nervous system

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ Description

  ▻ Figures

  ▻ In Situ Hybridization Data

  ▻ Sequences

  ▻ References

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  nervous system


DEFINITON:

  The nervous system is an organ system containing predominantly neuron and glial cells. In bilaterally symmetrical organisms, it is arranged in a network of tree-like structures connected to a central body. The main functions of the nervous system are to regulate and control body functions, and to receive sensory input, process this information, and generate behavior [CUMBO].


TERM DEFINITION CITATIONS:

  UBERON:0001016


TERM CITATIONS:


TERM ID:

  PLANA:0000025


ABOUT THIS TERM:

nervous system

  ↳is a anatomical system

  ↳part of sexual organism


  → neural progenitor cell develops into nervous system


  → central nervous system and peripheral nervous system is a nervous system


Expand to see terms that part of nervous system


BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


DESCRIPTION:   

WISH developmental time course data for two markers expressed in differentiated neurons, synaptotagmin and PC-2, suggests that the nervous system is limited to neurons in the temporary embryonic pharynx of S2-S5 embryos (Figure 1 – figure supplement 16 D, Figure 1 – figure supplement 12 A). Validated and presumptive neural progenitor markers showing low to undetectable expression during early embryogenesis are upregulated as organogenesis commences during S5 (Figure 1 – figure supplement 16 A) (Cowles et al., 2013; Currie and Pearson, 2013; Lapan and Reddien, 2012; März et al., 2013; Monjo and Romero, 2015; Scimone et al., 2014; Wenemoser et al., 2012), and many transcripts exhibiting enriched expression in adult neurons show upregulated expression during and after S5 (Figure 1 – figure supplement 16 C). During S6 and S7, neural progenitors and their descendants must migrate, interact, and organize themselves into two bilaterally symmetric cephalic ganglia and the attendant ventral nerve cords, commissural and peripheral neurons (Figure 1 – figure supplement 16 D). Differentiating neurons accumulate in the presumptive anterior region of the embryo, adjacent to the D/V margin, as the cephalic ganglia form (Figure 1 – figure supplement 16 B,D, cyan arrows). Ventral nerve cord formation is evident during S6, and appears to proceed from anterior to posterior (Figure 1 – figure supplement 16 D, cyan arrowheads). Gross morphology of the nervous system is comparable to that of adult animals during S7-S8 (Figure 1 – figure supplement 16 B,D).


 

back to top


FIGURES:


Figure 1 – figure supplement 16: Molecular markers for the developing nervous system

A, C: Average RPKM values per embryo for validated and putative adult neural progenitor transcripts (Cowles et al., 2013; Currie and Pearson, 2013; Lapan and Reddien, 2012; März et al., 2013; Monjo and Romero, 2015; Scimone et al., 2014; Wenemoser et al., 2012) (A) and adult neural classifier transcripts identified in single cell sequencing experiments (Wurtzel et al., 2015) (C), Y (yolk), Stage (S) S2-S8.  Neural transcripts that showed enriched expression during S5, S6, S7 and/or S8 are flagged in excel tables for S5-S8 enriched transcripts (Figure 1 – source data 5, Figure 1 – source data 6, Figure 1 – source data 7, Figure 1 – source data 8). 90% (n=533) of the neural enriched transcripts reported in (Wurtzel et al., 2015) were identified in the smed20140614 transcriptome; 60% (n=323) of the cross-referenced transcripts were enriched during S5, S6, S7 and/or S8. 

B, D: Expression of the neural progenitor marker pax6a (B) and the neural marker synaptotagmin (syt, D) (blue), S2-S8. Anterior: top (S6-S8). O: oral hemisphere. A: aboral hemisphere. D: dorsal. V: ventral. Black arrowheads: temporary embryonic pharynx.  Red arrowheads: definitive pharynx. Cyan arrows: cephalic ganglia. Cyan arrowheads: ventral nerve cords. Scale bars: 100 µm.

 

 

back to top


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30024586AFJ24746.1Pax6Apax6AStage 5, Stage 6, Stage 7, Stage 8nervous system, neural progenitor cell
SMED30022907SynaptotagminDj-sytStage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, ventral nerve cord, neuron, cephalic ganglia, nervous system, embryonic pharynx
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30019471 ID=SMED30019471|Name=Synaptotagmin|organism=Schmidtea mediterranea sexual|type=transcript|length=1910bp
TTTGGGACTTCTCCAATCTATTAAATATATTTAGAACGAACATCGTTGTGAGAAGCTTTGTCTTGCAAATGCACACCAAC
ACATTCTCTGCCTACTCGAGACCAGCCTGAAGGACGCACCCAGTCATCTCTTATAAAAAAAAAACTCTTCTCTGATTCGG
TATTTTCTGATTAATGGAGATCAAACAATGATTGGGCAACGTCTAGTTTAGAATATTTACAACTAAATCTGCGTATTTCA
ATTTTTTTTCGATTTTGATTGTTGCAAATATTTATGAGTATATCCAATAATATAAGCAGCGCTAGTAATATGACGATAAA
AATGCAACAAAATGTTGAAAAGTCTGTATCACAGCATGTAACAGCGCAAACAAAGGAATCAACATCAAATAAACTTCATA
CAACAACAGCCGGTATCTCGGTTTTGGAGAAAACATTAAAAACATTTCACATGAGTACTGGCACTTTGATTGGAATCGGA
GTTACAGTGTCTATCGTAGTTTTATTACTTCTTTATTGTATTTGCAAACGATGCATTAAGAAACGAAAGAAAAAGAAAGA
TGGCGGCAAAAAAGGTGGAAAAGGCGTAGACATGAAAAGCGTACAACTATTAGGAAATGCTTATAAAGAAAAGGTACAGC
CGGACCTAGAAGAACTGGATGCTAACATGGAAGATAATGAAGGGGCGCAAGATAAAGAAGCAGTCAATCTTGGAAAATTA
CAGTATTCCCTTGATTACGATTTTACAAAAGGCGAGCTAACAGTCGGAGTAATTCAAGCCACAGATCTCCCAGCAATGGA
CATGTCAGGAACTTCTGATCCATATGTGAAAGTTTTTCTATTACCGGATAAAAAGAAAAAATTCGAAACCAAAGTTCATC
GAAAAATATTAAATCCAGTCTTTAATGAGACATTTGTATTCAAGATTCCTTATTCTGAGGTCGGGTCTAAAACTTTGGTA
TTTAATGTTTTCGATTTCGACAGATTTTCAAAGCATGATCAAATTGGGCAAATCCAAATTCCACTGGGTTCAGTAGATTT
ATGCAAAGTTATTGAGGAATGGAAGGAACTCGGCCCACCTGACAGTGATAATGAAAAGGAAAATCGATTAGGAGACATTT
GTTTTTCTTTGAGATATGTTCCAACGTCTGGAAAGTTGAATATCGTCATTCTGGAAGCTAAAAACCTCAAGAAAATGGAT
GTTGGAGGATTGTCGGATCCTTACGTGAAACTATCGTTGATGCTTAACGGCAAACGAGTGAAAAAGAAGAAAACCACAAT
AAAAAAATACACATTAAATCCTTATTATAATGAGTCATTTTCATTCGAAGTTCCATTCGAGCAAATACAAAAAGTTAATT
TAATAGTGACAGTAGTTGATTATGATAGAATTGGAACAAGTGAACCTATTGGAAGAGTAGTTCTTGGATGCAATGCTACA
GGAGCAGAACTTCGGCACTGGTCCGATATGCTTGCTAATCCTAGGAGACCAATTGCCCAGTGGCATACCCTTCAAGATAT
GCCGGAGAAGAGCTGATTTCATTGATTTTAATTTTAAAATCTGTCATATTTTGTGATAAATTTTGCGTATTTATACAATC
ATTCGATTCGATCTTTCCATCAAGTTTCGTAAAATCTGCAGACATTCACGAGGATGCAGAAGAAATAGAAACTTTGTAAT
AAATTAGCATTAGCTGTGATCTCCTATTGACCAAAAAACATAAACTTAATTTTTATAAAGAATTGTGGTGAAATGTTGTT
AGGTTTCAGTCATAGATAACTGTATTTGTGTAATAGTTTGTGTATTTCTCGTCCTGGCCCGATTTTGTGCATTCCACTGG
CAATACTATTTCACTAATAAATTATGTCTGATAATGTATACCAGTATAGGATTTTGTTTGAATTAATGAA
>SMED30022907 ID=SMED30022907|Name=Synaptotagmin|organism=Schmidtea mediterranea sexual|type=transcript|length=1814bp
ATTTATTGAAAATTATTTTTTCTATTATTAGGAGAAAATTGATTATTTTTTTTTGACAAAATAAGTTTTGGATATATTTC
CCATTTGTTTGTATTCGTAAACCAATGAAGAATTCGACTCACGGATCGGATCATTCGGCCAGCAAGGCCAGTATGAAAAC
GAATGTGGAAAAATTTTGGCATGATCTCGGAAAAAAATTGCACATGGATCCAAAAGCATTAATAGGAGTAACAATCGGTT
TGGGAATATTGTTTTTGTTGTTCCTTTATTGCTTATGTAAAAAATGTGTTTTCAAGCGTCGAAAAAAGAAGGAAACGGCC
AAAAAAGGAGCCAAGGGAGTAGTCGATATGAAAAGTGCCCAATTGTTGGGGAATTCATATAAAGAAAAAATTCAACCCGA
TCTTGAAGAACTTGATGCAAACATGGAAGACAATGAAGGTGTAAAAGAAAAAGAAGATGTTCATTTAGGAAAATTACAAT
ATTCTCTAGATTATGATTTTCAGAAAGGAGAATTAACTGTTGGAGTTATTCAAGCAACTGATCTTCCAGCTATGGATATG
TCAGGAACATCAGATCCATATGTCAAATTATACCTTCTCCCAGACAAGAAAAAGAAATTCGAAACAAAGGTTCATAGGAA
AATTTTAAATCCTGTATTCAATGAAACTTTTGTTTTCAAAGTTCCTTTCAATGAAGTTGCATCGAAGACTTTGATTTTCA
ACGTTTATGACTTTGACAGATTTTCCAAACACGATCAAATCGGTCAAATAAAAGTACCATTGGGAGCTATAGATTTAGGT
CGAGTTATTGAAGAATGGAAGGAACTGGAATCTCCAGAAAACGATGGGGAAAAGGAAAACAGGTTGGGAGACATTTGTTT
CTCTTTAAGATACGTACCGACATCTGGAAAGCTTACAATAGTCATTTTGGAAGCAAAGAATCTTAAAAAAATGGATGTCG
GAGGATTGTCTGATCCATATGTTAAACTTTCCTTGATGCTTAATGGTAAACGAGTGAAGAAGAAGAAAACTACCATCAAA
AAGTATACACTAAATCCTTACTACAATGAATCATTTTCCTTTGAAGTACCATTCGAACAAATACAAAAAGTGAACTTGAT
CGTCACGGTTGTTGATTATGACAGAATCGGAACCAGCGAACCGATAGGTAGAATTGTTCTGGGATGTAACGCAACTGGAG
CAGAATTGCGACATTGGTCGGATATGTTGGCAAATCCCCGGCGACCAATCGCCCAGTGGCATACCCTCCAAGAGATGCCA
GAGAACAATTGATAGTGTTCGTTTGATGCTTTAAAGCGGTTTGCATAATTCGTGAAATAAGTTATCAAAATTTGAGAAAT
GTTTTTTTTTCTGAAACAAAAATGGCATGAGACAATATACCAGAGTTCATTAGTGTGTGGTTTCGTTGAATATTTTGGTG
GTGTTGCATCTTATCGTTTGTCCTCTAATCTAATAATGTTTTATTCTTTATATAGCTGATTTATTCTCGAGCGAAACATT
TTTTATGTGTACCAAAATACTTATGTCATAGCCATTGTGATTAGTCTGTAAACTATTGCGTAATAGCCCCTCTCATTGGC
TTTTTTTAAGAGTAGTGAGTTGGAAAAAAAAATACAAAAATGACTTCAATTGTTAAACATTACTCATATTTTATCAGTAA
GTTAACTTGCATATTTGCAGTTAATTATGGCATTTTATCTCTAAATCTCTGAAGCATGGCCTCAAGTCTTTTGTTTGTTT
TAATGTAATTATGTCTAGATGAGAATATTAAAATACTTCGGTTTATATAAAAGA
>SMED30024586 ID=SMED30024586|Name=Pax6A|organism=Schmidtea mediterranea sexual|type=transcript|length=1992bp
GTTGGTTTTTCTAACAGATTTATTAATGCTAGATTGGCCGCTCAAGATTAATCATAATATTCTGCTACTTTACTGATATA
ATTTTTATACACGGTTACTACTACTCCTCTACTATTTTCGCATTGTTGGCTTCTCAAATTCAATCCCTGGGCATAAATCA
AACCGCTTCATTGACAAAATCCTTTTTGACACTACAAGAAATTGATTCAGTTACTGAAGTAGAAAATATACACAGTCGAA
ACCTATGACCGAATCGAATGAAGAGGAAATAAAAAATAAAAAGAAAGTTAAACGAGGACATTCAGGAATCAATCAATTAG
GTGGAATGTTTGTCAACGGTCGACCTTTGCCCGATTCGACCCGACAGAGAATCGTTGAGTTGGCTCACTCCGGAGCGAGA
CCATGTGATATTTCCCGAATCCTCCAAGTTTCCAATGGATGCGTCAGTAAAATCCTATGCAGATACTACGAAACCGGTTC
AATTCGACCGAAAGCCATCGGAGGCAGCAAACCAAGAGTAGCTACCAGTTCAGTTGTGTCGAAAATTGCCGCCTACAAAC
GTGAATGCCCGTCGATATTTTCTTGGGAAATTCGCGATAGATTATTACAGGAAGGGGTTTGCAATCAGGATAACATTCCC
AGTGTCTCTTCGATAAATCGTGTTCTACGCAGTTTGTCTAATGAAAACCAACGACATTTAGTTGCAGCAACTGGAATGTA
TGACAAACTGTCATTGTTAAGCGGCCAGCCTTGGTCTACTGCAGCTGCTCATGCGGCTTGGTATTCCAGTGCTGCAGCAG
CACATGGGTATGCTTCATCGACATTTCCCAATTGTGGTGCCTATGGAGGCTTAACCGGAATCGGAATTATCAATGGAATG
AGTACAGCCCACGCGGTAGCGTCAATTAATCAGTCGAATTCCGGGGTCACAAATTACCATGTTCAATCAACAACCGATAG
TTCCGACAAACACAAATCAGAAAAATATTCAGAATCCATTGCACATTCTGAATCGAATGCTTCCAGTGAGCCTGGCAACG
AATATATGTCCGGAGTAAAAAGTGAGAATGATGATATGAGAATTAAACTGAAAAGGAAACTTCAAAGAAATCGAACATCG
TTTTCAACAGATCAGCTTGATTCTTTGGAAAAAGAATTTGAACGAACTCATTATCCTGATGTATTCGCCAGAGAGAAATT
GGCAGACAAAATCAGTCTTCCAGAGGCGAGAATACAAGTTTGGTTTTCAAATCGAAGAGCAAAATGGAGACGAGAAGAAA
AACTTCGTCGACAACGGCAAAATCTTATGCTTGGTTCAAACGGAACAAGTTCTACTGCTGATACTAATGTAACAACAAAT
GGAAATACTCAATGTTTGTCGACAACCGGACAAAATTCAATGGGATTTTCTGGAATAAATGATATCAGAAACCAATTTGG
TGATGTTGGAATGCAAACACCTTCATTGTCGGCTGTAGCAGCTGCAGGAATGTACCATTCGGCAGTTGCCTCTGCTGCAG
ATCAGTATGCAAAATCAGCCGGTTTACCAAATCTTTCGCAATCGTCAATCAATTCTCCATATTCCTACATGGCAAATTTG
CAGTCGAGATCCAGTGGTTCCCAAATTGACTTGCCAAACGTTACAAGCAATTCAAATTCTTTTTACAACCCCGGATCAGT
TTATCCCCCAAGTTTATTTCAAGGTGTAATGAGAGGATATGACACCATTGGATATCCCAAGTATCCTTCAGCAATGTTTC
CAGGATCACTCGAAAGTAATAATAATATCAACCCTGCCGGTTTTCTTGCAAATAATATGTCTTCGAATTCATCTAAACCC
GATTACGATTTCTCAGCATTTAATCGGCCCAGCAATTATTGGACTCCGGTCGCATAAAATTGCACAAATGAATGAAAACA
ATTTCAAAAATTCCGAAACAACAATGATTAGAACAAAAAAAACATTTTTCTAAAATAGTTGTTAATTTAAAC

 

back to top


ADDITIONAL REFERENCES:


Cowles, M.W., Brown, D.D., Nisperos, S.V., Stanley, B.N., Pearson, B.J., and Zayas, R.M. (2013). Genome-wide analysis of the bHLH gene family in planarians identifies factors required for adult neurogenesis and neuronal regeneration. Development 140, 4691-4702.

Currie, K.W., and Pearson, B.J. (2013). Transcription factors lhx1/5-1 and pitx are required for the maintenance and regeneration of serotonergic neurons in planarians. Development 140, 3577-3588.

Lapan, S.W., and Reddien, P.W. (2012). Transcriptome analysis of the planarian eye identifies ovo as a specific regulator of eye regeneration. Cell Rep 2, 294-307. 

März, M., Seebeck, F., and Bartscherer, K. (2013). A Pitx transcription factor controls the establishment and maintenance of the serotonergic lineage in planarians. Development 140, 4499-4509. 

Monjo, F., and Romero, R. (2015). Embryonic development of the nervous system in the planarian Schmidtea polychroa. Dev Biol 397, 305-319.

Scimone, M.L., Kravarik, K.M., Lapan, S.W., and Reddien, P.W. (2014). Neoblast specialization in regeneration of the planarian Schmidtea mediterranea. Stem Cell Reports 3, 339-352.

Wenemoser, D., Lapan, S.W., Wilkinson, A.W., Bell, G.W., and Reddien, P.W. (2012). A molecular wound response program associated with regeneration initiation in planarians. Genes Dev 26, 988-1002.

 

back to top



PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in nervous system. Click this link to learn more about PAGE.


PAGE Curations: 6300


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
nervous systemSMED30000511G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000064707.1 dd_Smed_v4_16018_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000514SMED30000514SMESG000036214.1 dd_Smed_v4_10854_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001584SMED30001584SMESG000058817.1 dd_Smed_v4_12647_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002317Helicase with zinc finger domain 2SMESG000017490.1 SMESG000017486.1 dd_Smed_v4_12219_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001031TRAF3-interacting protein 1SMESG000006345.1 dd_Smed_v4_10562_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003546SMED30003546SMESG000072344.1 dd_Smed_v4_11255_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016078Actin, cytoplasmicSMESG000012332.1 SMESG000012317.1 dd_Smed_v4_285_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005148Protocadherin-9SMESG000022791.1 dd_Smed_v4_7807_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000005SMED30000005SMESG000072036.1 dd_Smed_v4_13746_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005744FGFR1 oncogene partnerSMESG000006505.1 dd_Smed_v4_5371_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006557SMED30006557SMESG000034885.1 dd_Smed_v4_12780_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED300146071-phosphatidylinositol 4,5-bisphosphate phosphodiesteraseSMESG000013964.1 SMESG000013958.1 dd_Smed_v4_10098_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED300146071-phosphatidylinositol 4,5-bisphosphate phosphodiesteraseSMESG000013960.1 dd_Smed_v4_27189_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30031525Choline O-acetyltransferaseSMESG000051357.1 FG310880ncbi_smed_estsPMID:23318641
Chen et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30010096TPA_inf: prohormone convertase 2SMESG000008070.1 SMESG000008069.1 BK007043.1smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult fluorescence in situ hybridization evidence
nervous systemSMED30027106SMED30027106SMESG000008070.1 SMESG000008069.1 BK007043.1smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult fluorescence in situ hybridization evidence
nervous systemSMED30031525Choline O-acetyltransferaseSMESG000051357.1 FG310880ncbi_smed_estsPMID:24992682
Vásquez-Doorman et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30016693InnexinSMESG000059204.1 AY067877smed_ncbi_20200123PMID:17670787
Oviedo et al., 2007
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30025205InnexinSMESG000060499.1 AY067167smed_ncbi_20200123PMID:17670787
Oviedo et al., 2007
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30010455InnexinSMESG000048374.1 NB.39.10encbi_smed_estsPMID:17670787
Oviedo et al., 2007
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30013810TeashirtSMESG000008973.1 KP003815.1smed_ncbi_20200123PMID:25558068
Reuter et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
nervous systemSMED30010096TPA_inf: prohormone convertase 2SMESG000008070.1 SMESG000008069.1 BK007043.1smed_ncbi_20200123PMID:25558068
Reuter et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
nervous systemSMED30027106SMED30027106SMESG000008070.1 SMESG000008069.1 BK007043.1smed_ncbi_20200123PMID:25558068
Reuter et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
nervous systemSMED30031525Choline O-acetyltransferaseSMESG000051357.1 FG310880ncbi_smed_estsPMID:25725068
Owen et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30010096TPA_inf: prohormone convertase 2SMESG000008070.1 SMESG000008069.1 BK007043.1smed_ncbi_20200123PMID:29557542
Han et al., 2019
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30027106SMED30027106SMESG000008070.1 SMESG000008069.1 BK007043.1smed_ncbi_20200123PMID:29557542
Han et al., 2019
whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30001480Serine/threonine-protein kinase ULK2SMESG000049447.1 dd_Smed_v4_1196_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016265Tubulin beta chainSMESG000022928.1 dd_Smed_v4_341_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000152SMED30000152SMESG000014912.1 dd_Smed_v4_3390_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016487SMED30016487SMESG000071570.1 dd_Smed_v4_4464_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015079Dynein heavy chain 5, axonemalSMESG000049144.1 dd_Smed_v4_4569_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30012419Non-specific serine/threonine protein kinaseSMESG000069962.1 SMESG000069953.1 SMESG000069952.1 dd_Smed_v4_3244_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED300184652',3'-cyclic nucleotide 3'-phosphodiesteraseSMESG000060338.1 dd_Smed_v4_2431_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015426SMED30015426SMESG000038532.1 SMESG000038520.1 SMESG000038497.1 SMESG000036112.1 SMESG000036067.1 dd_Smed_v4_5097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30004487SMED30004487SMESG000012170.1 SMESG000012168.1 dd_Smed_v4_1367_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001808Calcium-transporting ATPaseSMESG000056345.1 dd_Smed_v4_9557_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001808Calcium-transporting ATPaseSMESG000056345.1 dd_Smed_v4_13223_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002549SyntaxinSMESG000043412.1 SMESG000043410.1 dd_Smed_v4_8453_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002449SMED30002449SMESG000051066.1 dd_Smed_v4_20805_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001056AcetylCoA_hyd_C domain-containing proteinSMESG000063866.1 dd_Smed_v4_1775_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006502SMED30006502SMESG000006746.1 dd_Smed_v4_3151_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30012216Heterogeneous nuclear ribonucleoprotein U-like 1SMESG000033768.1 dd_Smed_v4_1485_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30010258Synaptosomal-associated proteinSMESG000005619.1 dd_Smed_v4_13255_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002366cAMP-dependent protein kinase regulatory subunitSMESG000052390.1 dd_Smed_v4_7586_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014091Opioid-binding protein/cell adhesion moleculeSMESG000026220.1 dd_Smed_v4_5005_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001095SMED30001095SMESG000003398.1 dd_Smed_v4_248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002306SMED30002306SMESG000071777.1 SMESG000071776.1 dd_Smed_v4_3404_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019682Leukocyte receptor cluster member 8-like proteinSMESG000080104.1 SMESG000075783.1 dd_Smed_v4_2926_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30012459SMED30012459SMESG000003156.1 dd_Smed_v4_2446_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014318SBF2 domain-containing proteinSMESG000078604.1 dd_Smed_v4_3628_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019006Tubulin beta chainSMESG000022928.1 dd_Smed_v4_341_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013845Phosphoglucomutase-1SMESG000046578.1 dd_Smed_v4_3503_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015134Protein kinase domain-containing proteinSMESG000002855.1 dd_Smed_v4_5244_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30011512Radial spoke head 1 homologSMESG000014300.1 dd_Smed_v4_3321_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019808Zinc finger proteinSMESG000048367.1 dd_Smed_v4_5058_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007234Bardet-Biedl syndrome 7 protein homologSMESG000005653.1 dd_Smed_v4_15015_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005122SMED30005122SMESG000036086.1 SMESG000000765.1 dd_Smed_v4_4781_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018205Delta-like proteinSMESG000027403.1 SMESG000027402.1 dd_Smed_v4_11876_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006962SMED30006962SMESG000064896.1 dd_Smed_v4_4637_0_2dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006144Helicase with zinc finger domain 2SMESG000026061.1 SMESG000026055.1 dd_Smed_v4_7048_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED300070105-hydroxytryptamine receptor 1ASMESG000017736.1 dd_Smed_v4_5341_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002351Placenta specific protein 8SMESG000050210.1 dd_Smed_v4_5193_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016673Cylindromatosis (turban tumor syndrome), bSMESG000056847.1 SMESG000056843.1 SMESG000056838.1 SMESG000044770.1 SMESG000044762.1 SMESG000007140.1 dd_Smed_v4_1137_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019715Tumor protein p63-regulated gene 1 proteinSMESG000033840.1 dd_Smed_v4_2044_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007067SMED30007067SMESG000023796.1 SMESG000022519.1 dd_Smed_v4_4282_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016218Homeobox protein cut-likeSMESG000065026.1 dd_Smed_v4_13843_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000708Dynein heavy chain 5, axonemalSMESG000049144.1 dd_Smed_v4_4569_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005459SMED30005459SMESG000014884.1 dd_Smed_v4_2661_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007298Deoxynucleoside triphosphate triphosphohydrolase SAMHD1SMESG000079667.1 dd_Smed_v4_4632_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015584Nesprin-1SMESG000016745.1 dd_Smed_v4_23535_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015584Nesprin-1SMESG000016745.1 dd_Smed_v4_16850_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015584Nesprin-1SMESG000016745.1 dd_Smed_v4_23532_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30030621Regulator of G-protein signaling, putativeSMESG000072045.1 dd_Smed_v4_5311_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30021404ALMS_motif domain-containing proteinSMESG000077136.1 dd_Smed_v4_5064_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30021404ALMS_motif domain-containing proteinSMESG000077136.1 dd_Smed_v4_10880_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001654SMED30001654SMESG000012124.1 dd_Smed_v4_11272_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000370ANK_REP_REGION domain-containing proteinSMESG000013802.1 dd_Smed_v4_11317_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000370ANK_REP_REGION domain-containing proteinSMESG000013802.1 dd_Smed_v4_7813_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001630Ras-related C3 botulinum toxin substrate 1SMESG000024968.1 SMESG000005612.1 dd_Smed_v4_1050_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001148SMED30001148SMESG000041540.1 SMESG000041529.1 dd_Smed_v4_13075_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30024342Neuropeptide Y receptor, invertebrateSMESG000059151.1 dd_Smed_v4_10020_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30004318Triadin-like isoform X4SMESG000025109.1 dd_Smed_v4_13778_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30004318Triadin-like isoform X4SMESG000025109.1 dd_Smed_v4_22537_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006547SMED30006547SMESG000016698.1 dd_Smed_v4_13460_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005469slc17a-1SMESG000080078.1 SMESG000052932.1 dd_Smed_v4_10192_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003595FYVE_2 domain-containing proteinSMESG000050479.1 dd_Smed_v4_21937_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006481WD repeat-containing protein 49SMESG000041940.1 dd_Smed_v4_13248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005255SMED30005255SMESG000065026.1 dd_Smed_v4_13843_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED3000412414-3-3 protein beta/alphaSMESG000055903.1 dd_Smed_v4_138_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005517Receptor type tyrosine protein phosphataseSMESG000041927.1 dd_Smed_v4_10176_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006259DNA repair protein complementing XP-G cells-like proteinSMESG000019370.1 dd_Smed_v4_10808_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005638Phosphatidylinositol 4 phosphate 5 kinase type 1SMESG000017265.1 dd_Smed_v4_10693_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30004284InnexinSMESG000048827.1 dd_Smed_v4_13392_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001286DNA polymerase nuSMESG000032684.1 dd_Smed_v4_10383_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003423NFX1-type zinc finger-containing protein 1SMESG000034890.1 dd_Smed_v4_10024_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003418Guanine nucleotide-binding protein subunit betaSMESG000018712.1 dd_Smed_v4_1184_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016952Frizzled 5/8 proteinSMESG000005043.1 dd_Smed_v4_11823_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003675adenylate kinase 7-likeSMESG000075409.1 dd_Smed_v4_5880_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002938SH3 and multiple ankyrin repeat domains protein 2SMESG000078048.1 dd_Smed_v4_10116_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000524SMED30000524SMESG000004865.1 dd_Smed_v4_9063_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002828Interferon regulatory factor 2-binding protein 2SMESG000042710.1 dd_Smed_v4_18245_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30008651Guanylate cyclaseSMESG000019264.1 dd_Smed_v4_9453_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30024729SMED30024729SMESG000037686.1 SMESG000035410.1 SMESG000013977.1 SMESG000013857.1 dd_Smed_v4_10407_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30027945Major facilitator superfamily domain containing proteinSMESG000010822.1 dd_Smed_v4_10640_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30023483INX-13SMESG000043575.1 dd_Smed_v4_11501_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007276SMED30007276SMESG000014766.1 dd_Smed_v4_10073_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007588SMED30007588SMESG000034112.1 dd_Smed_v4_10100_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30008034Fukutin-related proteinSMESG000043202.1 SMESG000040730.1 SMESG000040722.1 SMESG000040691.1 SMESG000039390.1 SMESG000039363.1 SMESG000039356.1 SMESG000039355.1 SMESG000039343.1 dd_Smed_v4_13280_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007122Potassium channel subfamily K 8SMESG000024430.1 dd_Smed_v4_17586_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006985WD repeat-containing protein 49SMESG000041940.1 dd_Smed_v4_13248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007500coiled-coil domain-containing protein 170SMESG000074429.1 dd_Smed_v4_10140_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007518PIH1 domain-containing protein 1SMESG000041927.1 dd_Smed_v4_10176_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001792Retinal pigment epithelium-derived rhodopsin homologSMESG000045023.1 dd_Smed_v4_7301_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001792Retinal pigment epithelium-derived rhodopsin homologSMESG000045022.1 SMESG000045023.1 dd_Smed_v4_13675_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002038Calsyntenin 1SMESG000002834.1 SMESG000002830.1 dd_Smed_v4_1518_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001679Calcium-transporting ATPaseSMESG000014734.1 dd_Smed_v4_1721_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018866Diacylglycerol kinaseSMESG000051710.1 dd_Smed_v4_12579_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014446SMEDWI-2SMESG000069984.1 SMESG000069981.1 dd_Smed_v4_756_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000596PeroxiredoxinSMESG000001807.1 dd_Smed_v4_7781_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006221PHB domain-containing proteinSMESG000037334.1 dd_Smed_v4_6396_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002614SMED30002614SMESG000064510.1 dd_Smed_v4_1635_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30008033Plasma membrane calcium-transporting ATPase 3SMESG000006504.1 dd_Smed_v4_12866_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30022812Receptor-type tyrosine-protein phosphatase SSMESG000068618.1 dd_Smed_v4_12771_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30022812Receptor-type tyrosine-protein phosphatase SSMESG000068618.1 dd_Smed_v4_9734_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30031080KH domain-containing proteinSMESG000004103.1 dd_Smed_v4_1578_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30034968LysM domain-containing proteinSMESG000014261.1 dd_Smed_v4_5399_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015290Neur_chan_LBD domain-containing proteinSMESG000012532.1 dd_Smed_v4_13861_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016101SMED30016101SMESG000080786.1 dd_Smed_v4_14195_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013355Guanylate cyclase domain-containing proteinSMESG000035922.1 dd_Smed_v4_18111_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016246PB1 domain-containing proteinSMESG000052306.1 SMESG000022767.1 dd_Smed_v4_3842_3_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014085Glutamate receptor ionotropic, NMDA 3ASMESG000006949.1 dd_Smed_v4_18414_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30004118Tubulin beta chainSMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044888.1 SMESG000035755.1 dd_Smed_v4_83_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005336Phtf-FEM1B_bdg domain-containing proteinSMESG000058788.1 dd_Smed_v4_8465_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30012205ATP-binding cassette sub-family A member 7-like proteinSMESG000068605.1 dd_Smed_v4_20782_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30012205ATP-binding cassette sub-family A member 7-like proteinSMESG000068605.1 dd_Smed_v4_21124_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002783TNF receptor-associated factorSMESG000049199.1 SMESG000039087.1 dd_Smed_v4_8933_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000639Microtubule-actin cross-linking factor 1-like isoform X28SMESG000017517.1 SMESG000017520.1 SMESG000017519.1 dd_Smed_v4_6577_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30008218PhosphodiesteraseSMESG000009966.1 dd_Smed_v4_14191_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30008171Inositol polyphosphate 1-phosphataseSMESG000065023.1 dd_Smed_v4_9612_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007004SMED30007004SMESG000019033.1 dd_Smed_v4_12403_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006791slc40a-1SMESG000016854.1 dd_Smed_v4_9732_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000033VASt domain-containing proteinSMESG000033356.1 dd_Smed_v4_9149_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005004Protocadherin-1SMESG000007877.1 dd_Smed_v4_13961_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003887c-Myc-binding proteinSMESG000001466.1 dd_Smed_v4_891_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006229SMED30006229SMESG000019033.1 dd_Smed_v4_12403_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019393protocadherin-1SMESG000033799.1 dd_Smed_v4_16629_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017565Ephrin type-B receptor 2SMESG000008191.1 dd_Smed_v4_16928_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015821Neuropeptide-22SMESG000043852.1 dd_Smed_v4_1483_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006736colorectal mutant cancer proteinSMESG000002794.1 dd_Smed_v4_5396_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015008SMED30015008SMESG000001496.1 SMESG000001495.1 dd_Smed_v4_14943_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000566Ropporin-1-like proteinSMESG000079804.1 dd_Smed_v4_4888_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003899SMP-LTD domain-containing proteinSMESG000022335.1 dd_Smed_v4_4286_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30010448SMED30010448SMESG000016854.1 dd_Smed_v4_9732_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013499PHB domain-containing proteinSMESG000068910.1 dd_Smed_v4_17087_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017811Alpha actininSMESG000062022.1 dd_Smed_v4_6167_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005127Voltage-dependent L-type calcium channel subunit alphaSMESG000000524.1 dd_Smed_v4_8899_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005093NPHP5SMESG000005436.1 dd_Smed_v4_11329_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001980Protein phosphatase 1KSMESG000008048.1 dd_Smed_v4_3067_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017201SFI1SMESG000002829.1 dd_Smed_v4_12484_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000126Centrosomal protein 95SMESG000002923.1 dd_Smed_v4_8515_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006256SMED30006256SMESG000034101.1 dd_Smed_v4_9313_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016078Actin, cytoplasmicSMESG000012332.1 SMESG000012317.1 SMESG000058954.1 dd_Smed_v4_246_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001408Tyrosine-protein phosphatase Lar-likeSMESG000042151.1 dd_Smed_v4_16093_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003733c-SKI_SMAD_bind domain-containing proteinSMESG000067290.1 dd_Smed_v4_10921_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000448Cysteine-rich proteinSMESG000044206.1 dd_Smed_v4_1185_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001142CadherinSMESG000020071.1 dd_Smed_v4_11814_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001142CadherinSMESG000020082.1 SMESG000020071.1 dd_Smed_v4_2107_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000919Bravo_FIGEY domain-containing proteinSMESG000026407.1 dd_Smed_v4_11307_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002734echinoderm microtubule-associated protein-like 2 isoform X1SMESG000038072.1 dd_Smed_v4_21299_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002117Immunoglobulin domain-containing-like protein isoform 1SMESG000022938.1 dd_Smed_v4_21925_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002117Immunoglobulin domain-containing-like protein isoform 1SMESG000022938.1 dd_Smed_v4_13882_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002634SCP domain-containing proteinSMESG000036363.1 dd_Smed_v4_210_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002634SCP domain-containing proteinSMESG000036363.1 dd_Smed_v4_210_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30022522Centrin-3SMESG000016538.1 dd_Smed_v4_11582_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020678G-protein, gamma subunit,domain-containing proteinSMESG000066557.1 dd_Smed_v4_1237_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30027929Tubulin beta chainSMESG000022928.1 dd_Smed_v4_341_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30027929Tubulin beta chainSMESG000022928.1 dd_Smed_v4_471_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002730SMED30002730SMESG000051170.1 dd_Smed_v4_10305_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002730SMED30002730SMESG000051170.1 dd_Smed_v4_8704_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009756TNF receptor-associated factor 4SMESG000016362.1 dd_Smed_v4_13517_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003093SMED30003093SMESG000056847.1 SMESG000056843.1 SMESG000056838.1 SMESG000044770.1 SMESG000044762.1 SMESG000007140.1 dd_Smed_v4_1137_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014428Receptor-type tyrosine-protein phosphatase FSMESG000025325.1 dd_Smed_v4_14794_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006567Dual specificity tyrosine-phosphorylation-regulated kinase 1ASMESG000041146.1 dd_Smed_v4_8254_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009231Transmembrane proteinSMESG000002927.1 dd_Smed_v4_12002_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009231Transmembrane proteinSMESG000002927.1 dd_Smed_v4_16643_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017333centrosomal protein of 83 kDa-likeSMESG000033227.1 SMESG000033225.1 dd_Smed_v4_12969_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001116cilia- and flagella-associated protein 44-likeSMESG000022927.1 dd_Smed_v4_8760_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002597CalmodulinSMESG000008981.1 dd_Smed_v4_3441_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019324Clathrin light chainSMESG000019387.1 dd_Smed_v4_2973_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002595SMED30002595SMESG000060338.1 dd_Smed_v4_2431_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019754Cathepsin LSMESG000024014.1 dd_Smed_v4_3422_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30008431Calcium uptake protein 1, mitochondrialSMESG000065412.1 dd_Smed_v4_3581_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30029822Neuronal acetylcholine receptor subunit alpha-4SMESG000021568.1 dd_Smed_v4_9503_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30035291PikachurinSMESG000079944.1 dd_Smed_v4_10946_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30024800RING-type domain-containing proteinSMESG000036117.1 SMESG000036064.1 SMESG000000776.1 SMESG000000765.1 SMESG000000754.1 SMESG000000687.1 SMESG000000587.1 dd_Smed_v4_4074_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30029426Baculoviral IAP repeat-containing protein 7SMESG000067789.1 dd_Smed_v4_1187_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017943SMED30017943SMESG000022837.1 dd_Smed_v4_16017_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002286formimidoyltransferase-cyclodeaminaseSMESG000070969.1 dd_Smed_v4_7815_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001704Non-specific serine/threonine protein kinaseSMESG000055720.1 dd_Smed_v4_2538_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30033594Microtubule-associated protein 1ASMESG000014298.1 dd_Smed_v4_1301_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30033594Microtubule-associated protein 1ASMESG000014298.1 dd_Smed_v4_3654_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30033073Dynein heavy chain axonemal-likeSMESG000039073.1 dd_Smed_v4_4176_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30021847SMED30021847SMESG000017151.1 dd_Smed_v4_16489_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30033718SMED30033718SMESG000061174.1 dd_Smed_v4_12214_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30028833Protocadherin-1 isoform 2SMESG000008875.1 dd_Smed_v4_16566_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30031687TNF receptor-associated factorSMESG000014725.1 SMESG000014724.1 SMESG000014706.1 SMESG000014702.1 SMESG000014700.1 dd_Smed_v4_4420_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30029805Kinesin proteinSMESG000013633.1 SMESG000013625.1 dd_Smed_v4_13562_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020821SMED30020821SMESG000014298.1 dd_Smed_v4_1301_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30027886SMED30027886SMESG000003427.1 dd_Smed_v4_2708_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30029940SMED30029940SMESG000019033.1 dd_Smed_v4_12403_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30028738Band 4.1 protein 2SMESG000019493.1 dd_Smed_v4_1613_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30031682Ras guanyl-releasing protein 3SMESG000035948.1 dd_Smed_v4_15742_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30031682Ras guanyl-releasing protein 3SMESG000035948.1 dd_Smed_v4_15742_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30033432Amiloride-sensitive sodium channelSMESG000000681.1 dd_Smed_v4_16546_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30035611Fras1 related extracellular matrix proteinSMESG000032220.1 dd_Smed_v4_2407_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30026544Mucin-19-like isoform X3SMESG000001496.1 SMESG000001495.1 dd_Smed_v4_14943_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30031654SMED30031654SMESG000064362.1 dd_Smed_v4_3795_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30034893glypican-1SMESG000052359.1 dd_Smed_v4_4154_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30023687Peptidase S1 domain-containing proteinSMESG000022862.1 dd_Smed_v4_10267_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020913SMED30020913SMESG000009078.1 dd_Smed_v4_13484_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30022278Dynamin-type G domain-containing proteinSMESG000014762.1 SMESG000014753.1 dd_Smed_v4_2080_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30028992Guanine nucleotide-binding protein subunit betaSMESG000038555.1 dd_Smed_v4_1615_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED3002317260s ribosomal protein L14SMESG000022343.1 dd_Smed_v4_167_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30022163Tubulin polyglutamylase TTLL7SMESG000055128.1 dd_Smed_v4_13600_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30028328Protocadherin alpha-2SMESG000069340.1 dd_Smed_v4_14209_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30030980S-phase kinase-associated protein 1SMESG000054815.1 dd_Smed_v4_1337_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30031433SMED30031433SMESG000064896.1 dd_Smed_v4_4637_0_2dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30033309slc35f-3SMESG000077937.1 SMESG000077930.1 dd_Smed_v4_13553_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30033309slc35f-3SMESG000077930.1 dd_Smed_v4_18554_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30034635Tubulin tyrosine ligase-like family, member 7SMESG000055128.1 dd_Smed_v4_13600_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30031331G/T mismatch-specific thymine DNA glycosylaseSMESG000067021.1 SMESG000000954.1 dd_Smed_v4_4053_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30029183Calcium:calmodulin dependent protein kinase typeSMESG000027403.1 SMESG000027402.1 dd_Smed_v4_11876_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30027092SMED30027092SMESG000078236.1 SMESG000032651.1 dd_Smed_v4_4949_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30034198SMED30034198SMESG000002829.1 dd_Smed_v4_12484_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30031442Protocadherin-1SMESG000042783.1 dd_Smed_v4_13423_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30031442Protocadherin-1SMESG000042783.1 dd_Smed_v4_17621_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30032448Expressed conserved proteinSMESG000064362.1 dd_Smed_v4_3795_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30033071SMED30033071SMESG000037721.1 dd_Smed_v4_34084_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30035871SMED30035871SMESG000055722.1 SMESG000043901.1 SMESG000034363.1 SMESG000034362.1 dd_Smed_v4_3685_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30033752Tyrosine-protein kinaseSMESG000059352.1 SMESG000059351.1 dd_Smed_v4_420_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015276SMED30015276SMESG000054104.1 SMESG000017493.1 SMESG000016095.1 SMESG000014571.1 dd_Smed_v4_3885_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016693InnexinSMESG000059204.1 dd_Smed_v4_3985_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015151Phosphatidylinositol transfer protein alpha isoformSMESG000080104.1 SMESG000075783.1 dd_Smed_v4_2926_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015151Phosphatidylinositol transfer protein alpha isoformSMESG000014949.1 dd_Smed_v4_580_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017270H2A histone family, member YSMESG000012903.1 dd_Smed_v4_4487_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30012862E3 ubiquitin-protein ligaseSMESG000054341.1 SMESG000054340.1 dd_Smed_v4_2824_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001797SMED30001797SMESG000055722.1 SMESG000043901.1 SMESG000034363.1 SMESG000034362.1 dd_Smed_v4_3685_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002503SMED30002503SMESG000062999.1 SMESG000062995.1 dd_Smed_v4_3686_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016201V-type proton ATPase proteolipid subunitSMESG000068628.1 dd_Smed_v4_253_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016991Vesicle associated membrane protein 1SMESG000054009.1 SMESG000054006.1 dd_Smed_v4_4922_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015372SMED30015372SMESG000014912.1 dd_Smed_v4_3390_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015453Poly [ADP-ribose] polymeraseSMESG000011115.1 dd_Smed_v4_2611_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006820cilia- and flagella-associated protein 57SMESG000072029.1 dd_Smed_v4_3323_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016106Methyltransf_21 domain-containing proteinSMESG000071837.1 SMESG000020353.1 dd_Smed_v4_25359_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014257Oxysterol-binding proteinSMESG000008795.1 dd_Smed_v4_4931_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013870SMED30013870SMESG000014746.1 dd_Smed_v4_3255_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30010842EF-hand domain-containing protein 1SMESG000078434.1 dd_Smed_v4_2935_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013475SWI:SNF matrix associatedSMESG000013560.1 dd_Smed_v4_3355_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019565Radial spoke head protein 4-like protein ASMESG000044927.1 dd_Smed_v4_5346_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009131IRS-type PTB domain-containing proteinSMESG000055009.1 dd_Smed_v4_4462_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30010503CEP135SMESG000077870.1 dd_Smed_v4_5218_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30026043UTP--glucose-1-phosphate uridylyltransferaseSMESG000043519.1 dd_Smed_v4_3057_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30025075SMED30025075SMESG000048253.1 dd_Smed_v4_5617_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020684Neural cell adhesion molecule 1SMESG000060956.1 dd_Smed_v4_8548_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30030360Voltage-dependent calcium channel unc-36SMESG000020648.1 dd_Smed_v4_8926_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020027SMED30020027SMESG000020648.1 dd_Smed_v4_8926_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30035336LLGL scribble cell polarity complex component 2SMESG000018172.1 dd_Smed_v4_2164_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30035848Tubulin beta chainSMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044888.1 SMESG000035755.1 dd_Smed_v4_83_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30021908SMED30021908SMESG000010232.1 SMESG000010229.1 dd_Smed_v4_7466_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30029143ELM2 domain containing proteinSMESG000035512.1 SMESG000035510.1 dd_Smed_v4_8904_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30012075SMED30012075SMESG000059352.1 SMESG000059351.1 dd_Smed_v4_420_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009878Glycerophosphocholine phosphodiesterase GPCPD1SMESG000002821.1 dd_Smed_v4_7518_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001580Serine/threonine-protein kinase PDIK1LSMESG000059621.1 dd_Smed_v4_9834_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006130Transmembrane proteinSMESG000009898.1 dd_Smed_v4_3881_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009438Complexin-1/2SMESG000012002.1 dd_Smed_v4_9918_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30011798E3 ubiquitin-protein ligase MIB2SMESG000043477.1 SMESG000010549.1 SMESG000010347.1 SMESG000010327.1 dd_Smed_v4_593_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005721Lysine-specific demethylase 6ASMESG000077784.1 dd_Smed_v4_5564_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016993Rap guanine nucleotide exchange factor 4SMESG000014113.1 dd_Smed_v4_9547_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003506Anaphase promoting complex subunit 4SMESG000062466.1 dd_Smed_v4_4177_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006932SMED30006932SMESG000080376.1 dd_Smed_v4_23203_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007300Carnitine O-palmitoyltransferase 1, liver isoformSMESG000080051.1 dd_Smed_v4_5302_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003857Centrosomal protein of 162 kDaSMESG000027479.1 dd_Smed_v4_9279_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002896SMED30002896SMESG000065225.1 SMESG000065211.1 SMESG000065210.1 dd_Smed_v4_7442_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30004739TNF receptor-associated factorSMESG000014725.1 SMESG000014724.1 SMESG000014706.1 SMESG000014702.1 SMESG000014700.1 dd_Smed_v4_4420_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017089SMED30017089SMESG000001468.1 dd_Smed_v4_5675_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014866Low density lipoprotein-receptor, class A,domain-containing proteinSMESG000033681.1 dd_Smed_v4_5576_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002668HemocytinSMESG000041532.1 dd_Smed_v4_305_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30008671PhosphodiesteraseSMESG000021196.1 dd_Smed_v4_8589_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001715SMED30001715SMESG000047488.1 dd_Smed_v4_1497_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002847Degenerin unc-8SMESG000017678.1 dd_Smed_v4_16557_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001935Protocadherin-9SMESG000048913.1 dd_Smed_v4_14523_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30010874slc18a-7SMESG000009088.1 dd_Smed_v4_19744_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016880Zinc finger Ran-binding domain-containing protein 2SMESG000017096.1 dd_Smed_v4_1397_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019802SMED30019802SMESG000017096.1 dd_Smed_v4_1397_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015674TAR DNA-binding protein 43SMESG000032661.1 SMESG000006486.1 dd_Smed_v4_1408_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005979SMED30005979SMESG000002022.1 dd_Smed_v4_8339_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005606Ubiquitin-like modifier-activating enzyme 1SMESG000070068.1 dd_Smed_v4_1107_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002609Liprin-alpha-4SMESG000048911.1 dd_Smed_v4_5468_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001440TransporterSMESG000003011.1 dd_Smed_v4_5713_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020000RNA binding motif single stranded interactingSMESG000010632.1 dd_Smed_v4_3575_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002753X1.A5.1SMESG000062836.1 dd_Smed_v4_585_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018401NFX1-type zinc finger-containing protein 1SMESG000034890.1 dd_Smed_v4_10024_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006295SMED30006295SMESG000037104.1 dd_Smed_v4_3744_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018441CUGBP, Elav-like family member 4SMESG000026947.1 dd_Smed_v4_14010_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019664SMED30019664SMESG000064314.1 dd_Smed_v4_11640_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017231NEPH-3SMESG000022777.1 dd_Smed_v4_11280_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003816GM18668SMESG000032629.1 dd_Smed_v4_2860_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019632Tumor necrosis factor alpha-induced protein 8-like proteinSMESG000055619.1 dd_Smed_v4_11459_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015365Lysophosphatidic acid phosphatase type 6SMESG000000025.1 dd_Smed_v4_13744_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017980Cyclin-dependent kinase 5 activatorSMESG000003825.1 dd_Smed_v4_13788_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015422Pleckstrin homology domain containing, family H (with MyTH4 domain) member 1SMESG000058390.1 dd_Smed_v4_13619_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014552RabBD domain-containing proteinSMESG000050479.1 dd_Smed_v4_21937_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002458FerritinSMESG000076636.1 dd_Smed_v4_2638_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30023872Zinc finger MYM-type protein 5SMESG000055398.1 dd_Smed_v4_11239_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30025287Protein unc-13SMESG000042667.1 SMESG000042664.1 SMESG000042670.1 dd_Smed_v4_11981_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30026777Exonuclease 3'-5' domain-containing protein 1SMESG000036160.1 dd_Smed_v4_14291_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30033332Beta-adducinSMESG000059133.1 dd_Smed_v4_1425_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30026237Coiled-coil and C2 domain containing 2ASMESG000048372.1 dd_Smed_v4_11189_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30032831SMED30032831SMESG000055009.1 dd_Smed_v4_4462_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30025135SMED30025135SMESG000042667.1 SMESG000042664.1 SMESG000042670.1 dd_Smed_v4_11981_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30021120Ras-related protein Rap-1bSMESG000015251.1 dd_Smed_v4_12929_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30031693Antolefinin (Antolefinine)SMESG000019220.1 dd_Smed_v4_2253_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30029825ANK_REP_REGION domain-containing proteinSMESG000020706.1 dd_Smed_v4_21003_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30024373Rho_N domain-containing proteinSMESG000001901.1 SMESG000001889.1 SMESG000061056.1 SMESG000058180.1 SMESG000057533.1 SMESG000047874.1 SMESG000046659.1 dd_Smed_v4_12130_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30021645SMED30021645SMESG000014085.1 SMESG000014086.1 SMESG000014087.1 dd_Smed_v4_10249_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020257DUF3421 domain-containing proteinSMESG000046742.1 dd_Smed_v4_1040_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020566SMED30020566SMESG000038603.1 SMESG000038602.1 dd_Smed_v4_1140_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30023558Autophagy-related protein 3SMESG000062512.1 dd_Smed_v4_1915_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30026029Protocadherin alpha-2SMESG000059102.1 dd_Smed_v4_19925_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30024220SMED30024220SMESG000064314.1 dd_Smed_v4_11640_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30026987TNF receptor-associated factorSMESG000025998.1 SMESG000025982.1 SMESG000025980.1 SMESG000025963.1 SMESG000025934.1 SMESG000025901.1 SMESG000025797.1 SMESG000025794.1 SMESG000025517.1 dd_Smed_v4_1139_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30032014GCR320SMESG000028490.1 dd_Smed_v4_17008_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30022748ETS domain-containing proteinSMESG000078333.1 dd_Smed_v4_11113_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30022585SMED30022585SMESG000021277.1 dd_Smed_v4_16056_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30025753SMED30025753SMESG000016791.1 dd_Smed_v4_10_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30034870SMED30034870SMESG000047469.1 dd_Smed_v4_16220_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30034912SyntaxinSMESG000037133.1 dd_Smed_v4_4489_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30023140Glutamate receptor ionotropic, NMDA 2BSMESG000021416.1 dd_Smed_v4_11481_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30027021RUN domain-containing proteinSMESG000080383.1 dd_Smed_v4_10989_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30035225eukaryotic translation initiation factor 4E-binding protein 1SMESG000074256.1 dd_Smed_v4_1877_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30028387F-box and leucine rich repeat protein 16SMESG000006324.1 dd_Smed_v4_12738_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30021210Synembryn-ASMESG000016202.1 dd_Smed_v4_1142_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30029361KIF3B-like proteinSMESG000075065.1 dd_Smed_v4_4343_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30029361KIF3B-like proteinSMESG000020245.1 dd_Smed_v4_9308_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30021702C2H2-type domain-containing proteinSMESG000080376.1 dd_Smed_v4_15473_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30027677Carboxylic ester hydrolaseSMESG000005630.1 dd_Smed_v4_10334_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020318WD repeat-containing protein 49SMESG000041940.1 dd_Smed_v4_13248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30024725Protein lin-7 homologSMESG000057909.1 dd_Smed_v4_1009_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30025424rap guanine nucleotide exchange factor 2 isoform X2SMESG000009223.1 dd_Smed_v4_10889_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30033894Neur_chan_LBD domain-containing proteinSMESG000041829.1 dd_Smed_v4_19336_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30033894Neur_chan_LBD domain-containing proteinSMESG000034462.1 SMESG000034379.1 dd_Smed_v4_47882_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30021839Mediator of RNA polymerase II transcription subunit 12-like proteinSMESG000067021.1 SMESG000000954.1 dd_Smed_v4_4053_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30028311Spectrin beta chainSMESG000066485.1 dd_Smed_v4_12996_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30028311Spectrin beta chainSMESG000066485.1 dd_Smed_v4_7344_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30021870Potassium voltage-gated channel protein ShawSMESG000039493.1 dd_Smed_v4_14595_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30023862SMED30023862SMESG000009332.1 SMESG000009320.1 dd_Smed_v4_1555_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30026702SMED30026702SMESG000038479.1 SMESG000038478.1 dd_Smed_v4_1931_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30027052noggin-like protein 1SMESG000032255.1 dd_Smed_v4_14068_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30022824Dual specificity phosphatase-like proteinSMESG000047740.1 dd_Smed_v4_12651_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30032233SMED30032233SMESG000080577.1 dd_Smed_v4_19517_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30032498NPHP8SMESG000076081.1 dd_Smed_v4_11425_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30026862SMED30026862SMESG000054009.1 SMESG000054006.1 dd_Smed_v4_4922_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020834SMED30020834SMESG000060160.1 dd_Smed_v4_10167_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30022363SMED30022363SMESG000055009.1 dd_Smed_v4_4462_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020987Muscarinic acetylcholine receptorSMESG000039095.1 dd_Smed_v4_13962_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30022408Post-GPI attachment to proteins factor 2-like proteinSMESG000044614.1 dd_Smed_v4_10182_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30026904Integrase catalytic domain-containing proteinSMESG000081946.1 dd_Smed_v4_11923_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30021366Glutamate receptorSMESG000069665.1 dd_Smed_v4_13399_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30026738Centriolar coiled-coil protein of 110 kDaSMESG000008964.1 dd_Smed_v4_13022_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30026115Potassium voltage-gated channel subfamily H member 7SMESG000000377.1 dd_Smed_v4_12978_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30022844NEPH-3SMESG000022777.1 dd_Smed_v4_11280_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30030833SMED30030833SMESG000032988.1 dd_Smed_v4_10864_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30028642SMED30028642SMESG000062505.1 SMESG000062502.1 dd_Smed_v4_1898_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30023116Glycine receptor subunit alpha-3SMESG000037124.1 dd_Smed_v4_15331_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30026893SMED30026893SMESG000036214.1 dd_Smed_v4_10854_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30012252G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000063789.1 dd_Smed_v4_14726_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009038SMED30009038SMESG000068141.1 dd_Smed_v4_1067_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30012922NPHS1-2SMESG000021277.1 dd_Smed_v4_16056_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013766Matrin-type domain-containing proteinSMESG000072403.1 dd_Smed_v4_1859_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014354SMED30014354SMESG000077057.1 dd_Smed_v4_10013_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30010847SMED30010847SMESG000026789.1 dd_Smed_v4_10187_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007858netrin receptor-like proteinSMESG000042475.1 dd_Smed_v4_11409_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003780Serine/threonine-protein kinase 36SMESG000076885.1 dd_Smed_v4_11067_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014996SMED30014996SMESG000056431.1 dd_Smed_v4_15986_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007990FH2 domain-containing proteinSMESG000034094.1 dd_Smed_v4_15344_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007990FH2 domain-containing proteinSMESG000034095.1 SMESG000034094.1 dd_Smed_v4_414_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015332Ciliogenesis-associated TTC17-interacting proteinSMESG000009424.1 dd_Smed_v4_5952_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016660SMED30016660SMESG000029398.1 dd_Smed_v4_11848_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017079LRRCC1SMESG000016752.1 dd_Smed_v4_10086_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005253EF-hand domain-containing family member C2SMESG000076759.1 dd_Smed_v4_6035_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017910SMED30017910SMESG000061777.1 dd_Smed_v4_4589_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016995Transformer-2-relatedSMESG000031644.1 SMESG000031639.1 dd_Smed_v4_1618_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30004860STRA6-likeSMESG000041900.1 SMESG000031061.1 dd_Smed_v4_8135_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013350HPHLAWLY domain-containing proteinSMESG000034214.1 SMESG000030723.1 SMESG000030612.1 SMESG000030179.1 dd_Smed_v4_10891_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001648Phosphatase and actin regulatorSMESG000040085.1 dd_Smed_v4_5826_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000445Protocadherin 2 gamma c6 sCP1SMESG000053174.1 dd_Smed_v4_7871_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30012827SMED30012827SMESG000054420.1 dd_Smed_v4_5361_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017749Peptidyl-glycine alpha-amidating monooxygenaseSMESG000042480.1 dd_Smed_v4_3093_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009816Ral GTPase-activating protein subunit betaSMESG000028929.1 dd_Smed_v4_8678_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017604Alpha-mannosidaseSMESG000018139.1 dd_Smed_v4_8703_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013779Tubulin monoglycylase TTLL3SMESG000029205.1 dd_Smed_v4_10244_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007217Death domain-containing proteinSMESG000078437.1 dd_Smed_v4_7428_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016730Transmembrane protein 47SMESG000061681.1 dd_Smed_v4_12504_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016730Transmembrane protein 47SMESG000061681.1 dd_Smed_v4_7982_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013454Bromodomain-containing protein 2SMESG000015058.1 dd_Smed_v4_4933_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013454Bromodomain-containing protein 2SMESG000029685.1 SMESG000012934.1 dd_Smed_v4_6525_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30012136radial spoke head protein 9 homologSMESG000046857.1 dd_Smed_v4_4707_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002801insulin gene enhancer protein isl-1SMESG000059633.1 dd_Smed_v4_8820_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009508Phosphatidylinositol 4-kinase alphaSMESG000041715.1 dd_Smed_v4_7201_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30011296SMED30011296SMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044888.1 SMESG000035755.1 dd_Smed_v4_83_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018363Pre-mRNA-splicing factor 38ASMESG000050016.1 SMESG000012773.1 dd_Smed_v4_4386_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000565Dynein heavy chainSMESG000065732.1 dd_Smed_v4_6941_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30010795SCP domain-containing proteinSMESG000036385.1 dd_Smed_v4_5743_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30012152Lysine-specific demethylase 5ASMESG000015058.1 dd_Smed_v4_4933_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED300120465'-AMP-activated protein kinase subunit beta-1SMESG000037698.1 dd_Smed_v4_6112_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30004437Si:ch211-57i17.1SMESG000017011.1 dd_Smed_v4_6037_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30012646SMED30012646SMESG000047460.1 dd_Smed_v4_5132_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30008695SMED30008695SMESG000053808.1 dd_Smed_v4_7928_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002064Doublecortin domain-containing protein 2SMESG000040482.1 SMESG000040481.1 SMESG000040480.1 SMESG000038137.1 dd_Smed_v4_6464_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019320Stromal interaction molecule 2SMESG000052167.1 SMESG000045892.1 SMESG000045881.1 dd_Smed_v4_7756_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009048SMED30009048SMESG000043809.1 SMESG000043799.1 dd_Smed_v4_655_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001622SMED30001622SMESG000040908.1 dd_Smed_v4_10356_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30011285DNA polymerase subunit gamma-1SMESG000077612.1 SMESG000050769.1 dd_Smed_v4_5734_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007567Lysosomal trafficking regulatorSMESG000069984.1 SMESG000069981.1 dd_Smed_v4_756_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30021087SMED30021087SMESG000014860.1 dd_Smed_v4_6894_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020002BEN domain-containing proteinSMESG000080064.1 dd_Smed_v4_7370_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020402SMED30020402SMESG000011919.1 dd_Smed_v4_1147_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30024984LisH domain-containing protein ARMC9SMESG000049428.1 dd_Smed_v4_10926_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30030254SMED30030254SMESG000020648.1 dd_Smed_v4_8926_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30025097Disintegrin and metalloproteinase domain-containing protein 19SMESG000036142.1 dd_Smed_v4_8718_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30030163SMED30030163SMESG000062022.1 dd_Smed_v4_6167_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30024274roboASMESG000018028.1 SMESG000018027.1 dd_Smed_v4_8494_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30022907SynaptotagminSMESG000025329.1 dd_Smed_v4_4222_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30021989Phosphatidylinositol N-acetylglucosaminyltransferase subunit PSMESG000077599.1 dd_Smed_v4_6100_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30030985SMED30030985SMESG000003465.1 dd_Smed_v4_10573_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020571Tubulin monoglycylase TTLL3SMESG000062155.1 dd_Smed_v4_12717_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30023747SMED30023747SMESG000080918.1 dd_Smed_v4_3663_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30029081CalmodulinSMESG000065184.1 dd_Smed_v4_16185_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30021926Chloride channel accessory 1SMESG000080918.1 dd_Smed_v4_3663_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30021110Dynein heavy chain 17, axonemalSMESG000026263.1 dd_Smed_v4_10425_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30021110Dynein heavy chain 17, axonemalSMESG000026263.1 dd_Smed_v4_43708_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30024836PlasminogenSMESG000026301.1 dd_Smed_v4_13385_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30022806Calcyphosin proteinSMESG000025859.1 dd_Smed_v4_4512_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30024786Zinc finger protein castor-like protein 1SMESG000038913.1 dd_Smed_v4_6778_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30035248Sprouty related EVH1 domain containing 2aSMESG000045033.1 dd_Smed_v4_14816_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30021613Nesprin-1SMESG000077685.1 dd_Smed_v4_10214_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30021613Nesprin-1SMESG000077685.1 dd_Smed_v4_15904_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30023661Reverse transcriptase domain-containing proteinSMESG000042224.1 dd_Smed_v4_11697_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30027561SMED30027561SMESG000072848.1 dd_Smed_v4_11162_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30021117SMED30021117SMESG000079744.1 SMESG000074656.1 SMESG000054243.1 SMESG000040345.1 SMESG000035927.1 SMESG000022375.1 SMESG000019267.1 dd_Smed_v4_12375_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30029255Sodium/myo-inositol cotransporterSMESG000051963.1 dd_Smed_v4_6415_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020573SMED30020573SMESG000042830.1 dd_Smed_v4_30727_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30029401Propionyl-CoA synthetaseSMESG000043645.1 dd_Smed_v4_12050_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30022233SPATA6 domain-containing proteinSMESG000013811.1 dd_Smed_v4_4304_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30030581Melanocyte proliferating gene 1SMESG000027795.1 SMESG000027796.1 dd_Smed_v4_1148_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020209Synaptotagmin, putativeSMESG000021478.1 dd_Smed_v4_6920_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30023495V-SNARE coiled-coil homology domain-containing proteinSMESG000057424.1 dd_Smed_v4_6394_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30023266cilia- and flagella-associated protein 43SMESG000000491.1 dd_Smed_v4_10271_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013225SMED30013225SMESG000018299.1 dd_Smed_v4_17045_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014507FibronectinSMESG000029259.1 dd_Smed_v4_43824_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014507FibronectinSMESG000029226.1 SMESG000029259.1 dd_Smed_v4_16808_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003166slc4a-4SMESG000039045.1 dd_Smed_v4_12290_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005978Cyclic nucleotide gated channel alpha 3SMESG000044898.1 SMESG000035733.1 dd_Smed_v4_12825_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30011962ATP-binding cassette sub-family A member 1SMESG000056983.1 dd_Smed_v4_10304_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30004574SMED30004574SMESG000004485.1 dd_Smed_v4_1440_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019321TIR domain-containing proteinSMESG000079651.1 dd_Smed_v4_1838_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006258cGMP-dependent protein kinase,putativeSMESG000005347.1 dd_Smed_v4_16434_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009392NephrinSMESG000021277.1 dd_Smed_v4_16056_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009336PID domain-containing proteinSMESG000078082.1 dd_Smed_v4_12194_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30008461nuclear mitotic apparatus protein 1 isoform X2SMESG000071994.1 dd_Smed_v4_10823_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013109Heterogeneous nuclear ribonucleoprotein QSMESG000071117.1 dd_Smed_v4_10996_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005820SMED30005820SMESG000080577.1 dd_Smed_v4_19517_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30004695Voltage-dependent T-type calcium channel subunit alphaSMESG000000986.1 SMESG000000983.1 dd_Smed_v4_26967_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30004695Voltage-dependent T-type calcium channel subunit alphaSMESG000000986.1 dd_Smed_v4_25868_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30004695Voltage-dependent T-type calcium channel subunit alphaSMESG000000986.1 dd_Smed_v4_16822_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006773Calpain-BSMESG000039299.1 dd_Smed_v4_1752_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30011486migration and invasion-inhibitory proteinSMESG000018657.1 dd_Smed_v4_15255_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30008486SMED30008486SMESG000014085.1 SMESG000014086.1 SMESG000014087.1 dd_Smed_v4_10249_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009324SMED30009324SMESG000062402.1 dd_Smed_v4_15771_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019864Neur_chan_LBD domain-containing proteinSMESG000008589.1 dd_Smed_v4_10171_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013390Nesprin-1SMESG000069851.1 dd_Smed_v4_10646_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006199Acetyl-coenzyme A synthetaseSMESG000022079.1 dd_Smed_v4_1817_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007610Guanine nucleotide-binding protein G(q) subunit alphaSMESG000022892.1 dd_Smed_v4_3755_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30008751Liprin-alpha-2SMESG000024331.1 SMESG000024325.1 dd_Smed_v4_12307_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002166SMED30002166SMESG000058880.1 SMESG000039065.1 dd_Smed_v4_4225_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002166SMED30002166SMESG000039065.1 dd_Smed_v4_11656_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30012522Ankyrin-2SMESG000026655.1 dd_Smed_v4_10835_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006145slc18a-6SMESG000051356.1 dd_Smed_v4_11630_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014534SMED30014534SMESG000047985.1 SMESG000035720.1 SMESG000035719.1 dd_Smed_v4_14062_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015172Protein kinase CSMESG000039865.1 SMESG000039854.1 SMESG000032749.1 SMESG000032747.1 dd_Smed_v4_4244_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014047SMED30014047SMESG000025950.1 dd_Smed_v4_1574_6_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014047SMED30014047SMESG000025950.1 dd_Smed_v4_12336_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013286sn1-specific diacylglycerol lipase betaSMESG000046500.1 dd_Smed_v4_13306_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006476NEK8-2SMESG000043305.1 SMESG000043302.1 dd_Smed_v4_10144_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009010Syntaxin 1ASMESG000037133.1 dd_Smed_v4_4489_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009869fas-binding factor 1 homologSMESG000037546.1 dd_Smed_v4_12422_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009869fas-binding factor 1 homologSMESG000037546.1 dd_Smed_v4_12735_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003275Guanine nucleotide-binding protein G(O) subunit alphaSMESG000055191.1 dd_Smed_v4_1656_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30010168Cyclic nucleotide gated channel alpha 3SMESG000044898.1 SMESG000035733.1 dd_Smed_v4_12825_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30004112Dynein heavy chain 5, axonemalSMESG000012967.1 dd_Smed_v4_4113_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30004112Dynein heavy chain 5, axonemalSMESG000012967.1 dd_Smed_v4_17773_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30004112Dynein heavy chain 5, axonemalSMESG000012967.1 dd_Smed_v4_32529_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018823ATP-dependent 6-phosphofructokinaseSMESG000029088.1 dd_Smed_v4_1604_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005718Guanine nucleotide-binding protein G(I) subunit alphaSMESG000026774.1 dd_Smed_v4_12112_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018078Glycine receptor subunit alpha-3SMESG000041885.1 dd_Smed_v4_11342_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014919KIF3A-like proteinSMESG000075065.1 dd_Smed_v4_4343_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019101Inactive dipeptidyl peptidase 10SMESG000050507.1 dd_Smed_v4_12240_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002523RSR1 proteinSMESG000049496.1 dd_Smed_v4_15091_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30011980G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000060945.1 dd_Smed_v4_14651_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30011096Centrosomal protein 131SMESG000051138.1 dd_Smed_v4_13976_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020055Neur_chan_LBD domain-containing proteinSMESG000041829.1 dd_Smed_v4_19336_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30025806Metabotropic glutamate receptorSMESG000033752.1 SMESG000033749.1 dd_Smed_v4_15419_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30025532PhosphodiesteraseSMESG000004031.1 dd_Smed_v4_11039_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30025532PhosphodiesteraseSMESG000004031.1 dd_Smed_v4_45188_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30021281TIR domain-containing proteinSMESG000079651.1 dd_Smed_v4_1838_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30023488Neuronal acetylcholine receptor subunit alpha-7SMESG000080892.1 SMESG000080891.1 dd_Smed_v4_11839_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020683V-type proton ATPase proteolipid subunitSMESG000042238.1 dd_Smed_v4_1622_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30025849Centrosome and spindle pole-associated protein 1SMESG000080361.1 dd_Smed_v4_13453_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30025688Protein tilB homologSMESG000058220.1 dd_Smed_v4_10124_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30023344Sn1-specific diacylglycerol lipase betaSMESG000046500.1 dd_Smed_v4_13306_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30021539Diacylglycerol lipase betaSMESG000046500.1 dd_Smed_v4_13306_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30025648InnexinSMESG000027007.1 dd_Smed_v4_12178_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30033646SMED30033646SMESG000022408.1 dd_Smed_v4_2191_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018620SMED30018620SMESG000029398.1 dd_Smed_v4_11848_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003521Transient receptor potential cation channel subfamily M member-like 2SMESG000005057.1 dd_Smed_v4_11259_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006226Dual specificity protein kinase TTKSMESG000038940.1 SMESG000038939.1 dd_Smed_v4_13043_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019060Neutral sphingomyelinaseSMESG000012166.1 dd_Smed_v4_8717_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED300050684-coumarate--CoA ligase 2SMESG000064101.1 dd_Smed_v4_6511_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014077SMED30014077SMESG000053808.1 dd_Smed_v4_7928_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015427V-type proton ATPase subunit aSMESG000006351.1 dd_Smed_v4_4805_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009301Aamy domain-containing proteinSMESG000055799.1 dd_Smed_v4_7278_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003453Glutamate receptor, ionotropic kainateSMESG000005199.1 dd_Smed_v4_12299_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001542CaveolinSMESG000063380.1 SMESG000001725.1 dd_Smed_v4_6535_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019914Disks large homolog 1SMESG000034854.1 dd_Smed_v4_7374_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019117tRNA_int_endo domain-containing proteinSMESG000049881.1 dd_Smed_v4_4610_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019117tRNA_int_endo domain-containing proteinSMESG000049882.1 dd_Smed_v4_4610_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30011566Exonuclease 3'-5' domain-containing protein 1SMESG000028883.1 dd_Smed_v4_7434_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009072Protein phosphatase 1BSMESG000027795.1 SMESG000027796.1 dd_Smed_v4_1148_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30021186Glyoxylate reductase/hydroxypyruvate reductaseSMESG000004374.1 dd_Smed_v4_3230_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30025164Protein NDRG4SMESG000065324.1 dd_Smed_v4_2911_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020096SMED30020096SMESG000036117.1 SMESG000036064.1 SMESG000000776.1 SMESG000000765.1 SMESG000000754.1 SMESG000000687.1 SMESG000000587.1 dd_Smed_v4_4074_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30029683SMED30029683SMESG000023213.1 SMESG000023211.1 dd_Smed_v4_3814_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30032106SMED30032106SMESG000080318.1 dd_Smed_v4_8948_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30033019nou darake like-5SMESG000070953.1 dd_Smed_v4_5102_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30030156SMED30030156SMESG000032633.1 dd_Smed_v4_6252_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020212Protein kinase CSMESG000071570.1 dd_Smed_v4_4464_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30035008Dipeptidyl peptidase 4SMESG000018885.1 dd_Smed_v4_9183_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30024935FibronectinSMESG000029259.1 dd_Smed_v4_43824_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30027268Histone H1BSMESG000071975.1 dd_Smed_v4_3898_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30028912Nidogen 2a (osteonidogen)SMESG000016993.1 SMESG000016992.1 SMESG000016991.1 dd_Smed_v4_25_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30031552SMED30031552SMESG000025950.1 dd_Smed_v4_1574_6_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30024515SMED30024515SMESG000020136.1 dd_Smed_v4_3048_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30034143SMED30034143SMESG000060913.1 dd_Smed_v4_12123_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30031715Spectrin beta chainSMESG000035098.1 dd_Smed_v4_1684_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30024538Beta-amyloid-like proteinSMESG000025222.1 SMESG000025214.1 SMESG000025213.1 dd_Smed_v4_2561_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30031525Choline O-acetyltransferaseSMESG000051357.1 dd_Smed_v4_11968_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30031525Choline O-acetyltransferaseSMESG000051357.1 dd_Smed_v4_6208_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30035901Abelson helper integration site 1SMESG000005183.1 SMESG000005182.1 dd_Smed_v4_11557_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30025736PHB domain-containing proteinSMESG000076275.1 dd_Smed_v4_5746_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30021652Ras association domain family member 7aSMESG000080298.1 dd_Smed_v4_3722_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30030773ATP-dependent RNA helicase DBP2SMESG000005969.1 dd_Smed_v4_3743_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30023025Calcineurin subunit B typeSMESG000019278.1 dd_Smed_v4_4924_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30030055Protocadherin-9SMESG000033582.1 dd_Smed_v4_5930_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30022032SMED30022032SMESG000038532.1 SMESG000038520.1 SMESG000038497.1 SMESG000036112.1 SMESG000036067.1 dd_Smed_v4_5097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30022928SMED30022928SMESG000000986.1 SMESG000000983.1 dd_Smed_v4_26967_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30030822A-kinase anchor protein 17ASMESG000071777.1 SMESG000071776.1 dd_Smed_v4_3404_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30031764ADF-H domain-containing proteinSMESG000022423.1 dd_Smed_v4_112_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30024282Synaptosomal-associated proteinSMESG000034282.1 dd_Smed_v4_3977_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30025821Multiple PDZ domain crumbs cell polarity complex componentSMESG000053393.1 dd_Smed_v4_5376_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30031155Thioredoxin-like proteinSMESG000033891.1 dd_Smed_v4_12826_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30024351SMED30024351SMESG000081167.1 dd_Smed_v4_2889_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020268Dynamin-type G domain-containing proteinSMESG000014756.1 SMESG000014755.1 dd_Smed_v4_2390_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020268Dynamin-type G domain-containing proteinSMESG000014761.1 SMESG000014754.1 dd_Smed_v4_2777_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30025055NeurobeachinSMESG000017089.1 dd_Smed_v4_3880_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30028681Zinc finger and BTB domain containing 41SMESG000022366.1 dd_Smed_v4_10911_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30028562PhosphodiesteraseSMESG000077093.1 dd_Smed_v4_3394_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30024644Importin-11SMESG000066556.1 dd_Smed_v4_4566_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30030455TetraspaninSMESG000056558.1 dd_Smed_v4_3175_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30030306ABC transporter domain-containing proteinSMESG000058880.1 SMESG000039065.1 dd_Smed_v4_4225_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30024611Terminal nucleotidyltransferase 5CSMESG000052359.1 dd_Smed_v4_4154_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30024611Terminal nucleotidyltransferase 5CSMESG000016756.1 dd_Smed_v4_3449_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30023086U1 small nuclear ribonucleoprotein CSMESG000010972.1 dd_Smed_v4_3772_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020525Dynein intermediate chain 2, ciliarySMESG000001839.1 SMESG000001830.1 dd_Smed_v4_4753_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED3002512114-3-3 protein epsilonSMESG000076939.1 dd_Smed_v4_251_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30030673Alpha-soluble NSF attachment proteinSMESG000061347.1 dd_Smed_v4_2480_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30021914SMED30021914SMESG000047681.1 SMESG000016277.1 dd_Smed_v4_4415_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30021914SMED30021914SMESG000012307.1 dd_Smed_v4_2950_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30022087TNFR CD27 30 40 95 cysteine rich regionSMESG000065173.1 dd_Smed_v4_3783_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30024152CKLF-like MARVEL transmembrane domain-containing protein 7SMESG000001041.1 dd_Smed_v4_3096_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30021547Protein kinase CSMESG000071570.1 dd_Smed_v4_4464_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017036AP-2 complex subunit alphaSMESG000036030.1 dd_Smed_v4_1423_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018157Potassium channel subfamily K member 18SMESG000079785.1 dd_Smed_v4_13333_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014599Cell adhesion molecule-related/down-regulated by oncogenes isoform 2SMESG000063656.1 dd_Smed_v4_13217_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018242Guanine nucleotide binding protein subunitSMESG000068013.1 dd_Smed_v4_10481_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017988SMED30017988SMESG000064314.1 dd_Smed_v4_11640_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017299Protein kinase C beta typeSMESG000053142.1 dd_Smed_v4_12946_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000112glutathione hydrolase 1 proenzyme isoform X2SMESG000047031.1 dd_Smed_v4_4591_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006818Chromodomain-helicase-DNA-binding proteinSMESG000033397.1 SMESG000033395.1 dd_Smed_v4_2597_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006343dynein heavy chain 5, axonemalSMESG000049144.1 dd_Smed_v4_4569_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014799Friend leukemia integration 1SMESG000080027.1 dd_Smed_v4_14611_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30008376Helicase ATP-binding domain-containing proteinSMESG000014848.1 SMESG000014843.1 SMESG000014831.1 dd_Smed_v4_4361_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007047DNA_pol_B_2 domain-containing proteinSMESG000063380.1 SMESG000001725.1 dd_Smed_v4_6535_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000771SMED30000771SMESG000059918.1 SMESG000052306.1 SMESG000022407.1 dd_Smed_v4_474_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000771SMED30000771SMESG000059918.1 SMESG000052306.1 SMESG000022407.1 dd_Smed_v4_1996_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30008855Copper-transporting ATPase 1SMESG000058134.1 dd_Smed_v4_8956_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30012517DIRP domain-containing proteinSMESG000035512.1 SMESG000035510.1 dd_Smed_v4_8904_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017354SJCHGC05364 proteinSMESG000032293.1 dd_Smed_v4_7600_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013091SMED30013091SMESG000070818.1 dd_Smed_v4_1178_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30010458SMED30010458SMESG000026243.1 dd_Smed_v4_7664_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30025473mxi-2 proteinSMESG000060394.1 dd_Smed_v4_4048_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30034920G protein gamma domain-containing proteinSMESG000066557.1 dd_Smed_v4_1237_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30031952SMED30031952SMESG000003398.1 dd_Smed_v4_248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30021589Agrin, putativeSMESG000028865.1 SMESG000028859.1 dd_Smed_v4_3649_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30027913SMED30027913SMESG000014912.1 dd_Smed_v4_3390_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30022014TetraspaninSMESG000043678.1 dd_Smed_v4_2693_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014951SMED30014951SMESG000058720.1 dd_Smed_v4_7931_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019821LIM homeobox transcription factor 1-alphaSMESG000039808.1 dd_Smed_v4_14115_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013828E3 ubiquitin-protein ligaseSMESG000029925.1 SMESG000029933.1 dd_Smed_v4_4236_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006093Multiple PDZ domain crumbs cell polarity complex componentSMESG000056186.1 dd_Smed_v4_4520_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018604Neuronal calcium sensor 2SMESG000081434.1 SMESG000029869.1 dd_Smed_v4_6534_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000909SMED30000909SMESG000053119.1 SMESG000009621.1 SMESG000003158.1 SMESG000077074.1 SMESG000055143.1 SMESG000049878.1 SMESG000003715.1 dd_Smed_v4_3004_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30011825RING-type domain-containing proteinSMESG000069649.1 dd_Smed_v4_12211_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005171SMED30005171SMESG000024345.1 dd_Smed_v4_629_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001212Tubulin alpha chainSMESG000079660.1 dd_Smed_v4_2143_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001212Tubulin alpha chainSMESG000079660.1 dd_Smed_v4_2679_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001212Tubulin alpha chainSMESG000079660.1 dd_Smed_v4_2697_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001191Transcription factor Sox-2SMESG000067682.1 SMESG000060099.1 dd_Smed_v4_8104_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014149Ras-related protein Rab-3SMESG000034019.1 dd_Smed_v4_5920_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001852CD109 antigenSMESG000016163.1 dd_Smed_v4_3070_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015677fucolectinSMESG000046841.1 dd_Smed_v4_12352_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015677fucolectinSMESG000046841.1 dd_Smed_v4_22212_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30011922Tubulin-specific chaperone cofactor E-like proteinSMESG000068159.1 dd_Smed_v4_5186_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001197SMED30001197SMESG000004996.1 dd_Smed_v4_4124_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30034476Protein YIF1BSMESG000057246.1 dd_Smed_v4_3951_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30035317Phosphoglycerate kinaseSMESG000039090.1 dd_Smed_v4_972_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30034763c-Jun N-terminal kinasesSMESG000043618.1 dd_Smed_v4_5924_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30026440SMED30026440SMESG000053420.1 SMESG000053412.1 SMESG000053409.1 dd_Smed_v4_3142_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30035987Expressed conserved proteinSMESG000044572.1 dd_Smed_v4_5021_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30025657SMED30025657SMESG000051020.1 dd_Smed_v4_3927_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30023226SMED30023226SMESG000011108.1 dd_Smed_v4_4730_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30028445SMED30028445SMESG000070700.1 dd_Smed_v4_7472_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30021731Multidrug resistance protein 1-like proteinSMESG000004996.1 dd_Smed_v4_4124_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30024423Family with sequence similarity 135 member ASMESG000040644.1 dd_Smed_v4_4890_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30028571PellinoSMESG000081434.1 SMESG000029869.1 dd_Smed_v4_6534_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30023490SMED30023490SMESG000076531.1 dd_Smed_v4_7027_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30028559Serine/threonine kinase 32ASMESG000026303.1 dd_Smed_v4_6683_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30028510RAB GTPase activating protein 1SMESG000061861.1 dd_Smed_v4_3940_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30023193Tau tubulin kinaseSMESG000026133.1 dd_Smed_v4_12470_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30026519SMED30026519SMESG000064314.1 dd_Smed_v4_16650_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30023820USP domain-containing proteinSMESG000041514.1 dd_Smed_v4_2963_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30033431Protocadherin-11 X-linkedSMESG000072628.1 dd_Smed_v4_17019_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30027002Non-specific serine/threonine protein kinaseSMESG000009652.1 dd_Smed_v4_7408_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30024174Programmed cell death 6-interacting proteinSMESG000019014.1 dd_Smed_v4_1373_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30033334SMED30033334SMESG000060761.1 dd_Smed_v4_9434_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30024574Nipped-B proteinSMESG000051020.1 dd_Smed_v4_3927_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30033373OCA2 melanosomal transmembrane proteinSMESG000080562.1 dd_Smed_v4_5800_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30027015MAGUK p55 subfamily member 5SMESG000007837.1 dd_Smed_v4_5287_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30029487Smed-NDKSMESG000062038.1 dd_Smed_v4_11285_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30033121Phosphatidylinositol 3,4,5-trisphosphate 3-phosphatase TPTE2SMESG000060206.1 dd_Smed_v4_4925_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30027400SMED30027400SMESG000053119.1 SMESG000009621.1 SMESG000003158.1 SMESG000077074.1 SMESG000055143.1 SMESG000049878.1 SMESG000003715.1 dd_Smed_v4_3004_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30031880Family with sequence similarity 227 member BSMESG000052176.1 SMESG000046302.1 dd_Smed_v4_15102_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30024358Protein 4.1SMESG000029732.1 dd_Smed_v4_2825_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30024358Protein 4.1SMESG000029732.1 dd_Smed_v4_5331_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30026564Ubiquitin carboxyl-terminal hydrolase family proteinSMESG000040007.1 SMESG000039999.1 dd_Smed_v4_2299_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30026564Ubiquitin carboxyl-terminal hydrolase family proteinSMESG000040007.1 SMESG000039999.1 dd_Smed_v4_7457_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30034486SMED30034486SMESG000065023.1 dd_Smed_v4_9612_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30025143SMED30025143SMESG000053420.1 SMESG000053412.1 SMESG000053409.1 dd_Smed_v4_3142_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30026586Ft-2SMESG000017101.1 dd_Smed_v4_7638_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30031955Intraflagellar transport protein 52SMESG000043987.1 dd_Smed_v4_5043_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30026803X1.D.D8.3SMESG000053883.1 dd_Smed_v4_8540_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30033666Ubiquitin conjugation factor E4 ASMESG000060217.1 dd_Smed_v4_4558_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30034766EnolaseSMESG000052380.1 dd_Smed_v4_510_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30023228SMED30023228SMESG000058720.1 dd_Smed_v4_7931_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020015ABC transporter domain-containing proteinSMESG000015153.1 dd_Smed_v4_4142_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30022864Cyclin-YSMESG000026607.1 dd_Smed_v4_5512_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30025680Anosmin-1SMESG000033070.1 dd_Smed_v4_13188_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30025882Protein FAM13ASMESG000052108.1 dd_Smed_v4_12046_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30034254calreticulin-1SMESG000009012.1 dd_Smed_v4_220_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30023267Tubulin alpha chainSMESG000079660.1 dd_Smed_v4_2143_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30034396C2 NT-type domain-containing proteinSMESG000015934.1 dd_Smed_v4_5362_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30031141Tubulin polyglutamylase ttll6SMESG000075764.1 dd_Smed_v4_8131_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30029811Tyrosine-protein kinase receptorSMESG000041792.1 dd_Smed_v4_7911_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30033976Steroid 17-alpha-hydroxylase/17,20 lyaseSMESG000080703.1 dd_Smed_v4_4331_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020168c-Jun N-terminal kinasesSMESG000043618.1 dd_Smed_v4_5924_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30024943SMED30024943SMESG000064314.1 dd_Smed_v4_16650_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003613Calcium-binding protein, putativeSMESG000011029.1 dd_Smed_v4_660_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019041Synaptic vesicle 2-related proteinSMESG000035457.1 dd_Smed_v4_59_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019041Synaptic vesicle 2-related proteinSMESG000019460.1 dd_Smed_v4_3645_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006079Nucleobindin-2SMESG000013792.1 dd_Smed_v4_9013_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001112SMED30001112SMESG000061228.1 dd_Smed_v4_8351_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001112SMED30001112SMESG000061228.1 dd_Smed_v4_13515_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003902Tetratricopeptide repeat protein 21BSMESG000011579.1 dd_Smed_v4_12056_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002505Ethanolamine-phosphate cytidylyltransferaseSMESG000017201.1 dd_Smed_v4_3373_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30008882Cilia and flagella associated protein 157SMESG000036345.1 dd_Smed_v4_9862_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30011111coiled-coil domain-containing protein 170SMESG000051384.1 dd_Smed_v4_7992_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006533ADP-ribosylation factorSMESG000052764.1 SMESG000052762.1 SMESG000052759.1 SMESG000052750.1 SMESG000052741.1 SMESG000052739.1 dd_Smed_v4_3383_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009837Diacylglycerol kinaseSMESG000075921.1 dd_Smed_v4_6249_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018476Dpy-30 motif,Ankyrin repeat-containing domain,Ankyrin repeatSMESG000078142.1 dd_Smed_v4_29956_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000692Protein king tubbySMESG000073925.1 dd_Smed_v4_11228_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014844Flotillin-1SMESG000004975.1 dd_Smed_v4_1637_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009514histone H2BSMESG000067931.1 dd_Smed_v4_2520_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003323Non-specific serine/threonine protein kinaseSMESG000042362.1 dd_Smed_v4_5124_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30012938trimeric intracellular cation channel type 1B.1 isoform X1SMESG000016165.1 dd_Smed_v4_3001_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017852Ras family proteinSMESG000019606.1 dd_Smed_v4_23935_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016453SMED30016453SMESG000033480.1 SMESG000033479.1 SMESG000033473.1 dd_Smed_v4_5607_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013212Histone H2ASMESG000015784.1 dd_Smed_v4_469_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017315c-SKI_SMAD_bind domain-containing proteinSMESG000070642.1 dd_Smed_v4_19617_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30008926ATP-dependent DNA helicaseSMESG000023939.1 dd_Smed_v4_6024_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30004577Metal transporter cnnm2SMESG000047046.1 dd_Smed_v4_6903_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007341TBC1 domain family member 2BSMESG000078416.1 dd_Smed_v4_6508_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30008757Piezo-type mechanosensitive ion channel componentSMESG000051188.1 dd_Smed_v4_7182_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001510Protein unc-79 homologSMESG000053097.1 dd_Smed_v4_6600_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001428SMG-1SMESG000009788.1 dd_Smed_v4_4600_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019882Rabenosyn-5SMESG000056864.1 dd_Smed_v4_6187_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018665TetraspaninSMESG000073695.1 dd_Smed_v4_12033_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006636Kinesin-like proteinSMESG000022785.1 dd_Smed_v4_6697_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006636Kinesin-like proteinSMESG000022785.1 dd_Smed_v4_7089_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30012777Usp domain-containing proteinSMESG000035960.1 dd_Smed_v4_7254_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30010523SMED30010523SMESG000077800.1 SMESG000054046.1 SMESG000052058.1 SMESG000044674.1 SMESG000066333.1 SMESG000052053.1 SMESG000052952.1 SMESG000080770.1 SMESG000065333.1 SMESG000063486.1 SMESG000059844.1 SMESG000058646.1 SMESG000055266.1 SMESG000054970.1 SMESG000052813.1 SMESG000043147.1 SMESG000037745.1 SMESG000037601.1 SMESG000036070.1 SMESG000034880.1 SMESG000034368.1 SMESG000031415.1 SMESG000019663.1 SMESG000010897.1 SMESG000009005.1 SMESG000006729.1 SMESG000005029.1 SMESG000003989.1 dd_Smed_v4_1760_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007456Protein CBG04106SMESG000073042.1 dd_Smed_v4_13178_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009782Outer dense fiber protein 3SMESG000038718.1 dd_Smed_v4_2658_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019873plasminogen-1SMESG000018453.1 dd_Smed_v4_23420_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017476Intraflagellar transport protein 57SMESG000013668.1 dd_Smed_v4_7099_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007597SMED30007597SMESG000019748.1 dd_Smed_v4_2028_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005536SMED30005536SMESG000028873.1 dd_Smed_v4_1076_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000245Zinc finger protein 112-likeSMESG000072474.1 SMESG000072473.1 dd_Smed_v4_2635_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009968Intraflagellar transport protein 122 homologSMESG000039305.1 SMESG000039304.1 dd_Smed_v4_11912_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015125SMED30015125SMESG000061766.1 dd_Smed_v4_12632_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007846Cyclic nucleotide gated channel 1SMESG000038402.1 dd_Smed_v4_16523_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30008007Discoidin domain-containing receptor 2SMESG000066441.1 dd_Smed_v4_6578_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002377DNA-binding proteinSMESG000062714.1 dd_Smed_v4_12317_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013001SMED30013001SMESG000057336.1 dd_Smed_v4_6083_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000311RING-type domain-containing proteinSMESG000081132.1 dd_Smed_v4_6290_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014654Low density lipoprotein-receptor, class A,domain-containing proteinSMESG000021406.1 dd_Smed_v4_2598_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017099SMED30017099SMESG000030373.1 dd_Smed_v4_595_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30010254WW domain-containing proteinSMESG000022755.1 dd_Smed_v4_2334_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017834Breast cancer anti-estrogen resistance protein 1 CRK-associated substrate p130casSMESG000028562.1 dd_Smed_v4_6476_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016338Alpha-adducinSMESG000051636.1 dd_Smed_v4_2345_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000411Dynamin-1SMESG000021502.1 dd_Smed_v4_2160_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013474SMED30013474SMESG000069967.1 dd_Smed_v4_6939_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014167Kinesin-like proteinSMESG000050139.1 SMESG000050123.1 dd_Smed_v4_20223_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005723Synaptotagmin, putativeSMESG000040037.1 dd_Smed_v4_7243_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30024198protocadherin-9SMESG000023091.1 dd_Smed_v4_21207_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30035468DNAHb-1SMESG000072114.1 SMESG000072113.1 SMESG000072112.1 dd_Smed_v4_3670_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30022710dual specificity protein kinase CLK2SMESG000071751.1 dd_Smed_v4_6141_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30034880Discoidin domain-containing receptor 2SMESG000067438.1 dd_Smed_v4_10406_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30028777Protein unc-79 homologSMESG000053097.1 dd_Smed_v4_6600_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30031139WASH complex subunit 2CSMESG000014537.1 SMESG000014534.1 dd_Smed_v4_19560_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30030845AfadinSMESG000037577.1 dd_Smed_v4_7215_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30023841SMED30023841SMESG000041250.1 dd_Smed_v4_6437_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30034629Golgi-associated plant pathogenesis-related protein 1SMESG000063568.1 dd_Smed_v4_762_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30031197Microtubule-associated protein 4SMESG000068843.1 dd_Smed_v4_7133_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30025624E3 ubiquitin-protein ligase LRSAM1SMESG000046440.1 SMESG000027652.1 dd_Smed_v4_10841_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30033583SMED30033583SMESG000060313.1 SMESG000049383.1 dd_Smed_v4_158_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020501NHR domain-containing proteinSMESG000040495.1 dd_Smed_v4_7168_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30021868coiled-coil domain-containing protein 39SMESG000072035.1 SMESG000072034.1 dd_Smed_v4_5955_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30030132Protein kinase domain-containing proteinSMESG000078112.1 dd_Smed_v4_18559_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30027299PBXSMESG000022232.1 SMESG000001913.1 dd_Smed_v4_3098_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30031374Polyadenylate-binding proteinSMESG000058799.1 dd_Smed_v4_6574_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30027578SMED30027578SMESG000072474.1 SMESG000072473.1 dd_Smed_v4_2635_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30028083SMED30028083SMESG000002410.1 dd_Smed_v4_21480_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30030309SMED30030309SMESG000075212.1 SMESG000075211.1 SMESG000074910.1 SMESG000074908.1 SMESG000074907.1 dd_Smed_v4_1061_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30031029Protein kinaseSMESG000025153.1 SMESG000025152.1 dd_Smed_v4_6230_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30027388SMED30027388SMESG000037904.1 dd_Smed_v4_6832_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30035484PKD2-3SMESG000059487.1 SMESG000033381.1 dd_Smed_v4_17348_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30025910Microtubule-associated protein futschSMESG000044270.1 SMESG000030021.1 SMESG000025422.1 dd_Smed_v4_1999_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30024216neurexin-2-likeSMESG000054585.1 dd_Smed_v4_23270_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015584Nesprin-1SMESG000016745.1 dd_Smed_v4_34184_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015584Nesprin-1SMESG000016745.1 dd_Smed_v4_13561_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015584Nesprin-1SMESG000016745.1 dd_Smed_v4_17767_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016666SMED30016666SMESG000016698.1 dd_Smed_v4_13460_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019592Guanylate cyclaseSMESG000041839.1 dd_Smed_v4_12933_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002421Dynamin-type G domain-containing proteinSMESG000014746.1 dd_Smed_v4_3255_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017051EGF-like domain-containing proteinSMESG000016698.1 dd_Smed_v4_13460_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002469TPA_inf: pedal peptide prohormone like-1SMESG000035027.1 dd_Smed_v4_3211_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001395neural proliferation differentiation and control protein 1SMESG000059206.1 dd_Smed_v4_2985_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015748SMED30015748SMESG000036160.1 dd_Smed_v4_14291_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017048cilia- and flagella-associated protein 206SMESG000021247.1 dd_Smed_v4_11199_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018039TNF receptor-associated factorSMESG000025998.1 SMESG000025982.1 SMESG000025980.1 SMESG000025963.1 SMESG000025934.1 SMESG000025901.1 SMESG000025797.1 SMESG000025794.1 SMESG000025517.1 dd_Smed_v4_1139_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017042V-type proton ATPase subunit ESMESG000064093.1 dd_Smed_v4_1494_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018309Iroquois-class homeodomain protein IRX-4SMESG000061184.1 dd_Smed_v4_11500_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30004697centrosomal protein of 70 kDa-like isoform X4SMESG000052033.1 dd_Smed_v4_14545_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30011134SMED30011134SMESG000063657.1 dd_Smed_v4_10132_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30010740FERM and pleckstrin domain containing proteinSMESG000038155.1 dd_Smed_v4_14700_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30001010SMED30001010SMESG000039006.1 dd_Smed_v4_13470_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013909tud-1SMESG000029236.1 SMESG000029232.1 dd_Smed_v4_1582_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009189KinaseSMESG000003375.1 dd_Smed_v4_1630_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007971Rho GTPase-activating proteinSMESG000066536.1 dd_Smed_v4_10828_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013216Chromodomain-helicase-DNA-binding proteinSMESG000000092.1 dd_Smed_v4_12815_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013216Chromodomain-helicase-DNA-binding proteinSMESG000000092.1 dd_Smed_v4_7985_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30012386Alpha-1,4 glucan phosphorylaseSMESG000061417.1 dd_Smed_v4_1532_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30012578SMED30012578SMESG000064314.1 dd_Smed_v4_11640_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30008325Fatty acid synthaseSMESG000020850.1 dd_Smed_v4_10967_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30008015slc25a-14SMESG000066536.1 dd_Smed_v4_10828_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30004083Cellular communication network factor 4SMESG000036248.1 dd_Smed_v4_18465_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007155SMED30007155SMESG000021277.1 dd_Smed_v4_16056_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013821Protocadherin 11SMESG000001455.1 dd_Smed_v4_15834_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30011238Kinesin-like proteinSMESG000035453.1 dd_Smed_v4_10765_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30011238Kinesin-like proteinSMESG000035453.1 dd_Smed_v4_13424_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018397TPA_inf: Pax-beta1 paired domain proteinSMESG000080212.1 dd_Smed_v4_15732_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30010217RNA-binding protein 4BSMESG000059552.1 dd_Smed_v4_1566_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30011999SMED30011999SMESG000064314.1 dd_Smed_v4_11640_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007480Protein kinase CSMESG000039865.1 SMESG000039854.1 SMESG000032749.1 SMESG000032747.1 dd_Smed_v4_4244_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30003269Reticulon-like proteinSMESG000007676.1 dd_Smed_v4_1796_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30012867NEPH-2SMESG000071657.1 dd_Smed_v4_12118_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006225Cyclin dependent kinase like 1SMESG000038932.1 dd_Smed_v4_13082_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019744SMED-SMAD6/7-2SMESG000021574.1 dd_Smed_v4_16758_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30008774C2 domain-containing proteinSMESG000047389.1 dd_Smed_v4_15844_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016728Protocadherin-1SMESG000074162.1 dd_Smed_v4_14117_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30010179SMED30010179SMESG000064314.1 dd_Smed_v4_11640_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007371nuclear mitotic apparatus protein 1 isoform X2SMESG000071994.1 dd_Smed_v4_10823_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019001ras-specific guanine nucleotide-releasing factor 1SMESG000056262.1 dd_Smed_v4_18313_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009921SMED30009921SMESG000018657.1 dd_Smed_v4_15255_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30010372SMED30010372SMESG000079705.1 dd_Smed_v4_12668_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30008067Transient receptor potential cation channel subfamily V memberSMESG000039339.1 dd_Smed_v4_22272_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000225WW domain-binding protein 4SMESG000011434.1 dd_Smed_v4_10030_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30010852SMED30010852SMESG000063380.1 SMESG000001725.1 dd_Smed_v4_6535_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015587Dual specificity protein phosphatase 14SMESG000037868.1 dd_Smed_v4_7558_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30004358Protocadherin-11 X-linkedSMESG000066775.1 dd_Smed_v4_13412_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007788Transcription elongation regulator 1SMESG000011919.1 dd_Smed_v4_1147_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30005071SMED30005071SMESG000026871.1 dd_Smed_v4_15319_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014848Dynein light chainSMESG000043518.1 dd_Smed_v4_5284_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30010912SMED30010912SMESG000005057.1 dd_Smed_v4_11259_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018655Collagen type IV alpha-3-binding proteinSMESG000032017.1 SMESG000017536.1 SMESG000032019.1 dd_Smed_v4_5076_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019876Regulator of G-protein signalingSMESG000012254.1 dd_Smed_v4_8463_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009119Ankyrin-2SMESG000058557.1 dd_Smed_v4_1432_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013108Syntaxin-binding protein 1SMESG000013817.1 dd_Smed_v4_7111_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30011058SMED30011058SMESG000042000.1 dd_Smed_v4_3000_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019471SynaptotagminSMESG000055143.1 dd_Smed_v4_6730_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019657Microsomal glutathione S-transferase, putativeSMESG000078591.1 dd_Smed_v4_2049_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009498slc4a-3SMESG000049796.1 dd_Smed_v4_9699_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30012379SMED30012379SMESG000058557.1 dd_Smed_v4_1432_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30002428Gamma-aminobutyric acid receptor-associated proteinSMESG000026465.1 dd_Smed_v4_600_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015511X-ray radiation resistance-associated protein 1SMESG000019618.1 dd_Smed_v4_13519_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013840Tektin-2SMESG000065255.1 SMESG000050057.1 dd_Smed_v4_2339_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017165Succinate--CoA ligase [ADP-forming] subunit beta, mitochondrialSMESG000015204.1 dd_Smed_v4_2298_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019874CalmodulinSMESG000010769.1 dd_Smed_v4_255_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015887DUF4550 domain-containing proteinSMESG000000883.1 dd_Smed_v4_10058_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30011420Trinucleotide repeat containing 4-like proteinSMESG000005424.1 dd_Smed_v4_11349_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017722Kinesin-like protein KIF1ASMESG000071414.1 dd_Smed_v4_7108_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30010668MAGUK p55 subfamily member 5SMESG000017294.1 dd_Smed_v4_6790_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30010907Tigger transposable element-derived protein 6SMESG000056864.1 dd_Smed_v4_6187_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30012043Calcium-transporting ATPaseSMESG000063816.1 SMESG000010536.1 SMESG000045280.1 SMESG000029730.1 dd_Smed_v4_4145_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30012043Calcium-transporting ATPase dd_Smed_v4_13142_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018263SMED30018263SMESG000033726.1 dd_Smed_v4_19428_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018086Talin-1SMESG000019748.1 dd_Smed_v4_1233_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018086Talin-1SMESG000019748.1 dd_Smed_v4_2028_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018086Talin-1SMESG000066444.1 SMESG000060705.1 dd_Smed_v4_876_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018086Talin-1SMESG000019748.1 dd_Smed_v4_7313_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30007290GATA456SMESG000039559.1 SMESG000037031.1 dd_Smed_v4_4075_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30026380Phospholipid-transporting ATPaseSMESG000034375.1 SMESG000034325.1 dd_Smed_v4_13628_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30025436SMED30025436SMESG000029289.1 SMESG000029286.1 SMESG000029285.1 dd_Smed_v4_3083_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30022166SMED30022166SMESG000008632.1 dd_Smed_v4_23416_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30026514Golgin A5SMESG000002765.1 dd_Smed_v4_5164_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30023316Protocadherin gamma-A10SMESG000045218.1 SMESG000045211.1 dd_Smed_v4_26969_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30026442SMED30026442SMESG000054144.1 SMESG000054136.1 SMESG000046463.1 SMESG000046458.1 dd_Smed_v4_27312_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30022529SMED30022529SMESG000002022.1 dd_Smed_v4_8339_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020634SMED30020634SMESG000081436.1 dd_Smed_v4_9784_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30022769Glycine receptor subunit alpha-3SMESG000061905.1 dd_Smed_v4_8110_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30025235Ig-like domain-containing proteinSMESG000017403.1 dd_Smed_v4_31445_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30023155Thyroid adenoma-associated-like proteinSMESG000023235.1 dd_Smed_v4_12325_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30022421RIB43A-like with coiled-coils protein 2SMESG000037028.1 dd_Smed_v4_4547_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016784SMED30016784SMESG000033408.1 dd_Smed_v4_14494_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017619TNF receptor-associated factorSMESG000025998.1 SMESG000025982.1 SMESG000025980.1 SMESG000025963.1 SMESG000025934.1 SMESG000025901.1 SMESG000025797.1 SMESG000025794.1 SMESG000025517.1 dd_Smed_v4_1139_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013159LimbinSMESG000017303.1 dd_Smed_v4_10777_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30015710Glycine receptor subunit alpha-3SMESG000008993.1 dd_Smed_v4_10794_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016607SMED30016607SMESG000042667.1 SMESG000042664.1 SMESG000042670.1 dd_Smed_v4_11981_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013293Major vault proteinSMESG000037707.1 dd_Smed_v4_1098_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018233Troponin C, skeletal muscleSMESG000005066.1 dd_Smed_v4_12048_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30010364SMED30010364SMESG000056847.1 SMESG000056843.1 SMESG000056838.1 SMESG000044770.1 SMESG000044762.1 SMESG000007140.1 dd_Smed_v4_1137_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017265Protocadherin gammaSMESG000046654.1 dd_Smed_v4_11223_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013850SMED30013850SMESG000051170.1 dd_Smed_v4_10305_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013850SMED30013850SMESG000081995.1 SMESG000080328.1 SMESG000080048.1 SMESG000078665.1 SMESG000077025.1 SMESG000076395.1 SMESG000075858.1 SMESG000066691.1 SMESG000062442.1 SMESG000060496.1 SMESG000054975.1 SMESG000054276.1 SMESG000051957.1 SMESG000049162.1 SMESG000046165.1 SMESG000036894.1 SMESG000035648.1 SMESG000034762.1 SMESG000030928.1 SMESG000030475.1 SMESG000030445.1 SMESG000030069.1 SMESG000029693.1 SMESG000029692.1 SMESG000029599.1 SMESG000029355.1 SMESG000027993.1 SMESG000027217.1 SMESG000022058.1 SMESG000020046.1 SMESG000014020.1 SMESG000012961.1 SMESG000010709.1 SMESG000007675.1 SMESG000006952.1 SMESG000004166.1 SMESG000003706.1 SMESG000002779.1 SMESG000002239.1 SMESG000001845.1 SMESG000080313.1 SMESG000066842.1 SMESG000050392.1 SMESG000048356.1 SMESG000042931.1 SMESG000033095.1 SMESG000018900.1 SMESG000017493.1 SMESG000015917.1 SMESG000004121.1 dd_Smed_v4_3574_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013744SMED30013744SMESG000001468.1 dd_Smed_v4_5675_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013054Protein kinase domain-containing proteinSMESG000020466.1 dd_Smed_v4_11366_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30014355LIM domain only protein 7SMESG000039067.1 dd_Smed_v4_10011_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30011421SMED30011421SMESG000034948.1 SMESG000034947.1 dd_Smed_v4_2008_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017399Transmembrane protein 81SMESG000026648.1 dd_Smed_v4_10248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016004SMED30016004SMESG000018602.1 dd_Smed_v4_1083_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30008276SMED30008276SMESG000050479.1 dd_Smed_v4_21937_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30017885Ubiquitin-like proteinSMESG000054551.1 dd_Smed_v4_10574_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009463WD repeat-containing protein 49SMESG000041940.1 dd_Smed_v4_13248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30018208neurexin-1 isoform X16SMESG000066308.1 dd_Smed_v4_11832_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016654Intraflagellar transport protein 140SMESG000001316.1 dd_Smed_v4_11300_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013535slc5a-5SMESG000028614.1 dd_Smed_v4_12883_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30019485SMED30019485SMESG000075557.1 dd_Smed_v4_10583_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30016779JmjC domain-containing proteinSMESG000053108.1 dd_Smed_v4_12267_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30012052SMED30012052SMESG000068013.1 dd_Smed_v4_10481_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30013824Unc-5 netrin receptor BSMESG000040323.1 dd_Smed_v4_10380_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020234Kinase D-interacting substrateSMESG000079991.1 dd_Smed_v4_11743_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30020421slc15a-8SMESG000033891.1 dd_Smed_v4_12826_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30021707SMED30021707SMESG000063964.1 dd_Smed_v4_11231_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30000054Rab-GAP TBC domain-containing proteinSMESG000003946.1 dd_Smed_v4_10066_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006230Sperm surface protein Sp17SMESG000046919.1 dd_Smed_v4_2279_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30006230Sperm surface protein Sp17SMESG000046919.1 dd_Smed_v4_4783_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population