gut

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ In Situ Hybridization Data

  ▻ Sequences

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  gut


DEFINITON:

  The planarian triclad gut contains a central anterior gut branch connected to two posterior gut branches arranged around the pharynx. Secondary gut branches extend laterally from the primary gut branches, while tertiary gut branches extend from the secondary branches. Food and waste enter and exit the gut through the pharynx.


TERM DEFINITION CITATIONS:

  PMID:3490491


TERM CITATIONS:


TERM ID:

  PLANA:0000026


ABOUT THIS TERM:

gut

  ↳is a material entity and organ

  ↳contained in tail, copulatory region, ventral region of the whole animal, posterior region of the whole animal, parapharyngeal region, prepharyngeal region, head, dorsal region of the whole animal and anterior region of the whole animal

  ↳develops from gamma neoblast

  ↳existence overlaps Stage 6, juvenile, Stage 5, asexual adult, adult hermaphrodite, Stage 8 and Stage 7

  ↳existence starts during or after Stage 5

  ↳part of digestive system


Expand to see terms that part of gut


BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30007290AFF18488.1GATA456gata456aStage 2, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, gut, digestive system, gamma neoblast, embryonic pharynx
SMED30005748AFF18489.1HNF4hnf-4Stage 2, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, gut, digestive system, gamma neoblast, embryonic pharynx
SMED30025591ABW97518.1porcupine-like proteinporcn-AStage 5, Stage 6, Stage 7, Stage 8gut, digestive system
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30025591 ID=SMED30025591|Name=porcupine-like protein|organism=Schmidtea mediterranea sexual|type=transcript|length=3526bp
TTCCGATCTTTTCTTTTGAAATTTTTGAAATTTTAAATAAAATTAATGACAAAGGCAGAAAATCAGAGAACTACTAAAGC
ATCCGACTTCAAATTTGGAAAAGAAATCGGCCATGGCTCGTTCTCAACTGTAATGATAGCTAAGGAAATTTCTACCAATA
AACATTATGCTGCAAAAATTATTGATAAAGTTTTTATTTCTAAACAGCGAATGGTTAATACTGTTATGATTGAAAAAGAA
GTTCTCCGAAGAATAAATCACCAGTTTTTTGTATGTCTCAATTATACATTCCAAGATCCAGAGAGATTGTATTTTATTAT
ATCATATGCCGAACGAGGAGAACTTTTATCTCATTTAACAAGACTTTCGTGTTTTGATTTAACGTGCACACAATTTTATT
CCGCGGAAATTATTCTTGCATTAGAATATTTACATGGAATTAACGTTGTTCATCGAGATATAAAACCAGAAAATATTTTA
CTGAGTGAAAATATGCATATAAAAATTTGTGATTTTGGCAGTGCAATTATTATCGATAAACCAGATCTCAAGCCTTCTTC
TTTTACAGGTACAGCTCAATTCGTTTCTCCAGAAATGCTGGGATTCAGTAAAGAAACACGTGACAATAGCTATTCAGATG
AACCGAATTCTGATTCAGAGGAACATAGCGAAATTGAAGTTAAACGAACTAGTTCACCTGATAATTCTAGGGAAATATTA
TATCTAATGGACTTCTGGGCATTAGGATGCATCGTCTATCAAATGTTGTCTGGACGAATGCCATTTCACGTCAGGCATTC
ACGGCATGAATATGAAATTTTCCAAAAGATCCGAAATTTAAAATATGAGTTTCCGGTTGGGTTTGATGATACTGCTAAAG
ATTTTGTCTCTAAACTTCTTGTATTGAATCCACTGGAAAGATTAGGCAATCCATCCGATGGAAAGCACGCTGCTTTAAAA
GCCCACCCCCTTTTCCGTTCAATTGATTTCGAAATTATCGGATCACAAAAACCTCCGCTATTACTTCCAAATATTGAGCC
CATTGTTCAAAGTAATTGGGACGAAATTCCTGTTGGTTTTGAAGAAGCATGGAAATTCAATATCAAAAAAGAGTTTCAAG
AAATGGAAAAAGCCGATAAACAAAAATTATTGCAAAACCAAGAAAAACTAAATCCGTTTCATAGATTTGTACGCAATCGA
TTGATCATAAAACAAGGCATCTTGTACAAACGGCGTGGATTATTTACTCGTAAAAGAATGTTTCTATTAACTGAAGGACC
TCATTTATTTTATGTCGACCCCGATGCTATGCAATTTAAAAAAGAAGTCAGTCTAAACTTAATTACTGGCATAGAAGTAA
AAAATGACAAAGTATTTTATATCGTTACTAAAAGGCGAACATATTTTCTCGAAGATCCTTCAGCAAAGGCTGATGAATGG
CGACAGAGTATTGAATCGATTTGTGTAGAATATTATGGATCATTTAAATTATCCCCTGGCACTTGCACTCAAACGCCTCT
AGTTACATCATCTGAATCATAACTTTCGGTTTTATTTAAATTTATTTGTCATATAGAAAAAAATGTGAATTTAACGGTTT
TTAATATAATAATTTAATATTGGTTTGAATTCTTGTTTTTCATTTTAAAATTTAATGGATATAATTTAAATATTTTAATA
AATAAAAATATTCACATTGTTTTAATATTCTCTTTATGTCGTAATTGATAAATGATGCATTGTAAATGTATTTTACAACT
GATCTAAATGAAACCAATAGGAAACGAGTGGTTCGATGTCATGTGAATCAGCATGCAACCAATCATAGTTTTGTGATTCA
TTAAATATATTTTAAATTTTTAAAACAAATTAAATCACTTAATTAATTTTTAGACAATGTCACAATTTTATGGCGGATCC
ACGATATTGGCACCTCTATCGAACGTTATGGGTATACCAGTGGATCAAATTAATTTTATTGTGTGTAGTTTATTGTCAAT
CGGACTGGGTCAAATTATGCGACACAAATTCCCTCCTTCTAAATTGTCAGGAAGTACAAGAGGAATCATAGAAGCATTTT
TTGGAATACTAATTGTTCTTTTCTGCTTCGGATACCAAGTCAAGTATTTGTTACTACAATCAACAGTTTCCTATGTAATA
CTATTATTTTTGCCTTCACAAATATCAGCGCATTTGGTAACGTATTGGTGTATGGCTTTCATGGCGATAGTCCATTTATA
CAGGATGCATTACGATTACGGAGGTTATACTCTCGATATATCTGGTCCGGTTATGATTCAAACCCAAAAATTGACCAGCC
TCGCATTTAATCTTCTAGATGGACATCGAATAAATCAAGGAATAAAACTGCAACAGAGAAATCATGAATCTCACGCTGTG
AAAAAACTACCAGATGCAATCAAGTTTTTCGGTTACACATTCTACTTTCATGGTGTATTAGCGGGTCCTTTTGTATTCTA
CAATGAATATAAAGAATATATCACTGGATATGACGACAAGCATATTCCATGCTCCAAAAAGCAATTATCTTCAGCACTTT
GTTTATCAGTGATCCATGGATTATTAACAGCATATGTCGCACCGCAGTTTCCATATATATTTGTTTGCAGCACCGATTAC
CAACGGATGCATATGACTCGTAGAATAATGTTCACAATGATTTCATTTTTCCTCGTAAGACAAAAGTATTACTTTGCCTG
GTCAATGGTTGAAGCTGGTGCTCTTAGTACCGGATTGGGATATTGTGGAAAGGATAAAAACGGAGAGAATAATTGGTCGA
AAGTGAAAAATTACGATTTCATGGCAATCGAAAGCGGCAGTAGTTTGAAAGTGCTAGTGGACGGATGGAATATTTCCACA
ACAAGATGGCTCAGAGAATTAATTTATGAACGAGCTCCTTTATTCTGTCGGACAATTCTAGTTTTCACCGTCAGTGCATT
TTGGCATGGATTCTATCCTGGATATTATTTGATGTTTTTGACATTTTCTCTCTTTACGTTTTGCGCTAGAACCGTTAGGA
AACACATTCGACCATTGTTCATTGTCAGTCCAATTACACTTCAACTCTATCATGTTCTAACGAAAATATTCACAAATCTG
GCTTTAAATTACGGACAAGGACCATTTTATTTGCTGGAGTTTCAATCGGGACTTTTGTTTTGGAAGCCATATTACTTTTT
CGGACACGTTCTAGCAATGTTCTGCGTATTGACCTTGCAATTTCGGCCGATAATCAACGACAAAGTCAACATAATGAACA
ATGTTTTCACCAGAAAAGCCCAATATCGGTTTCAGAAACTAAAGATCCATTTGCAGAAAAAGTTGAGATGAAATTTTATT
GATTTTGATAATTTATATAAAATATTATAATTTTGTTTTTCGTTTTATTTTTATATCGATGAATTTATGATAAATGCTAA
ATATTCGATCCGGAATGAATTATTATTAATCTGGTTTTTATAATTGTTCATTTTTAATAGTTTTGTTTGTTTTTCGAAAA
TGGCGG
>SMED30007290 ID=SMED30007290|Name=GATA456|organism=Schmidtea mediterranea sexual|type=transcript|length=2033bp
AGGTAAGTGTCGTCATCACAAGTGGCTTTATTATTATCATTTAAATTTTTTATCATATTATCATTGATTGCTTGTTTTCC
TCATTCAAAATTTAACTGATTGTTATCAAGCTCATTTGATAACTCCAAATCTAATTGACACTCATGTAAATATCCCATTC
GAATTTCCGTTCCCGTCCGTAAGATCCACGATCCGACAATGTTTCTCCCATCGGTATTGTCGAATTCTCACCAGAGAAAC
TCACCAATAATGGACATTGTATCACCAAAATCCAACACCAGCAATCTGAATGCGTTGATCACGTATTCGAATTGTCCCAA
CATAGATCTACAGTCGAATGATCTGTCAGTGAACTTGACGAATTCTCAAAACTTCCACGAATTGGATCACAAAACCAATT
ACGGATACAAAGTTTCAAACAACGAGACAAAACTGAATGCTTTTCCATATTTAGCTCAATCGAACTTAACAGATTGCACA
ACAGACATCAGTGGAGATCTGAAAAATCCAAATTCACATCTCAACTATGGAAACGGAATTTCGTTCTCGGAATTTTCGAA
AATGTCCGAAACCAACATCCACGGATATCCGCCATATTGTTTCTCCACTAAACTGTTTCCCATTCCAAATCTACAAGAGA
AATCAATTATCAACGACAACTATTCCGTGAAATCCACCGCCGGAGGCTTTATCACCGAATCGAATGAGCATCAAAACTCT
GTAAATACTGGAAATTCCTACAATTCCAATTTAAGCTCATACAGAACGGTAATTCCCGCTCATTTTCATCTCTTCAATCA
GAATTCACCAGAATCGAACTCGTTTTACAATACGGCTTGGAACAACTATCCGTTTCAAATATCCCCAACTTATCCCATAC
AAAATCTACCGGATTCAACAATCAACTGGACAACAAACAATCAAATTCCAAGCAGCAATTTAGTTTTTGATCCCTGGAGC
TGTAAATCAAATCTTAATCTTCCTCCGATTAATGAATTCGGTTCCAATTGCGATGTCAGCAGAGAGTGTGTGAACTGTGG
AGCTAGCAATACTCAGTTGTGGTCCCGGGATAATTCTGGCTATTATTTGTGTGATGAATGCGACAGGTTCTCTCAAAACA
ACAGTAGAAACCTCGAAAAACTACCAACGAATCAAGTCTCATCAAGTACCGAAAATGAGTTCATGAAAAAATCCAATGCC
AACTTTCAACAATATGGAAAAAGATCCGACCTCGAATGCAGCAATTGTAAAATTACCAAGACTTCTTTATGGAGAAGAAA
CAACGAAGGAGAACCTGTCTGCAATGCTTGCGGCTTGTATTATAAATTACATAAGTCTCTAAGACCTCTTTCAATGAGGA
AAGAAGGAATACAAACAAGGAAAAGAAAACGGAAAACACAAATGAAACCGGTTTCCACTCATATTGCCAATAATCAAAAG
GTGCCGTCTTCAGAATCGTCATCAGAACAAAATCAGTTTATAAACACTGTGAAATCAAGTGAAAATTGCTATAACATGAT
TTCTGAAAATTCTCCAACATATATGCCAAATATATCAGTCCAGCCCTTCAATCACATTCTGAACTCCAGCCAATATCAAT
TCCAATCTACAGAAAATCCCATTAATCAATCATATTTAAATTCCTCAATCAAAAACAGCAATCCCTTTTACGATTCCGAA
AGTATACTTTATTCCTACAACAATTCAAACAAAATCAAAGATGAGCCCCTATTATCCATGGACAACGAACCGAAGCCCTA
TTCCTCAATCAACGAGAAAATTGACGTCAACTCCATAGTGAGAATTAATGAAATCTCAAACAATTCGAATTCGAGTTAAT
TATTCTGATCTACTTTTTAATTATATATTTAAGAACCGTATATACTTCGAAATATAATTTTAATGATAAAATTTTATATC
TAAAAAATGTAATTTTTAAGTGCGAATTATTAAGTATGCATTTAAATAGTGCAATTATTGTGGTAGTTATTTTTATTACT
AAATAAATGTTGTTTGTAAATTCGAGAATTTGT
>SMED30005748 ID=SMED30005748|Name=HNF4|organism=Schmidtea mediterranea sexual|type=transcript|length=3066bp
GAAGAATAACAAAGAAATTTATTGCCAAACTAAAATACCCGGCCTATTTCATCAAAAAAAAAACAATCAAAAACACAAAT
CGCTACGAAAACTTGTATAAAAGATTCACATTAAAAGTCATCAATATTCCTCTTTTTTAAAGACTGATGATTCAGATTCT
TGGATCCGAATGGGGTGATCTGTTAGGAAGTGAGCTGTTGACGAGATAGCTGAATAGTTTGATCTGGAATTGTGCTGTTG
GTTCGCTTCCGATGATCTGTTGGCGATTGATTGAATTTGGCAGTTTTCTATCGGCGAGTTTGGAAGCGACTTGGTATAGG
CCACAAGAAGCGACGGATCAACGACATTTTGAGTGGAATTCACAGAAAGAGCTGGGTGGATTAGGTCATCTGAATTGGAA
GAATTTGAGCAGTTATGATTTGCGTCACTGTTATAGGCGTATTTTGACTGGTTGATCATGGGGAACCCTTGATCAAGGTT
GACCAAGAAATGGCTGGTATCCTGTGATAAATTGGAATGCTGATAAAGATTGATGGAATCATTGACGCATGAAAACAGAG
AAGGAACGCCGACTCTTTCATTTTTCAGCATCATCCCATCGCTGTTGATTATCATACCGAAGTTGCTATTGTCCTGGGAA
TTTTGCTGCATTATTTCAGTTCCTTGATTAACAAAAGCTCGATATATATTTCCTGAAGGCATCGACGTAGAACTTGGCAA
ATATGCACTCCATATTTTTGAGGCCGCTTCAGGTGATATGTTTTGGTTGTTGATATTGAGTAGGACACTGTCTGGCATGA
AAGGGGGAATTCCGTAGCAGTCCTGGTAAGTATATTTCGGTGAGGAAATCCTGTGGGAGTTAATTATATCCATGGAATCG
TTTTGATTATTGTTATTGTTCCCATCTGTTTCTGGATCTATGCTGAATACCCCTGGTGGATTGTCACCCAATAATGTTTC
AGATAACAAGCTATCAATCTCGGCTAATCCTGTCATTTTCATGAACTCGACCTTCTTTACCATCAGCTGGGTGACCAATC
TCAGATCAGGAATTGTCAGCAGCAATTCCCCGAATCTACCCGGCTTGTGGTATTGCTTGTCATTCATGTGGTTCATCAGG
TCCATTTGTATTTGGTATCGGCATCGTCTCACGAACTCCTTGCCAGACTCGCTGACTCTCGGATCAAAAAATACGATCGC
TTTCAAACAAGCGAATTCTGCGTCATCCAATTGCAATTCTCGCAGCGGAATGAACAGGTCGTCAAGGATGTGACTGGCTA
TTTCAGCGAAATGTTTGTCACTGGAGTTCCTACTGATGATAAGATTGTTTCCCAATAATAGCACATCGTCTTCGTCCAAT
TGAAACGACCGCCTTATTACTCCAAGAATTAGAATTTCTCCCGCGTGTGCTTTTAAAAGGGAAATTTGATCGCTCAAGTT
TAACTGTGAAAAACAAGGCAAAGACTTTGCCCAATTCACTAGAAGAAATAACTGATTTTTCATGGACTCGCAAACATCAG
GCACATCGGCATATCTGTTCATGTATTCCTGAGGATTCGGGGGCTTTTGTATTGCAACCCTTTGCTCGGCCTGCATCAAC
TGAGAAATGGAGAGAATGACATTCGGAGGAATATCATCAAACGACGATCTTCGAGTACTGATCCTATCTCGTTCATTTTG
AACCGCTGCTCGCTTCATTCCTACAAGAATGCATTTCTTTAGCCGACAATAACGGCATTGGTTTCGTTTATCCTTGTCCA
TTTTACAATTCCGATTGTACTGGCAAGTGTAGTTATTCTTCTTCCTCACTGACCTCCGAAAAAATCCTTTACAACCGTCA
CACGAGAAAGCCCCATAATGTTTTCCTGTAGCTTTGTCACTGCAAATGAGACAGAGTTGATTGTTTTCCATTCCTTCTGG
TCCCGACGCGTTAGACGCATAGACTTCATGTTGTTGCGAGGACACTGAAACGAAAACTATTTGATAATATTTGTACAAAA
CAACTGACAGATGGTTTCGGAAAAGGTTCAATGTTCAGCCATAGTTCAGCGAAAGGTCAAATTCCTGAACTACTATTTCA
AGGTATAAATTTGAATATATTGGTTTTGCCTCGTGCTAACAAAGTCCAGAAATATAATAAGCAAAGTCTGAATCGTGTAC
TTTGGATTTCTAGCCAGGGGCACACAATAACCTATATTTAATAGCAGTTCATTGCGTTCACTCGTTATTTCTCCGACTGA
ACTGCATTGCAGGAGGATCCGCAACCATGGAGATTTCATAATTATTATCAAAATGATAATAATAATAATTATTATGAGGT
ATTGTAAAAGAAAACGTAACTCACTTTCACTTTCCAATGGATATTGCATCGAGGAAGCGTTGCTGGAAATGGAAATCGGA
GCTGAATTGCTAGTCAATAGTTGATAGGAGAATGCTGGATTGAGGTTCGGATGCTGGGTAGACGTCATATAGAATTGGCT
CGACGGATTCGGTAAAATTATGGTGAAGTTTACAATCGAAGCTCAGATATAACGTATTATAATGAAGTATTATTAATAAA
CTGCAAGTAACGTGCGCGCATTCTGAAGTGGTTGATTGAGAATAATCAGTTCTTATTCGACAAATTCAGATAAAAAAGGC
ACCACTCGAATTGTTCAGCTGCGTCATGTGAATGCCGGAACGTTGTGCGTTGGCTGTTGGCAGATCAGCGCTCCGTGTTC
ACTGCAATCCGGATACACCAGACCACTTGAAATCGTTGCGAATTCAGCGTGTCGAGTGCATTGTGCGAGATCAGTATCGG
TGTGTATGTGTGTCTGCCTGTGTGCGTGTGGATGTGTGTGCTTGTCGAGTCGGTTGTGTGTTTATGAGTGTAACTGTGTC
GATTTGGTCGAATGCAGTAGCAGATAGCTGAAATGCGATTGTTCCTATTTTTCATTTAATATTGTTTTATGTTTTGTTTC
TATTTTTATAATTTAATTTATCAGTTTTTGTTTAGATTATGCAATCATTGTTTAATTTATTTTTGTCAATTTAAAATTTA
TTATTAATTAAATTATTATAATTATT

 

back to top



PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in gut. Click this link to learn more about PAGE.


PAGE Curations: 3008


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
gutSMED30030305Peptidase_M14 domain-containing proteinSMESG000037626.1 Contig1315GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030305Peptidase_M14 domain-containing proteinSMESG000048042.1 Contig1315GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30033999Zinc finger MYM-type protein 1SMESG000060573.1 Contig5379newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30033999Zinc finger MYM-type protein 1SMESG000060573.1 Contig5379uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30033999Zinc finger MYM-type protein 1SMESG000073809.1 Contig5379newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30033999Zinc finger MYM-type protein 1SMESG000073809.1 Contig5379uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30033380Beta-hexosaminidaseSMESG000037355.1 Contig5533newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30033380Beta-hexosaminidaseSMESG000037355.1 Contig5533uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30033380Beta-hexosaminidaseSMESG000024479.1 Contig5533newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30033380Beta-hexosaminidaseSMESG000024479.1 Contig5533uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032901SMED30032901SMESG000059757.1 Contig3698GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032901SMED30032901SMESG000054316.1 Contig3698GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021127SMED30021127SMESG000037626.1 Contig1315newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021127SMED30021127SMESG000037626.1 Contig1315uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021127SMED30021127SMESG000048042.1 Contig1315newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021127SMED30021127SMESG000048042.1 Contig1315uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023199Leucine-zipper-like transcriptional regulator 1SMESG000007049.1 Contig3743GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023199Leucine-zipper-like transcriptional regulator 1SMESG000074654.1 Contig3743GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30026133BTB domain-containing proteinSMESG000001053.1 Contig525newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30026133BTB domain-containing proteinSMESG000001053.1 Contig525uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30026133BTB domain-containing proteinSMESG000033211.1 Contig525newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30026133BTB domain-containing proteinSMESG000033211.1 Contig525uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011545E3 ubiquitin-protein ligase XIAPSMESG000081058.1 Contig2302GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30009357ubiquilin-1SMESG000045386.1 Contig2009GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001750RanBP-type and C3HC4-type zinc finger containing 1SMESG000047137.1 Contig2730GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001750RanBP-type and C3HC4-type zinc finger containing 1SMESG000069303.1 Contig2730GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011250Granulin precursorSMESG000060269.1 Contig2381GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011250Granulin precursorSMESG000029882.1 Contig2381GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002332TNF receptor associated factor-2SMESG000070267.1 Contig1736GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008591Zinc finger MYM-type protein 1SMESG000053671.1 SMESG000053667.1 Contig5414newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008591Zinc finger MYM-type protein 1SMESG000053671.1 SMESG000053667.1 Contig5414uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013503Tpd52 like 1SMESG000013104.1 Contig988GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011213Osteoclast-stimulating factor 1SMESG000004952.1 Contig516GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001296Actin-related protein 2SMESG000019700.1 Contig701GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30033333SMED30033333SMESG000004952.1 Contig516newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030127bcl2-like proteinSMESG000043462.1 Contig210GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030127bcl2-like proteinSMESG000049099.1 Contig210GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30026256vault protein inter alpha trypsin-1SMESG000053671.1 SMESG000053667.1 Contig5414GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021161MARVEL domain-containing proteinSMESG000077709.1 SMESG000073947.1 SMESG000043656.1 SMESG000043279.1 SMESG000008519.1 SMESG000001897.1 Contig22GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021161MARVEL domain-containing proteinSMESG000013795.1 Contig22GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029603SMED30029603SMESG000027122.1 Contig1663GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029603SMED30029603SMESG000071278.1 Contig1663GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30018122MADS-box domain-containing proteinSMESG000005612.1 Contig594GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30018122MADS-box domain-containing proteinSMESG000011575.1 Contig594GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014822Moesin/ezrin/radixin homolog 1SMESG000056380.1 Contig1780GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017347Acetyl-CoA carboxylase 1SMESG000065082.1 Contig5150newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017347Acetyl-CoA carboxylase 1SMESG000065082.1 Contig5150uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017347Acetyl-CoA carboxylase 1SMESG000032321.1 Contig5150newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017347Acetyl-CoA carboxylase 1SMESG000032321.1 Contig5150uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016048VPS37C subunit of ESCRT-ISMESG000028338.1 Contig5669newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016048VPS37C subunit of ESCRT-ISMESG000028338.1 Contig5669uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016048VPS37C subunit of ESCRT-ISMESG000079512.1 Contig5669newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016048VPS37C subunit of ESCRT-ISMESG000079512.1 Contig5669uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007246SMED30007246SMESG000045656.1 Contig3259GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019727beta-catenin-like protein 2SMESG000014825.1 Contig3406GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019727beta-catenin-like protein 2SMESG000002541.1 Contig3406GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014901ATP-binding cassette sub-family A member 3-like ProteinSMESG000080870.1 Contig6189newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014901ATP-binding cassette sub-family A member 3-like ProteinSMESG000080870.1 Contig6189uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012378Clathrin heavy chainSMESG000040592.1 Contig5422GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012378Clathrin heavy chainSMESG000035457.1 Contig5422GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012378Clathrin heavy chainSMESG000072345.1 Contig4452GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012378Clathrin heavy chainSMESG000035457.1 Contig4452GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED300172003'(2'),5'-bisphosphate nucleotidase 1SMESG000014111.1 Contig4084GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013913Adenylate kinaseSMESG000047137.1 Contig2730newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013913Adenylate kinaseSMESG000047137.1 Contig2730uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013913Adenylate kinaseSMESG000069303.1 Contig2730newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013913Adenylate kinaseSMESG000069303.1 Contig2730uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013477MAU2 chromatid cohesion factorSMESG000008077.1 Contig5057newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013477MAU2 chromatid cohesion factorSMESG000008077.1 Contig5057uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013477MAU2 chromatid cohesion factorSMESG000017950.1 Contig5057newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013477MAU2 chromatid cohesion factorSMESG000017950.1 Contig5057uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013976SMED30013976SMESG000003513.1 Contig59newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007795Essential myosin light chainSMESG000042179.1 Contig1602GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30003680RanBP-type and C3HC4-type zinc finger-containing protein 1SMESG000069298.1 Contig3532GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005316ADP-ribosylation factor 1SMESG000000945.1 SMESG000000928.1 Contig3270GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002822RING-type domain-containing proteinSMESG000076385.1 SMESG000076375.1 SMESG000076363.1 SMESG000076223.1 SMESG000076482.1 SMESG000076470.1 SMESG000076410.1 SMESG000076358.1 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014928Formin-like proteinSMESG000044336.1 Contig1407newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014928Formin-like proteinSMESG000015063.1 Contig1407newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30009287Protein kinase, putativeSMESG000074416.1 SMESG000074407.1 Contig1629GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30010792Protein kinaseSMESG000074416.1 SMESG000074407.1 Contig1629GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016045Cysteine-rich proteinSMESG000044206.1 Contig353newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016045Cysteine-rich proteinSMESG000044206.1 Contig353uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016045Cysteine-rich proteinSMESG000003375.1 Contig353newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016045Cysteine-rich proteinSMESG000003375.1 Contig353uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016492B-cell receptor-associated protein 31SMESG000017490.1 Contig1500GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016492B-cell receptor-associated protein 31SMESG000064614.1 Contig1500GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011780Si:ch73-222h13.1SMESG000081135.1 Contig3433newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011780Si:ch73-222h13.1SMESG000081135.1 Contig3433uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30009189KinaseSMESG000044206.1 Contig353GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30009189KinaseSMESG000003375.1 Contig353GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019107SMED30019107SMESG000027122.1 Contig1663newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019107SMED30019107SMESG000071278.1 Contig1663newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004187SMED30004187SMESG000043423.1 Contig1792newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004187SMED30004187SMESG000043423.1 Contig1792uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004187SMED30004187SMESG000072544.1 Contig1792newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004187SMED30004187SMESG000072544.1 Contig1792uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011242Synaptosomal-associated protein 29SMESG000024796.1 Contig3946GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011242Synaptosomal-associated protein 29SMESG000001576.1 Contig3946GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008147SMED30008147SMESG000053405.1 Contig1766newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008147SMED30008147SMESG000053405.1 Contig1766uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008147SMED30008147SMESG000046314.1 SMESG000028362.1 Contig1766newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008147SMED30008147SMESG000046314.1 SMESG000028362.1 Contig1766uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002317Helicase with zinc finger domain 2SMESG000017490.1 Contig1500newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002317Helicase with zinc finger domain 2SMESG000017490.1 Contig1500uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002317Helicase with zinc finger domain 2SMESG000064614.1 Contig1500newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002317Helicase with zinc finger domain 2SMESG000064614.1 Contig1500uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008756SMED30008756SMESG000007049.1 Contig3743newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008756SMED30008756SMESG000007049.1 Contig3743uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008756SMED30008756SMESG000074654.1 Contig3743newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008756SMED30008756SMESG000074654.1 Contig3743uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001294Phosphatidylinositol-binding clathrin assembly proteinSMESG000043423.1 Contig1792GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001294Phosphatidylinositol-binding clathrin assembly proteinSMESG000072544.1 Contig1792GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012260Dual specificity tyrosine-phosphorylation-regulated kinase 1ASMESG000001908.1 SMESG000001895.1 SMESG000054185.1 SMESG000003953.1 Contig32newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012260Dual specificity tyrosine-phosphorylation-regulated kinase 1ASMESG000001908.1 SMESG000001895.1 SMESG000054185.1 SMESG000003953.1 Contig32uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012260Dual specificity tyrosine-phosphorylation-regulated kinase 1ASMESG000003941.1 Contig32newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012260Dual specificity tyrosine-phosphorylation-regulated kinase 1ASMESG000003941.1 Contig32uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007912SMED30007912SMESG000059785.1 Contig1211newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007912SMED30007912SMESG000059785.1 Contig1211uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007912SMED30007912SMESG000079004.1 Contig1211newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007912SMED30007912SMESG000079004.1 Contig1211uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001027Cathepsin LSMESG000054075.1 SMESG000034294.1 Contig1264newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001027Cathepsin LSMESG000054075.1 SMESG000034294.1 Contig1264uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001027Cathepsin LSMESG000065264.1 SMESG000065255.1 Contig1264newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001027Cathepsin LSMESG000065264.1 SMESG000065255.1 Contig1264uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30000448Cysteine-rich proteinSMESG000044206.1 Contig353newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30000448Cysteine-rich proteinSMESG000044206.1 Contig353uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30000448Cysteine-rich proteinSMESG000003375.1 Contig353newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30000448Cysteine-rich proteinSMESG000003375.1 Contig353uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015345TropomyosinSMESG000066854.1 Contig3688newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015345TropomyosinSMESG000066854.1 Contig3688uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015345TropomyosinSMESG000026500.1 Contig3688newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015345TropomyosinSMESG000026500.1 Contig3688uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028574Cytochrome P450 2K1-like proteinSMESG000073604.1 Contig1511GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028574Cytochrome P450 2K1-like proteinSMESG000078091.1 SMESG000078098.1 SMESG000078094.1 SMESG000078092.1 Contig1511GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023334Partitioning defective 6SMESG000066854.1 Contig3688GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023334Partitioning defective 6SMESG000026500.1 Contig3688GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30025543Coiled-coil domain-containing protein 93SMESG000022913.1 Contig1890GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021235Tubulin alpha chainSMESG000059785.1 Contig1211GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021235Tubulin alpha chainSMESG000079004.1 Contig1211GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021235Tubulin alpha chainSMESG000079004.1 PL030009A10F06ncbi_smed_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30022992Myosin heavy chainSMESG000062420.1 PL08009A2H09ncbi_smed_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30022992Myosin heavy chainSMESG000062420.1 PL06023A2A10ncbi_smed_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027682NAD(P)H-dependent FMN reductaseSMESG000060640.1 Contig3408newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027682NAD(P)H-dependent FMN reductaseSMESG000060640.1 Contig3408uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027682NAD(P)H-dependent FMN reductaseSMESG000074871.1 Contig3408newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027682NAD(P)H-dependent FMN reductaseSMESG000074871.1 Contig3408uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021956Actin-related protein 3SMESG000078631.1 Contig5723GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024044ADP-ribosylation factor-like protein 8BSMESG000001053.1 Contig525GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024044ADP-ribosylation factor-like protein 8BSMESG000033211.1 Contig525GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021080SMED30021080SMESG000060573.1 Contig5379newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021080SMED30021080SMESG000060573.1 Contig5379uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021080SMED30021080SMESG000073809.1 Contig5379newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021080SMED30021080SMESG000073809.1 Contig5379uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024498SMED30024498SMESG000036544.1 Contig3175newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024498SMED30024498SMESG000036544.1 Contig3175uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024498SMED30024498SMESG000000175.1 Contig3175newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024498SMED30024498SMESG000000175.1 Contig3175uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021752Cytochrome P450 2K1-like proteinSMESG000073604.1 Contig1511GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021752Cytochrome P450 2K1-like proteinSMESG000078091.1 SMESG000078098.1 SMESG000078094.1 SMESG000078092.1 Contig1511GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020811SMED30020811SMESG000005612.1 Contig594newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020811SMED30020811SMESG000005612.1 Contig594uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020811SMED30020811SMESG000011575.1 Contig594newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020811SMED30020811SMESG000011575.1 Contig594uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015409cAMP-responsive element modulatorSMESG000016695.1 Contig4585GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015409cAMP-responsive element modulatorSMESG000033655.1 Contig4585GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016832SH3 domain-binding protein 5-likeSMESG000061052.1 Contig4742newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016832SH3 domain-binding protein 5-likeSMESG000061052.1 Contig4742uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016832SH3 domain-binding protein 5-likeSMESG000022856.1 Contig4742newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016832SH3 domain-binding protein 5-likeSMESG000022856.1 Contig4742uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002600ATPase_AAA_core domain-containing proteinSMESG000072345.1 Contig4452newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002600ATPase_AAA_core domain-containing proteinSMESG000072345.1 Contig4452uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002600ATPase_AAA_core domain-containing proteinSMESG000035457.1 Contig4452newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035485low density lipoprotein receptor related-2SMESG000009332.1 SMESG000009320.1 Contig505GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035485low density lipoprotein receptor related-2SMESG000041448.1 Contig505GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030115ATP-dependent RNA helicase DDX3XSMESG000064743.1 Contig4698GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30031385SMED30031385SMESG000045568.1 Contig4881newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30031385SMED30031385SMESG000045568.1 Contig4881uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029573GFO_IDH_MocA domain-containing proteinSMESG000072407.1 Contig4428newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029573GFO_IDH_MocA domain-containing proteinSMESG000072407.1 Contig4428uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029573GFO_IDH_MocA domain-containing proteinSMESG000024833.1 Contig4428newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029573GFO_IDH_MocA domain-containing proteinSMESG000024833.1 Contig4428uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30026747Metallophos domain-containing proteinSMESG000036432.1 Contig450newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30026747Metallophos domain-containing proteinSMESG000036432.1 Contig450uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30026747Metallophos domain-containing proteinSMESG000051672.1 SMESG000051670.1 Contig450newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30026747Metallophos domain-containing proteinSMESG000051672.1 SMESG000051670.1 Contig450uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032393SMED30032393SMESG000036683.1 Contig4572newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032393SMED30032393SMESG000074788.1 Contig4572newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30026950terminal uridylyltransferase 4SMESG000061695.1 Contig4822GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30026950terminal uridylyltransferase 4SMESG000041562.1 Contig4822GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021882Disks large homolog 1SMESG000045568.1 Contig4881GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007434NADPH:adrenodoxin oxidoreductase, mitochondrialSMESG000050975.1 Contig7307newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007434NADPH:adrenodoxin oxidoreductase, mitochondrialSMESG000050975.1 Contig7307uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30022956Regulator of microtubule dynamics protein 1SMESG000038855.1 Contig2191GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002222SMED30002222 Contig7536newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002222SMED30002222 Contig7536uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034100SMED30034100 Contig1700newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034100SMED30034100 Contig1700uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028854SMED30028854 Contig1674GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30022483CGG triplet repeat-binding protein 1SMESG000020470.1 Contig1680newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30022483CGG triplet repeat-binding protein 1SMESG000020470.1 Contig1680uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30025305SMED30025305SMESG000027283.1 Contig1753newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005082SMED30005082SMESG000009320.1 Contig1862newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014226SMED30014226SMESG000074424.1 Contig1592newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016150RUN and FYVE domain-containing protein 2-likeSMESG000050873.1 Contig2383GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30018354SMED30018354SMESG000015778.1 Contig1955newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013692Small HSP proteinSMESG000055935.1 Contig651GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013692Small HSP proteinSMESG000059879.1 SMESG000059868.1 SMESG000059853.1 Contig651GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019591SMED30019591SMESG000050873.1 Contig2383newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012113SMED30012113SMESG000017135.1 Contig2203GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035150TLC domain-containing proteinSMESG000057441.1 Contig2269GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035917SMED30035917SMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044907.1 SMESG000044888.1 SMESG000035804.1 SMESG000035755.1 Contig2059newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029088SMED30029088SMESG000017135.1 Contig2203newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035848Tubulin beta chainSMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044907.1 SMESG000044888.1 SMESG000035804.1 SMESG000035755.1 Contig2059GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012469SMED30012469SMESG000038855.1 Contig2191newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014717WD repeat and FYVE domain-containing protein 3SMESG000043973.1 SMESG000011278.1 Contig1351GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014717WD repeat and FYVE domain-containing protein 3SMESG000039846.1 Contig1351GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005549DDE_Tnp_1_7 domain-containing proteinSMESG000080555.1 SMESG000049002.1 SMESG000075946.1 SMESG000067287.1 SMESG000064983.1 SMESG000064843.1 SMESG000062987.1 SMESG000047155.1 SMESG000013953.1 Contig927newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005549DDE_Tnp_1_7 domain-containing proteinSMESG000080555.1 SMESG000049002.1 SMESG000075946.1 SMESG000067287.1 SMESG000064983.1 SMESG000064843.1 SMESG000062987.1 SMESG000047155.1 SMESG000013953.1 Contig927uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005549DDE_Tnp_1_7 domain-containing proteinSMESG000076100.1 Contig927newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005549DDE_Tnp_1_7 domain-containing proteinSMESG000076100.1 Contig927uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004579SMED30004579SMESG000052600.1 Contig1622newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002973Mitochondrial sodium/calcium exchanger proteinSMESG000022806.1 SMESG000022803.1 Contig7328newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002973Mitochondrial sodium/calcium exchanger proteinSMESG000022806.1 SMESG000022803.1 Contig7328uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005434SMED30005434SMESG000038889.1 Contig2145newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012677Coiled-coil domain-containing protein 51SMESG000058452.1 Contig1190newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012677Coiled-coil domain-containing protein 51SMESG000058452.1 Contig1190uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012677Coiled-coil domain-containing protein 51SMESG000057519.1 Contig1190newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012677Coiled-coil domain-containing protein 51SMESG000057519.1 Contig1190uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004461Lateral signaling target protein 2 homologSMESG000080555.1 SMESG000049002.1 SMESG000075946.1 SMESG000067287.1 SMESG000064983.1 SMESG000064843.1 SMESG000062987.1 SMESG000047155.1 SMESG000013953.1 Contig927GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004461Lateral signaling target protein 2 homologSMESG000076100.1 Contig927GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005274Tripeptidyl peptidase 2SMESG000074726.1 Contig6326newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005274Tripeptidyl peptidase 2SMESG000074726.1 Contig6326uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004416SMED30004416SMESG000067412.1 Contig1164newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004416SMED30004416SMESG000067412.1 Contig1164uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004416SMED30004416SMESG000060394.1 Contig1164newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004416SMED30004416SMESG000060394.1 Contig1164uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30009611Str_synth domain-containing proteinSMESG000052600.1 Contig1622GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004193MACPF domain-containing protein 3SMESG000044682.1 Contig721newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004193MACPF domain-containing protein 3SMESG000044682.1 Contig721uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004193MACPF domain-containing protein 3SMESG000058940.1 Contig721newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004193MACPF domain-containing protein 3SMESG000058940.1 Contig721uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008076Reverse transcriptase domain-containing proteinSMESG000024306.1 Contig631GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008076Reverse transcriptase domain-containing proteinSMESG000008737.1 Contig631GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004652SMED30004652SMESG000033527.1 Contig2307newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015967Neurotracting/lsamp/neurotrimin/obcam related cell adhesion moleculeSMESG000019973.1 Contig692GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015967Neurotracting/lsamp/neurotrimin/obcam related cell adhesion moleculeSMESG000068491.1 Contig692GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008586Reverse transcriptase domain-containing proteinSMESG000024306.1 Contig631GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008586Reverse transcriptase domain-containing proteinSMESG000008737.1 Contig631GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30000579SMED30000579SMESG000022913.1 Contig1890newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30006740SJCHGC04139 proteinSMESG000045533.1 Contig1156GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30006740SJCHGC04139 proteinSMESG000035447.1 Contig1156GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002079SMED30002079SMESG000043462.1 Contig210newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002079SMED30002079SMESG000043462.1 Contig210uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002079SMED30002079SMESG000049099.1 Contig210newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002079SMED30002079SMESG000049099.1 Contig210uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30010493MATS2SMESG000015163.1 Contig1173GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30006536SMED30006536SMESG000054351.1 Contig1590newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30006536SMED30006536SMESG000005053.1 SMESG000005050.1 Contig1590newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001668SMED30001668SMESG000033527.1 Contig2307GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002200SMED30002200SMESG000015894.1 SMESG000000559.1 Contig1506newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002200SMED30002200SMESG000078978.1 Contig1506newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015354Tubby-like proteinSMESG000043973.1 SMESG000011278.1 Contig1351newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015354Tubby-like proteinSMESG000043973.1 SMESG000011278.1 Contig1351uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015354Tubby-like proteinSMESG000039846.1 Contig1351newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015354Tubby-like proteinSMESG000039846.1 Contig1351uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017714Basement membrane-specific heparan sulfate proteoglycan core proteinSMESG000075928.1 Contig7205newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017714Basement membrane-specific heparan sulfate proteoglycan core proteinSMESG000075928.1 Contig7205uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028707SMED30028707SMESG000018215.1 Contig6766newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028707SMED30028707SMESG000018215.1 Contig6766uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30025048exportin-1SMESG000045533.1 Contig1156newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30025048exportin-1SMESG000035447.1 Contig1156newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029557SMED30029557SMESG000028899.1 Contig1093newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029557SMED30029557SMESG000071997.1 Contig1093newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035887TNF receptor associated factor-2SMESG000020851.1 Contig1182GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30033014Phosphatidylinositol-4,5-bisphosphate 4-phosphataseSMESG000063221.1 Contig1068GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021405Neurogenic locus notch-like protein protein 1SMESG000041513.1 Contig7665newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021405Neurogenic locus notch-like protein protein 1SMESG000041513.1 Contig7665uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029077Macrophage-expressed gene 1 proteinSMESG000044682.1 Contig721newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029077Macrophage-expressed gene 1 proteinSMESG000044682.1 Contig721uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029077Macrophage-expressed gene 1 proteinSMESG000058940.1 Contig721newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029077Macrophage-expressed gene 1 proteinSMESG000058940.1 Contig721uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024411Protein kinase domain-containing proteinSMESG000028899.1 Contig1093GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024411Protein kinase domain-containing proteinSMESG000071997.1 Contig1093GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032776SMED30032776SMESG000063221.1 Contig1068newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027044SMED30027044SMESG000024306.1 Contig631newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027044SMED30027044SMESG000008737.1 Contig631newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029546Tektin 3SMESG000020792.1 Contig1106newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029546Tektin 3SMESG000020792.1 Contig1106uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029546Tektin 3SMESG000027124.1 Contig1106newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029546Tektin 3SMESG000027124.1 Contig1106uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30031903ProsaposinSMESG000019973.1 Contig692newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30031903ProsaposinSMESG000068491.1 Contig692newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30026637MATH domain-containing proteinSMESG000080555.1 SMESG000049002.1 SMESG000075946.1 SMESG000067287.1 SMESG000064983.1 SMESG000064843.1 SMESG000062987.1 SMESG000047155.1 SMESG000013953.1 Contig927newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30026637MATH domain-containing proteinSMESG000080555.1 SMESG000049002.1 SMESG000075946.1 SMESG000067287.1 SMESG000064983.1 SMESG000064843.1 SMESG000062987.1 SMESG000047155.1 SMESG000013953.1 Contig927uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30026637MATH domain-containing proteinSMESG000076100.1 Contig927newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30026637MATH domain-containing proteinSMESG000076100.1 Contig927uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30031764ADF-H domain-containing proteinSMESG000022423.1 Contig1245GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020801SMED30020801SMESG000075928.1 Contig7205newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020801SMED30020801SMESG000075928.1 Contig7205uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020849SMED30020849SMESG000044682.1 Contig721newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020849SMED30020849SMESG000044682.1 Contig721uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020849SMED30020849SMESG000058940.1 Contig721newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020849SMED30020849SMESG000058940.1 Contig721uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028347Engulfment and cell motility 3SMESG000013936.1 Contig1935GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028347Engulfment and cell motility 3SMESG000039535.1 Contig1935GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027910Calpain-5SMESG000045063.1 Contig7340newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027910Calpain-5SMESG000045063.1 Contig7340uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020100SMED30020100SMESG000013936.1 Contig1935newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020100SMED30020100SMESG000013936.1 Contig1935uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020100SMED30020100SMESG000039535.1 Contig1935newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020100SMED30020100SMESG000039535.1 Contig1935uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027012slc24a-7SMESG000022806.1 SMESG000022803.1 Contig7328newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027012slc24a-7SMESG000022806.1 SMESG000022803.1 Contig7328uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30021196SMED30021196SMESG000015163.1 Contig1173newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034467Protein tyrosine phosphatase type IVASMESG000015894.1 SMESG000000559.1 Contig1506GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034467Protein tyrosine phosphatase type IVASMESG000078978.1 Contig1506GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30025582SMED30025582SMESG000057502.1 Contig1846GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012021SMED30012021 Contig6139newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004118Tubulin beta chainSMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044907.1 SMESG000044888.1 SMESG000035804.1 SMESG000035755.1 Contig2059GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014645HP domain-containing proteinSMESG000075965.1 PL04009A1F04ncbi_smed_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005012SMED30005012 Contig1286newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019006Tubulin beta chainSMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044907.1 SMESG000044888.1 SMESG000035804.1 SMESG000035755.1 Contig2059GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001360Lipopolysaccharide cholineSMESG000060269.1 Contig2381newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001360Lipopolysaccharide cholineSMESG000060269.1 Contig2381uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001360Lipopolysaccharide cholineSMESG000029882.1 Contig2381newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001360Lipopolysaccharide cholineSMESG000029882.1 Contig2381uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004948Lysosomal Pro-X carboxypeptidaseSMESG000074424.1 Contig1592GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012784SEC14-like lipid binding 8SMESG000008338.1 PL05003A1B05ncbi_smed_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30010645SMED30010645 Contig1674newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30003215SMED30003215SMESG000057441.1 Contig2269newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30025473mxi-2 proteinSMESG000067412.1 Contig1164GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30025473mxi-2 proteinSMESG000060394.1 Contig1164GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034050Transmembrane proteinSMESG000058746.1 PL04021A1B12ncbi_smed_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30027929Tubulin beta chainSMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044907.1 SMESG000044888.1 SMESG000035804.1 SMESG000035755.1 Contig2059GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30022535GTPase activating proteinSMESG000068156.1 SMESG000010609.1 SMESG000076470.1 SMESG000073857.1 SMESG000062429.1 SMESG000060487.1 SMESG000058575.1 SMESG000053533.1 SMESG000026676.1 SMESG000020635.1 SMESG000015751.1 SMESG000005260.1 Contig236GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30022535GTPase activating proteinSMESG000037949.1 Contig236GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023243SMED30023243SMESG000009320.1 Contig1862GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028216RNA polymerase II subunit A C-terminal domain phosphatase Contig6262newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028216RNA polymerase II subunit A C-terminal domain phosphatase Contig6262uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029207SMED30029207 Contig1681newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30025103Actin Contig6807newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30025103Actin Contig6807uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023739SMED30023739SMESG000058452.1 Contig1190GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023739SMED30023739SMESG000057519.1 Contig1190GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023460TTF-type domain-containing proteinSMESG000046135.1 Contig1594newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30026190Tubulin beta chainSMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044907.1 SMESG000044888.1 SMESG000035804.1 SMESG000035755.1 Contig2059GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023220Transmembrane proteinSMESG000046135.1 Contig1594GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030294SMED30030294SMESG000026870.1 PL04016B2E04ncbi_smed_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013050SMED30013050SMESG000000175.1 Contig2068newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008812AP complex subunit sigmaSMESG000038889.1 Contig2145GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016747SMED30016747SMESG000019700.1 Contig701newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005382TYR_PHOSPHATASE_2 domain-containing proteinSMESG000030078.1 Contig1352GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011718SMED30011718SMESG000070267.1 Contig1736newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30033842SMED30033842SMESG000030078.1 Contig1352newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035805RING-type domain-containing proteinSMESG000043462.1 Contig210newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035805RING-type domain-containing proteinSMESG000043462.1 Contig210uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035805RING-type domain-containing proteinSMESG000049099.1 Contig210newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035805RING-type domain-containing proteinSMESG000049099.1 Contig210uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035284RING-type domain-containing proteinSMESG000055935.1 Contig651newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035284RING-type domain-containing proteinSMESG000055935.1 Contig651uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035284RING-type domain-containing proteinSMESG000059879.1 SMESG000059868.1 SMESG000059853.1 Contig651newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30035284RING-type domain-containing proteinSMESG000059879.1 SMESG000059868.1 SMESG000059853.1 Contig651uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30031811SMED30031811SMESG000057502.1 Contig1846newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020068Protein rolling stone Contig174GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED300097175-aminolevulinate synthaseSMESG000078664.1 SMED30009717smed_20140614PMID:27551436
Wang et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30025591porcupine-like proteinSMESG000051516.1 ABW97518.1smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult fluorescence in situ hybridization evidence
gutSMED30025591porcupine-like proteinSMESG000051516.1 EU130791.1smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult fluorescence in situ hybridization evidence
gutSMED30001081NudC nuclear distribution proteinSMESG000036795.1 DN303982.1ncbi_smed_estsPMID:22411224
Cowles et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020436Nuclear distribution protein nudE-like 1SMESG000016071.1 HO006501.1ncbi_smed_estsPMID:22411224
Cowles et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30016141lissencephaly-1SMESG000054739.1 SMESG000035997.1 JQ650355.1smed_ncbi_20200123PMID:22411224
Cowles et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002213Zinc finger, C2H2 typeSMESG000075102.1 dd_Smed_v4_3443_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30010350SMED30010350SMESG000017804.1 SMESG000017801.1 dd_Smed_v4_1_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020296Vitellogenin domain-containing proteinSMESG000037978.1 Contig54872uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020296Vitellogenin domain-containing proteinSMESG000037978.1 Contig54872newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020296Vitellogenin domain-containing proteinSMESG000037978.1 SMESG000037977.1 Contig38414newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020296Vitellogenin domain-containing proteinSMESG000037978.1 SMESG000037977.1 Contig38414uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034849Kyphoscoliosis peptidaseSMESG000061907.1 Contig47838newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034849Kyphoscoliosis peptidaseSMESG000061907.1 Contig47838uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020784SMED30020784SMESG000011782.1 Contig32583newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020784SMED30020784SMESG000011782.1 Contig32583uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30009712epidermal growth factor receptor 1SMESG000070834.1 Contig29100newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30009712epidermal growth factor receptor 1SMESG000070834.1 Contig29100uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED3000844110-formyltetrahydrofolate dehydrogenaseSMESG000005275.1 Contig10102newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED3000844110-formyltetrahydrofolate dehydrogenaseSMESG000005275.1 Contig10102uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013605SMED30013605SMESG000048192.1 Contig26075newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013605SMED30013605SMESG000048192.1 Contig26075uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028497AdenosylhomocysteinaseSMESG000012954.1 SMESG000012950.1 Contig41958newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028497AdenosylhomocysteinaseSMESG000012954.1 SMESG000012950.1 Contig41958uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034127Peptidase S1 domain-containing proteinSMESG000076526.1 Contig49240newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034127Peptidase S1 domain-containing proteinSMESG000076526.1 Contig49240uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034376slc6a-5SMESG000042091.1 Contig45795newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30034376slc6a-5SMESG000042091.1 Contig45795uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014808slc11a-1 Contig25723newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024574Nipped-B proteinSMESG000051020.1 Contig24429newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024778SMB domain-containing proteinSMESG000022577.1 Contig50773newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024778SMB domain-containing proteinSMESG000022577.1 Contig50773uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024329SMED30024329SMESG000051020.1 Contig24429newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019742Geranylgeranyl transferase type-2 subunit alphaSMESG000011257.1 Contig42506newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019742Geranylgeranyl transferase type-2 subunit alphaSMESG000011257.1 Contig42506uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001799NADH dehydrogenase subunit 5SMESG000061907.1 Contig47838newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001799NADH dehydrogenase subunit 5SMESG000061907.1 Contig47838uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017805CRAL-TRIO domain-containing proteinSMESG000009872.1 Contig54399newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017805CRAL-TRIO domain-containing proteinSMESG000009872.1 Contig54399uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005935TNF receptor-associated factor 2SMESG000070131.1 SMESG000070129.1 Contig51373newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005935TNF receptor-associated factor 2SMESG000070131.1 SMESG000070129.1 Contig51373uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012447FilaminSMESG000064795.1 Contig38577newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012447FilaminSMESG000064795.1 Contig38577uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012447FilaminSMESG000064795.1 Contig18792newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012447FilaminSMESG000064795.1 Contig18792uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011526SMED30011526SMESG000064795.1 Contig38577newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011526SMED30011526SMESG000064795.1 Contig38577uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011526SMED30011526SMESG000064795.1 Contig18792newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30011526SMED30011526SMESG000064795.1 Contig18792uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032932Protein kinase domain-containing proteinSMESG000066720.1 SMESG000065914.1 SMESG000065913.1 SMESG000044801.1 SMESG000021895.1 Contig36405newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032932Protein kinase domain-containing proteinSMESG000066720.1 SMESG000065914.1 SMESG000065913.1 SMESG000044801.1 SMESG000021895.1 Contig36405uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024994THAP-type domain-containing proteinSMESG000028189.1 Contig44799newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024994THAP-type domain-containing proteinSMESG000028189.1 Contig44799uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30022004SMED30022004SMESG000066720.1 SMESG000065914.1 SMESG000065913.1 SMESG000044801.1 SMESG000021895.1 Contig36405newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30022004SMED30022004SMESG000066720.1 SMESG000065914.1 SMESG000065913.1 SMESG000044801.1 SMESG000021895.1 Contig36405uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015235Amyloid-beta A4 precursor protein-binding family A member 2SMESG000028901.1 Contig30620newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015235Amyloid-beta A4 precursor protein-binding family A member 2SMESG000028901.1 Contig30620uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015243Kinase-like proteinSMESG000053627.1 Contig48300newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015243Kinase-like proteinSMESG000053627.1 Contig48300uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002497Neuronal acetylcholine receptor subunit alpha-4SMESG000005358.1 Contig36571newmark_estsPMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002497Neuronal acetylcholine receptor subunit alpha-4SMESG000005358.1 Contig36571uc_Smed_v2PMID:27612384
Roberts-Galbraith et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032879Selenide, water dikinase 1SMESG000075106.1 dd_Smed_v4_1918_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30029625slc39a-1SMESG000016191.1 dd_Smed_v4_1731_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED3003108940S ribosomal protein S12SMESG000052688.1 dd_Smed_v4_268_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30035502Cytochrome P450 2K1-like proteinSMESG000013701.1 SMESG000013700.1 SMESG000013697.1 dd_Smed_v4_2083_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30034590Post-GPI attachment to proteins factor 2-likeSMESG000044614.1 dd_Smed_v4_10182_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30024169SMED30024169SMESG000016970.1 dd_Smed_v4_2205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30026136Nad dependent epimerase dehydrataseSMESG000035068.1 dd_Smed_v4_3452_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30021252Sorting nexin, putativeSMESG000016883.1 dd_Smed_v4_1354_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30023825LITAF domain-containing proteinSMESG000020853.1 dd_Smed_v4_353_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30033234SMED30033234 dd_Smed_v4_37328_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30024035Serine/Threonine kinase domain proteinSMESG000071539.1 dd_Smed_v4_5501_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30028026Abl interactor 2SMESG000055438.1 dd_Smed_v4_690_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30021613Nesprin-1SMESG000077685.1 SMESG000072345.1 dd_Smed_v4_11466_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30029096slc38a-5SMESG000030873.1 dd_Smed_v4_2530_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30026513SMED30026513SMESG000005268.1 dd_Smed_v4_1537_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30035193Heat shock protein 90 dd_Smed_v4_56_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30008405Scavenger receptor class B, member 2SMESG000058915.1 dd_Smed_v4_2304_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30033902sec1 family domain-containing protein 1SMESG000044570.1 dd_Smed_v4_2992_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017862Jagged 2-1SMESG000025147.1 dd_Smed_v4_4792_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30017231NEPH-3SMESG000022777.1 dd_Smed_v4_11280_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007383GCR103SMESG000061776.1 dd_Smed_v4_7534_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30023831Phosphatase 1 regulatory subunit 37-like proteinSMESG000078284.1 dd_Smed_v4_5089_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30022844NEPH-3SMESG000022777.1 dd_Smed_v4_11280_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30009281Netrin-4SMESG000062589.1 dd_Smed_v4_6093_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30019378Exocyst complex componentSMESG000065870.1 dd_Smed_v4_2186_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013891Ig-like domain-containing proteinSMESG000075643.1 dd_Smed_v4_19460_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024185slc10a-5SMESG000064830.1 dd_Smed_v4_11330_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30005706SMED30005706SMESG000021036.1 SMESG000021035.1 SMESG000021034.1 dd_Smed_v4_5445_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028401InnexinSMESG000056430.1 AY967558smed_ncbi_20200123PMID:17670787
Oviedo et al., 2007
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30024236InnexinSMESG000056430.1 AY967558smed_ncbi_20200123PMID:17670787
Oviedo et al., 2007
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001723HTH CENPB-type domain-containing proteinSMESG000049778.1 SMESG000048378.1 SMESG000039423.1 SMESG000039024.1 SMESG000024543.1 SMESG000022136.1 SMESG000002434.1 JF894290.2smed_ncbi_20200123PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult fluorescence in situ hybridization evidence
gutSMED30001723HTH CENPB-type domain-containing proteinSMESG000049778.1 SMESG000048378.1 SMESG000039423.1 SMESG000039024.1 SMESG000024543.1 SMESG000022136.1 SMESG000002434.1 JF894290.2smed_ncbi_20200123PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30028047Regulatory-associated protein of mTORSMESG000049778.1 SMESG000048378.1 SMESG000039423.1 SMESG000039024.1 SMESG000024543.1 SMESG000022136.1 SMESG000002434.1 JF894290.2smed_ncbi_20200123PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult fluorescence in situ hybridization evidence
gutSMED30028047Regulatory-associated protein of mTORSMESG000049778.1 SMESG000048378.1 SMESG000039423.1 SMESG000039024.1 SMESG000024543.1 SMESG000022136.1 SMESG000002434.1 JF894290.2smed_ncbi_20200123PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30014131RPTOR independent companion of MTOR, complex 2 aSMESG000033571.1 SMESG000033570.1 JN815259.1smed_ncbi_20200123PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30006752TorSMESG000025384.1 JF894291.2smed_ncbi_20200123PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30006752TorSMESG000025384.1 JF894291.2smed_ncbi_20200123PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult fluorescence in situ hybridization evidence
gutSMED30022631Dimer_Tnp_hAT domain-containing proteinSMESG000049778.1 SMESG000048378.1 SMESG000039423.1 SMESG000039024.1 SMESG000024543.1 SMESG000022136.1 SMESG000002434.1 JF894290.2smed_ncbi_20200123PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult fluorescence in situ hybridization evidence
gutSMED30022631Dimer_Tnp_hAT domain-containing proteinSMESG000049778.1 SMESG000048378.1 SMESG000039423.1 SMESG000039024.1 SMESG000024543.1 SMESG000022136.1 SMESG000002434.1 JF894290.2smed_ncbi_20200123PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30003448Glycine N-methyltransferaseSMESG000037719.1 SmedASXL_008095SmedAsxl_ww_GCZZ01PMID:29158443
He et al., 2017
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30018398Superoxide dismutase [Cu-Zn]SMESG000005021.1 SmedASXL_019073SmedAsxl_ww_GCZZ01PMID:29158443
He et al., 2017
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30013673SMED30013673SMESG000035327.1 SmedASXL_016646SmedAsxl_ww_GCZZ01PMID:29158443
He et al., 2017
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30007461Ubiquitin-60S ribosomal protein L40SMESG000066595.1 SmedASXL_002380SmedAsxl_ww_GCZZ01PMID:29158443
He et al., 2017
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30020231DUF3421 domain-containing proteinSMESG000046728.1 SmedASXL_004676SmedAsxl_ww_GCZZ01PMID:29158443
He et al., 2017
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30032008PhosphodiesteraseSMESG000056509.1 SmedASXL_014050SmedAsxl_ww_GCZZ01PMID:29158443
He et al., 2017
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30031208Histone-lysine N-methyltransferase SETMAR SmedASXL_077649SmedAsxl_ww_GCZZ01PMID:29158443
He et al., 2017
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30029625slc39a-1SMESG000016191.1 SmedASXL_003002SmedAsxl_ww_GCZZ01PMID:29158443
He et al., 2017
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30002437SMED30002437 SmedASXL_052019SmedAsxl_ww_GCZZ01PMID:29158443
He et al., 2017
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30001319slc24a-8SMESG000030115.1 SmedASXL_015989SmedAsxl_ww_GCZZ01PMID:29158443
He et al., 2017
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30010096TPA_inf: prohormone convertase 2SMESG000008070.1 tr5_785mu_Smed_v1PMID:25558068
Reuter et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015406TNF receptor-associated factorSMESG000035446.1 tr5_1521mu_Smed_v1PMID:25558068
Reuter et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
gutSMED30016511SMED30016511SMESG000072006.1 tr5_6444mu_Smed_v1PMID:25558068
Reuter et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30012449ralBP1-associated Eps domain-containing protein 1 isoform X8SMESG000023078.1 tr5_3835mu_Smed_v1PMID:25558068
Reuter et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30008875SMED30008875SMESG000027213.1 tr5_1296mu_Smed_v1PMID:25558068
Reuter et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
gutSMED30034772Fibrillar collagen NC1 domain-containing proteinSMESG000077977.1 tr5_2051mu_Smed_v1PMID:25558068
Reuter et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004928phosphatidylinositol 4-kinase betaSMESG000061430.1 tr5_4416mu_Smed_v1PMID:25558068
Reuter et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30030074Mothers against decapentaplegic homologSMESG000029614.1 SMED30030074smed_20140614PMID:25558068
Reuter et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30003196Adenosine kinaseSMESG000027213.1 tr5_1296mu_Smed_v1PMID:25558068
Reuter et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
gutSMED30025591porcupine-like proteinSMESG000051516.1 EU130791.1smed_ncbi_20200123PMID:29557542
Han et al., 2019
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30015041Retinoic acid receptor betaSMESG000054304.1 SMED30015041smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
gutSMED30004939SMED30004939SMESG000001797.1 dd_Smed_v4_272_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30000639Microtubule-actin cross-linking factor 1-like isoform X28SMESG000017517.1 SMESG000017520.1 SMESG000017519.1 dd_Smed_v4_6577_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30005802SMED30005802SMESG000072483.1 dd_Smed_v4_5611_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30005508Long-chain-fatty-acid--CoA ligaseSMESG000024739.1 dd_Smed_v4_2009_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30003947transient receptor potential cation channel subfamily M member 3SMESG000005077.1 SMESG000004900.1 dd_Smed_v4_10485_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30030013GTP-binding nuclear proteinSMESG000072524.1 SMESG000072522.1 dd_Smed_v4_330_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30007290GATA456SMESG000039559.1 SMESG000037031.1 dd_Smed_v4_4075_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30007877SMED30007877SMESG000046412.1 SMESG000037658.1 dd_Smed_v4_1553_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30010541F-actin-capping protein subunit betaSMESG000008209.1 dd_Smed_v4_1165_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30014491Aldehyde dehydrogenaseSMESG000010552.1 dd_Smed_v4_1680_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30010515FR47 domain-containing proteinSMESG000035878.1 dd_Smed_v4_1705_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30003172Adenylosuccinate synthetaseSMESG000078697.1 dd_Smed_v4_2154_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30008762SMED30008762SMESG000006038.1 SMESG000005903.1 dd_Smed_v4_1785_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30034629Golgi-associated plant pathogenesis-related protein 1SMESG000063568.1 dd_Smed_v4_762_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30033774CatalaseSMESG000055572.1 dd_Smed_v4_859_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30011793Homeobox protein DTH-1SMESG000079512.1 dd_Smed_v4_2716_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30005748HNF4SMESG000014588.1 dd_Smed_v4_1694_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30002213Zinc finger, C2H2 typeSMESG000075102.1 dd_Smed_v4_3443_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30001630Ras-related C3 botulinum toxin substrate 1SMESG000024968.1 SMESG000005612.1 dd_Smed_v4_1050_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30025591porcupine-like proteinSMESG000051516.1 dd_Smed_v4_413_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30033476Zinc finger protein, putativeSMESG000025870.1 dd_Smed_v4_3821_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30027034Aminotran_5 domain-containing proteinSMESG000033958.1 dd_Smed_v4_6547_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30007637SMED30007637SMESG000066417.1 SMESG000066414.1 dd_132dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30007637SMED30007637SMESG000066417.1 SMESG000066414.1 dd_132dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
gutSMED30007637SMED30007637SMESG000066417.1 SMESG000066414.1 dd_Smed_v4_132_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30000038Ribosome-binding protein 1SMESG000031975.1 dd_Smed_v4_1111_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED3000905260S ribosomal protein L18SMESG000017166.1 dd_Smed_v4_128_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30005457SMED30005457SMESG000035312.1 SMESG000035313.1 dd_131dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
gutSMED30005457SMED30005457SMESG000035312.1 SMESG000035313.1 dd_131dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30005457SMED30005457SMESG000035312.1 dd_Smed_v4_131_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30011283SMED30011283SMESG000032426.1 SMESG000032414.1 dd_Smed_v4_6793_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30002592NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 3SMESG000016331.1 dd_Smed_v4_1078_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30003929Pyridoxal 5'-phosphate synthase subunit PdxSSMESG000026036.1 dd_Smed_v4_1240_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30010001ATP-binding cassette sub-family A member 1SMESG000032896.1 SMESG000029537.1 SMESG000029534.1 dd_Smed_v4_2300_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30004903Cytochrome b-c1 complex subunit 2, mitochondrialSMESG000064836.1 dd_Smed_v4_1004_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30005571Delta-1-pyrroline-5-carboxylate synthaseSMESG000045474.1 dd_Smed_v4_1060_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30010350SMED30010350SMESG000017804.1 SMESG000017801.1 dd_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
gutSMED30010350SMED30010350SMESG000017804.1 SMESG000017801.1 dd_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30010350SMED30010350SMESG000017804.1 SMESG000017801.1 dd_Smed_v4_1_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30003448Glycine N-methyltransferaseSMESG000037719.1 dd_Smed_v4_1127_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30000373retinol dehydrogenase 13-likeSMESG000049264.1 SMESG000009696.1 SMESG000009679.1 dd_Smed_v4_2096_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30008063SMED30008063SMESG000043378.1 dd_Smed_v4_1685_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30003676C-type lectin domain-containing proteinSMESG000028261.1 SMESG000028260.1 SMESG000028258.1 dd_Smed_v4_10_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30033686TNF receptor associated factor-2SMESG000027283.1 dd_Smed_v4_6768_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30030204SMED30030204SMESG000018900.1 dd_Smed_v4_10059_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30017013Vesicle-associated membrane protein 3SMESG000033382.1 dd_Smed_v4_1311_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30024958VAMP (vesicle-associated membrane protein)-associated protein A, likeSMESG000062111.1 dd_Smed_v4_1433_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30028080SMED30028080SMESG000024479.1 dd_Smed_v4_1163_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30006689Leucine-rich repeat serine/threonine-protein kinase 2-like proteinSMESG000056130.1 dd_Smed_v4_7343_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30000901ThioredoxinSMESG000069662.1 SMESG000030342.1 dd_Smed_v4_89_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30002305SMED30002305SMESG000047320.1 dd_Smed_v4_7461_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30005982delta-1SMESG000069662.1 SMESG000030342.1 dd_Smed_v4_89_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30001635cathepsin BSMESG000048413.1 dd_Smed_v4_81_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30018763Mitochondrial pyruvate carrierSMESG000004344.1 dd_Smed_v4_8071_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30011617Actin-related protein 2/3 complex subunit 4SMESG000003841.1 dd_Smed_v4_977_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30012464SMED30012464SMESG000035411.1 dd_Smed_v4_49258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30011629dual serine/threonine and tyrosine protein kinaseSMESG000012973.1 SMESG000012972.1 dd_Smed_v4_4436_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30011695Alpha-galactosidaseSMESG000009912.1 dd_Smed_v4_606_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30000819Acid sphingomyelinase-like phosphodiesteraseSMESG000071517.1 dd_Smed_v4_5377_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30004809TNF receptor-associated factorSMESG000038724.1 dd_Smed_v4_7950_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30011313Acyl-protein thioesterase 1SMESG000058272.1 dd_Smed_v4_638_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30010370Oxidation resistance protein 1SMESG000038268.1 SMESG000009764.1 SMESG000009763.1 dd_Smed_v4_6537_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30012777Usp domain-containing proteinSMESG000035960.1 dd_Smed_v4_7254_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30014224SMED30014224SMESG000036932.1 dd_Smed_v4_4287_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30004481pleckstrin homology domain-containing family F member 2SMESG000028452.1 dd_Smed_v4_5699_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30007563SulfotransferaseSMESG000046103.1 dd_Smed_v4_4622_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30014246Ras-related protein Rab-5ASMESG000064914.1 dd_Smed_v4_796_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30017098Chaperone protein DnaJSMESG000015446.1 dd_Smed_v4_9791_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30014056Eukaryotic translation initiation factor 4eSMESG000017108.1 dd_Smed_v4_5790_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30001271SMED30001271SMESG000038975.1 dd_Smed_v4_930_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30016943slc15a-6SMESG000030835.1 dd_Smed_v4_3578_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30002941Actin-related protein 2/3 complex subunit 3SMESG000003941.1 dd_Smed_v4_619_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30026534Rho-related GTP-binding proteinSMESG000022390.1 dd_Smed_v4_578_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30029481SMED30029481SMESG000079496.1 dd_Smed_v4_6860_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30033930Cystathionine beta-synthaseSMESG000065264.1 SMESG000065255.1 dd_Smed_v4_1585_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30027427Acetyl-coenzyme A synthetaseSMESG000023067.1 dd_Smed_v4_6561_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30030020SMED30030020SMESG000024202.1 dd_Smed_v4_8896_0_2dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30025783NADPH--cytochrome P450 reductaseSMESG000022047.1 dd_Smed_v4_542_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30021001Protein kinaseSMESG000017252.1 SMESG000017249.1 SMESG000017248.1 dd_Smed_v4_311_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30034544Disrupted in renal carcinoma protein 2-likeSMESG000017031.1 dd_Smed_v4_4596_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30024358Protein 4.1SMESG000029732.1 dd_Smed_v4_5331_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30024358Protein 4.1SMESG000029732.1 dd_Smed_v4_2825_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30028401InnexinSMESG000056430.1 dd_Smed_v4_734_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30021535slc31a-3SMESG000020554.1 dd_Smed_v4_6792_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30024839Mitochondrial ATP synthase subunit bSMESG000077800.1 dd_Smed_v4_905_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30034430Arp2/3 complex 34 kDa subunitSMESG000073809.1 dd_Smed_v4_693_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30020244Protein kinase domain containing proteinSMESG000017252.1 SMESG000017249.1 SMESG000017248.1 dd_Smed_v4_311_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30030305Peptidase_M14 domain-containing proteinSMESG000048042.1 dd_Smed_v4_2282_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30025246SMED30025246SMESG000077669.1 SMESG000077668.1 dd_Smed_v4_7171_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30020607TNF receptor-associated factorSMESG000027123.1 dd_Smed_v4_4148_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30033380Beta-hexosaminidaseSMESG000037355.1 dd_Smed_v4_576_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30030788SMED30030788SMESG000079496.1 dd_Smed_v4_6860_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30032901SMED30032901SMESG000054316.1 SMESG000054315.1 dd_Smed_v4_1435_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30027407SERPINE1 mRNA binding protein 1aSMESG000008791.1 dd_Smed_v4_697_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30021127SMED30021127SMESG000037626.1 dd_Smed_v4_7748_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30024236InnexinSMESG000056430.1 dd_Smed_v4_734_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30007410TNF receptor-associated factor 2SMESG000081190.1 SMESG000018409.1 dd_Smed_v4_2703_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30015414G_PROTEIN_RECEP_F2_4 domain-containing proteinSMESG000033615.1 dd_Smed_v4_10981_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30015414G_PROTEIN_RECEP_F2_4 domain-containing proteinSMESG000070072.1 dd_Smed_v4_1789_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30008050TRAF-5SMESG000014795.1 dd_Smed_v4_15545_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30002038Calsyntenin 1SMESG000002834.1 SMESG000002830.1 dd_Smed_v4_1518_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30000477Protein lifeguard 1SMESG000014373.1 dd_Smed_v4_16271_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30006762Transposon Ty3-I Gag-Pol polyproteinSMESG000051654.1 SMESG000029259.1 dd_Smed_v4_1871_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30019264DUF3421 domain-containing proteinSMESG000029906.1 dd_Smed_v4_2061_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30002513Histidine ammonia-lyaseSMESG000002694.1 SMESG000002559.1 dd_Smed_v4_2970_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30002513Histidine ammonia-lyaseSMESG000002694.1 SMESG000002559.1 dd_Smed_v4_2219_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30014265Neutral ceramidaseSMESG000003228.1 dd_Smed_v4_1726_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30012072SMED30012072SMESG000017135.1 dd_Smed_v4_2138_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30019393protocadherin-1SMESG000033799.1 dd_Smed_v4_16629_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED3000598860S ribosomal protein L24SMESG000007869.1 SMESG000007858.1 SMESG000007847.1 dd_Smed_v4_172_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30011250Granulin precursorSMESG000029882.1 dd_Smed_v4_442_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30003468Phosphoenolpyruvate carboxykinase [GTP]SMESG000073058.1 SMESG000003144.1 dd_Smed_v4_536_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30002882SMED30002882SMESG000069367.1 dd_Smed_v4_11838_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30002510Urocanate hydrataseSMESG000032396.1 dd_Smed_v4_1655_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED3000317640S ribosomal protein S2SMESG000051503.1 dd_Smed_v4_226_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED3001895450S ribosomal protein L7/L12SMESG000026245.1 dd_Smed_v4_2166_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30018688TNF receptor-associated factorSMESG000070130.1 SMESG000070126.1 dd_Smed_v4_1439_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30002332TNF receptor associated factor-2SMESG000070267.1 dd_Smed_v4_2599_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30017811Alpha actininSMESG000047739.1 dd_Smed_v4_1492_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30010940TetraspaninSMESG000021642.1 dd_Smed_v4_1257_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30008259Progesterone receptor membrane component 1SMESG000069126.1 SMESG000069122.1 dd_Smed_v4_2076_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30018702Voltage-dependent anion-selective channel protein 2SMESG000053095.1 dd_Smed_v4_2119_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30007903slc6a-2SMESG000009904.1 dd_Smed_v4_21305_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30001195da proteinSMESG000032044.1 dd_Smed_v4_5579_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30019834Guanine nucleotide-binding protein subunit beta-2-like 1SMESG000076568.1 dd_Smed_v4_174_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30011581AP2-associated protein kinase 1-like ProteinSMESG000041938.1 SMESG000041937.1 SMESG000051989.1 dd_Smed_v4_1179_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30017847Protein kinase domain-containing proteinSMESG000056697.1 dd_Smed_v4_1371_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30018082Progesterone receptor membrane component 1SMESG000069126.1 SMESG000069122.1 dd_Smed_v4_2076_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED3001553460S ribosomal protein L21SMESG000040216.1 dd_Smed_v4_189_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED3000985940S ribosomal protein S24SMESG000035929.1 dd_Smed_v4_164_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30005820SMED30005820SMESG000080577.1 dd_Smed_v4_19517_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30010687Serine/threonine-protein kinase STE20SMESG000014619.1 dd_Smed_v4_1212_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30017119Integrase catalytic domain-containing proteinSMESG000069853.1 dd_Smed_v4_1941_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30013053SMED30013053SMESG000078177.1 dd_Smed_v4_2249_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED3000236940S ribosomal protein S17SMESG000037102.1 dd_Smed_v4_195_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30013080G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000001813.1 dd_Smed_v4_19933_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30000998SMED30000998SMESG000008901.1 dd_Smed_v4_15396_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30016631SMED30016631SMESG000016297.1 SMESG000016293.1 dd_Smed_v4_2084_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30016347SMED30016347SMESG000033615.1 dd_Smed_v4_10981_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30017626Cysteine rich secretory protein LCCL domain containing 2SMESG000031543.1 dd_Smed_v4_11957_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30017337Serine/threonine kinaseSMESG000014619.1 dd_Smed_v4_1212_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30005074Protein kinase domain-containing proteinSMESG000014619.1 dd_Smed_v4_1212_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30009933WH1 domain-containing proteinSMESG000052345.1 dd_Smed_v4_1714_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30011213Osteoclast-stimulating factor 1SMESG000004952.1 SMESG000004951.1 dd_Smed_v4_2235_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30001296Actin-related protein 2SMESG000019700.1 dd_Smed_v4_623_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30005658SMED30005658SMESG000066596.1 dd_Smed_v4_11959_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30008385Solute carrier family 13 member 2SMESG000041335.1 dd_Smed_v4_12964_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30014459bak-2SMESG000008222.1 dd_Smed_v4_1767_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30009657TNF receptor-associated factorSMESG000001565.1 dd_Smed_v4_6485_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30027355Sorbitol dehydrogenase-like proteinSMESG000042474.1 dd_Smed_v4_1002_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30030377Polypeptide N-acetylgalactosaminyltransferaseSMESG000081429.1 SMESG000081318.1 SMESG000081285.1 dd_Smed_v4_8580_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30025732SMED30025732SMESG000000426.1 SMESG000000425.1 dd_Smed_v4_1369_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED3002341340S ribosomal protein S25SMESG000059049.1 dd_Smed_v4_134_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30020825Protein I'm not dead yetSMESG000041335.1 dd_Smed_v4_12964_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30022560Ribosomal_L28e domain-containing proteinSMESG000026745.1 dd_Smed_v4_221_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30020035DNA polymerase subunit gammaSMESG000050799.1 dd_Smed_v4_13411_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30006208Aconitate hydratase, mitochondrialSMESG000002904.1 dd_Smed_v4_979_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30008007Discoidin domain-containing receptor 2SMESG000066441.1 dd_Smed_v4_6578_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED3000844110-formyltetrahydrofolate dehydrogenaseSMESG000005275.1 dd_Smed_v4_5787_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30008458Lysosomal alpha-glucosidase-likeSMESG000005069.1 dd_Smed_v4_4668_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30007604SMED30007604SMESG000074719.1 dd_Smed_v4_3016_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30007604SMED30007604SMESG000074719.1 dd_Smed_v4_4756_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30006211Transmembrane protease serineSMESG000025034.1 dd_Smed_v4_4090_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30008978ArginaseSMESG000011875.1 dd_Smed_v4_6599_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30011818C2H2-type domain-containing proteinSMESG000048024.1 dd_Smed_v4_892_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30010520SMED30010520SMESG000066861.1 SMESG000059630.1 SMESG000066862.1 dd_Smed_v4_6647_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30030743Phosphatidylserine decarboxylase proenzyme, mitochondrialSMESG000048067.1 dd_Smed_v4_2087_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30026157GAS2-like 3SMESG000003786.1 SMESG000003788.1 SMESG000003787.1 dd_Smed_v4_3326_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30026995V-type proton ATPase subunit CSMESG000061029.1 dd_Smed_v4_1255_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30024160SMED30024160SMESG000046560.1 SMESG000010944.1 dd_Smed_v4_142_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30024160SMED30024160SMESG000046560.1 dd_Smed_v4_1394_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30022813Serine/threonine protein kinase, putativeSMESG000003862.1 dd_Smed_v4_3667_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30003079Prominin (Prom) protein, putativeSMESG000062666.1 dd_Smed_v4_4461_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30013735Elongation factor 1-alphaSMESG000061164.1 SMESG000061099.1 dd_Smed_v4_30_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30005741Actin-related protein 2/3 complex subunitSMESG000015778.1 dd_Smed_v4_978_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30015706Twinfilin-1SMESG000041071.1 dd_Smed_v4_2563_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30015831Purple acid phosphataseSMESG000028714.1 dd_Smed_v4_2643_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30002822RING-type domain-containing proteinSMESG000076482.1 SMESG000076470.1 SMESG000076469.1 SMESG000076410.1 SMESG000076409.1 SMESG000076408.1 SMESG000076407.1 SMESG000076406.1 SMESG000076390.1 SMESG000076389.1 SMESG000076385.1 SMESG000076375.1 SMESG000076371.1 SMESG000076363.1 SMESG000076358.1 SMESG000076223.1 SMESG000040665.1 dd_Smed_v4_645_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30019745Macrophage-expressed gene 1 proteinSMESG000044678.1 dd_Smed_v4_12605_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30013132Septin-2SMESG000008815.1 dd_Smed_v4_1509_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30009287Protein kinase, putativeSMESG000074416.1 SMESG000074407.1 dd_Smed_v4_3361_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30009287Protein kinase, putativeSMESG000074416.1 SMESG000074409.1 SMESG000074407.1 dd_Smed_v4_7011_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30014141Acyl carrier proteinSMESG000019639.1 dd_Smed_v4_1384_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30015660SMED30015660SMESG000018225.1 SMESG000017035.1 dd_Smed_v4_1426_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30019280SMED30019280SMESG000050162.1 dd_Smed_v4_1101_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30010792Protein kinaseSMESG000074416.1 SMESG000074407.1 dd_Smed_v4_3361_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30020421slc15a-8SMESG000009956.1 dd_Smed_v4_11818_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30025422GrpE protein homologSMESG000004230.1 dd_Smed_v4_1172_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30021037RibonucloproteinSMESG000027962.1 dd_Smed_v4_1928_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30021206Calcineurin B homologous protein 1SMESG000018297.1 dd_Smed_v4_1504_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30010718Cyclin-dependent kinase-like 1SMESG000078505.1 dd_Smed_v4_8479_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30010718Cyclin-dependent kinase-like 1SMESG000078505.1 dd_Smed_v4_8300_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30016492B-cell receptor-associated protein 31SMESG000064614.1 dd_Smed_v4_1559_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30004747Cytochrome P450SMESG000013786.1 SMESG000013783.1 SMESG000011362.1 dd_Smed_v4_2257_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30019830Kinase-like domain-containing proteinSMESG000010252.1 dd_Smed_v4_2672_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30012389SMED30012389SMESG000013786.1 SMESG000013783.1 SMESG000011362.1 dd_Smed_v4_2257_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30008855Copper-transporting ATPase 1SMESG000058134.1 dd_Smed_v4_8956_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30001294Phosphatidylinositol-binding clathrin assembly proteinSMESG000072544.1 dd_Smed_v4_1463_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30028574Cytochrome P450 2K1-like proteinSMESG000078092.1 SMESG000078091.1 dd_Smed_v4_2351_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30025913proton myo-inositol cotransporterSMESG000056326.1 SMESG000056325.1 dd_Smed_v4_4836_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30028497AdenosylhomocysteinaseSMESG000012954.1 SMESG000012950.1 dd_Smed_v4_526_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30031423ATP synthase subunitSMESG000021514.1 dd_Smed_v4_428_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30030897Ubox domain containing proteinSMESG000054668.1 dd_Smed_v4_2397_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30026889Ras-related protein Rab-10SMESG000042605.1 dd_Smed_v4_2906_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30024655Ligand of Numb protein X 2SMESG000067101.1 dd_Smed_v4_4763_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30020231DUF3421 domain-containing proteinSMESG000046728.1 dd_Smed_v4_1984_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30034127Peptidase S1 domain-containing proteinSMESG000076526.1 dd_Smed_v4_7541_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30025164Protein NDRG4SMESG000065324.1 dd_Smed_v4_2911_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED3002077640S ribosomal protein S21SMESG000004954.1 dd_Smed_v4_84_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30020663SMED30020663SMESG000003437.1 dd_Smed_v4_2920_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30025543Coiled-coil domain-containing protein 93SMESG000022913.1 dd_Smed_v4_2519_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30021235Tubulin alpha chainSMESG000079004.1 dd_Smed_v4_452_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30021445S-adenosylmethionine synthaseSMESG000053202.1 SMESG000053199.1 dd_Smed_v4_907_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
gutSMED30021445S-adenosylmethionine synthaseSMESG000053202.1 SMESG000053199.1 dd_Smed_v4_907_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30020261SMED30020261SMESG000045656.1 dd_Smed_v4_797_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30022992Myosin heavy chainSMESG000062420.1 dd_Smed_v4_791_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30024379SMED30024379SMESG000024211.1 dd_Smed_v4_4064_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30024023Retinol dehydrogenaseSMESG000071466.1 dd_Smed_v4_5348_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30023044ATP-binding cassette sub-family A member 1SMESG000032896.1 SMESG000029537.1 SMESG000029534.1 dd_Smed_v4_2300_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30021956Actin-related protein 3SMESG000078631.1 dd_Smed_v4_453_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30021559SMED30021559SMESG000079496.1 dd_Smed_v4_6860_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED3003151240S ribosomal protein S21SMESG000004954.1 dd_Smed_v4_84_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30025418CytohesinSMESG000053202.1 SMESG000053199.1 dd_Smed_v4_907_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
gutSMED30025418CytohesinSMESG000053202.1 SMESG000053199.1 dd_Smed_v4_907_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30026477SMED30026477 dd_Smed_v4_275_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30030294SMED30030294SMESG000026870.1 dd_Smed_v4_2495_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30022271SMED30022271 dd_Smed_v4_46184_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30034274G_PROTEIN_RECEP_F1_2 domain-containing protein dd_Smed_v4_79416_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30009038SMED30009038SMESG000068141.1 dd_Smed_v4_1067_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30002138slc36a-2SMESG000060771.1 dd_Smed_v4_2596_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30010974InnexinSMESG000055742.1 SMESG000055733.1 dd_Smed_v4_1120_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30009199Histone-lysine N-methyltransferase SETMARSMESG000031104.1 SMESG000031101.1 dd_Smed_v4_6221_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30015613GLI-2SMESG000060276.1 dd_Smed_v4_46372_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30015613GLI-2SMESG000060276.1 dd_Smed_v4_25554_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30012966SMED30012966SMESG000052698.1 SMESG000027142.1 SMESG000059994.1 dd_Smed_v4_1029_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30012966SMED30012966SMESG000079607.1 SMESG000072955.1 SMESG000049847.1 SMESG000049844.1 SMESG000049832.1 SMESG000049812.1 SMESG000049806.1 SMESG000049805.1 SMESG000049772.1 SMESG000049767.1 SMESG000049756.1 SMESG000049745.1 SMESG000049740.1 SMESG000049739.1 SMESG000049695.1 SMESG000049688.1 SMESG000049683.1 SMESG000049676.1 SMESG000049665.1 SMESG000049663.1 SMESG000049647.1 SMESG000049621.1 SMESG000049614.1 SMESG000049601.1 SMESG000049567.1 SMESG000049548.1 SMESG000040301.1 SMESG000040257.1 SMESG000032755.1 SMESG000032715.1 SMESG000022696.1 SMESG000022691.1 SMESG000022676.1 SMESG000022665.1 SMESG000022640.1 SMESG000022619.1 SMESG000022612.1 dd_Smed_v4_490_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30003248dehydrogenase/reductase SDR family member 11SMESG000077918.1 dd_Smed_v4_7587_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30006022Epidermal growth factor-8SMESG000077703.1 dd_Smed_v4_5019_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30002858APOBEC1 complementation factorSMESG000035182.1 dd_Smed_v4_7056_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30016201V-type proton ATPase proteolipid subunitSMESG000068628.1 dd_Smed_v4_253_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30002267CystinosinSMESG000079054.1 dd_Smed_v4_4571_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30000200Polypeptide N-acetylgalactosaminyltransferaseSMESG000017211.1 dd_Smed_v4_5368_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30000013Transforming growth factor-beta-induced proteinSMESG000036037.1 SMESG000036036.1 dd_Smed_v4_1088_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30003360LipaseSMESG000002840.1 dd_Smed_v4_1565_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30009201TNF receptor associated factor-2SMESG000024504.1 dd_Smed_v4_3038_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED3000621640S ribosomal protein S8SMESG000047167.1 dd_Smed_v4_156_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30004557Tyrosine-protein kinaseSMESG000015831.1 dd_Smed_v4_2291_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30018127SMED30018127SMESG000014578.1 SMESG000014566.1 SMESG000014563.1 SMESG000014544.1 SMESG000014542.1 SMESG000014523.1 dd_Smed_v4_1543_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30008806slc26a-1SMESG000035953.1 dd_Smed_v4_8150_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30001319slc24a-8SMESG000030115.1 dd_Smed_v4_7121_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30001652SMED30001652SMESG000052698.1 SMESG000027142.1 SMESG000059994.1 dd_Smed_v4_1029_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30010999Multidrug and toxin extrusion proteinSMESG000065608.1 dd_Smed_v4_7241_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30003899SMP-LTD domain-containing proteinSMESG000022335.1 dd_Smed_v4_4286_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30017717Ras-related protein Rab-2ASMESG000076159.1 dd_Smed_v4_1113_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30006764Phosphatidylinositol 3-kinase regulatory subunit alphaSMESG000078199.1 dd_Smed_v4_4794_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30010526SMED30010526SMESG000072556.1 dd_Smed_v4_10620_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30015020E3 ubiquitin-protein ligase XIAPSMESG000031958.1 dd_Smed_v4_2104_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30008365slc36a-1SMESG000022898.1 dd_Smed_v4_8683_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30017042V-type proton ATPase subunit ESMESG000064093.1 dd_Smed_v4_1494_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30012459SMED30012459SMESG000003156.1 dd_Smed_v4_2446_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30009340SMED30009340SMESG000014578.1 SMESG000014566.1 SMESG000014563.1 SMESG000014544.1 SMESG000014542.1 SMESG000014523.1 dd_Smed_v4_1543_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30007454cAMP-dependent protein kinase catalytic subunitSMESG000048623.1 SMESG000043218.1 dd_Smed_v4_8371_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30002344Bax inhibitor-1 proteinSMESG000038559.1 dd_Smed_v4_319_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30002603SMED30002603SMESG000053020.1 SMESG000053011.1 dd_Smed_v4_597_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30000545nuclear factor of activated T-cells 5-likeSMESG000001287.1 dd_Smed_v4_5978_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30011604Long-chain-fatty-acid--CoA ligaseSMESG000081754.1 dd_Smed_v4_2153_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30009414SMED30009414SMESG000017043.1 dd_Smed_v4_854_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30008798cAMP-dependent protein kinase type II regulatory subunitSMESG000051354.1 dd_Smed_v4_1362_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30019306Pyridoxal 5'-phosphate synthase subunit PdxTSMESG000058074.1 dd_Smed_v4_1595_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30000212Vacuolar protein sorting-associated protein 26BSMESG000026617.1 dd_Smed_v4_912_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30004216Dihydropyrimidine dehydrogenase [NADP( )]SMESG000034030.1 dd_Smed_v4_2037_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30017439SMED30017439SMESG000000381.1 SMESG000000382.1 dd_Smed_v4_2318_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30007804Immunoglobulin-like domain-containing proteinSMESG000010356.1 dd_Smed_v4_1827_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30003102UDENN domain-containing proteinSMESG000049466.1 dd_Smed_v4_7059_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30005382TYR_PHOSPHATASE_2 domain-containing proteinSMESG000030078.1 dd_Smed_v4_6110_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30015055Spinster-like protein 1SMESG000057652.1 dd_Smed_v4_4119_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30007586SMED30007586SMESG000043582.1 dd_Smed_v4_546_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30011590AP-3 complex subunit sigmaSMESG000011941.1 dd_Smed_v4_2510_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30010048SMED30010048SMESG000000602.1 SMESG000000601.1 dd_Smed_v4_7042_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30009337SMED30009337SMESG000045673.1 dd_Smed_v4_1022_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30000258Canalicular multispecific organic anion transporter 1SMESG000057252.1 dd_Smed_v4_6609_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30012159FHA domain-containing proteinSMESG000002561.1 dd_Smed_v4_3690_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30007824WASH complex subunit 4SMESG000003631.1 dd_Smed_v4_4183_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30014032SMED30014032SMESG000000381.1 SMESG000000382.1 dd_Smed_v4_2318_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED3001449360S ribosomal protein L5SMESG000004748.1 dd_Smed_v4_151_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30016516Protein diaphanous homolog 2SMESG000057806.1 dd_Smed_v4_2533_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30001895Very-long-chain 3-oxoacyl-CoA reductaseSMESG000077527.1 dd_Smed_v4_2464_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30035970transcription initiation factor TFIID subunit 2SMESG000037189.1 dd_Smed_v4_15494_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30035711Strawberry notch homolog 1SMESG000047829.1 dd_Smed_v4_10374_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30030498DUF862 domain-containing proteinSMESG000024663.1 dd_Smed_v4_1296_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30032985ras-related protein Rab-7L1SMESG000038328.1 SMESG000038167.1 dd_Smed_v4_2915_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED3002604960S ribosomal protein L35aSMESG000003977.1 dd_Smed_v4_318_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30033015SMED30033015SMESG000049533.1 dd_Smed_v4_2058_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30029173SMED30029173SMESG000016265.1 dd_Smed_v4_8681_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30022453AquaporinSMESG000023352.1 dd_Smed_v4_1224_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30027897COMM domain-containing protein 4SMESG000046681.1 dd_Smed_v4_2501_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30035852Ubiquitin-60S ribosomal protein L40SMESG000035681.1 dd_Smed_v4_176_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30031134slc13a-3SMESG000050959.1 dd_Smed_v4_1171_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30031912SMED30031912SMESG000003404.1 dd_Smed_v4_2094_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30035143PiggyBac transposable element-derived protein 2SMESG000052698.1 SMESG000027142.1 SMESG000059994.1 dd_Smed_v4_1029_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30032436Adipocyte plasma membrane-associated proteinSMESG000052602.1 dd_Smed_v4_3602_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30030118SMED30030118SMESG000072556.1 dd_Smed_v4_10620_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30029849slc24a-5SMESG000022809.1 dd_Smed_v4_9846_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30029849slc24a-5SMESG000022809.1 dd_Smed_v4_1009_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED3002930240S ribosomal protein S16SMESG000018349.1 SMESG000018333.1 dd_Smed_v4_170_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30004634Mitochondrial processing peptidase beta subunitSMESG000037024.1 dd_Smed_v4_729_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30012358Cytochrome b5SMESG000023205.1 dd_Smed_v4_567_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30014130ATP synthase subunit fSMESG000067649.1 SMESG000060121.1 dd_Smed_v4_776_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30008744Cyclin-KSMESG000004055.1 dd_Smed_v4_2558_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30014187Transmembrane protein 144SMESG000029046.1 dd_Smed_v4_4971_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30005751Ras-related protein Rab-6ASMESG000032326.1 dd_Smed_v4_2879_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30028416N-acetyltransferaseSMESG000078126.1 dd_Smed_v4_11109_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30021774NADH dehydrogenase ubiquinone 1 beta subcomplex subunit 6SMESG000026865.1 dd_Smed_v4_1994_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30024973SMED30024973SMESG000048287.1 dd_Smed_v4_4582_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30023880MFS domain-containing proteinSMESG000069681.1 dd_Smed_v4_4634_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30025610Repressor of the inhibitor of the protein kinaseSMESG000079624.1 dd_Smed_v4_6771_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30025610Repressor of the inhibitor of the protein kinase dd_Smed_v4_1325_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30030077Growth hormone-inducible transmembrane proteinSMESG000029240.1 dd_Smed_v4_754_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30030057GLOBIN domain-containing proteinSMESG000048632.1 SMESG000022262.1 dd_Smed_v4_2237_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30033529Amine oxidaseSMESG000029404.1 dd_Smed_v4_6606_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30023239Acyl-CoA dehydrogenase very long chainSMESG000052369.1 dd_Smed_v4_2663_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30035460Ubiquitin-conjugating enzyme E2 D2SMESG000064169.1 dd_Smed_v4_153_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30031645General transcription factor II-I repeat domain-containing 2A-like proteinSMESG000062458.1 dd_Smed_v4_5420_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30029100ras-related protein Rab-32SMESG000060721.1 dd_Smed_v4_6128_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30024661SMED30024661SMESG000060548.1 dd_Smed_v4_8385_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30028526SMED30028526SMESG000027404.1 dd_Smed_v4_11845_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30021516MICOS complex subunit MIC60SMESG000066687.1 dd_Smed_v4_1605_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30027608SMED30027608SMESG000023253.1 dd_Smed_v4_1757_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30026420Leucyl aminopeptidaseSMESG000037609.1 dd_Smed_v4_2903_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30026411Ectonucleotide pyrophosphatase/phosphodiesterase family member 5SMESG000023047.1 dd_Smed_v4_973_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30030914Ubiquitin-60S ribosomal protein L40SMESG000066693.1 dd_Smed_v4_325_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30022511SMED30022511SMESG000019851.1 SMESG000019820.1 dd_Smed_v4_1094_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30031888La ribonucleoprotein domain family member 1BSMESG000004135.1 dd_Smed_v4_2617_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30022614T-complex protein 1 subunit alphaSMESG000067696.1 dd_Smed_v4_1025_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30021295SMED30021295SMESG000010069.1 dd_Smed_v4_4414_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30028664two pore calcium channel protein 1SMESG000045181.1 SMESG000045178.1 SMESG000045168.1 dd_Smed_v4_8333_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30030149ATP-dependent zinc metalloprotease FtsHSMESG000077945.1 SMESG000077944.1 dd_Smed_v4_3475_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30029770ATP-binding cassette sub-family F member 2SMESG000071613.1 dd_Smed_v4_434_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30021920Potassium channel subfamily K memberSMESG000074840.1 dd_Smed_v4_9028_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30024473hydroxyacyl dehydrogenase bSMESG000070850.1 dd_Smed_v4_1593_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30027941SMED30027941SMESG000011835.1 dd_Smed_v4_3825_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30025294rRNA 2'-O-methyltransferase fibrillarinSMESG000051648.1 dd_Smed_v4_2811_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30023478Ubiquitin carboxyl-terminal hydrolaseSMESG000039981.1 dd_Smed_v4_9523_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30020124Ribosome biogenesis regulatory proteinSMESG000071880.1 dd_Smed_v4_2458_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30021116SMED30021116SMESG000060548.1 dd_Smed_v4_8385_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30020504Serine/threonine-protein phosphataseSMESG000060548.1 dd_Smed_v4_8385_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30035307Forkhead box C1SMESG000015673.1 dd_Smed_v4_16297_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30025800ras-related protein Rab-24SMESG000031513.1 dd_Smed_v4_2486_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30024637SMED30024637SMESG000000222.1 dd_Smed_v4_3200_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30025865Saccharopine dehydrogenase oxidoreductaseSMESG000028481.1 dd_Smed_v4_3019_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30023155Thyroid adenoma-associated-like proteinSMESG000023235.1 dd_Smed_v4_12325_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30029899slc25a-30SMESG000044697.1 SMESG000022161.1 dd_Smed_v4_50_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30027540Cathepsin FSMESG000005279.1 dd_Smed_v4_456_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30022719Protein kinase domain-containing proteinSMESG000032703.1 dd_Smed_v4_7746_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30007442SMED30007442SMESG000069832.1 dd_Smed_v4_5530_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30005665SMED30005665SMESG000074689.1 dd_Smed_v4_2429_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30014900Dimer_Tnp_hAT domain-containing proteinSMESG000051489.1 dd_Smed_v4_9709_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30007007Protein kinase domain-containing proteinSMESG000023685.1 dd_Smed_v4_4373_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30007394Phosphatidylinositol 4-kinase type 2SMESG000035623.1 dd_Smed_v4_9125_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED3001198260S ribosomal protein L17SMESG000009564.1 dd_Smed_v4_95_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30004147CarboxypeptidaseSMESG000029164.1 dd_Smed_v4_785_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30008163Usp domain-containing proteinSMESG000039918.1 dd_Smed_v4_2433_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30015939IQ motif containing GSMESG000055124.1 dd_Smed_v4_9650_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30006161slc24a-4SMESG000036251.1 dd_Smed_v4_9736_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30015243Kinase-like proteinSMESG000053627.1 dd_Smed_v4_3194_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30011830EH domain-containing protein 1SMESG000006379.1 dd_Smed_v4_3205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30004783DnaJ heat shock protein family (Hsp40) member C13SMESG000061705.1 dd_Smed_v4_2579_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30010816SH3 and multiple ankyrin repeat domains protein 3SMESG000018129.1 dd_Smed_v4_4371_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30014769SMED30014769SMESG000032777.1 dd_Smed_v4_725_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30008126N-acetylneuraminate lyaseSMESG000023444.1 dd_Smed_v4_2981_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30005770Cell number regulator 7SMESG000060415.1 dd_Smed_v4_743_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30007858netrin receptor-like proteinSMESG000042475.1 dd_Smed_v4_11409_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30008506SMED30008506SMESG000037104.1 SMESG000037103.1 dd_Smed_v4_407_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30008623Phospholipase B-likeSMESG000022762.1 dd_Smed_v4_485_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30008388slc1a-4SMESG000064122.1 dd_Smed_v4_11206_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30019729Bestrophin homologSMESG000080433.1 SMESG000010902.1 dd_Smed_v4_8882_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30019729Bestrophin homologSMESG000070057.1 dd_Smed_v4_8073_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30016830slc39a-5SMESG000015061.1 dd_Smed_v4_11586_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30002486slc31a-1SMESG000005775.1 dd_Smed_v4_1513_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30001962Protein kinase domain-containing proteinSMESG000017252.1 SMESG000017249.1 SMESG000017248.1 dd_Smed_v4_311_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30001962Protein kinase domain-containing proteinSMESG000017248.1 dd_Smed_v4_787_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30009861slc26a-3SMESG000064565.1 dd_Smed_v4_11142_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30009444CubilinSMESG000058235.1 dd_Smed_v4_11447_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30001501Vacuolar protein sorting-associated protein 13A/CSMESG000037244.1 dd_Smed_v4_1648_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30018812protein kinase C-binding protein NELL1-likeSMESG000066109.1 dd_Smed_v4_11653_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30005717BAR domain-containing proteinSMESG000000639.1 dd_Smed_v4_1387_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30006388Peptidyl-prolyl cis-trans isomeraseSMESG000006567.1 dd_Smed_v4_1508_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30016551SMED30016551SMESG000020889.1 SMESG000020887.1 SMESG000020886.1 dd_Smed_v4_324_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED3000665560S ribosomal protein L32SMESG000060036.1 dd_Smed_v4_149_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30004721SMED30004721SMESG000046687.1 dd_Smed_v4_1325_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30010203C2H2-type domain-containing proteinSMESG000067728.1 dd_Smed_v4_1455_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30001852CD109 antigenSMESG000016163.1 dd_Smed_v4_3070_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30020414SMED30020414SMESG000017203.1 dd_Smed_v4_391_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30035609Cathepsin L2SMESG000014167.1 SMESG000014166.1 dd_Smed_v4_267_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30031265Scavenger receptor class B member 1SMESG000058914.1 dd_Smed_v4_2951_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30020153SMED30020153SMESG000025120.1 dd_Smed_v4_5510_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30031407Coiled-coil-helix-coiled-coil-helix domain-containing protein 10 mitochondrialSMESG000003969.1 dd_Smed_v4_225_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30032157SMED30032157SMESG000032745.1 dd_Smed_v4_2208_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30035597SMED30035597SMESG000029469.1 dd_Smed_v4_1765_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30026337AnkyrinSMESG000019783.1 SMESG000019789.1 dd_Smed_v4_4438_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30027506Ubiquitin-like domain-containing proteinSMESG000066583.1 dd_Smed_v4_14332_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30035725Betaine--homocysteine S-methyltransferase 1SMESG000019342.1 dd_Smed_v4_873_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30029709Rab GDP dissociation inhibitorSMESG000034594.1 dd_Smed_v4_476_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30022057SJCHGC08494 proteinSMESG000027083.1 dd_Smed_v4_2196_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30030726Vacuolar protein sorting-associated protein 35SMESG000064165.1 dd_Smed_v4_2652_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30003698ANK_REP_REGION domain-containing proteinSMESG000068909.1 dd_Smed_v4_3689_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30014479SMED30014479SMESG000036948.1 dd_Smed_v4_4111_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30015218Microsomal triglyceride transfer protein large subunitSMESG000053503.1 SMESG000045597.1 dd_Smed_v4_5671_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30006092SMED30006092SMESG000020731.1 SMESG000020729.1 dd_Smed_v4_11220_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30013425NADH dehydrogenase ubiquinone 1 betaSMESG000011219.1 dd_Smed_v4_2640_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30009673SMED30009673SMESG000040843.1 dd_Smed_v4_5502_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30004640Hydroxysteroid dehydrogenase-like protein 2SMESG000049117.1 dd_Smed_v4_956_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30005444NicalinSMESG000032750.1 dd_Smed_v4_1389_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30017845Alpha-2-macroglobulinSMESG000037145.1 SMESG000037203.1 SMESG000037155.1 SMESG000037154.1 SMESG000037147.1 SMESG000037146.1 dd_Smed_v4_568_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30002811Acid sphingomyelinase-like phosphodiesteraseSMESG000024647.1 dd_Smed_v4_8403_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30009252bcl2-3SMESG000011963.1 dd_Smed_v4_2886_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED3001361360S ribosomal protein L26SMESG000066644.1 dd_Smed_v4_235_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30015956Metallophos domain-containing proteinSMESG000024647.1 dd_Smed_v4_8403_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30013319Long-chain-fatty-acid--CoA ligase ACSBG2SMESG000027204.1 dd_Smed_v4_1026_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30003316SMED30003316SMESG000075349.1 dd_Smed_v4_3126_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30004177SMED30004177SMESG000077853.1 dd_Smed_v4_5429_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30007667SMED30007667SMESG000010564.1 dd_Smed_v4_7137_0_2dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30004871Mitogen-activated protein kinaseSMESG000023035.1 SMESG000023025.1 dd_Smed_v4_10933_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30014235Myeloid differentiation primary response protein MyD88SMESG000051766.1 SMESG000051767.1 dd_Smed_v4_4532_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30007674G patch domain-containing protein 4SMESG000035189.1 dd_Smed_v4_1355_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30007550SMED30007550SMESG000031950.1 dd_Smed_v4_10910_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED3000102660S ribosomal protein L7SMESG000076604.1 dd_Smed_v4_1121_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30017015Deferrochelatase/peroxidase YfeXSMESG000077723.1 dd_Smed_v4_2999_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30003672Mitochondrial import inner membrane translocase subunit TIM17SMESG000027783.1 SMESG000027888.1 dd_Smed_v4_904_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30014469DUF862 domain-containing proteinSMESG000007684.1 dd_Smed_v4_1938_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30006834MAP/microtubule affinity-regulating kinase 3SMESG000052500.1 dd_Smed_v4_4580_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30014008MBOAT2SMESG000066852.1 dd_Smed_v4_3131_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30004082NIPSNAP domain-containing proteinSMESG000043687.1 dd_Smed_v4_2078_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30007287Nucleolar GTP-binding protein 1SMESG000074998.1 dd_Smed_v4_764_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30004081SMED30004081SMESG000040291.1 dd_Smed_v4_1144_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30000419bok-1SMESG000021216.1 dd_Smed_v4_18390_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30008607Calcium and integrin-binding family member 2SMESG000065551.1 dd_Smed_v4_7205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30010240Hsp70-Hsp90 organizing 2SMESG000024446.1 dd_Smed_v4_12016_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30000289SMED30000289SMESG000076644.1 SMESG000076643.1 dd_Smed_v4_227_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED3001990360S ribosomal protein L13aSMESG000041483.1 dd_Smed_v4_287_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30000284Electron transfer flavoprotein subunit betaSMESG000025689.1 dd_Smed_v4_1315_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30005161Failed axon connections homologSMESG000039746.1 dd_Smed_v4_1736_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30013304Enoyl-CoA delta isomerase 2SMESG000070742.1 SMESG000046541.1 SMESG000020638.1 dd_Smed_v4_5239_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30006391SMED30006391SMESG000026399.1 dd_Smed_v4_110_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30004666ATP-dependent zinc metalloprotease FtsHSMESG000006323.1 dd_Smed_v4_1250_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30008633SMED30008633SMESG000057402.1 dd_Smed_v4_2671_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30017236RING-type domain-containing proteinSMESG000014399.1 dd_Smed_v4_10917_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30034864group XV phospholipase A2-likeSMESG000010287.1 dd_Smed_v4_3592_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30022501Fatty acid-binding protein, heartSMESG000029500.1 dd_Smed_v4_599_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30025839Leukotriene A(4) hydrolaseSMESG000053576.1 SMESG000049276.1 dd_Smed_v4_733_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30027303Methylcrotonoyl-CoA carboxylase 2 (beta)SMESG000035087.1 dd_Smed_v4_5574_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED3002165739S ribosomal protein L23SMESG000037729.1 SMESG000037731.1 dd_Smed_v4_2551_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30033402Nascent polypeptide-associated complex subunit betaSMESG000026176.1 dd_Smed_v4_358_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30034418SMED30034418SMESG000015187.1 dd_Smed_v4_5922_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30021906SMED30021906SMESG000038869.1 dd_Smed_v4_1046_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30034179SMED30034179SMESG000049924.1 dd_Smed_v4_736_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED3002552260 kDa heat shock protein, mitochondrialSMESG000065325.1 dd_Smed_v4_141_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30020538Ss-alanyl conjugating enzymeSMESG000023215.1 dd_Smed_v4_17289_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30032348SMED30032348SMESG000071220.1 dd_Smed_v4_6653_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30030281BHLH domain-containing proteinSMESG000019783.1 SMESG000019789.1 dd_Smed_v4_4438_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30032573Group XV phospholipase A2SMESG000037734.1 dd_Smed_v4_8328_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30033121Phosphatidylinositol 3,4,5-trisphosphate 3-phosphatase TPTE2SMESG000060206.1 dd_Smed_v4_4925_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30022154ras-related protein Rab-43-likeSMESG000051108.1 dd_Smed_v4_2494_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30021960AminopeptidaseSMESG000067986.1 dd_Smed_v4_2224_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30027550tRNA (adenine(58)-N(1))-methyltransferase non-catalytic subunit TRM6SMESG000072786.1 dd_Smed_v4_3327_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30035459Pyridoxal phosphate homeostasis proteinSMESG000050381.1 dd_Smed_v4_3558_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30024985Translin-associated factor X-interacting protein 1SMESG000051766.1 SMESG000051767.1 dd_Smed_v4_4532_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30025105Plastin 3SMESG000081126.1 SMESG000081113.1 dd_Smed_v4_749_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30035267Alkylglycerol monooxygenaseSMESG000043173.1 dd_Smed_v4_3673_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30023981SMED30023981SMESG000026344.1 SMESG000026343.1 dd_Smed_v4_5515_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30027223SMED30027223SMESG000066359.1 SMESG000066357.1 SMESG000066355.1 dd_Smed_v4_31_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30026812SMED30026812SMESG000055072.1 dd_Smed_v4_4091_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30034659GCR158SMESG000077660.1 dd_Smed_v4_6018_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED300226652-acylglycerol O-acyltransferase 2SMESG000021419.1 dd_Smed_v4_4947_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30032019Moesin/ezrin/radixin homolog 1SMESG000068090.1 dd_Smed_v4_8101_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30027243Lysyl oxidaseSMESG000004065.1 SMESG000004062.1 dd_Smed_v4_7096_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30029882TNF receptor associated factor-2SMESG000014624.1 dd_Smed_v4_5715_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30022984SMED30022984SMESG000016701.1 dd_Smed_v4_10170_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30033389SMED30033389SMESG000079563.1 SMESG000052448.1 dd_Smed_v4_3113_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30029103Glutamine synthetaseSMESG000000228.1 SMESG000000227.1 SMESG000000225.1 SMESG000000212.1 dd_Smed_v4_896_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30025547Ganglioside-induced differentiation-associated-protein 2SMESG000047156.1 SMESG000047127.1 SMESG000037456.1 SMESG000037449.1 dd_Smed_v4_8031_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30021977Beta-1,3-galactosyltransferase 1SMESG000035184.1 dd_Smed_v4_11741_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30034560TNF receptor-associated factorSMESG000020135.1 dd_Smed_v4_974_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30024309Isocitrate dehydrogenase [NADP]SMESG000049154.1 dd_Smed_v4_449_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30028902DNA-directed RNA polymeraseSMESG000026344.1 SMESG000026343.1 dd_Smed_v4_5515_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30030766Y box protein-1SMESG000058066.1 dd_Smed_v4_52_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30030386SMED30030386SMESG000026344.1 SMESG000026343.1 dd_Smed_v4_5515_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gutSMED30032885Echinoderm microtubule-associated protein-like 4SMESG000021391.1 dd_Smed_v4_958_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
gut