007405.1 FJ471487.1smed_ncbi_20200123PMID:19174194
gutSMED3000317640S ribosomal protein S2SMESG000051503.1 dd_Smed_v4_226_0_1dd_Smed_v4PMID:29674431
gutSMED30012356SMED30012356SMESG000035312.1 SMESG000035313.1 dd_131dd_Smed_v4PMID:29674431
gutSMED30012356SMED30012356SMESG000035312.1 SMESG000035313.1 dd_131dd_Smed_v4PMID:29674431
gutSMED30004416SMED30004416SMESG000067412.1 Contig1164newmark_estsPMID:23079596
gutSMED30004416SMED30004416SMESG000067412.1 Contig1164uc_Smed_v2PMID:23079596
gutSMED30004416SMED30004416SMESG000060394.1 Contig1164newmark_estsPMID:23079596
gutSMED30004416SMED30004416SMESG000060394.1 Contig1164uc_Smed_v2PMID:23079596
gutSMED30008321SMED30008321SMESG000068172.1 Contig3306newmark_estsPMID:23079596
gutSMED30008321SMED30008321SMESG000068172.1 Contig3306uc_Smed_v2PMID:23079596
gutSMED30008321SMED30008321SMESG000025870.1 Contig3306newmark_estsPMID:23079596
gutSMED30008321SMED30008321SMESG000025870.1 Contig3306uc_Smed_v2PMID:23079596
gutSMED30013503Tpd52 like 1SMESG000013104.1 Contig988GPL15192PMID:23079596
gutSMED3000236940S ribosomal protein S17SMESG000037102.1 dd_Smed_v4_195_0_1dd_Smed_v4PMID:29674431
gutSMED30006714SMED30006714SMESG000001790.1 dd_Smed_v4_212_0_1dd_Smed_v4PMID:29674431
gutSMED30015413ras-related protein Rab-28-likeSMESG000007739.1 SMESG000007738.1 dd_Smed_v4_375_0_1dd_Smed_v4PMID:29674431
gutSMED30001810Protein NDRG3SMESG000005122.1 dd_Smed_v4_3896_0_1dd_Smed_v4PMID:29674431
gutSMED30031080KH domain-containing proteinSMESG000004103.1 DN294844ncbi_smed_estsPMID:16344473
gutSMED30031080KH domain-containing proteinSMESG000004103.1 SMED30031080smed_20140614PMID:26457503
gutSMED30033476Zinc finger protein, putativeSMESG000068172.1 Contig3306GPL15192PMID:23079596
gutSMED30033476Zinc finger protein, putativeSMESG000025870.1 Contig3306GPL15192PMID:23079596
gutSMED30033476Zinc finger protein, putativeSMESG000025870.1 dd_Smed_v4_3821_0_1dd_Smed_v4PMID:29674431
gutSMED30033476Zinc finger protein, putativeSMESG000025870.1 SMED30033476smed_20140614PMID:26457503
gutSMED30011793Homeobox protein DTH-1SMESG000028338.1 Contig5669GPL15192PMID:23079596
gutSMED30011793Homeobox protein DTH-1SMESG000079512.1 Contig5669GPL15192PMID:23079596
gutSMED30011793Homeobox protein DTH-1SMESG000079512.1 dd_Smed_v4_2716_0_1dd_Smed_v4PMID:29674431
gutSMED30011793Homeobox protein DTH-1SMESG000079512.1 SMED30011793smed_20140614PMID:26457503
gutSMED30011250Granulin precursorSMESG000060269.1 Contig2381GPL15192PMID:23079596
gutSMED30011250Granulin precursorSMESG000029882.1 Contig2381GPL15192PMID:23079596
gutSMED30011250Granulin precursorSMESG000029882.1 dd_Smed_v4_442_0_1dd_Smed_v4PMID:29674431
gutSMED30002332TNF receptor associated factor-2SMESG000070267.1 Contig1736GPL15192PMID:23079596
gutSMED30002332TNF receptor associated factor-2SMESG000070267.1 dd_Smed_v4_2599_0_1dd_Smed_v4PMID:29674431
gutSMED30009611Str_synth domain-containing proteinSMESG000052600.1 Contig1622GPL15192PMID:23079596
gutSMED30009611Str_synth domain-containing proteinSMESG000052600.1 dd_Smed_v4_1480_0_1dd_Smed_v4PMID:29674431
gutSMED30000758SMED30000758SMESG000050509.1 dd_Smed_v4_1451_0_1dd_Smed_v4PMID:29674431
gutSMED30000758SMED30000758SMESG000050509.1 Contig1785GPL15192PMID:23079596
gutSMED30004948Lysosomal Pro-X carboxypeptidaseSMESG000074424.1 Contig1592GPL15192PMID:23079596
gutSMED30004948Lysosomal Pro-X carboxypeptidaseSMESG000074424.1 dd_Smed_v4_1351_0_1dd_Smed_v4PMID:29674431
gutSMED30007326otxASMESG000006246.1 Contig3291newmark_estsPMID:23079596
gutSMED30008756SMED30008756SMESG000007049.1 Contig3743newmark_estsPMID:23079596
gutSMED30008756SMED30008756SMESG000007049.1 Contig3743uc_Smed_v2PMID:23079596
gutSMED30008756SMED30008756SMESG000074654.1 Contig3743newmark_estsPMID:23079596
gutSMED30008756SMED30008756SMESG000074654.1 Contig3743uc_Smed_v2PMID:23079596
gutSMED30001294Phosphatidylinositol-binding clathrin assembly proteinSMESG000072544.1 dd_Smed_v4_1463_0_1dd_Smed_v4PMID:29674431
gutSMED30001294Phosphatidylinositol-binding clathrin assembly proteinSMESG000043423.1 Contig1792GPL15192PMID:23079596
gutSMED30001294Phosphatidylinositol-binding clathrin assembly proteinSMESG000072544.1 Contig1792GPL15192PMID:23079596
gutSMED30004606Cytochrome P450 2K1-like proteinSMESG000020470.1 Contig1680GPL15192PMID:23079596
gutSMED30004606Cytochrome P450 2K1-like proteinSMESG000020470.1 SMED30004606smed_20140614PMID:26457503
gutSMED30003215SMED30003215SMESG000057441.1 Contig2269newmark_estsPMID:23079596
gutSMED30011213Osteoclast-stimulating factor 1SMESG000004952.1 Contig516GPL15192PMID:23079596
gutSMED30011213Osteoclast-stimulating factor 1SMESG000004952.1 SMESG000004951.1 dd_Smed_v4_2235_0_1dd_Smed_v4PMID:29674431
gutSMED30001710Vacuolar protein sorting 4SMESG000049145.1 Contig1087GPL15192PMID:23079596
gutSMED30001710Vacuolar protein sorting 4SMESG000075482.1 Contig1087GPL15192PMID:23079596
gutSMED30001710Vacuolar protein sorting 4SMESG000075482.1 dd_Smed_v4_1556_0_1dd_Smed_v4PMID:29674431
gutSMED30001630Ras-related C3 botulinum toxin substrate 1SMESG000005612.1 Contig594newmark_estsPMID:23079596
gutSMED30001630Ras-related C3 botulinum toxin substrate 1SMESG000005612.1 Contig594uc_Smed_v2PMID:23079596
gutSMED30001630Ras-related C3 botulinum toxin substrate 1SMESG000011575.1 Contig594newmark_estsPMID:23079596
gutSMED30001630Ras-related C3 botulinum toxin substrate 1SMESG000011575.1 Contig594uc_Smed_v2PMID:23079596
gutSMED30001630Ras-related C3 botulinum toxin substrate 1SMESG000024968.1 Contig2195GPL15192PMID:23079596
gutSMED30001630Ras-related C3 botulinum toxin substrate 1SMESG000024968.1 Contig5264GPL15192PMID:23079596
gutSMED30001630Ras-related C3 botulinum toxin substrate 1SMESG000024968.1 SMESG000005612.1 dd_Smed_v4_1050_0_1dd_Smed_v4PMID:29674431
gutSMED30015345TropomyosinSMESG000066854.1 Contig3688newmark_estsPMID:23079596
gutSMED30015345TropomyosinSMESG000066854.1 Contig3688uc_Smed_v2PMID:23079596
gutSMED30015345TropomyosinSMESG000026500.1 Contig3688newmark_estsPMID:23079596
gutSMED30015345TropomyosinSMESG000026500.1 Contig3688uc_Smed_v2PMID:23079596
gutSMED30033686TNF receptor associated factor-2SMESG000027283.1 Contig1753GPL15192PMID:23079596
gutSMED30033686TNF receptor associated factor-2SMESG000027283.1 dd_Smed_v4_6768_0_1dd_Smed_v4PMID:29674431
gutSMED30033686TNF receptor associated factor-2SMESG000027283.1 SMED30033686smed_20140614PMID:26457503
gutSMED30027929Tubulin beta chainSMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044907.1 SMESG000044888.1 SMESG000035804.1 SMESG000035755.1 Contig2059GPL15192PMID:23079596
gutSMED30000038Ribosome-binding protein 1SMESG000031975.1 dd_Smed_v4_1111_0_1dd_Smed_v4PMID:29674431
gutSMED3000905260S ribosomal protein L18SMESG000017166.1 dd_Smed_v4_128_0_1dd_Smed_v4PMID:29674431
gutSMED30009119Ankyrin-2SMESG000058557.1 dd_Smed_v4_1432_0_1dd_Smed_v4PMID:29674431
gutSMED30002600ATPase_AAA_core domain-containing proteinSMESG000072345.1 Contig4452newmark_estsPMID:23079596
gutSMED30002600ATPase_AAA_core domain-containing proteinSMESG000072345.1 Contig4452uc_Smed_v2PMID:23079596
gutSMED30002600ATPase_AAA_core domain-containing proteinSMESG000035457.1 Contig4452newmark_estsPMID:23079596
gutSMED30002600ATPase_AAA_core domain-containing proteinSMESG000035457.1 Contig4452uc_Smed_v2PMID:23079596
gutSMED30002600ATPase_AAA_core domain-containing proteinSMESG000077685.1 SMESG000072345.1 dd_Smed_v4_11466_0_1dd_Smed_v4PMID:29674431
gutSMED30002592NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 3SMESG000016331.1 dd_Smed_v4_1078_1_1dd_Smed_v4PMID:29674431
gutSMED30007241SMED30007241SMESG000077709.1 SMESG000073947.1 SMESG000043656.1 SMESG000043279.1 SMESG000008519.1 SMESG000001897.1 Contig22newmark_estsPMID:23079596
gutSMED30007241SMED30007241SMESG000013795.1 Contig22newmark_estsPMID:23079596
gutSMED3000985940S ribosomal protein S24SMESG000035929.1 dd_Smed_v4_164_0_1dd_Smed_v4PMID:29674431
gutSMED30004903Cytochrome b-c1 complex subunit 2, mitochondrialSMESG000064836.1 dd_Smed_v4_1004_0_1dd_Smed_v4PMID:29674431
gutSMED30005872NeurotrypsinSMESG000016089.1 dd_Smed_v4_1926_0_1dd_Smed_v4PMID:29674431
gutSMED30005872NeurotrypsinSMESG000016089.1 dd_Smed_v4_1926_0_1dd_Smed_v4PMID:30962434
gutSMED30007755LIM and SH3 domain protein 1SMESG000002154.1 dd_Smed_v4_1218_0_1dd_Smed_v4PMID:29674431
gutSMED30001027Cathepsin LSMESG000054075.1 SMESG000034294.1 Contig1264newmark_estsPMID:23079596
gutSMED30001027Cathepsin LSMESG000054075.1 SMESG000034294.1 Contig1264uc_Smed_v2PMID:23079596
gutSMED30001027Cathepsin LSMESG000065264.1 SMESG000065255.1 Contig1264newmark_estsPMID:23079596
gutSMED30001027Cathepsin LSMESG000065264.1 SMESG000065255.1 Contig1264uc_Smed_v2PMID:23079596
gutSMED30035887TNF receptor associated factor-2SMESG000020851.1 Contig1182GPL15192PMID:23079596
gutSMED30021063SMED30021063SMESG000025889.1 dd_Smed_v4_17_0_1dd_Smed_v4PMID:29674431
gutSMED30023874Aminoacylase-1SMESG000028017.1 dd_Smed_v4_1519_0_1dd_Smed_v4PMID:29674431
gutSMED30020797Pogo transposable element with KRABSMESG000055793.1 dd_Smed_v4_5462_0_1dd_Smed_v4PMID:29674431
gutSMED30020797Pogo transposable element with KRABSMESG000055793.1 SMED30020797smed_20140614PMID:26457503
gutSMED30030204SMED30030204SMESG000018900.1 dd_Smed_v4_10059_0_1dd_Smed_v4PMID:29674431
gutSMED30027034Aminotran_5 domain-containing proteinSMESG000033958.1 Contig1720GPL15192PMID:23079596
gutSMED30027034Aminotran_5 domain-containing proteinSMESG000033958.1 dd_Smed_v4_6547_0_1dd_Smed_v4PMID:29674431
gutSMED30027034Aminotran_5 domain-containing proteinSMESG000033958.1 SMED30027034smed_20140614PMID:26457503
gutSMED30005748HNF4SMESG000014588.1 JF802199.1smed_ncbi_20200123PMID:21566185
gutSMED30005748HNF4SMESG000014588.1 JF802199.1smed_ncbi_20200123PMID:28072387
gutSMED30005748HNF4SMESG000014588.1 JF802199.1smed_ncbi_20200123PMID:28072387
gutSMED30005748HNF4SMESG000014588.1 JF802199.1smed_ncbi_20200123PMID:28072387
gutSMED30005748HNF4SMESG000014588.1 JF802199.1smed_ncbi_20200123PMID:28072387
gutSMED30005748HNF4SMESG000014588.1 dd_Smed_v4_1694_0_1dd_Smed_v4PMID:29674431
gutSMED30005748HNF4SMESG000014588.1 AFF18489.1smed_ncbi_20200123PMID:28072387
gutSMED30005748HNF4SMESG000014588.1 AFF18489.1smed_ncbi_20200123PMID:28072387
gutSMED30005748HNF4SMESG000014588.1 AFF18489.1smed_ncbi_20200123PMID:28072387
gutSMED30005748HNF4SMESG000014588.1 AFF18489.1smed_ncbi_20200123PMID:28072387
gutSMED30005748HNF4SMESG000014588.1 JF802199smed_ncbi_20200123PMID:21566185
gutSMED30005748HNF4SMESG000014588.1 SMED30005748smed_20140614PMID:28072387
gutSMED30005748HNF4SMESG000014588.1 SMED30005748smed_20140614PMID:28072387
gutSMED30005748HNF4SMESG000014588.1 SMED30005748smed_20140614PMID:28072387
gutSMED30005748HNF4SMESG000014588.1 SMED30005748smed_20140614PMID:28072387
gutSMED30005748HNF4SMESG000014588.1 hnf4smed_ncbi_20200123PMID:25254346
gutSMED30005863DUF3421 domain-containing proteinSMESG000074396.1 SMESG000074378.1 dd_Smed_v4_11_0_1dd_Smed_v4PMID:29674431
gutSMED30003360LipaseSMESG000002840.1 dd_Smed_v4_1565_0_1dd_Smed_v4PMID:29674431
gutSMED30005457SMED30005457SMESG000035312.1 dd_Smed_v4_131_0_1dd_Smed_v4PMID:29674431
gutSMED30005457SMED30005457SMESG000035312.1 SMESG000035313.1 dd_131dd_Smed_v4PMID:29674431
gutSMED30005457SMED30005457SMESG000035312.1 SMESG000035313.1 dd_131dd_Smed_v4PMID:29674431
gutSMED30009858Polyadenylate-binding proteinSMESG000044671.1 SMED30009858smed_20140614PMID:28807897
gutSMED30009858Polyadenylate-binding proteinSMESG000044671.1 SMED30009858smed_20140614PMID:28807897
gutSMED30001652SMED30001652SMESG000052698.1 SMESG000027142.1 SMESG000059994.1 dd_Smed_v4_1029_1_1dd_Smed_v4PMID:29674431
gutSMED30008821SMED30008821SMESG000032294.1 dd_Smed_v4_1381_0_1dd_Smed_v4PMID:29674431
gutSMED30003929Pyridoxal 5'-phosphate synthase subunit PdxSSMESG000026036.1 dd_Smed_v4_1240_0_1dd_Smed_v4PMID:29674431
gutSMED30004119SMED30004119SMESG000032294.1 dd_Smed_v4_1381_0_1dd_Smed_v4PMID:29674431
gutSMED30013692Small HSP proteinSMESG000055935.1 Contig651GPL15192PMID:23079596
gutSMED30013692Small HSP proteinSMESG000059879.1 SMESG000059868.1 SMESG000059853.1 Contig651GPL15192PMID:23079596
gutSMED30003448Glycine N-methyltransferaseSMESG000037719.1 dd_Smed_v4_1127_0_1dd_Smed_v4PMID:29674431
gutSMED30003448Glycine N-methyltransferaseSMESG000037719.1 SmedASXL_008095SmedAsxl_ww_GCZZ01PMID:29158443
gutSMED30007804Immunoglobulin-like domain-containing proteinSMESG000010356.1 dd_Smed_v4_1827_0_1dd_Smed_v4PMID:29674431
gutSMED30005028SMED30005028SMESG000017098.1 SMESG000014979.1 SMESG000014974.1 dd_Smed_v4_7198_0_1dd_Smed_v4PMID:29674431
gutSMED30001367ADP-ribosylation factor 1SMESG000031561.1 SMESG000018862.1 Contig8GPL15192PMID:23079596
gutSMED30001367ADP-ribosylation factor 1SMESG000067743.1 Contig8GPL15192PMID:23079596
gutSMED30003676C-type lectin domain-containing proteinSMESG000028261.1 SMESG000028260.1 SMESG000028258.1 dd_Smed_v4_10_1_1dd_Smed_v4PMID:29674431
gutSMED30003676C-type lectin domain-containing proteinSMESG000028261.1 SMESG000028260.1 SMESG000028258.1 dd_Smed_v4_10_1_1dd_Smed_v4PMID:30962434
gutSMED30031519Tyrosine-protein kinaseSMESG000020289.1 dd_Smed_v4_9416_0_1dd_Smed_v4PMID:29674431
gutSMED30002200SMED30002200SMESG000015894.1 SMESG000000559.1 Contig1506newmark_estsPMID:23079596
gutSMED30002200SMED30002200SMESG000078978.1 Contig1506newmark_estsPMID:23079596
gutSMED30028497AdenosylhomocysteinaseSMESG000012954.1 SMESG000012950.1 dd_Smed_v4_526_0_1dd_Smed_v4PMID:29674431
gutSMED30028497AdenosylhomocysteinaseSMESG000012954.1 SMESG000012950.1 Contig41958newmark_estsPMID:27612384
gutSMED30028497AdenosylhomocysteinaseSMESG000012954.1 SMESG000012950.1 Contig41958uc_Smed_v2PMID:27612384
gutSMED30029578GGACT domain-containing proteinSMESG000077709.1 SMESG000073947.1 SMESG000043656.1 SMESG000043279.1 SMESG000008519.1 SMESG000001897.1 Contig22newmark_estsPMID:23079596
gutSMED30029578GGACT domain-containing proteinSMESG000013795.1 Contig22newmark_estsPMID:23079596
gutSMED30034412E3 ubiquitin-protein ligase CBLSMESG000039019.1 Contig3731GPL15192PMID:23079596
gutSMED30034412E3 ubiquitin-protein ligase CBLSMESG000056433.1 Contig3731GPL15192PMID:23079596
gutSMED30029546Tektin 3SMESG000020792.1 Contig1106newmark_estsPMID:23079596
gutSMED30029546Tektin 3SMESG000020792.1 Contig1106uc_Smed_v2PMID:23079596
gutSMED30029546Tektin 3SMESG000027124.1 Contig1106newmark_estsPMID:23079596
gutSMED30029546Tektin 3SMESG000027124.1 Contig1106uc_Smed_v2PMID:23079596
gutSMED30032389slc24a-1SMESG000010390.1 dd_Smed_v4_5868_0_1dd_Smed_v4PMID:29674431
gutSMED30032814SMED30032814SMESG000064204.1 Contig1439newmark_estsPMID:23079596
gutSMED30032814SMED30032814SMESG000064204.1 Contig1439uc_Smed_v2PMID:23079596
gutSMED30032814SMED30032814SMESG000030835.1 Contig1439newmark_estsPMID:23079596
gutSMED30032814SMED30032814SMESG000030835.1 Contig1439uc_Smed_v2PMID:23079596
gutSMED30024035Serine/Threonine kinase domain proteinSMESG000071539.1 dd_Smed_v4_5501_0_1dd_Smed_v4PMID:29674431
gutSMED30024044ADP-ribosylation factor-like protein 8BSMESG000001053.1 Contig525GPL15192PMID:23079596
gutSMED30024044ADP-ribosylation factor-like protein 8BSMESG000033211.1 Contig525GPL15192PMID:23079596
gutSMED30033685Dimer_Tnp_hAT domain-containing proteinSMESG000077667.1 dd_Smed_v4_4598_0_1dd_Smed_v4PMID:29674431
gutSMED30035840Placenta specific protein 8SMESG000050216.1 dd_Smed_v4_564_0_1dd_Smed_v4PMID:29674431
gutSMED30024849SMED30024849SMESG000027221.1 dd_Smed_v4_6047_0_1dd_Smed_v4PMID:29674431
gutSMED30026747Metallophos domain-containing proteinSMESG000036432.1 Contig450newmark_estsPMID:23079596
gutSMED30026747Metallophos domain-containing proteinSMESG000036432.1 Contig450uc_Smed_v2PMID:23079596
gutSMED30026747Metallophos domain-containing proteinSMESG000051672.1 SMESG000051670.1 Contig450newmark_estsPMID:23079596
gutSMED30026747Metallophos domain-containing proteinSMESG000051672.1 SMESG000051670.1 Contig450uc_Smed_v2PMID:23079596
gutSMED30029369Ras family proteinSMESG000066335.1 dd_Smed_v4_5049_0_1dd_Smed_v4PMID:29674431
gutSMED30029727Zinc finger, C2H2 typeSMESG000073676.1 dd_Smed_v4_5177_0_1dd_Smed_v4PMID:29674431
gutSMED30026133BTB domain-containing proteinSMESG000001053.1 Contig525newmark_estsPMID:23079596
gutSMED30026133BTB domain-containing proteinSMESG000001053.1 Contig525uc_Smed_v2PMID:23079596
gutSMED30026133BTB domain-containing proteinSMESG000033211.1 Contig525newmark_estsPMID:23079596
gutSMED30026133BTB domain-containing proteinSMESG000033211.1 Contig525uc_Smed_v2PMID:23079596
gutSMED30017520WD repeat domain 7SMESG000002835.1 Contig5582newmark_estsPMID:23079596
gutSMED30017520WD repeat domain 7SMESG000002835.1 Contig5582uc_Smed_v2PMID:23079596
gutSMED30017520WD repeat domain 7SMESG000016829.1 Contig5582newmark_estsPMID:23079596
gutSMED30017520WD repeat domain 7SMESG000016829.1 Contig5582uc_Smed_v2PMID:23079596
gutSMED30019715Tumor protein p63-regulated gene 1 proteinSMESG000038153.1 SMESG000018862.1 Contig1GPL15192PMID:23079596
gutSMED30019715Tumor protein p63-regulated gene 1 proteinSMESG000033840.1 Contig1GPL15192PMID:23079596
gutSMED30012991endoglycoceramidaseSMESG000030369.1 SMESG000030357.1 SMESG000030353.1 dd_Smed_v4_1570_0_1dd_Smed_v4PMID:29674431
gutSMED30019975E3 ubiquitin-protein ligaseSMESG000008708.1 dd_Smed_v4_1444_0_1dd_Smed_v4PMID:29674431
gutSMED30012113SMED30012113SMESG000017135.1 Contig2203GPL15192PMID:23079596
gutSMED30033014Phosphatidylinositol-4,5-bisphosphate 4-phosphataseSMESG000063221.1 Contig1068GPL15192PMID:23079596
gutSMED30033014Phosphatidylinositol-4,5-bisphosphate 4-phosphataseSMESG000063221.1 dd_Smed_v4_1079_0_1dd_Smed_v4PMID:29674431
gutSMED30029379Gamma-aminobutyric acid receptor-associated protein-like 2SMESG000033716.1 dd_Smed_v4_1441_0_1dd_Smed_v4PMID:29674431
gutSMED30023334Partitioning defective 6SMESG000066854.1 Contig3688GPL15192PMID:23079596
gutSMED30023334Partitioning defective 6SMESG000026500.1 Contig3688GPL15192PMID:23079596
gutSMED30030705SMED30030705SMESG000068156.1 SMESG000043474.1 SMESG000076470.1 SMESG000053533.1 SMESG000015751.1 Contig250newmark_estsPMID:23079596
gutSMED30030705SMED30030705SMESG000068156.1 SMESG000064685.1 SMESG000010609.1 SMESG000076470.1 SMESG000073857.1 SMESG000062429.1 SMESG000060487.1 SMESG000058575.1 SMESG000053533.1 SMESG000026676.1 SMESG000020635.1 SMESG000015751.1 SMESG000005260.1 Contig239newmark_estsPMID:23079596
gutSMED30030705SMED30030705SMESG000057816.1 Contig239newmark_estsPMID:23079596
gutSMED30030705SMED30030705SMESG000025034.1 Contig250newmark_estsPMID:23079596
gutSMED30030705SMED30030705SMESG000068156.1 SMESG000010609.1 SMESG000076470.1 SMESG000073857.1 SMESG000062429.1 SMESG000060487.1 SMESG000058575.1 SMESG000053533.1 SMESG000026676.1 SMESG000020635.1 SMESG000015751.1 SMESG000005260.1 Contig236newmark_estsPMID:23079596
gutSMED30030705SMED30030705SMESG000037949.1 Contig236newmark_estsPMID:23079596
gutSMED30033333SMED30033333SMESG000004952.1 Contig516newmark_estsPMID:23079596
gutSMED30032354EOG090X01A3SMESG000068156.1 SMESG000043474.1 SMESG000076470.1 SMESG000053533.1 SMESG000015751.1 Contig250newmark_estsPMID:23079596
gutSMED30032354EOG090X01A3SMESG000068156.1 SMESG000064685.1 SMESG000043474.1 SMESG000010609.1 SMESG000076470.1 SMESG000073857.1 SMESG000062429.1 SMESG000058575.1 SMESG000053533.1 SMESG000020635.1 SMESG000015751.1 SMESG000005260.1 Contig246newmark_estsPMID:23079596
gutSMED30032354EOG090X01A3SMESG000068156.1 SMESG000064685.1 SMESG000010609.1 SMESG000076470.1 SMESG000073857.1 SMESG000062429.1 SMESG000060487.1 SMESG000058575.1 SMESG000053533.1 SMESG000026676.1 SMESG000020635.1 SMESG000015751.1 SMESG000005260.1 Contig239newmark_estsPMID:23079596
gutSMED30032354EOG090X01A3SMESG000000175.1 Contig246newmark_estsPMID:23079596
gutSMED30032354EOG090X01A3SMESG000057816.1 Contig239newmark_estsPMID:23079596
gutSMED30032354EOG090X01A3SMESG000025034.1 Contig250newmark_estsPMID:23079596
gutSMED30032354EOG090X01A3SMESG000068156.1 SMESG000010609.1 SMESG000076470.1 SMESG000073857.1 SMESG000062429.1 SMESG000060487.1 SMESG000058575.1 SMESG000053533.1 SMESG000026676.1 SMESG000020635.1 SMESG000015751.1 SMESG000005260.1 Contig236newmark_estsPMID:23079596
gutSMED30032354EOG090X01A3SMESG000037949.1 Contig236newmark_estsPMID:23079596
gutSMED30024210BRO1 domain-containing protein BROXSMESG000055804.1 dd_Smed_v4_1658_0_1dd_Smed_v4PMID:29674431
gutSMED30020100SMED30020100SMESG000013936.1 Contig1935newmark_estsPMID:23079596
gutSMED30020100SMED30020100SMESG000013936.1 Contig1935uc_Smed_v2PMID:23079596
gutSMED30020100SMED30020100SMESG000039535.1 Contig1935newmark_estsPMID:23079596
gutSMED30020100SMED30020100SMESG000039535.1 Contig1935uc_Smed_v2PMID:23079596
gutSMED30029698Caspase-7SMESG000053168.1 Contig2992GPL15192PMID:23079596
gutSMED30029698Caspase-7SMESG000053168.1 dd_Smed_v4_1167_0_1dd_Smed_v4PMID:29674431
gutSMED30029603SMED30029603SMESG000071278.1 dd_Smed_v4_1649_0_1dd_Smed_v4PMID:29674431
gutSMED30029603SMED30029603SMESG000027122.1 Contig1663GPL15192PMID:23079596
gutSMED30029603SMED30029603SMESG000071278.1 Contig1663GPL15192PMID:23079596
gutSMED30035642Granulin bSMESG000060269.1 Contig2381GPL15192PMID:23079596
gutSMED30035642Granulin bSMESG000029882.1 Contig2381GPL15192PMID:23079596
gutSMED30035642Granulin bSMESG000029882.1 PL06004A1G01ncbi_smed_estsPMID:23079596
gutSMED30035642Granulin bSMESG000029882.1 dd_Smed_v4_162_0_1dd_Smed_v4PMID:29674431
gutSMED30035642Granulin bSMESG000029882.1 dd_Smed_v4_442_0_1dd_Smed_v4PMID:29674431
gutSMED30024121TetraspaninSMESG000023248.1 dd_Smed_v4_1808_0_1dd_Smed_v4PMID:29674431
gutSMED30022370Calcium-activated potassium channel slo-1, putativeSMESG000049145.1 Contig1087newmark_estsPMID:23079596
gutSMED30022370Calcium-activated potassium channel slo-1, putativeSMESG000075482.1 Contig1087newmark_estsPMID:23079596
gutSMED30014989AGAP013516-RBSMESG000056770.1 SMED30014989smed_20140614PMID:27441386
gutSMED30007858netrin receptor-like proteinSMESG000042475.1 dd_Smed_v4_11409_0_1dd_Smed_v4PMID:29674431
gutSMED30007199IlvB (bacterial acetolactate synthase)-likeSMESG000026596.1 dd_Smed_v4_1784_0_1dd_Smed_v4PMID:29674431
gutSMED30001036Receptor-type tyrosine-protein phosphatase betaSMESG000050003.1 SMESG000005247.1 dd_Smed_v4_5794_0_1dd_Smed_v4PMID:29674431
gutSMED30016080Deoxyhypusine hydroxylaseSMESG000051726.1 SMESG000051721.1 dd_Smed_v4_703_0_1dd_Smed_v4PMID:29674431
gutSMED30019154Glycine amidinotransferase mitochondrialSMESG000068402.1 SMED30019154smed_20140614PMID:26457503
gutSMED30001419Xaa-Pro dipeptidaseSMESG000012999.1 dd_Smed_v4_1297_0_1dd_Smed_v4PMID:29674431
gutSMED30008243SMED30008243SMESG000062646.1 dd_Smed_v4_2042_0_1dd_Smed_v4PMID:29674431
gutSMED30013124Aldehyde dehydrogenase family proteinSMESG000049241.1 dd_Smed_v4_1493_0_1dd_Smed_v4PMID:29674431
gutSMED30009913Beta-ureidopropionaseSMESG000060425.1 dd_Smed_v4_1584_0_1dd_Smed_v4PMID:29674431
gutSMED30011014acetolactate synthase-like proteinSMESG000026596.1 dd_Smed_v4_1784_0_1dd_Smed_v4PMID:29674431
gutSMED30009444CubilinSMESG000058235.1 dd_Smed_v4_11447_0_1dd_Smed_v4PMID:29674431
gutSMED30013605SMED30013605SMESG000048192.1 Contig26075newmark_estsPMID:27612384
gutSMED30013605SMED30013605SMESG000048192.1 Contig26075uc_Smed_v2PMID:27612384
gutSMED30014813Y box protein-1SMESG000058043.1 SMED30004532smed_20140614PMID:26457503
gutSMED30005873Transducin beta-like protein 3SMESG000071620.1 SMED30005873smed_20140614PMID:26457503
gutSMED30015687RING-type domain-containing proteinSMESG000007981.1 SMED30015687smed_20140614PMID:26457503
gutSMED30002098carboxypeptidase ESMESG000062760.1 SMED30002098smed_20140614PMID:26457503
gutSMED30007534Protein LLP homologSMESG000010838.1 SMED30007534smed_20140614PMID:26457503
gutSMED30007534Protein LLP homologSMESG000010838.1 dd_Smed_v4_5414_0_1dd_Smed_v4PMID:29674431
gutSMED30002242Nucleobindin 2SMESG000016720.1 SMED30002242smed_20140614PMID:26457503
gutSMED30016382SMED30016382SMESG000029089.1 SMED30016382smed_20140614PMID:26457503
gutSMED30018812protein kinase C-binding protein NELL1-likeSMESG000066109.1 dd_Smed_v4_11653_0_1dd_Smed_v4PMID:29674431
gutSMED30004532Y box protein-1SMESG000058043.1 SMED30004532smed_20140614PMID:26457503
gutSMED30002215DUF862 domain-containing proteinSMESG000024669.1 SMED30002215smed_20140614PMID:26457503
gutSMED30006606Alpha-mannosidaseSMESG000045085.1 SMESG000045072.1 dd_Smed_v4_1942_0_1dd_Smed_v4PMID:29674431
gutSMED30019456Dipeptidyl peptidase 2SMESG000048843.1 dd_Smed_v4_1123_0_1dd_Smed_v4PMID:29674431
gutSMED30026014WD repeat and HMG-box DNA binding protein 1SMESG000076132.1 SMED30026014smed_20140614PMID:26457503
gutSMED30030679Elongation of very long chain fatty acids proteinSMESG000068877.1 SMESG000068874.1 SMED30030679smed_20140614PMID:26457503
gutSMED30020414SMED30020414SMESG000017203.1 dd_Smed_v4_391_0_1dd_Smed_v4PMID:29674431
gutSMED30031568Cytochrome P450 2L1SMESG000050434.1 SMED30031568smed_20140614PMID:26457503
gutSMED30020439aadc SMESG000066844.1 dd_Smed_v4_11320_0_1dd_Smed_v4PMID:29674431
gutSMED3002552260 kDa heat shock protein, mitochondrialSMESG000065325.1 SMED30025522smed_20140614PMID:26457503
gutSMED3002552260 kDa heat shock protein, mitochondrialSMESG000065325.1 dd_Smed_v4_141_0_1dd_Smed_v4PMID:29674431
gutSMED30020964Adenylyltransferase and sulfurtransferase MOCS3SMESG000051640.1 SMED30020964smed_20140614PMID:26457503
gutSMED30021793Pmp-10SMESG000068743.1 SMED30021793smed_20140614PMID:26457503
gutSMED30028553zinc finger BED domain-containing protein 4-likeSMESG000045018.1 SMESG000034450.1 SMESG000023965.1 SMED30028553smed_20140614PMID:27502555
gutSMED30025584SMED30025584SMESG000077266.1 SMED30025584smed_20140614PMID:26457503
gutSMED30032169Glycine amidinotransferase, mitochondrialSMESG000043142.1 SMED30032169smed_20140614PMID:26457503
gutSMED30023536Microsomal glutathione S-transferase 3SMESG000078588.1 SMED30023536smed_20140614PMID:26457503
gutSMED30024865Intermediate filament proteinSMESG000030598.1 SMED30024865smed_20140614PMID:26457503
gutSMED30023489CDGSH iron sulfur domain-containing protein 3, mitochondrialSMESG000016828.1 SMED30023489smed_20140614PMID:26457503
gutSMED30026757Steroid 17-alpha-hydroxylase/17,20 lyaseSMESG000059367.1 SMESG000059323.1 SMESG000057929.1 SMESG000048655.1 SMED30026757smed_20140614PMID:26457503
gutSMED30022437Replication protein A2SMESG000049472.1 SMED30022437smed_20140614PMID:26457503
gutSMED30027207Ornithine decarboxylaseSMESG000055750.1 SMED30027207smed_20140614PMID:26457503
gutSMED30032645Heterochromatin protein 1-1SMESG000004606.1 SMED30032645smed_20140614PMID:26457503
gutSMED30020409SMED30020409SMESG000045132.1 dd_Smed_v4_182_0_1dd_Smed_v4PMID:29674431
gutSMED30020834SMED30020834SMESG000060160.1 dd_Smed_v4_10167_0_1dd_Smed_v4PMID:29674431
gutSMED30025603SMED30025603SMESG000018472.1 SMED30025603smed_20140614PMID:26457503
gutSMED30027266SMED30027266SMESG000041022.1 SMED30027266smed_20140614PMID:26457503
gutSMED30030642Cytochrome P450 2C3SMESG000023530.1 SMESG000023528.1 SMED30030642smed_20140614PMID:26457503
gutSMED300249343-hydroxybutyrate dehydrogenase, type 1SMESG000039796.1 SMESG000039794.1 SMESG000039792.1 SMED30024934smed_20140614PMID:26457503
gutSMED30032112Serine racemaseSMESG000064664.1 SMESG000064660.1 SMED30032112smed_20140614PMID:26457503
gutSMED30020778slc22a-6SMESG000020910.1 dd_Smed_v4_1159_0_1dd_Smed_v4PMID:29674431
gutSMED30031607Histone-lysine N-methyltransferaseSMESG000037819.1 Contig1168newmark_estsPMID:23079596
gutSMED30031607Histone-lysine N-methyltransferaseSMESG000037819.1 Contig1168uc_Smed_v2PMID:23079596
gutSMED30023460TTF-type domain-containing proteinSMESG000046135.1 Contig1594newmark_estsPMID:23079596
gutSMED30035808Serine/threonine-protein kinase fusedSMESG000078509.1 SMESG000078507.1 dd_Smed_v4_4259_0_1dd_Smed_v4PMID:29674431
gutSMED30026190Tubulin beta chainSMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044907.1 SMESG000044888.1 SMESG000035804.1 SMESG000035755.1 Contig2059GPL15192PMID:23079596
gutSMED30034775Ras-associating domain-containing proteinSMESG000002146.1 Contig5459GPL15192PMID:23079596
gutSMED30028596Ornithine carbamoyltransferaseSMESG000040441.1 SMESG000035784.1 dd_Smed_v4_3906_0_1dd_Smed_v4PMID:29674431
gutSMED30035848Tubulin beta chainSMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044907.1 SMESG000044888.1 SMESG000035804.1 SMESG000035755.1 Contig2059GPL15192PMID:23079596
gutSMED30023220Transmembrane proteinSMESG000046135.1 Contig1594GPL15192PMID:23079596
gutSMED30030788SMED30030788SMESG000079496.1 dd_Smed_v4_6860_0_1dd_Smed_v4PMID:29674431
gutSMED30027407SERPINE1 mRNA binding protein 1aSMESG000008791.1 dd_Smed_v4_697_0_1dd_Smed_v4PMID:29674431
gutSMED30035215G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000023842.1 dd_Smed_v4_32_0_1dd_Smed_v4PMID:29674431
gutSMED30023199Leucine-zipper-like transcriptional regulator 1SMESG000007049.1 Contig3743GPL15192PMID:23079596
gutSMED30023199Leucine-zipper-like transcriptional regulator 1SMESG000074654.1 Contig3743GPL15192PMID:23079596
gutSMED30028047Regulatory-associated protein of mTORSMESG000049778.1 SMESG000048378.1 SMESG000039423.1 SMESG000039024.1 SMESG000024543.1 SMESG000022136.1 SMESG000002434.1 JF894290.2smed_ncbi_20200123PMID:22451003
gutSMED30028047Regulatory-associated protein of mTORSMESG000049778.1 SMESG000048378.1 SMESG000039423.1 SMESG000039024.1 SMESG000024543.1 SMESG000022136.1 SMESG000002434.1 JF894290.2smed_ncbi_20200123PMID:22451003
gutSMED30022483CGG triplet repeat-binding protein 1SMESG000020470.1 Contig1680newmark_estsPMID:23079596
gutSMED30022483CGG triplet repeat-binding protein 1SMESG000020470.1 Contig1680uc_Smed_v2PMID:23079596
gutSMED30031091activin 1SMESG000072407.1 Contig4428GPL15192PMID:23079596
gutSMED30031091activin 1SMESG000024833.1 SMESG000024831.1 dd_Smed_v4_4120_0_1dd_Smed_v4PMID:29674431
gutSMED30031091activin 1SMESG000024833.1 Contig4428GPL15192PMID:23079596
gutSMED30034544Disrupted in renal carcinoma protein 2-likeSMESG000017031.1 Contig2590GPL15192PMID:23079596
gutSMED30034544Disrupted in renal carcinoma protein 2-likeSMESG000017031.1 dd_Smed_v4_4596_0_1dd_Smed_v4PMID:29674431
gutSMED30028380Ras-related proteinSMESG000024796.1 Contig3946newmark_estsPMID:23079596
gutSMED30028380Ras-related proteinSMESG000024796.1 Contig3946uc_Smed_v2PMID:23079596
gutSMED30028380Ras-related proteinSMESG000001576.1 Contig3946newmark_estsPMID:23079596
gutSMED30028380Ras-related proteinSMESG000001576.1 Contig3946uc_Smed_v2PMID:23079596
gutSMED30026693CXXC-type zinc finger protein isoform 1SMESG000074165.1 HO005298ncbi_smed_estsPMID:23235145
gutSMED30026693CXXC-type zinc finger protein isoform 1SMESG000074165.1 DN310044ncbi_smed_estsPMID:23235145
gutSMED30028985SMED30028985SMESG000062657.1 DN308448ncbi_smed_estsPMID:24173799
gutSMED30025338E3 ubiquitin-protein ligase CBLSMESG000072524.1 SMESG000072522.1 dd_Smed_v4_330_0_1dd_Smed_v4PMID:29674431
gutSMED300335115'-AMP-activated protein kinase subunit gamma-1-like proteinSMESG000053119.1 dd_Smed_v4_7565_0_1dd_Smed_v4PMID:29674431
gutSMED30031903ProsaposinSMESG000019973.1 Contig692newmark_estsPMID:23079596
gutSMED30031903ProsaposinSMESG000068491.1 Contig692newmark_estsPMID:23079596
gutSMED30034688SMED30034688SMESG000043655.1 SMESG000043653.1 dd_Smed_v4_8062_0_1dd_Smed_v4PMID:29674431
gutSMED30021956Actin-related protein 3SMESG000078631.1 Contig5723GPL15192PMID:23079596
gutSMED30021956Actin-related protein 3SMESG000078631.1 dd_Smed_v4_453_0_1dd_Smed_v4PMID:29674431
gutSMED30025105Plastin 3SMESG000081113.1 DN303981ncbi_smed_estsPMID:16344473
gutSMED30025105Plastin 3SMESG000081126.1 SMESG000081113.1 dd_Smed_v4_749_0_1dd_Smed_v4PMID:29674431
gutSMED30028401InnexinSMESG000056430.1 dd_Smed_v4_734_0_1dd_Smed_v4PMID:29674431
gutSMED30028401InnexinSMESG000056430.1 AY967558smed_ncbi_20200123PMID:17670787
gutSMED30029427Homogentisate 1,2-dioxygenaseSMESG000033366.1 dd_Smed_v4_2908_0_1dd_Smed_v4PMID:29674431
gutSMED30028026Abl interactor 2SMESG000055438.1 dd_Smed_v4_690_0_1dd_Smed_v4PMID:29674431
gutSMED30026151WD repeat domain 82SMESG000059185.1 DN297595ncbi_smed_estsPMID:23235145
gutSMED30026151WD repeat domain 82SMESG000059185.1 DN305959ncbi_smed_estsPMID:23235145
gutSMED30028347Engulfment and cell motility 3SMESG000013936.1 Contig1935GPL15192PMID:23079596
gutSMED30028347Engulfment and cell motility 3SMESG000039535.1 Contig1935GPL15192PMID:23079596
gutSMED30031471SMED30031471SMESG000050535.1 SMESG000050533.1 dd_Smed_v4_5107_0_1dd_Smed_v4PMID:29674431
gutSMED30027134AAA domain-containing proteinSMESG000080328.1 DN308519ncbi_smed_estsPMID:16344473
gutSMED30030364cAMP-dependent protein kinase catalytic subunitSMESG000068162.1 dd_Smed_v4_3711_0_1dd_Smed_v4PMID:29674431
gutSMED30030402Carrier domain-containing proteinSMESG000017098.1 SMESG000014979.1 SMESG000014974.1 dd_Smed_v4_7198_0_1dd_Smed_v4PMID:29674431
gutSMED30034430Arp2/3 complex 34 kDa subunitSMESG000060573.1 Contig5379GPL15192PMID:23079596
gutSMED30034430Arp2/3 complex 34 kDa subunitSMESG000073809.1 Contig5379GPL15192PMID:23079596
gutSMED30034430Arp2/3 complex 34 kDa subunitSMESG000073809.1 dd_Smed_v4_693_0_1dd_Smed_v4PMID:29674431
gutSMED30033482Histone-lysine N-methyltransferaseSMESG000062296.1 DN308184ncbi_smed_estsPMID:23235145
gutSMED30033482Histone-lysine N-methyltransferaseSMESG000062296.1 DN301487ncbi_smed_estsPMID:23235145
gutSMED3003151240S ribosomal protein S21SMESG000004954.1 dd_Smed_v4_84_0_1dd_Smed_v4PMID:29674431
gutSMED30029022SMED30029022SMESG000031167.1 Contig3159newmark_estsPMID:23079596
gutSMED30026043UTP--glucose-1-phosphate uridylyltransferaseSMESG000043519.1 dd_Smed_v4_3057_0_1dd_Smed_v4PMID:29674431
gutSMED30031385SMED30031385SMESG000045568.1 Contig4881newmark_estsPMID:23079596
gutSMED30031385SMED30031385SMESG000045568.1 Contig4881uc_Smed_v2PMID:23079596
gutSMED30024155SMED30024155SMESG000073623.1 dd_Smed_v4_3440_0_1dd_Smed_v4PMID:29674431
gutSMED30029573GFO_IDH_MocA domain-containing proteinSMESG000072407.1 Contig4428newmark_estsPMID:23079596
gutSMED30029573GFO_IDH_MocA domain-containing proteinSMESG000072407.1 Contig4428uc_Smed_v2PMID:23079596
gutSMED30029573GFO_IDH_MocA domain-containing proteinSMESG000024833.1 Contig4428newmark_estsPMID:23079596
gutSMED30029573GFO_IDH_MocA domain-containing proteinSMESG000024833.1 Contig4428uc_Smed_v2PMID:23079596
gutSMED30033999Zinc finger MYM-type protein 1SMESG000060573.1 Contig5379newmark_estsPMID:23079596
gutSMED30033999Zinc finger MYM-type protein 1SMESG000060573.1 Contig5379uc_Smed_v2PMID:23079596
gutSMED30033999Zinc finger MYM-type protein 1SMESG000073809.1 Contig5379newmark_estsPMID:23079596
gutSMED30033999Zinc finger MYM-type protein 1SMESG000073809.1 Contig5379uc_Smed_v2PMID:23079596
gutSMED30022486SMED30022486SMESG000043383.1 Contig1883newmark_estsPMID:23079596
gutSMED30027012slc24a-7SMESG000022806.1 SMESG000022803.1 Contig7328newmark_estsPMID:23079596
gutSMED30027012slc24a-7SMESG000022806.1 SMESG000022803.1 Contig7328uc_Smed_v2PMID:23079596
gutSMED30032067TRAF-4SMESG000044336.1 Contig1407GPL15192PMID:23079596
gutSMED30032067TRAF-4SMESG000015063.1 Contig1407GPL15192PMID:23079596
gutSMED30035284RING-type domain-containing proteinSMESG000055935.1 Contig651newmark_estsPMID:23079596
gutSMED30035284RING-type domain-containing proteinSMESG000055935.1 Contig651uc_Smed_v2PMID:23079596
gutSMED30035284RING-type domain-containing proteinSMESG000059879.1 SMESG000059868.1 SMESG000059853.1 Contig651newmark_estsPMID:23079596
gutSMED30035284RING-type domain-containing proteinSMESG000059879.1 SMESG000059868.1 SMESG000059853.1 Contig651uc_Smed_v2PMID:23079596
gutSMED30025809Cytochrome c oxidase subunit 4SMESG000071294.1 dd_Smed_v4_845_0_1dd_Smed_v4PMID:29674431
gutSMED30029979Retinoblastoma-binding protein 5 homologSMESG000077004.1 DN308991ncbi_smed_estsPMID:23235145
gutSMED30029979Retinoblastoma-binding protein 5 homologSMESG000077004.1 HO007192ncbi_smed_estsPMID:23235145
gutSMED30028174TTF-type domain-containing proteinSMESG000003943.1 Contig6476newmark_estsPMID:23079596
gutSMED30028174TTF-type domain-containing proteinSMESG000003943.1 Contig6476uc_Smed_v2PMID:23079596
gutSMED30024871SMED30024871SMESG000056380.1 Contig1780newmark_estsPMID:23079596
gutSMED30032334SMED30032334SMESG000025704.1 dd_Smed_v4_425_0_1dd_Smed_v4PMID:29674431
gutSMED30031607Histone-lysine N-methyltransferaseSMESG000074842.1 Contig1168newmark_estsPMID:23079596
gutSMED30031607Histone-lysine N-methyltransferaseSMESG000074842.1 Contig1168uc_Smed_v2PMID:23079596
gutSMED30014058SMED30014058SMESG000000945.1 SMESG000000928.1 Contig3270newmark_estsPMID:23079596
gutSMED30001281SMED30001281SMESG000031561.1 SMESG000018862.1 Contig8newmark_estsPMID:23079596
gutSMED30001281SMED30001281SMESG000067743.1 Contig8newmark_estsPMID:23079596
gutSMED30001281SMED30001281SMESG000038153.1 SMESG000018862.1 Contig1newmark_estsPMID:23079596
gutSMED30001281SMED30001281SMESG000033840.1 Contig1newmark_estsPMID:23079596
gutSMED30014226SMED30014226SMESG000074424.1 Contig1592newmark_estsPMID:23079596
gutSMED30004579SMED30004579SMESG000052600.1 Contig1622newmark_estsPMID:23079596
gutSMED30014527SMED30014527SMESG000003891.1 Contig1388newmark_estsPMID:23079596
gutSMED30014527SMED30014527SMESG000048111.1 Contig1388newmark_estsPMID:23079596
gutSMED30013050SMED30013050SMESG000000175.1 Contig2068newmark_estsPMID:23079596
gutSMED30019441SMED30019441SMESG000070776.1 SMESG000049855.1 Contig1854newmark_estsPMID:23079596
gutSMED30019441SMED30019441SMESG000075102.1 Contig1854newmark_estsPMID:23079596
gutSMED30006486SMED30006486SMESG000033958.1 Contig1720newmark_estsPMID:23079596
gutSMED30018354SMED30018354SMESG000015778.1 Contig1955newmark_estsPMID:23079596
gutSMED30004652SMED30004652SMESG000033527.1 Contig2307newmark_estsPMID:23079596
gutSMED30000575SMED30000575SMESG000064050.1 Contig4890newmark_estsPMID:23079596
gutSMED30000575SMED30000575SMESG000069596.1 Contig4890newmark_estsPMID:23079596
gutSMED30017833SMED30017833SMESG000053168.1 Contig2992newmark_estsPMID:23079596
gutSMED30016164SMED30016164SMESG000064161.1 Contig2672newmark_estsPMID:23079596
gutSMED30019591SMED30019591SMESG000050873.1 Contig2383newmark_estsPMID:23079596
gutSMED30007986SMED30007986SMESG000029355.1 Contig3561newmark_estsPMID:23079596
gutSMED30005235SMED30005235SMESG000036235.1 Contig2568newmark_estsPMID:23079596
gutSMED30006536SMED30006536SMESG000054351.1 Contig1590newmark_estsPMID:23079596
gutSMED30006536SMED30006536SMESG000005053.1 SMESG000005050.1 Contig1590newmark_estsPMID:23079596
gutSMED30012769SMED30012769SMESG000058788.1 Contig2701newmark_estsPMID:23079596
gutSMED30012769SMED30012769SMESG000058788.1 Contig2701uc_Smed_v2PMID:23079596
gutSMED30004302SMED30004302SMESG000069298.1 Contig3532newmark_estsPMID:23079596
gutSMED30002229SMED30002229SMESG000032180.1 Contig1715newmark_estsPMID:23079596
gutSMED30011718SMED30011718SMESG000070267.1 Contig1736newmark_estsPMID:23079596
gutSMED30026658SMED30026658SMESG000008925.1 dd_Smed_v4_376_0_1dd_Smed_v4PMID:29674431
gutSMED30031423ATP synthase subunitSMESG000021514.1 dd_Smed_v4_428_0_1dd_Smed_v4PMID:29674431
gutSMED30030897Ubox domain containing proteinSMESG000054668.1 dd_Smed_v4_2397_0_1dd_Smed_v4PMID:29674431
gutSMED30025048exportin-1SMESG000045533.1 Contig1156newmark_estsPMID:23079596
gutSMED30025048exportin-1SMESG000035447.1 Contig1156newmark_estsPMID:23079596
gutSMED30035150TLC domain-containing proteinSMESG000057441.1 Contig2269GPL15192PMID:23079596
gutSMED30025473mxi-2 proteinSMESG000067412.1 Contig1164GPL15192PMID:23079596
gutSMED30025473mxi-2 proteinSMESG000060394.1 Contig1164GPL15192PMID:23079596
gutSMED30025473mxi-2 proteinSMESG000060394.1 KF487116smed_ncbi_20200123PMID:24173799
gutSMED30030780SMED30030780SMESG000008077.1 Contig5057GPL15192PMID:23079596
gutSMED30030780SMED30030780SMESG000017950.1 Contig5057GPL15192PMID:23079596
gutSMED30029481SMED30029481SMESG000079496.1 dd_Smed_v4_6860_0_1dd_Smed_v4PMID:29674431
gutSMED30035609Cathepsin L2SMESG000014167.1 SMESG000014166.1 dd_Smed_v4_267_0_1dd_Smed_v4PMID:29674431
gutSMED30035609Cathepsin L2SMESG000014167.1 SMESG000014166.1 dd_Smed_v4_267_0_1dd_Smed_v4PMID:30962434
gutSMED30034127Peptidase S1 domain-containing proteinSMESG000076526.1 dd_Smed_v4_7541_0_1dd_Smed_v4PMID:29674431
gutSMED30034127Peptidase S1 domain-containing proteinSMESG000076526.1 dd_Smed_v4_7541_0_1dd_Smed_v4PMID:30962434
gutSMED30034127Peptidase S1 domain-containing proteinSMESG000076526.1 Contig49240newmark_estsPMID:27612384
gutSMED30034127Peptidase S1 domain-containing proteinSMESG000076526.1 Contig49240uc_Smed_v2PMID:27612384
gutSMED30034573Tubulin beta chainSMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044907.1 SMESG000044888.1 SMESG000035804.1 SMESG000035755.1 Contig2059GPL15192PMID:23079596
gutSMED30034573Tubulin beta chainSMESG000047291.1 SMESG000044907.1 SMESG000044888.1 SMESG000035804.1 SMESG000035755.1 SMESG000047284.1 Contig5821GPL15192PMID:23079596
gutSMED30035239Forkhead box proteinSMESG000061695.1 Contig4822newmark_estsPMID:23079596
gutSMED30035239Forkhead box proteinSMESG000061695.1 Contig4822uc_Smed_v2PMID:23079596
gutSMED30035239Forkhead box proteinSMESG000041562.1 Contig4822newmark_estsPMID:23079596
gutSMED30035239Forkhead box proteinSMESG000041562.1 Contig4822uc_Smed_v2PMID:23079596
gutSMED30031389CalnexinSMESG000016275.1 DN313316ncbi_smed_estsPMID:16344473
gutSMED30029036SMED30029036SMESG000023959.1 dd_Smed_v4_24743_0_1dd_Smed_v4PMID:29674431
gutSMED30029116Gamma-secretase subunit PEN-2SMESG000067691.1 Contig138GPL15192PMID:23079596
gutSMED30029116Gamma-secretase subunit PEN-2SMESG000035771.1 Contig138GPL15192PMID:23079596
gutSMED30026663Tropomyosin Tod p 1.0102SMESG000074053.1 DN312526ncbi_smed_estsPMID:16344473
gutSMED30034570SMED30034570SMESG000067691.1 Contig138newmark_estsPMID:23079596
gutSMED30034570SMED30034570SMESG000067691.1 Contig138uc_Smed_v2PMID:23079596
gutSMED30034570SMED30034570SMESG000035771.1 Contig138newmark_estsPMID:23079596
gutSMED30034570SMED30034570SMESG000035771.1 Contig138uc_Smed_v2PMID:23079596
gutSMED30024411Protein kinase domain-containing proteinSMESG000028899.1 Contig1093GPL15192PMID:23079596
gutSMED30024411Protein kinase domain-containing proteinSMESG000071997.1 Contig1093GPL15192PMID:23079596
gutSMED30031771Long-chain-fatty-acid--CoA ligase 4SMESG000060741.1 SMESG000060730.1 dd_Smed_v4_3021_0_1dd_Smed_v4PMID:29674431
gutSMED30032303SMED30032303SMESG000067685.1 dd_Smed_v4_3132_0_1dd_Smed_v4PMID:29674431
gutSMED30029687BHLH domain-containing proteinSMESG000040081.1 DN303577ncbi_smed_estsPMID:24173799
gutSMED30029687BHLH domain-containing proteinSMESG000040081.1 dd_Smed_v4_6869_0_1dd_Smed_v4PMID:29674431
gutSMED30023258Cell cycle associated protein 1aSMESG000043092.1 dd_Smed_v4_936_0_1dd_Smed_v4PMID:29674431
gutSMED30035485low density lipoprotein receptor related-2SMESG000009332.1 SMESG000009320.1 Contig505GPL15192PMID:23079596
gutSMED30035485low density lipoprotein receptor related-2SMESG000041448.1 Contig505GPL15192PMID:23079596
gutSMED30035485low density lipoprotein receptor related-2SMESG000041448.1 Contig42571newmark_estsPMID:27612384
gutSMED30035485low density lipoprotein receptor related-2SMESG000041448.1 dd_Smed_v4_3632_0_1dd_Smed_v4PMID:29674431
gutSMED30027044SMED30027044SMESG000024306.1 Contig631newmark_estsPMID:23079596
gutSMED30027044SMED30027044SMESG000008737.1 Contig631newmark_estsPMID:23079596
gutSMED30032050Cell division control protein 42 homologSMESG000064161.1 Contig2672GPL15192PMID:23079596
gutSMED3003108940S ribosomal protein S12SMESG000052688.1 dd_Smed_v4_268_0_1dd_Smed_v4PMID:29674431
gutSMED30029291SMED30029291SMESG000025667.1 SMESG000016264.1 dd_Smed_v4_4390_0_1dd_Smed_v4PMID:29674431
gutSMED30029291SMED30029291SMESG000025667.1 SMESG000016264.1 dd_4390dd_Smed_v4PMID:29674431
gutSMED30029291SMED30029291SMESG000025667.1 SMESG000016264.1 dd_4390dd_Smed_v4PMID:29674431
gutSMED30021001Protein kinaseSMESG000078478.1 Contig4368GPL15192PMID:23079596
gutSMED30021001Protein kinaseSMESG000017249.1 Contig4368GPL15192PMID:23079596
gutSMED30021001Protein kinaseSMESG000017252.1 SMESG000017249.1 SMESG000017248.1 dd_Smed_v4_311_0_1dd_Smed_v4PMID:29674431
gutSMED30022231Acyl-CoA synthetase short chain family member 3SMESG000043655.1 SMESG000043653.1 dd_Smed_v4_8062_0_1dd_Smed_v4PMID:29674431
gutSMED30024379SMED30024379SMESG000024211.1 dd_Smed_v4_4064_0_1dd_Smed_v4PMID:29674431
gutSMED30024023Retinol dehydrogenaseSMESG000071466.1 dd_Smed_v4_5348_0_1dd_Smed_v4PMID:29674431
gutSMED30024416Potassium channel tetramerization domain containing 1SMESG000067417.1 dd_Smed_v4_3793_0_1dd_Smed_v4PMID:29674431
gutSMED30022398C2H2-type domain-containing proteinSMESG000032119.1 Contig3970GPL15192PMID:23079596
gutSMED30021559SMED30021559SMESG000079496.1 dd_Smed_v4_6860_0_1dd_Smed_v4PMID:29674431
gutSMED30024282Synaptosomal-associated proteinSMESG000034282.1 Contig7503newmark_estsPMID:23079596
gutSMED30024282Synaptosomal-associated proteinSMESG000034282.1 Contig7503uc_Smed_v2PMID:23079596
gutSMED300226652-acylglycerol O-acyltransferase 2SMESG000021419.1 dd_Smed_v4_4947_0_1dd_Smed_v4PMID:29674431
gutSMED30020244Protein kinase domain containing proteinSMESG000078478.1 Contig4368GPL15192PMID:23079596
gutSMED30020244Protein kinase domain containing proteinSMESG000017249.1 Contig4368GPL15192PMID:23079596
gutSMED30020244Protein kinase domain containing proteinSMESG000017252.1 SMESG000017249.1 SMESG000017248.1 dd_Smed_v4_311_0_1dd_Smed_v4PMID:29674431
gutSMED30024391C-type lectin domain-containing proteinSMESG000028263.1 dd_Smed_v4_58_0_1dd_Smed_v4PMID:29674431
gutSMED30024391C-type lectin domain-containing proteinSMESG000028263.1 dd_Smed_v4_58_0_1dd_Smed_v4PMID:30962434
gutSMED30023739SMED30023739SMESG000058452.1 Contig1190GPL15192PMID:23079596
gutSMED30023739SMED30023739SMESG000057519.1 Contig1190GPL15192PMID:23079596
gutSMED30023739SMED30023739SMESG000057519.1 SMESG000057514.1 dd_Smed_v4_3277_0_1dd_Smed_v4PMID:29674431
gutSMED30023739SMED30023739SMESG000057519.1 Contig30434newmark_estsPMID:27612384
gutSMED30023739SMED30023739SMESG000057519.1 Contig30434uc_Smed_v2PMID:27612384
gutSMED30026950terminal uridylyltransferase 4SMESG000061695.1 Contig4822GPL15192PMID:23079596
gutSMED30026950terminal uridylyltransferase 4SMESG000041562.1 Contig4822GPL15192PMID:23079596
gutSMED30021882Disks large homolog 1SMESG000045568.1 Contig4881GPL15192PMID:23079596
gutSMED30024236InnexinSMESG000056430.1 dd_Smed_v4_734_0_1dd_Smed_v4PMID:29674431
gutSMED30024236InnexinSMESG000056430.1 AY967558smed_ncbi_20200123PMID:17670787
gutSMED30008732SMED30008732SMESG000064322.1 dd_Smed_v4_4685_1_1dd_Smed_v4PMID:29674431
gutSMED30006378PRELI/MSF1 domain-containing proteinSMESG000034043.1 DN289824ncbi_smed_estsPMID:16344473
gutSMED30006378PRELI/MSF1 domain-containing proteinSMESG000034043.1 dd_Smed_v4_922_1_1dd_Smed_v4PMID:29674431
gutSMED30009105Neuropeptide 8SMESG000069019.1 GU295189smed_ncbi_20200123PMID:20967238
gutSMED30019342SH3 and multiple ankyrin repeat domains proteinSMESG000014775.1 dd_Smed_v4_7862_0_1dd_Smed_v4PMID:29674431
gutSMED30013863Rac-1SMESG000024961.1 Contig5482GPL15192PMID:23079596
gutSMED30013863Rac-1SMESG000024961.1 dd_Smed_v4_610_0_1dd_Smed_v4PMID:29674431
gutSMED30011723persulfide dioxygenase ETHE1, mitochondrialSMESG000065858.1 dd_Smed_v4_944_0_1dd_Smed_v4PMID:29674431
gutSMED30014560SMED30014560SMESG000026537.1 dd_Smed_v4_858_0_1dd_Smed_v4PMID:29674431
gutSMED30018729T-complex protein subunit epsilonSMESG000012740.1 MF669567.1smed_ncbi_20200123PMID:29095551
gutSMED30007442SMED30007442SMESG000069832.1 dd_Smed_v4_5530_0_1dd_Smed_v4PMID:29674431
gutSMED30007704ActinSMESG000051672.1 SMESG000051670.1 dd_Smed_v4_3_0_1dd_Smed_v4PMID:29674431
gutSMED30007704ActinSMESG000036432.1 Contig450GPL15192PMID:23079596
gutSMED30007704ActinSMESG000051672.1 SMESG000051670.1 Contig450GPL15192PMID:23079596
gutSMED30007704ActinSMESG000030853.1 Contig1138GPL15192PMID:23079596
gutSMED30007704ActinSMESG000051672.1 SMESG000051670.1 Contig1138GPL15192PMID:23079596
gutSMED30013300Mitochondrial ATP synthase subunit 9SMESG000078181.1 dd_Smed_v4_23_0_1dd_Smed_v4PMID:29674431
gutSMED30008522Fatty acid-binding proteinSMESG000015143.1 dd_Smed_v4_271_0_1dd_Smed_v4PMID:29674431
gutSMED30006820cilia- and flagella-associated protein 57SMESG000072029.1 dd_Smed_v4_3323_0_1dd_Smed_v4PMID:29674431
gutSMED30006281Glycogenin-2SMESG000036946.1 dd_Smed_v4_885_0_1dd_Smed_v4PMID:29674431
gutSMED30004277InnexinSMESG000055258.1 SMESG000055257.1 dd_Smed_v4_3659_0_1dd_Smed_v4PMID:29674431
gutSMED30014822Moesin/ezrin/radixin homolog 1SMESG000056380.1 Contig1780GPL15192PMID:23079596
gutSMED30014822Moesin/ezrin/radixin homolog 1SMESG000056380.1 dd_Smed_v4_611_0_1dd_Smed_v4PMID:29674431
gutSMED30017953SMED30017953SMESG000011944.1 dd_Smed_v4_3820_0_1dd_Smed_v4PMID:29674431
gutSMED30009712epidermal growth factor receptor 1SMESG000070834.1 HM777018smed_ncbi_20200123PMID:21458439
gutSMED30009712epidermal growth factor receptor 1SMESG000070834.1 HM777018smed_ncbi_20200123PMID:27122174
gutSMED30009712epidermal growth factor receptor 1SMESG000070834.1 Contig29100newmark_estsPMID:27612384
gutSMED30009712epidermal growth factor receptor 1SMESG000070834.1 Contig29100uc_Smed_v2PMID:27612384
gutSMED30009712epidermal growth factor receptor 1SMESG000070834.1 HM777018.1smed_ncbi_20200123PMID:27122174
gutSMED30016302NADH-ubiquinone oxidoreductase 75 kDa subunit, mitochondrialSMESG000081864.1 dd_Smed_v4_2402_0_1dd_Smed_v4PMID:29674431
gutSMED30019668Proactivator polypeptideSMESG000042333.1 dd_Smed_v4_241_0_1dd_Smed_v4PMID:29674431
gutSMED30019668Proactivator polypeptideSMESG000042333.1 dd_Smed_v4_390_0_1dd_Smed_v4PMID:29674431
gutSMED30011519Mediator of RNA polymerase II transcription subunit 21SMESG000036235.1 Contig2568GPL15192PMID:23079596
gutSMED30012464SMED30012464SMESG000035411.1 dd_Smed_v4_49258_0_1dd_Smed_v4PMID:29674431
gutSMED30017639SMED30017639SMESG000035327.1 SMESG000035325.1 dd_Smed_v4_8_0_1dd_Smed_v4PMID:29674431
gutSMED30014243Lysosomal aspartic proteaseSMESG000035344.1 dd_Smed_v4_329_0_1dd_Smed_v4PMID:29674431
gutSMED3001361360S ribosomal protein L26SMESG000066644.1 dd_Smed_v4_235_0_1dd_Smed_v4PMID:29674431
gutSMED30010586Bridging integrator 3SMESG000029355.1 Contig3561GPL15192PMID:23079596
gutSMED30019727beta-catenin-like protein 2SMESG000014825.1 Contig3406GPL15192PMID:23079596
gutSMED30019727beta-catenin-like protein 2SMESG000002541.1 Contig3406GPL15192PMID:23079596
gutSMED30019727beta-catenin-like protein 2SMESG000002541.1 EU082825smed_ncbi_20200123PMID:18287199
gutSMED30014901ATP-binding cassette sub-family A member 3-like ProteinSMESG000080870.1 Contig6189newmark_estsPMID:23079596
gutSMED30014901ATP-binding cassette sub-family A member 3-like ProteinSMESG000080870.1 Contig6189uc_Smed_v2PMID:23079596
gutSMED30012378Clathrin heavy chainSMESG000040592.1 Contig5422GPL15192PMID:23079596
gutSMED30012378Clathrin heavy chainSMESG000035457.1 Contig5422GPL15192PMID:23079596
gutSMED30012378Clathrin heavy chainSMESG000072345.1 Contig4452GPL15192PMID:23079596
gutSMED30012378Clathrin heavy chainSMESG000035457.1 Contig4452GPL15192PMID:23079596
gutSMED30013673SMED30013673SMESG000035327.1 SmedASXL_016646SmedAsxl_ww_GCZZ01PMID:29158443
gutSMED30018167ImidazolonepropionaseSMESG000058218.1 dd_Smed_v4_5220_0_1dd_Smed_v4PMID:29674431
gutSMED3000723528S ribosomal protein S30, mitochondrialSMESG000042375.1 dd_Smed_v4_8469_0_1dd_Smed_v4PMID:29674431
gutSMED30010649max-like protein xSMESG000025391.1 HO006087ncbi_smed_estsPMID:24173799
gutSMED30016848SMED30016848SMESG000079496.1 dd_Smed_v4_6860_0_1dd_Smed_v4PMID:29674431
gutSMED30008411Aldo_ket_red domain-containing proteinSMESG000053228.1 dd_Smed_v4_487_0_1dd_Smed_v4PMID:29674431
gutSMED30012037InnexinSMESG000055258.1 SMESG000055257.1 dd_Smed_v4_3659_0_1dd_Smed_v4PMID:29674431
gutSMED30012993Cytochrome b-c1 complex subunit 6SMESG000040616.1 dd_Smed_v4_277_0_1dd_Smed_v4PMID:29674431
gutSMED30012572Leucine--tRNA ligaseSMESG000071689.1 dd_Smed_v4_9705_0_1dd_Smed_v4PMID:29674431
gutSMED30018398Superoxide dismutase [Cu-Zn]SMESG000005021.1 SmedASXL_019073SmedAsxl_ww_GCZZ01PMID:29158443
gutSMED30018899TetraspaninSMESG000078545.1 dd_Smed_v4_354_0_1dd_Smed_v4PMID:29674431
gutSMED30018303SMED30018303SMESG000006273.1 dd_Smed_v4_3891_0_1dd_Smed_v4PMID:29674431
gutSMED30011754ETS domain-containing proteinSMESG000021791.1 dd_Smed_v4_7040_0_1dd_Smed_v4PMID:29674431
gutSMED30014928Formin-like proteinSMESG000044336.1 Contig1407newmark_estsPMID:23079596
gutSMED30014928Formin-like proteinSMESG000015063.1 Contig1407newmark_estsPMID:23079596
gutSMED30010890Y box binding protein 1SMESG000008704.1 dd_Smed_v4_347_0_1dd_Smed_v4PMID:29674431
gutSMED30015967Neurotracting/lsamp/neurotrimin/obcam related cell adhesion moleculeSMESG000019973.1 Contig692GPL15192PMID:23079596
gutSMED30015967Neurotracting/lsamp/neurotrimin/obcam related cell adhesion moleculeSMESG000068491.1 Contig692GPL15192PMID:23079596
gutSMED30015967Neurotracting/lsamp/neurotrimin/obcam related cell adhesion moleculeSMESG000068491.1 dd_Smed_v4_2826_0_1dd_Smed_v4PMID:29674431
gutSMED30013913Adenylate kinaseSMESG000047137.1 Contig2730newmark_estsPMID:23079596
gutSMED30013913Adenylate kinaseSMESG000047137.1 Contig2730uc_Smed_v2PMID:23079596
gutSMED30013913Adenylate kinaseSMESG000069303.1 Contig2730newmark_estsPMID:23079596
gutSMED30013913Adenylate kinaseSMESG000069303.1 Contig2730uc_Smed_v2PMID:23079596
gutSMED30013477MAU2 chromatid cohesion factorSMESG000008077.1 Contig5057newmark_estsPMID:23079596
gutSMED30013477MAU2 chromatid cohesion factorSMESG000008077.1 Contig5057uc_Smed_v2PMID:23079596
gutSMED30013477MAU2 chromatid cohesion factorSMESG000017950.1 Contig5057newmark_estsPMID:23079596
gutSMED30013477MAU2 chromatid cohesion factorSMESG000017950.1 Contig5057uc_Smed_v2PMID:23079596
gutSMED30008645Endophilin-A3SMESG000043383.1 Contig1883GPL15192PMID:23079596
gutSMED30005745Protein kinaseSMESG000079303.1 Contig2289GPL15192PMID:23079596
gutSMED30005745Protein kinaseSMESG000017260.1 Contig2289GPL15192PMID:23079596
gutSMED30016571Thimet oligopeptidaseSMESG000014736.1 dd_Smed_v4_3546_0_1dd_Smed_v4PMID:29674431
gutSMED3000844110-formyltetrahydrofolate dehydrogenaseSMESG000005275.1 dd_Smed_v4_5787_0_1dd_Smed_v4PMID:29674431
gutSMED3000844110-formyltetrahydrofolate dehydrogenaseSMESG000005275.1 Contig10102newmark_estsPMID:27612384
gutSMED3000844110-formyltetrahydrofolate dehydrogenaseSMESG000005275.1 Contig10102uc_Smed_v2PMID:27612384
gutSMED30019367Set1/Ash2 histone methyltransferase complex subunit ASH2SMESG000051162.1 DN296978ncbi_smed_estsPMID:23235145
gutSMED30019367Set1/Ash2 histone methyltransferase complex subunit ASH2SMESG000051162.1 DN305606ncbi_smed_estsPMID:23235145
gutSMED30019367Set1/Ash2 histone methyltransferase complex subunit ASH2SMESG000051162.1 KC262336smed_ncbi_20200123PMID:23235145
gutSMED30017098Chaperone protein DnaJSMESG000015446.1 dd_Smed_v4_9791_0_1dd_Smed_v4PMID:29674431
gutSMED30012826SMED30012826SMESG000017012.1 SMESG000017011.1 dd_Smed_v4_309_0_1dd_Smed_v4PMID:29674431
gutSMED30016141lissencephaly-1SMESG000054739.1 SMESG000035997.1 JQ650355.1smed_ncbi_20200123PMID:22411224
gutSMED30018495ATPase_AAA_core domain-containing proteinSMESG000073596.1 dd_Smed_v4_9568_0_1dd_Smed_v4PMID:29674431
gutSMED30018495ATPase_AAA_core domain-containing proteinSMESG000073596.1 dd_Smed_v4_9484_0_1dd_Smed_v4PMID:29674431
gutSMED30006144Helicase with zinc finger domain 2SMESG000022691.1 SMESG000022690.1 Contig229GPL15192PMID:23079596
gutSMED30011909SMED30011909SMESG000027686.1 Contig2364GPL15192PMID:23079596
gutSMED30011909SMED30011909SMESG000012131.1 SMESG000012127.1 Contig2364GPL15192PMID:23079596
gutSMED30005837SMED30005837SMESG000016663.1 dd_Smed_v4_229_0_1dd_Smed_v4PMID:29674431
gutSMED30006887Gelsolin-like proteinSMESG000001429.1 Contig4707GPL15192PMID:23079596
gutSMED30006887Gelsolin-like proteinSMESG000015927.1 Contig4707GPL15192PMID:23079596
gutSMED30006887Gelsolin-like proteinSMESG000015927.1 dd_Smed_v4_929_0_1dd_Smed_v4PMID:29674431
gutSMED30014138LIM homeobox 1bSMESG000061052.1 Contig4742GPL15192PMID:23079596
gutSMED30014138LIM homeobox 1bSMESG000022856.1 Contig4742GPL15192PMID:23079596
gutSMED30014138LIM homeobox 1bSMESG000022856.1 dd_Smed_v4_8252_0_1dd_Smed_v4PMID:29674431
gutSMED30010493MATS2SMESG000015163.1 Contig1173GPL15192PMID:23079596
gutSMED3001990360S ribosomal protein L13aSMESG000041483.1 dd_Smed_v4_287_0_1dd_Smed_v4PMID:29674431
gutSMED30012816AminomethyltransferaseSMESG000012592.1 dd_Smed_v4_3994_0_1dd_Smed_v4PMID:29674431
gutSMED30019887SMED30019887SMESG000011341.1 dd_Smed_v4_2941_0_1dd_Smed_v4PMID:29674431
gutSMED30015801SMED30015801SMESG000079303.1 Contig2289newmark_estsPMID:23079596
gutSMED30015801SMED30015801SMESG000017260.1 Contig2289newmark_estsPMID:23079596
gutSMED30007568NADH-ubiquinone oxidoreductase 75 kDa subunit, mitochondrialSMESG000081864.1 dd_Smed_v4_2402_0_1dd_Smed_v4PMID:29674431
gutSMED30015286HexosyltransferaseSMESG000023690.1 dd_Smed_v4_9789_0_1dd_Smed_v4PMID:29674431
gutSMED30015783O-acyltransferaseSMESG000000989.1 SMESG000000988.1 dd_Smed_v4_2567_0_1dd_Smed_v4PMID:29674431
gutSMED30015783O-acyltransferaseSMESG000000989.1 SMESG000000988.1 Contig1658GPL15192PMID:23079596
gutSMED30018610MFS domain-containing proteinSMESG000069673.1 dd_Smed_v4_4607_0_1dd_Smed_v4PMID:29674431
gutSMED30005889LPTSMESG000040592.1 Contig5422newmark_estsPMID:23079596
gutSMED30005889LPTSMESG000040592.1 Contig5422uc_Smed_v2PMID:23079596
gutSMED30005889LPTSMESG000035457.1 Contig5422newmark_estsPMID:23079596
gutSMED30005889LPTSMESG000035457.1 Contig5422uc_Smed_v2PMID:23079596
gutSMED30012651Retrovirus-related Pol polyprotein from transposonSMESG000034282.1 Contig7503newmark_estsPMID:23079596
gutSMED30012651Retrovirus-related Pol polyprotein from transposonSMESG000034282.1 Contig7503uc_Smed_v2PMID:23079596
gutSMED30017714Basement membrane-specific heparan sulfate proteoglycan core proteinSMESG000075928.1 Contig7205newmark_estsPMID:23079596
gutSMED30017714Basement membrane-specific heparan sulfate proteoglycan core proteinSMESG000075928.1 Contig7205uc_Smed_v2PMID:23079596
gutSMED30014908slc46a-3SMESG000065064.1 dd_Smed_v4_7847_0_1dd_Smed_v4PMID:29674431
gutSMED30016943slc15a-6SMESG000064204.1 Contig1439GPL15192PMID:23079596
gutSMED30016943slc15a-6SMESG000030835.1 Contig1439GPL15192PMID:23079596
gutSMED30016943slc15a-6SMESG000030835.1 dd_Smed_v4_3578_0_1dd_Smed_v4PMID:29674431
gutSMED30013645Malate dehydrogenaseSMESG000073623.1 dd_Smed_v4_3440_0_1dd_Smed_v4PMID:29674431
gutSMED30019823AP-3 complex subunit sigmaSMESG000048773.1 dd_Smed_v4_4819_0_1dd_Smed_v4PMID:29674431
gutSMED30011818C2H2-type domain-containing proteinSMESG000048024.1 dd_Smed_v4_892_0_1dd_Smed_v4PMID:29674431
gutSMED30021941SMED30021941SMESG000051593.1 Contig4912newmark_estsPMID:23079596
gutSMED30021941SMED30021941SMESG000051593.1 Contig4912uc_Smed_v2PMID:23079596
gutSMED30021941SMED30021941SMESG000019014.1 Contig4912newmark_estsPMID:23079596
gutSMED30021941SMED30021941SMESG000019014.1 Contig4912uc_Smed_v2PMID:23079596
gutSMED30021511SMED30021511SMESG000038232.1 Contig5776GPL15192PMID:23079596
gutSMED30023269ANK_REP_REGION domain-containing proteinSMESG000020728.1 Contig2805GPL15192PMID:23079596
gutSMED30023232Lysine methyltransferase 2ESMESG000051295.1 DN314063ncbi_smed_estsPMID:23235145
gutSMED30023232Lysine methyltransferase 2ESMESG000051295.1 HO006509ncbi_smed_estsPMID:23235145
gutSMED3002077640S ribosomal protein S21SMESG000004954.1 dd_Smed_v4_84_0_1dd_Smed_v4PMID:29674431
gutSMED30021235Tubulin alpha chainSMESG000079004.1 dd_Smed_v4_452_0_1dd_Smed_v4PMID:29674431
gutSMED30021235Tubulin alpha chainSMESG000079004.1 PL030009A10F06ncbi_smed_estsPMID:23079596
gutSMED30021235Tubulin alpha chainSMESG000059785.1 Contig1211GPL15192PMID:23079596
gutSMED30021235Tubulin alpha chainSMESG000079004.1 Contig1211GPL15192PMID:23079596
gutSMED30021445S-adenosylmethionine synthaseSMESG000053202.1 EG413862ncbi_smed_estsPMID:23318641
gutSMED30021445S-adenosylmethionine synthaseSMESG000053202.1 EG413862ncbi_smed_estsPMID:21566185
gutSMED30021445S-adenosylmethionine synthaseSMESG000053202.1 SMESG000053199.1 dd_Smed_v4_907_0_1dd_Smed_v4PMID:29674431
gutSMED30021445S-adenosylmethionine synthaseSMESG000053202.1 SMESG000053199.1 dd_Smed_v4_907_0_1dd_Smed_v4PMID:29674431
gutSMED30025591porcupine-like proteinSMESG000051516.1 EU130791.1smed_ncbi_20200123PMID:28072387
gutSMED30025591porcupine-like proteinSMESG000051516.1 EU130791smed_ncbi_20200123PMID:18063757
gutSMED30025591porcupine-like proteinSMESG000051516.1 EU130791smed_ncbi_20200123PMID:28072387
gutSMED30025591porcupine-like proteinSMESG000051516.1 EU130791smed_ncbi_20200123PMID:28072387
gutSMED30025591porcupine-like proteinSMESG000051516.1 EU130791smed_ncbi_20200123PMID:28072387
gutSMED30025591porcupine-like proteinSMESG000051516.1 dd_Smed_v4_413_0_1dd_Smed_v4PMID:29674431
gutSMED30025591porcupine-like proteinSMESG000051516.1 SMESG000051515.1 SMED30025591smed_20140614PMID:28072387
gutSMED30025591porcupine-like proteinSMESG000051516.1 SMESG000051515.1 SMED30025591smed_20140614PMID:28072387
gutSMED30025591porcupine-like proteinSMESG000051516.1 SMESG000051515.1 SMED30025591smed_20140614PMID:28072387
gutSMED30025591porcupine-like proteinSMESG000051516.1 ABW97518.1smed_ncbi_20200123PMID:20707997
gutSMED30020231DUF3421 domain-containing proteinSMESG000046728.1 SmedASXL_004676SmedAsxl_ww_GCZZ01PMID:29158443
gutSMED30020231DUF3421 domain-containing proteinSMESG000046728.1 dd_Smed_v4_1984_0_1dd_Smed_v4PMID:29674431
gutSMED30033774CatalaseSMESG000055572.1 dd_Smed_v4_859_0_1dd_Smed_v4PMID:29674431
gutSMED30028184Ras-related protein Rab-32SMESG000060723.1 dd_Smed_v4_1037_0_1dd_Smed_v4PMID:29674431
gutSMED30028453Lysosomal alpha-glucosidaseSMESG000005050.1 dd_Smed_v4_1062_0_1dd_Smed_v4PMID:29674431
gutSMED30028453Lysosomal alpha-glucosidaseSMESG000005054.1 dd_Smed_v4_5392_0_1dd_Smed_v4PMID:29674431
gutSMED30030013GTP-binding nuclear proteinSMESG000072524.1 SMESG000072522.1 dd_Smed_v4_330_0_1dd_Smed_v4PMID:29674431
gutSMED3002420240S ribosomal protein S14SMESG000036550.1 dd_Smed_v4_139_0_1dd_Smed_v4PMID:29674431
gutSMED30022579SMED30022579SMESG000001429.1 Contig4707newmark_estsPMID:23079596
gutSMED30022579SMED30022579SMESG000015927.1 Contig4707newmark_estsPMID:23079596
gutSMED30024115Ubiquitin-40S ribosomal protein S27aSMESG000048830.1 DN303026ncbi_smed_estsPMID:16344473
gutSMED30024115Ubiquitin-40S ribosomal protein S27aSMESG000048830.1 dd_Smed_v4_121_0_1dd_Smed_v4PMID:29674431
gutSMED30026669WD repeat and SOCS box-containing 1SMESG000032294.1 dd_Smed_v4_1381_0_1dd_Smed_v4PMID:29674431
gutSMED30021390SMED30021390SMESG000033382.1 Contig3395newmark_estsPMID:23079596
gutSMED30021335G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000016714.1 dd_Smed_v4_11488_0_1dd_Smed_v4PMID:29674431
gutSMED30031134slc13a-3SMESG000050959.1 dd_Smed_v4_1171_0_1dd_Smed_v4PMID:29674431
gutSMED30021590Spectrin beta chainSMESG000081696.1 dd_Smed_v4_1122_0_1dd_Smed_v4PMID:29674431
gutSMED30035143PiggyBac transposable element-derived protein 2SMESG000052698.1 SMESG000027142.1 SMESG000059994.1 dd_Smed_v4_1029_1_1dd_Smed_v4PMID:29674431
gutSMED30029625slc39a-1SMESG000016191.1 dd_Smed_v4_1731_0_1dd_Smed_v4PMID:29674431
gutSMED30029625slc39a-1SMESG000016191.1 SmedASXL_003002SmedAsxl_ww_GCZZ01PMID:29158443
gutSMED30020872Myosin IESMESG000041553.1 Contig4772GPL15192PMID:23079596
gutSMED30020872Myosin IESMESG000068232.1 Contig4772GPL15192PMID:23079596
gutSMED30020872Myosin IESMESG000003513.1 Contig59GPL15192PMID:23079596
gutSMED30020872Myosin IESMESG000068232.1 Contig59GPL15192PMID:23079596
gutSMED30023411slc42a-1SMESG000048384.1 dd_Smed_v4_1882_0_1dd_Smed_v4PMID:29674431
gutSMED30027021RUN domain-containing proteinSMESG000080383.1 dd_Smed_v4_10989_0_1dd_Smed_v4PMID:29674431
gutSMED30022209ATPase family AAA domain containing proteinSMESG000003318.1 dd_Smed_v4_1807_0_1dd_Smed_v4PMID:29674431
gutSMED30020956Lysosomal alpha-glucosidaseSMESG000005050.1 dd_Smed_v4_1062_0_1dd_Smed_v4PMID:29674431
gutSMED30020956Lysosomal alpha-glucosidaseSMESG000054351.1 Contig1590GPL15192PMID:23079596
gutSMED30020956Lysosomal alpha-glucosidaseSMESG000005053.1 SMESG000005050.1 Contig1590GPL15192PMID:23079596
gutSMED30026513SMED30026513SMESG000005268.1 dd_Smed_v4_1537_0_1dd_Smed_v4PMID:29674431
gutSMED30035963SMED30035963SMESG000071278.1 dd_Smed_v4_1649_0_1dd_Smed_v4PMID:29674431
gutSMED30023862SMED30023862SMESG000009332.1 SMESG000009320.1 Contig505newmark_estsPMID:23079596
gutSMED30023862SMED30023862SMESG000009332.1 SMESG000009320.1 Contig505uc_Smed_v2PMID:23079596
gutSMED30023862SMED30023862SMESG000041448.1 Contig505newmark_estsPMID:23079596
gutSMED30023862SMED30023862SMESG000041448.1 Contig505uc_Smed_v2PMID:23079596
gutSMED30021161MARVEL domain-containing proteinSMESG000077709.1 SMESG000073947.1 SMESG000043656.1 SMESG000043279.1 SMESG000008519.1 SMESG000001897.1 Contig22GPL15192PMID:23079596
gutSMED30021161MARVEL domain-containing proteinSMESG000013795.1 Contig22GPL15192PMID:23079596
gutSMED30021161MARVEL domain-containing proteinSMESG000013795.1 dd_Smed_v4_1798_0_1dd_Smed_v4PMID:29674431
gutSMED3002418960S ribosomal protein L31SMESG000017099.1 dd_Smed_v4_113_0_1dd_Smed_v4PMID:29674431
gutSMED30021196SMED30021196SMESG000015163.1 Contig1173newmark_estsPMID:23079596
gutSMED30022425PeroxiredoxinSMESG000002993.1 dd_Smed_v4_1290_0_1dd_Smed_v4PMID:29674431
gutSMED30010718Cyclin-dependent kinase-like 1SMESG000078505.1 dd_Smed_v4_8300_0_1dd_Smed_v4PMID:29674431
gutSMED30010718Cyclin-dependent kinase-like 1SMESG000078505.1 dd_Smed_v4_8479_0_1dd_Smed_v4PMID:29674431
gutSMED30007156OxidoreductaseSMESG000002835.1 Contig5582GPL15192PMID:23079596
gutSMED30007156OxidoreductaseSMESG000016829.1 Contig5582GPL15192PMID:23079596
gutSMED30007156OxidoreductaseSMESG000016829.1 dd_Smed_v4_2290_0_1dd_Smed_v4PMID:29674431
gutSMED30014430ProtocadherinSMESG000027424.1 dd_Smed_v4_11605_0_1dd_Smed_v4PMID:29674431
gutSMED30005698SMED30005698SMESG000052123.1 dd_Smed_v4_2845_0_1dd_Smed_v4PMID:29674431
gutSMED30003079Prominin (Prom) protein, putativeSMESG000062666.1 Contig3501newmark_estsPMID:23079596
gutSMED30003079Prominin (Prom) protein, putativeSMESG000062666.1 Contig3501uc_Smed_v2PMID:23079596
gutSMED30003079Prominin (Prom) protein, putativeSMESG000015778.1 Contig3501newmark_estsPMID:23079596
gutSMED30003079Prominin (Prom) protein, putativeSMESG000015778.1 Contig3501uc_Smed_v2PMID:23079596
gutSMED30003079Prominin (Prom) protein, putativeSMESG000062666.1 dd_Smed_v4_4461_0_1dd_Smed_v4PMID:29674431
gutSMED30003372SMED30003372SMESG000020860.1 dd_Smed_v4_14_0_1dd_Smed_v4PMID:29674431
gutSMED30011615SMED30011615SMESG000036524.1 dd_Smed_v4_11034_0_1dd_Smed_v4PMID:29674431
gutSMED30012966SMED30012966SMESG000052698.1 SMESG000027142.1 SMESG000059994.1 dd_Smed_v4_1029_1_1dd_Smed_v4PMID:29674431
gutSMED30012966SMED30012966SMESG000079607.1 SMESG000072955.1 SMESG000049847.1 SMESG000049844.1 SMESG000049832.1 SMESG000049812.1 SMESG000049806.1 SMESG000049805.1 SMESG000049772.1 SMESG000049767.1 SMESG000049756.1 SMESG000049745.1 SMESG000049740.1 SMESG000049739.1 SMESG000049695.1 SMESG000049688.1 SMESG000049683.1 SMESG000049676.1 SMESG000049665.1 SMESG000049663.1 SMESG000049647.1 SMESG000049621.1 SMESG000049614.1 SMESG000049601.1 SMESG000049567.1 SMESG000049548.1 SMESG000040301.1 SMESG000040257.1 SMESG000032755.1 SMESG000032715.1 SMESG000022696.1 SMESG000022691.1 SMESG000022676.1 SMESG000022665.1 SMESG000022640.1 SMESG000022619.1 SMESG000022612.1 dd_Smed_v4_490_0_1dd_Smed_v4PMID:29674431
gutSMED30006119X-box-binding protein 1SMESG000003891.1 Contig1388GPL15192PMID:23079596
gutSMED30006119X-box-binding protein 1SMESG000048111.1 Contig1388GPL15192PMID:23079596
gutSMED30004118Tubulin beta chainSMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044907.1 SMESG000044888.1 SMESG000035804.1 SMESG000035755.1 Contig2059GPL15192PMID:23079596
gutSMED30019771Ammonium transporter Rh type BSMESG000048384.1 dd_Smed_v4_1882_0_1dd_Smed_v4PMID:29674431
gutSMED30016832SH3 domain-binding protein 5-likeSMESG000061052.1 Contig4742newmark_estsPMID:23079596
gutSMED30016832SH3 domain-binding protein 5-likeSMESG000061052.1 Contig4742uc_Smed_v2PMID:23079596
gutSMED30016832SH3 domain-binding protein 5-likeSMESG000022856.1 Contig4742newmark_estsPMID:23079596
gutSMED30016832SH3 domain-binding protein 5-likeSMESG000022856.1 Contig4742uc_Smed_v2PMID:23079596
gutSMED30017013Vesicle-associated membrane protein 3SMESG000033382.1 Contig3395GPL15192PMID:23079596
gutSMED30017013Vesicle-associated membrane protein 3SMESG000079659.1 SMESG000079651.1 Contig154GPL15192PMID:23079596
gutSMED30017013Vesicle-associated membrane protein 3SMESG000033382.1 Contig154GPL15192PMID:23079596
gutSMED30017013Vesicle-associated membrane protein 3SMESG000033382.1 dd_Smed_v4_1311_0_1dd_Smed_v4PMID:29674431
gutSMED30018984prefoldin subunit 2SMESG000075156.1 SMESG000075150.1 dd_Smed_v4_1368_0_1dd_Smed_v4PMID:29674431
gutSMED30005741Actin-related protein 2/3 complex subunitSMESG000062666.1 Contig3501GPL15192PMID:23079596
gutSMED30005741Actin-related protein 2/3 complex subunitSMESG000015778.1 Contig3501GPL15192PMID:23079596
gutSMED30005741Actin-related protein 2/3 complex subunitSMESG000015778.1 Contig1955GPL15192PMID:23079596
gutSMED30005741Actin-related protein 2/3 complex subunitSMESG000015778.1 dd_Smed_v4_978_0_1dd_Smed_v4PMID:29674431
gutSMED30019184Protein NDRG3SMESG000005122.1 dd_Smed_v4_3896_0_1dd_Smed_v4PMID:29674431
gutSMED30000967DUF3421 domain-containing proteinSMESG000057816.1 dd_Smed_v4_87_0_1dd_Smed_v4PMID:29674431
gutSMED30000967DUF3421 domain-containing proteinSMESG000068156.1 SMESG000064685.1 SMESG000010609.1 SMESG000076470.1 SMESG000073857.1 SMESG000062429.1 SMESG000060487.1 SMESG000058575.1 SMESG000053533.1 SMESG000026676.1 SMESG000020635.1 SMESG000015751.1 SMESG000005260.1 Contig239GPL15192PMID:23079596
gutSMED30000967DUF3421 domain-containing proteinSMESG000057816.1 Contig239GPL15192PMID:23079596
gutSMED3001369960S ribosomal protein L9SMESG000003774.1 dd_Smed_v4_150_0_1dd_Smed_v4PMID:29674431
gutSMED30002513Histidine ammonia-lyaseSMESG000002694.1 SMESG000002559.1 dd_Smed_v4_2970_0_1dd_Smed_v4PMID:29674431
gutSMED30002513Histidine ammonia-lyaseSMESG000002694.1 SMESG000002559.1 dd_Smed_v4_2219_0_1dd_Smed_v4PMID:29674431
gutSMED30009281Netrin-4SMESG000062589.1 dd_Smed_v4_6093_0_1dd_Smed_v4PMID:29674431
gutSMED30009281Netrin-4SMESG000062589.1 dd_Smed_v4_6093_0_1dd_Smed_v4PMID:27063937
gutSMED30009281Netrin-4SMESG000062589.1 dd_Smed_v4_6093_0_1dd_Smed_v4PMID:30962434
gutSMED3000344260S ribosomal protein L23SMESG000023040.1 dd_Smed_v4_242_0_1dd_Smed_v4PMID:29674431
gutSMED30005014ATP synthase subunit alphaSMESG000004897.1 dd_Smed_v4_731_0_1dd_Smed_v4PMID:29674431
gutSMED30012677Coiled-coil domain-containing protein 51SMESG000058452.1 Contig1190newmark_estsPMID:23079596
gutSMED30012677Coiled-coil domain-containing protein 51SMESG000058452.1 Contig1190uc_Smed_v2PMID:23079596
gutSMED30012677Coiled-coil domain-containing protein 51SMESG000057519.1 Contig1190newmark_estsPMID:23079596
gutSMED30012677Coiled-coil domain-containing protein 51SMESG000057519.1 Contig1190uc_Smed_v2PMID:23079596
gutSMED30012379SMED30012379SMESG000058557.1 dd_Smed_v4_1432_0_1dd_Smed_v4PMID:29674431
gutSMED30002213Zinc finger, C2H2 typeSMESG000070776.1 SMESG000049855.1 Contig1854GPL15192PMID:23079596
gutSMED30002213Zinc finger, C2H2 typeSMESG000075102.1 Contig1854GPL15192PMID:23079596
gutSMED30002213Zinc finger, C2H2 typeSMESG000075102.1 SMED30002213smed_20140614PMID:26457503
gutSMED30002213Zinc finger, C2H2 typeSMESG000075102.1 dd_Smed_v4_3443_0_1dd_Smed_v4PMID:27063937
gutSMED30002213Zinc finger, C2H2 typeSMESG000075102.1 dd_Smed_v4_3443_0_1dd_Smed_v4PMID:29674431
gutSMED30000562Acyl-CoA synthetase short chain family member 3SMESG000043630.1 dd_Smed_v4_2832_0_1dd_Smed_v4PMID:29674431
gutSMED30012981Cyclic nucleotide gated channel 1SMESG000036524.1 dd_Smed_v4_11034_0_1dd_Smed_v4PMID:29674431
gutSMED30013289SMED30013289SMESG000045568.1 Contig4881newmark_estsPMID:23079596
gutSMED30013289SMED30013289SMESG000045568.1 Contig4881uc_Smed_v2PMID:23079596
gutSMED30014491Aldehyde dehydrogenaseSMESG000010552.1 dd_Smed_v4_1680_0_1dd_Smed_v4PMID:29674431
gutSMED30014756SMED30014756SMESG000035312.1 SMESG000035313.1 dd_131dd_Smed_v4PMID:29674431
gutSMED30014756SMED30014756SMESG000035312.1 SMESG000035313.1 dd_131dd_Smed_v4PMID:29674431
gutSMED30016088Protein arginine N-methyltransferase 6SMESG000017273.1 dd_Smed_v4_1336_0_1dd_Smed_v4PMID:29674431
gutSMED30000118Leucine-rich repeat flightless-interacting protein 2SMESG000041553.1 Contig4772newmark_estsPMID:23079596
gutSMED30000118Leucine-rich repeat flightless-interacting protein 2SMESG000041553.1 Contig4772uc_Smed_v2PMID:23079596
gutSMED30000118Leucine-rich repeat flightless-interacting protein 2SMESG000068232.1 Contig4772newmark_estsPMID:23079596
gutSMED30000118Leucine-rich repeat flightless-interacting protein 2SMESG000068232.1 Contig4772uc_Smed_v2PMID:23079596
gutSMED30012193Ornithine aminotransferaseSMESG000055175.1 dd_Smed_v4_1896_0_1dd_Smed_v4PMID:29674431
gutSMED30008591Zinc finger MYM-type protein 1SMESG000053671.1 SMESG000053667.1 Contig5414newmark_estsPMID:23079596
gutSMED30008591Zinc finger MYM-type protein 1SMESG000053671.1 SMESG000053667.1 Contig5414uc_Smed_v2PMID:23079596
gutSMED30003680RanBP-type and C3HC4-type zinc finger-containing protein 1SMESG000069298.1 Contig3532GPL15192PMID:23079596
gutSMED30019834Guanine nucleotide-binding protein subunit beta-2-like 1SMESG000076568.1 dd_Smed_v4_174_0_1dd_Smed_v4PMID:29674431
gutSMED30001306SMED30001306SMESG000068156.1 SMESG000064685.1 SMESG000010609.1 SMESG000076470.1 SMESG000073857.1 SMESG000062429.1 SMESG000060487.1 SMESG000058575.1 SMESG000053533.1 SMESG000026676.1 SMESG000020635.1 SMESG000015751.1 SMESG000005260.1 Contig239newmark_estsPMID:23079596
gutSMED30001306SMED30001306SMESG000057816.1 Contig239newmark_estsPMID:23079596
gutSMED30001306SMED30001306SMESG000068156.1 SMESG000010609.1 SMESG000076470.1 SMESG000073857.1 SMESG000062429.1 SMESG000060487.1 SMESG000058575.1 SMESG000053533.1 SMESG000026676.1 SMESG000020635.1 SMESG000015751.1 SMESG000005260.1 Contig236newmark_estsPMID:23079596
gutSMED30001306SMED30001306SMESG000037949.1 Contig236newmark_estsPMID:23079596
gutSMED30011242Synaptosomal-associated protein 29SMESG000024796.1 Contig3946GPL15192PMID:23079596
gutSMED30011242Synaptosomal-associated protein 29SMESG000001576.1 Contig3946GPL15192PMID:23079596
gutSMED30001360Lipopolysaccharide cholineSMESG000060269.1 Contig2381newmark_estsPMID:23079596
gutSMED30001360Lipopolysaccharide cholineSMESG000060269.1 Contig2381uc_Smed_v2PMID:23079596
gutSMED30001360Lipopolysaccharide cholineSMESG000029882.1 Contig2381newmark_estsPMID:23079596
gutSMED30001360Lipopolysaccharide cholineSMESG000029882.1 Contig2381uc_Smed_v2PMID:23079596
gutSMED30005316ADP-ribosylation factor 1SMESG000000945.1 SMESG000000928.1 Contig3270GPL15192PMID:23079596
gutSMED300172003'(2'),5'-bisphosphate nucleotidase 1SMESG000014111.1 Contig4084GPL15192PMID:23079596
gutSMED300172003'(2'),5'-bisphosphate nucleotidase 1SMESG000014111.1 SMESG000014107.1 dd_Smed_v4_1334_0_1dd_Smed_v4PMID:29674431
gutSMED30001501Vacuolar protein sorting-associated protein 13A/CSMESG000037244.1 dd_Smed_v4_1648_0_1dd_Smed_v4PMID:29674431
gutSMED30014151Glutamine synthetaseSMESG000003831.1 dd_Smed_v4_1275_0_1dd_Smed_v4PMID:29674431
gutSMED30014558SMED30014558SMESG000023649.1 dd_Smed_v4_184_0_1dd_Smed_v4PMID:29674431
gutSMED30001490ADF-H domain-containing proteinSMESG000080129.1 dd_Smed_v4_260_0_1dd_Smed_v4PMID:29674431
gutSMED30001490ADF-H domain-containing proteinSMESG000080129.1 PL030005A10G01ncbi_smed_estsPMID:21664348
gutSMED30001490ADF-H domain-containing proteinSMESG000080129.1 DN290811ncbi_smed_estsPMID:21664348
gutSMED30001490ADF-H domain-containing proteinSMESG000080129.1 Contig513GPL15192PMID:23079596
gutSMED30005571Delta-1-pyrroline-5-carboxylate synthaseSMESG000045474.1 dd_Smed_v4_1060_0_1dd_Smed_v4PMID:29674431
gutSMED300197111,4-alpha-glucan-branching enzymeSMESG000060455.1 dd_Smed_v4_2161_0_1dd_Smed_v4PMID:29674431
gutSMED3001918960S ribosomal protein L37aSMESG000078736.1 dd_Smed_v4_140_0_1dd_Smed_v4PMID:29674431
gutSMED30012869Y-box-binding protein 1SMESG000032189.1 Contig3807GPL15192PMID:23079596
gutSMED30012869Y-box-binding protein 1SMESG000032189.1 dd_Smed_v4_114_0_1dd_Smed_v4PMID:29674431
gutSMED30019306Pyridoxal 5'-phosphate synthase subunit PdxTSMESG000058074.1 dd_Smed_v4_1595_0_1dd_Smed_v4PMID:29674431
gutSMED30013080G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000001813.1 dd_Smed_v4_19933_0_1dd_Smed_v4PMID:29674431
gutSMED30019261SMED30019261SMESG000022691.1 SMESG000022690.1 Contig229newmark_estsPMID:23079596
gutSMED30005382TYR_PHOSPHATASE_2 domain-containing proteinSMESG000030078.1 Contig1352GPL15192PMID:23079596
gutSMED30005382TYR_PHOSPHATASE_2 domain-containing proteinSMESG000030078.1 dd_Smed_v4_6110_0_1dd_Smed_v4PMID:29674431
gutSMED30011603Rho guanine nucleotide exchange factorSMESG000008077.1 Contig5057GPL15192PMID:23079596
gutSMED30011603Rho guanine nucleotide exchange factorSMESG000017950.1 Contig5057GPL15192PMID:23079596
gutSMED30011603Rho guanine nucleotide exchange factorSMESG000003891.1 Contig1388newmark_estsPMID:23079596
gutSMED30011603Rho guanine nucleotide exchange factorSMESG000048111.1 Contig1388newmark_estsPMID:23079596
gutSMED3001242160S ribosomal protein L37aSMESG000078736.1 dd_Smed_v4_140_0_1dd_Smed_v4PMID:29674431
gutSMED30019300Histone deacetylase,putativeSMESG000006246.1 dd_Smed_v4_1997_0_1dd_Smed_v4PMID:29674431
gutSMED30019300Histone deacetylase,putativeSMESG000006246.1 Contig3291GPL15192PMID:23079596
gutSMED30006740SJCHGC04139 proteinSMESG000045533.1 Contig1156GPL15192PMID:23079596
gutSMED30006740SJCHGC04139 proteinSMESG000035447.1 Contig1156GPL15192PMID:23079596
gutSMED30011963SMED30011963SMESG000032294.1 dd_Smed_v4_1381_0_1dd_Smed_v4PMID:29674431
gutSMED30005231Polyadenylate-binding proteinSMESG000058745.1 dd_Smed_v4_93_0_1dd_Smed_v4PMID:29674431
gutSMED30018826Mov10 like RISC complex RNA helicase 1SMESG000069873.1 SMESG000069862.1 DN311570ncbi_smed_estsPMID:16344473
gutSMED30001668SMED30001668SMESG000033527.1 Contig2307GPL15192PMID:23079596
gutSMED3000270360S ribosomal protein L23aSMESG000074545.1 dd_Smed_v4_281_0_1dd_Smed_v4PMID:29674431
gutSMED30006211Transmembrane protease serineSMESG000068156.1 SMESG000043474.1 SMESG000076470.1 SMESG000053533.1 SMESG000015751.1 Contig250GPL15192PMID:23079596
gutSMED30006211Transmembrane protease serineSMESG000025034.1 Contig250GPL15192PMID:23079596
gutSMED30006211Transmembrane protease serineSMESG000025034.1 dd_Smed_v4_4090_0_1dd_Smed_v4PMID:29674431
gutSMED30017140Ras-related protein Rap-1bSMESG000008077.1 Contig5057GPL15192PMID:23079596
gutSMED30017140Ras-related protein Rap-1bSMESG000017950.1 Contig5057GPL15192PMID:23079596
gutSMED30001271SMED30001271SMESG000038975.1 dd_Smed_v4_930_0_1dd_Smed_v4PMID:29674431
gutSMED30013396perilipin-2 isoform X1SMESG000075481.1 dd_Smed_v4_154_0_1dd_Smed_v4PMID:29674431
gutSMED30017937WASP like actin nucleation promoting factor bSMESG000036683.1 Contig4572GPL15192PMID:23079596
gutSMED30017937WASP like actin nucleation promoting factor bSMESG000074788.1 Contig4572GPL15192PMID:23079596
gutSMED30013155SMED30013155SMESG000019927.1 SMESG000019926.1 dd_Smed_v4_1347_0_1dd_Smed_v4PMID:29674431
gutSMED30006484EGF-like domain-containing proteinSMESG000032835.1 SMESG000032829.1 Contig2869GPL15192PMID:23079596
gutSMED30006484EGF-like domain-containing proteinSMESG000034231.1 Contig2869GPL15192PMID:23079596
gutSMED30003493Telomerase protein component 1SMESG000032835.1 SMESG000032829.1 Contig2869newmark_estsPMID:23079596
gutSMED30003493Telomerase protein component 1SMESG000032835.1 SMESG000032829.1 Contig2869uc_Smed_v2PMID:23079596
gutSMED30003493Telomerase protein component 1SMESG000034231.1 Contig2869newmark_estsPMID:23079596
gutSMED30003493Telomerase protein component 1SMESG000034231.1 Contig2869uc_Smed_v2PMID:23079596
gutSMED30027768SMED30027768SMESG000045568.1 Contig4881newmark_estsPMID:23079596
gutSMED30027768SMED30027768SMESG000045568.1 Contig4881uc_Smed_v2PMID:23079596
gutSMED30020784SMED30020784SMESG000011782.1 dd_Smed_v4_10359_0_1dd_Smed_v4PMID:29674431
gutSMED30020784SMED30020784SMESG000011782.1 Contig32583newmark_estsPMID:27612384
gutSMED30020784SMED30020784SMESG000011782.1 Contig32583uc_Smed_v2PMID:27612384
gutSMED30020784SMED30020784SMESG000011782.1 Contig1076GPL15192PMID:23079596
gutSMED30025591porcupine-like proteinSMESG000051516.1 EU130791.1smed_ncbi_20200123PMID:29557542
gutSMED30025591porcupine-like proteinSMESG000051516.1 EU130791.1smed_ncbi_20200123PMID:23318635
gutSMED30025591porcupine-like proteinSMESG000051516.1 EU130791.1smed_ncbi_20200123PMID:18063757
gutSMED30025591porcupine-like proteinSMESG000051516.1 EU130791.1smed_ncbi_20200123PMID:22125640
gutSMED30025591porcupine-like proteinSMESG000051516.1 EU130791.1smed_ncbi_20200123PMID:20707997
gutSMED30025591porcupine-like proteinSMESG000051516.1 EU130791.1smed_ncbi_20200123PMID:28072387
gutSMED30025591porcupine-like proteinSMESG000051516.1 EU130791.1smed_ncbi_20200123PMID:28072387
gutSMED30027910Calpain-5SMESG000045063.1 Contig7340newmark_estsPMID:23079596
gutSMED30027910Calpain-5SMESG000045063.1 Contig7340uc_Smed_v2PMID:23079596
gutSMED30022385Hyaluronan binding protein 2SMESG000061109.1 dd_Smed_v4_2031_0_1dd_Smed_v4PMID:29674431
gutSMED30024498SMED30024498SMESG000036544.1 Contig3175newmark_estsPMID:23079596
gutSMED30024498SMED30024498SMESG000036544.1 Contig3175uc_Smed_v2PMID:23079596
gutSMED30024498SMED30024498SMESG000000175.1 Contig3175newmark_estsPMID:23079596
gutSMED30024498SMED30024498SMESG000000175.1 Contig3175uc_Smed_v2PMID:23079596
gutSMED30032393SMED30032393SMESG000036683.1 Contig4572newmark_estsPMID:23079596
gutSMED30032393SMED30032393SMESG000074788.1 Contig4572newmark_estsPMID:23079596
gutSMED30033842SMED30033842SMESG000030078.1 Contig1352newmark_estsPMID:23079596
gutSMED30021752Cytochrome P450 2K1-like proteinSMESG000073604.1 Contig1511GPL15192PMID:23079596
gutSMED30021752Cytochrome P450 2K1-like proteinSMESG000078091.1 SMESG000078098.1 SMESG000078094.1 SMESG000078092.1 Contig1511GPL15192PMID:23079596
gutSMED30021752Cytochrome P450 2K1-like proteinSMESG000078100.1 SMESG000078094.1 SMED30021752smed_20140614PMID:26457503
gutSMED30022631Dimer_Tnp_hAT domain-containing proteinSMESG000049778.1 SMESG000048378.1 SMESG000039423.1 SMESG000039024.1 SMESG000024543.1 SMESG000022136.1 SMESG000002434.1 JF894290.2smed_ncbi_20200123PMID:22451003
gutSMED30022631Dimer_Tnp_hAT domain-containing proteinSMESG000049778.1 SMESG000048378.1 SMESG000039423.1 SMESG000039024.1 SMESG000024543.1 SMESG000022136.1 SMESG000002434.1 JF894290.2smed_ncbi_20200123PMID:22451003
gutSMED30025582SMED30025582SMESG000057502.1 Contig1846GPL15192PMID:23079596
gutSMED30025582SMED30025582SMESG000057502.1 dd_Smed_v4_13694_0_1dd_Smed_v4PMID:29674431
gutSMED30005357hypothetical proteinSMESG000027979.1 SMED30005357smed_20140614PMID:26457503
gutSMED30014019Intermediate filament proteinSMESG000030596.1 SMED30014019smed_20140614PMID:26457503
gutSMED30011545E3 ubiquitin-protein ligase XIAPSMESG000081058.1 Contig2302GPL15192PMID:23079596
gutSMED30009357ubiquilin-1SMESG000045386.1 Contig2009GPL15192PMID:23079596
gutSMED30016492B-cell receptor-associated protein 31SMESG000017490.1 Contig1500GPL15192PMID:23079596
gutSMED30016492B-cell receptor-associated protein 31SMESG000064614.1 Contig1500GPL15192PMID:23079596
gutSMED30016492B-cell receptor-associated protein 31SMESG000064614.1 dd_Smed_v4_1559_0_1dd_Smed_v4PMID:29674431
gutSMED30010541F-actin-capping protein subunit betaSMESG000008209.1 Contig1530GPL15192PMID:23079596
gutSMED30010541F-actin-capping protein subunit betaSMESG000008209.1 dd_Smed_v4_1165_0_1dd_Smed_v4PMID:29674431
gutSMED30010986Lysyl oxidase-likeSMESG000078255.1 SMED30010986smed_20140614PMID:26457503
gutSMED30010986Lysyl oxidase-likeSMESG000078255.1 dd_Smed_v4_10591_0_1dd_Smed_v4PMID:30962434
gutSMED30010986Lysyl oxidase-likeSMESG000078255.1 dd_Smed_v4_10591_0_1dd_Smed_v4PMID:29674431
gutSMED30006083SMED30006083SMESG000061797.1 SMED30006083smed_20140614PMID:26457503
gutSMED30018929Glycine N-acyltransferase 3SMESG000063826.1 SMED30018929smed_20140614PMID:26457503
gutSMED30011283SMED30011283SMESG000032426.1 SMESG000032414.1 dd_Smed_v4_6793_0_1dd_Smed_v4PMID:29674431
gutSMED30019107SMED30019107SMESG000027122.1 Contig1663newmark_estsPMID:23079596
gutSMED30019107SMED30019107SMESG000071278.1 Contig1663newmark_estsPMID:23079596
gutSMED30004187SMED30004187SMESG000043423.1 Contig1792newmark_estsPMID:23079596
gutSMED30004187SMED30004187SMESG000043423.1 Contig1792uc_Smed_v2PMID:23079596
gutSMED30004187SMED30004187SMESG000072544.1 Contig1792newmark_estsPMID:23079596
gutSMED30004187SMED30004187SMESG000072544.1 Contig1792uc_Smed_v2PMID:23079596
gutSMED30008855Copper-transporting ATPase 1SMESG000058134.1 SMED30008855smed_20140614PMID:26457503
gutSMED30008855Copper-transporting ATPase 1SMESG000058134.1 dd_Smed_v4_8956_0_1dd_Smed_v4PMID:29674431
gutSMED30008147SMED30008147SMESG000053405.1 Contig1766newmark_estsPMID:23079596
gutSMED30008147SMED30008147SMESG000053405.1 Contig1766uc_Smed_v2PMID:23079596
gutSMED30008147SMED30008147SMESG000046314.1 SMESG000028362.1 Contig1766newmark_estsPMID:23079596
gutSMED30008147SMED30008147SMESG000046314.1 SMESG000028362.1 Contig1766uc_Smed_v2PMID:23079596
gutSMED30002317Helicase with zinc finger domain 2SMESG000017490.1 Contig1500newmark_estsPMID:23079596
gutSMED30002317Helicase with zinc finger domain 2SMESG000017490.1 Contig1500uc_Smed_v2PMID:23079596
gutSMED30002317Helicase with zinc finger domain 2SMESG000064614.1 Contig1500newmark_estsPMID:23079596
gutSMED30002317Helicase with zinc finger domain 2SMESG000064614.1 Contig1500uc_Smed_v2PMID:23079596
gutSMED30019321TIR domain-containing proteinSMESG000079659.1 SMESG000079651.1 Contig154newmark_estsPMID:23079596
gutSMED30019321TIR domain-containing proteinSMESG000079659.1 SMESG000079651.1 Contig154uc_Smed_v2PMID:23079596
gutSMED30019321TIR domain-containing proteinSMESG000033382.1 Contig154newmark_estsPMID:23079596
gutSMED30019321TIR domain-containing proteinSMESG000033382.1 Contig154uc_Smed_v2PMID:23079596
gutSMED30005802SMED30005802SMESG000072483.1 SMED30005802smed_20140614PMID:26457503
gutSMED30005802SMED30005802SMESG000072483.1 dd_Smed_v4_5611_0_1dd_Smed_v4PMID:29674431
gutSMED30016747SMED30016747SMESG000019700.1 Contig701newmark_estsPMID:23079596
gutSMED30009017SMED30009017SMESG000020517.1 SMED30009017smed_20140614PMID:26457503
gutSMED30008120SMED30008120SMESG000042787.1 SMED30008120smed_20140614PMID:26457503
gutSMED30011447SMED30011447SMESG000034829.1 SMED30011447smed_20140614PMID:26457503
gutSMED30008999Voltage-dependent N-type calcium channel subunit alphaSMESG000019873.1 Contig6657newmark_estsPMID:23079596
gutSMED30008999Voltage-dependent N-type calcium channel subunit alphaSMESG000019873.1 Contig6657uc_Smed_v2PMID:23079596
gutSMED30013107Glyceraldehyde-3-phosphate dehydrogenaseSMESG000052353.1 dd_Smed_v4_78_0_1dd_Smed_v4PMID:29674431
gutSMED30000373retinol dehydrogenase 13-likeSMESG000049264.1 SMESG000009696.1 SMESG000009679.1 dd_Smed_v4_2096_0_1dd_Smed_v4PMID:29674431
gutSMED30001567SMED30001567SMESG000022139.1 SMED30001567smed_20140614PMID:26457503
gutSMED30012260Dual specificity tyrosine-phosphorylation-regulated kinase 1ASMESG000001908.1 SMESG000001895.1 SMESG000054185.1 SMESG000003953.1 Contig32newmark_estsPMID:23079596
gutSMED30012260Dual specificity tyrosine-phosphorylation-regulated kinase 1ASMESG000001908.1 SMESG000001895.1 SMESG000054185.1 SMESG000003953.1 Contig32uc_Smed_v2PMID:23079596
gutSMED30012260Dual specificity tyrosine-phosphorylation-regulated kinase 1ASMESG000003941.1 Contig32newmark_estsPMID:23079596
gutSMED30012260Dual specificity tyrosine-phosphorylation-regulated kinase 1ASMESG000003941.1 Contig32uc_Smed_v2PMID:23079596
gutSMED30028574Cytochrome P450 2K1-like proteinSMESG000073604.1 Contig1511GPL15192PMID:23079596
gutSMED30028574Cytochrome P450 2K1-like proteinSMESG000078091.1 SMESG000078098.1 SMESG000078094.1 SMESG000078092.1 Contig1511GPL15192PMID:23079596
gutSMED30028574Cytochrome P450 2K1-like proteinSMESG000078092.1 SMESG000078091.1 dd_Smed_v4_2351_0_1dd_Smed_v4PMID:29674431
gutSMED30028574Cytochrome P450 2K1-like proteinSMESG000078092.1 SMESG000078091.1 SMED30028574smed_20140614PMID:26457503
gutSMED30025964SMED30025964SMESG000041071.1 Contig2453newmark_estsPMID:23079596
gutSMED30030940SMED30030940SMESG000013104.1 Contig988newmark_estsPMID:23079596
gutSMED30029557SMED30029557SMESG000028899.1 Contig1093newmark_estsPMID:23079596
gutSMED30029557SMED30029557SMESG000071997.1 Contig1093newmark_estsPMID:23079596
gutSMED30027296SMED30027296SMESG000008043.1 SMED30027296smed_20140614PMID:26457503
gutSMED30027296SMED30027296SMESG000008043.1 dd_Smed_v4_994_0_1dd_Smed_v4PMID:29674431
gutSMED30035917SMED30035917SMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044907.1 SMESG000044888.1 SMESG000035804.1 SMESG000035755.1 Contig2059newmark_estsPMID:23079596
gutSMED30032776SMED30032776SMESG000063221.1 Contig1068newmark_estsPMID:23079596
gutSMED30030818Heterogeneous nuclear ribonucleoprotein KSMESG000021944.1 SMED30030818smed_20140614PMID:26457503
gutSMED30021281TIR domain-containing proteinSMESG000079659.1 SMESG000079651.1 Contig154newmark_estsPMID:23079596
gutSMED30021281TIR domain-containing proteinSMESG000079659.1 SMESG000079651.1 Contig154uc_Smed_v2PMID:23079596
gutSMED30021281TIR domain-containing proteinSMESG000033382.1 Contig154newmark_estsPMID:23079596
gutSMED30021281TIR domain-containing proteinSMESG000033382.1 Contig154uc_Smed_v2PMID:23079596
gutSMED30027273SMED30027273SMESG000017031.1 Contig2590newmark_estsPMID:23079596
gutSMED30035812large subunit GTPase 1 homologSMESG000056113.1 DN315293ncbi_smed_estsPMID:16344473
gutSMED30032408SMED30032408SMESG000027686.1 Contig2364newmark_estsPMID:23079596
gutSMED30032408SMED30032408SMESG000012131.1 SMESG000012127.1 Contig2364newmark_estsPMID:23079596
gutSMED3003581640S ribosomal protein S13SMESG000042470.1 SMESG000042447.1 dd_Smed_v4_360_0_1dd_Smed_v4PMID:29674431
gutSMED30034838Casein kinase II subunit alphaSMESG000039019.1 Contig3731newmark_estsPMID:23079596
gutSMED30034838Casein kinase II subunit alphaSMESG000056433.1 Contig3731newmark_estsPMID:23079596
gutSMED30025781WD repeat-containing protein 36SMESG000037091.1 SMED30025781smed_20140614PMID:26457503
gutSMED30025305SMED30025305SMESG000027283.1 Contig1753newmark_estsPMID:23079596
gutSMED30029088SMED30029088SMESG000017135.1 Contig2203newmark_estsPMID:23079596
gutSMED30020801SMED30020801SMESG000075928.1 Contig7205newmark_estsPMID:23079596
gutSMED30020801SMED30020801SMESG000075928.1 Contig7205uc_Smed_v2PMID:23079596
gutSMED30003449Steroid 17-alpha-hydroxylase/17,20 lyaseSMESG000059423.1 SMESG000059412.1 SMESG000059290.1 SMESG000048655.1 SMED30003449smed_20140614PMID:26457503
gutSMED30010354slc2a-9SMESG000056326.1 SMESG000056325.1 dd_Smed_v4_4836_0_1dd_Smed_v4PMID:29674431
gutSMED30002662Superoxide dismutaseSMESG000009484.1 dd_Smed_v4_1259_0_1dd_Smed_v4PMID:29674431
gutSMED3000257426S proteasome regulatory subunit N11SMESG000056298.1 SMESG000056198.1 dd_Smed_v4_2126_0_1dd_Smed_v4PMID:29674431
gutSMED30015963SMED30015963SMESG000000723.1 GDAG01079171.1SmedSxl_ww_GDAG01.fsa_ntPMID:279364
gutSMED3000599860s ribosomal protein l3SMESG000081260.1 dd_Smed_v4_12559_0_1dd_Smed_v4PMID:29674431
gutSMED30000284Electron transfer flavoprotein subunit betaSMESG000025689.1 dd_Smed_v4_1315_0_1dd_Smed_v4PMID:29674431
gutSMED30017117SMED30017117SMESG000010252.1 dd_Smed_v4_2672_0_1dd_Smed_v4PMID:29674431
gutSMED30004633Mitogen-activated protein kinase kinase 6SMESG000041446.1 SMED30004633smed_20140614PMID:27441386
gutSMED30008458Lysosomal alpha-glucosidase-likeSMESG000005069.1 dd_Smed_v4_4668_0_1dd_Smed_v4PMID:29674431
gutSMED30010772slc25a-32SMESG000010598.1 dd_Smed_v4_1662_0_1dd_Smed_v4PMID:29674431
gutSMED30001121Metabotropic glutamate receptor-likeSMESG000058947.1 SMED30001121smed_20140614PMID:26457503
gutSMED30001121Metabotropic glutamate receptor-likeSMESG000058947.1 dd_Smed_v4_10130_0_1dd_Smed_v4PMID:29674431
gutSMED30003242WD repeat-containing protein 3SMESG000002152.1 SMED30003242smed_20140614PMID:26457503
gutSMED30017878RING finger protein unkempt homologSMESG000001908.1 SMESG000001895.1 SMESG000054185.1 SMESG000003953.1 Contig32newmark_estsPMID:23079596
gutSMED30017878RING finger protein unkempt homologSMESG000001908.1 SMESG000001895.1 SMESG000054185.1 SMESG000003953.1 Contig32uc_Smed_v2PMID:23079596
gutSMED30017878RING finger protein unkempt homologSMESG000003941.1 Contig32newmark_estsPMID:23079596
gutSMED30017878RING finger protein unkempt homologSMESG000003941.1 Contig32uc_Smed_v2PMID:23079596
gutSMED30005278Mannosidase betaSMESG000055910.1 dd_Smed_v4_3209_0_1dd_Smed_v4PMID:29674431
gutSMED30002941Actin-related protein 2/3 complex subunit 3SMESG000001908.1 SMESG000001895.1 SMESG000054185.1 SMESG000003953.1 Contig32GPL15192PMID:23079596
gutSMED30002941Actin-related protein 2/3 complex subunit 3SMESG000003941.1 Contig32GPL15192PMID:23079596
gutSMED30002941Actin-related protein 2/3 complex subunit 3SMESG000003941.1 dd_Smed_v4_619_0_1dd_Smed_v4PMID:29674431
gutSMED30002356SMED30002356SMESG000069796.1 SMED30002356smed_20140614PMID:26457503
gutSMED30019056Proton myo-inositol cotransporter-likeSMESG000056326.1 SMESG000056325.1 dd_Smed_v4_4836_0_1dd_Smed_v4PMID:29674431
gutSMED30028287SMED30028287SMESG000068743.1 SMED30028287smed_20140614PMID:26457503
gutSMED30020153SMED30020153SMESG000025120.1 Contig1559GPL15192PMID:23079596
gutSMED30020153SMED30020153SMESG000025120.1 dd_Smed_v4_5510_0_1dd_Smed_v4PMID:29674431
gutSMED30030020SMED30030020SMESG000024202.1 dd_Smed_v4_8896_0_2dd_Smed_v4PMID:29674431
gutSMED30020663SMED30020663SMESG000003437.1 dd_Smed_v4_2920_0_1dd_Smed_v4PMID:29674431
gutSMED30020433Oxalate:formate antiporterSMESG000061390.1 dd_Smed_v4_4769_0_1dd_Smed_v4PMID:29674431
gutSMED30021545glutathione S transferase-1SMESG000003087.1 dd_Smed_v4_20_0_1dd_Smed_v4PMID:29674431
gutSMED30020615prohibitin-1SMESG000021272.1 dd_Smed_v4_1089_0_1dd_Smed_v4PMID:29674431
gutSMED30028142SMED30028142SMESG000061765.1 SMESG000061762.1 SMED30028142smed_20140614PMID:26457503
gutSMED30029098Oxygen-dependent coproporphyrinogen-III oxidaseSMESG000039696.1 SMED30029098smed_20140614PMID:26457503
gutSMED30020317Heat shock protein 90SMESG000024822.1 Contig1490GPL15192PMID:23079596
gutSMED30030127bcl2-like proteinSMESG000043462.1 Contig210GPL15192PMID:23079596
gutSMED30030127bcl2-like proteinSMESG000049099.1 Contig210GPL15192PMID:23079596
gutSMED30030127bcl2-like proteinSMESG000049099.1 FJ807655smed_ncbi_20200123PMID:19766622
gutSMED30029717SMED30029717SMESG000018042.1 SMED30029717smed_20140614PMID:26457503
gutSMED30028428Poly [ADP-ribose] polymeraseSMESG000045968.1 SMED30028428smed_20140614PMID:26457503
gutSMED30022535GTPase activating proteinSMESG000068156.1 SMESG000010609.1 SMESG000076470.1 SMESG000073857.1 SMESG000062429.1 SMESG000060487.1 SMESG000058575.1 SMESG000053533.1 SMESG000026676.1 SMESG000020635.1 SMESG000015751.1 SMESG000005260.1 Contig236GPL15192PMID:23079596
gutSMED30022535GTPase activating proteinSMESG000037949.1 Contig236GPL15192PMID:23079596
gutSMED30030292Cytochrome P450, family 1, subfamily D, polypeptide 1SMESG000012534.1 SMED30030292smed_20140614PMID:26457503
gutSMED30027243Lysyl oxidaseSMESG000004065.1 SMESG000004062.1 dd_Smed_v4_7096_0_1dd_Smed_v4PMID:29674431
gutSMED30027243Lysyl oxidaseSMESG000004065.1 SMESG000004062.1 dd_Smed_v4_7096_0_1dd_Smed_v4PMID:30962434
gutSMED30027243Lysyl oxidaseSMESG000004065.1 SMESG000004062.1 SMED30027243smed_20140614PMID:26457503
gutSMED30030305Peptidase_M14 domain-containing proteinSMESG000037626.1 Contig1315GPL15192PMID:23079596
gutSMED30030305Peptidase_M14 domain-containing proteinSMESG000048042.1 Contig1315GPL15192PMID:23079596
gutSMED30030305Peptidase_M14 domain-containing proteinSMESG000048042.1 dd_Smed_v4_2282_0_1dd_Smed_v4PMID:29674431
gutSMED30024671SMED30024671SMESG000017034.1 SMED30024671smed_20140614PMID:26457503
gutSMED30024671SMED30024671SMESG000017034.1 dd_Smed_v4_1516_0_1dd_Smed_v4PMID:29674431
gutSMED30035190Dimer_Tnp_hAT domain-containing proteinSMESG000074416.1 SMESG000074407.1 Contig1629newmark_estsPMID:23079596
gutSMED30035190Dimer_Tnp_hAT domain-containing proteinSMESG000074416.1 SMESG000074407.1 Contig1629uc_Smed_v2PMID:23079596
gutSMED30022784SMED30022784SMESG000058274.1 SMED30022784smed_20140614PMID:26457503
gutSMED30031507Zinc finger and SCAN domain-containing protein 2SMESG000072824.1 SMESG000049972.1 SMESG000031902.1 SMED30031507smed_20140614PMID:26457503
gutSMED30020710Succinyl-CoA:3-ketoacid-coenzyme A transferaseSMESG000080424.1 SMED30020710smed_20140614PMID:26457503
gutSMED30023369ATP dependent RNA helicase DDX6SMESG000027870.1 dd_Smed_v4_11802_0_1dd_Smed_v4PMID:29674431
gutSMED30030751Fibroblast growth factor receptorSMESG000022068.1 SMESG000022067.1 SMED30030751smed_20140614PMID:26457503
gutSMED30021127SMED30021127SMESG000037626.1 Contig1315newmark_estsPMID:23079596
gutSMED30021127SMED30021127SMESG000037626.1 Contig1315uc_Smed_v2PMID:23079596
gutSMED30021127SMED30021127SMESG000048042.1 Contig1315newmark_estsPMID:23079596
gutSMED30021127SMED30021127SMESG000048042.1 Contig1315uc_Smed_v2PMID:23079596
gutSMED30021127SMED30021127SMESG000037626.1 dd_Smed_v4_7748_0_1dd_Smed_v4PMID:29674431
gutSMED30017038Proton myo-inositol cotransporterSMESG000056326.1 SMESG000056325.1 dd_Smed_v4_4836_0_1dd_Smed_v4PMID:29674431
gutSMED30009783SMED30009783SMESG000072824.1 SMESG000049972.1 SMESG000031902.1 SMED30031507smed_20140614PMID:26457503
gutSMED30004754RNA-binding protein 8ASMESG000051885.1 dd_Smed_v4_1169_0_1dd_Smed_v4PMID:29674431
gutSMED30017941Clustered mitochondria protein homologSMESG000033500.1 dd_Smed_v4_1597_0_1dd_Smed_v4PMID:29674431
gutSMED30012043Calcium-transporting ATPaseSMESG000063816.1 SMESG000010536.1 SMESG000045280.1 SMESG000029730.1 dd_Smed_v4_4145_0_1dd_Smed_v4PMID:29674431
gutSMED30002704Cathepsin L2SMESG000013992.1 SMESG000013980.1 Contig1337GPL15192PMID:23079596
gutSMED30003859SMED30003859SMESG000018217.1 dd_Smed_v4_1350_0_1dd_Smed_v4PMID:29674431
gutSMED3001850460S ribosomal protein L30SMESG000022893.1 dd_Smed_v4_111_0_1dd_Smed_v4PMID:29674431
gutSMED30006674SMED30006674SMESG000046410.1 SMESG000037647.1 SMED30006674smed_20140614PMID:26457503
gutSMED30016368Endoribonuclease DicerSMESG000073604.1 Contig1511newmark_estsPMID:23079596
gutSMED30016368Endoribonuclease DicerSMESG000073604.1 Contig1511uc_Smed_v2PMID:23079596
gutSMED30016368Endoribonuclease DicerSMESG000078091.1 SMESG000078098.1 SMESG000078094.1 SMESG000078092.1 Contig1511newmark_estsPMID:23079596
gutSMED30016368Endoribonuclease DicerSMESG000078091.1 SMESG000078098.1 SMESG000078094.1 SMESG000078092.1 Contig1511uc_Smed_v2PMID:23079596
gutSMED30006337Glycine amidinotransferase mitochondrialSMESG000051929.1 dd_Smed_v4_11843_0_1dd_Smed_v4PMID:29674431
gutSMED30002834SMED30002834SMESG000043420.1 Contig1665newmark_estsPMID:23079596
gutSMED30002834SMED30002834SMESG000043420.1 Contig1665uc_Smed_v2PMID:23079596
gutSMED30002834SMED30002834SMESG000003841.1 Contig1665newmark_estsPMID:23079596
gutSMED30002834SMED30002834SMESG000003841.1 Contig1665uc_Smed_v2PMID:23079596
gutSMED30017270H2A histone family, member YSMESG000059652.1 Contig2797GPL15192PMID:23079596
gutSMED30017270H2A histone family, member YSMESG000012903.1 Contig2797GPL15192PMID:23079596
gutSMED30011291Acidic phospholipase A2SMESG000079712.1 SMED30011291smed_20140614PMID:26457503
gutSMED30011935SMED30011935SMESG000059652.1 Contig2797newmark_estsPMID:23079596
gutSMED30011935SMED30011935SMESG000012903.1 Contig2797newmark_estsPMID:23079596
gutSMED30019221SMED30019221SMESG000010252.1 dd_Smed_v4_2672_0_1dd_Smed_v4PMID:29674431
gutSMED30011988SMED30011988SMESG000029726.1 SMESG000029717.1 dd_Smed_v4_1411_0_1dd_Smed_v4PMID:29674431
gutSMED30003044ReticulocalbinSMESG000077405.1 SMED30003044smed_20140614PMID:26457503
gutSMED30016022SMED30016022SMESG000053405.1 Contig1766newmark_estsPMID:23079596
gutSMED30016022SMED30016022SMESG000053405.1 Contig1766uc_Smed_v2PMID:23079596
gutSMED30016022SMED30016022SMESG000046314.1 SMESG000028362.1 Contig1766newmark_estsPMID:23079596
gutSMED30016022SMED30016022SMESG000046314.1 SMESG000028362.1 Contig1766uc_Smed_v2PMID:23079596
gutSMED30015244SMED30015244SMESG000041433.1 dd_Smed_v4_12877_0_1dd_Smed_v4PMID:29674431
gutSMED30003773SMED30003773SMESG000024822.1 Contig1490newmark_estsPMID:23079596
gutSMED30018711SMED30018711SMESG000058514.1 dd_Smed_v4_13272_0_1dd_Smed_v4PMID:29674431
gutSMED30007143Nucleolar GTP-binding protein 2SMESG000026847.1 dd_Smed_v4_1134_0_1dd_Smed_v4PMID:29674431
gutSMED30008030Lymphocyte specific protein 1SMESG000043488.1 SMESG000043485.1 dd_Smed_v4_3716_0_1dd_Smed_v4PMID:29674431
gutSMED30011617Actin-related protein 2/3 complex subunit 4SMESG000043420.1 Contig1665GPL15192PMID:23079596
gutSMED30011617Actin-related protein 2/3 complex subunit 4SMESG000003841.1 Contig1665GPL15192PMID:23079596
gutSMED30011617Actin-related protein 2/3 complex subunit 4SMESG000003841.1 dd_Smed_v4_977_0_1dd_Smed_v4PMID:29674431
gutSMED3000013460S ribosomal protein L4SMESG000009479.1 dd_Smed_v4_211_0_1dd_Smed_v4PMID:29674431
gutSMED30007246SMED30007246SMESG000045656.1 Contig3259GPL15192PMID:23079596
gutSMED30007246SMED30007246SMESG000045656.1 dd_Smed_v4_797_0_1dd_Smed_v4PMID:29674431
gutSMED30013885SMED30013885SMESG000046850.1 SMED30013885smed_20140614PMID:26457503
gutSMED30014348Four and a half LIM domains protein 1SMESG000018217.1 dd_Smed_v4_1350_0_1dd_Smed_v4PMID:29674431
gutSMED30015706Twinfilin-1SMESG000041071.1 Contig2453GPL15192PMID:23079596
gutSMED30015706Twinfilin-1SMESG000041071.1 dd_Smed_v4_2563_0_1dd_Smed_v4PMID:29674431
gutSMED30010951SMED30010951SMESG000076142.1 SMED30010951smed_20140614PMID:26457503
gutSMED30001853Protein kinase domain-containing proteinSMESG000003859.1 dd_Smed_v4_1897_0_1dd_Smed_v4PMID:29674431
gutSMED30019830Kinase-like domain-containing proteinSMESG000010252.1 dd_Smed_v4_2672_0_1dd_Smed_v4PMID:29674431
gutSMED30005644X1.A.D4.1SMESG000053861.1 SMED30005644smed_20140614PMID:26457503
gutSMED30017717Ras-related protein Rab-2ASMESG000076159.1 dd_Smed_v4_1113_0_1dd_Smed_v4PMID:29674431
gutSMED30005538Polycomb group ring finger 2SMESG000066343.1 SMESG000066342.1 SMESG000066340.1 dd_Smed_v4_1858_0_1dd_Smed_v4PMID:29674431
gutSMED30014713SMED30014713SMESG000061767.1 SMED30014713smed_20140614PMID:26457503
gutSMED30011313Acyl-protein thioesterase 1SMESG000058272.1 dd_Smed_v4_638_0_1dd_Smed_v4PMID:29674431
gutSMED300196972-amino-3-carboxymuconate-6-semialdehyde decarboxylaseSMESG000077491.1 SMED30019697smed_20140614PMID:26457503
gutSMED300196972-amino-3-carboxymuconate-6-semialdehyde decarboxylaseSMESG000077491.1 dd_Smed_v4_8766_0_1dd_Smed_v4PMID:29674431
gutSMED30010366slc25a-19SMESG000020909.1 SMESG000020904.1 SMED30010366smed_20140614PMID:26457503
gutSMED30004594Dynamin 2SMESG000027378.1 SMESG000027377.1 SMED30004594smed_20140614PMID:24950970
gutSMED30009513Glycine amidinotransferase, mitochondrialSMESG000051953.1 SMED30009513smed_20140614PMID:26457503
gutSMED30003809Vitellogenin domain-containing proteinSMESG000073666.1 SMED30003809smed_20140614PMID:26457503
gutSMED30003809Vitellogenin domain-containing proteinSMESG000073666.1 dd_Smed_v4_636_0_1dd_Smed_v4PMID:29674431
gutSMED30003809Vitellogenin domain-containing proteinSMESG000073666.1 dd_Smed_v4_636_0_1dd_Smed_v4PMID:30962434
gutSMED30001471Cytochrome P450 2K1-like proteinSMESG000022101.1 SMESG000022100.1 SMED30001471smed_20140614PMID:26457503
gutSMED30015161Vacuolar protein sorting-associated protein 45SMESG000053405.1 Contig1766GPL15192PMID:23079596
gutSMED30015161Vacuolar protein sorting-associated protein 45SMESG000046314.1 SMESG000028362.1 Contig1766GPL15192PMID:23079596
gutSMED30012767SMED30012767SMESG000023421.1 SMED30012767smed_20140614PMID:26457503
gutSMED3000102660S ribosomal protein L7SMESG000076604.1 dd_Smed_v4_1121_0_1dd_Smed_v4PMID:29674431
gutSMED30010667SMED30010667SMESG000010252.1 dd_Smed_v4_2672_0_1dd_Smed_v4PMID:29674431
gutSMED30013445TetraspaninSMESG000063435.1 dd_Smed_v4_389_0_1dd_Smed_v4PMID:29674431
gutSMED30002664SMED30002664SMESG000002943.1 Contig3127GPL15192PMID:23079596
gutSMED30001192ras-related protein Rab-14SMESG000066109.1 SMESG000052687.1 SMESG000014240.1 SMESG000069832.1 SMESG000037642.1 dd_Smed_v4_106_0_1dd_Smed_v4PMID:29674431
gutSMED30008233Serine/threonine-protein phosphataseSMESG000023415.1 SMED30008233smed_20140614PMID:27441386
gutSMED300148153 hydroxyacyl CoA dehydrogenase type-2SMESG000044485.1 dd_Smed_v4_1682_0_1dd_Smed_v4PMID:29674431
gutSMED30005740SMED30005740SMESG000029096.1 SMED30005740smed_20140614PMID:26457503
gutSMED30001172Elongation factor 1-betaSMESG000026862.1 dd_Smed_v4_206_0_1dd_Smed_v4PMID:29674431
gutSMED30011312SMED30011312SMESG000066343.1 SMESG000066342.1 SMESG000066340.1 dd_Smed_v4_1858_0_1dd_Smed_v4PMID:29674431
gutSMED3000239240S ribosomal protein S15SMESG000015520.1 dd_Smed_v4_201_0_1dd_Smed_v4PMID:29674431
gutSMED30031855Glutamine synthetaseSMESG000000229.1 SMESG000000211.1 dd_Smed_v4_646_0_1dd_Smed_v4PMID:29674431
gutSMED30024994THAP-type domain-containing proteinSMESG000028189.1 Contig44799newmark_estsPMID:27612384
gutSMED30024994THAP-type domain-containing proteinSMESG000028189.1 Contig44799uc_Smed_v2PMID:27612384
gutSMED30031329Protein tyrosine phosphatase receptor type BSMESG000050003.1 SMESG000005247.1 dd_Smed_v4_5794_0_1dd_Smed_v4PMID:29674431
gutSMED3003415260S ribosomal protein L11SMESG000012668.1 SMESG000012475.1 dd_Smed_v4_144_0_1dd_Smed_v4PMID:29674431
gutSMED30026339Phospholipase A2SMESG000048503.1 SMESG000048502.1 dd_Smed_v4_3851_0_1dd_Smed_v4PMID:29674431
gutSMED30030074Mothers against decapentaplegic homologSMESG000029614.1 SMED30030074smed_20140614PMID:25558068
gutSMED30020990Eukaryotic translation initiation factor 2 subunit 2SMESG000017124.1 dd_Smed_v4_6980_0_1dd_Smed_v4PMID:29674431
gutSMED30021960AminopeptidaseSMESG000067986.1 dd_Smed_v4_2224_0_1dd_Smed_v4PMID:29674431
gutSMED30021960AminopeptidaseSMESG000067986.1 SMED30021960smed_20140614PMID:26457503
gutSMED30021860Phosphorylase kinase gamma subunitSMESG000023567.1 SMESG000038340.1 dd_Smed_v4_1020_0_1dd_Smed_v4PMID:29674431
gutSMED30029096slc38a-5SMESG000030873.1 dd_Smed_v4_2530_0_1dd_Smed_v4PMID:29674431
gutSMED30027223SMED30027223SMESG000066359.1 SMESG000066357.1 SMESG000066355.1 dd_Smed_v4_31_0_1dd_Smed_v4PMID:29674431
gutSMED30025363SMED30025363SMESG000014711.1 dd_Smed_v4_1754_0_1dd_Smed_v4PMID:29674431
gutSMED3002317260s ribosomal protein L14SMESG000022343.1 dd_Smed_v4_167_0_1dd_Smed_v4PMID:29674431
gutSMED30026394SMED30026394SMESG000029612.1 SMESG000029602.1 SMED30026394smed_20140614PMID:26457503
gutSMED30021508Glutamate dehydrogenaseSMESG000061402.1 dd_Smed_v4_932_0_1dd_Smed_v4PMID:29674431
gutSMED30027256SMED30027256SMESG000050003.1 SMESG000005247.1 dd_Smed_v4_5794_0_1dd_Smed_v4PMID:29674431
gutSMED30020423Cystinosin homolog-like ProteinSMESG000079054.1 dd_Smed_v4_4571_0_1dd_Smed_v4PMID:29674431
gutSMED30029873SMED30029873SMESG000042500.1 SMED30029873smed_20140614PMID:26457503
gutSMED30025747SMED30025747SMESG000049533.1 dd_Smed_v4_2058_0_1dd_Smed_v4PMID:29674431
gutSMED30026622beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase 3SMESG000008883.1 SMED30026622smed_20140614PMID:26457503
gutSMED30033389SMED30033389SMESG000079563.1 SMESG000052448.1 dd_Smed_v4_3113_1_1dd_Smed_v4PMID:29674431
gutSMED3002151340S ribosomal protein S9SMESG000058106.1 dd_Smed_v4_92_0_1dd_Smed_v4PMID:29674431
gutSMED30022004SMED30022004SMESG000066720.1 SMESG000065914.1 SMESG000065913.1 SMESG000044801.1 SMESG000021895.1 Contig36405newmark_estsPMID:27612384
gutSMED30022004SMED30022004SMESG000066720.1 SMESG000065914.1 SMESG000065913.1 SMESG000044801.1 SMESG000021895.1 Contig36405uc_Smed_v2PMID:27612384
gutSMED30034385Elongation of very long chain fatty acids proteinSMESG000045477.1 dd_Smed_v4_2311_0_1dd_Smed_v4PMID:29674431
gutSMED30029195Dynamin-like proteinSMESG000031118.1 SMESG000031117.1 SMESG000031112.1 SMESG000031106.1 dd_Smed_v4_2234_0_1dd_Smed_v4PMID:29674431
gutSMED30031947Long-chain-fatty-acid--CoA ligase ACSBG2SMESG000027217.1 dd_Smed_v4_2414_0_1dd_Smed_v4PMID:29674431
gutSMED30035570Poly(RC)-binding protein 3SMESG000005644.1 dd_Smed_v4_7334_0_1dd_Smed_v4PMID:29674431
gutSMED30034887RRM domain-containing proteinSMESG000017203.1 dd_Smed_v4_391_0_1dd_Smed_v4PMID:29674431
gutSMED30031209Calcium release-activated calcium channel protein 1SMESG000032795.1 SMESG000032781.1 dd_Smed_v4_8774_0_1dd_Smed_v4PMID:29674431
gutSMED30032816Multidrug and toxin extrusion proteinSMESG000005477.1 dd_Smed_v4_2361_0_1dd_Smed_v4PMID:29674431
gutSMED30021162Ribonuclease kappaSMESG000023567.1 SMESG000038340.1 dd_Smed_v4_1020_0_1dd_Smed_v4PMID:29674431
gutSMED30009038SMED30009038SMESG000068141.1 dd_Smed_v4_1067_0_1dd_Smed_v4PMID:29674431
gutSMED30019576SMED30019576SMESG000079563.1 SMESG000052448.1 dd_Smed_v4_3113_1_1dd_Smed_v4PMID:29674431
gutSMED30008473Protein kinase domain-containing proteinSMESG000023567.1 SMESG000038340.1 dd_Smed_v4_1020_0_1dd_Smed_v4PMID:29674431
gutSMED30010974InnexinSMESG000055742.1 SMESG000055733.1 dd_Smed_v4_1120_0_1dd_Smed_v4PMID:29674431
gutSMED30009612SMED30009612SMESG000061853.1 dd_Smed_v4_12983_0_1dd_Smed_v4PMID:29674431
gutSMED30012357SMED30012357SMESG000041431.1 dd_Smed_v4_12848_0_1dd_Smed_v4PMID:29674431
gutSMED30010061APOBEC1 complementation factorSMESG000032489.1 dd_Smed_v4_2228_0_1dd_Smed_v4PMID:29674431
gutSMED30017410Peptidoglycan-recognition proteinSMESG000004536.1 dd_Smed_v4_817_1_1dd_Smed_v4PMID:29674431
gutSMED30012974slc25a-27SMESG000061901.1 dd_Smed_v4_543_0_1dd_Smed_v4PMID:29674431
gutSMED30018460Charged multivesicular body protein 2bSMESG000054476.1 dd_Smed_v4_1514_0_1dd_Smed_v4PMID:29674431
gutSMED30010337major facilitator superfamily domain-containing protein 1SMESG000017192.1 dd_Smed_v4_1829_0_1dd_Smed_v4PMID:29674431
gutSMED30017635Poly(RC)-binding protein 3SMESG000005644.1 dd_Smed_v4_7334_0_1dd_Smed_v4PMID:29674431
gutSMED30001706C2H2-type domain-containing proteinSMESG000043342.1 dd_Smed_v4_11532_0_1dd_Smed_v4PMID:29674431
gutSMED30007394Phosphatidylinositol 4-kinase type 2SMESG000035623.1 dd_Smed_v4_9125_0_1dd_Smed_v4PMID:29674431
gutSMED30019742Geranylgeranyl transferase type-2 subunit alphaSMESG000011257.1 Contig42506newmark_estsPMID:27612384
gutSMED30019742Geranylgeranyl transferase type-2 subunit alphaSMESG000011257.1 Contig42506uc_Smed_v2PMID:27612384
gutSMED30001122slc37a-2SMESG000000703.1 dd_Smed_v4_1904_0_1dd_Smed_v4PMID:29674431
gutSMED30013482SMED30013482SMESG000068865.1 dd_Smed_v4_1298_0_1dd_Smed_v4PMID:29674431
gutSMED30010526SMED30010526SMESG000072556.1 dd_Smed_v4_10620_0_1dd_Smed_v4PMID:29674431
gutSMED30013334Glutathione peroxidaseSMESG000077750.1 dd_Smed_v4_662_0_1dd_Smed_v4PMID:29674431
gutSMED30014639SMED30014639SMESG000077674.1 SMESG000077672.1 dd_Smed_v4_7295_0_1dd_Smed_v4PMID:29674431
gutSMED30014639SMED30014639SMESG000077672.1 SMED30014639smed_20140614PMID:26457503
gutSMED30017872Protein kinase domain-containing proteinSMESG000015807.1 dd_Smed_v4_9437_0_1dd_Smed_v4PMID:29674431
gutSMED30008487Peptidylprolyl isomeraseSMESG000019381.1 dd_Smed_v4_870_0_1dd_Smed_v4PMID:29674431
gutSMED30002139Vacuole membrane protein 1SMESG000034612.1 dd_Smed_v4_1156_0_1dd_Smed_v4PMID:29674431
gutSMED30016560Calpain-5SMESG000035700.1 SMESG000035698.1 dd_Smed_v4_3864_0_1dd_Smed_v4PMID:29674431
gutSMED30006949CLUMA_CG005324, isoform ASMESG000073691.1 dd_Smed_v4_888_0_1dd_Smed_v4PMID:29674431
gutSMED30006949CLUMA_CG005324, isoform ASMESG000073691.1 dd_888dd_Smed_v4PMID:29674431
gutSMED30006949CLUMA_CG005324, isoform ASMESG000073691.1 dd_888dd_Smed_v4PMID:29674431
gutSMED30000059hypothetical proteinSMESG000066598.1 dd_Smed_v4_6448_0_1dd_Smed_v4PMID:29674431
gutSMED3001238340S ribosomal protein SASMESG000071180.1 dd_Smed_v4_171_0_1dd_Smed_v4PMID:29674431
gutSMED30010045SMED30010045SMESG000058295.1 dd_Smed_v4_6917_0_1dd_Smed_v4PMID:29674431
gutSMED30000040SMED30000040SMESG000001726.1 dd_Smed_v4_2615_0_1dd_Smed_v4PMID:29674431
gutSMED30018096Reactive intermediate imine deaminase A homologSMESG000036895.1 dd_Smed_v4_1895_0_1dd_Smed_v4PMID:29674431
gutSMED30000212Vacuolar protein sorting-associated protein 26BSMESG000026617.1 dd_Smed_v4_912_0_1dd_Smed_v4PMID:29674431
gutSMED30000647Cell wall integrity and stress response component 1SMESG000035037.1 SMESG000035036.1 dd_Smed_v4_6380_0_1dd_Smed_v4PMID:29674431
gutSMED30006454BZIP domain-containing proteinSMESG000012495.1 dd_Smed_v4_9007_0_1dd_Smed_v4PMID:29674431
gutSMED30016695leucine-rich repeat-containing protein 72SMESG000017213.1 dd_Smed_v4_2559_0_1dd_Smed_v4PMID:29674431
gutSMED30003475Kynurenine formamidaseSMESG000070097.1 dd_Smed_v4_12523_0_1dd_Smed_v4PMID:29674431
gutSMED30012889Family S33 non-peptidase homologue (S33 family)SMESG000021236.1 dd_Smed_v4_1414_0_1dd_Smed_v4PMID:29674431
gutSMED30008163Usp domain-containing proteinSMESG000039918.1 dd_Smed_v4_2433_0_1dd_Smed_v4PMID:29674431
gutSMED30015939IQ motif containing GSMESG000055124.1 dd_Smed_v4_9650_0_1dd_Smed_v4PMID:29674431
gutSMED30001495Ribosomal protein L15SMESG000056940.1 dd_Smed_v4_193_0_1dd_Smed_v4PMID:29674431
gutSMED30006161slc24a-4SMESG000036251.1 dd_Smed_v4_9736_0_1dd_Smed_v4PMID:29674431
gutSMED30014241SMED30014241SMESG000003392.1 dd_Smed_v4_2564_0_1dd_Smed_v4PMID:29674431
gutSMED30015660SMED30015660SMESG000018225.1 SMESG000017035.1 dd_Smed_v4_1426_0_1dd_Smed_v4PMID:29674431
gutSMED30000258Canalicular multispecific organic anion transporter 1SMESG000057252.1 dd_Smed_v4_6609_0_1dd_Smed_v4PMID:29674431
gutSMED30002489Apical junction component 1 homologSMESG000037093.1 dd_Smed_v4_11689_0_1dd_Smed_v4PMID:29674431
gutSMED30005508Long-chain-fatty-acid--CoA ligaseSMESG000024739.1 dd_Smed_v4_2009_0_1dd_Smed_v4PMID:29674431
gutSMED30005508Long-chain-fatty-acid--CoA ligaseSMESG000024739.1 SMED30005508smed_20140614PMID:26457503
gutSMED30005508Long-chain-fatty-acid--CoA ligaseSMESG000024739.1 Contig35360newmark_estsPMID:27612384
gutSMED30005508Long-chain-fatty-acid--CoA ligaseSMESG000024739.1 Contig35360uc_Smed_v2PMID:27612384
gutSMED30010096TPA_inf: prohormone convertase 2SMESG000008070.1 tr5_785mu_Smed_v1PMID:25558068
gutSMED30015364Phospholipase A2SMESG000048503.1 SMESG000048502.1 dd_Smed_v4_3851_0_1dd_Smed_v4PMID:29674431
gutSMED30005603TIR domain-containing proteinSMESG000065938.1 dd_Smed_v4_13709_0_1dd_Smed_v4PMID:29674431
gutSMED30004783DnaJ heat shock protein family (Hsp40) member C13SMESG000061705.1 dd_Smed_v4_2579_0_1dd_Smed_v4PMID:29674431
gutSMED30016516Protein diaphanous homolog 2SMESG000057806.1 dd_Smed_v4_2533_0_1dd_Smed_v4PMID:29674431
gutSMED30006469TNF receptor-associated factorSMESG000067216.1 dd_Smed_v4_2669_0_1dd_Smed_v4PMID:29674431
gutSMED30023006SMED30023006SMESG000045007.1 dd_Smed_v4_8336_0_1dd_Smed_v4PMID:29674431
gutSMED30023006SMED30023006SMESG000043200.1 SMESG000045007.1 SMED30023006smed_20140614PMID:26457503
gutSMED30024204SMED30024204SMESG000027140.1 dd_Smed_v4_75_0_1dd_Smed_v4PMID:29674431
gutSMED30024204SMED30024204SMESG000027140.1 Contig1248GPL15192PMID:23079596
gutSMED30024204SMED30024204SMESG000027140.1 dd_75dd_Smed_v4PMID:29674431
gutSMED30024204SMED30024204SMESG000027140.1 dd_75dd_Smed_v4PMID:29674431
gutSMED30024140Epithelial discoidin domain-containing receptorSMESG000070377.1 dd_Smed_v4_7988_0_1dd_Smed_v4PMID:29674431
gutSMED3003144714-3-3 protein beta/alphaSMESG000067831.1 SMED30031447smed_20140614PMID:26457503
gutSMED30027594CYLD lysine 63 deubiquitinaseSMESG000015653.1 SMED30027594smed_20140614PMID:27441386
gutSMED30034763c-Jun N-terminal kinasesSMESG000043618.1 SMED30034763smed_20140614PMID:27441386
gutSMED30033015SMED30033015SMESG000049533.1 dd_Smed_v4_2058_0_1dd_Smed_v4PMID:29674431
gutSMED30022840SMED30022840SMESG000025410.1 dd_Smed_v4_777_0_1dd_Smed_v4PMID:29674431
gutSMED30034179SMED30034179SMESG000049924.1 dd_Smed_v4_736_0_1dd_Smed_v4PMID:29674431
gutSMED30027897COMM domain-containing protein 4SMESG000046681.1 dd_Smed_v4_2501_0_1dd_Smed_v4PMID:29674431
gutSMED30034219PPM-type phosphatase domain-containing proteinSMESG000032910.1 SMESG000032921.1 SMED30034219smed_20140614PMID:27441386
gutSMED30021019CYTOSOL_AP domain-containing proteinSMESG000037599.1 dd_Smed_v4_181_0_1dd_Smed_v4PMID:29674431
gutSMED30023062bruno-likeSMESG000021009.1 SMED30023062smed_20140614PMID:26457503
gutSMED30035852Ubiquitin-60S ribosomal protein L40SMESG000035681.1 dd_Smed_v4_176_0_1dd_Smed_v4PMID:29674431
gutSMED30024544SMED30024544SMESG000048503.1 SMESG000048502.1 dd_Smed_v4_3851_0_1dd_Smed_v4PMID:29674431
gutSMED30031912SMED30031912SMESG000003404.1 dd_Smed_v4_2094_0_1dd_Smed_v4PMID:29674431
gutSMED30030118SMED30030118SMESG000072556.1 dd_Smed_v4_10620_0_1dd_Smed_v4PMID:29674431
gutSMED30034823SMED30034823SMESG000024340.1 dd_Smed_v4_822_0_1dd_Smed_v4PMID:29674431
gutSMED30034660Spectrin beta chain, non-erythrocytic 5SMESG000023006.1 dd_Smed_v4_2514_0_1dd_Smed_v4PMID:29674431
gutSMED30032019Moesin/ezrin/radixin homolog 1SMESG000068090.1 dd_Smed_v4_8101_0_1dd_Smed_v4PMID:29674431
gutSMED30020701Long-chain specific acyl-CoA dehydrogenaseSMESG000073618.1 SMESG000073174.1 SMESG000059623.1 SMESG000050300.1 SMESG000040932.1 SMESG000025201.1 SMESG000006554.1 SMESG000079557.1 SMESG000069853.1 SMESG000050880.1 SMESG000043279.1 SMESG000028068.1 SMESG000018675.1 SMESG000018320.1 SMESG000016710.1 SMESG000016088.1 SMESG000005066.1 SMESG000002984.1 SMESG000081574.1 SMESG000081529.1 SMESG000078601.1 SMESG000077556.1 SMESG000075496.1 SMESG000073961.1 SMESG000072739.1 SMESG000071859.1 SMESG000071198.1 SMESG000070153.1 SMESG000068262.1 SMESG000068028.1 SMESG000067334.1 SMESG000062504.1 SMESG000060952.1 SMESG000060260.1 SMESG000050479.1 SMESG000050299.1 SMESG000049776.1 SMESG000047126.1 SMESG000044971.1 SMESG000043973.1 SMESG000040474.1 SMESG000039792.1 SMESG000039741.1 SMESG000039356.1 SMESG000033763.1 SMESG000029537.1 SMESG000029286.1 SMESG000028614.1 SMESG000027381.1 SMESG000025022.1 SMESG000021522.1 SMESG000020398.1 SMESG000019968.1 SMESG000015216.1 SMESG000015102.1 SMESG000013389.1 SMESG000012534.1 SMESG000012464.1 SMESG000011278.1 SMESG000007021.1 SMED30032823smed_20140614PMID:26457503
gutSMED30020701Long-chain specific acyl-CoA dehydrogenaseSMESG000081273.1 SMESG000081269.1 dd_Smed_v4_1458_0_1dd_Smed_v4PMID:29674431
gutSMED30030996hypothetical proteinSMESG000029612.1 SMESG000029602.1 SMED30026394smed_20140614PMID:26457503
gutSMED30034827Histone-lysine N-methyltransferase SETMARSMESG000073618.1 SMESG000073174.1 SMESG000059623.1 SMESG000050300.1 SMESG000040932.1 SMESG000025201.1 SMESG000006554.1 SMESG000079557.1 SMESG000069853.1 SMESG000050880.1 SMESG000043279.1 SMESG000028068.1 SMESG000018675.1 SMESG000018320.1 SMESG000016710.1 SMESG000016088.1 SMESG000005066.1 SMESG000002984.1 SMESG000081574.1 SMESG000081529.1 SMESG000078601.1 SMESG000077556.1 SMESG000075496.1 SMESG000073961.1 SMESG000072739.1 SMESG000071859.1 SMESG000071198.1 SMESG000070153.1 SMESG000068262.1 SMESG000068028.1 SMESG000067334.1 SMESG000062504.1 SMESG000060952.1 SMESG000060260.1 SMESG000050479.1 SMESG000050299.1 SMESG000049776.1 SMESG000047126.1 SMESG000044971.1 SMESG000043973.1 SMESG000040474.1 SMESG000039792.1 SMESG000039741.1 SMESG000039356.1 SMESG000033763.1 SMESG000029537.1 SMESG000029286.1 SMESG000028614.1 SMESG000027381.1 SMESG000025022.1 SMESG000021522.1 SMESG000020398.1 SMESG000019968.1 SMESG000015216.1 SMESG000015102.1 SMESG000013389.1 SMESG000012534.1 SMESG000012464.1 SMESG000011278.1 SMESG000007021.1 SMED30032823smed_20140614PMID:26457503
gutSMED30024713Pyruvate carboxylaseSMESG000077941.1 Contig1099newmark_estsPMID:23079596
gutSMED30024713Pyruvate carboxylaseSMESG000077941.1 Contig1099uc_Smed_v2PMID:23079596
gutSMED30024713Pyruvate carboxylaseSMESG000064914.1 Contig1099newmark_estsPMID:23079596
gutSMED30024713Pyruvate carboxylaseSMESG000064914.1 Contig1099uc_Smed_v2PMID:23079596
gutSMED30023368SMED30023368SMESG000018780.1 dd_Smed_v4_4915_0_1dd_Smed_v4PMID:29674431
gutSMED30026045SMED30026045SMESG000018217.1 dd_Smed_v4_1350_0_1dd_Smed_v4PMID:29674431
gutSMED30028990Protein containing PTH2 domainSMESG000055936.1 dd_Smed_v4_6409_0_1dd_Smed_v4PMID:29674431
gutSMED30025467Heat shock protein 75 kDa, mitochondrialSMESG000016949.1 dd_Smed_v4_1445_0_1dd_Smed_v4PMID:29674431
gutSMED30028809Transient receptor potential cation channel subfamily M member-like 2SMESG000004955.1 dd_Smed_v4_8493_0_1dd_Smed_v4PMID:29674431
gutSMED30027596RNA-binding protein pno1SMESG000015341.1 dd_Smed_v4_1077_0_1dd_Smed_v4PMID:29674431
gutSMED30035074SMED30035074SMESG000068982.1 dd_Smed_v4_1190_0_1dd_Smed_v4PMID:29674431
gutSMED30028902DNA-directed RNA polymeraseSMESG000026344.1 SMESG000026343.1 dd_Smed_v4_5515_0_1dd_Smed_v4PMID:29674431
gutSMED30030386SMED30030386SMESG000026344.1 SMESG000026343.1 dd_Smed_v4_5515_0_1dd_Smed_v4PMID:29674431
gutSMED30035004NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 9, mitochondrialSMESG000072630.1 dd_Smed_v4_1524_0_1dd_Smed_v4PMID:29674431
gutSMED30028856Protein kinase CSMESG000021192.1 dd_Smed_v4_657_0_1dd_Smed_v4PMID:29674431
gutSMED30026844Protein MAK16 homologSMESG000060104.1 dd_Smed_v4_1416_0_1dd_Smed_v4PMID:29674431
gutSMED30035187Cytochrome c oxidase copper chaperoneSMESG000050382.1 dd_Smed_v4_732_0_1dd_Smed_v4PMID:29674431
gutSMED30020168c-Jun N-terminal kinasesSMESG000043618.1 SMED30034763smed_20140614PMID:27441386
gutSMED30028877epoxide hydrolase 4SMESG000022030.1 dd_Smed_v4_2011_0_1dd_Smed_v4PMID:29674431
gutSMED30034752Dynamin-type G domain-containing proteinSMESG000014753.1 dd_Smed_v4_2409_0_1dd_Smed_v4PMID:29674431
gutSMED30026110Acetolactate synthase, putativeSMESG000026596.1 dd_Smed_v4_1784_0_1dd_Smed_v4PMID:29674431
gutSMED30027855Aspartate dehydrogenase domain containingSMESG000061639.1 dd_Smed_v4_1769_0_1dd_Smed_v4PMID:29674431
gutSMED30027087L-xylulose reductaseSMESG000012434.1 dd_Smed_v4_2263_0_1dd_Smed_v4PMID:29674431
gutSMED30023339SMED30023339SMESG000045132.1 dd_Smed_v4_182_0_1dd_Smed_v4PMID:29674431
gutSMED30021828Baculoviral IAP repeat-containing protein 7SMESG000067788.1 dd_Smed_v4_8447_0_1dd_Smed_v4PMID:29674431
gutSMED30028569Flavin-containing monooxygenaseSMESG000040444.1 SMESG000035782.1 dd_Smed_v4_11470_0_1dd_Smed_v4PMID:29674431
gutSMED30006549SMED30006549SMESG000016886.1 SMESG000016875.1 dd_Smed_v4_7893_0_1dd_Smed_v4PMID:29674431
gutSMED30005280SMED30005280SMESG000077104.1 dd_Smed_v4_4063_0_1dd_Smed_v4PMID:29674431
gutSMED30016897SMED30016897SMESG000023253.1 dd_Smed_v4_1757_0_1dd_Smed_v4PMID:29674431
gutSMED30000714Activated cdc42 kinase 1SMESG000060583.1 dd_Smed_v4_6522_0_1dd_Smed_v4PMID:29674431
gutSMED30012198UPF0764 protein C16orf89 homolog isoform X3SMESG000053422.1 dd_Smed_v4_4213_0_1dd_Smed_v4PMID:29674431
gutSMED30000200Polypeptide N-acetylgalactosaminyltransferaseSMESG000017211.1 dd_Smed_v4_5368_0_1dd_Smed_v4PMID:29674431
gutSMED30005665SMED30005665SMESG000074689.1 dd_Smed_v4_2429_0_1dd_Smed_v4PMID:29674431
gutSMED30005489AP-3 complex subunit mu-1SMESG000025662.1 dd_Smed_v4_4846_0_1dd_Smed_v4PMID:29674431
gutSMED30002066SMED30002066SMESG000016886.1 SMESG000016875.1 dd_Smed_v4_7893_0_1dd_Smed_v4PMID:29674431
gutSMED30003469FerritinSMESG000068032.1 SMESG000068030.1 SMESG000068027.1 dd_Smed_v4_1033_0_1dd_Smed_v4PMID:29674431
gutSMED30014561SMED30014561SMESG000000219.1 dd_Smed_v4_862_0_1dd_Smed_v4PMID:29674431
gutSMED30013949SMED30013949SMESG000031517.1 dd_Smed_v4_1406_0_1dd_Smed_v4PMID:29674431
gutSMED30019702SMED30019702SMESG000016033.1 SMESG000000571.1 dd_Smed_v4_661_0_1dd_Smed_v4PMID:29674431
gutSMED30012303SMED30012303SMESG000010464.1 dd_Smed_v4_7906_0_1dd_Smed_v4PMID:29674431
gutSMED30001586Spectrin alpha chainSMESG000005289.1 dd_Smed_v4_919_0_1dd_Smed_v4PMID:29674431
gutSMED30001799NADH dehydrogenase subunit 5SMESG000061907.1 Contig47838newmark_estsPMID:27612384
gutSMED30001799NADH dehydrogenase subunit 5SMESG000061907.1 Contig47838uc_Smed_v2PMID:27612384
gutSMED30001799NADH dehydrogenase subunit 5 dd_Smed_v4_258_0_1dd_Smed_v4PMID:29674431
gutSMED30001799NADH dehydrogenase subunit 5 dd_Smed_v4_957_0_1dd_Smed_v4PMID:29674431
gutSMED30014658N acetyl D glucosamine kinaseSMESG000047333.1 dd_Smed_v4_643_0_1dd_Smed_v4PMID:29674431
gutSMED30019292Ring finger protein 34bSMESG000045336.1 dd_Smed_v4_1395_0_1dd_Smed_v4PMID:29674431
gutSMED30006354SMED30006354SMESG000011239.1 SMESG000011238.1 dd_Smed_v4_6615_0_1dd_Smed_v4PMID:29674431
gutSMED30009861slc26a-3SMESG000064565.1 dd_Smed_v4_11142_0_1dd_Smed_v4PMID:29674431
gutSMED30001818TNF receptor associated factor 3SMESG000026104.1 dd_Smed_v4_9703_0_1dd_Smed_v4PMID:29674431
gutSMED30013075Voltage-dependent anion channel 3SMESG000000196.1 dd_Smed_v4_738_0_1dd_Smed_v4PMID:29674431
gutSMED30007454cAMP-dependent protein kinase catalytic subunitSMESG000048623.1 SMESG000043218.1 dd_Smed_v4_8371_0_1dd_Smed_v4PMID:29674431
gutSMED30010964Type II pantothenate kinaseSMESG000077416.1 dd_Smed_v4_3794_0_1dd_Smed_v4PMID:29674431
gutSMED30009385SMED30009385SMESG000031786.1 dd_Smed_v4_1365_0_1dd_Smed_v4PMID:29674431
gutSMED30005190SMED30005190SMESG000041069.1 dd_Smed_v4_237_0_1dd_Smed_v4PMID:29674431
gutSMED30004147CarboxypeptidaseSMESG000029164.1 dd_Smed_v4_785_0_1dd_Smed_v4PMID:29674431
gutSMED30017862Jagged 2-1SMESG000025147.1 dd_Smed_v4_4792_0_1dd_Smed_v4PMID:27063937
gutSMED30017862Jagged 2-1SMESG000025147.1 dd_Smed_v4_4792_0_1dd_Smed_v4PMID:29674431
gutSMED30015802Trans-L-3-hydroxyproline dehydrataseSMESG000021283.1 dd_Smed_v4_7144_0_1dd_Smed_v4PMID:29674431
gutSMED30008521SMED30008521SMESG000004065.1 SMESG000004062.1 dd_Smed_v4_7096_0_1dd_Smed_v4PMID:29674431
gutSMED30008521SMED30008521SMESG000004065.1 SMESG000004062.1 dd_Smed_v4_7096_0_1dd_Smed_v4PMID:30962434
gutSMED30008521SMED30008521SMESG000004065.1 SMESG000004062.1 SMED30027243smed_20140614PMID:26457503
gutSMED30012757Tektin-4SMESG000068903.1 dd_Smed_v4_4872_0_1dd_Smed_v4PMID:29674431
gutSMED30000781SMED30000781SMESG000036926.1 SMESG000036919.1 dd_Smed_v4_4876_0_1dd_Smed_v4PMID:29674431
gutSMED30014246Ras-related protein Rab-5ASMESG000064914.1 dd_Smed_v4_796_0_1dd_Smed_v4PMID:29674431
gutSMED30014246Ras-related protein Rab-5ASMESG000077941.1 Contig1099GPL15192PMID:23079596
gutSMED30014246Ras-related protein Rab-5ASMESG000064914.1 Contig1099GPL15192PMID:23079596
gutSMED30009414SMED30009414SMESG000017043.1 dd_Smed_v4_854_0_1dd_Smed_v4PMID:29674431
gutSMED30014735LapA_dom domain-containing proteinSMESG000063585.1 dd_Smed_v4_4923_0_1dd_Smed_v4PMID:29674431
gutSMED30015436SMED30015436SMESG000011239.1 SMESG000011238.1 dd_Smed_v4_6615_0_1dd_Smed_v4PMID:29674431
gutSMED30005551Spectrin alpha chainSMESG000005289.1 dd_Smed_v4_919_0_1dd_Smed_v4PMID:29674431
gutSMED30004214SMED30004214SMESG000055805.1 dd_Smed_v4_857_0_1dd_Smed_v4PMID:29674431
gutSMED300191411-phosphatidylinositol 3-phosphate 5-kinaseSMESG000051464.1 dd_Smed_v4_3136_0_1dd_Smed_v4PMID:29674431
gutSMED30012555Ras-related protein Rab-39BSMESG000056866.1 Contig15474newmark_estsPMID:27612384
gutSMED30012555Ras-related protein Rab-39BSMESG000056866.1 Contig15474uc_Smed_v2PMID:27612384
gutSMED30014667SMED30014667SMESG000004032.1 dd_Smed_v4_6955_0_1dd_Smed_v4PMID:29674431
gutSMED30000248Ras-related protein Rab-11ASMESG000016036.1 dd_Smed_v4_4964_0_1dd_Smed_v4PMID:29674431
gutSMED30001546Y box protein-1SMESG000058043.1 SMED30004532smed_20140614PMID:26457503
gutSMED30016428SMED30016428SMESG000010464.1 dd_Smed_v4_7906_0_1dd_Smed_v4PMID:29674431
gutSMED30002537Y box protein-1SMESG000058043.1 SMED30004532smed_20140614PMID:26457503
gutSMED30002547Peptidyl-prolyl cis-trans isomeraseSMESG000052204.1 SMESG000006596.1 dd_Smed_v4_457_0_1dd_Smed_v4PMID:29674431
gutSMED30004315Bestrophin homologSMESG000070057.1 dd_Smed_v4_8073_0_1dd_Smed_v4PMID:29674431
gutSMED30020521Glycerol-3-phosphate acyltransferase 3SMESG000061821.1 dd_Smed_v4_2445_0_1dd_Smed_v4PMID:29674431
gutSMED30026578Peptidoglycan-recognition proteinSMESG000068025.1 dd_Smed_v4_1523_0_1dd_Smed_v4PMID:29674431
gutSMED3003191640S ribosomal protein S30SMESG000065562.1 dd_Smed_v4_126_0_1dd_Smed_v4PMID:29674431
gutSMED30020599Alpha-1,6-mannosyl-glycoprotein 2-beta-N-acetylglucosaminyltransferaseSMESG000047050.1 dd_Smed_v4_9232_0_1dd_Smed_v4PMID:29674431
gutSMED30032932Protein kinase domain-containing proteinSMESG000066720.1 SMESG000065914.1 SMESG000065913.1 SMESG000044801.1 SMESG000021895.1 Contig36405newmark_estsPMID:27612384
gutSMED30032932Protein kinase domain-containing proteinSMESG000066720.1 SMESG000065914.1 SMESG000065913.1 SMESG000044801.1 SMESG000021895.1 Contig36405uc_Smed_v2PMID:27612384
gutSMED30027932SMED30027932SMESG000043629.1 dd_Smed_v4_1216_0_1dd_Smed_v4PMID:29674431
gutSMED30035597SMED30035597SMESG000029469.1 dd_Smed_v4_1765_0_1dd_Smed_v4PMID:29674431
gutSMED30025489DUF21 domain-containing proteinSMESG000055506.1 dd_Smed_v4_6666_0_1dd_Smed_v4PMID:29674431
gutSMED30021123N-acetyltransferaseSMESG000064458.1 dd_Smed_v4_4567_0_1dd_Smed_v4PMID:29674431
gutSMED30020702SMED30020702SMESG000006139.1 dd_Smed_v4_7156_0_1dd_Smed_v4PMID:29674431
gutSMED30027608SMED30027608SMESG000023253.1 dd_Smed_v4_1757_0_1dd_Smed_v4PMID:29674431
gutSMED30028898BZIP domain-containing proteinSMESG000067543.1 dd_Smed_v4_1399_0_1dd_Smed_v4PMID:29674431
gutSMED30022057SJCHGC08494 proteinSMESG000027083.1 dd_Smed_v4_2196_0_1dd_Smed_v4PMID:29674431
gutSMED30035145Syntaxin binding proteinSMESG000060160.1 dd_Smed_v4_10167_0_1dd_Smed_v4PMID:29674431
gutSMED30035248Sprouty related EVH1 domain containing 2aSMESG000045033.1 dd_Smed_v4_14816_0_1dd_Smed_v4PMID:29674431
gutSMED30032172Guanine nucleotide-binding protein G(i) subunit alphaSMESG000005418.1 dd_Smed_v4_1773_0_1dd_Smed_v4PMID:29674431
gutSMED30022178SMED30022178SMESG000057910.1 dd_Smed_v4_1090_0_1dd_Smed_v4PMID:29674431
gutSMED30018716Acidic leucine-rich nuclear phosphoprotein 32 family member ASMESG000065271.1 SMED30018716smed_20140614PMID:26457503
gutSMED30002138slc36a-2SMESG000060771.1 dd_Smed_v4_2596_0_1dd_Smed_v4PMID:29674431
gutSMED30004928phosphatidylinositol 4-kinase betaSMESG000061430.1 tr5_4416mu_Smed_v1PMID:25558068
gutSMED300097175-aminolevulinate synthaseSMESG000078664.1 SMED30009717smed_20140614PMID:27551436
gutSMED30014479SMED30014479SMESG000036948.1 dd_Smed_v4_4111_0_1dd_Smed_v4PMID:29674431
gutSMED30019098SMED30019098SMESG000037105.1 dd_Smed_v4_848_0_1dd_Smed_v4PMID:29674431
gutSMED30013425NADH dehydrogenase ubiquinone 1 betaSMESG000011219.1 dd_Smed_v4_2640_0_1dd_Smed_v4PMID:29674431
gutSMED30009673SMED30009673SMESG000040843.1 dd_Smed_v4_5502_0_1dd_Smed_v4PMID:29674431
gutSMED30017845Alpha-2-macroglobulinSMESG000037145.1 SMESG000037203.1 SMESG000037155.1 SMESG000037154.1 SMESG000037147.1 SMESG000037146.1 dd_Smed_v4_568_0_1dd_Smed_v4PMID:29674431
gutSMED30004557Tyrosine-protein kinaseSMESG000015831.1 dd_Smed_v4_2291_0_1dd_Smed_v4PMID:29674431
gutSMED30008806slc26a-1SMESG000035953.1 dd_Smed_v4_8150_0_1dd_Smed_v4PMID:29674431
gutSMED30005465Ras-related protein Rab-11ASMESG000073334.1 dd_Smed_v4_867_0_1dd_Smed_v4PMID:29674431
gutSMED30018924SMED30018924SMESG000028420.1 SMED30018924smed_20140614PMID:26457503
gutSMED30009252bcl2-3SMESG000011963.1 dd_Smed_v4_2886_0_1dd_Smed_v4PMID:29674431
gutSMED30003127SMED30003127SMESG000027140.1 Contig1248newmark_estsPMID:23079596
gutSMED30011744Translocator proteinSMESG000079158.1 dd_Smed_v4_3672_0_1dd_Smed_v4PMID:29674431
gutSMED30009885SMED30009885SMESG000070660.1 SMESG000069659.1 SMESG000056147.1 SMESG000055898.1 SMESG000023221.1 SMESG000022877.1 SMESG000017867.1 SMESG000017539.1 SMESG000014828.1 SMESG000009159.1 SMESG000005977.1 SMESG000061817.1 SMESG000039834.1 SMESG000005147.1 dd_Smed_v4_684_0_1dd_Smed_v4PMID:29674431
gutSMED30007385SMED30007385SMESG000003089.1 dd_Smed_v4_780_0_1dd_Smed_v4PMID:29674431
gutSMED30017015Deferrochelatase/peroxidase YfeXSMESG000077723.1 dd_Smed_v4_2999_0_1dd_Smed_v4PMID:29674431
gutSMED30002603SMED30002603SMESG000053020.1 SMESG000053011.1 dd_Smed_v4_597_0_1dd_Smed_v4PMID:29674431
gutSMED30005783Tafazzin family proteinSMESG000048217.1 dd_Smed_v4_6026_0_1dd_Smed_v4PMID:29674431
gutSMED3000480860S ribosomal protein L27aSMESG000005086.1 dd_Smed_v4_549_0_1dd_Smed_v4PMID:29674431
gutSMED30014008MBOAT2SMESG000066852.1 dd_Smed_v4_3131_0_1dd_Smed_v4PMID:29674431
gutSMED30006731BZIP domain-containing proteinSMESG000008447.1 SMESG000008431.1 SMED30006731smed_20140614PMID:27441386
gutSMED30002094SMED30002094SMESG000003117.1 Contig1178GPL15192PMID:23079596
gutSMED30018353Glycine amidinotransferase, mitochondrialSMESG000051964.1 SMED30018353smed_20140614PMID:26457503
gutSMED30013201Peptidylprolyl isomeraseSMESG000062712.1 dd_Smed_v4_894_0_1dd_Smed_v4PMID:29674431
gutSMED30000788SMED30000788SMESG000035357.1 dd_Smed_v4_2571_0_1dd_Smed_v4PMID:29674431
gutSMED30008540O-acyltransferaseSMESG000037749.1 dd_Smed_v4_4278_0_1dd_Smed_v4PMID:29674431
gutSMED30013304Enoyl-CoA delta isomerase 2SMESG000070742.1 SMESG000046541.1 SMESG000020638.1 dd_Smed_v4_5239_0_1dd_Smed_v4PMID:29674431
gutSMED30004348Alpha-2-macroglobulinSMESG000037145.1 SMESG000037203.1 SMESG000037155.1 SMESG000037154.1 SMESG000037147.1 SMESG000037146.1 dd_Smed_v4_568_0_1dd_Smed_v4PMID:29674431
gutSMED30008633SMED30008633SMESG000057402.1 dd_Smed_v4_2671_0_1dd_Smed_v4PMID:29674431
gutSMED30011140Argininosuccinate synthaseSMESG000053053.1 SMESG000053052.1 SMED30011140smed_20140614PMID:26457503
gutSMED30001852CD109 antigenSMESG000016163.1 dd_Smed_v4_3070_0_1dd_Smed_v4PMID:29674431
gutSMED30001895Very-long-chain 3-oxoacyl-CoA reductaseSMESG000077527.1 dd_Smed_v4_2464_0_1dd_Smed_v4PMID:29674431
gutSMED30002994SMED30002994SMESG000028748.1 dd_Smed_v4_7699_0_1dd_Smed_v4PMID:29674431
gutSMED30027355Sorbitol dehydrogenase-like proteinSMESG000042474.1 dd_Smed_v4_1002_0_1dd_Smed_v4PMID:29674431
gutSMED30028039semaphorin 1SMESG000069640.1 dd_Smed_v4_12018_0_1dd_Smed_v4PMID:29674431
gutSMED30023538Si:dkey-12j5.1SMESG000041594.1 dd_Smed_v4_438_0_1dd_Smed_v4PMID:29674431
gutSMED30030198Lamin-B receptorSMESG000042131.1 SMED30030198smed_20140614PMID:26457503
gutSMED30022501Fatty acid-binding protein, heartSMESG000029500.1 dd_Smed_v4_599_0_1dd_Smed_v4PMID:29674431
gutSMED30035920SMED30035920SMESG000070660.1 SMESG000069659.1 SMESG000056147.1 SMESG000055898.1 SMESG000023221.1 SMESG000022877.1 SMESG000017867.1 SMESG000017539.1 SMESG000014828.1 SMESG000009159.1 SMESG000005977.1 SMESG000061817.1 SMESG000039834.1 SMESG000005147.1 dd_Smed_v4_684_0_1dd_Smed_v4PMID:29674431
gutSMED30035711Strawberry notch homolog 1SMESG000047829.1 dd_Smed_v4_10374_0_1dd_Smed_v4PMID:29674431
gutSMED3002341340S ribosomal protein S25SMESG000059049.1 dd_Smed_v4_134_0_1dd_Smed_v4PMID:29674431
gutSMED30027303Methylcrotonoyl-CoA carboxylase 2 (beta)SMESG000035087.1 dd_Smed_v4_5574_0_1dd_Smed_v4PMID:29674431
gutSMED30027474Succinate dehydrogenase cytochrome b560 subunitSMESG000017174.1 dd_Smed_v4_748_0_1dd_Smed_v4PMID:29674431
gutSMED3002165739S ribosomal protein L23SMESG000037729.1 SMESG000037731.1 dd_Smed_v4_2551_0_1dd_Smed_v4PMID:29674431
gutSMED30033402Nascent polypeptide-associated complex subunit betaSMESG000026176.1 dd_Smed_v4_358_0_1dd_Smed_v4PMID:29674431
gutSMED3002797940S ribosomal protein S27SMESG000066109.1 SMESG000052687.1 SMESG000014240.1 SMESG000069832.1 SMESG000037642.1 dd_Smed_v4_106_0_1dd_Smed_v4PMID:29674431
gutSMED30031407Coiled-coil-helix-coiled-coil-helix domain-containing protein 10 mitochondrialSMESG000003969.1 dd_Smed_v4_225_0_1dd_Smed_v4PMID:29674431
gutSMED30027156SMED30027156SMESG000038687.1 SMESG000038673.1 SMED30027156smed_20140614PMID:26457503
gutSMED30033257Cytochrome c oxidase subunit 5BSMESG000050948.1 dd_Smed_v4_861_0_1dd_Smed_v4PMID:29674431
gutSMED30023587SMED30023587SMESG000063816.1 SMESG000010536.1 SMESG000045280.1 SMESG000029730.1 dd_Smed_v4_4145_0_1dd_Smed_v4PMID:29674431
gutSMED30028056tudor-1SMESG000030853.1 Contig1138newmark_estsPMID:23079596
gutSMED30028056tudor-1SMESG000030853.1 Contig1138uc_Smed_v2PMID:23079596
gutSMED30028056tudor-1SMESG000051672.1 SMESG000051670.1 Contig1138newmark_estsPMID:23079596
gutSMED30028056tudor-1SMESG000051672.1 SMESG000051670.1 Contig1138uc_Smed_v2PMID:23079596
gutSMED3002669640S ribosomal protein S19SMESG000023987.1 SMESG000009719.1 dd_Smed_v4_202_0_1dd_Smed_v4PMID:29674431
gutSMED30031180SMED30031180SMESG000016699.1 dd_Smed_v4_10468_0_1dd_Smed_v4PMID:29674431
gutSMED30035359SMED30035359SMESG000073618.1 SMESG000073174.1 SMESG000059623.1 SMESG000050300.1 SMESG000040932.1 SMESG000025201.1 SMESG000006554.1 SMESG000079557.1 SMESG000069853.1 SMESG000050880.1 SMESG000043279.1 SMESG000028068.1 SMESG000018675.1 SMESG000018320.1 SMESG000016710.1 SMESG000016088.1 SMESG000005066.1 SMESG000002984.1 SMESG000081574.1 SMESG000081529.1 SMESG000078601.1 SMESG000077556.1 SMESG000075496.1 SMESG000073961.1 SMESG000072739.1 SMESG000071859.1 SMESG000071198.1 SMESG000070153.1 SMESG000068262.1 SMESG000068028.1 SMESG000067334.1 SMESG000062504.1 SMESG000060952.1 SMESG000060260.1 SMESG000050479.1 SMESG000050299.1 SMESG000049776.1 SMESG000047126.1 SMESG000044971.1 SMESG000043973.1 SMESG000040474.1 SMESG000039792.1 SMESG000039741.1 SMESG000039356.1 SMESG000033763.1 SMESG000029537.1 SMESG000029286.1 SMESG000028614.1 SMESG000027381.1 SMESG000025022.1 SMESG000021522.1 SMESG000020398.1 SMESG000019968.1 SMESG000015216.1 SMESG000015102.1 SMESG000013389.1 SMESG000012534.1 SMESG000012464.1 SMESG000011278.1 SMESG000007021.1 SMED30032823smed_20140614PMID:26457503
gutSMED30028041Transmembrane channel proteinSMESG000013576.1 dd_Smed_v4_6619_0_1dd_Smed_v4PMID:29674431
gutSMED30022078Translationally-controlled tumor protein homologSMESG000023212.1 dd_Smed_v4_136_0_1dd_Smed_v4PMID:29674431
gutSMED30024429SMED30024429SMESG000037418.1 dd_Smed_v4_1471_0_1dd_Smed_v4PMID:29674431
gutSMED30024295Mitogen-activated protein kinaseSMESG000032743.1 dd_Smed_v4_1319_0_1dd_Smed_v4PMID:29674431
gutSMED3002930240S ribosomal protein S16SMESG000018349.1 SMESG000018333.1 dd_Smed_v4_170_0_1dd_Smed_v4PMID:29674431
gutSMED30029332Cytochrome b-c1 complex subunit 9SMESG000012361.1 dd_Smed_v4_1607_0_1dd_Smed_v4PMID:29674431
gutSMED30025422GrpE protein homologSMESG000004230.1 dd_Smed_v4_1172_0_1dd_Smed_v4PMID:29674431
gutSMED30034751Elongation factor G, mitochondrialSMESG000035436.1 dd_Smed_v4_1879_0_1dd_Smed_v4PMID:29674431
gutSMED30025897Leucine aminopeptidaseSMESG000037231.1 dd_Smed_v4_1475_0_1dd_Smed_v4PMID:29674431
gutSMED30027550tRNA (adenine(58)-N(1))-methyltransferase non-catalytic subunit TRM6SMESG000072786.1 dd_Smed_v4_3327_0_1dd_Smed_v4PMID:29674431
gutSMED30035459Pyridoxal phosphate homeostasis proteinSMESG000050381.1 dd_Smed_v4_3558_0_1dd_Smed_v4PMID:29674431
gutSMED30028427C-1-tetrahydrofolate synthase, cytoplasmicSMESG000066343.1 SMESG000066342.1 SMESG000066340.1 dd_Smed_v4_1858_0_1dd_Smed_v4PMID:29674431
gutSMED30021206Calcineurin B homologous protein 1SMESG000018297.1 dd_Smed_v4_1504_0_1dd_Smed_v4PMID:29674431
gutSMED30020269MyophilinSMESG000081505.1 SMESG000049198.1 SMESG000047694.1 SMESG000035451.1 SMESG000035348.1 dd_Smed_v4_395_0_1dd_Smed_v4PMID:29674431
gutSMED30023981SMED30023981SMESG000026344.1 SMESG000026343.1 dd_Smed_v4_5515_0_1dd_Smed_v4PMID:29674431
gutSMED30026073NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 13SMESG000081249.1 dd_Smed_v4_1256_0_1dd_Smed_v4PMID:29674431
gutSMED30034953SMED30034953SMESG000065075.1 dd_Smed_v4_102_0_1dd_Smed_v4PMID:29674431
gutSMED30035692Long-chain specific acyl-CoA dehydrogenase, mitochondrialSMESG000081273.1 SMESG000081269.1 dd_Smed_v4_1458_0_1dd_Smed_v4PMID:29674431
gutSMED30028880Importin-7SMESG000014221.1 dd_Smed_v4_728_0_1dd_Smed_v4PMID:29674431
gutSMED30033892SMED30033892SMESG000029612.1 SMESG000029602.1 SMED30026394smed_20140614PMID:26457503
gutSMED30026993GCR104SMESG000018211.1 GCR104smed_ncbi_20200123PMID:27163480
gutSMED30031780Ras-related protein Rab-5ASMESG000065500.1 Contig1027GPL15192PMID:23079596
gutSMED30029555Serine/arginine-rich splicing factor 4SMESG000045501.1 dd_Smed_v4_473_0_1dd_Smed_v4PMID:29674431
gutSMED30007434NADPH:adrenodoxin oxidoreductase, mitochondrialSMESG000050975.1 Contig7307uc_Smed_v2PMID:23079596
gutSMED30007434NADPH:adrenodoxin oxidoreductase, mitochondrialSMESG000050975.1 Contig7307newmark_estsPMID:23079596
gutSMED30007434NADPH:adrenodoxin oxidoreductase, mitochondrialSMESG000050975.1 dd_Smed_v4_8668_0_1dd_Smed_v4PMID:29674431
gutSMED30010792Protein kinaseSMESG000074416.1 SMESG000074407.1 dd_Smed_v4_3361_0_1dd_Smed_v4PMID:29674431
gutSMED30010792Protein kinaseSMESG000074416.1 SMESG000074407.1 Contig1629GPL15192PMID:23079596
gutSMED30019325Myosin regulatory light chainSMESG000068156.1 SMESG000064685.1 SMESG000043474.1 SMESG000010609.1 SMESG000076470.1 SMESG000073857.1 SMESG000062429.1 SMESG000058575.1 SMESG000053533.1 SMESG000020635.1 SMESG000015751.1 SMESG000005260.1 Contig246GPL15192PMID:23079596
gutSMED30019325Myosin regulatory light chainSMESG000000175.1 Contig246GPL15192PMID:23079596
gutSMED30019325Myosin regulatory light chainSMESG000000175.1 Contig2068GPL15192PMID:23079596
gutSMED30019325Myosin regulatory light chainSMESG000036544.1 Contig3175GPL15192PMID:23079596
gutSMED30019325Myosin regulatory light chainSMESG000000175.1 Contig3175GPL15192PMID:23079596
gutSMED30003662Serine/threonine-protein phosphatase 2A 55 kDa regulatory subunit BSMESG000074250.1 dd_Smed_v4_5857_0_1dd_Smed_v4PMID:29674431
gutSMED30005634SMED30005634SMESG000017098.1 SMESG000014979.1 SMESG000014974.1 dd_Smed_v4_7198_0_1dd_Smed_v4PMID:29674431
gutSMED30015354Tubby-like proteinSMESG000043973.1 SMESG000011278.1 Contig1351newmark_estsPMID:23079596
gutSMED30015354Tubby-like proteinSMESG000043973.1 SMESG000011278.1 Contig1351uc_Smed_v2PMID:23079596
gutSMED30015354Tubby-like proteinSMESG000039846.1 Contig1351newmark_estsPMID:23079596
gutSMED30015354Tubby-like proteinSMESG000039846.1 Contig1351uc_Smed_v2PMID:23079596
gutSMED30008126N-acetylneuraminate lyaseSMESG000023444.1 dd_Smed_v4_2981_0_1dd_Smed_v4PMID:29674431
gutSMED30035970transcription initiation factor TFIID subunit 2SMESG000037189.1 dd_Smed_v4_15494_0_1dd_Smed_v4PMID:29674431
gutSMED3002737860S ribosomal protein L3SMESG000022732.1 dd_Smed_v4_127_0_1dd_Smed_v4PMID:29674431
gutSMED30033332Beta-adducinSMESG000059133.1 dd_Smed_v4_1425_0_1dd_Smed_v4PMID:29674431
gutSMED3002169814-3-3 protein epsilonSMESG000047644.1 Contig5316GPL15192PMID:23079596
gutSMED3002169814-3-3 protein epsilonSMESG000047644.1 dd_Smed_v4_36_0_1dd_Smed_v4PMID:29674431
gutSMED30031646SMED30031646SMESG000010156.1 dd_Smed_v4_105_0_1dd_Smed_v4PMID:29674431
gutSMED30033930Cystathionine beta-synthaseSMESG000065264.1 SMESG000065255.1 dd_Smed_v4_1585_0_1dd_Smed_v4PMID:29674431
gutSMED30033930Cystathionine beta-synthaseSMESG000054075.1 SMESG000034294.1 Contig1264GPL15192PMID:23079596
gutSMED30033930Cystathionine beta-synthaseSMESG000065264.1 SMESG000065255.1 Contig1264GPL15192PMID:23079596
gutSMED30035571Protein disulfide-isomerase A5SMESG000005268.1 dd_Smed_v4_1537_0_1dd_Smed_v4PMID:29674431
gutSMED30027909Mov10 like RISC complex RNA helicase 1SMESG000069873.1 SMESG000069862.1 DN311570ncbi_smed_estsPMID:16344473
gutSMED30032879Selenide, water dikinase 1SMESG000075106.1 dd_Smed_v4_1918_0_1dd_Smed_v4PMID:29674431
gutSMED30035502Cytochrome P450 2K1-like proteinSMESG000013701.1 SMESG000013700.1 SMESG000013697.1 dd_Smed_v4_2083_0_1dd_Smed_v4PMID:29674431
gutSMED30034590Post-GPI attachment to proteins factor 2-likeSMESG000044614.1 dd_Smed_v4_10182_0_1dd_Smed_v4PMID:29674431
gutSMED30024174Programmed cell death 6-interacting proteinSMESG000051593.1 Contig4912GPL15192PMID:23079596
gutSMED30024174Programmed cell death 6-interacting proteinSMESG000019014.1 Contig4912GPL15192PMID:23079596
gutSMED3003601340S ribosomal protein S20SMESG000002673.1 dd_Smed_v4_123_0_1dd_Smed_v4PMID:29674431
gutSMED30027751SMED30027751SMESG000014111.1 Contig4084newmark_estsPMID:23079596
gutSMED30032562SMED30032562SMESG000014825.1 Contig3406newmark_estsPMID:23079596
gutSMED30032562SMED30032562SMESG000014825.1 Contig3406uc_Smed_v2PMID:23079596
gutSMED30032562SMED30032562SMESG000002541.1 Contig3406newmark_estsPMID:23079596
gutSMED30032562SMED30032562SMESG000002541.1 Contig3406uc_Smed_v2PMID:23079596
gutSMED30030829Y-box proteinSMESG000032180.1 Contig1715GPL15192PMID:23079596
gutSMED30035881noggin-like protein 7SMESG000016086.1 FJ471489.1smed_ncbi_20200123PMID:19174194
gutSMED30035881noggin-like protein 7SMESG000016086.1 FJ471489smed_ncbi_20200123PMID:19174194
gutSMED30029442epidermal growth factor receptor 2SMESG000004201.1 SMESG000004200.1 HM777017smed_ncbi_20200123PMID:21458439
gutSMED30029442epidermal growth factor receptor 2SMESG000004201.1 SMESG000004200.1 dd_Smed_v4_10499_0_1dd_Smed_v4PMID:29674431
gutSMED30031764ADF-H domain-containing proteinSMESG000022423.1 Contig1245GPL15192PMID:23079596
gutSMED30026256vault protein inter alpha trypsin-1SMESG000053671.1 SMESG000053667.1 Contig5414GPL15192PMID:23079596
gutSMED30027697SMED30027697SMESG000012408.1 dd_Smed_v4_1776_0_1dd_Smed_v4PMID:29674431
gutSMED30032682Methylmalonate-semialdehyde dehydrogenaseSMESG000039266.1 dd_Smed_v4_2050_0_1dd_Smed_v4PMID:29674431
gutSMED30021080SMED30021080SMESG000060573.1 Contig5379newmark_estsPMID:23079596
gutSMED30021080SMED30021080SMESG000060573.1 Contig5379uc_Smed_v2PMID:23079596
gutSMED30021080SMED30021080SMESG000073809.1 Contig5379newmark_estsPMID:23079596
gutSMED30021080SMED30021080SMESG000073809.1 Contig5379uc_Smed_v2PMID:23079596
gutSMED30033453Dimer_Tnp_hAT domain-containing proteinSMESG000001790.1 dd_Smed_v4_212_0_1dd_Smed_v4PMID:29674431
gutSMED30023510Ornithine aminotransferaseSMESG000055175.1 dd_Smed_v4_1896_0_1dd_Smed_v4PMID:29674431
gutSMED30027595DUF3421 domain-containing proteinSMESG000027124.1 dd_Smed_v4_1333_0_1dd_Smed_v4PMID:29674431
gutSMED30027595DUF3421 domain-containing proteinSMESG000020792.1 Contig1106GPL15192PMID:23079596
gutSMED30027595DUF3421 domain-containing proteinSMESG000027124.1 Contig1106GPL15192PMID:23079596
gutSMED30035556Vacuolar protein sorting-associated protein 13A/CSMESG000037244.1 dd_Smed_v4_1648_0_1dd_Smed_v4PMID:29674431
gutSMED30034467Protein tyrosine phosphatase type IVASMESG000015894.1 SMESG000000559.1 Contig1506GPL15192PMID:23079596
gutSMED30034467Protein tyrosine phosphatase type IVASMESG000078978.1 Contig1506GPL15192PMID:23079596
gutSMED30034467Protein tyrosine phosphatase type IVASMESG000078978.1 SMESG000078867.1 SMESG000010171.1 dd_Smed_v4_2239_0_1dd_Smed_v4PMID:29674431
gutSMED30029551Acyl-CoA-binding proteinSMESG000036533.1 dd_Smed_v4_160_0_1dd_Smed_v4PMID:29674431
gutSMED30022408Post-GPI attachment to proteins factor 2-like proteinSMESG000044614.1 dd_Smed_v4_10182_0_1dd_Smed_v4PMID:29674431
gutSMED30030310SMED30030310SMESG000057201.1 dd_Smed_v4_1531_0_1dd_Smed_v4PMID:29674431
gutSMED30034290Ribosomal protein L24SMESG000014001.1 dd_Smed_v4_1638_0_1dd_Smed_v4PMID:29674431
gutSMED30020811SMED30020811SMESG000005612.1 Contig594newmark_estsPMID:23079596
gutSMED30020811SMED30020811SMESG000005612.1 Contig594uc_Smed_v2PMID:23079596
gutSMED30020811SMED30020811SMESG000011575.1 Contig594newmark_estsPMID:23079596
gutSMED30020811SMED30020811SMESG000011575.1 Contig594uc_Smed_v2PMID:23079596
gutSMED30020811SMED30020811SMESG000005612.1 dd_Smed_v4_2483_0_1dd_Smed_v4PMID:29674431
gutSMED30005413SMED30005413SMESG000017261.1 dd_Smed_v4_2030_0_1dd_Smed_v4PMID:29674431
gutSMED30001350SMED30001350SMESG000045656.1 Contig3259newmark_estsPMID:23079596
gutSMED30012477SMED30012477SMESG000081058.1 Contig2302newmark_estsPMID:23079596
gutSMED30008917Tubulin alpha chainSMESG000079650.1 SMESG000010171.1 dd_Smed_v4_124_0_1dd_Smed_v4PMID:29674431
gutSMED30005082SMED30005082SMESG000009320.1 Contig1862newmark_estsPMID:23079596
gutSMED30015613GLI-2SMESG000060276.1 dd_Smed_v4_46372_0_1dd_Smed_v4PMID:29674431
gutSMED30015613GLI-2SMESG000060276.1 dd_Smed_v4_25554_0_1dd_Smed_v4PMID:29674431
gutSMED30018086Talin-1SMESG000019748.1 dd_Smed_v4_1233_0_1dd_Smed_v4PMID:29674431
gutSMED30018086Talin-1SMESG000019748.1 dd_Smed_v4_7313_0_1dd_Smed_v4PMID:29674431
gutSMED30007877SMED30007877SMESG000046412.1 SMESG000037658.1 dd_Smed_v4_1553_0_1dd_Smed_v4PMID:29674431
gutSMED30012469SMED30012469SMESG000038855.1 Contig2191newmark_estsPMID:23079596
gutSMED30019264DUF3421 domain-containing proteinSMESG000029906.1 dd_Smed_v4_2061_0_1dd_Smed_v4PMID:29674431
gutSMED30008907SMED30008907SMESG000017261.1 dd_Smed_v4_2030_0_1dd_Smed_v4PMID:29674431
gutSMED3000598860S ribosomal protein L24SMESG000007869.1 SMESG000007858.1 SMESG000007847.1 dd_Smed_v4_172_0_1dd_Smed_v4PMID:29674431
gutSMED30013591Fructose-bisphosphate aldolaseSMESG000027545.1 dd_Smed_v4_398_0_1dd_Smed_v4PMID:29674431
gutSMED30017264SMED30017264SMESG000055031.1 dd_Smed_v4_2419_0_1dd_Smed_v4PMID:29674431
gutSMED30003249ProhibitinSMESG000038397.1 dd_Smed_v4_1038_0_1dd_Smed_v4PMID:29674431
gutSMED30012344SMED30012344SMESG000017261.1 dd_Smed_v4_2030_0_1dd_Smed_v4PMID:29674431
gutSMED30004908L1-like cell adhesion moleculeSMESG000025433.1 dd_Smed_v4_1916_0_1dd_Smed_v4PMID:29674431
gutSMED3001895450S ribosomal protein L7/L12SMESG000026245.1 dd_Smed_v4_2166_0_1dd_Smed_v4PMID:29674431
gutSMED30010999Multidrug and toxin extrusion proteinSMESG000065608.1 dd_Smed_v4_7241_0_1dd_Smed_v4PMID:29674431
gutSMED30011568Ragulator complex protein isoform 1SMESG000058434.1 dd_Smed_v4_2623_0_1dd_Smed_v4PMID:29674431
gutSMED30001674SMED30001674SMESG000002943.1 Contig3127newmark_estsPMID:23079596
gutSMED30018688TNF receptor-associated factorSMESG000070130.1 SMESG000070126.1 dd_Smed_v4_1439_0_1dd_Smed_v4PMID:29674431
gutSMED3000245560S ribosomal protein L6SMESG000076172.1 dd_Smed_v4_205_0_1dd_Smed_v4PMID:29674431
gutSMED30008259Progesterone receptor membrane component 1SMESG000069126.1 SMESG000069122.1 dd_Smed_v4_2076_0_1dd_Smed_v4PMID:29674431
gutSMED30018702Voltage-dependent anion-selective channel protein 2SMESG000053095.1 dd_Smed_v4_2119_0_1dd_Smed_v4PMID:29674431
gutSMED30015100SMED30015100SMESG000024438.1 dd_Smed_v4_7255_0_1dd_Smed_v4PMID:29674431
gutSMED30002047Histone-lysine N-methyltransferaseSMESG000064115.1 KC262345smed_ncbi_20200123PMID:23235145
gutSMED30018082Progesterone receptor membrane component 1SMESG000069126.1 SMESG000069122.1 dd_Smed_v4_2076_0_1dd_Smed_v4PMID:29674431
gutSMED3001553460S ribosomal protein L21SMESG000040216.1 dd_Smed_v4_189_0_1dd_Smed_v4PMID:29674431
gutSMED30017555Lipopolysaccharide cholinephosphotransferaseSMESG000043355.1 dd_Smed_v4_2367_0_1dd_Smed_v4PMID:29674431
gutSMED30005820SMED30005820SMESG000080577.1 dd_Smed_v4_19517_0_1dd_Smed_v4PMID:29674431
gutSMED30001514SMED30001514SMESG000077491.1 SMED30019697smed_20140614PMID:26457503
gutSMED30016130Glutamate receptor, metabotropic 1aSMESG000064054.1 GCR154smed_ncbi_20200123PMID:27163480
gutSMED30008798cAMP-dependent protein kinase type II regulatory subunitSMESG000051354.1 dd_Smed_v4_1362_0_1dd_Smed_v4PMID:29674431
gutSMED30015291SMED30015291SMESG000014369.1 dd_Smed_v4_470_0_1dd_Smed_v4PMID:29674431
gutSMED30017439SMED30017439SMESG000000381.1 SMESG000000382.1 dd_Smed_v4_2318_0_1dd_Smed_v4PMID:29674431
gutSMED30011190Cytosolic Fe-S cluster assembly factor NUBP2 homologSMESG000019851.1 SMESG000019820.1 dd_Smed_v4_1094_0_1dd_Smed_v4PMID:29674431
gutSMED30015055Spinster-like protein 1SMESG000057652.1 dd_Smed_v4_4119_0_1dd_Smed_v4PMID:29674431
gutSMED30010515FR47 domain-containing proteinSMESG000035878.1 dd_Smed_v4_1705_0_1dd_Smed_v4PMID:29674431
gutSMED30003172Adenylosuccinate synthetaseSMESG000078697.1 dd_Smed_v4_2154_0_1dd_Smed_v4PMID:29674431
gutSMED30003172Adenylosuccinate synthetaseSMESG000078697.1 SMED30003172smed_20140614PMID:26457503
gutSMED30015319SMED30015319SMESG000014789.1 Contig1758newmark_estsPMID:23079596
gutSMED30011590AP-3 complex subunit sigmaSMESG000011941.1 dd_Smed_v4_2510_0_1dd_Smed_v4PMID:29674431
gutSMED30010048SMED30010048SMESG000000602.1 SMESG000000601.1 dd_Smed_v4_7042_0_1dd_Smed_v4PMID:29674431
gutSMED30018632Protein kinase domain-containing proteinSMESG000017261.1 dd_Smed_v4_2030_0_1dd_Smed_v4PMID:29674431
gutSMED30004969SMED30004969SMESG000008209.1 Contig1530newmark_estsPMID:23079596
gutSMED30002079SMED30002079SMESG000043462.1 Contig210newmark_estsPMID:23079596
gutSMED30002079SMED30002079SMESG000043462.1 Contig210uc_Smed_v2PMID:23079596
gutSMED30002079SMED30002079SMESG000049099.1 Contig210newmark_estsPMID:23079596
gutSMED30002079SMED30002079SMESG000049099.1 Contig210uc_Smed_v2PMID:23079596
gutSMED30012159FHA domain-containing proteinSMESG000002561.1 dd_Smed_v4_3690_0_1dd_Smed_v4PMID:29674431
gutSMED30008080Transmembrane protein 45BSMESG000060226.1 SMESG000021986.1 dd_Smed_v4_1542_0_1dd_Smed_v4PMID:29674431
gutSMED3000448460S ribosomal protein L8SMESG000017087.1 dd_Smed_v4_108_0_1dd_Smed_v4PMID:29674431
gutSMED30019378Exocyst complex componentSMESG000065870.1 dd_Smed_v4_2186_0_1dd_Smed_v4PMID:29674431
gutSMED30019378Exocyst complex componentSMESG000065870.1 dd_Smed_v4_2186_0_1dd_Smed_v4PMID:27063937
gutSMED30015589SMED30015589SMESG000063816.1 SMESG000010536.1 SMESG000045280.1 SMESG000029730.1 dd_Smed_v4_4145_0_1dd_Smed_v4PMID:29674431
gutSMED30014459bak-2SMESG000008222.1 dd_Smed_v4_1767_0_1dd_Smed_v4PMID:29674431
gutSMED30006391SMED30006391SMESG000026399.1 dd_Smed_v4_110_0_1dd_Smed_v4PMID:29674431
gutSMED30008063SMED30008063SMESG000043378.1 dd_Smed_v4_1685_0_1dd_Smed_v4PMID:29674431
gutSMED30008797SMED30008797SMESG000076328.1 dd_Smed_v4_1587_0_1dd_Smed_v4PMID:29674431
gutSMED30002355Microtubule-associated protein RP/EB family member 1SMESG000069153.1 Contig19711newmark_estsPMID:27612384
gutSMED30002355Microtubule-associated protein RP/EB family member 1SMESG000069153.1 Contig19711uc_Smed_v2PMID:27612384
gutSMED30009657TNF receptor-associated factorSMESG000001565.1 dd_Smed_v4_6485_0_1dd_Smed_v4PMID:29674431
gutSMED30011830EH domain-containing protein 1SMESG000006379.1 dd_Smed_v4_3205_0_1dd_Smed_v4PMID:29674431
gutSMED30014032SMED30014032SMESG000000381.1 SMESG000000382.1 dd_Smed_v4_2318_0_1dd_Smed_v4PMID:29674431
gutSMED30008762SMED30008762SMESG000006038.1 SMESG000005903.1 dd_Smed_v4_1785_0_1dd_Smed_v4PMID:29674431
gutSMED30008294SMED30008294SMESG000016970.1 dd_Smed_v4_2205_0_1dd_Smed_v4PMID:29674431
gutSMED30034477Transducer of ERBB2, 1bSMESG000063539.1 dd_Smed_v4_7444_0_1dd_Smed_v4PMID:29674431
gutSMED30032447SMED30032447SMESG000025120.1 Contig1559newmark_estsPMID:23079596
gutSMED30029806CIA30 domain-containing proteinSMESG000077270.1 dd_Smed_v4_8887_0_1dd_Smed_v4PMID:29674431
gutSMED30025889Mucolipin-3 like proteinSMESG000015162.1 dd_Smed_v4_3616_0_1dd_Smed_v4PMID:29674431
gutSMED30029745SMED30029745SMESG000003948.1 dd_Smed_v4_5093_0_1dd_Smed_v4PMID:29674431
gutSMED30023662Disco-interacting protein 2 homolog CSMESG000017043.1 dd_Smed_v4_854_0_1dd_Smed_v4PMID:29674431
gutSMED30023889SMED30023889SMESG000055805.1 dd_Smed_v4_857_0_1dd_Smed_v4PMID:29674431
gutSMED30024910Leucine--tRNA ligase, cytoplasmicSMESG000031601.1 SMESG000029599.1 dd_Smed_v4_2849_0_1dd_Smed_v4PMID:29674431
gutSMED30024106Mitochondrial ATP synthase subunit 9SMESG000059768.1 dd_Smed_v4_401_0_1dd_Smed_v4PMID:29674431
gutSMED30006752TorSMESG000025384.1 JF894291.2smed_ncbi_20200123PMID:22451003
gutSMED30006752TorSMESG000025384.1 JF894291.2smed_ncbi_20200123PMID:22451003
gutSMED3000891040S ribosomal protein S4SMESG000026320.1 dd_Smed_v4_82_0_1dd_Smed_v4PMID:29674431
gutSMED30001750RanBP-type and C3HC4-type zinc finger containing 1SMESG000047137.1 Contig2730GPL15192PMID:23079596
gutSMED30001750RanBP-type and C3HC4-type zinc finger containing 1SMESG000069303.1 Contig2730GPL15192PMID:23079596
gutSMED30005336Phtf-FEM1B_bdg domain-containing proteinSMESG000058788.1 Contig2701GPL15192PMID:23079596
gutSMED30008623Phospholipase B-likeSMESG000022762.1 dd_Smed_v4_485_0_1dd_Smed_v4PMID:29674431
gutSMED30018122MADS-box domain-containing proteinSMESG000005612.1 Contig594GPL15192PMID:23079596
gutSMED30018122MADS-box domain-containing proteinSMESG000011575.1 Contig594GPL15192PMID:23079596
gutSMED30008954slc13a-1SMESG000024526.1 SMESG000024525.1 dd_Smed_v4_5476_0_1dd_Smed_v4PMID:29674431
gutSMED30014717WD repeat and FYVE domain-containing protein 3SMESG000043973.1 SMESG000011278.1 Contig1351GPL15192PMID:23079596
gutSMED30014717WD repeat and FYVE domain-containing protein 3SMESG000039846.1 Contig1351GPL15192PMID:23079596
gutSMED30000409mitfl-2 proteinSMESG000077129.1 Contig2622newmark_estsPMID:23079596
gutSMED30000409mitfl-2 proteinSMESG000077129.1 Contig2622uc_Smed_v2PMID:23079596
gutSMED30000409mitfl-2 proteinSMESG000005013.1 Contig2622newmark_estsPMID:23079596
gutSMED30000409mitfl-2 proteinSMESG000005013.1 Contig2622uc_Smed_v2PMID:23079596
gutSMED3000024060S ribosomal protein L10aSMESG000027088.1 dd_Smed_v4_350_0_1dd_Smed_v4PMID:29674431
gutSMED30005629Protein kinase domain-containing proteinSMESG000078509.1 SMESG000078507.1 dd_Smed_v4_4259_0_1dd_Smed_v4PMID:29674431
gutSMED30011034SMED30011034SMESG000035335.1 dd_Smed_v4_42_0_1dd_Smed_v4PMID:29674431
gutSMED30003468Phosphoenolpyruvate carboxykinase [GTP]SMESG000073058.1 SMESG000003144.1 dd_Smed_v4_536_0_1dd_Smed_v4PMID:29674431
gutSMED30016048VPS37C subunit of ESCRT-ISMESG000028338.1 Contig5669newmark_estsPMID:23079596
gutSMED30016048VPS37C subunit of ESCRT-ISMESG000028338.1 Contig5669uc_Smed_v2PMID:23079596
gutSMED30016048VPS37C subunit of ESCRT-ISMESG000079512.1 Contig5669newmark_estsPMID:23079596
gutSMED30016048VPS37C subunit of ESCRT-ISMESG000079512.1 Contig5669uc_Smed_v2PMID:23079596
gutSMED30002973Mitochondrial sodium/calcium exchanger proteinSMESG000022806.1 SMESG000022803.1 Contig7328newmark_estsPMID:23079596
gutSMED30002973Mitochondrial sodium/calcium exchanger proteinSMESG000022806.1 SMESG000022803.1 Contig7328uc_Smed_v2PMID:23079596
gutSMED30006944slc35e1SMESG000034003.1 dd_Smed_v4_5304_0_1dd_Smed_v4PMID:29674431
gutSMED30016150RUN and FYVE domain-containing protein 2-likeSMESG000050873.1 Contig2383GPL15192PMID:23079596
gutSMED30005274Tripeptidyl peptidase 2SMESG000074726.1 Contig6326newmark_estsPMID:23079596
gutSMED30005274Tripeptidyl peptidase 2SMESG000074726.1 Contig6326uc_Smed_v2PMID:23079596
gutSMED30011534Nucleobindin-2SMESG000022270.1 Contig2769GPL15192PMID:23079596
gutSMED30011534Nucleobindin-2SMESG000022270.1 dd_Smed_v4_4003_0_1dd_Smed_v4PMID:29674431
gutSMED30003270SMED30003270SMESG000052792.1 dd_Smed_v4_3513_0_1dd_Smed_v4PMID:29674431
gutSMED3000109640S ribosomal protein S23SMESG000017264.1 dd_Smed_v4_290_0_1dd_Smed_v4PMID:29674431
gutSMED30000773SMED30000773SMESG000064133.1 dd_Smed_v4_5943_0_1dd_Smed_v4PMID:29674431
gutSMED30004991Programmed cell death protein 10SMESG000031167.1 Contig3159GPL15192PMID:23079596
gutSMED30003600Ras-like C3 botulinum toxin substrate 1SMESG000077129.1 Contig2622GPL15192PMID:23079596
gutSMED30003600Ras-like C3 botulinum toxin substrate 1SMESG000005013.1 Contig2622GPL15192PMID:23079596
gutSMED30000430Ras-related C3 botulinum toxin substrate 1SMESG000005012.1 Contig2853GPL15192PMID:23079596
gutSMED30000430Ras-related C3 botulinum toxin substrate 1SMESG000005012.1 dd_Smed_v4_3362_0_1dd_Smed_v4PMID:29674431
gutSMED30019006Tubulin beta chainSMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044907.1 SMESG000044888.1 SMESG000035804.1 SMESG000035755.1 Contig2059GPL15192PMID:23079596
gutSMED30016267beta-secretase 1SMESG000074842.1 Contig1168GPL15192PMID:23079596
gutSMED30016267beta-secretase 1SMESG000037819.1 Contig1168GPL15192PMID:23079596
gutSMED30008079WD repeat-containing protein 7SMESG000032157.1 dd_Smed_v4_6105_0_1dd_Smed_v4PMID:29674431
gutSMED30008076Reverse transcriptase domain-containing proteinSMESG000024306.1 Contig631GPL15192PMID:23079596
gutSMED30008076Reverse transcriptase domain-containing proteinSMESG000008737.1 Contig631GPL15192PMID:23079596
gutSMED30008076Reverse transcriptase domain-containing proteinSMESG000008737.1 dd_Smed_v4_540_0_1dd_Smed_v4PMID:29674431
gutSMED30007607SMED30007607SMESG000050535.1 SMESG000050533.1 dd_Smed_v4_5107_0_1dd_Smed_v4PMID:29674431
gutSMED30009173Glutamate receptor-interacting protein 2SMESG000031603.1 dd_Smed_v4_3080_0_1dd_Smed_v4PMID:29674431
gutSMED30006208Aconitate hydratase, mitochondrialSMESG000002904.1 dd_Smed_v4_979_0_1dd_Smed_v4PMID:29674431
gutSMED30008010Oxalate:formate antiporterSMESG000069673.1 dd_Smed_v4_4607_0_1dd_Smed_v4PMID:29674431
gutSMED30001990zf-Tim10_DDP domain-containing proteinSMESG000071085.1 dd_Smed_v4_514_0_1dd_Smed_v4PMID:29674431
gutSMED30002133PolyubiquitinSMESG000039444.1 SMESG000014081.1 DN313275ncbi_smed_estsPMID:16344473
gutSMED30002133PolyubiquitinSMESG000039444.1 SMESG000014081.1 dd_Smed_v4_34_0_1dd_Smed_v4PMID:29674431
gutSMED30008586Reverse transcriptase domain-containing proteinSMESG000024306.1 Contig631GPL15192PMID:23079596
gutSMED30008586Reverse transcriptase domain-containing proteinSMESG000008737.1 Contig631GPL15192PMID:23079596
gutSMED30002349GATA456-2SMESG000022702.1 KX827244smed_ncbi_20200123PMID:28287248
gutSMED30003660Cytoplasmic dynein 1 heavy chain 1SMESG000064358.1 DN298896ncbi_smed_estsPMID:16344473
gutSMED30003660Cytoplasmic dynein 1 heavy chain 1SMESG000064358.1 dd_Smed_v4_8996_0_1dd_Smed_v4PMID:29674431
gutSMED30009287Protein kinase, putativeSMESG000074416.1 SMESG000074407.1 dd_Smed_v4_3361_0_1dd_Smed_v4PMID:29674431
gutSMED30009287Protein kinase, putativeSMESG000074416.1 SMESG000074407.1 Contig1629GPL15192PMID:23079596
gutSMED30009287Protein kinase, putativeSMESG000074416.1 SMESG000074409.1 SMESG000074407.1 dd_Smed_v4_7011_0_1dd_Smed_v4PMID:29674431
gutSMED30001526SMED30001526SMESG000078478.1 Contig4368newmark_estsPMID:23079596
gutSMED30001526SMED30001526SMESG000078478.1 Contig4368uc_Smed_v2PMID:23079596
gutSMED30001526SMED30001526SMESG000017249.1 Contig4368newmark_estsPMID:23079596
gutSMED30001526SMED30001526SMESG000017249.1 Contig4368uc_Smed_v2PMID:23079596
gutSMED30002579SMED30002579SMESG000064050.1 Contig4890GPL15192PMID:23079596
gutSMED30002579SMED30002579SMESG000069596.1 Contig4890GPL15192PMID:23079596
gutSMED30001296Actin-related protein 2SMESG000019700.1 Contig701GPL15192PMID:23079596
gutSMED30001296Actin-related protein 2SMESG000019700.1 dd_Smed_v4_623_0_1dd_Smed_v4PMID:29674431
gutSMED30007461Ubiquitin-60S ribosomal protein L40SMESG000066595.1 dd_Smed_v4_338_0_1dd_Smed_v4PMID:29674431
gutSMED30007461Ubiquitin-60S ribosomal protein L40SMESG000066595.1 SmedASXL_002380SmedAsxl_ww_GCZZ01PMID:29158443
gutSMED30023050Aldehyde dehydrogenase, mitochondrialSMESG000016195.1 dd_Smed_v4_1339_0_1dd_Smed_v4PMID:29674431
gutSMED30021884Purple acid phosphataseSMESG000074506.1 dd_Smed_v4_1053_0_1dd_Smed_v4PMID:29674431
gutSMED30022511SMED30022511SMESG000019851.1 SMESG000019820.1 dd_Smed_v4_1094_0_1dd_Smed_v4PMID:29674431
gutSMED30022614T-complex protein 1 subunit alphaSMESG000067696.1 dd_Smed_v4_1025_0_1dd_Smed_v4PMID:29674431
gutSMED30027745molybdate-anion transporter isoform X2SMESG000027072.1 dd_Smed_v4_3699_0_1dd_Smed_v4PMID:29674431
gutSMED3002653910 kDa heat shock protein, mitochondrialSMESG000000556.1 dd_Smed_v4_421_0_1dd_Smed_v4PMID:29674431
gutSMED30026153MFS domain-containing proteinSMESG000069675.1 dd_Smed_v4_7075_0_1dd_Smed_v4PMID:29674431
gutSMED30026736S-methyl-5'-thioadenosine phosphorylaseSMESG000016252.1 dd_Smed_v4_2328_0_1dd_Smed_v4PMID:29674431
gutSMED30025415Multidrug and toxin extrusion proteinSMESG000065608.1 dd_Smed_v4_7241_0_1dd_Smed_v4PMID:29674431
gutSMED30031662Acetylcholine receptor subunit alpha-likeSMESG000063816.1 SMESG000010536.1 SMESG000045280.1 SMESG000029730.1 dd_Smed_v4_4145_0_1dd_Smed_v4PMID:29674431
gutSMED30023831Phosphatase 1 regulatory subunit 37-like proteinSMESG000078284.1 dd_Smed_v4_5089_0_1dd_Smed_v4PMID:27063937
gutSMED30026101Reticulocalbin-1SMESG000077405.1 SMED30003044smed_20140614PMID:26457503
gutSMED30034659GCR158SMESG000077660.1 dd_Smed_v4_6018_0_1dd_Smed_v4PMID:29674431
gutSMED30029960SMED30029960SMESG000056926.1 dd_Smed_v4_270_0_1dd_Smed_v4PMID:29674431
gutSMED30023708ZFP-1SMESG000066384.1 SMED30023708smed_20140614PMID:26457503
gutSMED30035805RING-type domain-containing proteinSMESG000043462.1 Contig210newmark_estsPMID:23079596
gutSMED30035805RING-type domain-containing proteinSMESG000043462.1 Contig210uc_Smed_v2PMID:23079596
gutSMED30035805RING-type domain-containing proteinSMESG000049099.1 Contig210newmark_estsPMID:23079596
gutSMED30035805RING-type domain-containing proteinSMESG000049099.1 Contig210uc_Smed_v2PMID:23079596
gutSMED30034271Eukaryotic translation initiation factor 5ASMESG000081077.1 dd_Smed_v4_484_0_1dd_Smed_v4PMID:29674431
gutSMED30031985slc47a-2SMESG000065608.1 dd_Smed_v4_7241_0_1dd_Smed_v4PMID:29674431
gutSMED30032153Vacuolar proton pump subunit BSMESG000070660.1 SMESG000069659.1 SMESG000056147.1 SMESG000055898.1 SMESG000023221.1 SMESG000022877.1 SMESG000017867.1 SMESG000017539.1 SMESG000014828.1 SMESG000009159.1 SMESG000005977.1 SMESG000061817.1 SMESG000039834.1 SMESG000005147.1 dd_Smed_v4_684_0_1dd_Smed_v4PMID:29674431
gutSMED30028110SMED30028110SMESG000005260.1 dd_Smed_v4_8686_0_1dd_Smed_v4PMID:29674431
gutSMED30030835RING-CH-type domain-containing proteinSMESG000056612.1 dd_Smed_v4_4997_0_1dd_Smed_v4PMID:29674431
gutSMED30029070SMED30029070SMESG000038252.1 dd_Smed_v4_4054_0_1dd_Smed_v4PMID:29674431
gutSMED30024309Isocitrate dehydrogenase [NADP]SMESG000049154.1 dd_Smed_v4_449_0_1dd_Smed_v4PMID:29674431
gutSMED30026612Intermediate filament proteinSMESG000030598.1 SMED30024865smed_20140614PMID:26457503
gutSMED3002950760S ribosomal protein L12SMESG000006898.1 dd_Smed_v4_259_0_1dd_Smed_v4PMID:29674431
gutSMED30026171SMED30026171SMESG000021782.1 dd_Smed_v4_2350_0_1dd_Smed_v4PMID:29674431
gutSMED30028925Adiponectin receptor proteinSMESG000011535.1 dd_Smed_v4_2696_0_1dd_Smed_v4PMID:29674431
gutSMED30031811SMED30031811SMESG000057502.1 Contig1846newmark_estsPMID:23079596
gutSMED30025830Ornithine decarboxylaseSMESG000015244.1 SMESG000015241.1 SMESG000004848.1 SMESG000004822.1 SMESG000004820.1 SMESG000004806.1 dd_Smed_v4_280_0_1dd_Smed_v4PMID:29674431
gutSMED30035945SMED30035945SMESG000010464.1 dd_Smed_v4_7906_0_1dd_Smed_v4PMID:29674431
gutSMED3001818660S ribosomal protein L10SMESG000079023.1 SMESG000034764.1 SMESG000008177.1 SMESG000008153.1 dd_Smed_v4_130_0_1dd_Smed_v4PMID:29674431
gutSMED30013750SMED30013750SMESG000016699.1 dd_Smed_v4_10468_0_1dd_Smed_v4PMID:29674431
gutSMED30016287Reverse transcriptase domain-containing proteinSMESG000073618.1 SMESG000073174.1 SMESG000059623.1 SMESG000050300.1 SMESG000040932.1 SMESG000025201.1 SMESG000006554.1 SMESG000079557.1 SMESG000069853.1 SMESG000050880.1 SMESG000043279.1 SMESG000028068.1 SMESG000018675.1 SMESG000018320.1 SMESG000016710.1 SMESG000016088.1 SMESG000005066.1 SMESG000002984.1 SMESG000081574.1 SMESG000081529.1 SMESG000078601.1 SMESG000077556.1 SMESG000075496.1 SMESG000073961.1 SMESG000072739.1 SMESG000071859.1 SMESG000071198.1 SMESG000070153.1 SMESG000068262.1 SMESG000068028.1 SMESG000067334.1 SMESG000062504.1 SMESG000060952.1 SMESG000060260.1 SMESG000050479.1 SMESG000050299.1 SMESG000049776.1 SMESG000047126.1 SMESG000044971.1 SMESG000043973.1 SMESG000040474.1 SMESG000039792.1 SMESG000039741.1 SMESG000039356.1 SMESG000033763.1 SMESG000029537.1 SMESG000029286.1 SMESG000028614.1 SMESG000027381.1 SMESG000025022.1 SMESG000021522.1 SMESG000020398.1 SMESG000019968.1 SMESG000015216.1 SMESG000015102.1 SMESG000013389.1 SMESG000012534.1 SMESG000012464.1 SMESG000011278.1 SMESG000007021.1 SMED30032823smed_20140614PMID:26457503
gutSMED3000876940S ribosomal protein S10SMESG000034720.1 dd_Smed_v4_117_0_1dd_Smed_v4PMID:29674431
gutSMED30015406TNF receptor-associated factorSMESG000035446.1 tr5_1521mu_Smed_v1PMID:25558068
gutSMED30011562Leishmanolysin-like peptidaseSMESG000063815.1 dd_Smed_v4_10609_0_1dd_Smed_v4PMID:29674431
gutSMED30014496Ribosome biogenesis protein NSA2SMESG000028599.1 dd_Smed_v4_1012_0_1dd_Smed_v4PMID:29674431
gutSMED30013132Septin-2SMESG000008815.1 dd_Smed_v4_1509_0_1dd_Smed_v4PMID:29674431
gutSMED30007503SMED30007503SMESG000039907.1 dd_Smed_v4_13316_0_1dd_Smed_v4PMID:29674431
gutSMED30012726SMED30012726SMESG000073618.1 SMESG000073174.1 SMESG000059623.1 SMESG000050300.1 SMESG000040932.1 SMESG000025201.1 SMESG000006554.1 SMESG000079557.1 SMESG000069853.1 SMESG000050880.1 SMESG000043279.1