nervous system

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ Description

  ▻ Figures

  ▻ In Situ Hybridization Data

  ▻ Sequences

  ▻ References

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  nervous system


DEFINITON:

  The nervous system is an organ system containing predominantly neuron and glial cells. In bilaterally symmetrical organisms, it is arranged in a network of tree-like structures connected to a central body. The main functions of the nervous system are to regulate and control body functions, and to receive sensory input, process this information, and generate behavior [CUMBO].


TERM DEFINITION CITATIONS:

  UBERON:0001016


TERM CITATIONS:


TERM ID:

  PLANA:0000025


ABOUT THIS TERM:

nervous system

  ↳is a anatomical system

  ↳part of sexual organism


  → neural progenitor cell develops into nervous system


  → central nervous system and peripheral nervous system is a nervous system


Expand to see terms that part of nervous system


BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


DESCRIPTION:   

WISH developmental time course data for two markers expressed in differentiated neurons, synaptotagmin and PC-2, suggests that the nervous system is limited to neurons in the temporary embryonic pharynx of S2-S5 embryos (Figure 1 – figure supplement 16 D, Figure 1 – figure supplement 12 A). Validated and presumptive neural progenitor markers showing low to undetectable expression during early embryogenesis are upregulated as organogenesis commences during S5 (Figure 1 – figure supplement 16 A) (Cowles et al., 2013; Currie and Pearson, 2013; Lapan and Reddien, 2012; März et al., 2013; Monjo and Romero, 2015; Scimone et al., 2014; Wenemoser et al., 2012), and many transcripts exhibiting enriched expression in adult neurons show upregulated expression during and after S5 (Figure 1 – figure supplement 16 C). During S6 and S7, neural progenitors and their descendants must migrate, interact, and organize themselves into two bilaterally symmetric cephalic ganglia and the attendant ventral nerve cords, commissural and peripheral neurons (Figure 1 – figure supplement 16 D). Differentiating neurons accumulate in the presumptive anterior region of the embryo, adjacent to the D/V margin, as the cephalic ganglia form (Figure 1 – figure supplement 16 B,D, cyan arrows). Ventral nerve cord formation is evident during S6, and appears to proceed from anterior to posterior (Figure 1 – figure supplement 16 D, cyan arrowheads). Gross morphology of the nervous system is comparable to that of adult animals during S7-S8 (Figure 1 – figure supplement 16 B,D).


 

back to top


FIGURES:


Figure 1 – figure supplement 16: Molecular markers for the developing nervous system

A, C: Average RPKM values per embryo for validated and putative adult neural progenitor transcripts (Cowles et al., 2013; Currie and Pearson, 2013; Lapan and Reddien, 2012; März et al., 2013; Monjo and Romero, 2015; Scimone et al., 2014; Wenemoser et al., 2012) (A) and adult neural classifier transcripts identified in single cell sequencing experiments (Wurtzel et al., 2015) (C), Y (yolk), Stage (S) S2-S8.  Neural transcripts that showed enriched expression during S5, S6, S7 and/or S8 are flagged in excel tables for S5-S8 enriched transcripts (Figure 1 – source data 5, Figure 1 – source data 6, Figure 1 – source data 7, Figure 1 – source data 8). 90% (n=533) of the neural enriched transcripts reported in (Wurtzel et al., 2015) were identified in the smed20140614 transcriptome; 60% (n=323) of the cross-referenced transcripts were enriched during S5, S6, S7 and/or S8. 

B, D: Expression of the neural progenitor marker pax6a (B) and the neural marker synaptotagmin (syt, D) (blue), S2-S8. Anterior: top (S6-S8). O: oral hemisphere. A: aboral hemisphere. D: dorsal. V: ventral. Black arrowheads: temporary embryonic pharynx.  Red arrowheads: definitive pharynx. Cyan arrows: cephalic ganglia. Cyan arrowheads: ventral nerve cords. Scale bars: 100 µm.

 

 

back to top


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30024586AFJ24746.1Pax6Apax6AStage 5, Stage 6, Stage 7, Stage 8nervous system, neural progenitor cell
SMED30022907SynaptotagminDj-sytStage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, ventral nerve cord, neuron, cephalic ganglia, nervous system, embryonic pharynx
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30019471 ID=SMED30019471|Name=Synaptotagmin|organism=Schmidtea mediterranea sexual|type=transcript|length=1910bp
TTTGGGACTTCTCCAATCTATTAAATATATTTAGAACGAACATCGTTGTGAGAAGCTTTGTCTTGCAAATGCACACCAAC
ACATTCTCTGCCTACTCGAGACCAGCCTGAAGGACGCACCCAGTCATCTCTTATAAAAAAAAAACTCTTCTCTGATTCGG
TATTTTCTGATTAATGGAGATCAAACAATGATTGGGCAACGTCTAGTTTAGAATATTTACAACTAAATCTGCGTATTTCA
ATTTTTTTTCGATTTTGATTGTTGCAAATATTTATGAGTATATCCAATAATATAAGCAGCGCTAGTAATATGACGATAAA
AATGCAACAAAATGTTGAAAAGTCTGTATCACAGCATGTAACAGCGCAAACAAAGGAATCAACATCAAATAAACTTCATA
CAACAACAGCCGGTATCTCGGTTTTGGAGAAAACATTAAAAACATTTCACATGAGTACTGGCACTTTGATTGGAATCGGA
GTTACAGTGTCTATCGTAGTTTTATTACTTCTTTATTGTATTTGCAAACGATGCATTAAGAAACGAAAGAAAAAGAAAGA
TGGCGGCAAAAAAGGTGGAAAAGGCGTAGACATGAAAAGCGTACAACTATTAGGAAATGCTTATAAAGAAAAGGTACAGC
CGGACCTAGAAGAACTGGATGCTAACATGGAAGATAATGAAGGGGCGCAAGATAAAGAAGCAGTCAATCTTGGAAAATTA
CAGTATTCCCTTGATTACGATTTTACAAAAGGCGAGCTAACAGTCGGAGTAATTCAAGCCACAGATCTCCCAGCAATGGA
CATGTCAGGAACTTCTGATCCATATGTGAAAGTTTTTCTATTACCGGATAAAAAGAAAAAATTCGAAACCAAAGTTCATC
GAAAAATATTAAATCCAGTCTTTAATGAGACATTTGTATTCAAGATTCCTTATTCTGAGGTCGGGTCTAAAACTTTGGTA
TTTAATGTTTTCGATTTCGACAGATTTTCAAAGCATGATCAAATTGGGCAAATCCAAATTCCACTGGGTTCAGTAGATTT
ATGCAAAGTTATTGAGGAATGGAAGGAACTCGGCCCACCTGACAGTGATAATGAAAAGGAAAATCGATTAGGAGACATTT
GTTTTTCTTTGAGATATGTTCCAACGTCTGGAAAGTTGAATATCGTCATTCTGGAAGCTAAAAACCTCAAGAAAATGGAT
GTTGGAGGATTGTCGGATCCTTACGTGAAACTATCGTTGATGCTTAACGGCAAACGAGTGAAAAAGAAGAAAACCACAAT
AAAAAAATACACATTAAATCCTTATTATAATGAGTCATTTTCATTCGAAGTTCCATTCGAGCAAATACAAAAAGTTAATT
TAATAGTGACAGTAGTTGATTATGATAGAATTGGAACAAGTGAACCTATTGGAAGAGTAGTTCTTGGATGCAATGCTACA
GGAGCAGAACTTCGGCACTGGTCCGATATGCTTGCTAATCCTAGGAGACCAATTGCCCAGTGGCATACCCTTCAAGATAT
GCCGGAGAAGAGCTGATTTCATTGATTTTAATTTTAAAATCTGTCATATTTTGTGATAAATTTTGCGTATTTATACAATC
ATTCGATTCGATCTTTCCATCAAGTTTCGTAAAATCTGCAGACATTCACGAGGATGCAGAAGAAATAGAAACTTTGTAAT
AAATTAGCATTAGCTGTGATCTCCTATTGACCAAAAAACATAAACTTAATTTTTATAAAGAATTGTGGTGAAATGTTGTT
AGGTTTCAGTCATAGATAACTGTATTTGTGTAATAGTTTGTGTATTTCTCGTCCTGGCCCGATTTTGTGCATTCCACTGG
CAATACTATTTCACTAATAAATTATGTCTGATAATGTATACCAGTATAGGATTTTGTTTGAATTAATGAA
>SMED30022907 ID=SMED30022907|Name=Synaptotagmin|organism=Schmidtea mediterranea sexual|type=transcript|length=1814bp
ATTTATTGAAAATTATTTTTTCTATTATTAGGAGAAAATTGATTATTTTTTTTTGACAAAATAAGTTTTGGATATATTTC
CCATTTGTTTGTATTCGTAAACCAATGAAGAATTCGACTCACGGATCGGATCATTCGGCCAGCAAGGCCAGTATGAAAAC
GAATGTGGAAAAATTTTGGCATGATCTCGGAAAAAAATTGCACATGGATCCAAAAGCATTAATAGGAGTAACAATCGGTT
TGGGAATATTGTTTTTGTTGTTCCTTTATTGCTTATGTAAAAAATGTGTTTTCAAGCGTCGAAAAAAGAAGGAAACGGCC
AAAAAAGGAGCCAAGGGAGTAGTCGATATGAAAAGTGCCCAATTGTTGGGGAATTCATATAAAGAAAAAATTCAACCCGA
TCTTGAAGAACTTGATGCAAACATGGAAGACAATGAAGGTGTAAAAGAAAAAGAAGATGTTCATTTAGGAAAATTACAAT
ATTCTCTAGATTATGATTTTCAGAAAGGAGAATTAACTGTTGGAGTTATTCAAGCAACTGATCTTCCAGCTATGGATATG
TCAGGAACATCAGATCCATATGTCAAATTATACCTTCTCCCAGACAAGAAAAAGAAATTCGAAACAAAGGTTCATAGGAA
AATTTTAAATCCTGTATTCAATGAAACTTTTGTTTTCAAAGTTCCTTTCAATGAAGTTGCATCGAAGACTTTGATTTTCA
ACGTTTATGACTTTGACAGATTTTCCAAACACGATCAAATCGGTCAAATAAAAGTACCATTGGGAGCTATAGATTTAGGT
CGAGTTATTGAAGAATGGAAGGAACTGGAATCTCCAGAAAACGATGGGGAAAAGGAAAACAGGTTGGGAGACATTTGTTT
CTCTTTAAGATACGTACCGACATCTGGAAAGCTTACAATAGTCATTTTGGAAGCAAAGAATCTTAAAAAAATGGATGTCG
GAGGATTGTCTGATCCATATGTTAAACTTTCCTTGATGCTTAATGGTAAACGAGTGAAGAAGAAGAAAACTACCATCAAA
AAGTATACACTAAATCCTTACTACAATGAATCATTTTCCTTTGAAGTACCATTCGAACAAATACAAAAAGTGAACTTGAT
CGTCACGGTTGTTGATTATGACAGAATCGGAACCAGCGAACCGATAGGTAGAATTGTTCTGGGATGTAACGCAACTGGAG
CAGAATTGCGACATTGGTCGGATATGTTGGCAAATCCCCGGCGACCAATCGCCCAGTGGCATACCCTCCAAGAGATGCCA
GAGAACAATTGATAGTGTTCGTTTGATGCTTTAAAGCGGTTTGCATAATTCGTGAAATAAGTTATCAAAATTTGAGAAAT
GTTTTTTTTTCTGAAACAAAAATGGCATGAGACAATATACCAGAGTTCATTAGTGTGTGGTTTCGTTGAATATTTTGGTG
GTGTTGCATCTTATCGTTTGTCCTCTAATCTAATAATGTTTTATTCTTTATATAGCTGATTTATTCTCGAGCGAAACATT
TTTTATGTGTACCAAAATACTTATGTCATAGCCATTGTGATTAGTCTGTAAACTATTGCGTAATAGCCCCTCTCATTGGC
TTTTTTTAAGAGTAGTGAGTTGGAAAAAAAAATACAAAAATGACTTCAATTGTTAAACATTACTCATATTTTATCAGTAA
GTTAACTTGCATATTTGCAGTTAATTATGGCATTTTATCTCTAAATCTCTGAAGCATGGCCTCAAGTCTTTTGTTTGTTT
TAATGTAATTATGTCTAGATGAGAATATTAAAATACTTCGGTTTATATAAAAGA
>SMED30024586 ID=SMED30024586|Name=Pax6A|organism=Schmidtea mediterranea sexual|type=transcript|length=1992bp
GTTGGTTTTTCTAACAGATTTATTAATGCTAGATTGGCCGCTCAAGATTAATCATAATATTCTGCTACTTTACTGATATA
ATTTTTATACACGGTTACTACTACTCCTCTACTATTTTCGCATTGTTGGCTTCTCAAATTCAATCCCTGGGCATAAATCA
AACCGCTTCATTGACAAAATCCTTTTTGACACTACAAGAAATTGATTCAGTTACTGAAGTAGAAAATATACACAGTCGAA
ACCTATGACCGAATCGAATGAAGAGGAAATAAAAAATAAAAAGAAAGTTAAACGAGGACATTCAGGAATCAATCAATTAG
GTGGAATGTTTGTCAACGGTCGACCTTTGCCCGATTCGACCCGACAGAGAATCGTTGAGTTGGCTCACTCCGGAGCGAGA
CCATGTGATATTTCCCGAATCCTCCAAGTTTCCAATGGATGCGTCAGTAAAATCCTATGCAGATACTACGAAACCGGTTC
AATTCGACCGAAAGCCATCGGAGGCAGCAAACCAAGAGTAGCTACCAGTTCAGTTGTGTCGAAAATTGCCGCCTACAAAC
GTGAATGCCCGTCGATATTTTCTTGGGAAATTCGCGATAGATTATTACAGGAAGGGGTTTGCAATCAGGATAACATTCCC
AGTGTCTCTTCGATAAATCGTGTTCTACGCAGTTTGTCTAATGAAAACCAACGACATTTAGTTGCAGCAACTGGAATGTA
TGACAAACTGTCATTGTTAAGCGGCCAGCCTTGGTCTACTGCAGCTGCTCATGCGGCTTGGTATTCCAGTGCTGCAGCAG
CACATGGGTATGCTTCATCGACATTTCCCAATTGTGGTGCCTATGGAGGCTTAACCGGAATCGGAATTATCAATGGAATG
AGTACAGCCCACGCGGTAGCGTCAATTAATCAGTCGAATTCCGGGGTCACAAATTACCATGTTCAATCAACAACCGATAG
TTCCGACAAACACAAATCAGAAAAATATTCAGAATCCATTGCACATTCTGAATCGAATGCTTCCAGTGAGCCTGGCAACG
AATATATGTCCGGAGTAAAAAGTGAGAATGATGATATGAGAATTAAACTGAAAAGGAAACTTCAAAGAAATCGAACATCG
TTTTCAACAGATCAGCTTGATTCTTTGGAAAAAGAATTTGAACGAACTCATTATCCTGATGTATTCGCCAGAGAGAAATT
GGCAGACAAAATCAGTCTTCCAGAGGCGAGAATACAAGTTTGGTTTTCAAATCGAAGAGCAAAATGGAGACGAGAAGAAA
AACTTCGTCGACAACGGCAAAATCTTATGCTTGGTTCAAACGGAACAAGTTCTACTGCTGATACTAATGTAACAACAAAT
GGAAATACTCAATGTTTGTCGACAACCGGACAAAATTCAATGGGATTTTCTGGAATAAATGATATCAGAAACCAATTTGG
TGATGTTGGAATGCAAACACCTTCATTGTCGGCTGTAGCAGCTGCAGGAATGTACCATTCGGCAGTTGCCTCTGCTGCAG
ATCAGTATGCAAAATCAGCCGGTTTACCAAATCTTTCGCAATCGTCAATCAATTCTCCATATTCCTACATGGCAAATTTG
CAGTCGAGATCCAGTGGTTCCCAAATTGACTTGCCAAACGTTACAAGCAATTCAAATTCTTTTTACAACCCCGGATCAGT
TTATCCCCCAAGTTTATTTCAAGGTGTAATGAGAGGATATGACACCATTGGATATCCCAAGTATCCTTCAGCAATGTTTC
CAGGATCACTCGAAAGTAATAATAATATCAACCCTGCCGGTTTTCTTGCAAATAATATGTCTTCGAATTCATCTAAACCC
GATTACGATTTCTCAGCATTTAATCGGCCCAGCAATTATTGGACTCCGGTCGCATAAAATTGCACAAATGAATGAAAACA
ATTTCAAAAATTCCGAAACAACAATGATTAGAACAAAAAAAACATTTTTCTAAAATAGTTGTTAATTTAAAC

 

back to top


ADDITIONAL REFERENCES:


Cowles, M.W., Brown, D.D., Nisperos, S.V., Stanley, B.N., Pearson, B.J., and Zayas, R.M. (2013). Genome-wide analysis of the bHLH gene family in planarians identifies factors required for adult neurogenesis and neuronal regeneration. Development 140, 4691-4702.

Currie, K.W., and Pearson, B.J. (2013). Transcription factors lhx1/5-1 and pitx are required for the maintenance and regeneration of serotonergic neurons in planarians. Development 140, 3577-3588.

Lapan, S.W., and Reddien, P.W. (2012). Transcriptome analysis of the planarian eye identifies ovo as a specific regulator of eye regeneration. Cell Rep 2, 294-307. 

März, M., Seebeck, F., and Bartscherer, K. (2013). A Pitx transcription factor controls the establishment and maintenance of the serotonergic lineage in planarians. Development 140, 4499-4509. 

Monjo, F., and Romero, R. (2015). Embryonic development of the nervous system in the planarian Schmidtea polychroa. Dev Biol 397, 305-319.

Scimone, M.L., Kravarik, K.M., Lapan, S.W., and Reddien, P.W. (2014). Neoblast specialization in regeneration of the planarian Schmidtea mediterranea. Stem Cell Reports 3, 339-352.

Wenemoser, D., Lapan, S.W., Wilkinson, A.W., Bell, G.W., and Reddien, P.W. (2012). A molecular wound response program associated with regeneration initiation in planarians. Genes Dev 26, 988-1002.

 

back to top



PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in nervous system. Click this link to learn more about PAGE.


PAGE Curations: 6305


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
nervous systemSMED30000041Transcription factor tau subunit sfc6 isoform 1SMESG000063031.1 dd_Smed_v4_11007_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001031TRAF3-interacting protein 1SMESG000006345.1 dd_Smed_v4_10562_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002962GC-rich sequence DNA-binding factor 1SMESG000061662.1 dd_Smed_v4_11179_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003885Drebrin-like proteinSMESG000073128.1 dd_Smed_v4_1221_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000421TPR_REGION domain-containing proteinSMESG000071973.1 dd_Smed_v4_11462_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002166SMED30002166SMESG000039065.1 dd_Smed_v4_11656_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002166SMED30002166SMESG000058880.1 SMESG000039065.1 dd_Smed_v4_4225_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30010320Radial spoke head 10-like protein B2SMESG000039156.1 SMESG000039153.1 dd_Smed_v4_12762_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002847Degenerin unc-8SMESG000017678.1 dd_Smed_v4_16557_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003886inositol phosphoceramide mannosyltransferase 2-likeSMESG000020169.1 dd_Smed_v4_11577_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002438SMED30002438SMESG000003366.1 dd_Smed_v4_12927_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002581SMED30002581SMESG000015302.1 dd_Smed_v4_10603_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006257SMED30006257SMESG000016925.1 dd_Smed_v4_12203_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003733c-SKI_SMAD_bind domain-containing proteinSMESG000067290.1 dd_Smed_v4_10921_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30008052SMED30008052SMESG000075212.1 SMESG000075211.1 SMESG000074910.1 SMESG000074908.1 SMESG000074907.1 dd_Smed_v4_1061_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003140Phospholipid-transporting ATPaseSMESG000003090.1 dd_Smed_v4_10670_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED3000448460S ribosomal protein L8SMESG000017087.1 dd_Smed_v4_108_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005517Receptor type tyrosine protein phosphataseSMESG000041927.1 dd_Smed_v4_10176_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006259DNA repair protein complementing XP-G cells-like proteinSMESG000019370.1 dd_Smed_v4_10808_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30011825RING-type domain-containing proteinSMESG000069649.1 dd_Smed_v4_12211_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30010029T-complex-associated-testis-expressed 1SMESG000023093.1 dd_Smed_v4_12524_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001414UPF0728 protein C10orf53 homologSMESG000073355.1 dd_Smed_v4_10501_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001570Cyclin-dependent kinase 17SMESG000078466.1 SMESG000050786.1 SMESG000050790.1 dd_Smed_v4_11772_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000004ThioredoxinSMESG000039109.1 dd_Smed_v4_12784_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005638Phosphatidylinositol 4 phosphate 5 kinase type 1SMESG000017265.1 dd_Smed_v4_10693_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009733PKD2-1SMESG000005014.1 dd_Smed_v4_12955_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000594Polycomb protein suz12SMESG000054377.1 dd_Smed_v4_12930_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000448Cysteine-rich proteinSMESG000044206.1 dd_Smed_v4_1185_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED300146071-phosphatidylinositol 4,5-bisphosphate phosphodiesteraseSMESG000013964.1 SMESG000013958.1 dd_Smed_v4_10098_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED300146071-phosphatidylinositol 4,5-bisphosphate phosphodiesteraseSMESG000013960.1 dd_Smed_v4_27189_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007518PIH1 domain-containing protein 1SMESG000041927.1 dd_Smed_v4_10176_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30029570GCR304SMESG000016325.1 dd_Smed_v4_10325_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30031490SMED30031490SMESG000017778.1 dd_Smed_v4_10175_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30028591Protein kinaseSMESG000030545.1 dd_Smed_v4_11177_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30031788Jagged-likeSMESG000005484.1 dd_Smed_v4_10221_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30029528Zinc finger proteinSMESG000067419.1 dd_Smed_v4_10260_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30022522Centrin-3SMESG000016538.1 dd_Smed_v4_11582_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30028420Nucleotide-binding oligomerization domain-containing protein 2SMESG000018415.1 dd_Smed_v4_10594_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30034590Post-GPI attachment to proteins factor 2-likeSMESG000044614.1 dd_Smed_v4_10182_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30032689POC1 centriolar protein homolog ASMESG000024482.1 dd_Smed_v4_10806_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30032074ATP binding cassette subfamily A member 1SMESG000056983.1 dd_Smed_v4_10304_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30028668Leucine-rich repeat-containing protein 71SMESG000006778.1 dd_Smed_v4_10715_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30028668Leucine-rich repeat-containing protein 71SMESG000006778.1 dd_Smed_v4_12043_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30025647Ig-like domain-containing proteinSMESG000079961.1 dd_Smed_v4_12974_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30021266Uncoordinated 5SMESG000073898.1 dd_Smed_v4_10585_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30032592Protein ovoSMESG000016051.1 dd_Smed_v4_10673_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30030268Ribosome biogenesis protein WDR12 homologSMESG000035645.1 dd_Smed_v4_10263_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30021279Retinal-binding proteinSMESG000035531.1 dd_Smed_v4_11513_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30024729SMED30024729SMESG000037686.1 SMESG000035410.1 SMESG000013977.1 SMESG000013857.1 dd_Smed_v4_10407_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30032994ATPase, AAA familySMESG000040165.1 SMESG000000068.1 SMESG000000064.1 dd_Smed_v4_10082_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30024150C2H2-type domain-containing proteinSMESG000004456.1 dd_Smed_v4_12617_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30024671SMED30024671SMESG000017034.1 dd_Smed_v4_1516_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30030104SMED30030104SMESG000065276.1 dd_Smed_v4_12282_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30027945Major facilitator superfamily domain containing proteinSMESG000010822.1 dd_Smed_v4_10640_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30030833SMED30030833SMESG000032988.1 dd_Smed_v4_10864_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019985Organic solute carrier partner 1SMESG000013444.1 dd_Smed_v4_12742_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018242Guanine nucleotide binding protein subunitSMESG000068013.1 dd_Smed_v4_10481_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018600Calcitonin family peptide receptorSMESG000066855.1 dd_Smed_v4_13281_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018957Protocadherin-11 X-linkedSMESG000012836.1 dd_Smed_v4_11345_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016919TNF receptor associated factor-2SMESG000024584.1 dd_Smed_v4_10569_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017925Dynein light chain Tctex-type 1SMESG000026631.1 dd_Smed_v4_1166_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014753NACHT domain- and WD repeat-containing protein 1SMESG000074035.1 dd_Smed_v4_11085_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019396LsmAD domain-containing proteinSMESG000036673.1 dd_Smed_v4_11128_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018511von Willebrand factor A domain-containing protein 3BSMESG000009195.1 dd_Smed_v4_10837_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018755Small ubiquitin-related modifierSMESG000018835.1 dd_Smed_v4_1253_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019468protein arginine methyltransferase 1-like proteinSMESG000038790.1 dd_Smed_v4_1302_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016961Dimer_Tnp_hAT domain-containing proteinSMESG000079481.1 SMESG000064306.1 SMESG000055041.1 SMESG000052607.1 SMESG000047756.1 SMESG000036787.1 SMESG000035547.1 SMESG000026972.1 SMESG000026708.1 SMESG000025874.1 SMESG000023292.1 SMESG000007438.1 dd_Smed_v4_17002_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017286Major facilitator superfamily domain-containing 4SMESG000038006.1 dd_Smed_v4_10372_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017073FMRFamide-activated amiloride-sensitive sodium channelSMESG000037525.1 dd_Smed_v4_10522_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018900Intraflagellar transport protein 56SMESG000031670.1 dd_Smed_v4_12618_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002306SMED30002306SMESG000071777.1 SMESG000071776.1 dd_Smed_v4_3404_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015064Cyclin-dependent kinase 11BSMESG000033370.1 dd_Smed_v4_3540_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017997WSC domain-containing proteinSMESG000057220.1 dd_Smed_v4_10762_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015710Glycine receptor subunit alpha-3SMESG000008993.1 dd_Smed_v4_10794_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30004983YTH domain-containing proteinSMESG000018260.1 dd_Smed_v4_3491_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018766Centrosomal protein of 120 kDaSMESG000006990.1 dd_Smed_v4_10444_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019915Potassium voltage-gated channel subfamily A member 2SMESG000013562.1 dd_Smed_v4_15133_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015739Aldo-keto reductaseSMESG000081151.1 dd_Smed_v4_1044_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019632Tumor necrosis factor alpha-induced protein 8-like proteinSMESG000055619.1 dd_Smed_v4_11459_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017337Serine/threonine kinaseSMESG000014619.1 dd_Smed_v4_1212_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018208neurexin-1 isoform X16SMESG000066308.1 dd_Smed_v4_11832_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019223Protein FAM47ESMESG000026097.1 dd_Smed_v4_10346_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007857SMED30007857SMESG000022810.1 dd_Smed_v4_28465_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019485SMED30019485SMESG000075557.1 dd_Smed_v4_10583_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018684TGc domain-containing proteinSMESG000073008.1 dd_Smed_v4_10479_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016927SMED30016927SMESG000079481.1 SMESG000064306.1 SMESG000055041.1 SMESG000052607.1 SMESG000047756.1 SMESG000036787.1 SMESG000035547.1 SMESG000026972.1 SMESG000026708.1 SMESG000025874.1 SMESG000023292.1 SMESG000007438.1 dd_Smed_v4_17002_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30023872Zinc finger MYM-type protein 5SMESG000055398.1 dd_Smed_v4_11239_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30024412Guanine nucleotide-binding protein subunit gammaSMESG000014262.1 dd_Smed_v4_2883_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30031485Lipoxygenase homology domain-containing protein 1SMESG000001054.1 dd_Smed_v4_10315_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30031945UPF0638 protein BSMESG000003269.1 dd_Smed_v4_10707_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30026407Acetylcholine receptor subunit beta-like proteinSMESG000064521.1 dd_Smed_v4_12146_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30026237Coiled-coil and C2 domain containing 2ASMESG000048372.1 dd_Smed_v4_11189_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30026092Elongation factor 1-deltaSMESG000081496.1 dd_Smed_v4_1045_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30032941TNF receptor associated factor 4SMESG000025998.1 SMESG000025982.1 SMESG000025980.1 SMESG000025963.1 SMESG000025934.1 SMESG000025901.1 SMESG000025797.1 SMESG000025794.1 SMESG000025517.1 dd_Smed_v4_1139_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30021167SMED30021167SMESG000035386.1 dd_Smed_v4_10651_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30027713E3 ubiquitin-protein ligase RBBP6SMESG000023195.1 dd_Smed_v4_12318_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30025624E3 ubiquitin-protein ligase LRSAM1SMESG000046440.1 SMESG000027652.1 dd_Smed_v4_10841_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30022604SMED30022604SMESG000076527.1 SMESG000069759.1 SMESG000057276.1 SMESG000045286.1 SMESG000040833.1 SMESG000017867.1 dd_Smed_v4_12301_1_2dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30024195Guanylate cyclaseSMESG000065840.1 SMESG000065837.1 SMESG000011120.1 dd_Smed_v4_12305_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020260SMED30020260SMESG000005697.1 dd_Smed_v4_12813_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30031525Choline O-acetyltransferaseSMESG000051357.1 FG310880ncbi_smed_estsPMID:23318641
Chen et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30027106SMED30027106SMESG000008070.1 SMESG000008069.1 BK007043.1smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult fluorescence in situ hybridization evidence
nervous systemSMED30010096TPA_inf: prohormone convertase 2SMESG000008070.1 SMESG000008069.1 BK007043.1smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult fluorescence in situ hybridization evidence
nervous systemSMED30031525Choline O-acetyltransferaseSMESG000051357.1 FG310880ncbi_smed_estsPMID:24992682
Vásquez-Doorman et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30010455InnexinSMESG000048374.1 NB.39.10encbi_smed_estsPMID:17670787
Oviedo et al., 2007
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30016693InnexinSMESG000059204.1 AY067877smed_ncbi_20200123PMID:17670787
Oviedo et al., 2007
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30025205InnexinSMESG000060499.1 AY067167smed_ncbi_20200123PMID:17670787
Oviedo et al., 2007
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30027106SMED30027106SMESG000008070.1 SMESG000008069.1 BK007043.1smed_ncbi_20200123PMID:25558068
Reuter et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
nervous systemSMED30010096TPA_inf: prohormone convertase 2SMESG000008070.1 SMESG000008069.1 BK007043.1smed_ncbi_20200123PMID:25558068
Reuter et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
nervous systemSMED30013810TeashirtSMESG000008973.1 KP003815.1smed_ncbi_20200123PMID:25558068
Reuter et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
nervous systemSMED30031525Choline O-acetyltransferaseSMESG000051357.1 FG310880ncbi_smed_estsPMID:25725068
Owen et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30027106SMED30027106SMESG000008070.1 SMESG000008069.1 BK007043.1smed_ncbi_20200123PMID:29557542
Han et al., 2019
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30010096TPA_inf: prohormone convertase 2SMESG000008070.1 SMESG000008069.1 BK007043.1smed_ncbi_20200123PMID:29557542
Han et al., 2019
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30015546Cyclic AMP-responsive element-binding protein 3SMESG000059546.1 dd_Smed_v4_1032_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014608Peptidase M60 domain-containing proteinSMESG000026283.1 dd_Smed_v4_11830_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30010006Transitional endoplasmic reticulum ATPaseSMESG000040165.1 SMESG000000068.1 SMESG000000064.1 dd_Smed_v4_10082_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30011690Heterogeneous nuclear ribonucleoprotein A2SMESG000050993.1 SMESG000050994.1 dd_Smed_v4_1194_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007788Transcription elongation regulator 1SMESG000011919.1 dd_Smed_v4_1147_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015251Transmembrane protein 184CSMESG000049447.1 dd_Smed_v4_1196_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015251Transmembrane protein 184CSMESG000048961.1 SMESG000028913.1 dd_Smed_v4_3934_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015057Transitional endoplasmic reticulum ATPaseSMESG000040165.1 SMESG000000068.1 SMESG000000064.1 dd_Smed_v4_10082_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30011235SMED30011235SMESG000014788.1 SMESG000014786.1 dd_Smed_v4_11758_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30011962ATP-binding cassette sub-family A member 1SMESG000056983.1 dd_Smed_v4_10304_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013850SMED30013850SMESG000051170.1 dd_Smed_v4_10305_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013850SMED30013850SMESG000081995.1 SMESG000080328.1 SMESG000080048.1 SMESG000078665.1 SMESG000077025.1 SMESG000076395.1 SMESG000075858.1 SMESG000066691.1 SMESG000062442.1 SMESG000060496.1 SMESG000054975.1 SMESG000054276.1 SMESG000051957.1 SMESG000049162.1 SMESG000046165.1 SMESG000036894.1 SMESG000035648.1 SMESG000034762.1 SMESG000030928.1 SMESG000030475.1 SMESG000030445.1 SMESG000030069.1 SMESG000029693.1 SMESG000029692.1 SMESG000029599.1 SMESG000029355.1 SMESG000027993.1 SMESG000027217.1 SMESG000022058.1 SMESG000020046.1 SMESG000014020.1 SMESG000012961.1 SMESG000010709.1 SMESG000007675.1 SMESG000006952.1 SMESG000004166.1 SMESG000003706.1 SMESG000002779.1 SMESG000002239.1 SMESG000001845.1 SMESG000080313.1 SMESG000066842.1 SMESG000050392.1 SMESG000048356.1 SMESG000042931.1 SMESG000033095.1 SMESG000018900.1 SMESG000017493.1 SMESG000015917.1 SMESG000004121.1 dd_Smed_v4_3574_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014355LIM domain only protein 7SMESG000039067.1 dd_Smed_v4_10011_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014496Ribosome biogenesis protein NSA2SMESG000028599.1 dd_Smed_v4_1012_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30010967SMED30010967SMESG000070444.1 dd_Smed_v4_10200_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009537bmp-like proteinSMESG000063420.1 dd_Smed_v4_12035_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30008051Malate dehydrogenase 1BSMESG000070444.1 dd_Smed_v4_10200_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30010564Hydrolase_4 domain-containing proteinSMESG000015331.1 SMESG000015322.1 dd_Smed_v4_10349_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013817SMED30013817SMESG000021812.1 SMESG000013063.1 dd_Smed_v4_10629_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30011574Ubiquitin-conjugating enzyme E2 variant 2SMESG000062065.1 dd_Smed_v4_1036_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30004899WD repeat-containing protein 93SMESG000037987.1 dd_Smed_v4_12161_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006498Histone-lysine N-methyltransferase SETMARSMESG000075151.1 SMESG000074964.1 dd_Smed_v4_10186_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007588SMED30007588SMESG000034112.1 dd_Smed_v4_10100_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005845NPHS1-6SMESG000028689.1 dd_Smed_v4_10689_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002934forkhead box J1-like protein 4SMESG000010030.1 dd_Smed_v4_10152_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007369C-terminal binding proteinSMESG000039168.1 dd_Smed_v4_1063_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30004224Sodium/hydrogen exchanger 11SMESG000052479.1 dd_Smed_v4_10212_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003540FAS-associated factor 2SMESG000048881.1 dd_Smed_v4_10511_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003177Bardet-Biedl syndrome 2 protein homologSMESG000075151.1 SMESG000074964.1 dd_Smed_v4_10186_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003986SMED30003986SMESG000044251.1 dd_Smed_v4_10819_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006476NEK8-2SMESG000043305.1 SMESG000043302.1 dd_Smed_v4_10144_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007500coiled-coil domain-containing protein 170SMESG000074429.1 dd_Smed_v4_10140_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002829Tubulin-specific chaperone DSMESG000000964.1 dd_Smed_v4_10610_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006792Argonaute 1SMESG000050993.1 SMESG000050994.1 dd_Smed_v4_1194_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006792Argonaute 1SMESG000050994.1 dd_Smed_v4_2478_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003943Cytosolic carboxypeptidase-like protein 5SMESG000009236.1 dd_Smed_v4_13116_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30023902Mitogen-activated protein kinase kinase kinase kinase 4SMESG000031711.1 dd_Smed_v4_1029_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30026585UbiquitinSMESG000003212.1 dd_Smed_v4_104_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30026585Ubiquitin dd_Smed_v4_12463_0_3dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30024115Ubiquitin-40S ribosomal protein S27aSMESG000048830.1 dd_Smed_v4_121_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30025226CalmodulinSMESG000004980.1 dd_Smed_v4_13205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED300232331.B9.3SMESG000000901.1 dd_Smed_v4_13104_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30025872Pleckstrin homology and RhoGEF domain containing G5SMESG000023541.1 SMESG000023540.1 dd_Smed_v4_10072_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30025406Retrovirus-related Pol polyprotein from type-1 retrotransposable element R2SMESG000061623.1 SMESG000041246.1 SMESG000010825.1 dd_Smed_v4_13241_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30022441G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000044466.1 dd_Smed_v4_11997_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30025688Protein tilB homologSMESG000058220.1 dd_Smed_v4_10124_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30024458SMED30024458SMESG000023541.1 SMESG000023540.1 dd_Smed_v4_10072_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30027677Carboxylic ester hydrolaseSMESG000005630.1 dd_Smed_v4_10334_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30024725Protein lin-7 homologSMESG000057909.1 dd_Smed_v4_1009_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30025424rap guanine nucleotide exchange factor 2 isoform X2SMESG000009223.1 dd_Smed_v4_10889_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30023266cilia- and flagella-associated protein 43SMESG000000491.1 dd_Smed_v4_10271_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002730SMED30002730SMESG000051170.1 dd_Smed_v4_10305_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002730SMED30002730SMESG000051170.1 dd_Smed_v4_8704_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005617Dynamin-1-like proteinSMESG000059031.1 SMESG000059029.1 SMESG000059025.1 SMESG000059016.1 dd_Smed_v4_1074_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000054Rab-GAP TBC domain-containing proteinSMESG000003946.1 dd_Smed_v4_10066_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002477Nucleosome-remodeling factor subunit BPTFSMESG000013525.1 dd_Smed_v4_10311_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002477Nucleosome-remodeling factor subunit BPTFSMESG000013525.1 dd_Smed_v4_8604_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000225WW domain-binding protein 4SMESG000011434.1 dd_Smed_v4_10030_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001480Serine/threonine-protein kinase ULK2SMESG000049447.1 dd_Smed_v4_1196_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005469slc17a-1SMESG000080078.1 SMESG000052932.1 dd_Smed_v4_10192_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014144Phytanoyl-CoA dioxygenase domain-containing protein 1-likeSMESG000023010.1 dd_Smed_v4_1207_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000192ankyrin and armadillo repeat-containing proteinSMESG000068683.1 dd_Smed_v4_10062_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002139Vacuole membrane protein 1SMESG000034612.1 dd_Smed_v4_1156_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005453slc16a-18SMESG000003109.1 dd_Smed_v4_10147_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000972Leucine-rich repeat-containing protein 71SMESG000006778.1 dd_Smed_v4_10715_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000972Leucine-rich repeat-containing protein 71SMESG000006778.1 dd_Smed_v4_12043_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30010096TPA_inf: prohormone convertase 2SMESG000008070.1 dd_Smed_v4_1566_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006813UDG domain-containing proteinSMESG000064938.1 dd_Smed_v4_10660_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30025144Protein rolling stoneSMESG000077396.1 dd_Smed_v4_10421_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30022043Protein odd-skipped-related 2SMESG000032229.1 dd_Smed_v4_10039_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018086Talin-1SMESG000019748.1 dd_Smed_v4_1233_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018086Talin-1SMESG000066444.1 SMESG000060705.1 dd_Smed_v4_876_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018086Talin-1SMESG000019748.1 dd_Smed_v4_2028_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018086Talin-1SMESG000019748.1 dd_Smed_v4_7313_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017880Alpha-int-1SMESG000022733.1 dd_Smed_v4_11655_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019373Rab6-interacting protein 2/elks/erc/cast,putativeSMESG000051528.1 dd_Smed_v4_12278_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017992Kunitz-type protease inhibitorSMESG000037999.1 SMESG000037995.1 dd_Smed_v4_1072_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017278Ig-like domain-containing proteinSMESG000001734.1 dd_Smed_v4_10042_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015887DUF4550 domain-containing proteinSMESG000000883.1 dd_Smed_v4_10058_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017418Casein kinase II subunit alphaSMESG000024545.1 dd_Smed_v4_1000_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019877Rho GTPase activating protein 44SMESG000068429.1 dd_Smed_v4_10426_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018309Iroquois-class homeodomain protein IRX-4SMESG000061184.1 dd_Smed_v4_11500_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016072SMED30016072SMESG000064318.1 dd_Smed_v4_10400_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016004SMED30016004SMESG000018602.1 dd_Smed_v4_1083_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017759neurofilament heavy polypeptide isoform X5SMESG000068550.1 dd_Smed_v4_10236_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017886Transitional endoplasmic reticulum ATPaseSMESG000016085.1 dd_Smed_v4_100930_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020747SMED30020747SMESG000037087.1 dd_Smed_v4_10194_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001230Meiotic recombination protein rec8SMESG000041612.1 dd_Smed_v4_15392_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30004441Origin recognition complex subunit 5SMESG000055362.1 SMESG000054627.1 dd_Smed_v4_12818_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009785Kinase-like proteinSMESG000033266.1 dd_Smed_v4_6672_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30011121SMED30011121SMESG000013773.1 dd_Smed_v4_11424_0_2dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013107Glyceraldehyde-3-phosphate dehydrogenaseSMESG000052353.1 dd_Smed_v4_78_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001654SMED30001654SMESG000012124.1 dd_Smed_v4_11272_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000644Kinesin proteinSMESG000060958.1 dd_Smed_v4_7196_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014833DNA replication ATP-dependent helicase/nuclease DNA2SMESG000005730.1 dd_Smed_v4_12638_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003831SMED30003831SMESG000071535.1 dd_Smed_v4_3895_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30008003Sodium-coupled neutral amino acid transporter 10SMESG000035203.1 dd_Smed_v4_2398_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006353SMED30006353SMESG000004009.1 dd_Smed_v4_7680_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30004840Coiled-coil domain containing 88AaSMESG000012304.1 dd_Smed_v4_3591_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015419SMED30015419SMESG000021688.1 dd_Smed_v4_11297_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002134SMED30002134SMESG000054781.1 SMESG000025013.1 SMESG000025003.1 dd_Smed_v4_69_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30008883Protein CEPU-1SMESG000040207.1 dd_Smed_v4_11326_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016760HATPase_c domain-containing proteinSMESG000054821.1 SMESG000054819.1 dd_Smed_v4_2265_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30035291PikachurinSMESG000079944.1 dd_Smed_v4_10946_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30026182Sodium/potassium-transporting ATPase subunit beta-2SMESG000071416.1 dd_Smed_v4_7917_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30027439SMED30027439SMESG000031258.1 dd_Smed_v4_12080_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30034448synaptotagmin-17SMESG000076969.1 dd_Smed_v4_19213_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30031345Pyruvate dehydrogenase E1 component subunit alphaSMESG000073271.1 dd_Smed_v4_1310_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30031282cAMP-dependent protein kinase regulatory subunitSMESG000078515.1 dd_Smed_v4_13623_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30031487Outer membrane autotransporter barrel domain-containing proteinSMESG000019226.1 dd_Smed_v4_10493_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30034212SMED30034212SMESG000023080.1 dd_Smed_v4_8763_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30027608SMED30027608SMESG000023253.1 dd_Smed_v4_1757_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30032897Signal recognition particle receptor subunit alphaSMESG000012673.1 dd_Smed_v4_1375_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30031106Ribosomal protein S6 kinaseSMESG000068122.1 dd_Smed_v4_1228_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30032687Synapse-associated protein 1SMESG000070056.1 dd_Smed_v4_1295_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30030837cilia- and flagella-associated protein 299SMESG000052708.1 dd_Smed_v4_11277_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30035902Serine/threonine-protein phosphataseSMESG000010596.1 dd_Smed_v4_1280_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30031525Choline O-acetyltransferaseSMESG000051357.1 dd_Smed_v4_6208_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30031525Choline O-acetyltransferaseSMESG000051357.1 dd_Smed_v4_11968_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30029356SMED30029356SMESG000015738.1 dd_Smed_v4_14782_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30028387F-box and leucine rich repeat protein 16SMESG000006324.1 dd_Smed_v4_12738_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30021206Calcineurin B homologous protein 1SMESG000018297.1 dd_Smed_v4_1504_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30033020Histone acetyltransferase KAT6ASMESG000038926.1 dd_Smed_v4_11245_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30030098Peptidase M60 domain-containing proteinSMESG000011622.1 dd_Smed_v4_13298_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED3002317260s ribosomal protein L14SMESG000022343.1 dd_Smed_v4_167_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30022111GCR032SMESG000009917.1 dd_Smed_v4_14650_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30035160Ubiquitin-ligase E3CSMESG000068094.1 dd_Smed_v4_13725_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30032428Protocadherin-9SMESG000005371.1 SMESG000005372.1 dd_Smed_v4_14613_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30028328Protocadherin alpha-2SMESG000069340.1 dd_Smed_v4_14209_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30034950SMED30034950SMESG000028882.1 dd_Smed_v4_13703_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30022344FERM domain containing-1SMESG000070273.1 dd_Smed_v4_1131_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30026380Phospholipid-transporting ATPaseSMESG000034375.1 SMESG000034325.1 dd_Smed_v4_13628_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30035333MFS transporterSMESG000061401.1 dd_Smed_v4_10656_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020769GCR103SMESG000075889.1 dd_Smed_v4_14122_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30029350Serine incorporator 3SMESG000020805.1 dd_Smed_v4_1130_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30032108ProtocadherinSMESG000033639.1 dd_Smed_v4_12429_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30022087TNFR CD27 30 40 95 cysteine rich regionSMESG000065173.1 dd_Smed_v4_3783_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30022905DihydropyrimidinaseSMESG000028784.1 SMESG000061889.1 dd_Smed_v4_3519_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30024528Potassium channel subfamily K member 18SMESG000013544.1 dd_Smed_v4_23109_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30031879Protein kinase domain-containing proteinSMESG000043386.1 dd_Smed_v4_15542_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001515AnnexinSMESG000042839.1 dd_Smed_v4_1104_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30004380SMED30004380SMESG000007103.1 dd_Smed_v4_10719_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30010853slc25a-21SMESG000073400.1 dd_Smed_v4_13134_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007891Galactosylceramide sulfotransferaseSMESG000021672.1 dd_Smed_v4_13130_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005292Post-GPI attachment to proteins factor 3SMESG000077193.1 dd_Smed_v4_11282_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30004754RNA-binding protein 8ASMESG000051885.1 dd_Smed_v4_1169_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003859SMED30003859SMESG000018217.1 dd_Smed_v4_1350_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006226Dual specificity protein kinase TTKSMESG000038940.1 SMESG000038939.1 dd_Smed_v4_13043_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30008917Tubulin alpha chainSMESG000079650.1 SMESG000010171.1 dd_Smed_v4_124_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007858netrin receptor-like proteinSMESG000042475.1 dd_Smed_v4_11409_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009182SMED30009182SMESG000006804.1 dd_Smed_v4_12952_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001341Carbonic anhydrase-relatedSMESG000054330.1 dd_Smed_v4_10750_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003780Serine/threonine-protein kinase 36SMESG000076885.1 dd_Smed_v4_11067_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002238PI-PLC X domain-containing protein 3SMESG000037587.1 dd_Smed_v4_11786_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED3000501926S proteasome regulatory subunit 4 homologSMESG000020306.1 dd_Smed_v4_1222_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002357SMED30002357SMESG000038052.1 dd_Smed_v4_101_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001362SMEDWI-3SMESG000081970.1 dd_Smed_v4_1258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30004972SMED30004972SMESG000007019.1 dd_Smed_v4_10965_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30010421SMED30010421SMESG000003797.1 dd_Smed_v4_11739_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007971Rho GTPase-activating proteinSMESG000066536.1 dd_Smed_v4_10828_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019358SMED30019358SMESG000017193.1 dd_Smed_v4_13200_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002324SMED30002324SMESG000020128.1 dd_Smed_v4_12353_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30004411SMED30004411SMESG000061558.1 dd_Smed_v4_11002_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000840Coiled-coil domain-containing protein 42-like proteinSMESG000046807.1 dd_Smed_v4_12378_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30008015slc25a-14SMESG000066536.1 dd_Smed_v4_10828_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30004174Holocarboxylase synthetaseSMESG000020128.1 dd_Smed_v4_12353_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30010781KH domain-containing proteinSMESG000068399.1 dd_Smed_v4_13063_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30012709SMED30012709SMESG000030742.1 dd_Smed_v4_1138_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30011027Dynein axonemal assembly factor 4SMESG000052823.1 dd_Smed_v4_12396_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30012631Phospholipid-transporting ATPaseSMESG000011472.1 dd_Smed_v4_10737_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000203Glutamate receptor, metabotropicSMESG000064049.1 dd_Smed_v4_11092_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30004455DUF2428 domain-containing proteinSMESG000032327.1 dd_Smed_v4_12316_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000514SMED30000514SMESG000036214.1 dd_Smed_v4_10854_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003110Ig-like domain-containing proteinSMESG000018621.1 dd_Smed_v4_10688_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016664SMED30016664SMESG000011618.1 dd_Smed_v4_2370_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009316Fork head domain proteinSMESG000048193.1 dd_Smed_v4_11337_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018866Diacylglycerol kinaseSMESG000051710.1 dd_Smed_v4_12579_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001470wntP-3SMESG000067888.1 dd_Smed_v4_14865_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001666slc18a-1SMESG000041557.1 SMESG000041534.1 dd_Smed_v4_11917_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30004537Proteasome subunit betaSMESG000004962.1 dd_Smed_v4_1264_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30010638DNA-binding protein inhibitor ID-2SMESG000017492.1 dd_Smed_v4_11911_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED3000102660S ribosomal protein L7SMESG000076604.1 dd_Smed_v4_1121_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000756EGFR-5SMESG000044603.1 dd_Smed_v4_11310_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007209serine/threonine-protein kinase DCLK1SMESG000078466.1 SMESG000050786.1 SMESG000050790.1 dd_Smed_v4_11772_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003345BTB domain-containing proteinSMESG000014239.1 dd_Smed_v4_12440_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001975vasohibin-2SMESG000072424.1 dd_Smed_v4_12833_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006846Bardet-Biedl syndrome 9SMESG000064061.1 dd_Smed_v4_11428_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30030892Intraflagellar transport protein 172SMESG000028841.1 dd_Smed_v4_7533_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30028575Serine/threonine-protein phosphatase with EF-handsSMESG000042202.1 dd_Smed_v4_11874_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30026893SMED30026893SMESG000036214.1 dd_Smed_v4_10854_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016001SMED30016001SMESG000063470.1 dd_Smed_v4_17673_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30010993SMED30010993SMESG000019824.1 dd_Smed_v4_12331_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014142Zgc:158640SMESG000055915.1 dd_Smed_v4_13161_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016045Cysteine-rich proteinSMESG000044206.1 dd_Smed_v4_1185_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED3001850460S ribosomal protein L30SMESG000022893.1 dd_Smed_v4_111_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017193Protocadherin 1SMESG000010555.1 dd_Smed_v4_12697_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30012817Methionine synthaseSMESG000054393.1 dd_Smed_v4_10302_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30008388slc1a-4SMESG000064122.1 dd_Smed_v4_11206_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30008787innexin-1SMESG000043134.1 dd_Smed_v4_11254_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013216Chromodomain-helicase-DNA-binding proteinSMESG000000092.1 dd_Smed_v4_12815_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013216Chromodomain-helicase-DNA-binding proteinSMESG000000092.1 dd_Smed_v4_7985_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016710SMED30016710SMESG000075557.1 dd_Smed_v4_10583_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013666Acetyltransferase component of pyruvate dehydrogenase complexSMESG000002956.1 dd_Smed_v4_1069_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014415Protein FAM32ASMESG000034920.1 dd_Smed_v4_1341_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30008113nicolin-1SMESG000079687.1 SMESG000054751.1 dd_Smed_v4_11961_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30012144NEPH-1SMESG000074081.1 dd_Smed_v4_11554_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015266adhesion G protein-coupled receptor L2-likeSMESG000058907.1 dd_Smed_v4_12277_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015266adhesion G protein-coupled receptor L2-likeSMESG000058907.1 dd_Smed_v4_16446_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018797BAH domain-containing proteinSMESG000012095.1 dd_Smed_v4_10101_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014348Four and a half LIM domains protein 1SMESG000018217.1 dd_Smed_v4_1350_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014348Four and a half LIM domains protein 1SMESG000006322.1 dd_Smed_v4_10293_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30008915SMED30008915SMESG000002588.1 dd_Smed_v4_10456_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017312Coiled-coil domain-containing protein 189SMESG000046576.1 dd_Smed_v4_12703_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30012188Small nuclear ribonucleoprotein FSMESG000025747.1 dd_Smed_v4_1056_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018039TNF receptor-associated factorSMESG000025998.1 SMESG000025982.1 SMESG000025980.1 SMESG000025963.1 SMESG000025934.1 SMESG000025901.1 SMESG000025797.1 SMESG000025794.1 SMESG000025517.1 dd_Smed_v4_1139_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30011041Heat shock protein 903SMESG000006119.1 dd_Smed_v4_1310_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30011041Heat shock protein 903SMESG000041107.1 dd_Smed_v4_758_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016121Phosphorylated adapter RNA export proteinSMESG000070992.1 dd_Smed_v4_11764_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017619TNF receptor-associated factorSMESG000025998.1 SMESG000025982.1 SMESG000025980.1 SMESG000025963.1 SMESG000025934.1 SMESG000025901.1 SMESG000025797.1 SMESG000025794.1 SMESG000025517.1 dd_Smed_v4_1139_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017456epidermal growth factor receptor 3SMESG000016935.1 dd_Smed_v4_10624_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018665TetraspaninSMESG000073695.1 dd_Smed_v4_12033_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007592SMED30007592SMESG000075491.1 dd_Smed_v4_11446_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30008115TPR repeat-containing protein DDB_G0287407 isoform X2SMESG000012448.1 dd_Smed_v4_12326_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016327Ras GTPase-activating protein SynGAPSMESG000060891.1 SMESG000060888.1 SMESG000060447.1 dd_Smed_v4_11115_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013342SMED30013342SMESG000068114.1 dd_Smed_v4_10914_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005206Serine/arginine-rich splicing factor 1SMESG000075205.1 dd_Smed_v4_1192_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007456Protein CBG04106SMESG000073042.1 dd_Smed_v4_13178_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30011581AP2-associated protein kinase 1-like ProteinSMESG000041938.1 SMESG000041937.1 SMESG000051989.1 dd_Smed_v4_1179_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30011800G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000020911.1 dd_Smed_v4_12466_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006402Progesterone immunomodulatory binding factor 1SMESG000046936.1 dd_Smed_v4_13444_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013293Major vault proteinSMESG000037707.1 dd_Smed_v4_1098_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005209Ankyrin repeat domain 50SMESG000028414.1 dd_Smed_v4_12936_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015748SMED30015748SMESG000036160.1 dd_Smed_v4_14291_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013109Heterogeneous nuclear ribonucleoprotein QSMESG000071117.1 dd_Smed_v4_10996_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016230SMED30016230SMESG000017162.1 dd_Smed_v4_11625_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017265Protocadherin gammaSMESG000046654.1 dd_Smed_v4_11223_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009358slc16a-3SMESG000011418.1 dd_Smed_v4_16616_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013865OFD1SMESG000046592.1 dd_Smed_v4_13339_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30010687Serine/threonine-protein kinase STE20SMESG000014619.1 dd_Smed_v4_1212_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30008486SMED30008486SMESG000014085.1 SMESG000014086.1 SMESG000014087.1 dd_Smed_v4_10249_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013054Protein kinase domain-containing proteinSMESG000020466.1 dd_Smed_v4_11366_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016383Coiled-coil domain containing 112SMESG000011105.1 dd_Smed_v4_12448_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009586SMED30009586SMESG000030829.1 dd_Smed_v4_10825_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30012869Y-box-binding protein 1SMESG000032189.1 dd_Smed_v4_114_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007846Cyclic nucleotide gated channel 1SMESG000038402.1 dd_Smed_v4_16523_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30012483SMED30012483SMESG000044609.1 dd_Smed_v4_1665_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30010620Histone acetyltransferaseSMESG000017094.1 dd_Smed_v4_12274_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30012522Ankyrin-2SMESG000026655.1 dd_Smed_v4_10835_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30011190Cytosolic Fe-S cluster assembly factor NUBP2 homologSMESG000019851.1 SMESG000019820.1 dd_Smed_v4_1094_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005074Protein kinase domain-containing proteinSMESG000014619.1 dd_Smed_v4_1212_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013313SMED30013313SMESG000060891.1 SMESG000060888.1 SMESG000060447.1 dd_Smed_v4_11115_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019319SMED30019319SMESG000006804.1 dd_Smed_v4_12952_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018078Glycine receptor subunit alpha-3SMESG000041885.1 dd_Smed_v4_11342_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30012238SMED30012238SMESG000044609.1 dd_Smed_v4_1665_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013535slc5a-5SMESG000028614.1 dd_Smed_v4_12883_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013349Carboxyl-terminal PDZ ligand of neuronal nitric oxide synthase proteinSMESG000010313.1 dd_Smed_v4_1082_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30012052SMED30012052SMESG000068013.1 dd_Smed_v4_10481_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30008805Protein kinase CSMESG000003366.1 dd_Smed_v4_12927_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017260Pre mRNA processing factor 6SMESG000011657.1 dd_Smed_v4_1153_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006964SMED30006964SMESG000011995.1 dd_Smed_v4_1851_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000144CAP-Gly domain-containing proteinSMESG000000637.1 dd_Smed_v4_16405_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001792Retinal pigment epithelium-derived rhodopsin homologSMESG000045022.1 SMESG000045023.1 dd_Smed_v4_13675_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001792Retinal pigment epithelium-derived rhodopsin homologSMESG000045023.1 dd_Smed_v4_7301_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018721Nipped-B proteinSMESG000008990.1 dd_Smed_v4_10776_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018716Acidic leucine-rich nuclear phosphoprotein 32 family member ASMESG000065271.1 dd_Smed_v4_1396_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013766Matrin-type domain-containing proteinSMESG000072403.1 dd_Smed_v4_1859_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30011615SMED30011615SMESG000036524.1 dd_Smed_v4_11034_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30010632E3 ubiquitin-protein ligase RGLG4SMESG000076482.1 SMESG000076409.1 SMESG000076405.1 SMESG000076390.1 SMESG000076375.1 SMESG000076364.1 SMESG000076223.1 SMESG000040665.1 SMESG000019753.1 dd_Smed_v4_1097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016586tubulin polyglutamylase complex subunit 2SMESG000041945.1 dd_Smed_v4_13845_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014085Glutamate receptor ionotropic, NMDA 3ASMESG000006949.1 dd_Smed_v4_18414_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002754TPR_REGION domain-containing proteinSMESG000008310.1 dd_Smed_v4_11374_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000692Protein king tubbySMESG000073925.1 dd_Smed_v4_11228_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002644SMED30002644SMESG000018388.1 dd_Smed_v4_9819_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED3000652126S proteasome non-ATPase regulatory subunit 3SMESG000066329.1 SMESG000066317.1 dd_Smed_v4_1449_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009789SMED30009789SMESG000023107.1 dd_Smed_v4_14239_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007477cAMP-dependent protein kinase type I-alpha regulatory subunitSMESG000069771.1 dd_Smed_v4_11269_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014978PKD2L-1SMESG000018514.1 SMESG000018510.1 dd_Smed_v4_15626_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003741KH domain-containing proteinSMESG000068335.1 dd_Smed_v4_1393_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015272SMED30015272SMESG000045574.1 dd_Smed_v4_19180_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007173Protocadherin-11 X-linkedSMESG000009208.1 dd_Smed_v4_15332_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000896Coiled-coil domain-containing protein 186SMESG000062953.1 dd_Smed_v4_14004_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002665CREB-binding proteinSMESG000048249.1 dd_Smed_v4_9154_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009798SMED30009798SMESG000051529.1 dd_Smed_v4_18270_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001451PWWP domain-containing proteinSMESG000052118.1 dd_Smed_v4_8702_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007143Nucleolar GTP-binding protein 2SMESG000026847.1 dd_Smed_v4_1134_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002882SMED30002882SMESG000069367.1 dd_Smed_v4_11838_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002882SMED30002882SMESG000069367.1 dd_Smed_v4_9233_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001335Muscarinic acetylcholine receptorSMESG000081829.1 dd_Smed_v4_14482_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30010217RNA-binding protein 4BSMESG000059552.1 dd_Smed_v4_1566_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009125arh proteinSMESG000070743.1 dd_Smed_v4_17534_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001640SMED30001640SMESG000007247.1 dd_Smed_v4_4472_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009900Copine-3SMESG000064685.1 dd_Smed_v4_15889_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30004459Cytoplasmic FMR1-interacting proteinSMESG000062092.1 dd_Smed_v4_1820_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018221Epithelial cell transforming 2 likeSMESG000074748.1 dd_Smed_v4_14243_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018062Glyco_tran_10_N domain-containing proteinSMESG000005277.1 dd_Smed_v4_14363_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009255Solute carrier family 12 member 9SMESG000033021.1 dd_Smed_v4_1738_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015285SMED30015285SMESG000045945.1 dd_Smed_v4_18168_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30012092SMED30012092SMESG000073142.1 dd_Smed_v4_1835_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016144SMED30016144SMESG000048818.1 dd_Smed_v4_12165_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002317Helicase with zinc finger domain 2SMESG000017490.1 SMESG000017486.1 dd_Smed_v4_12219_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED3000898760S ribosomal protein L13-like proteinSMESG000036992.1 dd_Smed_v4_145_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED3000985940S ribosomal protein S24SMESG000035929.1 dd_Smed_v4_164_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015424Retrovirus-related Pol polyprotein from type-1 retrotransposable element R2SMESG000062936.1 SMESG000024338.1 SMESG000024319.1 SMESG000024308.1 dd_Smed_v4_18000_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED300148153 hydroxyacyl CoA dehydrogenase type-2SMESG000044485.1 dd_Smed_v4_1682_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000794Luc7-like protein 3SMESG000041410.1 dd_Smed_v4_1899_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018391Kv channel-interacting protein 1 isoform X2SMESG000056720.1 dd_Smed_v4_13820_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30008627SMED30008627SMESG000041685.1 SMESG000041696.1 dd_Smed_v4_13591_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003546SMED30003546SMESG000072344.1 dd_Smed_v4_11255_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30008798cAMP-dependent protein kinase type II regulatory subunitSMESG000051354.1 dd_Smed_v4_1362_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005188Venom allergen 5SMESG000062609.1 dd_Smed_v4_159_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002315kcnbSMESG000004060.1 dd_Smed_v4_19025_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017290Mitofusin 1SMESG000070111.1 dd_Smed_v4_16499_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005997SMED30005997SMESG000050405.1 dd_Smed_v4_1663_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30010944SMED30010944SMESG000062936.1 SMESG000024338.1 SMESG000024319.1 SMESG000024308.1 dd_Smed_v4_18000_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013414Lysine-specific demethylase 6ASMESG000068495.1 dd_Smed_v4_12576_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30012899PalmitoyltransferaseSMESG000004248.1 dd_Smed_v4_11261_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013709Endoglin CD105 antigenSMESG000039228.1 SMESG000013245.1 dd_Smed_v4_13730_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013417Cadherin like and PC-esterase domain containing 1SMESG000016689.1 dd_Smed_v4_14757_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009090Mushroom body large-type Kenyon-related proteinSMESG000070784.1 dd_Smed_v4_17498_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019942Roc domain-containing proteinSMESG000038728.1 dd_Smed_v4_11334_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30008063SMED30008063SMESG000043378.1 dd_Smed_v4_1685_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30012990G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000032545.1 dd_Smed_v4_17171_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30004666ATP-dependent zinc metalloprotease FtsHSMESG000006322.1 dd_Smed_v4_10293_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014840RRM domain-containing proteinSMESG000020677.1 dd_Smed_v4_14052_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001622SMED30001622SMESG000040908.1 dd_Smed_v4_10356_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30030198Lamin-B receptorSMESG000042131.1 dd_Smed_v4_2016_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30033073Dynein heavy chain axonemal-likeSMESG000039073.1 dd_Smed_v4_4176_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30032395T-box transcription factor TBX2SMESG000061015.1 dd_Smed_v4_11693_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30032843SMED30032843SMESG000062936.1 SMESG000024338.1 SMESG000024319.1 SMESG000024308.1 dd_Smed_v4_18000_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30030435Serine/arginine-rich splicing factorSMESG000015564.1 dd_Smed_v4_3431_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30033079InnexinSMESG000045304.1 dd_Smed_v4_11502_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30035908Serine-rich adhesin for platelets (Staphylococcus aureus surface protein A)SMESG000025158.1 dd_Smed_v4_3220_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30022907SynaptotagminSMESG000025329.1 dd_Smed_v4_4222_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30023043SMED30023043SMESG000019067.1 dd_Smed_v4_13671_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30033367FAD-binding PCMH-type domain-containing proteinSMESG000022021.1 dd_Smed_v4_21866_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020234Kinase D-interacting substrateSMESG000079991.1 dd_Smed_v4_11743_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30031058Galanin receptor type 2SMESG000043375.1 SMESG000043376.1 dd_Smed_v4_18897_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020946ATP-dependent RNA helicase DHX8SMESG000038860.1 dd_Smed_v4_12329_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30034201Delta-like proteinSMESG000036778.1 dd_Smed_v4_15985_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30030073Thymus, brain and testes associatedSMESG000053617.1 dd_Smed_v4_4229_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30035542SMED30035542SMESG000062936.1 SMESG000024338.1 SMESG000024319.1 SMESG000024308.1 dd_Smed_v4_18000_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30033432Amiloride-sensitive sodium channelSMESG000000681.1 dd_Smed_v4_16546_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30027929Tubulin beta chainSMESG000022928.1 dd_Smed_v4_471_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30027929Tubulin beta chainSMESG000022928.1 dd_Smed_v4_341_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020347Transient receptor potential cation channelSMESG000004126.1 dd_Smed_v4_11377_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30034363SMED30034363SMESG000031923.1 dd_Smed_v4_32230_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30029349AdenosylhomocysteinaseSMESG000029405.1 dd_Smed_v4_3408_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30029381Slc16a-24SMESG000008037.1 dd_Smed_v4_27909_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30030230Histidine triad nucleotide-binding protein 1SMESG000067518.1 SMESG000060398.1 dd_Smed_v4_3055_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30028255RRM domain-containing proteinSMESG000071928.1 dd_Smed_v4_36288_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30029150RNA-binding proteinSMESG000040788.1 dd_Smed_v4_11304_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30034472Potassium channel subfamily K member 18SMESG000019992.1 dd_Smed_v4_40463_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30030404Bifunctional glutamate/proline--tRNA ligaseSMESG000057140.1 dd_Smed_v4_2488_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30030621Regulator of G-protein signaling, putativeSMESG000072045.1 dd_Smed_v4_5311_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30032823NeurotrypsinSMESG000081574.1 SMESG000081529.1 SMESG000079557.1 SMESG000079250.1 SMESG000077556.1 SMESG000075496.1 SMESG000073961.1 SMESG000073618.1 SMESG000073174.1 SMESG000071859.1 SMESG000071198.1 SMESG000071073.1 SMESG000070153.1 SMESG000068262.1 SMESG000068028.1 SMESG000067334.1 SMESG000065567.1 SMESG000061192.1 SMESG000060952.1 SMESG000060260.1 SMESG000059623.1 SMESG000050492.1 SMESG000050479.1 SMESG000050299.1 SMESG000049776.1 SMESG000048159.1 SMESG000044971.1 SMESG000043973.1 SMESG000042620.1 SMESG000040932.1 SMESG000039792.1 SMESG000039741.1 SMESG000039356.1 SMESG000034716.1 SMESG000033763.1 SMESG000029286.1 SMESG000028614.1 SMESG000027381.1 SMESG000025022.1 SMESG000021522.1 SMESG000020398.1 SMESG000019968.1 SMESG000018320.1 SMESG000015216.1 SMESG000015117.1 SMESG000015102.1 SMESG000013389.1 SMESG000012534.1 SMESG000012464.1 SMESG000011278.1 SMESG000011147.1 SMESG000007021.1 SMESG000006554.1 SMESG000001897.1 SMESG000070487.1 SMESG000068881.1 SMESG000064552.1 SMESG000063831.1 SMESG000056926.1 SMESG000050300.1 SMESG000047318.1 SMESG000047014.1 SMESG000043279.1 SMESG000030931.1 SMESG000023641.1 SMESG000018675.1 SMESG000017256.1 SMESG000013665.1 SMESG000013089.1 SMESG000011196.1 SMESG000009621.1 SMESG000008519.1 SMESG000005066.1 dd_Smed_v4_129_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30032823NeurotrypsinSMESG000081078.1 SMESG000069853.1 SMESG000045007.1 SMESG000016710.1 SMESG000016305.1 SMESG000002984.1 SMESG000078601.1 SMESG000062504.1 SMESG000047126.1 SMESG000040474.1 SMESG000029537.1 dd_Smed_v4_199_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30035314SMED30035314SMESG000020883.1 dd_Smed_v4_11620_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30021628SMED30021628SMESG000068735.1 dd_Smed_v4_15435_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30035044Deoxyribose-phosphate aldolaseSMESG000002972.1 SMESG000069749.1 dd_Smed_v4_12065_0_2dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30031120SMED30031120SMESG000036622.1 dd_Smed_v4_9680_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30027444slc16a-24SMESG000008037.1 dd_Smed_v4_27909_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30035336LLGL scribble cell polarity complex component 2SMESG000018172.1 dd_Smed_v4_2164_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30026123SMED30026123SMESG000061517.1 dd_Smed_v4_14659_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30023155Thyroid adenoma-associated-like proteinSMESG000023235.1 dd_Smed_v4_12325_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30023483INX-13SMESG000043575.1 dd_Smed_v4_11501_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30034737Protocadherin-1SMESG000005378.1 dd_Smed_v4_10467_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30032616TSNAXIP1_N domain-containing proteinSMESG000025884.1 dd_Smed_v4_9605_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30022646SMED30022646SMESG000002972.1 SMESG000069749.1 dd_Smed_v4_12065_0_2dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003521Transient receptor potential cation channel subfamily M member-like 2SMESG000005057.1 dd_Smed_v4_11259_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30010847SMED30010847SMESG000026789.1 dd_Smed_v4_10187_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002753X1.A5.1SMESG000062836.1 dd_Smed_v4_585_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005785SMED30005785SMESG000008183.1 dd_Smed_v4_13129_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30008650Beta-hexosaminidaseSMESG000008181.1 dd_Smed_v4_12408_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006515ZZ-type domain-containing proteinSMESG000055420.1 dd_Smed_v4_10173_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30010912SMED30010912SMESG000005057.1 dd_Smed_v4_11259_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30008752Homeobox domain-containing proteinSMESG000016670.1 dd_Smed_v4_11150_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30004541SMED30004541SMESG000056767.1 dd_Smed_v4_13044_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000535CEP72SMESG000043538.1 dd_Smed_v4_12835_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007202Guanylate cyclaseSMESG000068881.1 dd_Smed_v4_14331_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009869fas-binding factor 1 homologSMESG000037546.1 dd_Smed_v4_12735_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009869fas-binding factor 1 homologSMESG000037546.1 dd_Smed_v4_12422_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30004306SMED30004306SMESG000062897.1 dd_Smed_v4_1005_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30011215ATP-binding cassette sub-family B member 6, mitochondrialSMESG000070808.1 SMESG000070801.1 SMESG000070797.1 dd_Smed_v4_7348_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013560SMED30013560SMESG000065648.1 dd_Smed_v4_15123_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30034040interferon-induced helicase C domain-containing protein 1SMESG000014877.1 SMESG000014858.1 SMESG000014841.1 dd_Smed_v4_3742_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30034040interferon-induced helicase C domain-containing protein 1SMESG000014848.1 SMESG000014843.1 SMESG000014831.1 dd_Smed_v4_4361_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30024342Neuropeptide Y receptor, invertebrateSMESG000059151.1 dd_Smed_v4_10020_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020291Centrosomal protein 104SMESG000023549.1 dd_Smed_v4_10228_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020402SMED30020402SMESG000011919.1 dd_Smed_v4_1147_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020257DUF3421 domain-containing proteinSMESG000046742.1 dd_Smed_v4_1040_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30021117SMED30021117SMESG000079744.1 SMESG000074656.1 SMESG000054243.1 SMESG000040345.1 SMESG000035927.1 SMESG000022375.1 SMESG000019267.1 dd_Smed_v4_12375_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30022408Post-GPI attachment to proteins factor 2-like proteinSMESG000044614.1 dd_Smed_v4_10182_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30004142Calcium-dependent secretion activator 1SMESG000011756.1 dd_Smed_v4_11725_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005606Ubiquitin-like modifier-activating enzyme 1SMESG000070068.1 dd_Smed_v4_1107_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003418Guanine nucleotide-binding protein subunit betaSMESG000018712.1 dd_Smed_v4_1184_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002156TNF receptor associated factor-2SMESG000065606.1 SMESG000000563.1 SMESG000000559.1 SMESG000000493.1 SMESG000000294.1 dd_Smed_v4_1243_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006229SMED30006229SMESG000019033.1 dd_Smed_v4_12403_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001690SMED30001690SMESG000069322.1 dd_Smed_v4_12571_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000553Epithelial discoidin domain-containing receptorSMESG000069322.1 dd_Smed_v4_12571_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005093NPHP5SMESG000005436.1 dd_Smed_v4_11329_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30004913Ras-like GTP-binding protein YPT1SMESG000076068.1 dd_Smed_v4_11071_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006233GTP-binding protein GEMSMESG000032890.1 dd_Smed_v4_11010_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006383SMED30006383SMESG000008503.1 dd_Smed_v4_15602_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005978Cyclic nucleotide gated channel alpha 3SMESG000044898.1 SMESG000035733.1 dd_Smed_v4_12825_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005046Dynein heavy chain, axonemalSMESG000050247.1 dd_Smed_v4_13135_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005046Dynein heavy chain, axonemalSMESG000050247.1 SMESG000050248.1 dd_Smed_v4_10191_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003408Centrosomal protein of 89 kDaSMESG000031345.1 dd_Smed_v4_13073_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000284Electron transfer flavoprotein subunit betaSMESG000025689.1 dd_Smed_v4_1315_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30010168Cyclic nucleotide gated channel alpha 3SMESG000044898.1 SMESG000035733.1 dd_Smed_v4_12825_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005421CAP-Gly domain-containing proteinSMESG000006189.1 dd_Smed_v4_12985_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005421CAP-Gly domain-containing proteinSMESG000006189.1 dd_Smed_v4_14698_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001810Protein NDRG3SMESG000005138.1 SMESG000005122.1 dd_Smed_v4_1911_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001148SMED30001148SMESG000041540.1 SMESG000041529.1 dd_Smed_v4_13075_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000450Calcitonin receptorSMESG000006966.1 dd_Smed_v4_18236_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002182Neuropeptide Y prohormone-11SMESG000064810.1 dd_Smed_v4_16946_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006125C2H2-type domain-containing proteinSMESG000020158.1 dd_Smed_v4_14413_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019774SMED30019774SMESG000065670.1 dd_Smed_v4_10718_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000230SMED30000230SMESG000051919.1 dd_Smed_v4_17743_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001953Rab-like protein 3SMESG000023258.1 dd_Smed_v4_3718_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30004447Family with sequence similarity 184 member ASMESG000058677.1 dd_Smed_v4_16975_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019763CS domain-containing proteinSMESG000078259.1 SMESG000075881.1 SMESG000064589.1 SMESG000031042.1 SMESG000029607.1 SMESG000021352.1 SMESG000004064.1 dd_Smed_v4_3736_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003978SMED30003978SMESG000052391.1 dd_Smed_v4_10608_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED3000883926S proteasome non-ATPase regulatory subunit 12SMESG000057467.1 dd_Smed_v4_2546_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002162Glycosyl transferaseSMESG000030921.1 dd_Smed_v4_11247_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30008111DnaJ homolog subfamily C member 2SMESG000080160.1 dd_Smed_v4_1353_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30027428forkhead box A-1SMESG000065670.1 dd_Smed_v4_10718_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003592SMED30003592SMESG000013335.1 dd_Smed_v4_10619_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30004318Triadin-like isoform X4SMESG000025109.1 dd_Smed_v4_22537_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30004318Triadin-like isoform X4SMESG000025109.1 dd_Smed_v4_13778_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30010426GCR317SMESG000074480.1 dd_Smed_v4_14520_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30004080PIM-1-like proteinSMESG000061809.1 SMESG000061808.1 dd_Smed_v4_16306_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED3000170160S ribosomal protein L7aSMESG000020535.1 dd_Smed_v4_296_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009210Protein kinase domain-containing proteinSMESG000039711.1 dd_Smed_v4_13767_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002629SMED30002629SMESG000011026.1 dd_Smed_v4_13789_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005819bambiSMESG000054829.1 dd_Smed_v4_11062_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007957Iroquois-class homeodomain protein IRX-6SMESG000022899.1 dd_Smed_v4_14656_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007670DystrobrevinSMESG000078318.1 dd_Smed_v4_12275_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007004SMED30007004SMESG000019033.1 dd_Smed_v4_12403_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019535Protein lifeguard 2SMESG000057144.1 dd_Smed_v4_1586_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30008034Fukutin-related proteinSMESG000043202.1 SMESG000040730.1 SMESG000040722.1 SMESG000040691.1 SMESG000039390.1 SMESG000039363.1 SMESG000039356.1 SMESG000039355.1 SMESG000039343.1 dd_Smed_v4_13280_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001880Lysine-specific demethylase 3BSMESG000051397.1 SMESG000006486.1 dd_Smed_v4_2582_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED3000905260S ribosomal protein L18SMESG000017166.1 dd_Smed_v4_128_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30012386Alpha-1,4 glucan phosphorylaseSMESG000061417.1 dd_Smed_v4_1532_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009634Proteasome subunit alpha typeSMESG000060349.1 dd_Smed_v4_1154_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014265Neutral ceramidaseSMESG000003228.1 dd_Smed_v4_1726_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30010164Potassium voltage-gated channel subfamily H member 7SMESG000024222.1 SMESG000024219.1 dd_Smed_v4_12621_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014549Prominin (Prom) protein, putativeSMESG000013192.1 dd_Smed_v4_1386_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000511G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000064707.1 dd_Smed_v4_16018_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018397TPA_inf: Pax-beta1 paired domain proteinSMESG000080212.1 dd_Smed_v4_15732_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009087SMED30009087SMESG000023687.1 dd_Smed_v4_1016_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009645SMED30009645SMESG000037851.1 SMESG000037843.1 SMESG000037842.1 SMESG000037831.1 SMESG000037828.1 SMESG000019412.1 dd_Smed_v4_10887_0_2dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015511X-ray radiation resistance-associated protein 1SMESG000019618.1 dd_Smed_v4_13519_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009043Fork-head domain-containing proteinSMESG000044628.1 dd_Smed_v4_12170_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013404SMED30013404SMESG000027863.1 dd_Smed_v4_16528_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30010766C2 domain-containing protein 3SMESG000025571.1 dd_Smed_v4_13019_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30011335Dynein heavy chain 10, axonemalSMESG000051829.1 dd_Smed_v4_12797_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30011335Dynein heavy chain 10, axonemalSMESG000051829.1 dd_Smed_v4_5169_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013225SMED30013225SMESG000018299.1 dd_Smed_v4_17045_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30008418SMED30008418SMESG000027863.1 dd_Smed_v4_16528_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006971SMED30006971SMESG000030739.1 dd_Smed_v4_14664_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000771SMED30000771SMESG000059918.1 SMESG000052306.1 SMESG000022407.1 dd_Smed_v4_1996_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000771SMED30000771SMESG000059918.1 SMESG000052306.1 SMESG000022407.1 dd_Smed_v4_474_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016794G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000004267.1 dd_Smed_v4_16725_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006459Serine/threonine-protein kinase PLK4SMESG000076532.1 dd_Smed_v4_12637_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006822SMED30006822SMESG000043386.1 dd_Smed_v4_15542_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000938Homeobox domain-containing proteinSMESG000060967.1 dd_Smed_v4_15471_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED3000832026S proteasome regulatory subunit 8SMESG000066841.1 dd_Smed_v4_1176_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001359SMED30001359SMESG000059918.1 SMESG000052306.1 SMESG000022407.1 dd_Smed_v4_1996_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30012272ZP domain-containing proteinSMESG000039966.1 dd_Smed_v4_13456_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001793UDP-N-acetylglucosamine--peptide N-acetylglucosaminyltransferase subunitSMESG000002813.1 dd_Smed_v4_2939_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005536SMED30005536SMESG000028873.1 dd_Smed_v4_1076_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006503InnexinSMESG000016539.1 dd_Smed_v4_13475_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006503InnexinSMESG000068735.1 dd_Smed_v4_15435_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009071SMED30009071SMESG000017123.1 dd_Smed_v4_10551_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30010231SMED30010231SMESG000015116.1 dd_Smed_v4_10874_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001192ras-related protein Rab-14SMESG000044270.1 dd_Smed_v4_2241_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001192ras-related protein Rab-14SMESG000066109.1 SMESG000052687.1 SMESG000014240.1 SMESG000069832.1 SMESG000037642.1 dd_Smed_v4_106_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30010283Anosmin-1SMESG000067656.1 dd_Smed_v4_12201_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009017SMED30009017SMESG000020517.1 dd_Smed_v4_14248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007610Guanine nucleotide-binding protein G(q) subunit alphaSMESG000022892.1 dd_Smed_v4_3755_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018442PHB domain-containing proteinSMESG000026539.1 dd_Smed_v4_15992_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30011996Neuronal cell adhesion molecule aSMESG000051919.1 dd_Smed_v4_17743_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016730Transmembrane protein 47SMESG000061681.1 dd_Smed_v4_12504_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016730Transmembrane protein 47SMESG000061681.1 dd_Smed_v4_7982_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED3001242160S ribosomal protein L37aSMESG000078736.1 dd_Smed_v4_140_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017949slc7a-6SMESG000051755.1 dd_Smed_v4_7207_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009177Protocadherin-11 X-linkedSMESG000070713.1 dd_Smed_v4_14317_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019907SMED30019907SMESG000046990.1 dd_Smed_v4_57814_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001478Dynamin-like proteinSMESG000002033.1 dd_Smed_v4_884_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017180Dynein regulatory complex protein 1SMESG000072168.1 dd_Smed_v4_8761_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30033718SMED30033718SMESG000061174.1 dd_Smed_v4_12214_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30035317Phosphoglycerate kinaseSMESG000039090.1 dd_Smed_v4_972_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30021280Leucine Rich repeat-containing domain proteinSMESG000006503.1 dd_Smed_v4_18031_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30023889SMED30023889SMESG000055805.1 dd_Smed_v4_857_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30026571TIR domain-containing proteinSMESG000077763.1 dd_Smed_v4_9201_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30032001SMED30032001SMESG000010967.1 dd_Smed_v4_8765_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30026580Phospholipid scramblaseSMESG000047456.1 SMESG000047455.1 dd_Smed_v4_6988_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30026278Pre-mRNA-splicing factor ISY1SMESG000047126.1 SMESG000004187.1 dd_Smed_v4_8243_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30024920Ectonucleoside triphosphate diphosphohydrolaseSMESG000068450.1 dd_Smed_v4_11962_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30028849One cut domain family memberSMESG000007728.1 dd_Smed_v4_7877_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30034690Mitogen-activated protein kinase kinase kinaseSMESG000070043.1 dd_Smed_v4_8364_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30023352Vang-1SMESG000029281.1 dd_Smed_v4_9100_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30033766Actin binding LIM protein family member 2SMESG000037349.1 dd_Smed_v4_12268_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30024869c-Myc-binding proteinSMESG000006427.1 dd_Smed_v4_12156_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30032065SMED30032065SMESG000075340.1 dd_Smed_v4_76503_0_2dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30032297BTB domain-containing proteinSMESG000017289.1 SMESG000017288.1 dd_Smed_v4_8895_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30035855Poly [ADP-ribose] polymeraseSMESG000067451.1 SMESG000060010.1 dd_Smed_v4_6154_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30033098WD repeat-containing protein 97 isoform X2SMESG000010382.1 dd_Smed_v4_11828_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30023147SMED30023147SMESG000032765.1 SMESG000032764.1 dd_Smed_v4_9225_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30030068SMED30030068SMESG000051921.1 SMESG000051913.1 dd_Smed_v4_1175_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30023924SMED30023924SMESG000030689.1 dd_Smed_v4_561_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30023661Reverse transcriptase domain-containing proteinSMESG000042224.1 dd_Smed_v4_11697_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020199SMED30020199SMESG000041669.1 dd_Smed_v4_5991_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30029853SMED30029853SMESG000062819.1 dd_Smed_v4_26649_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED300276035'-AMP-activated protein kinase subunit gamma-2SMESG000078418.1 dd_Smed_v4_8677_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30024446receptor tyrosine kinase-1SMESG000025275.1 dd_Smed_v4_8651_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30030025SynaptogyrinSMESG000051237.1 SMESG000051238.1 dd_Smed_v4_1195_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30022151CaveolinSMESG000074524.1 dd_Smed_v4_8555_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30028223Stabilizer of axonemal microtubules 1SMESG000042230.1 dd_Smed_v4_5551_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30035680Calmodulin-regulated spectrin-associated protein 1SMESG000017885.1 dd_Smed_v4_7356_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30029401Propionyl-CoA synthetaseSMESG000043645.1 dd_Smed_v4_12050_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30028228Centrosomal protein 164SMESG000054195.1 SMESG000021687.1 dd_Smed_v4_12228_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30025709Chaperone protein DnaJSMESG000028986.1 SMESG000028985.1 dd_Smed_v4_9057_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30032517SMED30032517SMESG000074268.1 SMESG000050484.1 dd_Smed_v4_6367_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED3002151340S ribosomal protein S9SMESG000058106.1 dd_Smed_v4_92_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30034767synaptotagmin-14SMESG000051011.1 SMESG000046823.1 dd_Smed_v4_9164_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020704Poly [ADP-ribose] polymeraseSMESG000067451.1 SMESG000060010.1 dd_Smed_v4_6154_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30023424Multidrug and toxin extrusion proteinSMESG000005478.1 dd_Smed_v4_12128_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30035570Poly(RC)-binding protein 3SMESG000005644.1 dd_Smed_v4_7334_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30033789One cut domain family memberSMESG000007728.1 dd_Smed_v4_7877_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30033864pim-3SMESG000014593.1 dd_Smed_v4_6420_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30032882utxSMESG000020110.1 dd_Smed_v4_5837_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30021666Zinc finger, CCHC domain containing 9SMESG000035083.1 dd_Smed_v4_7172_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30029143ELM2 domain containing proteinSMESG000035512.1 SMESG000035510.1 dd_Smed_v4_8904_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015265translocon associated protein subunit deltaSMESG000067948.1 dd_Smed_v4_2051_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014545GCR037SMESG000065390.1 dd_Smed_v4_31134_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018013Protein F37C4.5SMESG000042992.1 SMESG000007398.1 dd_Smed_v4_3629_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30026658SMED30026658SMESG000008925.1 dd_Smed_v4_376_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED3002604960S ribosomal protein L35aSMESG000003977.1 dd_Smed_v4_318_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30024600Serine/arginine repetitive matrix protein 1SMESG000023657.1 dd_Smed_v4_3886_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020726P-type phospholipid transporterSMESG000040790.1 dd_Smed_v4_238_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020768SMED30020768SMESG000072019.1 SMESG000071607.1 dd_Smed_v4_3316_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30027162MDS1 and EVI1 complex locus protein EVI1SMESG000028951.1 dd_Smed_v4_22685_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30026172srebp proteinSMESG000056019.1 dd_Smed_v4_3641_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30023391AnkyrinSMESG000040152.1 dd_Smed_v4_3523_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30024243Peptidase S1 domain-containing proteinSMESG000077235.1 dd_Smed_v4_3075_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30025235Ig-like domain-containing proteinSMESG000017403.1 dd_Smed_v4_31445_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007044SMED30007044SMESG000060901.1 SMESG000060885.1 dd_Smed_v4_8148_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002221SMED30002221SMESG000011558.1 dd_Smed_v4_3733_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016186SMED30016186SMESG000033673.1 dd_Smed_v4_1071_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018244UDP-N-acetylglucosamine-peptide N-acetylglucosaminyltransferaseSMESG000004467.1 SMESG000004465.1 SMESG000069298.1 dd_Smed_v4_2819_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30008378Protein kinase domain-containing proteinSMESG000003368.1 dd_Smed_v4_8275_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013687SMED30013687SMESG000027896.1 dd_Smed_v4_11457_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013056Paired like homeobox 2ASMESG000052478.1 dd_Smed_v4_29211_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006489SMED30006489SMESG000011558.1 dd_Smed_v4_3733_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30012938trimeric intracellular cation channel type 1B.1 isoform X1SMESG000016165.1 dd_Smed_v4_3001_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015015GTP-binding proteinSMESG000055098.1 dd_Smed_v4_37931_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001929F-box domain-containing proteinSMESG000077869.1 dd_Smed_v4_14890_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016068SMED30016068SMESG000024947.1 SMESG000024945.1 SMESG000024886.1 SMESG000024883.1 dd_Smed_v4_15610_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003949Insulin-degrading enzymeSMESG000016400.1 dd_Smed_v4_9500_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003480Lactation elevated protein 1SMESG000074214.1 SMESG000074209.1 dd_Smed_v4_4382_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015672Gelsolin-like proteinSMESG000015928.1 dd_Smed_v4_1215_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002502Choline-phosphate cytidylyltransferaseSMESG000081359.1 dd_Smed_v4_5385_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005936TitinSMESG000005752.1 dd_Smed_v4_2438_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000808Zinc finger MYM-type protein 1SMESG000038481.1 dd_Smed_v4_6644_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014094Kinesin-like proteinSMESG000016386.1 dd_Smed_v4_11012_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000522SMED30000522SMESG000021458.1 dd_Smed_v4_7661_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001446RNA-binding protein 25SMESG000074806.1 dd_Smed_v4_3955_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30011696SMED30011696SMESG000053119.1 SMESG000009621.1 SMESG000003158.1 SMESG000077074.1 SMESG000055143.1 SMESG000049878.1 SMESG000003715.1 dd_Smed_v4_3004_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017160sertSMESG000021044.1 dd_Smed_v4_12700_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017048cilia- and flagella-associated protein 206SMESG000021247.1 dd_Smed_v4_11199_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003279C3H1-type domain-containing proteinSMESG000077844.1 dd_Smed_v4_5036_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003011NPHP1SMESG000061008.1 dd_Smed_v4_9990_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30008550intraflagellar transport protein 20 homologSMESG000067757.1 dd_Smed_v4_9545_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000566Ropporin-1-like proteinSMESG000079804.1 dd_Smed_v4_4888_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013128Death domain proteinSMESG000003436.1 dd_Smed_v4_7532_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007879SMED30007879SMESG000014356.1 dd_Smed_v4_4641_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002152Arf-GAP with SH3 domain ANK repeat and PH domain-containing proteinSMESG000068882.1 dd_Smed_v4_6590_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30008229SMED30008229SMESG000077869.1 dd_Smed_v4_14890_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003010SMED30003010SMESG000061578.1 dd_Smed_v4_4576_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009328SMED30009328SMESG000053119.1 SMESG000009621.1 SMESG000003158.1 SMESG000077074.1 SMESG000055143.1 SMESG000049878.1 SMESG000003715.1 dd_Smed_v4_3004_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002976Integrase_H2C2 domain-containing proteinSMESG000031440.1 dd_Smed_v4_9924_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002295Glutamine-dependent NAD( ) synthetaseSMESG000004423.1 dd_Smed_v4_7717_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019292Ring finger protein 34bSMESG000045336.1 dd_Smed_v4_1395_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003680RanBP-type and C3HC4-type zinc finger-containing protein 1SMESG000004467.1 SMESG000004465.1 SMESG000069298.1 dd_Smed_v4_2819_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005492FHA domain-containing proteinSMESG000051866.1 dd_Smed_v4_8216_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017201SFI1SMESG000002829.1 dd_Smed_v4_12484_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30021820Guanylate cyclaseSMESG000056411.1 dd_Smed_v4_11767_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020981Protein NDRG3SMESG000005138.1 SMESG000005122.1 dd_Smed_v4_1911_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019147SMED30019147SMESG000061850.1 dd_Smed_v4_11560_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016673Cylindromatosis (turban tumor syndrome), bSMESG000056847.1 SMESG000056843.1 SMESG000056838.1 SMESG000044770.1 SMESG000044762.1 SMESG000007140.1 dd_Smed_v4_1137_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017080FHA domain-containing proteinSMESG000061238.1 dd_Smed_v4_11335_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014211MATH domain-containing proteinSMESG000026079.1 dd_Smed_v4_12140_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014211MATH domain-containing proteinSMESG000075612.1 SMESG000026079.1 SMESG000018825.1 SMESG000002232.1 dd_Smed_v4_6759_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019159SMED30019159SMESG000009968.1 dd_Smed_v4_15164_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED3001927340S ribosomal protein S3aSMESG000066540.1 SMESG000066537.1 dd_Smed_v4_163_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017883Serine/threonine-protein phosphataseSMESG000067423.1 dd_Smed_v4_1407_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015008SMED30015008SMESG000001496.1 SMESG000001495.1 dd_Smed_v4_14943_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018860SMED30018860SMESG000058663.1 dd_Smed_v4_10545_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018703SMED30018703SMESG000077766.1 dd_Smed_v4_13378_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018703SMED30018703SMESG000077766.1 dd_Smed_v4_60073_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017379DJ-1SMESG000003454.1 dd_Smed_v4_1223_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016609SMED30016609SMESG000044186.1 dd_Smed_v4_13633_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017770Zinc finger MYM-type protein 1SMESG000042368.1 SMESG000042366.1 dd_Smed_v4_14779_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017031FMRFamide-activated amiloride-sensitive sodium channelSMESG000045131.1 dd_Smed_v4_18219_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016871SMED30016871SMESG000036609.1 dd_Smed_v4_1747_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018205Delta-like proteinSMESG000027403.1 SMESG000027402.1 dd_Smed_v4_11876_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30012656NPHS1-6SMESG000056135.1 dd_Smed_v4_16187_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014047SMED30014047SMESG000025950.1 dd_Smed_v4_1574_6_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014047SMED30014047SMESG000025950.1 dd_Smed_v4_12336_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013374Transmembrane protein 232SMESG000060638.1 dd_Smed_v4_15138_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017587cilia- and flagella-associated protein 65SMESG000069031.1 dd_Smed_v4_12428_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017943SMED30017943SMESG000022837.1 dd_Smed_v4_16017_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014193Peptidase S1 S6 chymotrypsin Hap active site isoform 2SMESG000060842.1 SMESG000038428.1 dd_Smed_v4_15903_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30022857Protocadherin Fat 3SMESG000003985.1 dd_Smed_v4_18595_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30022433SMED30022433SMESG000036199.1 dd_Smed_v4_11599_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30026061SMED30026061SMESG000076482.1 SMESG000076409.1 SMESG000076405.1 SMESG000076390.1 SMESG000076375.1 SMESG000076364.1 SMESG000076223.1 SMESG000040665.1 SMESG000019753.1 dd_Smed_v4_1097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30026086MIEAP domain-containing proteinSMESG000057251.1 dd_Smed_v4_14351_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020437Glutamate receptor ionotropic kainate 3SMESG000005192.1 dd_Smed_v4_13705_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30021824centromere protein JSMESG000028453.1 dd_Smed_v4_13670_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30026166SMED30026166SMESG000017270.1 dd_Smed_v4_13958_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30021613Nesprin-1SMESG000077685.1 dd_Smed_v4_15904_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30021613Nesprin-1SMESG000077685.1 dd_Smed_v4_10214_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020086C2H2-type domain-containing proteinSMESG000042794.1 dd_Smed_v4_10757_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30021972PalmitoyltransferaseSMESG000053356.1 dd_Smed_v4_14057_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30022033G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000043889.1 dd_Smed_v4_16149_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020164SMED30020164SMESG000061910.1 dd_Smed_v4_14161_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30022414SMED30022414SMESG000076482.1 SMESG000076409.1 SMESG000076405.1 SMESG000076390.1 SMESG000076375.1 SMESG000076364.1 SMESG000076223.1 SMESG000040665.1 SMESG000019753.1 dd_Smed_v4_1097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30022414SMED30022414SMESG000076482.1 SMESG000076470.1 SMESG000076469.1 SMESG000076410.1 SMESG000076409.1 SMESG000076408.1 SMESG000076407.1 SMESG000076406.1 SMESG000076390.1 SMESG000076389.1 SMESG000076385.1 SMESG000076375.1 SMESG000076371.1 SMESG000076363.1 SMESG000076358.1 SMESG000076223.1 SMESG000040665.1 dd_Smed_v4_645_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020450Small conductance calcium-activated potassium channel proteinSMESG000036688.1 dd_Smed_v4_13309_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020814SMED30020814SMESG000076482.1 SMESG000076409.1 SMESG000076405.1 SMESG000076390.1 SMESG000076375.1 SMESG000076364.1 SMESG000076223.1 SMESG000040665.1 SMESG000019753.1 dd_Smed_v4_1097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020013SMED30020013SMESG000042368.1 SMESG000042366.1 dd_Smed_v4_14779_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020459SMED30020459SMESG000019441.1 dd_Smed_v4_14381_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006549SMED30006549SMESG000016886.1 SMESG000016875.1 dd_Smed_v4_7893_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018750SMED30018750SMESG000032765.1 SMESG000032764.1 dd_Smed_v4_9225_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000404SMED30000404SMESG000012897.1 dd_Smed_v4_6875_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018620SMED30018620SMESG000029398.1 dd_Smed_v4_11848_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019060Neutral sphingomyelinaseSMESG000012166.1 dd_Smed_v4_8717_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019263Nucleoside diphosphate kinaseSMESG000056344.1 dd_Smed_v4_856_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003355Ig-like domain-containing proteinSMESG000001556.1 SMESG000001555.1 dd_Smed_v4_8246_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007715SMED30007715SMESG000048230.1 dd_Smed_v4_8747_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013480DihydropyrimidinaseSMESG000060188.1 dd_Smed_v4_2040_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30004191SMED30004191SMESG000051011.1 SMESG000046823.1 dd_Smed_v4_9164_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019515SMED30019515SMESG000032393.1 dd_Smed_v4_26526_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005514SMED30005514SMESG000003380.1 dd_Smed_v4_26249_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002066SMED30002066SMESG000016886.1 SMESG000016875.1 dd_Smed_v4_7893_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013077SMED30013077SMESG000076350.1 dd_Smed_v4_7379_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017635Poly(RC)-binding protein 3SMESG000005644.1 dd_Smed_v4_7334_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017792SMED30017792SMESG000011709.1 dd_Smed_v4_8315_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007392tetratricopeptide repeat protein 38SMESG000072019.1 SMESG000071607.1 dd_Smed_v4_3316_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015194SMED30015194SMESG000056142.1 dd_Smed_v4_938_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003675adenylate kinase 7-likeSMESG000075409.1 dd_Smed_v4_5880_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014033SMED30014033SMESG000065669.1 dd_Smed_v4_69578_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017508MetalloendopeptidaseSMESG000045572.1 dd_Smed_v4_11993_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003249ProhibitinSMESG000038397.1 dd_Smed_v4_1038_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30008994phosphorylated CTD-interacting factor 1SMESG000057164.1 dd_Smed_v4_9161_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED300119385'-AMP-activated protein kinase subunit gamma-1SMESG000078418.1 dd_Smed_v4_8677_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018834SMED30018834SMESG000010762.1 dd_Smed_v4_3061_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005681Nkap_C domain-containing proteinSMESG000047456.1 SMESG000047455.1 dd_Smed_v4_6988_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014525Dolichyl-diphosphooligosaccharide--protein glycosyltransferase 48 kDa subunitSMESG000010589.1 dd_Smed_v4_948_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000846CaltractinSMESG000029908.1 dd_Smed_v4_8753_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001680SMED30001680SMESG000002033.1 dd_Smed_v4_884_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007277Tryptophan-2,3-dioxygenaseSMESG000075109.1 dd_Smed_v4_3550_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014099SMED30014099SMESG000068932.1 dd_Smed_v4_7094_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015202Splicing factor U2af subunit like proteinSMESG000002374.1 dd_Smed_v4_3092_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001543X1.A.G7.1SMESG000046822.1 dd_Smed_v4_7962_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30012517DIRP domain-containing proteinSMESG000035512.1 SMESG000035510.1 dd_Smed_v4_8904_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014090SMED30014090SMESG000012851.1 dd_Smed_v4_29680_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014090SMED30014090SMESG000012851.1 dd_Smed_v4_22852_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30012777Usp domain-containing proteinSMESG000035960.1 dd_Smed_v4_7254_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006256SMED30006256SMESG000034101.1 dd_Smed_v4_9313_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018995PhosphodiesteraseSMESG000074268.1 SMESG000050484.1 dd_Smed_v4_6367_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019930mmp1 proteinSMESG000040780.1 SMESG000040772.1 dd_Smed_v4_274_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018233Troponin C, skeletal muscleSMESG000005066.1 dd_Smed_v4_12048_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016660SMED30016660SMESG000029398.1 dd_Smed_v4_11848_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001583Protocadherin delta 1SMESG000022902.1 dd_Smed_v4_8478_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30010966Core 1 udp-galactose:n-acetylgalactosamine-alpha-r beta 1,3-galactosyltransferase, putativeSMESG000061089.1 dd_Smed_v4_2796_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019972Kinesin-like proteinSMESG000017021.1 dd_Smed_v4_9460_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003935AAA domain-containing proteinSMESG000012845.1 dd_Smed_v4_9637_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30012877ATP-binding cassette sub-family A memberSMESG000068605.1 dd_Smed_v4_32573_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30011943Fibronectin type III and ankyrin repeat domains 1SMESG000033969.1 dd_Smed_v4_7571_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005654SMED30005654SMESG000044586.1 dd_Smed_v4_6921_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30004214SMED30004214SMESG000055805.1 dd_Smed_v4_857_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30010468RBR-type E3 ubiquitin transferaseSMESG000062644.1 dd_Smed_v4_3281_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018185SMED30018185SMESG000003780.1 dd_Smed_v4_9295_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002801insulin gene enhancer protein isl-1SMESG000059633.1 dd_Smed_v4_8820_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015061G protein regulated inducer of neurite outgrowthSMESG000062691.1 dd_Smed_v4_10294_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30008080Transmembrane protein 45BSMESG000060226.1 SMESG000021986.1 dd_Smed_v4_1542_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30010203C2H2-type domain-containing proteinSMESG000067728.1 dd_Smed_v4_1455_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006859Peptidyl-prolyl cis-trans isomeraseSMESG000059112.1 dd_Smed_v4_10327_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005404RanBP-type and C3HC4-type zinc finger containing 1SMESG000081060.1 dd_Smed_v4_1293_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019623serrate RNA effector moleculeSMESG000030605.1 dd_Smed_v4_1872_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000411Dynamin-1SMESG000021502.1 dd_Smed_v4_2160_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006557SMED30006557SMESG000034885.1 dd_Smed_v4_12780_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002946PKD1L-1SMESG000067002.1 dd_Smed_v4_27650_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002946PKD1L-1SMESG000067002.1 dd_Smed_v4_15525_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007993GTP-binding proteinSMESG000065983.1 dd_Smed_v4_11291_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001875Dynein light chain roadblockSMESG000072361.1 dd_Smed_v4_1126_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30035674NADP-dependent oxidoreductase domain containing 1SMESG000062781.1 dd_Smed_v4_14962_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30032025NPYR-5SMESG000004267.1 dd_Smed_v4_16725_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30034880Discoidin domain-containing receptor 2SMESG000067438.1 dd_Smed_v4_10406_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30033100Dihydropteridine reductaseSMESG000060612.1 dd_Smed_v4_2408_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30021469intraflagellar transport protein 22 homologSMESG000052133.1 dd_Smed_v4_11176_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30034416Synaptotagmin-like 5SMESG000078217.1 dd_Smed_v4_10429_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30026121Ectonucleotide pyrophosphatase/phosphodiesterase family member 6SMESG000040292.1 dd_Smed_v4_1269_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30021903SMED30021903SMESG000040469.1 dd_Smed_v4_10729_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30026519SMED30026519SMESG000064314.1 dd_Smed_v4_16650_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30026227SMED30026227SMESG000055174.1 SMESG000055172.1 dd_Smed_v4_10518_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30031682Ras guanyl-releasing protein 3SMESG000035948.1 dd_Smed_v4_15742_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30031682Ras guanyl-releasing protein 3SMESG000035948.1 dd_Smed_v4_15742_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30032035SMED30032035SMESG000064986.1 dd_Smed_v4_11403_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30035715Sodium channel proteinSMESG000075431.1 SMESG000075430.1 dd_Smed_v4_12243_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30035715Sodium channel proteinSMESG000075430.1 dd_Smed_v4_38612_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30026245SMED30026245SMESG000079026.1 dd_Smed_v4_16190_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30027281CalpainSMESG000079026.1 dd_Smed_v4_16190_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020941beta 1,3 galactosyltransferase-1SMESG000008720.1 dd_Smed_v4_10927_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30031269SMED30031269SMESG000023258.1 dd_Smed_v4_3718_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30025786SMED30025786SMESG000009944.1 dd_Smed_v4_16708_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30029122ATP-dependent DNA helicaseSMESG000028029.1 dd_Smed_v4_11145_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30021807SMED30021807SMESG000030582.1 dd_Smed_v4_1124_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30030953Dimer_Tnp_hAT domain-containing proteinSMESG000079481.1 SMESG000064306.1 SMESG000055041.1 SMESG000052607.1 SMESG000047756.1 SMESG000036787.1 SMESG000035547.1 SMESG000026972.1 SMESG000026708.1 SMESG000025874.1 SMESG000023292.1 SMESG000007438.1 dd_Smed_v4_17002_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30032555cAMP-dependent protein kinase catalytic subunit, putativeSMESG000000892.1 dd_Smed_v4_17154_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020781SMED30020781SMESG000026458.1 dd_Smed_v4_15391_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30025623SMED30025623SMESG000065670.1 dd_Smed_v4_10718_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30034138Coiled-coil domain-containing protein 96SMESG000050787.1 dd_Smed_v4_11884_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30033385Endoglin CD105 antigenSMESG000025327.1 dd_Smed_v4_17373_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30030634Family with sequence similarity 184 member ASMESG000058677.1 dd_Smed_v4_16975_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30032143slc16a-28SMESG000056616.1 dd_Smed_v4_12311_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30033335SMED30033335SMESG000002226.1 dd_Smed_v4_10738_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30029399SMED30029399SMESG000015116.1 dd_Smed_v4_10874_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30023736sine oculis-1/2SMESG000001687.1 dd_Smed_v4_15436_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30025807RuvB-like helicaseSMESG000033997.1 SMESG000018207.1 dd_Smed_v4_2547_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30022392PKD1L-1SMESG000067002.1 dd_Smed_v4_27650_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30022392PKD1L-1SMESG000067002.1 dd_Smed_v4_15525_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30024943SMED30024943SMESG000064314.1 dd_Smed_v4_16650_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30035297DNA repair protein complementing XP-A cellsSMESG000010409.1 dd_Smed_v4_1950_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30011968SMED30011968SMESG000019928.1 dd_Smed_v4_6314_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013086SMED30013086SMESG000011794.1 dd_Smed_v4_3694_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30004755RING-type domain-containing proteinSMESG000015738.1 dd_Smed_v4_14782_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015276SMED30015276SMESG000054104.1 SMESG000017493.1 SMESG000016095.1 SMESG000014571.1 dd_Smed_v4_3885_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003981Tctex1 domain containing 1SMESG000021852.1 dd_Smed_v4_12108_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007290GATA456SMESG000039559.1 SMESG000037031.1 dd_Smed_v4_4075_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005657Malic enzymeSMESG000045895.1 dd_Smed_v4_2140_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006119X-box-binding protein 1SMESG000048111.1 dd_Smed_v4_415_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001049Ubiquitin carboxyl-terminal hydrolaseSMESG000038532.1 SMESG000038519.1 SMESG000038510.1 SMESG000036103.1 SMESG000036102.1 SMESG000036062.1 dd_Smed_v4_8017_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001049Ubiquitin carboxyl-terminal hydrolaseSMESG000036112.1 SMESG000036067.1 dd_Smed_v4_9156_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002038Calsyntenin 1SMESG000002834.1 SMESG000002830.1 dd_Smed_v4_1518_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001010SMED30001010SMESG000039006.1 dd_Smed_v4_13470_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014853N-acyl-phosphatidylethanolamine-hydrolyzing phospholipase DSMESG000000990.1 dd_Smed_v4_6408_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30011420Trinucleotide repeat containing 4-like proteinSMESG000005424.1 dd_Smed_v4_11349_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009284Hsp70SMESG000056256.1 dd_Smed_v4_424_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009142Hepatoma derived growth factor proteinSMESG000037796.1 SMESG000057565.1 SMESG000057564.1 dd_Smed_v4_2842_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006112Calcium activated potassium channel subunitSMESG000053268.1 dd_Smed_v4_12880_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009737Testis-specific Y-encoded-like protein 1SMESG000026284.1 dd_Smed_v4_326_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000785Protocadherin-1SMESG000026621.1 dd_Smed_v4_6467_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30004117Peptidyl-prolyl cis-trans isomeraseSMESG000070665.1 dd_Smed_v4_2064_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003593Structural maintenance of chromosomes proteinSMESG000017173.1 SMESG000017172.1 dd_Smed_v4_3809_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007162SMED30007162SMESG000081806.1 SMESG000081805.1 dd_Smed_v4_12844_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED3000013460S ribosomal protein L4SMESG000009479.1 dd_Smed_v4_211_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30010780SMED30010780SMESG000028899.1 dd_Smed_v4_36575_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30012677Coiled-coil domain-containing protein 51SMESG000058452.1 dd_Smed_v4_12107_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000256Golgin subfamily A member 2SMESG000047115.1 SMESG000004000.1 dd_Smed_v4_6515_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000256Golgin subfamily A member 2SMESG000047115.1 SMESG000004000.1 dd_Smed_v4_2558_0_2dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30011750Phosphoinositide phospholipase CSMESG000070728.1 dd_Smed_v4_39585_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30011750Phosphoinositide phospholipase CSMESG000070741.1 SMESG000070728.1 dd_Smed_v4_9716_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007495SMED30007495SMESG000017466.1 SMESG000017458.1 dd_Smed_v4_13059_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015071Eyes absent homologSMESG000001561.1 dd_Smed_v4_11372_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30004097SMED30004097SMESG000031258.1 dd_Smed_v4_12080_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001510Protein unc-79 homologSMESG000053097.1 dd_Smed_v4_6600_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30004301Transposon Ty3-I Gag-Pol polyproteinSMESG000023258.1 dd_Smed_v4_3718_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001493Calcium-activated potassium channel slo-1, putativeSMESG000014623.1 dd_Smed_v4_13498_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous system