nervous system

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ Description

  ▻ Figures

  ▻ In Situ Hybridization Data

  ▻ Sequences

  ▻ References

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  nervous system


DEFINITON:

  The nervous system is an organ system containing predominantly neuron and glial cells. In bilaterally symmetrical organisms, it is arranged in a network of tree-like structures connected to a central body. The main functions of the nervous system are to regulate and control body functions, and to receive sensory input, process this information, and generate behavior [CUMBO].


TERM DEFINITION CITATIONS:

  UBERON:0001016


TERM CITATIONS:


TERM ID:

  PLANA:0000025


ABOUT THIS TERM:

nervous system

  ↳is a anatomical system

  ↳part of sexual organism


  → neural progenitor cell develops into nervous system


  → central nervous system and peripheral nervous system is a nervous system


Expand to see terms that part of nervous system


BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


DESCRIPTION:   

WISH developmental time course data for two markers expressed in differentiated neurons, synaptotagmin and PC-2, suggests that the nervous system is limited to neurons in the temporary embryonic pharynx of S2-S5 embryos (Figure 1 – figure supplement 16 D, Figure 1 – figure supplement 12 A). Validated and presumptive neural progenitor markers showing low to undetectable expression during early embryogenesis are upregulated as organogenesis commences during S5 (Figure 1 – figure supplement 16 A) (Cowles et al., 2013; Currie and Pearson, 2013; Lapan and Reddien, 2012; März et al., 2013; Monjo and Romero, 2015; Scimone et al., 2014; Wenemoser et al., 2012), and many transcripts exhibiting enriched expression in adult neurons show upregulated expression during and after S5 (Figure 1 – figure supplement 16 C). During S6 and S7, neural progenitors and their descendants must migrate, interact, and organize themselves into two bilaterally symmetric cephalic ganglia and the attendant ventral nerve cords, commissural and peripheral neurons (Figure 1 – figure supplement 16 D). Differentiating neurons accumulate in the presumptive anterior region of the embryo, adjacent to the D/V margin, as the cephalic ganglia form (Figure 1 – figure supplement 16 B,D, cyan arrows). Ventral nerve cord formation is evident during S6, and appears to proceed from anterior to posterior (Figure 1 – figure supplement 16 D, cyan arrowheads). Gross morphology of the nervous system is comparable to that of adult animals during S7-S8 (Figure 1 – figure supplement 16 B,D).


 

back to top


FIGURES:


Figure 1 – figure supplement 16: Molecular markers for the developing nervous system

A, C: Average RPKM values per embryo for validated and putative adult neural progenitor transcripts (Cowles et al., 2013; Currie and Pearson, 2013; Lapan and Reddien, 2012; März et al., 2013; Monjo and Romero, 2015; Scimone et al., 2014; Wenemoser et al., 2012) (A) and adult neural classifier transcripts identified in single cell sequencing experiments (Wurtzel et al., 2015) (C), Y (yolk), Stage (S) S2-S8.  Neural transcripts that showed enriched expression during S5, S6, S7 and/or S8 are flagged in excel tables for S5-S8 enriched transcripts (Figure 1 – source data 5, Figure 1 – source data 6, Figure 1 – source data 7, Figure 1 – source data 8). 90% (n=533) of the neural enriched transcripts reported in (Wurtzel et al., 2015) were identified in the smed20140614 transcriptome; 60% (n=323) of the cross-referenced transcripts were enriched during S5, S6, S7 and/or S8. 

B, D: Expression of the neural progenitor marker pax6a (B) and the neural marker synaptotagmin (syt, D) (blue), S2-S8. Anterior: top (S6-S8). O: oral hemisphere. A: aboral hemisphere. D: dorsal. V: ventral. Black arrowheads: temporary embryonic pharynx.  Red arrowheads: definitive pharynx. Cyan arrows: cephalic ganglia. Cyan arrowheads: ventral nerve cords. Scale bars: 100 µm.

 

 

back to top


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30024586AFJ24746.1Pax6Apax6AStage 5, Stage 6, Stage 7, Stage 8nervous system, neural progenitor cell
SMED30022907SynaptotagminDj-sytStage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, ventral nerve cord, neuron, cephalic ganglia, nervous system, embryonic pharynx
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30019471 ID=SMED30019471|Name=Synaptotagmin|organism=Schmidtea mediterranea sexual|type=transcript|length=1910bp
TTTGGGACTTCTCCAATCTATTAAATATATTTAGAACGAACATCGTTGTGAGAAGCTTTGTCTTGCAAATGCACACCAAC
ACATTCTCTGCCTACTCGAGACCAGCCTGAAGGACGCACCCAGTCATCTCTTATAAAAAAAAAACTCTTCTCTGATTCGG
TATTTTCTGATTAATGGAGATCAAACAATGATTGGGCAACGTCTAGTTTAGAATATTTACAACTAAATCTGCGTATTTCA
ATTTTTTTTCGATTTTGATTGTTGCAAATATTTATGAGTATATCCAATAATATAAGCAGCGCTAGTAATATGACGATAAA
AATGCAACAAAATGTTGAAAAGTCTGTATCACAGCATGTAACAGCGCAAACAAAGGAATCAACATCAAATAAACTTCATA
CAACAACAGCCGGTATCTCGGTTTTGGAGAAAACATTAAAAACATTTCACATGAGTACTGGCACTTTGATTGGAATCGGA
GTTACAGTGTCTATCGTAGTTTTATTACTTCTTTATTGTATTTGCAAACGATGCATTAAGAAACGAAAGAAAAAGAAAGA
TGGCGGCAAAAAAGGTGGAAAAGGCGTAGACATGAAAAGCGTACAACTATTAGGAAATGCTTATAAAGAAAAGGTACAGC
CGGACCTAGAAGAACTGGATGCTAACATGGAAGATAATGAAGGGGCGCAAGATAAAGAAGCAGTCAATCTTGGAAAATTA
CAGTATTCCCTTGATTACGATTTTACAAAAGGCGAGCTAACAGTCGGAGTAATTCAAGCCACAGATCTCCCAGCAATGGA
CATGTCAGGAACTTCTGATCCATATGTGAAAGTTTTTCTATTACCGGATAAAAAGAAAAAATTCGAAACCAAAGTTCATC
GAAAAATATTAAATCCAGTCTTTAATGAGACATTTGTATTCAAGATTCCTTATTCTGAGGTCGGGTCTAAAACTTTGGTA
TTTAATGTTTTCGATTTCGACAGATTTTCAAAGCATGATCAAATTGGGCAAATCCAAATTCCACTGGGTTCAGTAGATTT
ATGCAAAGTTATTGAGGAATGGAAGGAACTCGGCCCACCTGACAGTGATAATGAAAAGGAAAATCGATTAGGAGACATTT
GTTTTTCTTTGAGATATGTTCCAACGTCTGGAAAGTTGAATATCGTCATTCTGGAAGCTAAAAACCTCAAGAAAATGGAT
GTTGGAGGATTGTCGGATCCTTACGTGAAACTATCGTTGATGCTTAACGGCAAACGAGTGAAAAAGAAGAAAACCACAAT
AAAAAAATACACATTAAATCCTTATTATAATGAGTCATTTTCATTCGAAGTTCCATTCGAGCAAATACAAAAAGTTAATT
TAATAGTGACAGTAGTTGATTATGATAGAATTGGAACAAGTGAACCTATTGGAAGAGTAGTTCTTGGATGCAATGCTACA
GGAGCAGAACTTCGGCACTGGTCCGATATGCTTGCTAATCCTAGGAGACCAATTGCCCAGTGGCATACCCTTCAAGATAT
GCCGGAGAAGAGCTGATTTCATTGATTTTAATTTTAAAATCTGTCATATTTTGTGATAAATTTTGCGTATTTATACAATC
ATTCGATTCGATCTTTCCATCAAGTTTCGTAAAATCTGCAGACATTCACGAGGATGCAGAAGAAATAGAAACTTTGTAAT
AAATTAGCATTAGCTGTGATCTCCTATTGACCAAAAAACATAAACTTAATTTTTATAAAGAATTGTGGTGAAATGTTGTT
AGGTTTCAGTCATAGATAACTGTATTTGTGTAATAGTTTGTGTATTTCTCGTCCTGGCCCGATTTTGTGCATTCCACTGG
CAATACTATTTCACTAATAAATTATGTCTGATAATGTATACCAGTATAGGATTTTGTTTGAATTAATGAA
>SMED30022907 ID=SMED30022907|Name=Synaptotagmin|organism=Schmidtea mediterranea sexual|type=transcript|length=1814bp
ATTTATTGAAAATTATTTTTTCTATTATTAGGAGAAAATTGATTATTTTTTTTTGACAAAATAAGTTTTGGATATATTTC
CCATTTGTTTGTATTCGTAAACCAATGAAGAATTCGACTCACGGATCGGATCATTCGGCCAGCAAGGCCAGTATGAAAAC
GAATGTGGAAAAATTTTGGCATGATCTCGGAAAAAAATTGCACATGGATCCAAAAGCATTAATAGGAGTAACAATCGGTT
TGGGAATATTGTTTTTGTTGTTCCTTTATTGCTTATGTAAAAAATGTGTTTTCAAGCGTCGAAAAAAGAAGGAAACGGCC
AAAAAAGGAGCCAAGGGAGTAGTCGATATGAAAAGTGCCCAATTGTTGGGGAATTCATATAAAGAAAAAATTCAACCCGA
TCTTGAAGAACTTGATGCAAACATGGAAGACAATGAAGGTGTAAAAGAAAAAGAAGATGTTCATTTAGGAAAATTACAAT
ATTCTCTAGATTATGATTTTCAGAAAGGAGAATTAACTGTTGGAGTTATTCAAGCAACTGATCTTCCAGCTATGGATATG
TCAGGAACATCAGATCCATATGTCAAATTATACCTTCTCCCAGACAAGAAAAAGAAATTCGAAACAAAGGTTCATAGGAA
AATTTTAAATCCTGTATTCAATGAAACTTTTGTTTTCAAAGTTCCTTTCAATGAAGTTGCATCGAAGACTTTGATTTTCA
ACGTTTATGACTTTGACAGATTTTCCAAACACGATCAAATCGGTCAAATAAAAGTACCATTGGGAGCTATAGATTTAGGT
CGAGTTATTGAAGAATGGAAGGAACTGGAATCTCCAGAAAACGATGGGGAAAAGGAAAACAGGTTGGGAGACATTTGTTT
CTCTTTAAGATACGTACCGACATCTGGAAAGCTTACAATAGTCATTTTGGAAGCAAAGAATCTTAAAAAAATGGATGTCG
GAGGATTGTCTGATCCATATGTTAAACTTTCCTTGATGCTTAATGGTAAACGAGTGAAGAAGAAGAAAACTACCATCAAA
AAGTATACACTAAATCCTTACTACAATGAATCATTTTCCTTTGAAGTACCATTCGAACAAATACAAAAAGTGAACTTGAT
CGTCACGGTTGTTGATTATGACAGAATCGGAACCAGCGAACCGATAGGTAGAATTGTTCTGGGATGTAACGCAACTGGAG
CAGAATTGCGACATTGGTCGGATATGTTGGCAAATCCCCGGCGACCAATCGCCCAGTGGCATACCCTCCAAGAGATGCCA
GAGAACAATTGATAGTGTTCGTTTGATGCTTTAAAGCGGTTTGCATAATTCGTGAAATAAGTTATCAAAATTTGAGAAAT
GTTTTTTTTTCTGAAACAAAAATGGCATGAGACAATATACCAGAGTTCATTAGTGTGTGGTTTCGTTGAATATTTTGGTG
GTGTTGCATCTTATCGTTTGTCCTCTAATCTAATAATGTTTTATTCTTTATATAGCTGATTTATTCTCGAGCGAAACATT
TTTTATGTGTACCAAAATACTTATGTCATAGCCATTGTGATTAGTCTGTAAACTATTGCGTAATAGCCCCTCTCATTGGC
TTTTTTTAAGAGTAGTGAGTTGGAAAAAAAAATACAAAAATGACTTCAATTGTTAAACATTACTCATATTTTATCAGTAA
GTTAACTTGCATATTTGCAGTTAATTATGGCATTTTATCTCTAAATCTCTGAAGCATGGCCTCAAGTCTTTTGTTTGTTT
TAATGTAATTATGTCTAGATGAGAATATTAAAATACTTCGGTTTATATAAAAGA
>SMED30024586 ID=SMED30024586|Name=Pax6A|organism=Schmidtea mediterranea sexual|type=transcript|length=1992bp
GTTGGTTTTTCTAACAGATTTATTAATGCTAGATTGGCCGCTCAAGATTAATCATAATATTCTGCTACTTTACTGATATA
ATTTTTATACACGGTTACTACTACTCCTCTACTATTTTCGCATTGTTGGCTTCTCAAATTCAATCCCTGGGCATAAATCA
AACCGCTTCATTGACAAAATCCTTTTTGACACTACAAGAAATTGATTCAGTTACTGAAGTAGAAAATATACACAGTCGAA
ACCTATGACCGAATCGAATGAAGAGGAAATAAAAAATAAAAAGAAAGTTAAACGAGGACATTCAGGAATCAATCAATTAG
GTGGAATGTTTGTCAACGGTCGACCTTTGCCCGATTCGACCCGACAGAGAATCGTTGAGTTGGCTCACTCCGGAGCGAGA
CCATGTGATATTTCCCGAATCCTCCAAGTTTCCAATGGATGCGTCAGTAAAATCCTATGCAGATACTACGAAACCGGTTC
AATTCGACCGAAAGCCATCGGAGGCAGCAAACCAAGAGTAGCTACCAGTTCAGTTGTGTCGAAAATTGCCGCCTACAAAC
GTGAATGCCCGTCGATATTTTCTTGGGAAATTCGCGATAGATTATTACAGGAAGGGGTTTGCAATCAGGATAACATTCCC
AGTGTCTCTTCGATAAATCGTGTTCTACGCAGTTTGTCTAATGAAAACCAACGACATTTAGTTGCAGCAACTGGAATGTA
TGACAAACTGTCATTGTTAAGCGGCCAGCCTTGGTCTACTGCAGCTGCTCATGCGGCTTGGTATTCCAGTGCTGCAGCAG
CACATGGGTATGCTTCATCGACATTTCCCAATTGTGGTGCCTATGGAGGCTTAACCGGAATCGGAATTATCAATGGAATG
AGTACAGCCCACGCGGTAGCGTCAATTAATCAGTCGAATTCCGGGGTCACAAATTACCATGTTCAATCAACAACCGATAG
TTCCGACAAACACAAATCAGAAAAATATTCAGAATCCATTGCACATTCTGAATCGAATGCTTCCAGTGAGCCTGGCAACG
AATATATGTCCGGAGTAAAAAGTGAGAATGATGATATGAGAATTAAACTGAAAAGGAAACTTCAAAGAAATCGAACATCG
TTTTCAACAGATCAGCTTGATTCTTTGGAAAAAGAATTTGAACGAACTCATTATCCTGATGTATTCGCCAGAGAGAAATT
GGCAGACAAAATCAGTCTTCCAGAGGCGAGAATACAAGTTTGGTTTTCAAATCGAAGAGCAAAATGGAGACGAGAAGAAA
AACTTCGTCGACAACGGCAAAATCTTATGCTTGGTTCAAACGGAACAAGTTCTACTGCTGATACTAATGTAACAACAAAT
GGAAATACTCAATGTTTGTCGACAACCGGACAAAATTCAATGGGATTTTCTGGAATAAATGATATCAGAAACCAATTTGG
TGATGTTGGAATGCAAACACCTTCATTGTCGGCTGTAGCAGCTGCAGGAATGTACCATTCGGCAGTTGCCTCTGCTGCAG
ATCAGTATGCAAAATCAGCCGGTTTACCAAATCTTTCGCAATCGTCAATCAATTCTCCATATTCCTACATGGCAAATTTG
CAGTCGAGATCCAGTGGTTCCCAAATTGACTTGCCAAACGTTACAAGCAATTCAAATTCTTTTTACAACCCCGGATCAGT
TTATCCCCCAAGTTTATTTCAAGGTGTAATGAGAGGATATGACACCATTGGATATCCCAAGTATCCTTCAGCAATGTTTC
CAGGATCACTCGAAAGTAATAATAATATCAACCCTGCCGGTTTTCTTGCAAATAATATGTCTTCGAATTCATCTAAACCC
GATTACGATTTCTCAGCATTTAATCGGCCCAGCAATTATTGGACTCCGGTCGCATAAAATTGCACAAATGAATGAAAACA
ATTTCAAAAATTCCGAAACAACAATGATTAGAACAAAAAAAACATTTTTCTAAAATAGTTGTTAATTTAAAC

 

back to top


ADDITIONAL REFERENCES:


Cowles, M.W., Brown, D.D., Nisperos, S.V., Stanley, B.N., Pearson, B.J., and Zayas, R.M. (2013). Genome-wide analysis of the bHLH gene family in planarians identifies factors required for adult neurogenesis and neuronal regeneration. Development 140, 4691-4702.

Currie, K.W., and Pearson, B.J. (2013). Transcription factors lhx1/5-1 and pitx are required for the maintenance and regeneration of serotonergic neurons in planarians. Development 140, 3577-3588.

Lapan, S.W., and Reddien, P.W. (2012). Transcriptome analysis of the planarian eye identifies ovo as a specific regulator of eye regeneration. Cell Rep 2, 294-307. 

März, M., Seebeck, F., and Bartscherer, K. (2013). A Pitx transcription factor controls the establishment and maintenance of the serotonergic lineage in planarians. Development 140, 4499-4509. 

Monjo, F., and Romero, R. (2015). Embryonic development of the nervous system in the planarian Schmidtea polychroa. Dev Biol 397, 305-319.

Scimone, M.L., Kravarik, K.M., Lapan, S.W., and Reddien, P.W. (2014). Neoblast specialization in regeneration of the planarian Schmidtea mediterranea. Stem Cell Reports 3, 339-352.

Wenemoser, D., Lapan, S.W., Wilkinson, A.W., Bell, G.W., and Reddien, P.W. (2012). A molecular wound response program associated with regeneration initiation in planarians. Genes Dev 26, 988-1002.

 

back to top



PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in nervous system. Click this link to learn more about PAGE.


PAGE Curations: 109


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
nervous systemSMED30023758F-box domain-containing proteinSMESG000065201.1 dd_Smed_v6_8211_0_1dd_Smed_v6PMID:29291974
Strand et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30030980S-phase kinase-associated protein 1SMESG000054815.1 DN305227ncbi_smed_estsPMID:29291974
Strand et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30003098F-box and WD repeat domain containing 7SMESG000065201.1 dd_Smed_v6_8211_0_1dd_Smed_v6PMID:29291974
Strand et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30003218SMED30003218SMESG000027728.1 dd_Smed_v6_9752_0_1dd_Smed_v6PMID:29291974
Strand et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30013438Mitochondrial division protein 1SMESG000011456.1 DN311839ncbi_smed_estsPMID:29291974
Strand et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30004687F-box/LRR-repeat protein 2SMESG000081003.1 DN304091ncbi_smed_estsPMID:29291974
Strand et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30004088Ubiquitin conjugating enzyme morgueSMESG000027551.1 DN300983ncbi_smed_estsPMID:29291974
Strand et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30008868SMED30008868SMESG000034993.1 dd_Smed_v6_7155_0_1dd_Smed_v6PMID:29291974
Strand et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30001929F-box domain-containing proteinSMESG000077869.1 dd_Smed_v6_14890_0_1dd_Smed_v6PMID:29291974
Strand et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30008229SMED30008229SMESG000077869.1 dd_Smed_v6_14890_0_1dd_Smed_v6PMID:29291974
Strand et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30031525Choline O-acetyltransferaseSMESG000051357.1 FG310880ncbi_smed_estsPMID:23318641
Chen et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30027106SMED30027106SMESG000008070.1 SMESG000008069.1 BK007043.1smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult fluorescence in situ hybridization evidence
nervous systemSMED30010096TPA_inf: prohormone convertase 2SMESG000008070.1 SMESG000008069.1 BK007043.1smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult fluorescence in situ hybridization evidence
nervous systemSMED30031525Choline O-acetyltransferaseSMESG000051357.1 FG310880ncbi_smed_estsPMID:24992682
Vásquez-Doorman et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30016693InnexinSMESG000059204.1 AY067877smed_ncbi_20200123PMID:17670787
Oviedo et al., 2007
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30025205InnexinSMESG000060499.1 AY067167smed_ncbi_20200123PMID:17670787
Oviedo et al., 2007
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30010455InnexinSMESG000048374.1 NB.39.10encbi_smed_estsPMID:17670787
Oviedo et al., 2007
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30027106SMED30027106SMESG000008070.1 SMESG000008069.1 BK007043.1smed_ncbi_20200123PMID:25558068
Reuter et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
nervous systemSMED30013810TeashirtSMESG000008973.1 KP003815.1smed_ncbi_20200123PMID:25558068
Reuter et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
nervous systemSMED30010096TPA_inf: prohormone convertase 2SMESG000008070.1 SMESG000008069.1 BK007043.1smed_ncbi_20200123PMID:25558068
Reuter et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
nervous systemSMED30031525Choline O-acetyltransferaseSMESG000051357.1 FG310880ncbi_smed_estsPMID:25725068
Owen et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30027106SMED30027106SMESG000008070.1 SMESG000008069.1 BK007043.1smed_ncbi_20200123PMID:29557542
Han et al., 2019
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30010096TPA_inf: prohormone convertase 2SMESG000008070.1 SMESG000008069.1 BK007043.1smed_ncbi_20200123PMID:29557542
Han et al., 2019
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30031525Choline O-acetyltransferaseSMESG000051357.1 FG310880ncbi_smed_estsPMID:21566185
Wagner et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
nervous systemSMED30027106SMED30027106SMESG000008070.1 SMESG000008069.1 BK007043.1smed_ncbi_20200123PMID:21566185
Wagner et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
nervous systemSMED30027106SMED30027106SMESG000008070.1 SMESG000008069.1 BK007043smed_ncbi_20200123PMID:21566185
Wagner et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
nervous systemSMED30016589SynapsinSMESG000063523.1 dd_Smed_v6_3135_0_1dd_Smed_v6PMID:21566185
Wagner et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
nervous systemSMED30016589SynapsinSMESG000063523.1 AY067773smed_ncbi_20200123PMID:21566185
Wagner et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
nervous systemSMED30010096TPA_inf: prohormone convertase 2SMESG000008070.1 SMESG000008069.1 BK007043.1smed_ncbi_20200123PMID:21566185
Wagner et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
nervous systemSMED30010096TPA_inf: prohormone convertase 2SMESG000008070.1 SMESG000008069.1 BK007043smed_ncbi_20200123PMID:21566185
Wagner et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
nervous systemSMED30022907SynaptotagminSMESG000025329.1 SMED30022907smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 5 colorimetric in situ hybridization evidence
nervous systemSMED30022907SynaptotagminSMESG000025329.1 SMED30022907smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
nervous systemSMED30022907SynaptotagminSMESG000025329.1 SMED30022907smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
nervous systemSMED30022907SynaptotagminSMESG000025329.1 SMED30022907smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
nervous systemSMED30024586Pax6ASMESG000039056.1 JX010503.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
nervous systemSMED30024586Pax6ASMESG000039056.1 JX010503.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 5 colorimetric in situ hybridization evidence
nervous systemSMED30024586Pax6ASMESG000039056.1 JX010503.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
nervous systemSMED30024586Pax6ASMESG000039056.1 JX010503.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
nervous systemSMED30024586Pax6ASMESG000039056.1 SMED30024586smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
nervous systemSMED30024586Pax6ASMESG000039056.1 SMED30024586smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 5 colorimetric in situ hybridization evidence
nervous systemSMED30024586Pax6ASMESG000039056.1 SMED30024586smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
nervous systemSMED30024586Pax6ASMESG000039056.1 SMED30024586smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
nervous systemSMED30024586Pax6ASMESG000039056.1 AFJ24746.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
nervous systemSMED30024586Pax6ASMESG000039056.1 AFJ24746.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 5 colorimetric in situ hybridization evidence
nervous systemSMED30024586Pax6ASMESG000039056.1 AFJ24746.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
nervous systemSMED30024586Pax6ASMESG000039056.1 AFJ24746.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
nervous systemSMED30024368chromodomain helicase DNA-binding protein 4SMESG000068192.1 GU980571.1smed_ncbi_20200123PMID:20223763
Scimone et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30014145SMED30014145 DN308176ncbi_smed_estsPMID:25356635
Cowles et al., 2014
whole organism asexual adult fluorescence in situ hybridization evidence
nervous systemSMED30033838Secreted peptide prohormone 18SMESG000030647.1 ADC84438smed_ncbi_20200123PMID:25356635
Cowles et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30018588MusashiSMESG000077233.1 DN311207ncbi_smed_estsPMID:25356635
Cowles et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30029355SMED30029355 DN308442ncbi_smed_estsPMID:25356635
Cowles et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30029006LITAF domain-containing proteinSMESG000020865.1 DN306897ncbi_smed_estsPMID:25356635
Cowles et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30025852Thrombospondin-1SMESG000014733.1 DN306833ncbi_smed_estsPMID:25356635
Cowles et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30022151CaveolinSMESG000074524.1 KJ187183smed_ncbi_20200123PMID:25356635
Cowles et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30020684Neural cell adhesion molecule 1SMESG000060956.1 DN304033ncbi_smed_estsPMID:25356635
Cowles et al., 2014
whole organism asexual adult fluorescence in situ hybridization evidence
nervous systemSMED30026581Otopetrin-2-like isoform X1 isoform 2 DN308442ncbi_smed_estsPMID:25356635
Cowles et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30022326Cerebral peptide prohormone like-1SMESG000015527.1 DAA33901smed_ncbi_20200123PMID:25356635
Cowles et al., 2014
whole organism asexual adult fluorescence in situ hybridization evidence
nervous systemSMED30022326Cerebral peptide prohormone like-1SMESG000015527.1 DAA33901smed_ncbi_20200123PMID:25356635
Cowles et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30023495V-SNARE coiled-coil homology domain-containing proteinSMESG000057424.1 DN307612ncbi_smed_estsPMID:25356635
Cowles et al., 2014
whole organism asexual adult fluorescence in situ hybridization evidence
nervous systemSMED30023495V-SNARE coiled-coil homology domain-containing proteinSMESG000057424.1 DN307612ncbi_smed_estsPMID:25356635
Cowles et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30028690kcnbSMESG000004060.1 KJ187187smed_ncbi_20200123PMID:25356635
Cowles et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30031317Secreted peptide prohormone 19SMESG000053016.1 SMESG000053015.1 ADC84440smed_ncbi_20200123PMID:25356635
Cowles et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30020055Neur_chan_LBD domain-containing proteinSMESG000064433.1 DN303054ncbi_smed_estsPMID:25356635
Cowles et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30024988Secreted peptide prohormone-2SMESG000070298.1 DAA33921smed_ncbi_20200123PMID:25356635
Cowles et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30031525Choline O-acetyltransferaseSMESG000051357.1 FG310880ncbi_smed_estsPMID:25356635
Cowles et al., 2014
whole organism asexual adult fluorescence in situ hybridization evidence
nervous systemSMED30033894Neur_chan_LBD domain-containing proteinSMESG000041829.1 DN306571ncbi_smed_estsPMID:25356635
Cowles et al., 2014
whole organism asexual adult fluorescence in situ hybridization evidence
nervous systemSMED30032426pou4l-1SMESG000013430.1 KJ187188smed_ncbi_20200123PMID:25356635
Cowles et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30005164coe proteinSMESG000069088.1 KF487109smed_ncbi_20200123PMID:25356635
Cowles et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30005164coe proteinSMESG000069088.1 KF487109smed_ncbi_20200123PMID:25356635
Cowles et al., 2014
whole organism asexual adult fluorescence in situ hybridization evidence
nervous systemSMED30013386netrin 1SMESG000006806.1 AAY23350smed_ncbi_20200123PMID:25356635
Cowles et al., 2014
whole organism asexual adult fluorescence in situ hybridization evidence
nervous systemSMED30016664SMED30016664SMESG000011618.1 DAA33898smed_ncbi_20200123PMID:25356635
Cowles et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30001342Tyrosine protein phosphatase non receptor typeSMESG000028955.1 DN305232ncbi_smed_estsPMID:25356635
Cowles et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30013976SMED30013976SMESG000003513.1 HO005517ncbi_smed_estsPMID:25356635
Cowles et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30035715Sodium channel proteinSMESG000075431.1 KJ187192smed_ncbi_20200123PMID:25356635
Cowles et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30007957Iroquois-class homeodomain protein IRX-6SMESG000022899.1 DN307336ncbi_smed_estsPMID:25356635
Cowles et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30004389scna-1SMESG000017743.1 KJ187191smed_ncbi_20200123PMID:25356635
Cowles et al., 2014
whole organism asexual adult fluorescence in situ hybridization evidence
nervous systemSMED30004389scna-1SMESG000017743.1 KJ187191smed_ncbi_20200123PMID:25356635
Cowles et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30004389scna-1SMESG000017743.1 KJ187193smed_ncbi_20200123PMID:25356635
Cowles et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30002315kcnbSMESG000004060.1 KJ187187smed_ncbi_20200123PMID:25356635
Cowles et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30011055Evi/WlsSMESG000068488.1 FJ463748.1smed_ncbi_20200123PMID:19211673
Adell et al., 2009
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30011055Evi/WlsSMESG000068488.1 FJ463748smed_ncbi_20200123PMID:19211673
Adell et al., 2009
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30034380SMED30034380SMESG000020144.1 dd_Smed_v4_677_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30031736SMED30031736SMESG000019122.1 dd_Smed_v4_8185_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019873plasminogen-1SMESG000018453.1 dd_Smed_v4_23420_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018004SMED30018004SMESG000039905.1 dd_Smed_v4_8655_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019754Cathepsin LSMESG000024014.1 dd_Smed_v4_3422_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30028912Nidogen 2a (osteonidogen)SMESG000016993.1 SMESG000016992.1 SMESG000016991.1 dd_Smed_v4_25_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30024515SMED30024515SMESG000020136.1 dd_Smed_v4_3048_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30031091activin 1SMESG000024833.1 SMESG000024831.1 dd_Smed_v4_4120_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020684Neural cell adhesion molecule 1SMESG000060956.1 dd_Smed_v4_8548_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014608Peptidase M60 domain-containing proteinSMESG000026283.1 dd_Smed_v4_11830_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017992Kunitz-type protease inhibitorSMESG000037999.1 SMESG000037995.1 dd_Smed_v4_1072_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015677fucolectinSMESG000046841.1 dd_Smed_v4_12352_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30035291PikachurinSMESG000079944.1 dd_Smed_v4_10946_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30024836PlasminogenSMESG000026301.1 dd_Smed_v4_13385_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30034181CystinosinSMESG000016910.1 dd_Smed_v4_4540_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30031183SMB domain-containing proteinSMESG000079236.1 dd_Smed_v4_11622_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30027052noggin-like protein 1SMESG000032255.1 dd_Smed_v4_14068_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30021202Kunitz-type serine protease inhibitor IX dd_Smed_v4_1274_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30028923SMED30028923SMESG000020133.1 dd_Smed_v4_10389_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002168Spondin-1SMESG000039905.1 dd_Smed_v4_8655_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30010795SCP domain-containing proteinSMESG000036385.1 dd_Smed_v4_5743_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015799SMED30015799SMESG000039126.1 dd_Smed_v4_895_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001852CD109 antigenSMESG000016163.1 dd_Smed_v4_3070_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30004083Cellular communication network factor 4SMESG000036248.1 dd_Smed_v4_18465_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30011038Cubilin-like proteinSMESG000081204.1 SMESG000081199.1 dd_Smed_v4_19493_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007649SMED30007649SMESG000048765.1 dd_Smed_v4_14165_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002634SCP domain-containing proteinSMESG000036363.1 dd_Smed_v4_210_1_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30032752F-box domain-containing proteinSMESG000034993.1 dd_Smed_v6_7155_0_1dd_Smed_v6PMID:29291974
Strand et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
Note: Hover over icons to view figure legend

 

 

back to top