nervous system

The Planarian Anatomoy Ontology (PLANA) is a collection of terms curated from the literature and other organism anatomy ontologies to describe anatomical features, life cycle stages and developmental processes in the regenerative flatworm Schmidtea mediterranea. The latest version of the PLANA Ontology is available through the Open Biological and Biomedical Ontology Foundry (OBO) . PLANA Ontology terms are searchable at the EMBL-EBI Ontology Lookup Service (OLS) and the PLANA Ontology Terms Page.

Below, the Overview Section is populated with infomration from the OLS.

Additional experimental information related to PLANA Ontology terms can be found in the Additional Term Information Section.



    ▻ Planarian Anatomy Ontology Term Overview

    ▻ Additional Term Information

      ▻ Description

      ▻ Figures

      ▻ In Situ Hybridization Data

      ▻ Sequences

      ▻ References




    Planarian Anatomy Ontology Term Overview


    NAME:

      nervous system


    DEFINITON:

      The nervous system is an organ system containing predominantly neuron and glial cells. In bilaterally symmetrical organisms, it is arranged in a network of tree-like structures connected to a central body. The main functions of the nervous system are to regulate and control body functions, and to receive sensory input, process this information, and generate behavior [CUMBO].


    TERM DEFINITION CITATIONS:

      UBERON:0001016


    TERM CITATIONS:

      UBERON:0001016

    TERM ID:

      PLANA:0000025


    ABOUT THIS TERM:

      nervous system "is a" anatomical system

      nervous system "existence overlaps" juvenile, asexual adult and sexually mature adult


      peripheral nervous system and central nervous system "is a" nervous system

      neural progenitor "is a" nervous system


    BROWSE ONTOLOGY TREE (IN OLS):

    Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.


    Planarian Anatomy Ontology


    EXPLORE ONTOLOGY GRAPH:


    Dynamically explore this term by selecting additional relationships to display ( checkboxes on the right ) and by expanding nodes by double clicking on a node. Single click on a node to display the definition below.

     

    back to top


    Additional Term Information


    All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


    DESCRIPTION:   

    WISH developmental time course data for two markers expressed in differentiated neurons, synaptotagmin and PC-2, suggests that the nervous system is limited to neurons in the temporary embryonic pharynx of S2-S5 embryos (Figure 1 – figure supplement 16 D, Figure 1 – figure supplement 12 A). Validated and presumptive neural progenitor markers showing low to undetectable expression during early embryogenesis are upregulated as organogenesis commences during S5 (Figure 1 – figure supplement 16 A) (Cowles et al., 2013; Currie and Pearson, 2013; Lapan and Reddien, 2012; März et al., 2013; Monjo and Romero, 2015; Scimone et al., 2014; Wenemoser et al., 2012), and many transcripts exhibiting enriched expression in adult neurons show upregulated expression during and after S5 (Figure 1 – figure supplement 16 C). During S6 and S7, neural progenitors and their descendants must migrate, interact, and organize themselves into two bilaterally symmetric cephalic ganglia and the attendant ventral nerve cords, commissural and peripheral neurons (Figure 1 – figure supplement 16 D). Differentiating neurons accumulate in the presumptive anterior region of the embryo, adjacent to the D/V margin, as the cephalic ganglia form (Figure 1 – figure supplement 16 B,D, cyan arrows). Ventral nerve cord formation is evident during S6, and appears to proceed from anterior to posterior (Figure 1 – figure supplement 16 D, cyan arrowheads). Gross morphology of the nervous system is comparable to that of adult animals during S7-S8 (Figure 1 – figure supplement 16 B,D).


     

    back to top


    FIGURES:


    Figure 1 – figure supplement 16: Molecular markers for the developing nervous system

    A, C: Average RPKM values per embryo for validated and putative adult neural progenitor transcripts (Cowles et al., 2013; Currie and Pearson, 2013; Lapan and Reddien, 2012; März et al., 2013; Monjo and Romero, 2015; Scimone et al., 2014; Wenemoser et al., 2012) (A) and adult neural classifier transcripts identified in single cell sequencing experiments (Wurtzel et al., 2015) (C), Y (yolk), Stage (S) S2-S8.  Neural transcripts that showed enriched expression during S5, S6, S7 and/or S8 are flagged in excel tables for S5-S8 enriched transcripts (Figure 1 – source data 5, Figure 1 – source data 6, Figure 1 – source data 7, Figure 1 – source data 8). 90% (n=533) of the neural enriched transcripts reported in (Wurtzel et al., 2015) were identified in the smed20140614 transcriptome; 60% (n=323) of the cross-referenced transcripts were enriched during S5, S6, S7 and/or S8. 

    B, D: Expression of the neural progenitor marker pax6a (B) and the neural marker synaptotagmin (syt, D) (blue), S2-S8. Anterior: top (S6-S8). O: oral hemisphere. A: aboral hemisphere. D: dorsal. V: ventral. Black arrowheads: temporary embryonic pharynx.  Red arrowheads: definitive pharynx. Cyan arrows: cephalic ganglia. Cyan arrowheads: ventral nerve cords. Scale bars: 100 µm.

     

     

    back to top


    IN SITU HYBRIDIZATION DATA:


    Smed IDAccessionNameAliasEnriched during stage(s)Tissue/PatternImages
    SMED30024586AFJ24746.1Pax6Apax6AStage 5, Stage 6, Stage 7, Stage 8neural progenitor, nervous system
    SMED30022907Synaptotagmin-1Dj-sytStage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, ventral nerve cord, neuron, cephalic ganglia, nervous system, temporary embryonic pharynx
    Click to see image symbols and abbreviations
    Abbreviation or symbolDefinition
    Ooral hemisphere
    Aaboral hemisphere
    Ddorsal
    Vventral
    Llateral
    black arrowheadembryonic pharynx
    red arrowheaddefinitive pharynx
    black arrowsprimitive gut
    yellow arrowsprimitive ectoderm cells
    cyan arrowsbrain
    cyan arrowheadsnerve cords
    blue arrowheadseye progenitors (trail cells)
    purple arrowheadseyes
    scale bar100 µm

     

    back to top


    SEQUENCES:

    smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

    >SMED30019471 ID=SMED30019471|Name=Synaptotagmin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1910bp
    TTTGGGACTTCTCCAATCTATTAAATATATTTAGAACGAACATCGTTGTGAGAAGCTTTGTCTTGCAAATGCACACCAAC
    ACATTCTCTGCCTACTCGAGACCAGCCTGAAGGACGCACCCAGTCATCTCTTATAAAAAAAAAACTCTTCTCTGATTCGG
    TATTTTCTGATTAATGGAGATCAAACAATGATTGGGCAACGTCTAGTTTAGAATATTTACAACTAAATCTGCGTATTTCA
    ATTTTTTTTCGATTTTGATTGTTGCAAATATTTATGAGTATATCCAATAATATAAGCAGCGCTAGTAATATGACGATAAA
    AATGCAACAAAATGTTGAAAAGTCTGTATCACAGCATGTAACAGCGCAAACAAAGGAATCAACATCAAATAAACTTCATA
    CAACAACAGCCGGTATCTCGGTTTTGGAGAAAACATTAAAAACATTTCACATGAGTACTGGCACTTTGATTGGAATCGGA
    GTTACAGTGTCTATCGTAGTTTTATTACTTCTTTATTGTATTTGCAAACGATGCATTAAGAAACGAAAGAAAAAGAAAGA
    TGGCGGCAAAAAAGGTGGAAAAGGCGTAGACATGAAAAGCGTACAACTATTAGGAAATGCTTATAAAGAAAAGGTACAGC
    CGGACCTAGAAGAACTGGATGCTAACATGGAAGATAATGAAGGGGCGCAAGATAAAGAAGCAGTCAATCTTGGAAAATTA
    CAGTATTCCCTTGATTACGATTTTACAAAAGGCGAGCTAACAGTCGGAGTAATTCAAGCCACAGATCTCCCAGCAATGGA
    CATGTCAGGAACTTCTGATCCATATGTGAAAGTTTTTCTATTACCGGATAAAAAGAAAAAATTCGAAACCAAAGTTCATC
    GAAAAATATTAAATCCAGTCTTTAATGAGACATTTGTATTCAAGATTCCTTATTCTGAGGTCGGGTCTAAAACTTTGGTA
    TTTAATGTTTTCGATTTCGACAGATTTTCAAAGCATGATCAAATTGGGCAAATCCAAATTCCACTGGGTTCAGTAGATTT
    ATGCAAAGTTATTGAGGAATGGAAGGAACTCGGCCCACCTGACAGTGATAATGAAAAGGAAAATCGATTAGGAGACATTT
    GTTTTTCTTTGAGATATGTTCCAACGTCTGGAAAGTTGAATATCGTCATTCTGGAAGCTAAAAACCTCAAGAAAATGGAT
    GTTGGAGGATTGTCGGATCCTTACGTGAAACTATCGTTGATGCTTAACGGCAAACGAGTGAAAAAGAAGAAAACCACAAT
    AAAAAAATACACATTAAATCCTTATTATAATGAGTCATTTTCATTCGAAGTTCCATTCGAGCAAATACAAAAAGTTAATT
    TAATAGTGACAGTAGTTGATTATGATAGAATTGGAACAAGTGAACCTATTGGAAGAGTAGTTCTTGGATGCAATGCTACA
    GGAGCAGAACTTCGGCACTGGTCCGATATGCTTGCTAATCCTAGGAGACCAATTGCCCAGTGGCATACCCTTCAAGATAT
    GCCGGAGAAGAGCTGATTTCATTGATTTTAATTTTAAAATCTGTCATATTTTGTGATAAATTTTGCGTATTTATACAATC
    ATTCGATTCGATCTTTCCATCAAGTTTCGTAAAATCTGCAGACATTCACGAGGATGCAGAAGAAATAGAAACTTTGTAAT
    AAATTAGCATTAGCTGTGATCTCCTATTGACCAAAAAACATAAACTTAATTTTTATAAAGAATTGTGGTGAAATGTTGTT
    AGGTTTCAGTCATAGATAACTGTATTTGTGTAATAGTTTGTGTATTTCTCGTCCTGGCCCGATTTTGTGCATTCCACTGG
    CAATACTATTTCACTAATAAATTATGTCTGATAATGTATACCAGTATAGGATTTTGTTTGAATTAATGAA
    >SMED30020209 ID=SMED30020209|Name=Synaptotagmin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1588bp
    TGCTTGAACGCTGTTGGGCAATTTCATACTGGTTGAATGACTCTCCCAGCTGTATTCTGACCTATGAAAGTTAAATTAAT
    ATAGTTATTTGTATGAGATTGTTATATATGGAATTTCCCAGTGAATTGCGCCCAATAATTGGTATCTTGATGGGCCGATC
    TCGGTTTGTGGAATAATTCATTTGATTACAAGCTAAATTACCTTGAAATGACAGAAACAAAAATGAAATTTCATGCCAAT
    TTCACTGCTTCAACGACCTCCGGTAAAACCTCAACAAATGCTGCAAAAGAAAAATTCCAGGAAATAATTACATATTTGTC
    GAAAAAAATGAAAGTACCCCCATGGGCAGTTTACGCAATTGGAGTAGCAATCATACTTGTTATCCTCATAATTTTCTTTT
    GTCTCATAAAGATTTGTTGCTGCAAACGACGCAAAAAATCAAAAGGTGGAGGCAAAAAAGGAAAAAATGCAACAAAGAAT
    ATGAAAATCATTGGTGGAGCTGTAGATAATAAGACCCAATCAGATGAAGAAGATTTGGTTCTAGATAAAGATGACGATAA
    TGAAAAGAAAGAAGAGGAAAAAGAATATTTGGGAAAATTAGAATACAAATTAGATTACGATTTTACAAAAGGAGAGCTTA
    CAGTTGGAATTTTGCAAGCTCAAGAACTACCAGCACTCGATATGAATGGGACGTCAGACCCATACGTCAAAGTCTTTTTA
    AAACCAGATAAAAAGAAAAAATTTGAAACAAAAGTTCATCGAAAAACTTTAAATCCGGTCTTTGATGAAGTTTTTCTTTT
    TAAAGTACCATTTTCAGAAATAACTTCCAAAACTCTTTGTCTTCATATTTACGATTTTGATAGATTCTCAAAGCATGATC
    AAATTGGTCAGTTGGAAATTCCATTGGGTTCAATAGATTTGTGTCAAGTTGTGCAGGAATGGAAGGAACTTGAACCAAGT
    AAAGATAGTGCTGAAAAAGAAAATAAACTTGGTGACATTTGTTTTTCGTTGAGATACGTTCCAACAAATGGAAAACTGAC
    CGTTGTCGTTTTGGAAGCAAAGAACCTCAAAAAAATGGATGTTGGGGGATTATCTGATCCTTACGTCAAAATTTCGTTAA
    TGATGAATGGAAAACGAATAAAAAAGAAGAAAACAACAATCAAAAAATGTACTTTAAATCCATATTACAATGAATCGTTT
    TCGTTTGAGGTGCCATTCGAGCAGATACAGAGGATTAATCTAATAGTAACGGTTGTTGATTATGATAGAATCGGAACCTC
    GGAGCCGATTGGAAGGGTCGTGTTAGGTTGTAATGCTTCAGGGACTGCTCTTCGTCAATGGTCTGACATGCTTGCTAATC
    CTAGAAGACCAATTGCGCAATGGCAAACTTTACAAGAAATGCCAGAAAAATAACTTTTCCTATTTTTCCTATTATATGCT
    GATAAAAATTTAAATCTAGTCATTCGTTATGTGATTTCTTATTTTTAGACGACAATTTTAATATTTTCATCGTTTAATGT
    AATTTTTTCTTAACTTTAAGGCTAGTTTTGGTTTTTAGCAGTCTGTATCAAGTGAATGTGAAAATCTG
    >SMED30022362 ID=SMED30022362|Name=Synaptotagmin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1443bp
    CTCTTCCGATCTCAAACATTTCAGTCGCAAAGCAGGTCGCCACGAAATACATAAATCCGAACTCAACTGCTATTTGCATT
    AAGCATTTCAATGGCCTTCACGAACATACCAAGCACACACCGACCTTTTGCATAGCAAAATAATTTATTATCATTAAAAC
    AACCTTTGTGACTCTATTTTATCGATTTGAACGAAATTCACCACGATGGCACCATAAACAATCAGATCTCACAAATGTCT
    GCGACTCTAAGCACAATGTCAACACTGAAGTTCACAAGGCCAACAAATGTAACCTCAAACCTCTACAAAGACATAATCAA
    ATATCTTGATCTCCCGGAACCGTTGATTGTAGCAATCTTTGCCGCTGCTGGTTTGTTAATATTCGTTATTTTCATATTGT
    TTTGTTCGAGATGCTGCTGCAGAAAATGCTGCAAGCAAACTGCCGATAAAGACAAATACAAAAGACGGAAGCTAGAAACA
    AAAGAAATTGACAAAATTTTCAGAGACGAGTTGAATCTTGGATTTAATGAGAGTTTTGGAAAGATATATTTTGCGCTCAA
    ATATCTCCTCGTAAAAGAATTGTTAATTGTAAAGGTTATTAAGGTGGAAAACCTACCGACACCAATTGACGACTGTCTTG
    ATCCATACGTTGTCGTACAAGTGAAATCAAAAAGTTTGACTGAGGAAAAGAAAACCAAAATTAAATACAAACATATAGAT
    CCGGTATTCAATGAAAAGTTTACTTTCAAAATTCTCCATCCAGAACTTAATGATTCGGAAATTTTTTTTAAGGTTTTTGA
    CTATGATAAATTTGGAGCCGACTCATTGCTAGGTCAACTTGCACTAAATTTTAAAGACCTCAATCCCAGTAGCATCATAA
    ACATGTTGTCAGAGTTTTCCAAAGATTTAAAAGAAGGTGAAGATACATCGGAAGGCATGGGACAGGTATGCATAATTCTG
    AATTCAAATGGACAGGCAGGATTACTAGTCACTATACTAGAAGCTAAAAATCTTCGAGTTAAAGAAAACATGAGTTATTC
    TCACATTTTTGTCACAGTTAAAATCAAGTCTCGGAAACACGGGAACAAATTTAAAACTCACTCGAAAAAAAGAACCAAAG
    ACGCTCATTGTGGACCTTTTCCGTATTTCAATGAAACATTTCTTTTCCCGAAACCTCATGGAACGATATCAGACTGTTTA
    GTATCAGTTAAAATTTGGATCAGTAGAATGTTTAAAATGCCAATCTGCATCGGGTACGTCTCATTAGGTTCTGAAATGAA
    TATGACTTCCGGCGCCATTCATTGGCAAAGCATGCTTGACAGTCCCCGACACCCGGTTGCAAAATGGCATGTCCTAACCA
    ATCCTAATGTGAAAGAATAAAGATTTAATATTTAGTCCTTCAACATATCTTTTTAATAATTAAAATAATAATTATTTGTC
    GGT
    >SMED30022586 ID=SMED30022586|Name=Synaptotagmin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1214bp
    TCACCATCTTGTCTTTGATGGGATAGTTTGACTAATTTTTGGTTTTGATTGGTTCTCTTAATTGGGAATGCAAATTTTAC
    GGTGCTTGCACTTATGACATGGCATTATTTGCAGAATGAGTTTTCAGAGGCTGTGTGGAGATATTATAATAAAACTTTTG
    GAAACTTGTTGTTTTTGTTTTCATTCAGAAACTGAAGAAAAAGGGAAACTATACATCCACGATAGAACATCTCCAATGAT
    TTTAAACCAAAAACCTTCAATTATGAATCAGGAAATAGAGATAAAAAATATTTCATTGAATCTGCAGACGGAAAATACAT
    TAAATCCAAGAAAACAATCTCTTGGAGGCAATTTTCTTGTTCCAAATGCAGGGTTAAATGAAAAACTTCCTTCAGTAATT
    AAAGTAAAACGACATTCGGAATCGGATTTGGGGGACATGAATTACAATTTTCCTGTTGAAATTAACCATAACCACATTTT
    GAACGTTTTGTCTATTAAAGTTTTTCCAAACGAAAAAATTCCTGATAAATTTGATATTTCTGTGAAAACTAATGACAAAA
    TCACCAAGAAAATAAGCTACTTTTACAAAGTTATTACATTTGACAATATAAGTGAAGATGATTTAAATACATCTTTCCTG
    AGCTTGACATTTTATAAGAGAAAAACGCCAGATGATAAAAAAAGTTTCGGAGAAATAAAATTTCCTCTAAAGTTAATATT
    GAAGAAAAAAATTCAAAATTCAATTAGATTTTACAATACAGATTTCAATTTATTTCAAAACAATGTGAAATTATCCAACG
    GAACGCTTGAAATCGGTTTACGTTTTGATCATAAAAACACTCAATTAACGGTAAATGTTTACGAAGGACAGAATTTTTCA
    AACCAAAATCAAACCCCTTTAAATACTTTCTGTGTCGTTGAATTATTTAAAACACATACCCTCTATATGACCTACAAAAC
    CAGTGTCAAATTCAATTCGAATTGTCCGATTTGGAATGAAACTTTCATCTTTCCAATTAAGCTTGCCGAATTGGCTAATC
    ATATCAAACTGATTATAACAGTCTACAATGAAAATGAAACGGCAAATCTACCAATTGGAAAATTGTTTTTCCCGTCTTCT
    GAAATGGCATTGGAAACTCGTCATTGGAATGAAATTCATACAAATTCCAACCTACAAATCAGAATGTTGCATAGCTTAAA
    ATGACATTTAAATA
    >SMED30022907 ID=SMED30022907|Name=Synaptotagmin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1814bp
    ATTTATTGAAAATTATTTTTTCTATTATTAGGAGAAAATTGATTATTTTTTTTTGACAAAATAAGTTTTGGATATATTTC
    CCATTTGTTTGTATTCGTAAACCAATGAAGAATTCGACTCACGGATCGGATCATTCGGCCAGCAAGGCCAGTATGAAAAC
    GAATGTGGAAAAATTTTGGCATGATCTCGGAAAAAAATTGCACATGGATCCAAAAGCATTAATAGGAGTAACAATCGGTT
    TGGGAATATTGTTTTTGTTGTTCCTTTATTGCTTATGTAAAAAATGTGTTTTCAAGCGTCGAAAAAAGAAGGAAACGGCC
    AAAAAAGGAGCCAAGGGAGTAGTCGATATGAAAAGTGCCCAATTGTTGGGGAATTCATATAAAGAAAAAATTCAACCCGA
    TCTTGAAGAACTTGATGCAAACATGGAAGACAATGAAGGTGTAAAAGAAAAAGAAGATGTTCATTTAGGAAAATTACAAT
    ATTCTCTAGATTATGATTTTCAGAAAGGAGAATTAACTGTTGGAGTTATTCAAGCAACTGATCTTCCAGCTATGGATATG
    TCAGGAACATCAGATCCATATGTCAAATTATACCTTCTCCCAGACAAGAAAAAGAAATTCGAAACAAAGGTTCATAGGAA
    AATTTTAAATCCTGTATTCAATGAAACTTTTGTTTTCAAAGTTCCTTTCAATGAAGTTGCATCGAAGACTTTGATTTTCA
    ACGTTTATGACTTTGACAGATTTTCCAAACACGATCAAATCGGTCAAATAAAAGTACCATTGGGAGCTATAGATTTAGGT
    CGAGTTATTGAAGAATGGAAGGAACTGGAATCTCCAGAAAACGATGGGGAAAAGGAAAACAGGTTGGGAGACATTTGTTT
    CTCTTTAAGATACGTACCGACATCTGGAAAGCTTACAATAGTCATTTTGGAAGCAAAGAATCTTAAAAAAATGGATGTCG
    GAGGATTGTCTGATCCATATGTTAAACTTTCCTTGATGCTTAATGGTAAACGAGTGAAGAAGAAGAAAACTACCATCAAA
    AAGTATACACTAAATCCTTACTACAATGAATCATTTTCCTTTGAAGTACCATTCGAACAAATACAAAAAGTGAACTTGAT
    CGTCACGGTTGTTGATTATGACAGAATCGGAACCAGCGAACCGATAGGTAGAATTGTTCTGGGATGTAACGCAACTGGAG
    CAGAATTGCGACATTGGTCGGATATGTTGGCAAATCCCCGGCGACCAATCGCCCAGTGGCATACCCTCCAAGAGATGCCA
    GAGAACAATTGATAGTGTTCGTTTGATGCTTTAAAGCGGTTTGCATAATTCGTGAAATAAGTTATCAAAATTTGAGAAAT
    GTTTTTTTTTCTGAAACAAAAATGGCATGAGACAATATACCAGAGTTCATTAGTGTGTGGTTTCGTTGAATATTTTGGTG
    GTGTTGCATCTTATCGTTTGTCCTCTAATCTAATAATGTTTTATTCTTTATATAGCTGATTTATTCTCGAGCGAAACATT
    TTTTATGTGTACCAAAATACTTATGTCATAGCCATTGTGATTAGTCTGTAAACTATTGCGTAATAGCCCCTCTCATTGGC
    TTTTTTTAAGAGTAGTGAGTTGGAAAAAAAAATACAAAAATGACTTCAATTGTTAAACATTACTCATATTTTATCAGTAA
    GTTAACTTGCATATTTGCAGTTAATTATGGCATTTTATCTCTAAATCTCTGAAGCATGGCCTCAAGTCTTTTGTTTGTTT
    TAATGTAATTATGTCTAGATGAGAATATTAAAATACTTCGGTTTATATAAAAGA
    >SMED30024586 ID=SMED30024586|Name=Pax6A|organism=Schmidtea mediterranea sexual|type=transcript|length=1992bp
    GTTGGTTTTTCTAACAGATTTATTAATGCTAGATTGGCCGCTCAAGATTAATCATAATATTCTGCTACTTTACTGATATA
    ATTTTTATACACGGTTACTACTACTCCTCTACTATTTTCGCATTGTTGGCTTCTCAAATTCAATCCCTGGGCATAAATCA
    AACCGCTTCATTGACAAAATCCTTTTTGACACTACAAGAAATTGATTCAGTTACTGAAGTAGAAAATATACACAGTCGAA
    ACCTATGACCGAATCGAATGAAGAGGAAATAAAAAATAAAAAGAAAGTTAAACGAGGACATTCAGGAATCAATCAATTAG
    GTGGAATGTTTGTCAACGGTCGACCTTTGCCCGATTCGACCCGACAGAGAATCGTTGAGTTGGCTCACTCCGGAGCGAGA
    CCATGTGATATTTCCCGAATCCTCCAAGTTTCCAATGGATGCGTCAGTAAAATCCTATGCAGATACTACGAAACCGGTTC
    AATTCGACCGAAAGCCATCGGAGGCAGCAAACCAAGAGTAGCTACCAGTTCAGTTGTGTCGAAAATTGCCGCCTACAAAC
    GTGAATGCCCGTCGATATTTTCTTGGGAAATTCGCGATAGATTATTACAGGAAGGGGTTTGCAATCAGGATAACATTCCC
    AGTGTCTCTTCGATAAATCGTGTTCTACGCAGTTTGTCTAATGAAAACCAACGACATTTAGTTGCAGCAACTGGAATGTA
    TGACAAACTGTCATTGTTAAGCGGCCAGCCTTGGTCTACTGCAGCTGCTCATGCGGCTTGGTATTCCAGTGCTGCAGCAG
    CACATGGGTATGCTTCATCGACATTTCCCAATTGTGGTGCCTATGGAGGCTTAACCGGAATCGGAATTATCAATGGAATG
    AGTACAGCCCACGCGGTAGCGTCAATTAATCAGTCGAATTCCGGGGTCACAAATTACCATGTTCAATCAACAACCGATAG
    TTCCGACAAACACAAATCAGAAAAATATTCAGAATCCATTGCACATTCTGAATCGAATGCTTCCAGTGAGCCTGGCAACG
    AATATATGTCCGGAGTAAAAAGTGAGAATGATGATATGAGAATTAAACTGAAAAGGAAACTTCAAAGAAATCGAACATCG
    TTTTCAACAGATCAGCTTGATTCTTTGGAAAAAGAATTTGAACGAACTCATTATCCTGATGTATTCGCCAGAGAGAAATT
    GGCAGACAAAATCAGTCTTCCAGAGGCGAGAATACAAGTTTGGTTTTCAAATCGAAGAGCAAAATGGAGACGAGAAGAAA
    AACTTCGTCGACAACGGCAAAATCTTATGCTTGGTTCAAACGGAACAAGTTCTACTGCTGATACTAATGTAACAACAAAT
    GGAAATACTCAATGTTTGTCGACAACCGGACAAAATTCAATGGGATTTTCTGGAATAAATGATATCAGAAACCAATTTGG
    TGATGTTGGAATGCAAACACCTTCATTGTCGGCTGTAGCAGCTGCAGGAATGTACCATTCGGCAGTTGCCTCTGCTGCAG
    ATCAGTATGCAAAATCAGCCGGTTTACCAAATCTTTCGCAATCGTCAATCAATTCTCCATATTCCTACATGGCAAATTTG
    CAGTCGAGATCCAGTGGTTCCCAAATTGACTTGCCAAACGTTACAAGCAATTCAAATTCTTTTTACAACCCCGGATCAGT
    TTATCCCCCAAGTTTATTTCAAGGTGTAATGAGAGGATATGACACCATTGGATATCCCAAGTATCCTTCAGCAATGTTTC
    CAGGATCACTCGAAAGTAATAATAATATCAACCCTGCCGGTTTTCTTGCAAATAATATGTCTTCGAATTCATCTAAACCC
    GATTACGATTTCTCAGCATTTAATCGGCCCAGCAATTATTGGACTCCGGTCGCATAAAATTGCACAAATGAATGAAAACA
    ATTTCAAAAATTCCGAAACAACAATGATTAGAACAAAAAAAACATTTTTCTAAAATAGTTGTTAATTTAAAC
    >SMED30028321 ID=SMED30028321|Name=Synaptotagmin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1303bp
    TTTAATTGTGAGTGTATAATTAATTCATTAATAAATGTGCAAAATATGTTCAGACAAGTATAAAGATATATTCATTATTA
    ACCATTCAACCATAACAATAGATTCTGTAAGGCCTCTAAATTCTCTGATTGTCATGTATAACAATGTAACAATTCGAAAT
    GTAAACCAAACATCAGTTCTTGGAACTTATTTCAATAACCTATTAAAGTTATGGAACATAAGTCCATTACAAGGAATGTT
    CATATCCGTCGGACTTTTGCTTGCTGTCGTTCTGACAGTGGCTATCATTATATATTGTGTTAGAAAATCAGTCGAGGGTG
    AAGATACCAAAAGGAGTCGACTTTCAAATCTTAAGAAACATCTTCCAGTGAACAGTTCGTCATCAGAGATTGATACTCCA
    CATGGGTATATTGAAGCATCAGTCAAGTATAAAAAAAAGCAGAAAGAGATTGAAATTCAAGACATTCAAATTTACAAATT
    AGAATTTAACTCAATGAAAAAGCCGGATTGTTATTTAGTAATGTTTGTAAGGCATGGGAAATCTCAGTTGTATCCTTCCC
    AAAGAACGAAAACTGCTTTGAATGATTTGTATCCAAATTTCAATGAACACTTTAAGTTTAAAATAAGAAATATGAACAAC
    AATATTCTCCAATTTGAACTTTACGACGAAAATCTATCGGGAAATGACATTCTCATTCGTCAGGGAGAAATGATGTTGAA
    AGATATCAGCGAAAAGAAATTCCAGGATTATTTTCAGAATTTTGTAATCCACTTGGACAAGCCTTCAGAATTAAAAGGTC
    TCGGTGATGTCGCTGTGATTCTGACTGGAAATCCACCAATTTTGAGAATAACAATTCTTGAAGCAAAAGGATTGGCACAA
    AAAGAAAATCTTAACTCCAATTCTTTGTACAGTTTTCACGCAGAAGTTAAAGTTTTCGTCAATAAACATTTAGTAAAACA
    TTTCAAAACGAAAAAAATTCGTCATATTTCCAATCCGTATTTCCAGGAAACATTTTCATTAAAAGTTTTGTCAAAAATGT
    GGGATAAAATTTTAATAAAAATTGAATTATTCCGATCGGGATTTCGTAGAATCGGAAAGGCTTATATCGGTTACAAAGAG
    TCCAATTCGAAAGTTAATTATTTGGGGAACTTGCATTGGGAGAATACTTGCAATGACCGTAAAATGTCGAAAGCGATTTG
    GCATACGTTGGTCAAATAGGTTGCATATTTCCCTTTGCGGTCTGATTCTTGATGACCCTCACTCTATTCTGACTATAATC
    AAAATCTTGTTCAATCTTATTAT
    >SMED30028676 ID=SMED30028676|Name=Synaptotagmin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1385bp
    AAATCAGAAAAATCAAAAAGAAATTTCACAGAATTACGGAACTTATGAAACAGTGAGCAAAGCGCCGCTGGAAATCACAA
    TTACAAAAGCAGAGGATAACGAAGGGGTTTCAAATAAAAAAATAATCCTTCAAGATGACCGTCGATGTACTATGCCATGC
    ATTTTACCATCGAGCAACAATTCTTCAGATGGATACTCGGAAAGCAATCTAAGTGTAAATGAAAGTTCTGTATTCTCTCT
    TAATTCCAATAATCTTTTGCTTTCCGGTCTGATTTCTCCTGCTCGACGATACAGCGACAATTCAAATACGCAAAATTTCG
    TTGAGTTACGAAAGAAAAGTGTCCGACCCGATAGATCAAAACGAACTTTCTTCATATGAGATACTGAATTTATACGGACA
    AGGTAAACTATGTTTTTCAATAGTTTACAATGAACATATTTCTCGACTCTACGTGACAATAAACAAAGCAGTTTATTTAA
    ACAGTTCCAAAACTAACAATCTGGCCGGATTCTATGTGAAAGTGTATTTATTAAATACAGAAAATGATATGAAATTGCAA
    ATGCATAAATCGGAAATTGTAACTGCAAATAAAAATCCAATGTTCGAGCAAACATTTTCGTTTCTTTTAACAAAATCCTC
    TTTAGTCAGCATAAAATTACAGTTCAAAGTCAAACAAGCACATATAAAAGTAAAAAAAAATGAATATCTCGGAGGATTCA
    TGTTTCATCTTGATAATAATGAAATAATTAACAACCCGGAACTCTTTCAAGAATTATGGCGAGATCTGCGGGGCGACTTG
    AGGAAAGACACCAGACGTGGAGAAATCCTCATTTCCCTGATGTACAGCGAACACCAATCTTCAGCTTTTCTATCAGTTAA
    TCTGCATCGAGCTAAAAATCTACAAATTCGACAACATGACAATTCTGTTTTTGCCAGATGTACAATGTTGGTTGGAAACA
    AACCGATCAAAACAAAGCGATCAATTACAGTAAAACAAGACATCTCTGCGCCCTATGTTGATCTTGAAAGTGTTTTCAAT
    GTCGACAAATTGAACATCATGGAAGTCGGCGTTGTTATTCATATATGTAGCCGCAGCAAAATAGGTTTCAGTCACCTGCT
    GGGCAAGCTGATCCTGGGATCTGTGATGTATACGGACGATAAGTCAGTCCTAATACACTGGAAGGACATGATCAGTTATC
    AGAACAGAACCGTCACTAAGTGGCATACGATTATGTGAACATAAAATAACTTTAGACAATTTGTTGGCATGGATGAATGT
    TTACAAATCTCATGAAATTAGCCGTTCATAAAAATGTGTTCACAGACTAATGGTAATTTTTAGGCATAATTCGACCATTC
    ATTTAAAATTTCGATTAAATCATAG

     

    back to top


    ADDITIONAL REFERENCES:


    Cowles, M.W., Brown, D.D., Nisperos, S.V., Stanley, B.N., Pearson, B.J., and Zayas, R.M. (2013). Genome-wide analysis of the bHLH gene family in planarians identifies factors required for adult neurogenesis and neuronal regeneration. Development 140, 4691-4702.

    Currie, K.W., and Pearson, B.J. (2013). Transcription factors lhx1/5-1 and pitx are required for the maintenance and regeneration of serotonergic neurons in planarians. Development 140, 3577-3588.

    Lapan, S.W., and Reddien, P.W. (2012). Transcriptome analysis of the planarian eye identifies ovo as a specific regulator of eye regeneration. Cell Rep 2, 294-307. 

    März, M., Seebeck, F., and Bartscherer, K. (2013). A Pitx transcription factor controls the establishment and maintenance of the serotonergic lineage in planarians. Development 140, 4499-4509. 

    Monjo, F., and Romero, R. (2015). Embryonic development of the nervous system in the planarian Schmidtea polychroa. Dev Biol 397, 305-319.

    Scimone, M.L., Kravarik, K.M., Lapan, S.W., and Reddien, P.W. (2014). Neoblast specialization in regeneration of the planarian Schmidtea mediterranea. Stem Cell Reports 3, 339-352.

    Wenemoser, D., Lapan, S.W., Wilkinson, A.W., Bell, G.W., and Reddien, P.W. (2012). A molecular wound response program associated with regeneration initiation in planarians. Genes Dev 26, 988-1002.

     

    back to top