embryonic pharynx

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ Description

  ▻ Figures

  ▻ In Situ Hybridization Data

  ▻ Sequences

  ▻ References

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  embryonic pharynx


DEFINITON:

  An innervated, muscular pump that ingests yolk cells into the gut cavity. The embryonic pharynx is an extraembryonic tissue that forms during Stage 2, functions during Stages 3-5, and degenerates during Stages 6-7.


TERM DEFINITION CITATIONS:

  PMID:28072387


TERM CITATIONS:

Expand publication list

TERM ID:

  PLANA:0000023


ABOUT THIS TERM:

embryonic pharynx

  ↳is a extraembryonic organ and material entity

  ↳contained in oral hemisphere

  ↳develops from blastomere

  ↳existence ends during or before Stage 6

  ↳existence overlaps Stage 4, Stage 3, Stage 6, Stage 5 and Stage 2

  ↳existence starts during or after Stage 2

  ↳part of embryonic digestive system




DEPICTED BY:


BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


DESCRIPTION:   

The temporary embryonic pharynx is an innervated, muscular pump that ingests yolk into the gut cavity (Figure 1 – figure supplement 12 A-B). It forms during S2 and likely functions during S3 through S5. Temporary embryonic pharynx-specific markers were identified among the S2-S4 enriched transcripts, including VAL-like (Figure 1 – figure supplement 12 C-D), netrin-like (Figure 1 – figure supplement 12 C,E), MPEG1-like-1 (Figure 1 – figure supplement 12 C,F), MPEG1-like-2 (Figure 1 – figure supplement 12 C,G). Expression of foxA1, a developmental transcription factor required for maintenance and regeneration of the pharynx during adulthood (Adler et al., 2014; Scimone et al., 2014), was detected in the epithelial cells lining the lumen of the temporary embryonic pharynx during S3-S5 (Figure 1 – figure supplement 14 A, black arrowheads). The temporary embryonic pharynx degenerates during S6, as the definitive pharynx primordium develops beneath it (Martín-Durán and Romero, 2011). Temporary embryonic pharynx markers are no longer detectable by S7 (Figure 1 – figure supplement 12 C-D).


 

back to top


FIGURES:


Figure 1 – figure supplement 12: Molecular markers for the temporary embryonic pharynx

A-B: The temporary embryonic pharynx is innervated by PC-2+ neurons (A) and contains mhc-1+ radial muscle fibers (B). For simplicity, only S4 is shown. The image shown in B is also shown in Figure 1 – figure supplement 17 C.

C: Average RPKM values per embryo for the temporary embryonic pharynx markers venom allergen-like (VAL-like; SMED30015313), macrophage expressed gene 1 like-1 (MPEG1-like 1; SMED30000139), MPEG1-like 2 (SMED30034696) and netrin-like (SMED30023593) during embryogenesis, Y (yolk), Stage (S) S2-S8.  

D-G: Expression of temporary embryonic pharynx specific markers VAL-like (D, S3-S7), netrin-like (E, S2-S7), MPEG1-like-1 (F, S3-S4) and MPEG1-like-2 (G, S3-S4). 

A-B, D-G: Anterior: top (S6-S8). Black arrowheads: temporary embryonic pharynx. Red arrowheads: definitive pharynx. O: oral hemisphere. A: aboral hemisphere. D: dorsal. V: ventral. Scale bars: 100 µm.

 

 

back to top


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30018602ATP dependent RNA helicase DDX5DDX5-likeStage 2, Stage 3, Stage 4embryonic digestive system, primitive ectoderm, embryonic pharynx, blastomere
SMED30023322Cathepsin LCTSL-likeStage 2, Stage 3, Stage 4, Stage 5, Stage 6embryonic digestive system, embryonic gut cell, primitive gut cell, embryonic pharynx
SMED30003202Eukaryotic initiation factor 4A-like ProteineIF4a-likeStage 2, Stage 3, Stage 4embryonic digestive system, primitive ectoderm, embryonic pharynx, blastomere
SMED30027428AFJ24799.1forkhead box A-1foxA1Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, digestive system, pharynx, pharynx progenitor cell, embryonic pharynx
SMED30007290AFF18488.1GATA456gata456aStage 2, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, gut, digestive system, gamma neoblast, embryonic pharynx
SMED30014940Gelsolingelsolin-likeStage 2, Stage 3, Stage 4, Stage 5embryonic digestive system, primitive ectoderm cell, primitive ectoderm, embryonic pharynx
SMED30033466Histone H4Stage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, neoblast, primitive ectoderm, embryonic pharynx, blastomere
SMED30005748AFF18489.1HNF4hnf-4Stage 2, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, gut, digestive system, gamma neoblast, embryonic pharynx
SMED30028442Lysosomal alpha-glucosidaseStage 2, Stage 3, Stage 4, Stage 5, Stage 6embryonic digestive system, embryonic gut cell, primitive gut cell, embryonic pharynx
SMED30000139Macrophage-expressed gene 1 proteinMPEG1-like-1Stage 3, Stage 4embryonic digestive system, embryonic pharynx
SMED30015696Macrophage-expressed gene 1 proteinMPEG1-like-3Stage 2, Stage 3, Stage 4, Stage 5embryonic digestive system, embryonic gut cell, primitive gut cell, embryonic pharynx
SMED30034696Macrophage-expressed gene 1 proteinMPEG1-like-2Stage 3, Stage 4embryonic digestive system, embryonic pharynx
SMED30025388Myosin heavy chainDj-mhcStage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, musculature system, muscle cell, embryonic pharynx
SMED30023593Netrin 1netrin-likeStage 2, Stage 3, Stage 4embryonic digestive system, embryonic pharynx
SMED30022907SynaptotagminDj-sytStage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, ventral nerve cord, neuron, cephalic ganglia, nervous system, embryonic pharynx
SMED30010096DAA33932.1TPA_inf: prohormone convertase 2Stage 4embryonic digestive system, embryonic pharynx
SMED30027646Transcription factor BTF3BTF3-likeStage 2, Stage 3, Stage 4embryonic digestive system, primitive ectoderm, embryonic pharynx, blastomere
SMED30025427Translationally controlled tumor proteintct-likeStage 2, Stage 3, Stage 4embryonic digestive system, primitive ectoderm, embryonic pharynx, blastomere
SMED30015313Venom allergen 5VAL-likeStage 3, Stage 4, Stage 5embryonic digestive system, embryonic pharynx
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30015512 ID=SMED30015512|Name=Venom allergen 5|organism=Schmidtea mediterranea sexual|type=transcript|length=890bp
CTCTTTTATGGTGAAAAATAGAAAAGAATGGTTGAAAATAAGTAGAAAAATCAATTCATAATTGTCCGGAGACTCGATTT
AAACAAGTATAGAATTAAAAACTAAAGGAAATTTAACCAGAAATCTTTTCAATCAGTCAATCATACTTTTAATGGATCTC
AATACTTAGTTTGAGCAAAAATTATATAAATGATTGCTTAGTTTTAGATTGGAAAATCTACACGAATAATGAATTATAAT
TTCTTCATATTAATTATTAATATTATTTTTCTAAGGATTTGTTTGAGTGATCTTAATGAAAAGCATAAAGAAGAAATTCT
CTTTGAACACAATAGATATAGGCAACTGATCGCAAAGGGTATGATTTCGGATCAACCACCGGCTGCCAACATGGTAAAAA
TGACATGGAATGAAGAATCAGCAGAGAAAGCCCAACGAAAAGCGGATACATGCGAGTTTTCACACGACTCAAAGCAAGAT
CGTAGTTATAGTCATCATGAGTGGGTTGGTCAAAATATTGCCATGTCAAGTGGAAGAAAAATTTCAAACGGATTAAAATT
ATGGTTCAACGAAGTCAAAGGATATTCTTATTCCGATAATAGCTGTTCTTTAAATACTTGTGGACATTACACTCAGGTTA
TCTGGGCGAAATCCAAGGAATTAGGTTGTGGAATTTCAAAATGCAGTCATGGACGATTTTTGATAAATTTTTTGGTTTGC
AATTATGGTCCAGGGGGTAATTTTAACAGTGAATTACCATACGAATCCGGACCTGCGTGTTCAAAATGTATTTCAGGGAC
AACTTGTGATGGTGGCCTGTGTAATTAATGAGAACTTTCATTTGAAAAAAGCAATAGAATGTTTTTAGATATTTATATAA
TACTTTAGAA
>SMED30013734 ID=SMED30013734|Name=Venom allergen 5|organism=Schmidtea mediterranea sexual|type=transcript|length=359bp
AATTAAAGTCGGATTTGTTTTAGTTGTTCTAGAATTTTGTTCTGGAGATCTTTCTAATGACGATAAAGACATAATCTTGA
CTCTCCACAACATGTACCGACAATATGTGGTCTATGAAGTATTTTCAGATATACCCGTCGCATCGAACATGCAGCAAATG
GTATGGAGTGAAGAATCCGCGTCAAAAGCGCAGATCTACGCGGATAAATGCATATTTGCTCACGACACAATAGATGACCG
TAAATACGGAGATTTTGAATGGGTTGGACAGAATGTTGCTAAGTTCGCTGGACAAAAAATTGCCAGAGGCGTCGAATTGT
GGTTTAATCAGGTTTCCGGATTCACATTTGAAAATAGTG
>SMED30028603 ID=SMED30028603|Name=Venom allergen 5|organism=Schmidtea mediterranea sexual|type=transcript|length=676bp
TAAAAATGTAAATCCGTTTAGTTTTTCTATTTCGATATGAATTTTTTAATTGAAGTCGCATTTGTTTTAGTTGTTCTAGA
TTTTTGTTCTGGAGATCTTTCTGAAAAAGAAAAAAATCTACTCTTGAATATCCACAATGAATACCGAGGAGATGTGGCCA
TAGGACAAGTTTCAGGGCAACCCACAGCATCGAACATGCAACTAATGGTATGGAATGAAAAATCCGCGTCGAAAGCGCAG
ATCTACGCGGATAAATGCATATTTGCTCACGACACAAAAGATGACCGTAAATACGGAGATTTTGAATGGGTTGGACAGAA
TGTTGCTAAGTTCGCTGGAGAGATAATTACCAGAGGCGCAGAATTGTGGTTTATTCAGGTTTCCGGATTCACATTTGAAA
ATAGTGCCTGTTCATTAAAAACCTGCGGCCATTATACACAACTTGTATGGGCCAACTCTACTGAGCTTGGATGTGGACTT
GCGAAATGTATAATTGACGGAATTGATTTGAATTTGTTAGTTTGCAATTACGGTCCAGGAGGCAATTATGTCGGTGAGAA
ACCCTATAAATCTGGCGAGCCATGTTCTGAATGCAAATCCGGCCAATCCTGCACTGCATATGGACTTTGTTATGATTAAT
AAATATCCCGTCAATCCTGCAGTCAGGATTGACTTG
>SMED30008247 ID=SMED30008247|Name=Venom allergen 5|organism=Schmidtea mediterranea sexual|type=transcript|length=799bp
TATTTAATTAGGGGAAATTATATTTGATTTATCTGAGTTGAACAGTTATTTAGTAAATCTTTATTCGCATGTTATATTAA
CTGACAAATTTGAAAAAAATATTCAATGATGATTCTTACGGGCTTCGTATTGATATCCATAATTTCTCAAGCATTTTCCA
TTACAAGTGATCTCCGAGATGACTTTCTAATGGCCCACAACAAGTTCCGGCGGCAAGTAGCTCAAGGTAAAGTTCCAGGT
CAACCGGCAGCCTCCGATATGATGGAAATGGTCTGGAGTGATGAATTGGCAGCGACTGCAGAGAAATGGGCCAGTAGATG
TGTGTTTGGACATGATGAAAATAGACAAACTAAATCTTTTCCAATAACAGGACAAAATATTTATGCCGGTTGGGAGCCAA
AAGAAGTGCAACAAAGTTATGGTTCAATGAACACATGCATTACACATACAACAATGATCATTGTAACGGAGTTTGTGGAC
ATTATACACAGGTGGTATGGGCCAACAGTAATGCTGTGGGATGCGCCAGTTCTCATTGTGAAAAGGTGAATGGATTCAGA
TACAAATATTTTGTCGTTTGCAACTATGGACCAGCATAATGGAAACTACCAATTTGTAAAACCTTATATTGCTGGAGAGA
CTTGATCAAAATGCCCTGCCGGTTCAACATGCAATGATGGACTCTGCTCAAATTATGACATCACTGACAAGAATGAGAAG
AATTAAAAAAAATAAGATATTGGACAAAATTATCCACCAAACAAAATTAAATGACAAACCTTTTGAAACGTTTTAAAAT
>SMED30012792 ID=SMED30012792|Name=Netrin 1|organism=Schmidtea mediterranea sexual|type=transcript|length=2046bp
CATCTGCGTGCGAGATCGAGTGCTGACTGATTTGAAGAATACCATTTTTGCAATACAAAAAAACACATGAAAATTCTTTC
TCCGCCACAATATACAACGGACACAAAATAAAGATTCACTTTTTTAATTCATATCAAAAAGAAAAAATCAATATCAAAAC
AAACGAAGTGAAAACCCCACAAGAAAAATGTGCAGATATATTTTCACAGTTTATTTTTCAATGTTTTACAAATTTGTGCT
ATCGCAGTTACACATGAATAATTTGACTCCCAGTCCATGCTACGCTCACGGATCCGCATATCAGTGCATGCCTCCATTCA
CAAACATTGTAGAGAATATGATTCCAAAGATCGAAACCCTATGTAAAAAGAAGGAAGTCTGTCCTATAAAATCTCCAAGG
GATAATTTAATCACAGATTATCACTTGACTCACAATCAAACATGCTGGAAGTCAGTTCCGCTACAAGCTAATCATGTAAA
TATTACGTTTTCATTTGCTAAGAGATTTGAAGTTTATTACATCTCTTTGACACCATGCGAATCAGGAATTCCCAACGCCA
TCGCCTTTTATAAAAGCAACAACTTTGGAATCACTTGGAAACCTTGGCATTATCTTGCAACAAACTGTTTATCCATGTTC
AATATGAAAGAAACGACAATTCCCAGTCTACAGTTCAATGATTTTCGAATTCAACGTAGAGAACAAGCTGCTAGATGTTT
TCCATTAAAATTGTCGCTAACCGACAACGAGCCAGTTGTGGCTTTCAATACAGTTTTAGAAGGCGCCTATGAAAACGTTG
GGGATTCCAGCTTGATTGACTGGATGAGTGCGTCTGATATTCGGATTACATTGTTCAAATTTGACAATCCTAAACCGAAA
AAGTCGAATATTTTCCGATTCGCTAGAAATTCTCCGAAGAAAATTTTGTCAATTTCCGACATTTCAATAGGTGGACGATG
CAAATGCAATGGTCATGCAAATGCTTGCAATAAAAATCCTATAACGAATAAAATTGAATGCGTTTGTCAGCATAACACTG
AAGGACAAGATTGCGAAAAATGCAAAAAAAACTATTTGGATCTTCCTTGGGCAAGAGCCACAGTAAACTCTCCAGCTCAG
TGTAAAAAATGTGAATGCAATTTGCACTCTTCAAACTGCTATTTCAGTCAAGATCTTTACATTCTTCGAAAGCAAATCAC
TGGAGGCGTATGTACAAACTGTCAACACAATACAGCGGGAGTAAGATGCCATTATTGCAATGATGGATACTACAGAGATT
GGACAAAGCCATTAGATCATAAATTCGTTTGTAAAAAGTGTACTTGCCATATCATTGGGGCTAAATTTCCGGATAGATGT
GATAAAAGAACAGGACAGTGCTTGTGTAAAAGTGGTGTAACGGGAGAAATGTGTAATAGATGCGCATCAGGATTTAGACA
AAGTAACTCAACAGAAACCCCATGCGTAAAATATATTCAAATGGAGTCAGCTGAAAACAAATGCAAAGCGTGTGATTCGA
AAAGAACTAGAATTAGATTTCAAAAATTCTGTCGCAAAGACGCAGTGTTTTCTGCGACTTTACAATCTCAAGAAATCATT
GGGGATTTTATTCGGTTTGATGTCACAGTTGATAATATCTGGCATAGTAAAAATTCAATCAAAGATTTATATCCTGGAAT
ATTTAGCCAGCCCATAATGCGCCCTTCAAGCAAGTCCAGACTAAATAACAGGCCTACAAATCCGATATGGCTGAAATTGA
GGGACCTGAAATGCAACTGTGTCCAGTTGCAACTGGGGCAAACCTATTTATTAATTATCAAATCAACGACTTATCACTAT
CAAAATCGTGCGGAGCTTCTCATCAAATCTCCTCGAAGCATCATTTTAACATGGAATCCGACATGGAAACGACGACTCAA
TAGATTTAAACAAAAAAAAGAAAAAGGCGAATGCTCAAAATTTCAAAATCGTTCTCCGTTTCGAAAACCGGTGAACTGGT
CAACGCCGAATTACAGAACTGACTCAAATAATTTGTAAAGTTTCTC
>SMED30000735 ID=SMED30000735|Name=Venom allergen 5|organism=Schmidtea mediterranea sexual|type=transcript|length=669bp
GTTGACAGTAGACGGCAGGAAATTCGGCCCGATTTTAGTGGTGCTCATCTAGGAGGGGGTAAAACATCGATTAAATCCAA
ATTACCCCCATCGTTGTTCTAGAATTTTGTTCTGGAGATCTTTCTAATGACGATAAAGACGCACTCTTGAGATTCCACAA
CAATTACCGAAGAGATGTGGTCTATGGAAGCGTTACAGGGCAACCCACAGCAACGAACATGAAACACATGGTATGGAGTA
AAGAATCCGCGTCGAAAGCGCAGATCTACGCGGATAAATGCATATTTGCTCACGACACAATAGACGACCGTAAATACGGA
GATTTTGAATGGGTTGGACAGAATGTTGCTAAGTTCGCTGGAAAAAAAATTGACAGAGGCTTAGAATTGTGGTATAATGA
GGCTTCCGGATTCACATTTGAAAATAGTGCCTGTTCATTAAAAACCTGCGGCCATTATACACAACTTGTATGGGCCAACT
CTACTGAGGTTGGATGTGGACTTTCCAAATGTTCAATTGACGGAATTGATTTGAGTTTGTTAGTTTGCAATTACGGTCCA
GGAGGCAATTATGTCGGTGAGAAACCCTATAAAGCTGGCAAGACATGTTCTGAATGCAAATCCGGCCAATCCTGCACTGA
ATATGGACTTTGTAATTGATTAAAATAAA
>SMED30029163 ID=SMED30029163|Name=Histone H4|organism=Schmidtea mediterranea sexual|type=transcript|length=537bp
AGGTTACAGTTTTTCAACTAATACCTCAAAGAAATAATGAAAGATGGACAGTAGAGTTTTGTCACCATCAGGAGACCAAG
TGTCATTTAGGATGATAATAGCCCAGTTAAGGAATCTTGCTGATCTAATCAATGCCAAAAATATTACAAAATTTCGATTT
AAAAGAAGCTAAAGGAGAAAAATTACACGGAAAAGTTCAGAGGTACAACATCCAAGGCATCCCTAGGTCTGCAATTAAAC
GATTAGCACAAAAAAGAGGTGTGAAAAGAATTCATGGGCTTATTTACAAAGAAACAATATATGTTATCAAGTTAGTCCTT
GAAAATGTCATCTTATATGATATTAAATACACATTGCAAGCCAAGCAAGAAACTTTTACTGCCAAGGATGTTTTTAATAT
TCTTGAATGTTTGGAGTTTTCTATTTTGTGATAACATCCTTCCCCAAATGAAAGTTATCAGATCATTTTGCAAAGTTTGT
GAGAAGGGATATATATTTACCAACAAGAAAAATGTTTTGAATTTAAGAATAGGACTC
>SMED30002175 ID=SMED30002175|Name=Venom allergen 5|organism=Schmidtea mediterranea sexual|type=transcript|length=647bp
AAATGAATAATACAATCCTCGCAATTGTTATAATTCTAAGCAATCTCTTTGTATGTTATGGAGATCTTTTGGAAGATCAA
AAATCTCAACTTCTAGAAGCTCACAACATTTTTAGGCAAACTGTAGCAAAAGGTCTTGTTAAAAGTCAACCGCCAGCAGC
TGATATGTTGAAATTAATTTGGAGCACTGATTCCGCTTCTAAAGCACAGGGGTTAGCAGATAAATGTGCATTCTCCCATG
ATTCCATGAGCGATCGGGCATATGGAGATTACCAGTGGGTCGGACAAAATGTAGCAATGTTCAGTGGACAAAATATATCA
AAGGGTCTAGAGCTCTGGTTTAATGAAGTTACAGGATATTCTTATACAACTGGTGCTTGCTCGGGAATATCCTGTGGACA
TTATACACAATTAATATGGGCAACATCAAAGGAACTTGGTTGTGGAGTGGCTAGTTGTCCATATTCGAGTTACACAATTT
TATTTTTGGTCTGCAACTATGCCCCGGGTGGTAATACTAACGATGAGAAGCCATATCAAGTAGGAGATAATTGTTCTAAA
TGTCCAATTGGAACCGCTTGTACTGATGGACTTTGCAATTAGTTTTTCATTATTAAAATAAAAATTATGCACTGCAGATC
GGAAGAG
>SMED30018781 ID=SMED30018781|Name=Venom allergen 5|organism=Schmidtea mediterranea sexual|type=transcript|length=627bp
CCATGAATTTTATAATTAAAATTACATTTGTTTTAGTTGCACTAGATTTCTGTTCTGGAGATCTTTCTGATGAAGAAAGA
AATCAAATCTTGGAAATCCATAACAAATTCCGAAAATCTGTGGCCAATGGAGAAGTTTCGAACCAACCCAAAGCAGCGAA
CATGCAACAAATGGTATGGAGTGAAGAAGCGGCATCCAGAGCGCAGGCAACCGCGGATAAATGCTCATTTAATCACGACA
CAATAAATGACCGTAAATATGGAAATTATGAATGGGTTGGACAGAATATTGCCATGTTCACAGGAGGAAATATTGCCAAG
GGCGTACAATTGTGGTTTAACGAGGTTTCCGGATACACATTTTCAGATAATAGTTGTTCAGAAAATACTTGCGGACATTA
TACACAAATTGTATGGGCCAAATCTAAAGAGCTGGGCTGTGGACTGGCCAAATGTAAATATTCAAAGTATAAAATGAATT
TTTTGGTTTGCAATTACGGTCCAGGGGGTAATTTCAACAGTGAGCTACCTTACGAAACAGGCGAGCCATGTTCAAAATGT
CAATCCGGTTCAAACTGTAGTAATGGACTATGTTAAAGTTTTCAATAAATAAAATTTGCATCCAATG
>SMED30027701 ID=SMED30027701|Name=ATP dependent RNA helicase DDX5|organism=Schmidtea mediterranea sexual|type=transcript|length=2292bp
ATAATAATAATTGTTGTTATTATTTGATGAAACAATGAAGAATAGTGTCGATGTTTACTAGACATACAAGCCGTTACAAC
AAAGCGGCACATTTACGGGACTAAGCTGACATGTCCATAAATGGTCTATGTTAGCCGTGTGGGCGCATATCTGTGTGCAT
CAACACGGTAATTTCTCACACGAGCCGGTGGAGTGGTCTCGTTCATCGTGTTGCTGATAACCACCGAATGATGGTTTGCT
GTTGCCAAATAGCTCATCAGCCTCAGAGATTTGTGTCGTCGACCGGGGTGGTCGATGGAGCCACAGGTTTTGTCACTGGT
TTCCCACCAAGAAAGCCCGTGACACGACATCGCTTCGTGGTTCTGGTGATCACTCGGCGCGACTTCAATGACACACAGAA
AGACACATAGACAACTGTCCGGTCTCTTATGGGAGTACGTGGATATTGATGATATTGAATATGTCATCAATTATGATTAT
CCGAGCAAGTTAGAGGATTATATACATAGAATTGGCAGAACAGCTAGAAGCGGCAAAAAGGGAATCGCGTATACATTTTT
CAATCCCATGAAAGATAAGCCTAGACAAGCACAAGATCTAATTATGATTCTGGAAGAAGCAAAGCAAGAAGTTCCAACGG
AATTAAGAGACGTTGCTTCAAATCGAATACCTAGCAAACGATTTAAAAGTAAAAGAAATCGATCTCGTAGTAAACAGCGA
TCAAATAGTCCTAAAAGGTCAAGAAGTCGAAGAAGTAGAAGAAGATCAAAGAGTTCCAAAAAATCGAGAAGTCGTAGTCG
TAGACGATCTCGCAGTCCAAAACGTCGATCGAGAAGTAATCGTAGAAGGCGCTCACGTAGTGTAAGAAGAAGATCTCGGA
GTATTCGAAGATCAAGAAGTAGAAGACGTCGATCTAGAAGTAATCCAAGAAGATCAATAAATAGACGTCGAAGAGCAGAA
AGTAGAAGAAGAAGCAGAAGTCGGAATGATAGAAGATTGGCTGTTCCTAGACGACGACGCGTTTCACCTACTCCACCAAG
GTTACGTAGAAGAAAAAGCAGTTCCAGCAGTATATCAGGAAGTCAGTCTAGTGATTCTCGTTCCAATAGTAGCGTCTCAA
TAAAACGGGAAGCACTAGCCGATAAGATTCCAAATATAGCCAATGAAAAAGAAACTCATCAAAATGAACTGGAATCAAAA
CTTCATGACGAATTGAGTTCGGAAAATAGAGAGCCATTGGATATCCAATTGACAGTTAATGAAAATGAATTTGAAATCGA
AATGTCGAAATCAAGATTGAAAAAAGATATTGGGGAAGAGAGAAATAAAGAAAACAAAGTATACGAAAATTGCATGTGGC
AAAATAACTTTGCGGAAGAGGTTTTTGAAGTGCCTCCCGTTGTTGCACACCACGAGGTCGATATGGATATTGATGAATAT
CGAAAGTCATTTGATGCATTGAATCAAACAAGGCAAAAGGAGAAATTATTCGATTCTATTCGGAAAATAATAAAAATCGA
TGACGCTGCAAAACAGCGACCGATAGAAGTTATGACTAATGAAGAAATCGATATTATAACAACTGTTGAGCAGCCACCTG
TTAAAATGACGGCAGAGAAATCTGTCCAATACGAAGAACCGGAATTGGATAATATTGCAATGAAGGAATCAATCAAATCA
GATGTTGAAGTACTTTTGGAAAAATCCACTGAAAAGGATCAAAAAGTCAAAGTTCTGGAGTCTGACGAGGAACCTAAAAC
CTCCAATAAATCTAATTTGGATGAAAAATGTAAAAGTCGAAATAAATCCGATAATCAACATAGTTCAAGAGATGATCGTG
ATGAGAAATTTAAAAAAAGCAAAAATGAAAGCGATAAATCCAAGCGCACCGAAGACAAAAGCGATTCTAGAGTGGATAAT
AGAAAAGAGAGCAAACGTGACTCGAAAGGTGAACCACGTGTTTCTCGTTGGGAGATTCATTCATCGAATAAAAATGAAGA
AATCAAAGCGATGGGAAAGTGGGAAACTAAATCTGAGCTTAATCAAGATAAATGTGAAGCTGAAAAAACGTTTGATAGTA
AAGAGGAAAAACCTTGTAATATGCTCGAAGAAAAAAAGTTGGAAAAGAAGCATGAGCCGAAAGATGACAAGAAGCGGGAT
CATAAAGATGAAAAGAAACACGAACAGAGAGAAGATAAAAAACGTGATCATAAAGAGGATAAAAAACACGAAACGAAAGA
CGATAAGAAACATGAAGTGAAAGAAGAAAAGAAACATGAAACGAAAGACGAC
>SMED30020956 ID=SMED30020956|Name=Lysosomal alpha-glucosidase|organism=Schmidtea mediterranea sexual|type=transcript|length=2869bp
GTAAAGTGCTAAATTTCAAGATGATGTATAGAGAAAATGAATGACCAAAGTACAAAATATAAAGATATTTAAGTAATAAA
ATTGAATTCCGAACTTAAATTGAAATGTTGAAGTTATTGTTGATAATCTCCTTGAACTTTATAATCGTGTCCAATGCTCT
CCAATGTTCAGTACCGAATAACAATTATAGGCTAGACTGCTTTCCTGGGTCCAATGCAAATCAGAACGATTGTTTGGCTA
GAGGATGTTGTTGGTCACCACCGGAAACCCGGGAATATAGTCAGAATAATCCGACTATTCCATACTGCTACTTTCCAATA
GAATATCCAAACTACCAAATTAATTCATTCACTCCTACCGATCGAGGATTCAAAGCTCGTCTAACAAAACAACAAAAATC
ATTTTTACCGAAGGAAATATTAAATTTGAACTTTGAAGTGATCTTTGAGACAAATACTCGATTGAGAATAAGAATCACCG
ATCCGAATGTGCAAAGATTTGAAGTTCCGATTCAGCTTGGATCTCCTGATCCGACTCCACCTTCAAATGTTCAATATAAA
TTCACAATGCCCACAAATGGTTCTTTTGGATTCGAAGTCAAAAGAAATTCCGACGGATTGAGCTTGTTCAAAACATTTGG
TCCTCTATTGTATTCTGATCAGTTCATACAAATATCTTCTTTGATGTCAATCCAACACGTTTATGGAATCGGAGAACAGA
ATCGTCCATTTCTACATGATTTGTCTACTCAATGGGAAAGAATAGGACTGTGGGCACGCGATAATGGAATAGATACATAT
AATAATTTATATGGTACTCACCCGTTTTATATGTCACTGCCTGATTCTGGAGAAGCGTTTGGAGTTTATTATTTCAATAG
CAATGCACAAGAATTTGTTTTACAACCGGCTCCAGCGATTACTTACCGAACAATCGGAGGAATACTCGATATTTTCATTT
TTTCAGGTGGAACACCGGAAACAACCGTTAGTCAATACACTGAATTAATAGGAAGACCAATGCTTCCTCCGTTTTGGTCT
CTTGGATTCCATCTATCAAAATACGGTTATAAAAGTATTGCTGATGTTTCTAACACTCTGTATAGAAATATTAATATAAG
CATACCAATAGAGGTCCAGTGGTCTGACATTGATTACATGGACAAATATAAAGACTTCACATCCGATCCGATCAAATATG
CAAATTTTGGTTCATTTGTTGCATATCTTAATATAACTTTAGGAATAAGGTATATTGTTATAATAGATCCCGGAATCAGT
ATACAAAGTCCCGGTGCATATTCCCCATATGATGAAGGACTTGAAATGAACTTATATATTAAAGATGCGAATACTAAGAA
ACCTTTAATTGGACAGGTTTGGCCAGGGGAAACATGTTATCCTGATTTTACTCATCCTAATGCTTCAAAGTATTGGTCAA
ATCAAATTCAAAGATTTCATTCTCAAGTACCAATAGATGGTTTGTGGATTGATATGAATGAACCATCAAATTTCTACGAT
GGATCTAGAACCGGATGCGCTCTAAATAATCCGTATGACTATCCATTCTTTGTACCGACAATCAGAGATGGTTCGTTAAT
TAAAAAAACAATATGTTCATCTTCTCTTCATTATAACAATGTCATGCATTACAACTTGCATAATTTATATGGTTACACCG
AGGCAGTAGCGACTCATAGTGCTTTATTGAATACCATTCCAAACAAAAGACCATTTATTTTATCTCGTTCCACATTCAGT
GGATCTGGTAAGTACACCTTTCATTGGACCGGTGATAATTCGGCAAATTGGGATCAGTTAGCCAATTCAATCAGGCAAGT
CCTCAATTTCAACATGTTTGGTATTCCAATGACGGGTGCGGATATTTGTGGATTCAATGGAGATAGTAATGAAGAACTGT
GTATAAGATGGATGCAATTAGGTGCTTTCTATCCATTCATGCGGAATCATAATACCTATGGTGTAAGAGATCAAGACCCA
GCATCTTGGAGTAAAGAAGCTCAGAACATTATGAGAAAAAGTATCAATTTAAGATATGTTTGGTTACCTAACTTTTATAC
ATTATTGGTTAAATCATATTTGTACGGTGGCACTGTGATGCGACCATTGAGTTTCCAGTTTTACAGTGATGCTGAGACGC
ATGAAATTGAGAGGCAATTTATGATTGGTTCCTCGATGCTCGTCAATCCAGTTGTTGTCCAAGGAGCTAGAAATGTTGTA
GCATATTTTCCAACTGGAGTCTGGTATGATGGATACACAAATCAAGTCGTCCATTCAGGACCAATTGGAAAATGGATCAG
TTTAGATGCGCCGATAGATAAATTGAATTATGCAATTAGAGGGGGCTCTATTTTGACAGGATTGTTTCCAGCTATGACCA
CTACGTCATCTCGCAATGGTCCTTGCTTTTTATATTGTGCTCTTTCTCTTAACAGAACTGCTTCTGGCGAATTGTATTGG
GACGATGGAGAAAGCTTCGACAGTTATTCAGGAAATAAATATAGTTATATTACCTTTACGGCAGACTCGAGGGGATTAAA
GGTGACACCTCAATTCGTTGGATTCCGTTCTATTCCTTTACTGGCAAGTATTTCTGTTGTTGGACTTGAAAATTTGTCAA
TCACAAAAGTGTCATTAAATGGAAAAGAAGTTCCATTTATTGTTTTGAACAATTGCTTAATAATTACGACTGGGAAGGTT
TCAATGTCAACTGATATTCATGTAACTTGGCTATAAAATTCGGGAATTTTATTTTTGATTTAATTATTCATTTGTTTAAA
AGAGTCATTATTATGGTTTCATTTTATTCAAATTAAATTGAGTTACTTTCACAGATAAAAATCTCACCT
>SMED30022921 ID=SMED30022921|Name=Netrin 1|organism=Schmidtea mediterranea sexual|type=transcript|length=1370bp
GATTTTTATAAGAACAATAGCAATTCTAAATTTATCAGTGTGGATTCATTCTGTCAAGGTTATTTTTGAATCTCAGTCTT
CACCATGCTATTTAAACGGGAGGCCTCAACAGTGTTTGCCGTCTTTTACAAATATTATTGAAAACGTTAAAGCAGAAACT
ACAAGTACGTGTGGGACCAATGGACCGGAACAGATTTGTCGGAATTGGTATGACAAGACAACTGCAGAAGCCCGACAATA
TTGTAGTATATGCGACGCAAAACATCGTTCATATCCACCATCCCATATAACAGACCGACACATTCCAAAAAATCAAACAT
GTTGGTTTTCTGGACCGTTACAGGAAAATCCTGGTCAAAATGAAGTCAATATTACTGTTTCGCTGAAGAAAAGCTTCGAA
GTTTATTACATTGCATTGCAAATCTGCGGAACACTTCCAGATTCAATAGCAATTTACAAAAGCTTAGATTTTGGAGTTTC
ATGGAAACCTTGGCAGTTTTTTTCACAAGATTGCTACAGGGCATTTAAAATGCCAACAACCAACGAACAGAACTCTCAAA
TCACTCCTGCAAACATTCACGAAGTTCTTTGTGTTGAATTAAAAGCCCCTGAACGATACAATGATTATGGACAAGCAGAA
ACTGTGTTACCGTTTAGTACCATTTATGGGCGACCATCTGGACCTCCATGGAGTCAAGATTTAGTTGAATGGATGACAAT
GACAGATTTGAGAATAAGTTTGATGAGATTTACACCGGAAAAATCGACTCCATACAGATTGAAAGAATTGTATTATCATA
CCGAATCACTTCCCCAAGCACCACCGAATTTAGTCAACCATAAAACTGAGCCGATTGTTCATTTTGGTTTGTCAGATCTT
GCTGTTGGTGGACGCTGCAAATGCAATGGCCATGCTAATCGATGTTTGATTGATGATAACGATGAAATCAAGTGTGACTG
TCACCACAACACCGAAGGTCAAGAGTGTGAAAGATGCAAATCTAATTATCTTGATCGACCATGGCAAAGAGCAACCAGGC
AAAATGCCAATGTCTGCAAATTATGCCAATGTTACAACCATTCTGATAAATGCATGTTCAGCATGGGCATGTACAAACAA
ACTCGAGGACAACATGGAGGGGTTTGTTTGGAATGCAAACACAATACAGAGGGTCACGCTTGTGATGAATGTGCTGCATT
TCATTATCGTGATATAACAAAACCAGTTACACATCCTCAAGCTTGTACAAATTCATGGCACAGGTAGGTGAAGGCGCAAA
GCACCCGTTAATACTATTAATTGCGCACCGTGAACTAACCAATAAAAATCGAGTCAGGTTGCAAATGTCACACTATAGGA
TCTATTAAAC
>SMED30020435 ID=SMED30020435|Name=Myosin heavy chain|organism=Schmidtea mediterranea sexual|type=transcript|length=3615bp
TCTGAATTTAAACAAAGATATTCAATTTTGGCCGCAGATGTAATAGGGCAAGGATTTATTGATGGAAAACAGTGTACTGC
AAAGATAATGGAAGCAATCCAATTAGATAAAAACAACTACAGGCTTGGATCAACTAAAATCTTTTTCAAGGCCGGAGTAC
TTGCTCAGTTAGAAGACATGCGAGATGAGAAATTATCATCCATTTTGTCTGTATTCCAAGCACAGATGAGAGGATATATA
ATGAGAAAAGCATATAAGACATTGCAAGATCAACGAATTGCTCTTTCTCTCATTCAAAGAAACATCAGAAAATATTTATT
ACTAAAAACATGGCCATGGTGGAGACTATACACTAAAGTCAAACCACTCCTCAATATCGCAAGACAAGAAGAGGAGATGA
AGAAAGCTGCTGAAGAGTTGATTAAATTGAAAGAAGAATATGAAAAGATAGAAAAATTTAAAAAGGAATTGGAAGGTCAA
AATGTGGTTTTGCTTGAGCAGAAAAATGATTTATTTTTACAACTGCAAACAGAACAAGACAATCTTAGTGACGCTGAAGA
AAAGATTCAAAAGATGATCAATCAAAGAGTTGAAATGGAGAACCAATTTAAAGAATTAGAAGATAAATTAATGGATTCGG
AAGACATTCAAGATGAATTGGAAATCGAAAAAAAGAAATTGTTGTTGGATATGGATGAATTGAAATCGGACATTGACGAA
CTTGAAGTATCTTTAGAAAAGTCTGAACAAGAAAAACAAGCTCGCGATCAACAAATTAATAATTTGAAAGAAGAAATTCA
AAAACAAGATACTTCTATCGGAAAAGTTCAAAAGGAGAAAAAGACTCTAGAAGATAACTTAAATCAGACCAGAGAAGCTT
TAAATGCTGAAGAAGACAAGGTCAATCAGTTGACTAAAATCAAATCAAAATTGGAATCTGAAATAGATGAAATGGAAGAA
GCTCTAGAACGGGAAAAGAAGATCCGTGGAGATGTTGAAAAACTTAAACGGAAATTAGAAGCTGATCTCAAATCAAGCCT
TGATAACTGTAATGAGTTGGAAAATATAAAGCAGGAGTTAGAAGAAAATATTCAGAGAAAGGACATTGAAATATCAAAAT
TAAATGTCAAATTGGAAGATGAATCTTCAATTGTCACTCAACTTCAACGAAAAATTAAGGAATTACAAACTGTTATACAA
GATCTTGAAGAAGATCTAGAAGGTGAGAGACAAGGTCGATCAAAATCTGAAAAAGCTCGACAGTTGGCTGAACAAGAACT
CGATGAACTAGCTGACAGACTTGAAGAGCAGGGAGGTGCTACTATGGCACAAGTGGAATTGGCCAAGAAACGAGAAACTG
AATTAATGAAACTTAAAAAAGAATTACAAGATACCAATTTACAGAATGAGCAAATACTCAATGGTTTGAAAAAGAAAAAC
CAAGAAATTACCAATGAATTCTCCGAGCAAGTCGATCAAATAAATAAATCTAAATCAAAAATCGAAAAAGAAAAGGCGAC
TCTTAAGCATGATCTGGATGAATTTGTTTCTCAATTAGAATCTGTTTCAAAGCTAAAGGCCAATACAGAAAAACATTCAA
AACATTTAGAAAGTCAAATTATGGAATTGGAAAACAAAATAGACGAACAGAATCATCAAATATCAGAAATGGTTTCACAG
TCTAATAAAGACTCTCAAGCAATAATGTCTTTAGAACAACAACTAGAACAAGCAGAAAATGAAAATCACCAATTGAGCAA
ATCCAAACAACAATTCCTCCAACAAATTAATGACTGTAAATCGACTCTTGAAGACGAAGAAAAAGTAAAGGCCAAACTTT
TCAATGAAATTCGTAATCTGAATGATGAAATGGGCAATTTAAGATCCAGTTTGGAAGAAGAGCAAGAATCCAAAAGTGAA
ATTCAAAGGTCACTAGCAAAATCCCAATCTGAACTTGTACAAATGAAAAATAAATTTGATAGTGAAGGTTCAGGTCGCAT
TGAAGAAGTTGAAGAAGCTAAACGTAAGTTGCAAACGAAACTTCAAGACATGGAACAAGAATTTGACGCTATTAAAAATA
AATGCGCGCAACTTGAAAAAATCAAAATTCGTCTCACTGGAGAAATCGAAGACATGAGTGTTGATGTTGACAGAGCTAAT
GCAGTGGCTAATCAACTAGAAAAGAAACAAAAGAACTTTGACAAAACCGTCAGTGAATGGCAGTCTAAATGCAACTGCCT
TCAAACTGAAGTTGATGTTGCAAATCAAGAATCAAGATTTTTGTCAACCGAAGTATTTAAATGTAAAAGCCAAAACGAAG
AATTGCTTTCACAAATCGAAAATCTTAAACGAGAAAATAAGTCTCTCAGTGATGAAATTCACGATTTAACGGAACAACTA
AGTGATGGCGGAAAATCTGTTCACGATATAGAAAAGGCAAAACGAAAATTGGAAATAGAAAAGGAAGAACTGGAACAAGC
TTTGGAAGAAGCTGAATCAACATTGGAAAATGAAGAAGCCAAATTACAAAGAGCTCAGTTAGAGTTGAGTCAGATGAAAT
CAGATGTAGAAAAACGATTGTGTGAAAAGGAGGAAGATTTTGAAGGAACTCGCCGTAATCATCAAAGAGCAATGGAATCA
ATGCAAGCTTCTTTGGAGGCAGAAATTAAAATTAAACAGGACTCAATTAAAGCCAAGAAGAAGTTAGAACAAGAAATCAG
TGAACTCGAAGCCAATTTAGATCAAATCCAAAGACTGAAATCAGATGCTGATAAGAACAATTCAAGAATGCAACAGCAAA
TTCATGATTTACATTCAGAGATTGAACAAGAACAACACAGTAAAAACGAAGTCCGAGAACATGCTCAGATGGCTGAAAAG
AGATTTTTATCGGCTAATGGAGAACTAGAAGATTTGCGAGCCAAATTTGAACAATCAGATAGAAATCGTAGAAATGCTGA
ATCTGAGCTTCAAGATTTGAGTGATAAATACAATGAAAGCCAAGCACTGATCACTTCACTTCAAAGTTCAAAAAGAAAAA
TGGAAATGGATTACGTAGCTATGCAGTCCGATCTTGATGATATGTCAAACCATGTTCAACAAGCTGAGGAAAGAGCAAAG
AAAGCAGCTGGTGACGCTGCCCATATGTCAGAACAACTTCATCAAGAACAAGACAATAGTTTGCACACGGATAAAATGAG
GAAGCAAATGGAAATTCAAATCAAAGAAATGCAGTGTAAACTAGAAGAAGCCGAAAGTAATGTTTTGTCAGGCGGCAAAA
AGACTTTGGCAAAGTTAGAGTCAAAAATACGAGAATTGGAAACTAATCTTGATAACGAAATGAGAAAACATGCTGAAACT
CAAAAGAATTATCGCAAAGTAGATAGACGAATGAAAGAACTAACATTACAATTGGAAGACGATAGAGCTCAACAAGAAAA
ATCAAATCAAGTTATTGAAAAATTCCAAGGACAAATCAAAACCCTTCGAAAACAATTAGAAGAATCAGAAGAAGTTGCCG
TTTTGAATATTGCCAAATTTAAGAAAGTACAATGTGATTTTGAAGAAGCCGAAGAAAGAGCGAATGAATCGGAACAAGCT
TTACAAAAATTAAGA
>SMED30017650 ID=SMED30017650|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=1091bp
GATGGGTCCTATCTTGATATGTTTATTATTAGCAGTGATTTCAGAAGCCAGAACCACTTATAGCCATCACAAATCAGTTC
CAAGTGATGACATTTCTAGTAAATTTGAACTAGAAAATATGGTATCTCTCTTGTCCCGTTACGATGGAGAATTCCAAACC
TTCAAACAGCGATATAATAAATCTTATAGTTCCATGCATGAAGAGAATTCCAGATTTTTAAATTTTATATCATCTCTACT
TGAGATCAATCATCACAATCAACTTTATGAAAACGGTCAGAAATCATACGAGATTGGAATCAACCATTTGAGTGATTGGA
GTGGCGAAGAACTCGCTCAACTGACTAAATTGAAACAATCAAACCTGACGGGCTCATCATATCTATCATCCAATGTGAAA
ATTGACCTTCCAGATTCATTCGACTGGAGAGAGAAAGGTGCAGTTACTGAAGTAAAAAACCAAGGATTTTGTGGATCATG
TTATGCATTTGCTACTACTGGCACCCTAGAAGCCCAAATCTGGAGGAAGACTGGGAAATTGATCAGTTTATCAGAACAAC
AAATTGTTGATTGCGATACTAATGATGATGGTTGTGATGGCGGATTTGTGCAAGACGCGTTATCATACATCAAGTCAAAT
GGAGGCATTGAAAATGAGGAAAGTTACCCTTACATATCAAGTGAAACATTTAAACCTAATTCTAAATGCAATTTCTTCAA
AAGCAAAGTAGTGGCCACCGACACTGGATTCGTTCAAATGCCAGCAAATGACGAAACAAAAATGAAAGAAGCTCTAGTTA
CAATTGGGCCTATTTCAGTAGCAATATCTGCAACCAAATCGCTCAAAAGATATACAAGTGGCATTTTTCATGAGGATGAA
TGTGACAAACTAAAACTTAATCACGCTGTTCTGATAGTCGGATATGGAACAGATCAAACTTCCGGGACACCATATTGGAT
AATTAAAAATAGTTGGAGCTCATTTTGGGGAGAAAATGGATATTTCCGGTTACCCAGAAATATAAATGCTTGCAAAGTAG
CGATGATGCCAGTTTATCCTTTGGTTTGAATTGATAAAATTTTGTTCACAC
>SMED30019754 ID=SMED30019754|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=1366bp
ATTTAATTTGCTCTATTTTATTTATCAGTAATTTGTTTATTCAAAATATATAATTAACATTGTTTTGGACATCTGTTATG
AAGTTAGTAATAGTTTGTGTTATTCTCTGTTCAGGCCTTGTTAATTGTAATCCAATAACTAAGCTTTCTGACAATGAAGA
CAATTTAATTTTTGATTCAAACCTTTCTAATTCCAAGTCAAATCATGATCATTTTATTGTCAACTTTGGTCAACTAATTA
CTTATGATTCCAAGTTAGTAAAAGAATTGTCGAATTTATTAAATGAATTTCTACAACTCCCAACAATTGAGTTTATAAAT
CAAATAAAAATAGAATGGACAAATTTTAAAGTTAAATTTAAGAAAATTTACAAAGATGTTAAAGAAGAATCTGAACGGTT
TTTGATATTCTTAAAAAATTATCTCAAAATAAAAAGCCACAATTTAAAATTTAATTCCGGAACAGTTCAATTCAATATGT
CAACTAATCATTTATCTGATCTAACTGATTCTGAATATTCAACATTATTGGGCTTTAAATTTGGAAAGCGTAAAGATGGG
CCTTCGTATTTGTCACCTATGTCTCGCGTAATGTTACCGAACCAAGTTGACTGGAGATTAACTGCAGTTACTCCAGTGAA
AGACCAAGGAAATTGTGGGTCATGTTGGGCTTTTTCTGCAACAGGCTCGTTAGAAGGTCAACATTATAGGAAAACGAAAA
AACTTATCAGTTTATCTGAACAGCAATTGGTGGATTGCAGTCTAGATAATAGCGGTTGCAATGGTGGGTTAATGGATCTG
GCTTTCACATATGTCAATGATAATGGGGGTATTGACAATGAGCAAGCCTATCCATATACCAGTGGGAAAACCGGACGAAG
ATCTGCCAAATGTAATTTTACTATACACAATATTGGCGCAAAGGATTTCGGATATATTGATATTCCTCAAGGAAATGAAG
TTTTGCTTAAAGAGACTGTGGCATTGATTGGTCCAATTAGTGTTGCTATTGATGCTAGTCAATTCAGTTTCAGAAATTAC
CATTCTGGTGTTTATGAAGATCCCAATTGTAGTTCTGTAGAACTTGATCATGGTGTATTGTTAGTAGGCTACGGAATCGA
AAAAGAATCGAACATTCCATATTGGTTAGTTAAAAATAGTTGGAGTACAAATTGGGGAGATTCGGGTTACATAAAAATGA
GACGAAATTCTAATAACATGTGCGGAATCGCTACAGCCGCTTCATTTCCTATAGTGTGAAAGTCTGTCATATTTATTATT
GTTCATTCTCATGATATTCTGTTCATGTTTCAATAGTTGTCCATATCGTACTCTACGTTCTTTTTTATATAATAAAAAGT
TAATAT
>SMED30010096 ID=SMED30010096|Name=TPA_inf: prohormone convertase 2|organism=Schmidtea mediterranea sexual|type=transcript|length=2542bp
CTTTGTTTGTAACCAGACTGAAACTGGATATTGTTGTCATAAAAAAATGAAAATTTTGAACCAATTAAATTCCATTGAGT
AACTGAAAACAAGATAAAAACTAGGAAAATCGTTTTTATCGTGAACGAACAAACAAAACAGATCATTCATTGTGCCCCTT
TACAATTCATTCTCACTTTGCCCTTGTGTCTGTGCGTGTGTGTACGCGCGCGCGTGATGACGTCAGCACAAATAATTGAT
GCTCCTGAAGAAATAATATCGATCGATTCTCTCACCGAGTCCAGAGCATGCATATTATTTCTGCAAACATAAAGAATTAT
GTGTAGGTGGGATGCAGATAAAATACAAACAACGACTTTCTATAAAATTTCTGGAAAATTTCTATCGAATCTACTTTTTC
ATTAGATTTGCTATTTTTAGATGAAGATTACATGGATCCTTTTGTTTCTATGCGAATATGTAGTTTGTGGAAAAATTGTC
ACCAATCAATGGCATGTCCACCTTCATGATCCTGCAACTCAAGAATCGGCAAATAAAGTAGCTCAGGAAACTGGTTTCTC
GGTCTTACGAAACCATCTGAATTCTCCAAATGAATTTGTTTTCCATCACAAAACCGTTCCTCACGTTAGTTCAGTTCCAA
GTTGGAGTCAACACAAAGTTCTATTGGCTCACCATCTTGTTAAAAACGCAAAACAAGTTGAAGGGTTTTTGAGACGAAAG
AGAGGCTATAAGCCAATTAAAAAACAAGGTCGTGTCCCACTGCCAACGATTAATAAAAAAGGAATTCCCGGCCTGGGAGA
GTCTGACAACATTAAAGTGGATTTGAAATTACCTACTGATCCTCTATTTTCTAAAGAATGGTACATCAGAAATACCGGTC
AAGCTGATGGAGTGAAAGATCTTGATCTTAATGTATTATCAGCGTGGGCTCAAGGTATAACCGGCAAAGGGGTCACGACT
GCAATCATGGATGATGGAATAGACTATCTTCACCCGGATTTATCAAAAAATTATAACGCAGAAAGCAGTTATGATTTCAG
TAGCAATGACCCTTACCCGTTCCCTCGATATACTGACGATTGGTTTAACAGTCACGGAACAAGATGTGCCGGTGAGATTT
CCGCCGAACGTGATAATGGCATTTGTGGTGTTGGAGTGGCATACGATTCCAAAATCGCTGGGTTGCGCATGCTAGATCAA
CCATATATGACAGATCTCATTGAGGCAGCAGCTATGAGTTATGATCGAGACAATATTGACATTTACTCTGCTAGCTGGGG
ACCCACGGATGATGGAAGAACTGTAGATGGGCCGAGAAATGAAACGATGCGCGCTATTGTTGAAGGTGTAAATAAGGGAC
GCAAAGGCAAAGGAAGCATTTACGTTTGGGCATCTGGTGACGGTGGAGCAGCTGACGATTGTAATTGCGATGGATATGCT
GCCAGCATGTGGACAATAAGTATTAATTCAGCAACCAATGATGGAGAAACCGCAAGCTATGATGAATCCTGTTCTTCAAC
ACTTGCGTCGACATTTTCTAATGGTAAGGCATGGTTTAGCCTTGACGCCGGTGTCGGAACTGTGGATTTATATGGCCAAT
GTACTCTACATCATTCGGGAACTTCTGCTGCTGCTCCAGAAGCAGCTGGAGTGTTTGCTCTTGCTCTTGAAGCCAATTCG
AATATTGGCTGGAGAGATATGCAGCATTTGACAGTGCTTACGAGTAAACGAAATCATTTGCATGACAGAGATCGACGCCA
TAATTGGACCATTAATGGAGCGGGTTTGGAATTCAATCATCTTTTTGGATACGGAGTACTCGATGCTGGTGACATGGTCC
GAGTTGCTAAAAAGTGGGTGAATGTACCAGAACGATTTCACTGCATTGCCGGACAAATCGATAAGCGTTATCGATTCAAT
GTAACAAAAGCTTTAATATTGGAAATTGATACTGACGCGTGCAAATCAGATATAGGTCATCGAGTGAATTATCTTGAGCA
TGTCCAGGCTTTTGTTTCAGTTAAATCTAGTCGACGAGGAGACATAACAATGTTTTTAACGAGCCCCATGGGTACGACTT
CTATGATTCTCAGCCATCGACCAAAGGATGACGATTCCACAAGAGGATTCACCAAATGGCCATTTATGACCACTCATACA
TGGGGAGAAAACCCTCGCGGAAAATGGAAACTGACAGTAATGTTCGACACGAAAGATCCATTAAGTCAAGGAATATTTTC
TGAATGGGTGCTCGTGCTTCATGGAACACAGAGTCGACCCTATGACAAATTGTCTAGTTCACTAGAGAAAATCATTCCTA
AACTCGGTGTAGTAAAGAGACAACATGCCTCTAACAGATTTTCACAATAGTTGTTGAACTTGATCTTTATTTAGTATTGA
TAATATTTTTTGTCTTTGACCGCGACTAAGCAGTGCTACTGCAGATTTTGTGATCGTATTTTTGTAAACTTTTGTCCAGT
AAGATTGTCGTATCTTATTGTTATTATTAATTTCACTATCATTTCATCAACAGGATTAATAA
>SMED30032925 ID=SMED30032925|Name=Macrophage-expressed gene 1 protein|organism=Schmidtea mediterranea sexual|type=transcript|length=2580bp
AGTCGCGATAGCACGCAACGTCGACATTGCGATGACGTAATCATTGTGAATCTCTACTACAATCGGATCATTCTAATCAC
GTGCATCCTAAAACAATATAAATCTTACAAACGGGAATCCAATTGAACATTTATTTACTCAAGCGTGAAACCAATGATAC
CGTGTAGACTTAATAGTATAATATTGTTTATATTTGTTTATGGAGTTCTATCGGTTTCATGTGAAGGCGAATCAAATAGA
GACCTCCCGTCAGAGAGGCAAGTCCATAAATGTAAACTTACCAACAAGCAATACACATTTGACATTCTTCCGGGGTCTGG
GTGGGATAATCTTGAAAACAAAGAACTCGGTCAAGTTTTAGAAATTTCATACAAGGAATGTTTGGCTTCGAATGATGGCA
GCTTTCTCATTCCAAAAGACGTAATAATAAATCCAATAAAGAAATCTACTGTCGACTTAACATCAGAGATATTTGATCAT
TTCTCAAATGTCACCTCGACAACAGCAATGTCTATAAATGCTGATGCAAGCTTCGCTTCTATAGGCTTTAAAATCAGTGG
ATCATTTTCTTTCGAAAAGAAAAGAATAAAGAACGACCAAATAAAAGAAAAGTCGTCGGTTTCACGAGCTCAATTGAGAC
ATGAATTATACACCGTTTCATTTCAACCTGACTCACAACTCGATCCGGAATTCAGGAACAGAATTCTAGATATTGGAGCG
TTATTGAAAGAAGGAAAAGACACAATTTATCCACAATATTTAGCGGATTTAATTGTCCGTGACTTCGGCACTCACGTCAT
TCGGTCGGTGGATGCGGGAGCGACACTAATAAAGACTGATGTTTTAAAATCGAATTATGTCAAAGGTTTTAAAGGGGATA
CAACTAAGATTGCAGCTGCGGCATCATTCAGTATGACAACAATGCTTTCAGTCAACCTCAAAGGAACCTATGTTGGTGAT
ACCACGAGTCTCAATGAATTCAATAGTAATAGTGCAAGTACAAAAGTCGAAACTTTTGGTGGTATACCGTTTGGTTCGAA
TTTTAAGTTGGAAGATTGGGAGAAAACCCTTGAAACGAATTTGGTAGCAATTGATCGCAAAGGTGAACCGTTGTCCTATG
CTATTACATCAAGAACTCTTCCAGAATTTGACGAGAAAATTATTTACAAAATCGCTACTCTCATCAAAGAAGCAGTCAAT
AGATATTATGCAGCCAACACGAGAGTGGGATGTATGAATATGGAGTCAGAAAATTTCAATGACGACGCAAATGTTGACGG
TGGAAACTGCGAACCTCCTAATACATTTTACAGTTTTGGAGGAACTTTTCAAACCTGCTCAGGCCCTGATTATCAGTGTA
TGGATGTCGCGGCAAAAAACCCAGTGACCAATAGTTATGCTTGTCCTGATAACTATGATACCATTGAATTACAAAGTGGA
TTGAATAAATGTGAGAACGAATGCTCTCATTATGCACTCTATTGGTGTGCCCCTGTTATTCAAAAGATATTTACAGAAGG
CGCCTTATTTGGAGGGTTTTACACGAAAACTTCTCCGAATCCAATTACAAAATCCTATAATTGTCCAGAGAATTATTATG
CATATCAATTTGGAATGACTACAAAGATTTGTTTAGCATTCAATAATGAAAATGCTTTGGAGAATCATTTACCATTTGGA
GGAATTTATAGTTGCAAAGCTGGCAATCCACTTGCAAGTAATCATGAATATGGCATGTTACAAGAATTCGAATATTGGCC
TCAAGGTTGCTCAACCGGATATTCATCACATGTAGCTATTGTCGACAGAGCTTGTCAAATTTCCTATTGCGTTAAAAATA
ACGCCATTAGCATGAGAGAGCAACCGCCTCTCTACCGACCACCTTTTATTGATTTGGGATTTGGACCCAATATGACAGTA
ATTACCTCTCTGGACACTCCAATGGGGGTCCGATTATCTGTTGATGAAAACGGGAAATGGAGTCATAATCACCAATACAA
ATTATCCAATTACAATATTATAATAATATCAGTCATTATGGCGGCAGGAGCCAGCATTGCAATTATTATTATAATTCTTG
GAGTTCAAAGATTCAGCAGAAACCGAAAAGGTCAAGTCTCACCGGAATCTCATGAATTTGATAGCAGATATGATTCTACT
AAAGATGTTGCCAATCTTGCGTTACCCGGCGAGGTTCCACCGTTTCGTGTTATAATTGACGGAGCGAAATGATGCTTGGA
ACCTTTTATTATTTCTGTTGAATCTGATCTGTAAATGTTTTCAGAATATTTTTCTAATAAAATCGTTCTGAAATTTTAAA
GTGATCCTTGATGCTATTAAATGATGGACTTTATTGTTCCCTGAATTGGGTCACCCTTATTCGCATAAATTTCATTATCA
TTTCTTTTTTAGACTATCGATCAATATATTGTCCTATATTAGACATGAATGTTCAGCACTGTCCGTTTAGTTTGTTTAAA
TATAAAACCCAATATCGGCCTTTAGTTCGAAAAAATGTAATAAATAATGAAGAATATAAAAAAAGATTAAATTTATATCA
ACGATTAAATTATTATGTCA
>SMED30007290 ID=SMED30007290|Name=GATA456|organism=Schmidtea mediterranea sexual|type=transcript|length=2033bp
AGGTAAGTGTCGTCATCACAAGTGGCTTTATTATTATCATTTAAATTTTTTATCATATTATCATTGATTGCTTGTTTTCC
TCATTCAAAATTTAACTGATTGTTATCAAGCTCATTTGATAACTCCAAATCTAATTGACACTCATGTAAATATCCCATTC
GAATTTCCGTTCCCGTCCGTAAGATCCACGATCCGACAATGTTTCTCCCATCGGTATTGTCGAATTCTCACCAGAGAAAC
TCACCAATAATGGACATTGTATCACCAAAATCCAACACCAGCAATCTGAATGCGTTGATCACGTATTCGAATTGTCCCAA
CATAGATCTACAGTCGAATGATCTGTCAGTGAACTTGACGAATTCTCAAAACTTCCACGAATTGGATCACAAAACCAATT
ACGGATACAAAGTTTCAAACAACGAGACAAAACTGAATGCTTTTCCATATTTAGCTCAATCGAACTTAACAGATTGCACA
ACAGACATCAGTGGAGATCTGAAAAATCCAAATTCACATCTCAACTATGGAAACGGAATTTCGTTCTCGGAATTTTCGAA
AATGTCCGAAACCAACATCCACGGATATCCGCCATATTGTTTCTCCACTAAACTGTTTCCCATTCCAAATCTACAAGAGA
AATCAATTATCAACGACAACTATTCCGTGAAATCCACCGCCGGAGGCTTTATCACCGAATCGAATGAGCATCAAAACTCT
GTAAATACTGGAAATTCCTACAATTCCAATTTAAGCTCATACAGAACGGTAATTCCCGCTCATTTTCATCTCTTCAATCA
GAATTCACCAGAATCGAACTCGTTTTACAATACGGCTTGGAACAACTATCCGTTTCAAATATCCCCAACTTATCCCATAC
AAAATCTACCGGATTCAACAATCAACTGGACAACAAACAATCAAATTCCAAGCAGCAATTTAGTTTTTGATCCCTGGAGC
TGTAAATCAAATCTTAATCTTCCTCCGATTAATGAATTCGGTTCCAATTGCGATGTCAGCAGAGAGTGTGTGAACTGTGG
AGCTAGCAATACTCAGTTGTGGTCCCGGGATAATTCTGGCTATTATTTGTGTGATGAATGCGACAGGTTCTCTCAAAACA
ACAGTAGAAACCTCGAAAAACTACCAACGAATCAAGTCTCATCAAGTACCGAAAATGAGTTCATGAAAAAATCCAATGCC
AACTTTCAACAATATGGAAAAAGATCCGACCTCGAATGCAGCAATTGTAAAATTACCAAGACTTCTTTATGGAGAAGAAA
CAACGAAGGAGAACCTGTCTGCAATGCTTGCGGCTTGTATTATAAATTACATAAGTCTCTAAGACCTCTTTCAATGAGGA
AAGAAGGAATACAAACAAGGAAAAGAAAACGGAAAACACAAATGAAACCGGTTTCCACTCATATTGCCAATAATCAAAAG
GTGCCGTCTTCAGAATCGTCATCAGAACAAAATCAGTTTATAAACACTGTGAAATCAAGTGAAAATTGCTATAACATGAT
TTCTGAAAATTCTCCAACATATATGCCAAATATATCAGTCCAGCCCTTCAATCACATTCTGAACTCCAGCCAATATCAAT
TCCAATCTACAGAAAATCCCATTAATCAATCATATTTAAATTCCTCAATCAAAAACAGCAATCCCTTTTACGATTCCGAA
AGTATACTTTATTCCTACAACAATTCAAACAAAATCAAAGATGAGCCCCTATTATCCATGGACAACGAACCGAAGCCCTA
TTCCTCAATCAACGAGAAAATTGACGTCAACTCCATAGTGAGAATTAATGAAATCTCAAACAATTCGAATTCGAGTTAAT
TATTCTGATCTACTTTTTAATTATATATTTAAGAACCGTATATACTTCGAAATATAATTTTAATGATAAAATTTTATATC
TAAAAAATGTAATTTTTAAGTGCGAATTATTAAGTATGCATTTAAATAGTGCAATTATTGTGGTAGTTATTTTTATTACT
AAATAAATGTTGTTTGTAAATTCGAGAATTTGT
>SMED30028442 ID=SMED30028442|Name=Lysosomal alpha-glucosidase|organism=Schmidtea mediterranea sexual|type=transcript|length=2946bp
ATTGTTATGCAAAATTATTTTAGCAAAAATTCCGATAGGTTTTATCTAATTAGTAATTAAGTAGATACTTCATGCTCTTG
AACTTGATTTTATTTTAAAATGGAGGTGTGTCGCTGATCTGGAAAAGTTTAATTTCAAATTATCTTTAATTAGATCATCA
CACCTATTTTAGTTGTTGTAGAGAGTCAAAGTTCAGCTTTTAATTAATATATATTCAATTAAAAATTTGCAAAAAATTAT
TTCCATTTCAAATGAAATTAATAATATTAATAAGTTTTATTAATTTGATTTCGTTATTCAACTTTTCCAACGCGACAGCA
CAATGTCAAATAGCCAATAACAATGAGAGACTTGATTGCTACCCAGAATCCGGAGCCAATCAAGATTCATGTATAGCAAG
GGGGTGTTGCTGGTCCGAACCAATGAGATTGTCCAATAAATTGCAAGGTGTTCCACTATCAATCCCATATTGCTATTATC
CAACTGATTATTCCAACTATATGATTAAATCCTTAAGAAAATCTTCAAGAGGGATCAAAGCAAAATTAGTCAGGGAATCA
CCAAGTTATTTACCCTATGAAGTTGCAATGTTAGATCTTGAGGTAATTTATGAAACAAAATCTAGAACTCGAGTCAGAAT
AACAGATCCTAAACAAAAAAGATATGAAGTTCCAATGAAACTCAGTCCTCCAGATTTGAAGCCACCGACTGATCGAGAAT
ATGAAGTCATAATCCCATCTGATGGTTCATTTTCTATTGAAATTAAACGAAAATCAGATGATCGTTCACTTTTCAAATCA
TTTGGGCCACTTTTATATTCTGATCAATTTTTACAAATATCTTCAATAATGTCAACTGATCAAATCTATGGAATAGGAGA
ACAAAATAGACCCTTTCTTCATCAATTATCCAATGGCTGGGAAAGAATTGGATTGTGGGCAAGAGACAATCCGATTGAAA
CATTTATGAATCTTTATGGAGCTCATCCATTTTATATCGGTATGCCAGACGATGGAAAAGCTTTCGGTGTTTTTCACTTT
AATAGTAATGGTCAAGAATTCGCTTTACAACCGGCACCAGCAGTAACTTATAGAACAATCGGTGGAATTTTAGATTTCTT
TATTTTTACCGGAGGCAGCCCTGAAGAAACAGTAAAACAATACCTAGAATTGGTAGGAAAGCCAATGCTTCCTCCATATT
GGTCTCTTGGATTCCATCTGTCAAAATGGGGTTACAAAAATATTGAGCAATTGTCTGAAATATTTCAAAGAAATATTAAT
GCCGGTTTCCCAATCGGTACTCAGTGGAGTGATATAGATTATATGGAAAATTATAAAGATTTTACTGTCGACAAAGAGAA
ATTTAATGGATTGGGAAGATTTGTCAGAGAGATTAAACAAAAATATAACTCTAGATTTGTTGCAATTGTTGATCCAGGAA
TAAGCTGCACAAGTGGTAACGAATATCCACCTTATTATGAAGGAGTATTTATGGATATTTTCATCAAAGATTCACAGACC
AATCAACCAATTGTTGGCAAGGTTTGGCCCGGAGAAACAGTTTATCCAGACTTCACTCATCCGAACATTTCTATGTATTG
GTATAAACAAATTCAACGCTTTTATAATGATGTTCCAATTGATGGGCTTTGGATTGATATGAATGAGCCATCTAATTTCT
ACGATGGTTCCAAAAGAGGCTGTCAAGGAAATAGTAAATATGACAATCCATTTTTTGTACCGGATATTCGAGATCAGTCA
TTAATATCTAAAACTATTTGTTCTTCAGCACTCCATTACAATAACGAAAAGCATTATAATTTGCACAATCTCTACGGCTA
TACGGAATCAGTAACAACAAATAAAGCATTATTAAAAACGATACACGGAAAAAGACCTTTTATTTTATCCCGGTCAACTT
TCAGTGGATCTGGTAAATATACCTTCCATTGGACCGGGGATAATCAAGCAAGTTGGGATCAGTTAAGAAATTCCATTAGA
CAAGTGCTTAATTTCAACATGTTTGGTATTCCGATGACTGGTGCTGACATTTGTGGATTTAACGGTAACAGTGATGAAGA
ACTCTGTATTAGATGGATGCAATTGGGCGCTTTTTATCCATTCATGAGGAACCACAATGCAATCAACCAGAGAGATCAAG
ATCCAGCTTCATGGAATACGGAAGCCCAGAAAATAATGAAAACAGCTATTTCTAATCGTTATGCAATGTTGCCTTTATTT
TATACATTATTAGTCAAATCCCATATGAATGGTGGCACCGTAATGAGACCAATGAGCTTTGAATTCTTTTCAGATAAAGT
AACGCATTCTATAGAATTACAGTTTATGATTGGATCCTCGATTATGGCAACTCCAGTTGTTTATCCTGGGGCCAGATCTG
TAGATGCATATTTTCCAGCTGGAGTCTGGTACGATTTTCACAGTGGAAAATTGTTACATTCAGATGCTGAAGGAGCTTGG
TTGACTTTGGATGCTCCTTTGGACAAAATTAATATTGCATTACGCGGCGGTCATATAGTTCCTCTATTGGATTCCAATAG
AAATTCTAAATCAAACATACCAAATAAAATGACATTGTATTGCGGAATGGCACAAGATATGAGTGCTTCTGGAGATTTAT
ATTGGGACGATGGCGAGAGCATTGACTCCTACTCACGCAATAGATATAGCTATGTATCATTCAATGCTAGCCCTGAGCAA
CTGTTAATAACACCGGTTTACTTTGGCTACGACTTGTTGCCGGTCTTAAACAAAATCGTAATCCTTGGGTTTGAGAATAA
GTCAATTACTAAATTTCTATTAAATGACAATGATATTCCTTTCCATTATAATCCGGAGACTTCATCTGTGGTGCTCAGCA
GTTTAAATGCCAATTTAAATTCCGAAATAAAAATTCAATGGATGTGAATAATTTTTTGTATTTTAT
>SMED30024552 ID=SMED30024552|Name=Myosin heavy chain|organism=Schmidtea mediterranea sexual|type=transcript|length=2149bp
TCACTGGAGTTAATAAACGACAAATTAAGGAAAAATGAACATGAACGATCCAGAAATGCAATACTTGGCCATTGACCGCA
AAGAATTGCTGAAAAGTTTAGATGTTGGGACTTTTGACAGTAAGAAAAATTGCTGGGTCCCCGATGAGAAGGAAATGTTT
GTGGCGGCGGAAATTAAATCCTCCTTAGGAGGTATTTTAAAAGTTCAAACGAAAAATGGAGAAAATCGTGAAGTTAAAGA
AGACGATATTCAACAAATGAATCCACCGAAATTCGAAATGATTGATGATATGGCTAATCTCACTTTTCTAAACGATGCTA
GTGTGTTACATAACCTAAAATCCCGTTATTACCGTGATTTGATATATACTTATTCTGGTCTGTTTTGTGTGGCTATAAAC
CCATATAAAAGAATTCCCATTTACACCCCAAGTATCATGCAGAAATTCAAGGGTAAACGAAAGACTGAAATGCCCCCCCA
TGTGTTCTCGGTATCCGACAACGCATATAATAACATGTTGAGAGATCGGGAAAATCAGTCCATTCTTATTACCGGTGAGA
GTGGTGCTGGTAAAACAGAAAACACTAAAAAAGTCATTTCCTATTTTGCTCAGGTGGCAGCCAATTCAAAAGATGAAGAT
AAAAGCAAAGGATCCCTTGAAGATCAAATTGTACAAGCTAATCCGGTTTTAGAAGCATATGGTAATGCAAAAACAAATAG
AAATAACAATTCCTCAAGATTTGGTAAATTCGTTAGAATTCATTTTGGATAACGGCAAAATTGCCGGAGCTGACATTGAA
TACTATCTTTTGGAAAAATCAAGAGTTGTCTCACAACAAAAAGGAGAAAGAAATTATCATATTTTCTACCAAATATTGTC
TAACAGTGCCAAAAACCTCCATGAAAAATTATTGATAGAACCAAATGCCAGCATTTATTCATTTATTAATCAAGGTGAAC
TAACAATTGACGGGGTGAATGATTCAGATGAATTCGCTTTGACTGATGAAGCGTTCGATGTTTTGGGTTTCACCACTGAA
GAAAAAATGGGACTTTTTAGATGCACAACTGCTATCATGAATATGGGTGAAATGAAATTTAAACAGCGTCCTCGTGAGGA
GCAAGCAGAAGCTGATGGTACTTCAGAAGCTGAAAAAGTTGCATTCTTACTCGGAGTAAATGCTAAAGATTTACTACAAG
CATTTTTGAAGCCAAAAGTAAAAGTTGGTACTGAATATGTTACTAAAGGACAAACTAAAGACCAGGTCTTGTTTGCTCAA
GGAGCGTTAGCTAAATCCATATATAGTCGTATGTTTTCTTGGTTGGTGACCAGAGTTAATAAAACTCTTGATACGAAAGT
GAAAAGGCAATGCTTTATTGGTGTGTTGGATATTGCCGGTTTTGAAATCTTTGAATATAACGGATTTGAACAACTGTGCA
TTAACTACACAAATGAAAGACTCCAACAATTTTTCAATCATCATATGTTCGTATTGGAACAAGAAGAGTATAAGAAAGAA
GCGATTGACTGGGAGTTTATAGACTTCGGATTAGATTTACAAGCTTGCATTGAACTTATTGAAAGACCAATGGGTATTCT
GTCAATTCTTGAGGAAGAGTGTATGTTTCCTAAAGCAACCGATGAGACTTTTGTTGCAAAATTGTATGAAAATCATCTGG
GTAAAAGTCCTAACTTTGGAAAACCAAAACCAAATGGTCAAGCAACTGCCCATTTTGAGTTACATCATTACGCTGGCTCT
GTTGGATATTCAATTACTGGATGGTTGATAAAAAATAAAGATCCAGTCAATGACAGTGTTCTTCAAACTTTAGGAGCTAG
TAAAGAAGCTCTTGTTGCTCAACTTTTTGCTCCTGCGGATGATGATGCTACTGGAAAGAAAAGGAAAGGAGGCAGCTTCT
TAACAGTATCGTTTGTTCACAGAGAATCTTTGAATAAACTTATGAAGAATTTACAAAGCACTAGTCCACATTTCATTAGA
TGTATTATTCCCAATGAATTAAAACAATCTGGATTCATTGACTCCCACTTAGTCCTACATCAACTTCATTGTAATGGTGT
GTTAGAAGGTATAAGAATATGTAGAAAAGGATTTCCAAATAGACTTATTTATTCTGAATTTAAACAAAG
>SMED30019745 ID=SMED30019745|Name=Macrophage-expressed gene 1 protein|organism=Schmidtea mediterranea sexual|type=transcript|length=2146bp
CAAAGTTTAAAAATTTATTGTAAATGTATATTCAAATATTACTAATAATTAGTCTTTTCAAAATATTAGTGAAAGGATCA
AATGAAGTCAATACTATCAAGGATGCGTATCAATTGTGTCAGTTGATGCCCAATCAAAGAACGTTCGATGTTTTACCTGG
ATCAGGATGGGATAACCTGGCCAATATCGACATGGGAAGGATACTTGATTTAAACTTTTCAAAGTGTTCATTTTCGAATG
ACAACAAATATCTGATCCCGAATCAACTGGCCATTTATCCAGAAAAATCTTCCCAAGTTGAAATCTCAAGTGAAATATTC
CGTCATTTCTCAAATTACACATCAATGTCTTCGCAATCTATCAATGTTGGTGCTGAAGGTGGCTACGGAATATTTAAAAT
TGGGGGATCTTTTTCCACGGAAAATACAAAGATCAAAAGTGATCAGATGGAAACGAAATCCATTTTCACCAGAGTTCAGT
TGCGATATTTGGGGTTCCAGTCAATGTTTGAGCCGGATACGCCTCTCTATCCGACATTCAAGAACAGAATCATGGACATT
GCTGGATTAGTTGTTGAAAATAAAGACTCACTTTATCCTGAGTATTTGGCTGACATGATTGTTCGAGACTACGGGACCCA
TGTAATCCGTGCTATAGATGCTGGGGCGATTTTGTCAAAAACCGATGCTCTACAATCTAAATATGCAAAATCTTACCAAT
CTGACAGCACTACAATTTCGGTTTCTGCGACTGCGTCCTTTCTAAATCTATTCAGTATGAGTTCTAAGTTTCAATCAACA
ACTAGCCAAGAGAAAGTCAATGAATATAATGAAAATATATCGAAAACTCACATTGATACGATTGGAGGGGGATTATTTGG
AGCTAATACGACTTTAGCAGATTGGGAAGAAACAGTCATGAATAATTTAGTTCCAATAGATCGTAGGGGTGAACCCTTAT
ACTATGTCATTACTCCCCGAGCGTTACCGGAACTTGATGACGAAACCGTAAATCAAGTTTATCAACTAGTGAAGAAGGCA
ATTGAACGATATTATTTTAGAAATGGCCGCAAAGGTTGTCTCGATATCATGTCTCCTAATTTCAATCCAGATGCCAATAT
AGATTCGGGTAATTGTGAACATCCTTCAGTAAATTTTACATTTGGAGGAGTTTATCAATCATGTGAGGGACCCTCTTGTA
GTTCTAGTGTTCAGGAAAATCCTTTAACTGGAACCTACTCGTGTCCTTCTGGATTTAGTTCGTTAGAACTTCATCGTGGG
CTGGTAAAGTGTATACAAATATGTCATGGGTGGTGGATCTTTCGTAACTGTGAAACAAAATGCTCATATTATACACTTTA
TTGGTGTCATCCAAATGAAAGTGGATCAAATTATAATGGGTATCAATTTGGAGGCATTCGGCAAGGAAGTTGTCCCATTG
GATTTATTCCACTTAAGTTTGGATTAAATATAGAAATTTGTGTGACCATTGATACAGATCCAAACAACCCATTTGTAATC
CAATTTGGTGGTTTATTTAGCTGTAGTGCCGGTAATCCTTTAGCCAAAGAATATGTAAATGGAAAAGCAAAATCATTTCA
AAATTTAAAGATGAATGACATAAAATATTGGCCTAAAACATGTGCTAAAGGATTTGTGGCTCACATTGCAACCATTGAAC
AAGGATGTCAGATTTCCTACTGTACCGAAACCAATAAAGTTTCTTATGGTGCTTTTCCTCGCTTAATCAAGCCACCATTT
ATTTCAATAAATTACAATCCAAACAGTACAAAAGTGTTAGTTTTTTCCAATTTAAAAGGAGAAACTTTGATCAAAGATAA
CTTTGGAACATGGAAAGTGGATGAATTGAAAAAGCAAAATAGAGATTTGCTAATAGGAACAATAGTTGGCAGTTTGTTAT
TAGCAGCTTGTATTTGTTTCGTTATCTTTTACATTCAAAGAAGATATTACATTAATAGATACAAGCTGATTAATAGAAAG
AAGTTCACTGATGAAGAAAGCATGACAAATTATGGCTCAATCAACGGAACGGAAATAGCGTAGCCAATCAGATAATTACA
AAAGCCTATGTGAACAATCCTTTTATATTTATCTTTATATTTTATCTCACTTTTCGATCCAGATCG
>SMED30000837 ID=SMED30000837|Name=Histone H4|organism=Schmidtea mediterranea sexual|type=transcript|length=1387bp
ATTAACACTAAATTTTGTTTATATAATGATTAAATATTTCAATAATCAATTAATTGAAAAATGTCTGGTCGTGGTAAAGG
AGGAAAAGGGTTAGGAAAAGGTGGAGCCAAGCGTCATCGTAAGGTTTTACGTGATAACATTCAAGGAATAACTAAGCCGG
CAATTAGAAGATTAGCTCGTAGAGGCGGAGTAAAAAGAATATCTGGTTTAATTTACGAAGAAACTCGTGGTGTTCTCAAA
GTTTTCCTGGAAAATGTTATAAGAGACGCTGTTACTTATACTGAACATGCTAAGCGTAAGACAGTAACTGCAATGGATGT
TGTTTACGCTCTTAAACGCCAAGGAAGAACTTTATACGGATTCGGAGGTTAAATGTGAAACCAATGATATTTTAAGCTAA
CATTTATTTGTTGAGAATGTTTATGGTCCTCCTTAGGGCCACAATTTTTGATTGTTTACTTTATTTTGTTAGCATTACGT
AATTTTACAGTGATTGGTTATCTTGCTGGTTGTCTGAAATATTAAATAATAATATGCTATAATTAAATGATATTAGTATA
GAAAACAAAAATCGGTTTTATTGTTTGATCAACACAATGAATATGTTTATCAATTATCATCATTTCCAGTTTTTCGATTT
CAGTTGATAATAATTATTTGCGAATTTGTGATTATATTTTCTAATGGGTTGCGAGACATAAATGAGCGTGCAGATATCAC
ATGCGAACCTGGTTCATGTAGTGTTTTGAGCTACACACTGCAGATAGACGATCAAATCTATAAAGTGAAAAAAGGGTTCA
AATCAGCTTGCAGCACCAGACTATGTGAAAATTGTGCTCACAAAGGTGATTGGTCAATGAGACTGATTGACGGAAACAAA
TATATGGTACGACAAGTCAATAAATGTTTAACTAATAATATTTTGGCAGTTGAGCAACTTTTCACAAATTTATATACTCC
TGTCTCAGATTTTACATGCTCCTTGCATAAGTGCTCTAAATATAATTATTCTTATAATGGAAATATGATTAGCTTTAGCT
ATATAGGAGTTTGTGACCATTCTTACTGTGACTCATGCCGCTATTCCGACAATTGGAGTCTATTAACCGGATATTTGCAG
CGGACGACCATTTCATGTTATGTTGTCGATAAAATTAGACTTGAAGATTATTTTCTCATTCCAGAGTTTACCGAAACCTT
CTATACACTAATTCGGAAATTAGCAATAACTATAAGCTGCGCTTCATTTTTGTGTTTGGTGATCATTCTTTTGGTTTGTT
TTGCTAAAAAATGAGATCTTACAGAAGCTTTAAGGAACTTAATTTTATTTAACAATATATTTATACTTAGATCTAATGCT
TTGAATGATCCTTTCGCAAGTCCATCC
>SMED30033466 ID=SMED30033466|Name=Histone H4|organism=Schmidtea mediterranea sexual|type=transcript|length=421bp
GATCTCACTATATAAATAAGTATTTGTCCCTATTAATTCATAACAATTATTCAACATGTCTGGTCGAGGTAAAGGAGGAA
AAGGACTAGGAAAAGGTGGAGCAAAGCGTCACAGAAAAGTCCTTCGTGATAACATTCAAGGTATCACAAAGCCAGCAATC
AGAAGATTAGCTCGTCGAGGTGGTGTTAAGAGAATTTCTGGATTGATATATGAAGAAACCCGAGGTGTTCTTAAAGTATT
CTTGGAAAATGTTATTAGAGACGCTGTGACATACACTGAGCACGCTAAGCGCAAGACAGTAACTGCCATGGATGTCGTCT
ATGCTTTGAAACGACAAGGAAGAACTTTGTACGGTTTTGGAGGTTAAATAACACTTTCATATTTGTGAATGTTTTAGCGG
CCCTCTTTAGGGCCACAAATG
>SMED30011876 ID=SMED30011876|Name=Macrophage-expressed gene 1 protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1880bp
AACGGAAATACAAATAAATTCTCGATTTGTCAACTCTCTAAAGTTCAAGAGTGCTACAAAGAAAAAAATAGATCACAAAT
GTCCTCTGAGCAATAATCAAACTCAATTCAACACTTTTCCCGGGTTGGGGTGGGACAATTTGGTAAATCAAGAAATGAAG
CCCGTTCTGAAGATCTCATTTTCCAAGTGCGAAGAGTCCAGTGATGGAGTTTATCTCATTCCAGACATGACGACCATTTT
TCCATTAAAAAAATCAAAATTTCATATGAATTCTGATTTATTCTCCAGCTCTTCTGAATATGTTTCTCTCACTTCTCAGT
CCATTAATGAAGATATTAATTTCTCTGATTTCCCTACTTTAATAAATGGCGCATTTTCAAACGAAAAGACCTCTTTGAAA
AGGAAAAAAATAAAGAAAAATTCTATTTTATCTCAAGTTCAATTGAGATACGAAGTTTATAATATTTTGTCTCAACCGGA
CAGTGATCTCTCGAGGGAATTCAAAGACCGAATTGTTGAATTAACGAAATACTTGGACGACGAAAAGAATTTGTTATATT
TGGATTACTTGTCGGATTTGATCATAAGAGATTTCGGAACGCATGTCATCAAGTCCGTGACAGCCGGGGCAATTCTTGCC
AAAATTGACGTTCTCAAACCGGAATATGCGTCAAAATATAATAAAAATCAAGGGGAAATTAAATTAGCAGCCGCCTCAAG
CATGGCTGAAAACGTCGGTACGAATCATGAAAAAGATGAAAGATCAAAAAAATTATTAAAAGAATATAAAGACAATTGTA
TCAGTTCGACAATGAAAGCAATCGGTGGAATGCCAATTGAGTCAAATTTCAATTTGCAAAAATGGACAAATACCATAAAG
TCGAACTTAGCACCCATCGACCGACAAGGTGACCCACTCAATTATGTGGTGACAAAGAAAAGTTTACCGGAATTGAAAGA
TAAAGCAATTTTCGATATAAATAAATTAATTAGTAAAGCAATAAACCGTTACTACAGAGCAAATATGGGATCAGATTGTA
CGAATATTGGTTCTATGAGTAATGAAAATAATGGAAATATTAATAATAAAATGTGCGAGCAGTCAACAGAAATTAAAAGA
TTTGGTGGAATATACCAAACATGCGATGGTGAATCGTGTAGTGAATACAAACAGGATAATCCTGCGACTGGAAATTTAAG
CTGTCCAAAAGGCTACAATTCGTCTATCCTTTATAAAACCATGAACATTAGTAAATGTAAAGAAAATTGTCGAAGCTTAA
CTTTGTACATGTGTTATGCAAACAGCAATGGATTCAATGATCTTGGTTTTTCTTTTGGTAGAATAATACCCAGATTCAAG
CCGAAGTCCGATTGCCCTAAATATCACATCTCGCTACGCTTTGGTGCGCAAAACATTTTATGTGTCACTTCAGGTAGAGA
GCAAGTAGAAGAAAACAGCTTACAATTCGGTGGTTTTTACAGCTGTTTGATAGGAAATCCGTTTACTATAAAAAAACAAT
CAAACGACAGTGCGAATGGCATTTATGAAAAATCATGCCCCCCAGGATTTACAAGTCAACTTAGTCAAGTCGATTCGGAT
TGCCCGGTTTATTATTGTACGAGAATATACAAAACCATCAGCAGAGTCGTTTTATTAAGACCGCCATTTATCAAAATTGA
TTGGAATTTAACTGCTACTAGCGCTGAAACATTCGACAAAATTGACGGTAAAACTGAGATGAAAAAGATCTGGAATAATA
AAGCGTTTCGGTATTGTGTAATTGCATTAGCAATTTTCTTATTTGTTTTCTTACTTCTATTTTTAATATTGTTCCATCTG
AAATTTTGCAAAAAATAAATGTTAACTAATTGGTGAGGCC
>SMED30000153 ID=SMED30000153|Name=Netrin 1|organism=Schmidtea mediterranea sexual|type=transcript|length=1945bp
TTACTTCATGAAAATGCAAGAAACTATTAAAAAATAAAATTACTTATTTTAATCTTGAATGAATTCAACGAATATTTTGT
TGATTTTATTGAATATCATTTGGAAATTGACTATAATTAAAGGTTTTTCCTCGTGTTTTTCCGAGTCCGGCAGAGCAAAA
TTCTGTGAACCTGACTTTATCAATGTTGCACAAAATGCTACATTTGAAGTTACAAGTACATGCGGTCAGAAAGGATCAAC
AGACAGAATTTGCCGAAACTGGTACACATCTTCAGGCTTAAACGAAGGCAAATGTTTGAAGTGCGATGATAGAATTCCGG
AATTATCGAGAAATATATCTCTCGTATTCGATCGAAACATTCAAGGCCATGAAACGGTATGGGTTTCTGGACGTATTCCA
AAATTTAGTGGAATTCACTCCATTAATATCACGATTAATTTAAATAAGCTATATGAAGTATATTATATAATTGTCGAATT
TGCCGGTCAGCTTCCAGATTCTATGGTTTTATATAAAAGGGATAAAAATGGAAAAACTTGGTTACCTTGGAATTATTTTT
CGTCTTCTTGTAAGAAATCATTTAAAATGAAGAGAAGTAAACCTTTACACATTCAACAACGATCATTTAACAAGATAAGT
CCTGCTTGCTTTTCTTTCAAACACAGTGTCCAAAATATCACATCTAATATTAAAGTTCTTCCATTTAATCCGATGACAGG
CCGAACTTCTTTATTACCGAATTCCAGATTAATTAAAGAATGGGTCAGTGTTACTGATATTATGATATCATTACTAACTG
ATGGCTCTAAAAAACGAAATAAGTCACCATATGATCACTTGTCAATATCTGATATTACGATTGGTGCTAGAAGTCAGTGT
TATGGTCATGCTAAGAGTTTAATTAAAAAAAATGGCACCACAGTTTGTGACTGTCTACACAAGACAGCAGGACCGGATTG
TTCACAATGTCTTAAAACTCATAATGATCAACCCTGGAAAATAATTTTTCCCTCGGAACCAGCTGGGAATATTTGTGAAA
GATGTTTTTGTAATAACCATGCGGAAGAATGCAAATTCGATGAGAAAATTTATAAGAATTCTAGCGGGAAGCATGGAAGT
CGCTGTCTTCACTGTTTGCATCATACTACAGGTCCTCATTGCAACTCATGTTCCCCTGGTTACTATAGGAACCGTGCATT
CCCTATAAATCATCCTCAAGTCTGCCAAAAATGCGGTTGCCATCCTTACGGGTCTTTGCCCCAATCTTATTGTAATCCTG
ATAATGGGATCTGTCAATGCAAAATTGGTGTCGAGGGTAAATTATGTAACAGGTGTAAAAAAGGCTACCAACAAACAAAA
TCTTCAAGCACACCATGTGCTCCAGAGACGAAAAATAATCTCATGGCTACAGAAGAACGTTGCGGAAGTTGTGGGAAAAA
CCGTCCGAGAATTAGGTTTCGAAAATTCTGCAAAAAACACATAATGATTAAAATATCCATTCAATCAAAGGAGATCCACG
GTGAATGGACTCGATTCGGAGTTCGGGTGTTAAAGATCTGGAGAATCCAGCAATCATTAAAATCACAAGTCAACCTCTAT
GAATCTGAGTATTCAATATACCCAATATGGGTGGAAAATGCAGACATACGCTGTAAATGCCCGAATCTTCAACTTGGTCA
CACCTACCTCCTTTTGACTAAAATCAAATTAAAAAATTATCTCAATCAGCCAGAATTAATCGTTGATAGAAAGAGCAGTG
CACTTGATTGGAGTGACGACTGGATTCGAAGGCTGGACATGTTTAAAATGAGAGAGGAACAGGGTAAATGTGACCGCTAT
CAATATAAACGGAAACACTCGAAATTGATGAACTCTAGATGAAATGTTGAGTTGACCCTTAGATGTCTAGATATTTCATT
TTTACTTTTCATTCTCCATGTAAAA
>SMED30019471 ID=SMED30019471|Name=Synaptotagmin|organism=Schmidtea mediterranea sexual|type=transcript|length=1910bp
TTTGGGACTTCTCCAATCTATTAAATATATTTAGAACGAACATCGTTGTGAGAAGCTTTGTCTTGCAAATGCACACCAAC
ACATTCTCTGCCTACTCGAGACCAGCCTGAAGGACGCACCCAGTCATCTCTTATAAAAAAAAAACTCTTCTCTGATTCGG
TATTTTCTGATTAATGGAGATCAAACAATGATTGGGCAACGTCTAGTTTAGAATATTTACAACTAAATCTGCGTATTTCA
ATTTTTTTTCGATTTTGATTGTTGCAAATATTTATGAGTATATCCAATAATATAAGCAGCGCTAGTAATATGACGATAAA
AATGCAACAAAATGTTGAAAAGTCTGTATCACAGCATGTAACAGCGCAAACAAAGGAATCAACATCAAATAAACTTCATA
CAACAACAGCCGGTATCTCGGTTTTGGAGAAAACATTAAAAACATTTCACATGAGTACTGGCACTTTGATTGGAATCGGA
GTTACAGTGTCTATCGTAGTTTTATTACTTCTTTATTGTATTTGCAAACGATGCATTAAGAAACGAAAGAAAAAGAAAGA
TGGCGGCAAAAAAGGTGGAAAAGGCGTAGACATGAAAAGCGTACAACTATTAGGAAATGCTTATAAAGAAAAGGTACAGC
CGGACCTAGAAGAACTGGATGCTAACATGGAAGATAATGAAGGGGCGCAAGATAAAGAAGCAGTCAATCTTGGAAAATTA
CAGTATTCCCTTGATTACGATTTTACAAAAGGCGAGCTAACAGTCGGAGTAATTCAAGCCACAGATCTCCCAGCAATGGA
CATGTCAGGAACTTCTGATCCATATGTGAAAGTTTTTCTATTACCGGATAAAAAGAAAAAATTCGAAACCAAAGTTCATC
GAAAAATATTAAATCCAGTCTTTAATGAGACATTTGTATTCAAGATTCCTTATTCTGAGGTCGGGTCTAAAACTTTGGTA
TTTAATGTTTTCGATTTCGACAGATTTTCAAAGCATGATCAAATTGGGCAAATCCAAATTCCACTGGGTTCAGTAGATTT
ATGCAAAGTTATTGAGGAATGGAAGGAACTCGGCCCACCTGACAGTGATAATGAAAAGGAAAATCGATTAGGAGACATTT
GTTTTTCTTTGAGATATGTTCCAACGTCTGGAAAGTTGAATATCGTCATTCTGGAAGCTAAAAACCTCAAGAAAATGGAT
GTTGGAGGATTGTCGGATCCTTACGTGAAACTATCGTTGATGCTTAACGGCAAACGAGTGAAAAAGAAGAAAACCACAAT
AAAAAAATACACATTAAATCCTTATTATAATGAGTCATTTTCATTCGAAGTTCCATTCGAGCAAATACAAAAAGTTAATT
TAATAGTGACAGTAGTTGATTATGATAGAATTGGAACAAGTGAACCTATTGGAAGAGTAGTTCTTGGATGCAATGCTACA
GGAGCAGAACTTCGGCACTGGTCCGATATGCTTGCTAATCCTAGGAGACCAATTGCCCAGTGGCATACCCTTCAAGATAT
GCCGGAGAAGAGCTGATTTCATTGATTTTAATTTTAAAATCTGTCATATTTTGTGATAAATTTTGCGTATTTATACAATC
ATTCGATTCGATCTTTCCATCAAGTTTCGTAAAATCTGCAGACATTCACGAGGATGCAGAAGAAATAGAAACTTTGTAAT
AAATTAGCATTAGCTGTGATCTCCTATTGACCAAAAAACATAAACTTAATTTTTATAAAGAATTGTGGTGAAATGTTGTT
AGGTTTCAGTCATAGATAACTGTATTTGTGTAATAGTTTGTGTATTTCTCGTCCTGGCCCGATTTTGTGCATTCCACTGG
CAATACTATTTCACTAATAAATTATGTCTGATAATGTATACCAGTATAGGATTTTGTTTGAATTAATGAA
>SMED30011264 ID=SMED30011264|Name=Macrophage-expressed gene 1 protein|organism=Schmidtea mediterranea sexual|type=transcript|length=2311bp
AGTCGCGATAGCACGCAACGTCGACATTGCGATGACGTAATCATTGTGAATCTCTACTACAATCGGATCATTCTAATCAC
GTGCATCCTAAAACAATATAAATCTTACAAACGGGAATCCAATTGAACATTTATTTACTCAAGCGTGAAACCAATGATAC
CGTGTAGACTTAATAGTATAATATTGTTTATATTTGTTTATGGAGTTCTATCGGTTTCATGTGAAATTGAACCTAACCGA
GATCAACCATCTTCAAGACGAGTTCATGAGTGTAAACTCACCAGCAACCAATATCCAGTGAATGTTCTTCCCGGATCTGG
GTGGGATAATCTTGAAAACAAAGAACTCGGTCAAGTTTTAGAAATTTCATATAAAGGATGTTTTGGATCGAATGATGGAA
GCTTTCTCATTCCAGACAATGTGGTGATCACCCCAATAAAGAAATCTATTGTCGAGTTAACTTCAGATATATTTGACCAT
TTCTCAAATGTCACCTCTACAACGGCGATGTCTATCAACGCCGATGCCAGTTACTCAACACCAAGCTACAAAATCAGTGG
ATCATTTTCATTTGAAAAAATAAGAATAAAAAACGATCAAATCAAAGAAAAGTCGTCGATTTCGAGATCCCAGTTAAGAC
ATGAATTATATGAAGTAGCGTTCCAACCACACTCAAAACTAGACGCAAAATTCAGAAACAGAATTCTAGATATTGGAGCG
TTATTGAAAGAAGGAAAAGACACAATTTATCCACAATATTTAGCGGATTTAATTGTCCGTGACTTCGGCACTCACGTCAT
TCGGTCGGTGGATGCGGGAGCGACTTTAATAAAGACTGACGTTCTGAAGTCGAAATACGTTAATAAATTCAAAGGAGATA
CAACAACCATAGCAGCCGCCGCATCGTTTAGTATGACAAAAGTTCTTGGGGTAACAATCAAAGGAAACTACTTCAGTGAC
ACTGCTAGCCTCGATGAATACAACAATAACAGCGCAAGCACTAAAGTTGAAACAGTTGGTGGAAGACCATTCGGTTCGAA
CTTCAAATTGGAAGATTGGGAAAAATCTCTGGATTCAAATTTGGTGGCCATTGATCGTCGAGGCAATCCATTATTCTACG
CAATAACACCAAGAAGTCTCCCGGAATTTGATGATAAAACCGTTAATAAAATTGTTACTCTTATCAAAAACGCTGTCAAC
AGATATTATGCAGCCAACACTAGAGTAGGTAAGTTAAACTTTAATAATAAAATACAACGTTGAGACTAGGGTGCATGAAT
ATGGAATCAGAAAATTTCAATGACGATGCAAATATTGATGGTGGAAATTGTGAAACTCCAAAATCATATTACACACTTGG
AGGAACATTTCAAACCTGCAAAGGGCCGGATTACCAATGTGAAAACGTAGCTGGCAAGAACCCCATAACGAATAGCTATG
CGTGTCCTGCAAATTACAAAACCGTTGAATTGGAAAGTGGATTGAGTAAATGCGAAAAGGTTTGCGTTAGGACTTTTTGG
TTTAGTTACAACTGTCATTACGAATGTTCCTATTACGCACTCTATTGGTGTGCTGCAACGAAAGCGACAACAAAATCAGA
AGGATCATTATTCGGTGGATTTTACTCAAATACATATCCGAACCCGATAACAAATGCCTATAATTGTCCGCAATATTATT
ATCCATCTCGATTTGGAATGGTCGGAACGATTTGTTTGGCATTCAATAGAGCAGAGACAATGGAACACCATTTGCCTTTC
GGAGGATTTTACAGCTGCAAGGTCGGAAATCCACTCTCAGACAAATTTGTAGATAATACCACACAGGATCCCAAATATTG
GTCGGAAGGTTGCGCAACTGGATACTCATCTCATGTGGCTATTGTCAACCGAGGCTGTCAAATTTCTTACTGTATCAAGA
ACAACGCGCTTAGCAAAAGGGAGCAACCTCCTCTTTTTAGACCCCCATTTGTTGATTTGGGATTCGGACCGAATGCGACC
ATCACTACTAGTTTAGAAACTCCAACTGGACTCAAACTCTCCGTCGACGAAAACGGGAAGTGGAGTGAAAACAAAAAATC
AAAATCATCCAATTATAATATTATTATATTTTCTGTAACAGCAGTAGCAATAATCACCATAATGATTATAATATTAATTC
TTGGAATTAAAATTCATAGAAAAACTCGAAGAATAACCGTTTTGCCAGAATATAATGGCAGCGATAGGAGCAATTCTACG
AGTTCTTTGAATAATCCAACAACATCGAATCGCGTTCAGCCATTCAAAATACTTATAGATGAGAATCAATA
>SMED30016824 ID=SMED30016824|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=375bp
AAATGTATTTATGATAAATCAAAAGTTGTTGCAAATTTCACTTCGTTTACTGTTATCGAGCCAGGAAACGAATCTGACTT
GGCAGCCGCCGTGGCCACCGTTGGACCTGTGTCCGTATGCATCGATGCCGATCATCCAGGTTTCCAACATTATAAAACTG
GTATTTACAATAACCCCAAATGTTCATTTTTATGCTTAAATCATGCCGTTTTAATCGTTGGTTATGGATCACTCAATGGA
GATAACTTTTGGATTGTGAAGAACAGTTGGGGACCAGATTGGGGAATAGAAGGATACATACTCATGTCAAAGGACAAGGA
CAACCAATGTGGAATTGCTAGTCTAGCCGCTTATCCAGTGGTCTAATATGCATGC
>SMED30005188 ID=SMED30005188|Name=Venom allergen 5|organism=Schmidtea mediterranea sexual|type=transcript|length=1330bp
TGACAACTTCTCGCATCAATTTATTAGTAAAATTTTCTACTTTTAAAAATAAACTAAATTCAAGTTAAAAATTTTTCAAT
CCTCTCTTGTCAGATTGTGCTTATTAAGCATCCAGATTCTAAAATTCAGAGCACTAGCTAAAGTAATCCACGCAAGATAC
GGAAGCAACAGATTTGACGCTTGGTGGCTGATAGGTCGAAACGTTAGAACACACGCAACAACATTCGCATATAGAATTGT
CAAATCCACGGATGCCCATCCAATTTGATGTTTTTTAAAGAAAATCACAGACCAAGCCCAATTTAAAACTAATTGTGTTC
CATATAACATTATTGGTAATTTTGTTTGTTCGTTAAATCCCCCACCTTCTTTCCAAAGCAAATACGATGCATATCCCATT
GCTGCATACAATGCAGTCCATACTGGTCCAAAAACGTAATTAGGAGGAGTGAAACATGGCTTTTTAATCGTTTTATACCA
TCCATCAATTTCTTTTTTCATCGTGAATTGAGAAGGAAGACTTCCATAAAACGGAAGAGAAATCGCAAAAGCCATTTTTA
GATATTCACTCATAGTTAACTAATTCGTTGAGTTAACAAAATATAATTAAGCAAAAATTATATAATTGTTAATTTCAAGG
TCAAGGTCACTAGACAGTTGAATTAGTAAAAAAAAAAAAGAAAATGAGAAATTCTATATTATTTGGATTAATAATTTGTG
TCGTTTTGTCGGTTATCGAATGTGGAGTGACTCCCGCTCAACAGAAGCAACTGATTGATGCTCACAATAAATACCGCCGA
GATGCTGCCCAAGGTAAAATTGGAGGACAACCAGCTGCTGCAAATATGTTGGAATTGAAATGGAATAATGAAGCCGCACA
GCGAGCTCAAAACAGTGCTAATAAATGCGTCTTCGGACATGATCAACCCAGAGATCGTAAATTTGGAAATTATGATTGGG
TCGGTCAAAATATTGCATTCTGGTCGAGCAATGATGTGACAGAAGGAGTAAAAATGTGGTACGATGAAGTTAATGGTTAC
AATTTCAATTCAGACCAATGTTCAGGATTCACCTGCTTGCACTACACTGCTCTTGTCTGGGCAAAAACCAAAGAATTCGG
ATGTGGCATAGCTGATTGTTCTCGACAAAACCTGGGAAAGATTTTCTTATTTTGCAATTATGGACCCGGAGGAAATTGGA
ACAGAGAGAAACCATATGAAGTTGGTAAAGCCTGTTCGAAATGCCCAAGTGGAACCAGATGCAACAATGGACTATGCAGT
TAGAAATAATCTAAGAACTTGTCACTTATCAAAATAATTTAATACAATTT
>SMED30028453 ID=SMED30028453|Name=Lysosomal alpha-glucosidase|organism=Schmidtea mediterranea sexual|type=transcript|length=2906bp
AGAATTAGGTAAAGTGCTAAATTTCAAGATGATGGATAGAGAAAATGAATGACCAAAGTACAAAATATAAAGATATTTAA
GTAATAAAATTGAATTCCGAACTTAAATTGAAATGTTGAAGTTATTGTTGATAATCTCCTTGAACTTTATAATTGTGTCC
AATGCTCTCCAATGTTCAGTACCGAATAACAATTATAGGCTAGACTGCTTTCCTGGGTCCAATGCAAATCAGAACGATTG
TTTGGCTAGAGGATGTTGTTGGTCACCACCGGAAACCCGGGAATATAGTCAGAATAATCCGACTATTCCATACTGCTTCT
TTCCAATAGAATATCCAAACTACCAAATTAATTCATTCACTCCTACCGATCGAGGATTCAAAGCTCGTCTAACAAAACAA
CAAAAATCATTTTTACGGAAGGAAATATTAAATTTGAACTTTGAAGTGATCTTTGAGACAAATACTCGATTGAGAATAAG
AATCACCGATCCGAATGTGCAAAGATTTGAAGTTCCGATTCAGCTTGGATCTCCTGATCCGACTCCACCTTCAAATATTC
AATATAAATTCACAATGCCCACAAATGGTTCTTTTGGATTCGAAGTCAAAAGAAATTCCGACGGATTGAGCTTGTTCAAA
ACATTTGGTCCTCTATTGTATTCTGATCAGTTCATACAAATATCTTCTTTGATGTCAATCCAACACGTTTATGGAATCGG
AGAACAGAATCGTCCATTTCTACATGATTTGTCTACTCAATGGGAAAGAATAGGACTGTGGGCACGCGATAATGGAATAG
ATACATATAATAATTTATATGGTACTCACCCATTCTATATGTCACTGCCTGATTCTGGAGAAGCGTTTGGAGTTTATTAT
TTCAATAGCAATGCACAAGAATTTGTTTTACAACCGGCTCCAGCGATTACTTACCGAACAATCGGAGGAATACTCGATAT
TTTCATTTTTTCAGGAGGAACACCGGAAACCACCGTTAGTCAATACACTGAATTAATAGGAAGACCAATGCTTCCTCCGT
TTTGGTCTCTTGGATTCCATCTATCAAAATACGGTTATAAAAGTATTGCAGATGTTTCTAACACTCTGTATAGAAATATT
AATATAAGCATACCAATAGAGGTCCAGTGGTCTGACATTGATTACATGGACAAATACAAAGACTTCACATCGGATCCGAT
AAGATACCCTAACTTTGGTTCTTTTGTCGCCCATTTGAATCAATCTTTAGGAATAAAGTATATTGTTATAATTGATCCTG
GAATCAGTATACAAAGTCCCGGTGTATATTCTGCTTACGATGAAGGACTTGAATTGAATATATTCATTAAAGATGCGAAT
ACTAAGAAAGATTTGATTTCAAATGTTTGGCCAGGAGAAACATGTTTTCCTGACTTTACTCATCCTAATGCTTCAAAGTA
TTGGTCACATCAAATTCAACGATTTCATTCTCAAGTACCAATAGATGGTTTGTGGATTGATATGAATGAACCATCAAATT
TCTACGATGGATCTAGAACCGGATGCGCTCTAAATAATCCGTACGACTATCCATTCTTTGTACCGACAATCAGAGATGGT
TCATTAATTAAGAAAACAATATGTTCATCCTCTCTTCATTATAACAATGTCATGCATTACAACTTGCATAATTTATATGG
TTACACCGAGGCAGTAGCCACTCATAGTGCTTTATTGAATACCATTCCAAACAAAAGACCATTTATTTTATCTCGTTCCA
CATTCAGCGGATCTGGTAAGTACACCTTTCATTGGACCGGTGATAATTCGGCAAATTGGGATCAGTTAGCCAATTCAATC
AGGCAAGTCCTCAATTTTAACATGTTTGGTATTCCAATGACGGGTGCGGATATTTGTGGATTCAATGGAGATAGTAATGA
AGAACTGTGTATAAGATGGATGCAATTAGGTGCTTTCTATCCATTCATGCGAAATCATAATAGTATTGGCGCTAAAGCCC
AAGATCCAGCTTCATGGAGTCAAGAAGCTCAAATTATTATGAAAAAAAGTATTATAATAAGATATGTTTGGTTACCTAAC
TTTTATACATTATTGGTTAAATCATATTTGTACGGTGGCACTGTGATGCGACCATTGAGTTTCCAGTTTTACAGTGATGC
TGAGACGCATGAAATTGAGAGGCAATTTATGATTGGTTCCTCGATGCTCGTCAATCCAGTTGTTGTCCAAGGAGCTAGAA
ATGTTGTAGCATATTTCCCAGCTGGGATTTGGTATGATGCAACAGATTTGAGTGTTATTTATTCGGGGAAAACTGGAAAA
TGGATTTCTTTGAATGCACCTCTTGAAAGAACTAATGTTGCATTACGTGGAGGACATGCTTTGATTTTATCAAGTTTGGT
AAACAGTACCGAGTATTCAAGAAAGGTCATTAATTTGGTTTGTATATTATCAATGAATCAAACAGCTGCGGGAGATTTGT
ATTGGGATGATGGAGAGAGTATGGACAGTTATTCTGGTAAGAAATTCAGTTATTTTAAATTTACTGCAACTTCCAGCAGT
GTTCTTATCAATCCTGAAATATTAGGATATAGTGTTCTTCCGTCTTTGAATAGTATTATAATACTCGGAATTAATACCTC
CTCAATCACTACTGTAACTATAAATGATAAACCAATACAGTTTTATAAAAAATCTAATTTGTTAGACGCCCTCCTTGGCG
GCTTGTTTCCTATTGGTCAGAAATTAATTTTAAAATGGAAATGACGAGATTCATTATTTAGTGCATAATTATGATTTTAT
ATTTTTTATTTTTTTATTTTTTTAATGAAGATTGATTGATTGATTGACTAATCATTAAATTGTGATTTATTGAAATTAAA
AATTTGTTCGATTTTTATAAAAAAAA
>SMED30026848 ID=SMED30026848|Name=Venom allergen 5|organism=Schmidtea mediterranea sexual|type=transcript|length=347bp
CCGAAGAGCTGTGGCCTATGGAAGATTTCCAGGGCAACCCAAAGCATCGAACATGCAACAAATGGTATGGAATGCAGATT
CCGCGCCAAAAGCGCAGATCTACCCGGATAAATGCATATTTGCTAATGACACAAAAGATGACCGTAAATACGGAGGTTTT
GAATCGGTTGGACAGAATGTTGCCACGTACTCTGGCAAAAATATTTTTAGAGGCGAAGAATTGTGGTATAATGAGGTTTT
CGGATTCACATTTTCAAATAATACCTGTTCATTAAAATCCTGCGGCCATTATACACAAGTTGTATGGGCCGACTCTTCAG
AGCTTGGATGTGGACTTGCGAAATGTG
>SMED30034696 ID=SMED30034696|Name=Macrophage-expressed gene 1 protein|organism=Schmidtea mediterranea sexual|type=transcript|length=2009bp
AGCGAAAATATGACTCGTTTTTCTGTTGCCAGTGCAACATTTATTTGGTTTTTATTTTTCGGTTCCACACTAGCGGATGA
AGCAGTCATTGAGCCGGATAACGTAATTCAGAACTCGAATTTTCCATCCAAACGTGTTGTAAATGATTGCCACCTGACTA
ATGATCAGTATGCATTCAATGTCTTGCCGGGGTCCGGTTGGGATAATCTTGCCAATCAAGAGTTAGGCCAGATTCTGAAA
TTATCCTATAAAAACTGCAAATCTTCCAATGATGCCAGCTTCCTAATTCCCGATGAGGTTTCAATGTCACCAGAAATGTT
GTCTAATGTTCAATTGGATTCCGACCTAGTCTCACATTTTTCAAAATACGATTCAATGACTTCCAAGTCTATTAACATTG
AAGCAAACGCCGCAACGCCAAATTATCAAGTCAGTGGATCGTTTTCTTTTGAAAAGAAAGATGTTAAGAAAAATCAAATG
AAAGAAAAATCCGAAATTTCTCATACGCAACTGAGATACGAACTTCACCACCTTGCCTTTCAGCCAGACAGTGAATTGGA
TCCTACCTTTCTCAATAGGGTCATTGACATGGGAATAGTTTTGGAAAAAGAAAGTAAAAATACTTACTCAGAGTTTTGGC
TGATTTGATCGTAAGAGACTACGGAACTCATGTAATACGGTCTGTTGTCGCTGGAGCTATTCTTTCTAAAACTGATGTTC
TCAAAGGCAATTTTATGTCCAAATCCAGGGGAAATTCTATAAATGTTGCGGCCTCTGCCGCTGTAAGCATGAGAATGGCT
GTGGGAATTAAGATTGGAGGAGGTTATGGCAATTCTGAAACCAATGCCACGGAATATGAAAAGAATTGCGCAAGTTCAAG
AATTAACACCTTTGGTGGAGGACCATATGGTTCTAATTTCAAATTAGAAGATTGGGAAAAGACCCTTCCTACTAACCTTG
TTACTATAGATCGTACTGGTGATCCTTTATATTACGTAATAACAAAAAGAAACGTACCGTATTTCAGTGACAAAACAATA
TTTAACATCAACACTTTGATTAAAAATGCAATCAACAGGTATTACTCAGCTAATTCTCGCCCTGGATGCATGGATATTAA
ATCTGATAATTTTGATGAAAATGCTAACATTGACAATGGCATATGCCAAAATCCAGACGATAATTTCAAATTCGGAGGAG
TTTATCAATTTTGTTATGGGCTGAGTGCTAAATGTAAGGAACTGAACCAACTCAACCCAATCACTGGAACATCCTCATGT
CCAGATGGATTTGACCCTGTTGAGCTATTTTATGTATATAGTAATGAGAATAACGATGGTATGGTCATCAACACGTTTTG
GTGTGCTCCTAATCAAAAATCAACTCATTCAAATGGATATTTATTTGGCGGGATTTTTACCGATGCATATCCGAACCCTG
TTACTGGATCTTCTAGTTGTCCACAATATTTTCTATCTTTGAAATTTGGACGTACCGCAAAGATTTGCGTTTCACAGGAT
ATCGAACTTGGAATGAAAAATAGTCTGCCTTTTGGAGGGTTTTTCAGTTGTTCCATGGGGAATCCCTTGACACAGAAGAA
GACGACTAATTCTCCCGCTGACTATTGGACCCAATCATGCGCACCCGGTTATTCTGCACATTTGGCGGTCATCGAAATTA
ATTGTCAGATTTCATATTGTATCAAGAGTAACGCATTAAAAGGCAAAGAAGAAATTCCTCTTTATCGGCCACCATTCATT
AATTTAGACGATGGAATTAAGTATAATTCTATAAAGAAATTTCAAACTACTTCCGGGATAGAATTGAAACTTTCCAAGGA
CGGAATGTGGAATAAAGTGAAATATGTTCCTTTCGCAAGATCTAAATTTGGTTTAATTATTTTTTCCGAGGTTACCCTAA
TCTTGGTAATTATTGTTGTGGTTTTAATGGTTTGTTGGTTTAAATCCCGTTAAAAGAAAAATTGTTTTAAATAAAGACAG
ATCGGAAGA
>SMED30001002 ID=SMED30001002|Name=Venom allergen 5|organism=Schmidtea mediterranea sexual|type=transcript|length=918bp
TTAATTTAAGAATTTTTTAACCTTTTTTGGACTTTATATGCGGATATTTTTTAAAGAATAAAATTAAATTTTGATTTACG
GCTGAAATGACAGCAGAACTTCAATTTAATACAGAAGGTTTAGAAACCCATAATGAGCTAAGAAGATTACATAATGCACC
TGATATGACTATTAATGATTTACTTATGTCTGATGCTCAGGATTGGGCAAGGCATATGGCAGAAACAATGAAGCTTGAAC
ACAGTAAATCTGACGGTAAATATGGAGAAAATATAGCATCATCTTCCAAAAAACTTAATGGGCAGGAAGTAACTTTAATG
TGGTATAGAGAAATTTTCGATTACAATTTCAACGACGAAAAGCAAAATTTGGCAAAGACTGGTCATTTTTCTCAAGTGGT
TTGGAAAAGCAGTTTAGAAATTGGATTCGGATTAGAAAAATCAACTAACGGAATGTGGTATTATTGCTCACGTTATTTAC
CACCAGGCAATTGCGTTGGAAAATATTTGGAACATGTAAATAACTACGGAAAAAATTGGATTGATCATCCTCTCATTATA
AAGATCTCTCAACATAGACATCCATCTTTAGGAAGTCAAAAAAGCGAGGAGAATAGCGAAATGAAGTTGGTCGGAATATC
GAAAAAAACAACCATTGTCAACGGCATAGAAACGACTGAACTGGTCGAAACTTTTGTAAATGAAGATGGCACTAAAAATA
TTAAAAAAACCATTGTTGAGAAACAGTTACCACATGAGTTGGGAAACCTCTGCCAACAAGGAAAAGCCTCAATAAGTATC
CGAAAGTTAAAGAAAACTGAATAAAACCTTTGGTTTTTTTTTGGAAAACAAAAAAATAATCTTGAAGAAAACGCGGTTTC
TACTGTAAAGTCTACCTCTTCAAATAAAAGAAACTTTT
>SMED30025388 ID=SMED30025388|Name=Myosin heavy chain|organism=Schmidtea mediterranea sexual|type=transcript|length=6089bp
TTTTTTTTCGAGTTTGTGCTAGAAATTAATTTCAGTTTGAAATTTTTTGCCTATTTCGAGTTCTTTGAAAACAATCTGAA
AACATGAACCCATCTGATCCCGATTTTCAATATCTCGGTGTCGACCGAAAAGCTTTAATGAAGCAGTATGGGGATTCCTT
TGACAGCAAGAAAAACTGTTGGATTCCTGACGAGAAAGAAGCCTTCATTGCGGCGACAATTGAAGATGCGTCTGGAGATG
TCTATACGGTCAAAACCGATAAAAGTGAAACCAAGACTGTTAAAAAGGACGAAATCGAACAAATGAATCCACCGAAATTT
TTGATGATTGAAGACATGGCAAATTTAACCTTTCTAAACGATGCCAGCGTTCTTGATAATTTAAGACAAAGATATTACAA
GAATCTGATTTATACCTACTCTGGACTGTTTTGTGTGACAATAAATCCATACAAAAGATTTCCAATTTACACCCCGCAGG
TGATTTCAAAATACAAAGGTAAACGACGAACTGAAATGCCTCCACATATTTTCTCGATATCCGACAATGCTTACACCAAC
ATGTTGGCGGACCGAGATAATCAATCTGTCTTAATTACTGGTGAAAGTGGAGCTGGGAAAACTGAAAATACAAAAAAAGT
TATCACTTATTTTGCACACGTTGCAGCTGCTACTAAAAAAGAAGAGGATGATACTGGAACTGGTCAAAAGAGAAAGGGAA
CATTGGAAGACCAAATCGTGCAAGCAAATCCTGTTTTAGAAGCATACGGTAACGCAAAAACTGTGCGAAACAACAATTCA
TCCAGATTTGGTAAATTCATTCGTATTCATTTCGGTACAAGTGGAAAAATAGCTGGAGCTGATATTGAATTTTACTTACT
CGAAAAATCGAGAGTAAATTCTCAACAGAAAGGTGAAAGAAACTATCACATTTTCTATCAAATTTTATCGAACGGAGGAA
AACCATTTCATGAAAAATTACTCATCTCTCCTGATCCAGCTTTGTATTCCTTCATTAATCAAGGTGAATTAACAATCGAT
GGAGTCGACGATGAAGAAGAAATGAAAATAACTGATGAAGCTTTCGACATTTTGGGATTTTCTGCCGAAGAAAAAATGAG
CTTGTTCAAGTGTACTTGCTCAATTTTAAACATGGGCGAAATGAAATTTAAACAAAGGCCAAGAGAAGAACAAGCCGAAG
CCGACGGTACTGCTGAAGCTGAGAAAGTGGCTTTTCTGTTGGGTGTCAATGCAAAAGATTTAATGCAATCGATTCTGAAA
CCGAAAGTTAAAGTTGGTAATGAATATGTCACAAAGGGGCAGAATAAAGATCAAGTTCTTTATTCGGTTGGTGCGCTAGC
AAAATCTCTTTACAACAGAATGTTTGCGTGGTTGGTTTTGAGAGTTAACAAAACCCTCGACACTAAAGTCAAGCGACAAT
TTTTCATCGGTGTTTTGGATATTGCCGGTTTCGAAATTTTCAATTTCAATGGATTTGAACAAATTTGTATTAATTACACC
AATGAAAGATTGCAGCAATTTTTTAACCATCACATGTTCGTGTTGGAACAGGAAGAGTACAAGAAGGAAGCGATCGATTG
GGAGTTCATTGATTTTGGAATGGATCTTCAAGCGTGCATTGAGCTCATTGAAAAGCCAATGGGTATTCTGTCAATCTTAG
AAGAAGAGTGCATGTTTCCGAAAGCATCTGATATGACATTTAAAGCAAAATTGTATGATAATCATCTCGGAAAAAGTCCC
AATTTTGGAAAGCCAAAACCTCCAAAACCCGGACAGGCTGAAGCTCACTTCGAATTGCATCACTATGCTGGCAGTGTGCC
ATACAATGTTACTGGTTGGCTGGAAAAGAATAAAGATCCTCTCAACGAAACTGTGATAAATCTACTTGCGGCAAGTAAAG
AGGCATTAGTTTCGAGTTTGTTTGCTCCGGCTGAAGATCCAAATAATACGGGTAAACGGAAAAAGGGTGGGGCCATGCAG
ACCATTTCTTCAACTCATAGGGAATCCTTGAATAAATTGATGAAAAATTTACAAAGTACCAGTCCACATTTTATCCGATG
CATTGTTCCAAACGAATTCAAACAACCTGGTGTAATCGACGCTCATTTGGTATTACATCAATTGCATTGTAACGGTGTCC
TTGAAGGCATCAGAATCTGTCGAAAGGGTTTCCCAAACAGAATGATTTATTCTGAATTTAAACAAAGATATTCTATCTTG
GCTCCAAATGCAATTCCACAGGGATTTGTTGAAGGCAAACAAGTAACGAGCAAAATTCTGGAAGCTGTTCAATTGGACAC
CAATCTTTACCGCCTGGGAAATACTAAGGTATTTTTCAAAGCTGGAACTTTGGCTGATTTAGAAGACATGCGTGATGAAA
AATTATCTTCACTGATTTCATTGTTTCAAGCTCAAATACGCGGATATTTGATGCGAAGACAATATAAAAAATTACAAGAT
CAGAGAGTTGCTCTATCTATCATTCAAAGAAATATTCGTAAATATCTTCTTCTGAGAACATGGCCATGGTGGAAATTGTA
TACCAAAGTTAAGCCACTTTTGAACATTGCTCGTCAAGAGGAAGAAATGAAAAAGGCCGCTGAAGAATTGACAAAATTAA
AGGAAGAATTCGAAAAAGTTGACAAATTCAAAAAAGAACTTGAAGAACAAAACGTCAAATTGTTGGAAGCTAAAAACGAT
TTGTTCTTACAATTACAAACCGAACAAGACAGTTTAGCCGATGCCGAGGAAAAGGTTTCAAAATTGGTTATGCAAAAAGC
CGATATGGAAGGAAGAATTAAAGAATTGGAAGATCACCTTCTAGAAGAAGAAGATAATGCTGCTGGACTGGAAGATATCA
AGAAGAAAATGCAGGGTGAGATTGAAGAGTTGAAAAAAGATGTTGTCGATTTGGAATCTTCATTACAAAAGGCTGAACAA
GAGAAAACCGCGAAAGATCAACAGATAAAATCGTTACAAGATCAAATGGCAAAACAAGAAGAAGAGATGAACAAATTGAA
AAAGGAGAAAAAGGCCGCCGATGAAGTGCAAAAGAAAACCGAAGAATCTCTACTAGCGGAAGAAGAGAAAGTCAAAAATC
TAAACAAAGCTAAAGCCAAATTGGAACAGACCATTGATGAGATGGAAGAAAACCTCTCGCGAGAACAGAAAATCCGAGCT
GACGTAGAAAAAGTTAAACGAAAAATCGAAACTGAACTGAAACAAACTCAAGAGACCGTAGACGATTTGGAAAGAGTAAA
ACGAGAATTAGAGGAACAATTGAAGCGCAAGGAAATGGAATTAGTCAATGCTTCATCGAAAATTGAAGACGAATCGGGAT
TAGTTGCCCAGCTTCAGAGGAAAATCAAAGAACTTCAAGCTCGAATTCAAGAATTGGAAGAAGATCTGGAAGCAGAAAGA
CAAGCCCGTGCAAAAGCAGAGAAAAGCCGACATCAACTCGAAGGCGAGTTGGAAGAATTGAGTGATCGACTGGAAGAACA
AGGAGGCGCAACCTCAGCTCAAATGGATCTCAATAAGAAGCGAGAGGCAGAATTAATGAAATTAAAGAGAGATTTAGAAG
AATCGAATATGCAACACGATCAGGTTATCGCACAAGCTCGAAAGAAGCAACAGGATGTTGTCAATGAATTCTCAGAACAG
CTCGATCAACTGCAGAAAGTCAAAGCTAAAGTTGAAAAAGAAAAGAATGAGATGAAAGAAGATTTAAATGACCTACAAGG
ACAGCTGGAATCATTAAATAAAGCCAAGGCTAACAGCGACAAACGAATCAAAGAAATCGAAGCTCAAAATTCCGAATTAC
AGGGCAAATTGGAAGAGGCAAATAGACATATCAATGATGCCAACAATACATCTGGAAAGAATCAACAAACCAATGCGGAA
CTCCAAGCACGTTTAGAAGAAGCCGAATCGCAAATCAATCAGCTGGGTAAAGTCAAGCAACAAATGCAGACTCAACTCGA
AGAAGCCAGGCAAATCGCTGAGGAAGAGTCGAGAGCAAAGGCTAAATTGAGTTCTGATGTTCGCAATCTCAATGCCGATT
TAGACAATCTCAGGGAGGCACTGGAAGAGGAAAATGAGAACAAAAGTGACATACAGAGACAGCTAGTTAAAGCTCAGGGA
GAAATGCAACAATTGAAGGCTAAATTCGAAGGCTCGGGATCCATTCGTTCAGAAGAGTTGGATGAAGCCAAGCGAAAGTT
TATGACACGAATCCATGAGCTGGAAGAGGAAGCTGAAACCGCCAAATCGAAAGCCGGACAACTAGAAAAAGTTAAAGCTC
GACTCCAAGGAGAAATCGAAGATATGCTGGTCGACGTTGACAGAGCGAATACACTCGCATCTCAGTTGGAAAAGAAGCAG
AAAACATTCGATAAAGTCGTGTCAGAATGGCAGCAGAAATATGCTGAATCTCAGGCGGAATTGGAAGCATCCCAGAGAGA
AAGCAGGACGATTTCAGCTGAGGTGTTTCGAATGAAAGCACAAATCGAAGAAAGTCAAGAGCAGTTGGAAAGCGTTAAAC
GGGAAAACAAAAATCTAGCAGATGAAATCCACGATTTGACAGAGCAAATCGGAGAAGGAGGTCGCAGTGTTCACGAAATC
GACAAAGCAAGGAAACGATTGGAAATGGAAAAGGAAGAATTGCAACATGCGTTAGAAGAAGCCGAACAAGCTTTGGAACA
GGAAGAAGCCAAGTCTCAACGATCACAACTGGAAATGAGCCAGATCAGACAAGAAATCGACAGGCGATTGGCTGAGAAGG
AAGAGGAATTCGAGGCCACTCGAGTCAATCATCAAAGAGCAATGGAGTCAATGGAAGCCTCACTTGAAGCCGAATCCAGA
GGCAGGGCTGAAGCAACGAAGATGAAAAAGAAACTGGAGCACGATATCGGTGAACTGGAAGTTGCAGTGGATACCGCCAA
CAGAATCCGATCGGAGCAAGAAAAGAACGCAAAGAAATTCCAGCAGCAAGTTCAAGAATTGCTATCAATGGTGGAGGATG
AGAAACACCAGAAGGATCAGATACGAGAGCAAACGACGATGACAGAAAGGAAATTGACAATGGTCCTGGCAGAGCTTGAG
GAGGTTCGTGGCTCATTGGAAAATTCCGAGAGAAACAGGAAAAATACCGAGAATGAGAAAATGGAAATAACTGATCGATT
GAATGAGTTGAGTGTCCAGAGCTCCGGTTTCATGGCTACCAAGCGGAAATTGGAAGCTGATTTGGCTGCTATGCAGTCCG
ATTTAGAGGAGGCCGCTACTGAAGCCCGACAAGCCAATGAACAAGCCAAGAAGGCTGTTGCTGACAGTGCGAGATTGTTT
GATGAAATCCGGCAAGAGCAGGAACACGCACAGCAAATCGATAAGATCAAGAAACAACTCGAGGCCCAAAATAAAGAATT
GCAAGCCAAATTAGATGAATCGGAGAATAATGCTTTGAAAGGTGGCAAAAAAGCCTTGAGCAAACTAGAGCAACGCGTTC
GTGAACTTGAAGCCGAATTAGACGGAGAACAAAAAAGACACGTTGAAAGTCAAAAGAACTCCAGAAAAGTTGAAAGACGG
CTTAAGGAGCTTGGATTACAAACCGACGAAGATAAGAAGAACCAAGAAAGATTGCAAGATCTGGTGGAGAAGCTTCAAGG
TAAAATCAAAACCTACAAACGCCAGGTGGAAGAGGCGGAAGAAATTGCTGCTGTAAACTTAGCAAAATACAGAAAGATCC
AACAGGAAATCGAAGATTCCGAAGAAAGAGCTGATCAAGCTGAACAAGCGTTGCAGAAGCTGAGGACCAAAAACCGCAGC
TCCGTTTCGACAGCGAGAGGCGGTAGCATGGCTCCCGGCATGACCACAGTGAAATCGACATCACTCTCTGTTTCGGCTTC
GAGCCGACGACAAGGTTCTAGTGTTTCCAGAGAGAGCTAAGTCAGAAATTCTAGTAACACAACGATAAATTATTAGGATT
TACTTAATTGACATTATTTGCATGTTATCAATTATTGGACACAATTTAGTGATGCTTTTATTTAATAAAATTTACATTTT
GAAAAAAAA
>SMED30018602 ID=SMED30018602|Name=ATP dependent RNA helicase DDX5|organism=Schmidtea mediterranea sexual|type=transcript|length=607bp
TATTCAAAAGATAAACGATTGTTAGAAGTTGTTAGCAAAACTCCACGGGACAAAATGATTGTGTTCGCAGAAACGAAAAG
GAAAGCTGATATGATTTGTTCTTTCCTACGTTCAAAACAATTCAGAGTTGGTGCAATGCATGGAGATAAGTCACAGAGCG
ACAGAGAATATATTCTTAATGGGTTTCGAGGTGAAAATTTAAATATTCTCGTGGCAACAGATGTAGCAAGCAGGGGTTTA
GATGTTGATGATATTAAAGTTGTAATCAATTACGACTTCCCTATTCAATTTGAAGATTACATTCATAGAATCGGTAGGAC
AGGCCGACGAGGAAAATCCGGTGTGTCTTATACATTTTTCAATAGAAAGAATTCGAAAAGTGCTCGTCAATTGGTGAAAG
TGATGGAAGAAGCTAATCAATCAGTTTCAGATAGTTTGTATGATCTTGCATATATACCAAGAAGTGAGCGTAGACAAAAT
TTCAATCGTCCGCCAATGCCAGTGCCGCAAGTAAATAATTATCAAGTACCTCCGCCTCAATATAATGGTGGAAATAACAT
GTATCCGCAACCAGATTTATATATGCAAAACGGAGCAGCACATCACA
>SMED30035691 ID=SMED30035691|Name=Macrophage-expressed gene 1 protein|organism=Schmidtea mediterranea sexual|type=transcript|length=2718bp
TATATTTTAGAGATTATGATTATAAAAATTTAAAGTGCCGACAGTTAATAAAAACAATTAATGCTTACAACGTAAGGTCA
TCATGATGATGTAATCATTCGGATGTTCTATGACGTTCGGATAACCCTTATCACGTGGATCCTAAACAAAATATATCAAT
CAACTAGGAATTACAATATACATTTGTTTGTTCAACAGTGAAACCAGTGATACTTTGTATGTTTAATAATATAATAATAA
TTATATTTGTCTGTGGAGTTCTATCTTTTAAATGTAAAAGCGAATCAAACAGAGACCTCCCGTCAGAGAGGCAAGTCCAT
AAATGTAAACTTACTAACAAACAATACGCATTCGATATCCTCCCTGGATCTGGATGGGATAATCTTGAAAACAAGGAACT
CGGTCAAGTTTTAGAAATTTCATACAAGGAATGTTTGGCTTCGAATGATGGCAGCTTTCTCATTCCTGACAACTCGGTGA
TTATTCCGATCAAAAGGTCAACTGTCGAATTGGCATCTGACATATTTGATCATTTCTCTAATTTCACATCTGCCACGTCC
AAATCCATAAATGCCGATGCAAGTTACGCCACACCAAGCTATCAGATTAGTGGCTCGTTTTCATGGGAAAAAAAGGATGT
AAAAAATGACCAAATCAAAGAAAAGTCTTTGGTTTCTCGGGTACAATTGAGACACGAATTTTACACCGTTTCATTTCAGC
CAGACTCGAAATTTGATCGTCAATTCAAGAACAGAATTCTAGATATTGGAGCGTTATTGAAAGAAGGAAAAGACACAATT
TATCCACAATATTTAGCGGATTTAATTGTCCGTGACTTCGGCACTCACGTCATTCGGTCGGTGGATGCGGGAGCGACACT
AATAAAGACTGATGTTTTAAAATCGAATTATGTCAAAGGTTTTAAAGGGGATACAACTAAGATTGCAGCTGCGGCATCAT
TCAGTATGACAACAATGCTTTCAGTCAACCTCAAAGGAACCTATGTTGGTGATACCACGAGTCTCAATGAATTCAATAGT
AATAGTGCAAGTACAAAAGTCGAAACTTTTGGTGGTATACCGTTTGGTTCGAATTTTAAGTTGGAAGATTGGGAGAAAAC
CCTTGAAACGAATTTGGTAGCAATTGATCGCAAAGGTGAACCGTTGTCCTATGCTATTACATCAAGAACTCTTCCAGAAT
TTGACGAGAAAATTATTTACAAAATCGCTACTCTCATCAAAGAAGCAGTCAATAGATATTATGCAGCCAACACGAGAGTG
GGATGTATGAATATGGAGTCAGAAAATTTCAATGACGACGCAAATGTTGACGGTGGAAACTGCGAACCTCCTAATACATT
TTACAGTTTTGGAGGAACTTTTCAAACCTGCTCAGGCCCTGATTATCAGTGTATGGATGTCGCGGCAAAAAACCCAGTGA
CCAATAGTTATGCTTGTCCTGATAACTATGATACCATTGAATTACAAAGTGGATTGAATAAATGCATAAATTATTGCACC
AAATACTTATTTTCCACTCAATGTCATTACGAGTGTTCCCAATATGCATTGTATTGGTGTTCTTCTACAAACAAAACGAA
AATATCAGAAGGCGCACTTTTCGGGGGATTCTACACTAATACATTTCCGAATCCACTTACAAATTCCTATAGTTGTCCAC
AATACTATGTAGCGACAAGATTCGGCGTAAACGCCAAGGTTTGCACTGCACTCAATAAGGCAGAGGCTATGGAACACCAT
TTGCCGTTTGGAGGATTTTATAGTTGCAAAGTTGGAAATCCTCTACTAGATGATCCTCTCTACAACATTACACAGGATCC
CAAATATTGGCCTCAAGGTTGTTCAACCGGATATTCATCACATGTAGCTATTGTCGACAGAGCTTGTCAAATTTCCTATT
GCGTTAAAAATAACGCCCTTAGCATGAGAGAGCAACCGCCTCTCTACCGACCACCTTTTATTGATTTGGGATTTGGACCC
AATATGACAGTAATTACCTCTCTGGACACTCCAATGGGGGTCCGATTATCTGTTGATGAAAACGGGAAATGGAGTCATAA
TCACCAATACAAATTATCCAATTACAATATTATAATAATATCAGTCATTATGGCGGCAGGAGCCAGCATTGCAATTATTA
TTATAATTCTTGGAGTTCAAAGATTCAGCAGAAACCGAAAAGGTCAAGTCTCACCGGAATCTCATGAATTTGATAGCAGA
TATGATTCTACTAAAGATGTTGCCAATCTTGCGTTACCCGGCGAGGTTCCACCGTTTCGTGTTATAATTGACGGAGCGAA
ATGATGCTTGGAACCTTTTATTATTTCTGTTGAATCTGATCTGTAAATGTTTTCAGAATATTTTTCTAATAAAATCGTTC
TGAAATTTTAAAGTGATCCTTGATGCTATTAAATGATGGACTTTATTGTACCCCGAATTGGGTCACCCTTGTTCACGCAA
ATTCGTGCTTAGGATATTTGTACGGGCTTATGCAACTTTTTAAATTTTTATTTTTCCTTATTTTTATTAGCAATCCGTTT
TATTTATAACGACAAATGCTTGATGTTTGAATCAAATTTTTATTATGTTTCTTAATGAAACATAGTGAACAATGTGCCAC
TAATTTCATAACCAAGGTCTAATCAAATAGTTTGGGTAGTGAAAGCAATATTACAGAGTTTAGGTTTGTCATTCATAT
>SMED30027428 ID=SMED30027428|Name=forkhead box A-1|organism=Schmidtea mediterranea sexual|type=transcript|length=2149bp
ATCACTTGGTGCTGCTTTTTGCCCCGATAAATCTCTCGGTGCTCCAAAATTTGTGTAAGCGAGCAAAAGATGATTGGGCA
ATTTCTAGCACGTCATTCGGCAACGATGTTTACAAGTTTCTCTGATTGGATGATAAAGTAGAAACTTTCCGAAAATGAAA
CTTCTCCGAACATGCGCATACCGACTGAAAATTAACTCTAAGCCAGCCAATGGAATTGAAGCAAAATTCAAGAGAATATT
AATTGACTTCGCGAATGAACTCAAATTTTCTATTGGCGTATTGTGTGTGCCTCATTGTGAGTGGTTGCGATCGCATCTCA
AATTATTTACACACAAAAAAATAACGCACACAGACATTGAATAGATATATTTGATCAAGTCAATATCACAATGTCAATAT
TAGCTTTTTCTGAAGAAAGAAGACGAACTAGAAGAAAAACAACAACGAAATAGATTCGATAAGGCTACTGAGCGATTTTC
ATAATCTAAATATTATTTTATTATTGATACGGACAAAAATTGGTCTTTTACCAAGTACTACTAGATTGTTGATAAAGAGA
GGTTATTTAGATGCTTGGAAAAAATCCTTATGAAACTGCAATGAGCAACGTGTATTCTCTACCTCCGGGAGGTTCTATTT
ACAATATGAACCCGATGAGTATATCATCAGCTGGCTACAACTCTCAACAAGTATCAACACTATCGTTGAACTTGACCGGA
ATCGGACCTCATTCATTAAGCCCAATGAGTGCAAGCATGTCGGGTATAGCTGCAATGGCCGGTGGAATGAGACAAGGTCT
TGAGTTGGGTCTTGGTAGAAGTGATAGTCCAAGAGATAAAAATTCAATTTCCAATAACAACCGACCATATCAAAGAAGTT
ACACTCATGCCAAGCCTCCATACAGTTATATAAGTTTGATAACAATGGCGATTCAAAATTCTCCAGTAAACATGTGCACT
CTATCGGAGATCTATCAATTCATTATGGATCATTTTCCATACTATCGTCAAAATCAACAGCGATGGCAGAATTCGATTCG
ACATTCTTTGTCCTTCAACGATTGCTTTGTTAAGGTTAGTAGAAGCCCAGAAAAACCAGGTAAAGGCTCATATTGGACCT
TGCATCCTCAATCAGGTAACATGTTTGAAAACGGTTGTTATCTCAGAAGACAAAAGCGATTCAAAGATCCACACAGAGAA
ATCGGCAGACAGAGTCAAAGAGCTGCCACTGGTCCTGGATCAAATGTCACAGAAAACAATCACGACAACGCATCGCAAGA
AGCTAGTGATAACGCAGAAAGTGATACGAAACCCAACATCAAGCAACTTGATTTATCAAGCGATCTCTTAACTAATCAAG
GTCATAATATTAAAAATACTAATCCAACTTCTGTTAGTCAGAGTTGTTCGATGTTTCATCGGAAAAAGGAAAACTGCTCA
CCAGTAGAAATGAAATTGAATAACCAAAACCAACAATCAAACCAGCAAGAACATCCACAAATCCATTACAATCCCAATCA
GCAATTCTACTCAAATCAGCAAAACATTTTCCAACAAAGTTCTCTTGATCATTACAGTCTATTAGCATCCGATGATCCTC
TTGGTCAAGGTATGCACTTGCCACCAGGTGCAAATAGTGTTTTCGGACTTTACGGGGCACATAACTTACCAAACGATGAT
CAAATTTCAGTGTCATTACCATCGATATCCTTATCCGGACATCCGTATGACAATTTATCAACAGCAATGGCATATCAATA
TGAAGCATCTCAACACAATTCTTCATTACTAACGACAAGTAATCCGTTCTCAATAGATCGTTTGATGCATCCAAGACTAG
TCGCTGCAGCGATGGGGGTCAGTCCCCATGATACTCTATACGCAGGAGCTACCGGCCCATCAGTTGATCTAGAACACATG
AAATACTACTCAAACTACAACAATGTGCCTCCTTATTCCTCTGCAATGTCTGACTACTACAAATATGTACAAAATCCTCA
GCCGGGCAACAGCGACATGAGTCTTTGAATTGAGTCCATTGAAGTCTACGGCAGTTTCCTCGAAATTTCACATTCAACCA
GATGTTTATCGCCTAATATAAAGCTGTGTTTTTTTATTTATTTACAATTAAATCTTTGTACAAGAGATC
>SMED30033415 ID=SMED30033415|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=703bp
AGAACAAAAGGATACGTAACTCCAGTGAAGTATCAAAAAAAATGTAAGTCCTGTTATTCCTTTTCAACTGCAGGATCTCT
TGAAGGTCAATATTTTCGGAAAACAGGCAAATTGGTTAATTTTTCTGCACAGCAATTAGTTGACTGCAGTAGTTCTTTTG
GAAATGAAGGATGCCGAGGAGGATTTGTAGAAACGTCCTACAGCTATGTGATGGAATACGGCATTCAGTTAGAAAGTGAT
TACCCGTATGAAGGAAAATTTAGACAGTGTAAATACAATAAATCTCAAGTCGTAGGAAAATGCAGTGGATTTGTTCGCAT
AGAAGAAGGGAATGAAACTGATTTGGCCATCGCGGTTTCAACGGTTGGACCTCTGTCCGTTTCAATAAATGTTCAAAAGG
ATTTCATGGATTACAAAAGTGGCATTTACAATAATGCGAATTGTCTGTTTTATTCATTAAATCATGCTCTTCTACTTGTC
GGTTATGGATCAGAAAACGGAGTCAACTATTGGCTTTTGAAAAATCAATGGGGAACTGCTTGGGGTGAAGAAGGATACGC
CAAAATGGTAAAAGACGCGAGAAATCACTGTGGAATCGCTACAGCTGCCAATTATCCCTTAATATAAAATAGACTGATAT
TAATAAAAATGTTTTGTTATAAATTTTAGAATTAAAAAAAGTAATAATAATAATAATAAATTG
>SMED30027646 ID=SMED30027646|Name=Transcription factor BTF3|organism=Schmidtea mediterranea sexual|type=transcript|length=541bp
AAATTAATTTGTTTAAATAAATTTCTTTAGAATCACGCAATGGACGGTTTTAAAATTAACACTGAAAAATTAGAAAAACT
TAGTAAGTTGTCGGAAAATGTCCGAACAGGTGGTAAAGGTACAATGAGACGAAAGAAGAAGGTCATTGTCAAGAGTTCAG
CAGCAGATGATAAGAAATTAGAGGCAACCTTCAAATCATTGTCAATGAGCCCGGTTCCAGTTGAAGAAGTAAACATGTTC
AAGGATGATGGAACTGTTATTAATTTCGTTAATCCAAAAGTCAATGTGTCACTTCCATGCAACACTCTCTCAGTTACTGG
AAAATCCGAAATTAAGCAATTGACCGAAATACTTCCAAAAGTTTGGCAACAACTTGGCCCACTTAAAGGAGATCTTTTCA
AGAAAATTGCACAAAACATGGAAAATCAAGCAACTGTCGAAGATATTGATGATGAAGACGATGACGTTCCAACTCTCGTC
ACAGACTTCGATCAACAAAGCAAATTGGAATAACTTTTTAATATCAATAAATTTTTTGGAC
>SMED30024188 ID=SMED30024188|Name=Venom allergen 5|organism=Schmidtea mediterranea sexual|type=transcript|length=507bp
TTTTAATTAAAGTCGGATTTGTTTTAGTTGTTCTAGAATTTTGTTCTGGAGATCTTTCTAATGACGATAAAGACGCACTC
TTGAGATTCCACAACAATTACCGAAGAGCTGTGGTCTATGGAAGCGTTACAGGGCAACCCACAGCAACGAACATGAAAAA
CATGGTATGGAGTAAAGAATCCGCGTCGAAAGCGCAGATCTACGCGGATAAATGCATATTTGCTCACGACACAAAAGATG
ACCGTAAATACGGAGATTTTGAATCGGTTGGACAGAATGTTGCCATGTTTTCTGGAAAAAATATTTTCAGAGGCGTAGAA
TTGTGGTATAATGAGGCTTTCGGATTCACATTTTCAAATAATACCTGTTCATTAAAAACCTGCGGACATTATACACAACT
TGTATGGGCCGACTCTTCAGAGCTTGGCTGTGGATTGGCGAAATGTGTAATTTCAAAAGAAAATGTGAATTTGTTGTTTT
GCAATTACGGTCCAGGAGGCAATTATG
>SMED30036022 ID=SMED30036022|Name=Lysosomal alpha-glucosidase|organism=Schmidtea mediterranea sexual|type=transcript|length=2871bp
TTCTAGTACTTCGATCAAAGTCCAAACTACGATTTCCTATTTATGATGAAAATTATTGAATTAGCAAAACGCATTATAAT
GAAAAGTTTCATTATTTTTCAGATCTTTTTTTATTTTTATGTTGCCCATAATTCGGCCGCGAATTCTCCTCAGTGCTTGA
TCCAAAATAACAATGAACGTCTTGATTGCCACCCAGAACCTAATGCTAATGAACAATCGTGTAGAAGCAAAGGATGCTGT
TGGTCTGAACCCATGCGATCATCAAATAAATTACAAGCCTTGCCAGGATCAATTCCTTATTGCTATTTTCCCACAAATTA
TCCCAATTATGCTGTCAAAGATATAGAAGTTTCTAACAGAGGAATCAAAGCGAAACTGATCAAGCAGAAATTTAATCATC
TACCAGAGGAAATTTTATCGTTAAATCTAGATGTCATTTATGAAACGAAATCCAGAGTTCGTATCAGAATATCTGACACT
GAAAACAAGCGATTTGAAGTTCCAATAAAACTAAATCCTGCGGATCCTACTCCGCCAACTGATACAGATTATGATGTCTT
CATTCCATCTGAAGGGTCGTTCTCTATTGAAATTAAAAGAAAGTCAGATGGTCGATCGCTTTTTAAAACCTTTGGTCCAC
TTTTGTATTCCGATCAGTTTTTGCAAATATCAACATTGATGTCAACTGATCAAGTTTATGGGATTGGAGAACAAAATAGA
CCTTTCCTTCATCAACTATCTAATGGGTGGACACGAATTGGATTATGGGCGAGAGATTATGGAATTGAAACATTCAACAA
TTTGTACGGAACTCATCCTTTTTATATGGGAATTCCAGACGATGGAAAAGCTTTTGGTGTTTTTCATTTCAATAGTAATG
CCCAAGAATTCTCGTTGCAGCCTGCACCCGCAATTACGTATCGTTCAATTGGAGGAATACTAGATATTTTCATATTTACC
GGAGACACTCCTGAAGAAACCGTTAAGCAGTACGTAACTCTCATTGGTAAGCCAATGCTTCCTCCATATTGGTCTCTTGG
ATTCCATCTGTCAAAATGGGGTTACAAAAATATTGAGCAATTGTCTGAAATATTTCAAAGAAATATTAATGCCGGTTTCC
CAATCGGTACTCAGTGGAGTGATATAGATTATATGGAAAATTATAAAGATTTTACTGTCGACAAAGAGAAATTTAATGGA
TTGGGAAGATTTGTCAGAGAGATTAAACAAAAATATAACTCTAGATTTGTTGCAATTGTTGATCCAGGAATAAGCTGCAC
AAGTGGTAACGAATATCCACCTTATTATGAAGGAGTATTTATGGATATTTTCATCAAAGATTCACAGACCAATCAACCAA
TTGTTGGCAAGGTTTGGCCCGGAGAAACAGTTTATCCAGACTTCACTCATCCGAACATTTCTATGTATTGGTATAAACAA
ATTCAACGCTTTTATAATGATGTTCCAATTGATGGGCTTTGGATTGATATGAATGAGCCATCTAATTTCTACGATGGTTC
CAAAAGAGGCTGTCAAGGAAATAGTAAATATGACAATCCATTTTTTGTACCGGATATTCGAGATCAGTCATTAATATCTA
AAACTATTTGTTCTTCAGCACTCCATTACAATAACGAAAAGCATTATAATTTGCACAATCTCTACGGCTATACGGAATCA
GTAACAACAAATAAAGCATTATTAAAAACGATACACGGAAAAAGACCTTTTATTTTATCCCGGTCAACTTTCAGTGGATC
TGGTAAATATACCTTCCATTGGACCGGGGATAATCAAGCAAGTTGGGATCAGTTAAGAAATTCCATTAGACAAGTGCTTA
ATTTCAACATGTTTGGTATTCCGATGACTGGTGCTGACATTTGTGGATTTAACGGTAACAGTAATGAAGAACTCTGTATT
AGATGGATGCAATTGGGCGCTTTTTATCCATTCATGAGGAACCACAATGCAATCAACCAGAGAGATCAAGATCCAGCTTC
ATGGAGTATTGAAGCTCAGAAAATCATGAAAATTGCAATAAACATTAGATATGCATTATTCCCTCATTTTTATACTTCTC
TTGTTAAATCTCATTTATACGGTGGAACCGTGATGAAACCAATGAGCTTTGAGTTTTACTCTGATAGAAATACCCACGGA
TTGGACCTACAATTCATGATTGGATCATCTATAATGGTTGTTCCTGTAGTTGATCAGGGTGCCAGAAAAGTCAATGCTTA
TTTCCCAGCTGGTATTTGGTATGATTTCCAAAGTGGTAGTATTTTGTATTCTGATTCCAAAGGTGCCCAGGTAACCCTAG
ATGCTCCATTAGATAAAATAAATGTTGCACTAAGAGGAGGCCATATAGTTTCATTGATATCAGATTCTATGACAAATCCT
CAGATGTCAACAAATAAAATGATTTTATATTGTGCTTTATCGGAAGATTCACAGGCATCTGGAGATGCATATTGGGATGA
TGGGGAAAATGTTGATTCTTATTCTGGAAATAAGTACAATTATTTGAAATTTATTGCCAACGGAAATAGGCTGGAAATTT
CAGTAGAATTCAAGGGATATGAACTTGTCCCGGTGTTGTCAAAAGTAGTAATTTTGGGGGTAAAACAAACTGGTGTACAA
AATGTCTCTATAAATGACAGACCAGTAGACTATCAATTCGACGCAGAAAAATCAATTTTACTGATCAGCAATATTGATCT
TAGTATTGATTCGCACATTTTGCTTTCATGGAATTGACTGAAGCAATCTCACAAAAAATATTTTTATTAATAAAACACTA
TTGTTTTTTAATGCTTGATTAAATTATATTTTTAAAGTTTTTAAAGGATTTATTAATAAAAGAAATGTTTG
>SMED30016085 ID=SMED30016085|Name=Macrophage-expressed gene 1 protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1970bp
TTACAATATAGAAAATGCTTTGCTTTCCTCTGGGAGGGTTGATTCTACTGATATCCATAGCATTTAGCTTAGCTGACATC
AATCTACCTCAATATCAAAGAGGATCAAACACGAATTTCCCATCGAGACGAATGGCCCATGGGTGCCAGTTGACAAATAA
TGAATATCCATTCAATGTGTTGCCAGGATCAGGTTGGGATAACCTCTCTAATCGGGAGCAAGCACAAGTGTTAAAAATAT
CATATGACAAATGTAAAGCCTCAAATGACGGAAGATTTCTAATTCCTGATCAAACGAAATTAGTGCCAAAAATGAAGTCA
ATAGTGCAGTTAGATTCAAATTTGATTTCACATTTTTCAAAATATCCGTCGACTACTTCTAAATCTATTAATGCGGAAGC
AAGTGGAGAAACGAAGAAATATTCAATCAGTGGATCTTTTTCCAATGAAAGGGAAGACGTAAAACGAAATCAGTTAAATT
CTAAATCCTCAATATCCCAATCTCAATTGAGATACGATCTTTACAAAATTTCTCATATCGTAGACGCTGAACTTGATACA
AAGTTTCACCAAAGAATCCTAAACATTGGGGTGTTGATTGAAACAAAAAAGGATTCTTTATATTCAGCATATCTCGCTGA
TTTAATCGTCAGAGAATTTGGAACTCATGTCATTACATCGGTGGATGCTGGAGCCGTTTTGTCGAAAATTGACATCTTGA
AACAAAAATATGTCTTAGATAGTCAAGTACAAAATAGTGACGTATCAGTTGCAGCATCATTCAGTTTGGGACAAATTTGT
GGATTTAAATTCGGTTCAAATTTTAAAAATGATGACACAAAAATTGAGGAATATAACAATAATTGTGCCAGTACGAGAAT
TAAAACAATTGGCGGTGGACCTTTCGGCTCGGATTTCTCTTTAGAAGAATGGGAAAAAACCCTTGACACAAACTTGGTGG
CTATAGATAGAATCGGAGAGCCTTTGTATAACGTAATTACAAAGCATAATATTCCAGAATTTAGTGACAAAACGATTTAC
GAAATAAACTTACTTGTCAAAACTGCTATTGAGAAATATTATTCCACAAACACTCGATTAGGATGCATGGATTTTAATTC
ACATAGCTTTGATGAAAATGCCAATGTCAACTCCGGTTTGTGCAATGAAACGGGAAATACTTATCCCTTTGGTGGGGTTT
ATCAAACCTGCCAGAATTCAGACAAATGTGACACATATAATCAAAAGAATCCCGCCACCGGAGACTATAGCTGTCCAAAG
GCATTTAATCCTATCAAACTGTTTGAACTTGACAATCCAAGTATCACTTTTGTTTGGTGTGCTCCACGAAGCTCTTCAAG
CGCAATAAATGGATATCTATTTGGCGGAATGTATACTGAACAATATCCGAATCTTGTTACTAATAATCACAACTGTCCGC
AATATTACTTTCCTGTCCAGTATGGAATCAGTGGGAAAATATGCATAACTCAAGATAAAGAACTCGGCGGCAAAAATAGT
TTGCCATTCGGAGGATTCTACAGCTGCAAGACTGGAAATCCATTAGCTTTGGCCATTTACAATGGAACTCAGACAAACTT
TCCTCTGACCTGCGGTTCGGGTTATTCTACTCATTTAGCGTCTATTTTTAACAACTGCCATTATTCGTATTGCGTTAAAA
ATAATGCTATAAAAACGAAAGCTGCGACTCCACTTTACAGGCCTCCGTTTGTTGATTTGCAAATGGATTCGAATATTGAA
GTCGTCAGTGAACTCACTACTTCAGCAGGAATGAAGCTGGTTTTAGCCGAAGATGGAATATGGAAGGAAGAAATCCTGAG
AACTTACATGGTCGAGTATATAATGATAGCAGTAACTGTTGCGTTGCTGACTCTAATTGCTATATATATCAAGTTCAAAT
GTTTCGTTGGAAAGAAGTTAAATCCTACTCAAGTTTCAGCAGATCGGAAG
>SMED30025427 ID=SMED30025427|Name=Translationally controlled tumor protein|organism=Schmidtea mediterranea sexual|type=transcript|length=570bp
AAGTAATACTTTTATCATTTAATTGAAAAAATGCTCATTTACAAGGATATTGTTGCCGGCGATGAGTTGTGCTCTGATAC
ATTCCCAATGACGATTGTCGACGATGTCGTTTACGAATTCAACGGAAGAAATATTACTATTAAAAACGGTATTTCTGACG
CCCTCTTTGGTGGAAATGCTTCAGAGGAAGCTGCTGGCGATGATGACGTTGCTGATTCGGACGAGACAGCAATTGACATT
GTATACAGCAACCGATTAGTCGAAATGAGCTTTGACAAGAAAGGTTACACGAGTTACATCAAAGGTTACATGAAAAGTAT
TTTGGAAAGATTGAATGCCACTAATAAAGAACGAGCTGAAATCTTCAAATCCAAAGTCGGTGCCTATGTTACAAAAATCA
TCAAAAATTTTGATGAATATCGTTTCTACTGTGGAGAGTCAATGAACCCTGACGGAATGATCATTCCATGCAATTACAGA
GAAGACCAAATTACCCCATACTTTGTTCTCTTCAAAGATGGCCTCGAAGAAGAAAAATGCTAGATTTCTGTTAAATAAAT
TTAGTGGAAC
>SMED30023322 ID=SMED30023322|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=613bp
ACGCATTCTCTACGACAGGCGCGTTAGAAGGTCAACTATTCAGAAAAACTGGAAATTTGATAAGTTTATCTGAACAACAG
ATTGTTGATTGTGATAGTTTTGATTATGCATGTAACGGTGGATTTGTGACTGATACTTTAACTTATATTAAACAAAATGG
AGGAATTGAATCTGAGCAAGATTATCCATATGTGTCAGGAAGGACGAAGAAACCTAATAAAAAATGTTATTTCAAAAAAG
AAAAAATAGTGGGAACAGATACTGGTTTCGTATCTTTACCTCCAGGAGATGAAGAAGCTCTGAGAGAAGCTCTAGTAACA
ATTGGGCCAATTTCAATAGCTTTTTCCGCGTCGCCTTTGTTATCAGGATATAAGAATGGGATATATCATGATTACATGTG
TGCTGATGTTCGCATCAATCATGCAGTTTTACTAGTAGGATATGGAACGGATGAAGAATCAGGAACACCTTATTGGATAA
TAAAAAACAGTTGGGGTCCCGCATGGGGAGAAAATGGATATTTTCGAATGGAAAGAAATAAAAACATGTGCAACATGGCA
TACAATTCATACTATCCATTGGTTTGATTGAACGACTTCTTATGAGTGTGTGT
>SMED30005748 ID=SMED30005748|Name=HNF4|organism=Schmidtea mediterranea sexual|type=transcript|length=3066bp
GAAGAATAACAAAGAAATTTATTGCCAAACTAAAATACCCGGCCTATTTCATCAAAAAAAAAACAATCAAAAACACAAAT
CGCTACGAAAACTTGTATAAAAGATTCACATTAAAAGTCATCAATATTCCTCTTTTTTAAAGACTGATGATTCAGATTCT
TGGATCCGAATGGGGTGATCTGTTAGGAAGTGAGCTGTTGACGAGATAGCTGAATAGTTTGATCTGGAATTGTGCTGTTG
GTTCGCTTCCGATGATCTGTTGGCGATTGATTGAATTTGGCAGTTTTCTATCGGCGAGTTTGGAAGCGACTTGGTATAGG
CCACAAGAAGCGACGGATCAACGACATTTTGAGTGGAATTCACAGAAAGAGCTGGGTGGATTAGGTCATCTGAATTGGAA
GAATTTGAGCAGTTATGATTTGCGTCACTGTTATAGGCGTATTTTGACTGGTTGATCATGGGGAACCCTTGATCAAGGTT
GACCAAGAAATGGCTGGTATCCTGTGATAAATTGGAATGCTGATAAAGATTGATGGAATCATTGACGCATGAAAACAGAG
AAGGAACGCCGACTCTTTCATTTTTCAGCATCATCCCATCGCTGTTGATTATCATACCGAAGTTGCTATTGTCCTGGGAA
TTTTGCTGCATTATTTCAGTTCCTTGATTAACAAAAGCTCGATATATATTTCCTGAAGGCATCGACGTAGAACTTGGCAA
ATATGCACTCCATATTTTTGAGGCCGCTTCAGGTGATATGTTTTGGTTGTTGATATTGAGTAGGACACTGTCTGGCATGA
AAGGGGGAATTCCGTAGCAGTCCTGGTAAGTATATTTCGGTGAGGAAATCCTGTGGGAGTTAATTATATCCATGGAATCG
TTTTGATTATTGTTATTGTTCCCATCTGTTTCTGGATCTATGCTGAATACCCCTGGTGGATTGTCACCCAATAATGTTTC
AGATAACAAGCTATCAATCTCGGCTAATCCTGTCATTTTCATGAACTCGACCTTCTTTACCATCAGCTGGGTGACCAATC
TCAGATCAGGAATTGTCAGCAGCAATTCCCCGAATCTACCCGGCTTGTGGTATTGCTTGTCATTCATGTGGTTCATCAGG
TCCATTTGTATTTGGTATCGGCATCGTCTCACGAACTCCTTGCCAGACTCGCTGACTCTCGGATCAAAAAATACGATCGC
TTTCAAACAAGCGAATTCTGCGTCATCCAATTGCAATTCTCGCAGCGGAATGAACAGGTCGTCAAGGATGTGACTGGCTA
TTTCAGCGAAATGTTTGTCACTGGAGTTCCTACTGATGATAAGATTGTTTCCCAATAATAGCACATCGTCTTCGTCCAAT
TGAAACGACCGCCTTATTACTCCAAGAATTAGAATTTCTCCCGCGTGTGCTTTTAAAAGGGAAATTTGATCGCTCAAGTT
TAACTGTGAAAAACAAGGCAAAGACTTTGCCCAATTCACTAGAAGAAATAACTGATTTTTCATGGACTCGCAAACATCAG
GCACATCGGCATATCTGTTCATGTATTCCTGAGGATTCGGGGGCTTTTGTATTGCAACCCTTTGCTCGGCCTGCATCAAC
TGAGAAATGGAGAGAATGACATTCGGAGGAATATCATCAAACGACGATCTTCGAGTACTGATCCTATCTCGTTCATTTTG
AACCGCTGCTCGCTTCATTCCTACAAGAATGCATTTCTTTAGCCGACAATAACGGCATTGGTTTCGTTTATCCTTGTCCA
TTTTACAATTCCGATTGTACTGGCAAGTGTAGTTATTCTTCTTCCTCACTGACCTCCGAAAAAATCCTTTACAACCGTCA
CACGAGAAAGCCCCATAATGTTTTCCTGTAGCTTTGTCACTGCAAATGAGACAGAGTTGATTGTTTTCCATTCCTTCTGG
TCCCGACGCGTTAGACGCATAGACTTCATGTTGTTGCGAGGACACTGAAACGAAAACTATTTGATAATATTTGTACAAAA
CAACTGACAGATGGTTTCGGAAAAGGTTCAATGTTCAGCCATAGTTCAGCGAAAGGTCAAATTCCTGAACTACTATTTCA
AGGTATAAATTTGAATATATTGGTTTTGCCTCGTGCTAACAAAGTCCAGAAATATAATAAGCAAAGTCTGAATCGTGTAC
TTTGGATTTCTAGCCAGGGGCACACAATAACCTATATTTAATAGCAGTTCATTGCGTTCACTCGTTATTTCTCCGACTGA
ACTGCATTGCAGGAGGATCCGCAACCATGGAGATTTCATAATTATTATCAAAATGATAATAATAATAATTATTATGAGGT
ATTGTAAAAGAAAACGTAACTCACTTTCACTTTCCAATGGATATTGCATCGAGGAAGCGTTGCTGGAAATGGAAATCGGA
GCTGAATTGCTAGTCAATAGTTGATAGGAGAATGCTGGATTGAGGTTCGGATGCTGGGTAGACGTCATATAGAATTGGCT
CGACGGATTCGGTAAAATTATGGTGAAGTTTACAATCGAAGCTCAGATATAACGTATTATAATGAAGTATTATTAATAAA
CTGCAAGTAACGTGCGCGCATTCTGAAGTGGTTGATTGAGAATAATCAGTTCTTATTCGACAAATTCAGATAAAAAAGGC
ACCACTCGAATTGTTCAGCTGCGTCATGTGAATGCCGGAACGTTGTGCGTTGGCTGTTGGCAGATCAGCGCTCCGTGTTC
ACTGCAATCCGGATACACCAGACCACTTGAAATCGTTGCGAATTCAGCGTGTCGAGTGCATTGTGCGAGATCAGTATCGG
TGTGTATGTGTGTCTGCCTGTGTGCGTGTGGATGTGTGTGCTTGTCGAGTCGGTTGTGTGTTTATGAGTGTAACTGTGTC
GATTTGGTCGAATGCAGTAGCAGATAGCTGAAATGCGATTGTTCCTATTTTTCATTTAATATTGTTTTATGTTTTGTTTC
TATTTTTATAATTTAATTTATCAGTTTTTGTTTAGATTATGCAATCATTGTTTAATTTATTTTTGTCAATTTAAAATTTA
TTATTAATTAAATTATTATAATTATT
>SMED30019695 ID=SMED30019695|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=1216bp
TTGAAATTCTGCATTGATGGGAATTGCGTCGTAATAATCACGCGCCGAATATCAAATGTATAAATAAGATATTTGTTCTT
CACTTAATATAATTATAATGTTTGCGATGGGTCCTATCTTGATATGTTTATTATTAGCAGTGATTTCAGAAGCCAGAACC
ACTTATAGCCATCACAAATCAGTTCCAAGTGATGACATTTCTAGTAAATTTGAACTAGAAAATATGGTATCTCTCTTGTC
CCGTTACGACGGAGAATTCCAAACCTTCAAACAGCGATATAATAAATCTTATAGTTCCATGCATGAAGAGAATTCCAGAT
TTTTAAATTTTATATCATCTCTACTTGAGATCAATCATCACAATCAACTTTATGAAAACGGTCAGAAATCATACGAGATT
GGAATCAACCATTTGAGTGATTGGAGTGATGAAGAACTCGCTCAACTGACTAAATTGAAACAATCAAACCTGACGGGCTC
ATCATATTTATCATCCAGTGTGAAAATTGACCTTCCTGATTCATTCGACTGGAGAGAGAAGGGTGCAGTTACTGAAGTTA
AAGATCAAGGAAAGTGTGGATCATGCTATGCATTTGCTGCTACTGGCACTCTAGAAGCCCAAATCTGGAGAAAGACTGGG
AAATTGATCAGTTTATCAGAACAACAAATTGTTGATTGCGATACTAATGATAACAATTGTTACGGTGGATTTGTACAAGA
CGCGTTATCATACATCAAGTCAAATGGAGGCATTGAAAATGAGGAAAATTACCCTTATGTTTCCGGCAAAACAGCAGATA
TGAACCCAAAATGTAATTTCGTAAAAAGCAAAGTAGTGGCGACTGATACTGGATTTGTTAAAATGCCAGCAAATGATGAA
GAAAAATTAAAAGAAGCTCTTGTTACAATTGGCCCTATTTCTGCATTATTATCTGCTCCTAAATCGCTTATAAAATATTC
AAAAGGAATTTTCTACGACAAAGAATGTGAAAAACTAAGAGTTAATCACGCTGTTCTGATAGTCGGATATGGAACAGATC
AAACTTCCGGGACACCATATTGGATAATTAAGAATAGTTGGAACGCATCTTGGGGTGAAAAAGGATATTTCCGGTTACCC
AGAAATATAAATGCTTGCAAAATAGCGTCAGTGCCAGTTTATCCTTTGGTTTGAATTAAAATGTTTATGTAATAAATATA
TTTTTTTGTCTCAAAA
>SMED30029077 ID=SMED30029077|Name=Macrophage-expressed gene 1 protein|organism=Schmidtea mediterranea sexual|type=transcript|length=2367bp
TAAGTAAAACAAAAATTCGAAATTTGTATATTAATGCGAACAAAGTTTAAAAATTTATTGTAAATGTATATTCAAATATT
ACTAATAATTAGTCTTTTCAAAATATTAGTGAGAGGATCAAATGAAGTCAATACTATTAAGGATGCGTATCAATTGTGTC
AGTTGATGCCCAATCAAAGAACGTTCGATGTTTTACCTGGATCAGGATGGGATAACCTGGCCAATATCGGCATGGGAAGG
ATACTTGATTTAAACTTTTCGAAGTGTTCATTTTCCAATGACAACAAATATCTGATCCCGAATCAACTGGCCATTTATCC
AGAAAAATCTTCCCAAGTTGAAATCTCAAGTGAAATATTCCGTCATTTCTCAAATTACACATCTATGTCTTCGCAATCTA
TCAATGTTGGTGCTGAAGGTGGCTACGGAATATTTAAAATTGGGGGATCTTTTTCCACGGAAAATACAAAGATCAAAAGT
GATCAGATGGAAACGAAATCCATTTTCACCAGAGTTCAGTTGCGATATTTGGGGTTCCAGTCAATGTTTGAGCCGGATAC
GCCTCTCTATCCAACATTCAAGAACAGAATTATGGACATTGCTGGATTAGTTGTTGAAAATAAAGACTCACTTTATCCTG
AGTATTTGGCTGACATGATTGTTCGAGACTACGGGACCCATGTAATCCGTGCTATAGATGCTGGGGCGATTTTGTCAAAA
ACCGATGCTTTGAATTCACAATACGTAAAGAAATATGAATCGGATAGTTCCACAATCTCCGTTTCTGCGTCAGCATCTTT
TCTTAGTTTGTTTAAAATAGATGGTAAATACCAAACTAAAACTACACAAACGAATATTGATGAGTTCAATCACAACGTTG
TTAAAACTCACATTGATACGGTCGGAGGTGCCATATTTGGAGCCAATACGTCTTTGTCCGACTGGGAAAATTCTGTCATG
AATAATTTAGTTCCCATAGATCGGAGGGGTGAACCATTATACTATGCCATTACTCCTCGTGCCTTGCCAGAACTGGATCA
AGAAACCGTGCACAAAATTTATGTCTTAATAAAGAAAGCAATTCTACGATATTATACAGCCAATGGCCGAATTGGATGCC
TTGATATATATTCTCCAAACTTCAATCCGGATGCCAATATTGATTCTGGGAATTGTGAACATCCGTCTGTGAATTTTACT
TTTGGAGGTACTTATCAAGTTTGCGGTGGTCCTGCATGTGGTCCATATGCTCAAGTAAATCCATTAACAGGAGGGTTTTC
TTGTCCCTCTGGATTTATTTCGATAAAACTTCACAGTGGCTTAGTTCGATGTGACGAATCATGTCATGGGTGGTGGTTTT
GGAGAAGCTGCGATACAACTTGCTCTTATTTTACCACTTTTTGGTGTTATCCGGTGAATATCGGCCCAAATTACAATGGA
TATCAATTTGGAGGAATTCGTCAAGGAAGTTGTCCCATTGGATATATTCCACTCAAGGTCGGATTAAGCATAGAAATTTG
TGTGACAGTTGATGCTGACCCGTTCAATCCATATGCTATTAAATTTGGCGGCTTTTTCAGCTGCAGTGCCGGAAATCCGC
TAGCTCAAGAATATGTTAAAAACAAACCAAAGTTATATTCCAGTTCGAAAATGGCAGATTTAAAATATTGGCCTAAAACC
TGTGCCAAAGGTTATGTGGCTCACATTTCATCAATTGAACAAGGCTGTCAGATTTCATACTGTACAGAGACAAATAAAGT
TTCTTTAGGCCCTTTACCTCGGATAATTAAACCTCCATTTATTTCAATTGATTACAATCCAAACAGCACGAAAGTTTTAA
TATTTACAACCAAAAACGGTGAAACGTTTATAAAAGATAACGTTGGATCATGGAAATTAGAGGACATTCAAAGAGAGAAA
AGAAATATGTTAGTTGGATCAATCGTTGGAAGTTTTCTAATGGCTGCCTGCATCTGTTTGACGATTTTCTTCATTCAAAG
AAGACATTATAAACGAATGATTGAAAAGTTAGATTATAAACCATTAACAAAGAATGAACAATTGGCGGACTACGGCTCAA
TAAATAATACAGACAGAGTGTAATTAAAACAACAAAATTAAATGTTTTTCAAACATTTTTAGCTTAGCTCATGAAAACAA
TTTACATTGTTCACAAAATTTATTTGCATTTTTTATCAATTATTGTAATTGCTTAATGTCGTTAATAATTACATTTTTAT
ATGGAAATATATCTGATTTCATTATTTTTTCAAAATGATAAGATGACTATTTAATTTTGTTTGATAGCAAGAGAACAAAA
AATTTTGTGATTAATTCTGATGATTTATTGATCTATTTTCATTTGAC
>SMED30012382 ID=SMED30012382|Name=Macrophage-expressed gene 1 protein|organism=Schmidtea mediterranea sexual|type=transcript|length=2261bp
CGCAGAGGTCCCTCTGGCAACACCGAAGGAAGTGTGTGACAATGAAACAAATCAAAATTAAGATTTTACCATTTTGAAGT
TGAGTCAAATATTTCATTGATGACCAATGCAGTGCAAATTAAAAGTTGACGTATACAAAACATACCACAGTAAGAAGGCA
ATTTCTTTCCGAGCATCCCGCAAATAATCCCAAAAGAGATATTGCAATTACTATGATCCCAATAGCCAAAACAAAAGTAA
CTGATGGAAAAATAGAATATCTTTGTGCCAAATTCATGCTGAATCAGTAGTTGAACCGGAAGATATTATAAAGCAAATGA
ATCTGCCATCCTCTAGAATTGTGCATAAATGTCACTTGACCAAAACTCAGTATCCTTTTAATGTTTTACCAGGATCAGGA
TGGGACAATTTAGCAAACAAGGAATCGGGACAAGTTTACAAAATTTCATATGATAATTGCTCGGGATCAAACGATGGACG
GTTTTTAATCCCCGATTCAATCATTATAACTCCATACATGAAATCCAAAGTCCAAATGGATTCAGATATGGTTTCTCATT
TCTCAAAATATACATCAACGACTTCTAAATCTATTAATCTTGAAGTCAGTGCTTCTACGCCAAATTATGAAATAAGTGGT
TCATTTTCATGGGAAAAGAAAGATATTAAAGAAAATCAAATGAAAGAAAAATCATCTATATCCAAGGTTCAACTACGATA
TGAATTGTATCACGTCGCATTTCAACCTGATTCAAAGTTGGACCCTATTTTCAAAAACAGAATTATACAATTGGGAGTTC
TGATGGAAACGCAAAAGAATTATCTATATTCCCAGTATTTAGCCGATTTGATAGTTCGAGATTATGGAACCCATGTTATC
AGGTCTGTGGATGCGGGTGCAATTCTGTCAAAAGTTGACATACTGAAAGCAGAGTATTTGTCAAAACATAAGGGCTCCCA
AACGACAATTTCATTAGCAGCATCTGGAAGCCTGAATTCAGCAATTGGCTTAAAAATTGGCGGCTCAAATAAAAATAACG
AATCAGAAGTTCGCGAGTACAATAAGAATTGTGCTAGCTCAAAAATTAATACAATTGGCGGTGGGCCATACGGATCCAAT
TTTCAATTAGCTGAATGGGAGAAAACTATTCAAGAAAATTTGGTTCCAATTGATAGAATCGGAGATCCGCTATTCCACGT
TATAACTAAGAGAAGTTTGCCAGAGTTTGACGATATAACGGTTTATAAAATTGGAAATTTAATTAAAGACGCAATTACAA
GATACTATAAAATAAATACGCGATCGGGTTGCATGGACATAAAATCCGATAATTTTGACGTAAATGCAAATGTTAATAAT
GGGATCTGCCAAGACTCAAAAATCTCATACGTTTTCGGAGGTGTCTATCAAACATGTGAAGGAAATTCGTGTGAAAATTT
GATTCAAACCAACCCAGCCACTGGTTCAACTTCTTGTCCAGCGGGATATAATGCAACCTTAGTCTATCACGGCTTATATT
CTGAGCAAACGATTTGTACTTATTATGTTTTCTCTACTGTTTGCAACAATTTCCAAACATATATATCTTCATATTGGTGT
GCTCCTGATCCGAAAAAAAATCCGGAAAGTGTATATTTATTCGGTGGGTTTTACTCAAAGGTTTTCCCTAATCCAATTAC
AAATTCTTTCACTTGTCCACAAAGTTTCATTGCTCTACGTTTCGGTCATAGTTCATGGGTTTGTGTTACGTCAGATTCAG
TGCTTGGGAGAAAATTCAGTTTACCTTTTGGTGGATTTTACAGCTGCATGAGTGGTAACGCGCTGGTGGCTGATGCATCA
GCACGATCACAGACCTGGGCAAAATCTTGTCCCCCAGGCTATTCGGCCCACTTCGCATTTTTAGAAAACAGTTGTCAAAT
ATCGTATTGTCTAAAAGCCAACTCTCTTAAAGGTATCAAAGAAATACCTCTTTACCGGCCTCCATTTATTACGATGGACA
ATGGGCCTAATGTGACTGACGTAAATAAATTCAAAACTTCATCTGGAGTCAATCTTGTTCTCTCCAAAGATGGACTATGG
AAGAGGAAACAAAAGAAAGTTTTCATGAAAACCCTAATAGCCGTTATCATTCTTGGTATTTTGATAGCCGTTTGTATAAT
AATGAATGGGGCTTTCGGTTTGAGGTTATTGATATCAAAAAAACAAAAGTAGAATAAAAGTATATTCTAAAATTCATTTT
GATGAATAAATGTTTTGGGTT
>SMED30004852 ID=SMED30004852|Name=Venom allergen 5|organism=Schmidtea mediterranea sexual|type=transcript|length=676bp
TAAAAATGTAAATCCGTTTAGTTTTTCTATTTCGATATGAATTTTTTAATTGAAGTCGCATTTGTTTTAGTTGTTCTAGA
TTTCTGTTCTGGAGATGTTACTAATTATGAAAAAGAAATGCTCTTGGATATCCACAATGAATGCCGAGCAAATGTGGCCA
AAGGAGACGTTTCAGGTCAACCCCCAGCAACGTACATGGAAGCATTGGTATGGAATCCAGAATCCGCGTCAAAAGCGCAG
ATCTACGCGGATAAATGCATATTTGCTCACGACACAAAAGACAACCGTAAATACGGAGATTTTGAATGGGTTGGACAGAA
TGTTGCTAAGTTCGCCTCAGAAATAATTTCCAGAGGCGTAGAATTGTGGTTTAATCAGGCTTCCGGATTCACATTTGCAG
ATAATTCCTGTTCATTAAAAAACTGCGGACATTATACACAACTTGTATGGGCCAACTCTACTGAGGTTGGATGTGGACTT
TCCAAATGTTCAATTGACGGAATTGATTTGAGTTTGTTAGTTTGCAATTACGGTCCAGGAGGCAATTATGTCGGTGAGAA
ACCCTATAAATCTGGCGAGCCATGTTCTGAATGCAAATCCGGCCAATCCTGCACTGCATATGGACTTTGTTATGATTAAT
AAATATCCCGTCAATCCTGCAGTCAGGATTGACTTG
>SMED30008009 ID=SMED30008009|Name=Venom allergen 5|organism=Schmidtea mediterranea sexual|type=transcript|length=667bp
ATCTTAAAGAATAAATAAAATGAAAATGAATTTTAAATTGGTATTTGTAGCGATCTATATAACAATTTGCCACTGTAACG
TGACCCCCGATCAGAAAAAGGCTTTGATTGATGCTCACAACAAATACCGCCGAGAAGTAGCTCAAGGAAAAGTTAGTAAA
CAACCCGAAGCTGCAAACATGCTAGAATTGAAATGGAGTAGCGAAGCAGAGGCAAAGGCGCAGAAGTTCGTAAATAAATG
TGTATTCAAACACGATTCTTCGGGTGAAAGAAAATTTGGAAGTTACCAATGGGTTGGGCAAAATATCGCATATTGGCACA
GTGATGATGTTACAGAAGGTATTAAAATGTGGTATGATGAAGTGAAGGGTTACAATTTCCAATCCGAAAAATGCTCCGTC
TCAACATGCTTGCATTATACTCAAGTAGTATGGGCAAAAACGAAAGAGTTTGGATGCGGTGTTGCTGACTGTTCAAAGAA
AAAACTAGGAAAAATATTTTTAGCTTGTAATTATGCACCTGGTGGAAATTGGAATAATGAAAAGGCCTATGAAGTTGGAA
AAGCATGCAGTAAATGCCCAACCGGGACCAAATGCAATGATGGACTATGCAGTTAATCTAAAATTTATATTTTAATCAAA
AGAATTGAAACTGAAATACTTTTAAAA
>SMED30017598 ID=SMED30017598|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=824bp
TTCAAATATGATTATCTCATATTATATTATATTGCTTTATTTTTTCATCCTTCTGACTGAAGCATCACCCGTACTTCGTC
TTTATTCTATTGTTTCTAATCTAACATTCTCGCCTTTCATTAGTCAGTTTTTAATAACTGATCTTCCTGAATCGGTAGAC
TGGAGGCTGAAAGGAGCAGTTACTGAAGTTAAAGATCAGCAAGAATGCGGCTGTTGTTATGCATTTTCAGCTATTGGAGT
AATAGAATCTCAAATTTGGATAAAAACAGGAAAACTTGTAGATTTATCAGTTCAACAAATTTTAGATTGTGATGGAAAAT
CTCAACAGTGTCATGGTGGATTTCCCGACGACAATTTCAATTATATAACTAAAGCTGGAGGAATCGAGACTGAAAAGACC
TATCCTTATGTTTCTGGTTATAATAGTCGGGAACTTTATAAATGTAAGTTCAATGAAACGAATTCCGTGGCAGCTGTAAA
AGGATTCGTTCAAATTCCAAAAGGGGACGAAGATGCATTAATGGAAGCAGTGGCAACAGTAGGACCAGTCTCTGTCAGCT
TGTGTGTTTCCTATGACCTTGGTTCTTACACTTCTGGGATTTTCAAAGATAAATTGCCTGATCATAATGAGTTTAACCAC
GCTGCTATCGTTGTTGGGTATGGAAATGATAACGTAACTGGGACACCATATTGGTTGTTAAAAAATGCTTATGGTAAAGA
GTGGGGAGAAAATGGATATTTTCGCATTGAAAGAAATAAAAATTCCTGCTACATTGCTCAATACGCTTTGTATCCCATTG
TTTCAGTTACGTAAGAATAAACTC
>SMED30022907 ID=SMED30022907|Name=Synaptotagmin|organism=Schmidtea mediterranea sexual|type=transcript|length=1814bp
ATTTATTGAAAATTATTTTTTCTATTATTAGGAGAAAATTGATTATTTTTTTTTGACAAAATAAGTTTTGGATATATTTC
CCATTTGTTTGTATTCGTAAACCAATGAAGAATTCGACTCACGGATCGGATCATTCGGCCAGCAAGGCCAGTATGAAAAC
GAATGTGGAAAAATTTTGGCATGATCTCGGAAAAAAATTGCACATGGATCCAAAAGCATTAATAGGAGTAACAATCGGTT
TGGGAATATTGTTTTTGTTGTTCCTTTATTGCTTATGTAAAAAATGTGTTTTCAAGCGTCGAAAAAAGAAGGAAACGGCC
AAAAAAGGAGCCAAGGGAGTAGTCGATATGAAAAGTGCCCAATTGTTGGGGAATTCATATAAAGAAAAAATTCAACCCGA
TCTTGAAGAACTTGATGCAAACATGGAAGACAATGAAGGTGTAAAAGAAAAAGAAGATGTTCATTTAGGAAAATTACAAT
ATTCTCTAGATTATGATTTTCAGAAAGGAGAATTAACTGTTGGAGTTATTCAAGCAACTGATCTTCCAGCTATGGATATG
TCAGGAACATCAGATCCATATGTCAAATTATACCTTCTCCCAGACAAGAAAAAGAAATTCGAAACAAAGGTTCATAGGAA
AATTTTAAATCCTGTATTCAATGAAACTTTTGTTTTCAAAGTTCCTTTCAATGAAGTTGCATCGAAGACTTTGATTTTCA
ACGTTTATGACTTTGACAGATTTTCCAAACACGATCAAATCGGTCAAATAAAAGTACCATTGGGAGCTATAGATTTAGGT
CGAGTTATTGAAGAATGGAAGGAACTGGAATCTCCAGAAAACGATGGGGAAAAGGAAAACAGGTTGGGAGACATTTGTTT
CTCTTTAAGATACGTACCGACATCTGGAAAGCTTACAATAGTCATTTTGGAAGCAAAGAATCTTAAAAAAATGGATGTCG
GAGGATTGTCTGATCCATATGTTAAACTTTCCTTGATGCTTAATGGTAAACGAGTGAAGAAGAAGAAAACTACCATCAAA
AAGTATACACTAAATCCTTACTACAATGAATCATTTTCCTTTGAAGTACCATTCGAACAAATACAAAAAGTGAACTTGAT
CGTCACGGTTGTTGATTATGACAGAATCGGAACCAGCGAACCGATAGGTAGAATTGTTCTGGGATGTAACGCAACTGGAG
CAGAATTGCGACATTGGTCGGATATGTTGGCAAATCCCCGGCGACCAATCGCCCAGTGGCATACCCTCCAAGAGATGCCA
GAGAACAATTGATAGTGTTCGTTTGATGCTTTAAAGCGGTTTGCATAATTCGTGAAATAAGTTATCAAAATTTGAGAAAT
GTTTTTTTTTCTGAAACAAAAATGGCATGAGACAATATACCAGAGTTCATTAGTGTGTGGTTTCGTTGAATATTTTGGTG
GTGTTGCATCTTATCGTTTGTCCTCTAATCTAATAATGTTTTATTCTTTATATAGCTGATTTATTCTCGAGCGAAACATT
TTTTATGTGTACCAAAATACTTATGTCATAGCCATTGTGATTAGTCTGTAAACTATTGCGTAATAGCCCCTCTCATTGGC
TTTTTTTAAGAGTAGTGAGTTGGAAAAAAAAATACAAAAATGACTTCAATTGTTAAACATTACTCATATTTTATCAGTAA
GTTAACTTGCATATTTGCAGTTAATTATGGCATTTTATCTCTAAATCTCTGAAGCATGGCCTCAAGTCTTTTGTTTGTTT
TAATGTAATTATGTCTAGATGAGAATATTAAAATACTTCGGTTTATATAAAAGA
>SMED30033633 ID=SMED30033633|Name=Venom allergen 5|organism=Schmidtea mediterranea sexual|type=transcript|length=585bp
CTCATTTTAATTTCATCTTTATATTTTATTTGTTTCCAAAGTGCCCAAGGCGATCTTACAGATCGACAGAAGAAAGAAAT
GCTTGATATTCACAACAGGTTCAGAGCAGCTGTTGCTAGTGGAAGAGGAGCTCAGCAGTCCACTGCTGCAAGTATGCTGA
AAATGAAATGGAGCAATGAATCGGCATCGAAGGCGCAAAACCTAGCGGACCAATGTAAGTTTGATAACGTCACGATGGAG
GATATAAGCTACGGAACGTACAAAACCGTTGGGAATAATAGTGCTCTGATTACAGATAGTTTTCCTTTCATCAATCCGTC
TCGGATTTACCAACAGTGGTTTCCAGAAGCTTATTATTACGACATTAAAACAAATACATGCAGTTCTCCTACTTGTGAAC
ATTATACTCAAATTGTATGGGCTGATTCTCAAGAACTTGGATGTGGTATGTCCAACTGTGACACTTCCCAGGTTAAGCAA
AGTTATTTAATCTGCATTTACGGACCTGGAGGAGATGTGAAACTCAAACCTCCATATATAAGCGGACCTCCTTGCTCGCA
ATGTCCAATTGGAACATCTTGTGTC
>SMED30001027 ID=SMED30001027|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=1243bp
TAATAATTTGCACATCAAACCGTAATAATAACGGATCCGTACAATTTCATCAATATAAAATATTACACAACAAATGCGAC
TTGCATCGACAATTCATATAAAAATCTCCAACTTTCACTACTATTCATAAATTACAAATGATCTCCTCAGTTGTATTGTT
ATTTTCTATCTCAGTCGCATTCCTAGCAAATGCCGAAATCTGGGAACCAGATCGAAACCTTTCAAACGTCCATCAGAGTC
ACGCTAATACAAAGTTTTCCAGGAAAATTTCATCTTTGATGGTGGATTTCAAGTCAGAATTCGCCAAATTTAAATTACAA
TATGGAAAGGTTTACGAGTCAATTGAGAAAGAAAACGAAAGATTCAACAATTTCATATTATCTCAAGTTGAAATAAACAA
TCACAATCAAATGTTTGAAAAGGGTCACAAGAAATTCCAAATGGAAATTAATCACATGAGTGATTGGACTCCAGAAGAAT
TCAATCAACTTAATAGCCTAAAGATATCTAATCTCACCGGTTCGACATATTTGCCATTGAACATAAAGCCTGGCCTTCCA
GAGTCTTTTGATTGGAGAGACAAAGGTGCAGTTACTGAAGTCAAAAATCAGAAATATTGCGGTTCGTGCTACGCATTCTC
TACGACAGGCGCGTTAGAAGGTCAACTATTCAGAAAAACCGGAAATTTGATAAGTTTATCTGAACAACAAATTGTTGATT
GTGATCATGTTGATTATGGTTGTAGTGGTGGCTTAGTACCAGACGCTTTCAATTACATCAAATACTCCGGAGGAATTGAA
TCCGAACAAGAGTATCCATATGTATCTGGATTGACAAAGAAACCAAATCCAAATTGTAATTTCAAAGAAAAAAAAGCAGT
TGGAACAGATACCGGATTTGTGAAATTGCCTCCTGGAGATGAAGAGGCTTTGAGAGAAGCTTTAGTGACAATAGGCCCGA
TTTCGATAGCGTTTTCCGCCACTGAGCGATTCAAACATTACAAAAATGGAATTTACCATGATGATTGGTGTTCAAATGTC
CGTATCAATCATGCAGTTTTACTCGTCGGATATGGAATGGATGAAGAATCAGGAACGCCTTATTGGATAATAAAAAATAG
TTGGGGACCCAAATGGGGAGAAAACGGATATTTCCGTTTCGAAAGAAATAAAAACATGTGCAACATGGCATACAATTCAT
ACTATCCATTGGTTTGATTGAACGACTTCTTATGAGTGTGTGC
>SMED30000710 ID=SMED30000710|Name=Venom allergen 5|organism=Schmidtea mediterranea sexual|type=transcript|length=676bp
TAAAAATGTAAATCCGTTTAGTTTTTCTATTTCGATATGAATTTTTTAATTGAAGTCGCATTTGTTTTAGTTGTTCTAGA
TTTTTGTTCTGGAGGTCTTTCTGATGACGAAAGAAAAGAAGTCTTGAATTACCACAATGACTACCGATCAGCTGTGGCCC
AAGGATACGTTTCAGGGCAACCCAAAGCATCGAACATGCAAAAATTGGTATGGAATGAAGAATCCGCGTCGAAAGCGCAG
ATCACCGCGGATAAATGCATATTTGCTCACGACACAAAAGACGACCGTAAATACGGAGGTTTTGAATGGGTTGGACAGAA
TGTTGTTAAGTTCGCTGGAATAGATGTTGGCAGAGGCGTCTTTTTGTGGTATAATCAGGTTTCCGGATTCACATTTTCAA
ATAATTCCTGTTCATTAAAAACCTGCGGCCATTATACACAACTTGTATGGGCCAACTCTACTGAGCTTGGATGTGGACTT
GCGAAATGTATAATTGACGGAATTGATTTGAATTTGTTAGTTTGCAATTACGGTCCAGGAGGCAATTATGTCGGTGAGAA
ACCCTATAAATCTGGCGAGCCATGTTCTGAATGCAAATCCGGCCAATCCTGCACTGCATATGGACTTTGTTATGATTAAT
AAATATCCCGTCAATCCTGCAGTCAGGATTGACTTG
>SMED30035218 ID=SMED30035218|Name=Gelsolin|organism=Schmidtea mediterranea sexual|type=transcript|length=1573bp
TTATAACAGTCGCTTAATAAAATGATTAAAATCCTTAATTTTTAGTGAATTCAAATAACAAATTTTAAAATCTAATTAAT
AATTAAAATCTGTGACTTTGACAATCGATATGATAAAACAAAAAAAATACAACTGGAAAGACTCCAACTTATCTTTATTT
GGATCTGATACGGAAAAATTAGTCAAAAAAACTTCGTCGGAAACAGAAGCAGCATGGAAATTGGTAAAAACTGTAACTAC
ACCGAGTCTTTTTATTTGGAGAATTGAAAAATTTAAAGTTGTCAATTGGCCTAAAGAAGACTATGGGAAATTTTTCAATG
GAGATTCGTATATCATTTTAAAAATAAAAAAGGAAGAAAATAGTCCTGAATTATTTTATGATATTCATTTTTGGATTGGA
AAAAGAAGTACACAAGACGAGTATGGCACAGCTGCGTACAAAACAGTAGAACTAGATACATTTCTTGATGATAAAGCAAT
ACAGCATCGTGAAGTTCACGGTTTTGAATCTGATTTATTTAAGTCCTATTTTCCGGTTATTACAATAATGAAAGGCGGAT
GTGAAAGTGGTTTCAGACAAGTAACTCCAGAAAAATATGAACCAAGACTTTTACATTTTCACTGTGCTGATCAAAAACAT
GTTGAACTTGTAGAAGTGAAATTTTCAAAAAACTCTTTGGATTCAGGCGATGTATTTATTTTAGACAACGGACTAGAGGC
TTTTCAGTGGAATGGAAAACTATCAAATAAAAATGAGAAAGTTAAAGCAGCACAATTTTTACAGCAATTAGAATCAGAAC
GAAACGGTCGGTGCAAAACAGATGTATTAGACGAAGAAGATACTCCTTTGACGCATAAAATTTACAAATTACTACCTGAT
ACAGCTGTTACTAAGAAGGTTCACAAAGACTTGGCAATTTCCAAACGTCTGTATAGATTATCTGATGAGACAGGCAAAAT
AACGTTTTCTCTAATCTCAGAGGGCAAAACTCCAAAATCTATGCTGAAAGACAATGATGTGTTTATGATAGATAATGGGC
GACACATGTTTGTATATATTGGCGCCGGTGCGTCTCCGGATGAAAAGAAAAATGCAATGTCATATGCACATAATTACTTG
AAAGAAACTGACCATCCATTAATTGGAATTACTTGTCTCCAAGCTGGCCAGCATAGCAAAGAATTTGAGCTTCAATTGGA
CTAGAAAATGATTATGAAATTTTAAATTGCATGGCATTTCAATATTTTTAAATATTTGTGTTTTTACTTAATTTTTACAA
AATGCATGAGTTTATGGTAATTCATTTTCTTAGAAGAGTGAAGAAATATTTTTTTGTTTATGTATTTCATAAATTGCTTA
AATATAATTAAACCTAATGTATATATTGCTGTATTATTTGCTGTTACGAATATTATTGGGCTTGATAGAGCTATCAGAAC
TAACTCGCCATGCTCTTGATCATAACAAGAAATCTACGCAATCAATATATTTGTACCAAAAATCATAACCATTACAATTT
TCACCAACACAAATCAATCTAGTTTTTATTTGTTGCCAGAATCAAATTTTGGG
>SMED30016401 ID=SMED30016401|Name=Venom allergen 5|organism=Schmidtea mediterranea sexual|type=transcript|length=1445bp
TAAAATAGTAAAATAATTATGTGAGTAGGCTGCATATAAAAGCGATTTATTGTTAGTAGTTTTTAGAATTTTTAATTGGA
TTAAAAATGTCAGAATTAGAGGATTTTAATTACGAATGTTTACATTCACATAATGGCTTGCGTAAAGAACACAATGCCCC
TCCACTGAGATATAGCAAACAGTTGAGTTTGGATGCTCAAAGGTATGCTGAGCTGATAGCAGCGAAAGATGAAATGGAAC
ACAGTAAAAAGGAAGATCGTAACGATGCTGGTGAAAATCTAGCTATGAGCATGAGGCCGTTTGTAGACTATAAATATTCC
GGATTAGGAGCAAGTGCTAGCTGGTATTCAGAAATTAAGGATTATGATTTTAACAAAGAAGCCCAGCCACCAAACAATCC
AGCGACAGGACATTTTACTCAATTGATTTGGAAAGGTTCTAAAGAAGCCGGTTTTGGTCGAGCGAAAAACCCTACATCAA
ATTGTTGGTACATTGTTGGAAGATATCAACCCGCTGGAAACTTTGTTGGAAAATATTTAGAAAATGTTCCCCCGTTGCCT
AGAGGACAGAAATGGGATAAAGTGCCGATTATTGAAGAATATCTCGATGAACTGCGAACGATGGAATACACTCCAGCAAG
AAAACACATTCTAGATGATTGGAGAGCCAACTGGATGTCGGGAACAAAAGCTGGTGTTTCCTACTGTGATGTTGTTGAAA
CCTTTACAACGCCAACTGGGTCGACATATACGGGAGAAAATCATTTTTCCGAAGATCCAAGAAAATTGCCAAGACCAATT
TTTCAAAGTCAATTGGATGACAGCGTTTATGATCTTGGTGATGATCAACTGAATGGATATGCCAGTGACAAAGATTCAGA
TAAAGGAGAAAACGAAGAAATTAAAAGTTTCATTGAAGCAGTTGTATCTCAGCATAATTATTATCGAAGGAATCATAATG
TAGCAACTTTGAATTTGGACAACCAACTAAATACTTATGCTCAAGACTGGGCTGATGAATTGGCGTTAGAAAATAAAATG
TCCTTTAGTAATTATTTATTTGAAAATGTACCCTTAGGTGAAAATATTACTACGAAAAAAGGAAATGTCACAGAAGAGTC
AGCCAAAGCTCTTGTTGACAGCTGGTATAATGAAGGAAGAAATTACAATTATAGAAAAGAACCCGACAACTTCAAGAGTG
TTGGACATTTTACTCAATTGTTGTGGAAAAAGTCCAAGAAAATTGGAGTCGGAGTGGGAAAGAATTCAAAAGGAGAATCT
TTTATTGTTTGTTTTTATAGTCCCGCAGGAAATACTAAAAATGAATTTTCTCAAAATGTTTTAAAATCATGAAAATTGAA
ACAAAAATTTATGCAACAATAATTGCCTTGCTTTGATTTATTTGAATTGAAATTATGATTTTTATTAAATTGTGTATTGT
AAAAA
>SMED30022124 ID=SMED30022124|Name=Gelsolin|organism=Schmidtea mediterranea sexual|type=transcript|length=998bp
TGTACATTAGGATGAATATGGAACAGCAGCGTATAAAACCGTTGAGTTGGACACTTTACTCGACGATAAAGCCATTCAGC
ATAGAGAGGTGCAAGGAAATGAAACTGATCTTTTCAAATCTTATTTCCCAATTATGACAATTATGAAAGGCGGTTGCGAA
AGCGGTTTCCATCATGTTACCCCAGACAAATATGAACCGAGACTTTTACATTTCCGATGCACCGATCACAAGCATGTTGA
ATTGGTGGAGGTGAAACTTTCAAAGCAGGCTTTGGATTCGGAAGATGTTTTAATCTTAGACAATGGCTTAGAGGTTTTCC
AATGGAACGGAAAATTATCCAATAAAAATGAGAAATTTAAAGCCGCACAATTTTTGCAACAGTTGAAATCCGAAAGAAGC
GGACGTGTTAAGACCGATGTTTTGGATGAGGAATTCACTGCTGCCAACCATAGAATATTTAAATTGTTGCCAGATGTTCC
ATTTACAAAGAAAACTCAAAACGATTTAAATATGAGTAAAATGCTTTATCGATTGTCTGATGAAAGTGGAAAAATGACTT
TCTCCTGCATTTCTGAAGGATCAATTCCAAGGTCAATGTTAAAGGATGACGATGTCTACATGATTGACAATGGCAGACAT
TTGTTCGTGTATATTGGAGCACGGGCATCGCAGGAGGAAAAGAAGAACGCGATGTCATATGCCCACAACTACCTGAAGAC
GACTGAGCACCCACTTATCGGAATCACATGCCTCCAATCTGGTCAACATAACAAGGAATATGATCTTCAATTAGAATAGG
ATGTTAAATGATAATTTTGGAATATGTAATAAAAATTAACAAAGCAATTTTTTAAAAACAATAATTTCACAAAATAGGAA
TGAAAATCACAAAAGTATTAAAATTCCATCTATGAATTGAATATCACAATTATAAATTCTTCAACACATAAATCTTGAGC
GAAGCAATAACTTAAAGATTTCAAACATTTACCGCCGC
>SMED30003202 ID=SMED30003202|Name=Eukaryotic initiation factor 4A-like Protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1324bp
ATTAATAACAATGGAAAATCCAGGAGAAATAGAAAGTAATTACGACAAAATAGTTGAATCATTTGAAGATTTAAACTTAA
AAGAAGATTTGTTAAGAGGAATCTTTGCTTATGGTTTTGAAAAACCTTCTGCTATTCAGAAGCGTGCTATTTTGCCAGCT
ATTGAAGGTCACGATGTCATTGCCCAAGCACAATCTGGAACCGGAAAAACTGCCACTTTCAGTATTGCTGTTTTGCAGAA
TATTGACACTTCTATCAATTCTACACAAGCTATTATTCTAGCACCTACCAGAGAACTTGCAGTTCAAATCCACAAAGTTA
TAATGACCCTTGGTGACTATATGGGAGCTAAATGTTGCTCATGCATTGGTGGAAGAAATGTCCGTGACGACATTAACAAT
TTGGAAAGTGGAATGCATGTTGTTGTCGGTACTCCAGGACGAGTTAAAGATATGATAAAGAAGGGCCATATTAAATCAGA
TTTCGTGAAAATGTTTGTCCTTGATGAAGCCGATGAAATGTTGAGTCGAGGTTTTCAAAATGACGTTTGTGAATGCGTTC
AATATTTATCTGCCGAAACCCAAAATTTCATTCTTTCTGCAACAATGCCAGATGAAGTTTTAAAAGTCAGTAACGAATTC
ATGAATAATCCAGTGAAAATTCTCGTTAAAAAAGAGGAATTGACTCTGGAAGGTATTCGTCAATTCTACGTTAACGTTAG
CCAAGAAGAATACAAATTTGATACCTTATGTGATTTATATGAATCTCTGACCATCACCCAAGCTGTCATTTTCTGTAACT
TCAAAAACAAAGTTATATTTTTAAATGATAACTTGAAAAGTAAAGGATTTGTTGTTTCATCAGTCCACGGTGACATGGAG
CAACAAGCTAGAGACCAGATTATGAAAGAGTTCCGAAGTGGATCAAGTAGAATTCTCATCACCACAGATTTGCTATGCCG
AGGTATTGACGTCCAACAAGTCTCAATGGTCATTAATTATGATTTGCCTAAAAACAAAGAAAATTATATTCATCGAATTG
GCAGAGGAGGCCGATTCGGAAGGAAAGGAGTTGCACTAAATTTTGTCACAGACAAAGATATTGCTGAAATGCAGGAGCTG
GAAAATTTTTATAACACCAAGATTGAAGAGATGCCCATTAATTTATCTGAATTCTTATAAATGATTTACCGCTATTTTTG
TAAATAAATTTTAATTTACAATTAAATTAGGTTATTCATAACTTCCTTTGTTACGTAATTTTTGCTATCTTATCTATTTT
TGTTAGTAATGTATTTATGCTGCGTCACATTTTTGTTGCAAATT
>SMED30008977 ID=SMED30008977|Name=Lysosomal alpha-glucosidase|organism=Schmidtea mediterranea sexual|type=transcript|length=2946bp
ATTGTTATGCAAAATTATTTTAGCAAAAATTCCGATAGGTTTTATCTAATTAGTAATTAAGTAGATACTTCATGCTCTTG
AACTTGATTTTATTTTAAAATGGAGGTGTGTCGCTGATCTGGAAAAGTTTAATTTCAAATTATCTTTAATTAGATCATCA
CACCTATTTTAGTTGTTGTAGAGAGTCAAAGTTCAGCTTTTAATTAATATATATTCAATTAAAAATTTGCAAAAAATTAT
TTCCATTTCAAATGAAATTAATAATATTAATAAGTTTTATTAATTTGATTTCGTTATTCAACTTTTCCAACGCGACAGCA
CAATGTCAAATAGCCAATAACAATGAGAGACTTGATTGCTACCCAGAATCCGGAGCCAATCAAGATTCATGTATAGCAAG
GGGGTGTTGCTGGTCCGAACCAATGAGATTGTCCAATAAATTGCAAGGTGTTCCACTATCAATCCCATATTGCTATTATC
CAACTGATTATTCCAACTATATGATTAAATCCTTAAGAAAATCTTCAAGAGGGATCAAAGCAAAATTAGTCAGGGAATCA
CCAAGTTATTTACCCTATGAAGTTGCAATGTTAGATCTTGAGGTAATTTATGAAACAAAATCTAGAACTCGAGTCAGAAT
AACAGATCCTAAACAAAAAAGATATGAAGTTCCAATGAAACTCAGTCCTCCAGATTTGAAGCCACCGACTGATCGAGAAT
ATGAAGTCATAATCCCATCTGATGGTTCATTTTCTATTGAAATTAAACGAAAATCAGATGATCGTTCACTTTTCAAATCA
TTTGGGCCACTTTTATATTCTGATCAATTTTTACAAATATCTTCAATAATGTCAACTGATCAAATCTATGGAATAGGAGA
ACAAAATAGACCCTTTCTTCATCAATTATCCAATGGCTGGGAAAGAATTGGATTGTGGGCAAGAGACAATCCGATTGAAA
CATTTATGAATCTTTATGGAGCTCATCCATTTTATATCGGTATGCCAGACGATGGAAAAGCTTTCGGTGTTTTTCACTTT
AATAGTAATGGTCAAGAATTCGCTTTACAACCGGCACCAGCAGTAACTTATAGAACAATCGGTGGAATTTTAGATTTCTT
TATTTTTACCGGAGGCAGCCCTGAAGAAACAGTAAAACAATACCTAGAATTGGTAGGAAAGCCAATGCTTCCTCCATATT
GGTCTCTCGGATTTCATTTATCTAAATACGGCTATAAAGATATCAAAGAAATCCATGAGACCCTACAAAGAAATGTCAAC
TCCGGTATATCAGTGGATGTCCAATGGTCTGACATAGATTATATGGATGGTTACAAAGATTTTTCGGTTGATAATCAAAA
TTATCAAAACTTTGGAGAATTTGTTAAACAGATCAGAGATGCTTACAATACGCGGTACATTAGTATAATTGATCCCGCCA
TCAGTAATCAGAACACTGACAATTACTCTCCTTATACAGATGGATTGGAAATGGATATTTTCATCAAGAACCCTGACACA
AATGAACCAATAATCGGAGAAGTGTGGCCAGGAAAAACAGTTTTCCCTGATTTTACTCATCCTGATATAACAAAATATTG
GTCAAAACAGATTCGCGCCTTTCATGACATGGTACCAGTGGATGGCTTATGGATTGATATGAATGACCCTTCCAGTTTTG
TTGATGGATCAACCACTGGATGCTCCAATAATAATCGGTATGACAGACCGTTTTTTGTGCCGGAAATTCGAGACCAGTCA
TTAATAGCAAAGACAATTTGTTCATCATCCCTTCATTACAATAAAGAAAAACATTATAATTTACACAATATTTATGGCTT
TAAAGAATCTGTGGTCACTAATGATGTATTACTTCAAATTTTTCCGAAGAAAAGACCTTTTCTTTTATCCCGGTCAACTT
TCAGCGGATCTGGTAAATACGCTTTTCATTGGACGGGGGATAATCAAGCTAGTTGGGATCATTTAAGGAACTCCATTAGA
CAAGTGCTTAATTTCAACATGTTTGGTATTCCGATGACTGGTGCTGACATTTGTGGATTTAACGGTAACAGTGATGAAGA
ACTCTGTATTAGATGGATGCAATTAGGCGCTTTTTATCCATTCATGCGGAATCACAATGCAATCAACCAGAGAGATCAAG
ATCCAGCTTCATGGAATACGGAAGCCCAGAAAATAATGAAAACAGCTATTTCTAATCGTTATGCAATGTTGCCTTTATTT
TATACATTATTAGTCAAATCCCATATGAATGGTGGCACCGTAATGAGACCAATGAGCTTTGAATTCTTTTCAGATAAAGT
AACGCATTCTATAGAATTACAGTTTATGATTGGATCCTCGATTATGGCAACTCCAGTTGTTTATCCTGGGGCCAGATCTG
TAGATGCATATTTTCCAGCTGGAGTCTGGTACGATTTTCACAGTGGAAAATTGTTACATTCAGATGCTGAAGGAGCTTGG
TTGACTTTGGATGCTCCTTTGGACAAAATTAATATTGCATTACGCGGCGGTCATATAGTTCCTCTATTGGATTCCAATAG
AAATTCTAAATCAAACATACCAAATAAAATGACATTGTATTGCGGAATGGCACAAGATATGAGTGCTTCTGGAGATTTAT
ATTGGGACGATGGCGAGAGCATTGACTCCTACTCACGCAATAGATATAGCTATGTATCATTCAATGCTAGCCCTGAGCAA
CTGTTAATAACACCGGTTTACTTTGGCTACGACTTGTTGCCGGTCTTAAACAAAATCGTAATCCTTGGGTTTGAGAATAA
GTCAATTACTAAATTTCTATTAAATGACAATGATATTCCTTTCCATTATAATCCGGAGACTTCATCTGTGGTGCTCAGCA
GTTTAAATGCCAATTTAAATTCCGAAATAAAAATTCAATGGATGTGAATAATTTTTTGTATTTTAT
>SMED30014940 ID=SMED30014940|Name=Gelsolin|organism=Schmidtea mediterranea sexual|type=transcript|length=530bp
CAAATAAATTTTCGTTTCGTAATTATTTAAATTTCACATGTTTTTTATTTAACTATAAATTCTGGAAAATAAATTAATTT
TACATTCAATTAATTCAAACAATGAAATTAGATTTTAAAAGTAAATCATTTCTAGAATTTTTTGTTTTTTAAACTTTCTA
AAAAGGAAACAACTACGGAGCAGTCGAAGAAGTTCTTGTCACCGGACACAGAAAGTCTGACAAAACCGGAATGATAAAAC
AAAAAAACTACGATTGGAAAGATTCCAATTTGGCTTTGTTTGGATCAGACACGGAAAAATTAGTAAAAAAAACTTCCGCT
GAAACCGAACCAGCATGGAGAGTTGCTAAGGCAACTACGGTTCCAGGTTTATTTGTTTGGAGAATAGAAAAATTCAAAGT
CATCAGTTTACCAAAGGAAGAATTCGGAAAATTTTACAATGGAGATTCTTACATTATTTTGAAAATCAATAAAGAAGAAG
ACAGTCCGGAGTTGCTATACGATGTGCATTTTTGGATTGGAAAATATTCT
>SMED30016281 ID=SMED30016281|Name=Myosin heavy chain|organism=Schmidtea mediterranea sexual|type=transcript|length=5986bp
CTAAAATTTAGTTGATTTCGATTGTTTGAATAAAAATATCTAATGGACCCATCAGATCCTGATTTTATCTACTTGGGAGT
CGACAGGAAAGCTTTATTGAAGCAATATGGCGACTCGTTTGATAGTAAAAAGAACATGTGGATACCGGATGAAAAGGAGG
GGTACATCGCAATTACCGTTGAAGAAACAAATGGCGATAAAGTAACTGTTAAAACCGATAAAGGAGAAACTAAAGTCGTC
AAGCAAGACTCCTTGGAACAAATGAATCCCCCCAAATTCATGATGATTGAAGACATGGCGAATTTAACATTTCTCAATGA
TGCCAGTGTATTTGATAATCTGAGACAAAGATATTACAAAAATCTGATTTATACTTACTCCGGACTGTTCTGTATTGCAG
TGAATCCTTATCGAAGATTTCCGATTTATACGTCCCAAGTAATTATGAAATATAAAGGAAAACGTAGAGGAGAAATGCCA
CCGCATATTTTCTCAATTTCGGATAATGCTTACTCAAATATGCTTGTCGATCGAGAAAATCAGTCTGTTTTGATTACTGG
AGAAAGTGGTGCTGGGAAAACTGAAAACACGAAAAAAGTTATTACTTACTTCGCCAATGTAGCAGCAGCAAGTAAAAAAG
ATGATGACGATCCATCGAAGAAAAAAGGTTCATTGGAAGATCAAATTGTACAAGCCAATCCTGTACTGGAGGCATACGGA
AACGCCAAAACAACTAGAAATAATAATTCGTCAAGATTTGGAAAATTCATCCGAATTCATTTTGGCACTAGTGGAAAAAT
TGCAGGAGCTGATATTGAGTTTTATTTGTTGGAGAAATCTCGTGTTATCTCACAGCAAAAAGGAGAAAGAAATTACCATA
TTTTCTATCAATTGCTTTCGGCAGGAGGGAAAAGTTACCACGATAAACTTTTGGTTACTGCTGATCCTGCTCTGTTTTCT
TTTATCAACCAAGGAGAATTGACGATTGACGGTGTTGATGATGAGGAAGAAATGAAACTTACTGATGAAGCCTTTAGTAT
TCTTGGGTTTTCCGATGAAGAGAAAATGAGTTTGTTTAAATGCACTACTTCAATCATGAATATGGGAGAAATGAAATTTA
AACAAAGACCCCGTGAAGAACAAGCCGAGGCTGATGGTACAACAGAAGCTGAAAAAGTCTCTTTCTTACTTGGAGTGAAT
GCCAAAGATCTAATGCAAGCAATTCTTAAACCCAAAGTCAAAGTAGGAAACGAATATGTAACGAAAGGTCAAAGCAAAGA
TCAGGTTTTATATTCTCTTGGAGCCTTAGCAAAATCTTTATATAACAGAATGTTTGCTTGGTTGGTTACTCGCGTGAACA
AAACGCTGGACACAAAAGTCAAAAGACAGTTTTTCATTGGTGTCTTAGATATTGCCGGATTTGAAATATTTGATTTCAAT
GGTTTCGAACAAATTTGTATCAACTATACTAATGAGAGACTCCAACAATTTTTCAATCACCATATGTTTGTTCTTGAACA
AGAGGAATATAAAAAAGAGGCCATTGACTGGGAGTTCATAGATTTTGGAATGGATCTCCAAGCTTGCATTGAGTTGATTG
AAAAGCCTATGGGTATTTTGTCGATTTTAGAGGAAGAATGTATGTTTCCCAAAGCAAGCGATCAAACATTGAAAGCTAAA
TTGTACGATAATCACTTGGGTAAAAGTCCGAATTTCGGAAAACCAAAACCACCAAAACCAGGACAACACGAAGCCCATTT
CGAATTACATCATTATGCTGGCAGTGTTCCATATAATATTACTGGGTGGTTGGAGAAAAATAAGGATCCATTGAACGAAA
GTGTTGTTGGATTACTCGGAGCATCTAAAGAATGTCTAGTAGCTTCTTTATTTGCACCGGCTGAAGATACAGGAAAACCC
GGAACCAAGAAAAAGGGTGGATCCTTTATGACTGTGTCATATATGCACAGGGAATCATTGAATAAATTGATGAAAAATCT
AATGAGTACAAGTCCACATTTTATTCGTTGCATTGTCCCCAATGAATTCAAACAACCAGGAGTTGTTGATGCGCATTTGG
TTATGCACCAACTTCATTGCAACGGTGTATTGGAAGGTATTAGGATTTGCAGAAAAGGATTCCCAAATAGAATGATCTAT
TCTGAATTCAAACAAAGATATTCAATTTTGGCACCGAATGCCATTCCACAAGGATTTGTTGAAGGCAAACAGGTCACTGA
TAAAATCCTCACAGCCATTCAACTGGACACAAATCTTTATCGCTTAGGAAATACCAAAGTATTTTTTAAAGCTGGAACAT
TGGCTCAACTTGAAGATATAAGAGACGAGAAACTTTCGTCGTTGATATCGTTGTTTCAAGCTCAAATTAGGGGATATTTA
ATGAGACGGCAATACAAAAAACTTCAAGATCAAAGAGTTGCTCTGTCTTTGATTCAAAGAAATATTAGAAAATATTTGGT
TTTGAGAACATGGACCTGGTGGAAATTGTTCACTAAAGTAAAGCCTATGCTTAATATTGCTCGCCAAGAAGAAGAAATGA
AAAAGGCAGCCGAAGAATTAGAAAAGCTGAAAGAGGAATTTGAAAAAACTGAAAAATATAAGAAAGAACTTGAAGAACAA
AATGTTACTTTACTTCAAGCAAAGAACGATTTATTCTTGCAGTTGCAAACTGAACAAGATAGTTTAGCTGACGCTGAAGA
GAAAGTATCTAAATTAGTTCTACAAAAGGCTGACATGGAAGGAAGAATTAAAGAACTTGAGGACTCACTTTCAGAAGAAG
AAAATTCAGCTTCAACATTAGAAGAAGCAAAAAAGAAACTCAATGCTGACATCGATGAATTGAAGAAAGATGTTGAAGAT
TTGGAATCATCTTTACAAAAAGCAGAACAAGAAAAAGTTGCAAAGGATCAGCAGATTAAATCCCTCAACGACAATGTTCG
TGAAAAAGAAGAACAATTAGCCAAAATGCAAAAGGAAAAGAAAGCTGCTGATGAATTACAAAAAAAAACAGAAGAATCAT
TGAAAGCCGAAGAAGAGAAAGTCAGTAACCTCAATAAAGCTAAAGCTAAATTAGAACAAGCCCTGGATGAAATGGAAGAA
AATCTTGGTCGAGAACAAAAAATTAGAGCAGATGTTGAAAAAGCAAAACGAAAAGTTGAAGGTGAACTTAAACAGAATCA
AGAGTTATTAAATGACTTGGAGCGCATAAAATCCGAACTTGAGGAACAATTAAAACGAAAAGAAATTGAATTGAATGGTG
CTAACTCTAAAATCGAAGATGAATCTAATTTAGTTGCAACACTTCAACGGAAGATCAAAGAACTTCAAGCCAGAATCCAA
GAATTAGAAGAAGACCTTGAGGCGGAAAGACAAGCAAGGGCAAAAGCTGAGAAAGCTAAACATCAATTGGAAGCGGAACT
TGAGGAAATCAGTGAAAGACTAGAAGAACAAGGAGGTGCAACTCAAGCCCAAACAGATTTAAATAAAAAACGAGAAGCTG
AACTCATAAAATTAAAGCGAGACTTGGAAGAGGCTAATATGCAACACGAACAAGCCTTGGTGCAAATGAGAAAGAAACAA
CAAGATACTAGCAATGAATTCGCAGATCAGTTAGATCAATTGCAAAAATCAAAATCAAAGATTGAAAGAGAAAAGAGTGA
ACTTAGAGCAGACATTGAAGATTTATCAAGTCAGCTGGAATCACTGAATAAGACCAAGGGAAATCTTGAAAAGTCAAATA
AAGCATTAGAAACCACAGTTTCAGATCTTCAAAACAAACTCGATGAATTAAGCAGACAATTGACAGAAGCAGGAAACGTC
AACAATCGAAATCAACATGAAAATAGTGAAATGCACAAAACCTTAGAAGACGCCGAATCACAAATAAACCAACTCGGAAA
GGCTAAACAACAACTCCAAGCGCAGCTAGAAGAGGCTAAACAAAATTTGGAAGATGAATCACGCGCAAAAGCAAAACTTA
ATGGAGATTTAAGAAATGCGATGAGTGATTTAGATGCATTACGGGAATCATTGGAAGAAGAACAAGAAGGCAAAAGCGAT
GTTCAAAGACAGCTTGTGAAAGTCCAAAATGAATTACAGCAACTTAAAGCAAATTCTCAAGGTACTGGAGGAGTGAGAAC
AGAAGAAATGGAAGAATTCAGACGAAAGATGAATGCCAGAATCCAAGAACTAGAAGAAGAATCGGAATCAAATAAATCTA
AATGCAGTCAATTAGAAAAAATGAAATCCAGACTTCAAGGAGAAATTGAAGATTTAGTGATAGATGTTGAAAGAGCCAAT
GGATTAGCATCGCAACTGGAAAAGAAACAGAAAAATGTTGACAAATTAATAGGCGAATGGCAAAAAAAATATTCAGAAAG
TCAACAGGAACTAGAAGTATCACTGAGAGAATCAAGAACAGTTTCCGCTGAAGTTTTCAAATTGAAATCACAATTAGAAA
ATTCTCAAGATCAAATCGAAAGTTTAAGAAGAGAAAATAAAAATCTATCTGATGAAATTCATGACTTAACTGAACAATTG
GGAGAAGGAGGACGAAATGTACATGAAATTGAAAAGACTCGAAAAAGAATTGAAATTGAAAGAGATGAATTACAACATGC
ATTAGAAGAAGCTGAATCAGCTTTGGAACAAGAAGAAGCTAAAAGCCAAAGAGCTCAGTTAGAAATAAGTCAAGCCCGTC
AAGAATCTGAAAGAAGACTTGCAGAAAAAGAAGAAGAATTTGAAGGTACACGAAAAAATCATCAACGAACACTCGAATCC
ATGCAAGCATCTCTTGAAGCTGAAGTTAGAGGACGAACTGAAGCAATGAAAATGAAAAAGAAGCTGGAGCATGATATTAA
TGAGCTTGAAGTTGGGTTAGACACGGCTAATAGACTGAAATCTGAACAAGAGAAAAATGCTAAGAAATATCAGCAACAAT
TAGCAGAAATGCAAGCTCAAGTTGAAGAACAGCATCATCAACGAGAGCAAGTTAGTGAACAGCTTGCGTTAACAGAACGA
AAATTAGGTATGATGCACGGAGAGCTGGAGGAAATGAAAAATATGTGTGATCATGCTGAAAAAAATAGAAAAGTCGCTGA
ATCTGAAAAGAATGAAGCCATTGATAAACTAAATGAGTTTTCAATTCAAAATTCTTCATTCATGGCAACTAAAAGAAAGA
TGGAAGCAGATTTAGCAGCAATGCAAGCTGACTTAGAAGAATCTACAAATGCAGCTAGACAAGCTAATGAACAATTGAAA
AAGGCAATATTTGATAATACTCGACTTTTCGATGAAATTAAACAAGAACAAGAACATGCTCAACAAGCTGAAAAAGCAAG
AAAGAATTTGGAGAGCCAGTTGAAAGAATTGCAATCAAAACTTGAAGAAGCAGAAGCAAATGTACTTAAAGGAGGCAAAA
AGGCTTTGAGTAAATTAGAGCAAAGAATAAGGGAATTGGAAGGCGAACTAGATGGTGAACAAAAACGACATGTTGAAACT
CAAAAGAATGCTAGAAAGTCAGATAGGCGACTGAAAGAAATTTCGTACCAGATCGACGAGGATAAAAAGAATCAAGATCG
AATGCAACAACTTATTGAAAGTTTACAAGCAAAAATAAAGACTTATAAACGACAAGTAGAAGAAGCTGAAGAAATCGCTG
CTGTGAATTTGGCAAAATATCGCAAAATTCAACAAGAGATTGAAGATTCTGAAGAGCGAGCTGATCAAGCTGAACAAGCT
TTACAAAAATTAAGAGCAAAGAATAGAAGCTCGGTATCTGTTAGTCGAGGAGCAAGTTCTGGACCTGGAACCAAAATTTC
TATAACTGCGACATCAATCCGCAGTGAGGACTAATCTGACAGAAAAAATTCATCATTAGGAAATATGCAATTAGTTAGCC
AATATTTCCCTTAGACTAGATTTTAAACCTTTAAGACATTTTTTTCAAATTAATAAAACGTTTTGA
>SMED30031287 ID=SMED30031287|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=505bp
TTGGGCATTTTCAACGACTGAATCATTGAAAGGTCAAAACCAAAGTAAAACTGATAATTTATTCAGTTTTTCTGAGGAAC
AATTGGCTGATTGTAGTCAGGCATACGGTAATTTTTGTTGTGAGGGTGGTCTGATGGACTTTGGTTTCCAATACGTTATG
ATTAATAGAATTGAAGCTGAGGATGATTATCCATATTCCGGCATCTTGAGTTTCATAGGATAATAATTGCCGATGTAATG
GATTCAAAGCAGTCTGGGAATGTATGGAATACAATGACATCGAATCAGGACATGAACAAGATCTTGTAATTGCCATAGCG
ACAGGTGCACCAGTAAAACTATAATTCTGCGCAACTGCAAGTGTACTTGACATATGTTTAGAGACGGAGTTTATGATGAA
CCCGGATGTGCATTGGATAACCTAGACTATGGAGTATTTGCAATACGGTATGGAAATGAGTATGGCAATGACTATTGGCT
TGTCAAGAATAGTTGGAGAACACGT
>SMED30005904 ID=SMED30005904|Name=Venom allergen 5|organism=Schmidtea mediterranea sexual|type=transcript|length=2067bp
ATTGAGATCTCTCCACAAAGCTCCGCCTTTAAAATTATCGATACAACTAGCGGAAGATTCTCAAATATCTTCTGATAATA
TCGCAAGAAAAATTAAACAAGTTAAAAAGAAATCACATTATTTATTTGGGGAAAATAAAAGCTTTTCAAATTATAAACAA
TCAGGAGAGGAAATCACTTTGAAGTGGTATCGAGAGGTTGATGAATTCAAATTTAGTCAAGAAAGGCAAAATTTAGCAGC
TATTTGTCTGTCATTTAATAAATAAATAATATTTCATAATAAATTTTAGGTCATTTTGCTCAAATAGTATGGAAAGAAAC
TTCTGAAGTTGGGTTCGGGAGAAGCAAAACTGATGATGGTCAATGGATTGTGATTGCTCGCTATGTTAAACCTGGAAATA
TTGTGGGGAAATTTTTGAACAATGTTCAACATCGAATTATAGGATGGGAAAGTTATCCTATAATCTTGAAATTAAAAAGC
TATAACAACTTTCAAGCGAAAATGATTAACAGTCCAACTGGAAATGTTGTTAAAGTGGAAAGAAATGTTGACGCCAGAAC
AAATTATGATGATGATATGCTTAAAGATCCAGAAAAAAATTCAATAAATGTAACTCCACCTTTTGATAACAAAAGAATCG
ATTTCAAATTTGAGAGTAAACTAACTAATGAAAACTTTTATTCTGATAAAAATATGGAAGAAGATATAAATAAAATTAAA
AACATCAATCATAATTTCCTCAAGTCAAGTGAAGACAAAGTTTTAAACTATTTTCTACAAAACAAAAATGAAGAACAATT
AAAACAATTATCGAATGAAAAAAAATTCAATATTAGGAAAAATAATGAAGATCTTCAAACAGGAAATAGTGACACAAGCT
CGATTTATTCAAATTTAATTTTAGAAAATAGAATAGGAGATTTCAAAACCTTTCCAAATAAATCTAATAAATATTCTAAT
TCTGAACAAAATATTATTTTTAAGCAAGTAAATGGAAATGAAAGTCAACCGGAAGGCTCTACCTTGACCGAACAAATAAA
GAACTCGCAAATTAAAACAAACGAGACTTCTTTAAAAGAAAATTTTAATTTAATTTTGGAAGATGAAAATTCATCTGTTG
TTTCCTATGACAATTTTTCCAAAAACCGTAATTTAGGAATAATTTTGAAGCCTGAGCCATTTGCAAAAGCACAAAGTTAT
CAAAATGTCAATAAACAAGAAAGTCATCCAGTCCATAGATTACCACCCGATGAACCAGACTTCATGGACGATTCTAAAGC
ATATAAGAAAAACCAGCCTAACAAGATCAATCTCAAAGATGAAGAAATTATTCAACCAAAAAAAGTCGGTTCAGAATATA
CAGATTTAGATTTGATAGATGGAATTAATGATGAAGAAGAAGTTTTTAATGAAAGAAACATAGATGATTTCCGTAATAAT
ATATTGGAAATTCACAACCAATACAGAAGGCGGCACAACACAAAACCACTGAAGTCCAATCAGGAAATAAATGAATTAGC
ACAAAATTGGGCTCAATACATCGCTACAGCAAATCAAATCGGATACAGTAACCAAAAATATAAAGGACATGTAGTCGGTG
AAAATATTGTCCTTCAACTTAAAGGTTCTTTACCATCTTTCATCGACAAAATGGTTTTCAATTGGTACCAGGAAAAGGAA
AACTTCCAGTATGGAATTGAGCCAAAAAATGTCGATGATATAGGGCATTTCTCCCAAGTAGTATGGGACAAAACAAAGGA
AATTGGCATCGGAATATCAACCACGTCTCGCTATTCTGTAATTGTTTGTTTTTATTTTCCTCCTGGGAACATAAAAGGTG
AATTTGTAAAGAATATCAAACCAACAATAACTCAAAAACAAAATATTGAATAGCAAAATATCAGTTTAATTTATGTAACT
CCCTAATTCTAGTTGCTTTTAATATTTATTTCTTATTATTATAAATAATAATGCTATTTTAATTTTCCTCTATATTTATA
CAATAAAGTTGAACTGTTTTTAAAAGTCTAAGCTCTACACGATGATCTCATCCAAATAATATTATAG
>SMED30022992 ID=SMED30022992|Name=Myosin heavy chain|organism=Schmidtea mediterranea sexual|type=transcript|length=6157bp
ATATATATGCATCTCAAAATTGGAAATTAAATTATTAATTTTAATTTACTAACAAATTTTTGTTGTAAAATGGAAAATAT
TGATGCTAAAGACTTGCAATATTTACAAGTTGATAAAAGTTTAGTTTCTGACTCTGCTAATTTGTCTGATTGGGCTAACA
AAAAATTGGTTTGGATACCTGACGACAATGAAGGATTTATTTCAGGATCACTTATAGAAGAAAAAGGCGATGAAGCTACT
GTCAAACTGGAAAATGGCAAAACAATGAAATTACCAATTGAAAATGTTCAAAAAGTGAATCCACCAAAATTTTTTAAATC
TGAAGATATGGCAGATTTAACTTATTTGAATGAAGCATCAGTTCTATATAATTTAAAAGACAGATATTTTTCAGACTTAA
TATATACATATTCCGGATTATTTTGTGTCGTTGTAAATCCATACAAGCGCTTGCCTATTTATACAAATAATGTAATTGAG
TGGTACAAAGGTCGAAAACGTCACGAAAGACCGCCACATATTTACGCAGTTACTGATGTCGCATATCGAAATATGCTCCA
AGATAAAGAAAATCAATCAATTCTTTGCACTGGTGAATCCGGAGCAGGAAAAACTGAAAATACGAAAAAAGTTATTCAAT
ATTTGGCCTCAGTTGCAACTTCTTTGAAAAATCAAAAAACCACAGCCAGTAATGCATTGTCACAATTTTATGCTCACGAT
GTTAACATTGGAGAATTGGAGACCCAATTACTTCAGGCCAATCCGGTTTTAGAAGCTTTTGGAAATGCAAAGACTATCAA
AAACGATAATTCATCTCGTTTTGGTAAATTTATTCGAATCAATTTTGACACTTCTGGATTCATTTCCAGTGCAAACATAG
AAACATATTTATTGGAAAAAGCTAGAGTTATTAGACAGGCAGCTAATGAACGGTGCTTTCACGTGTTTTATCAGCTTCTT
CTTGGTGCAGACGACCGATTGAAAAAGGAATTAATCTTAGAAAATGTTTCTACATACAAACTTTTATCCAACGGCATGAT
AGCTGTACCAGATTACGATGAAAAGCAAATGTTTAAAGATACAGTCGAAGCTCTCGATATAATGGGGATTTCGAAAGACG
AACAAGAATCTATTTTCCGAGTTATAGCCGCAGTTTTACACATGGGAAATATCGAATTCAAACAAGAAAGAAGTTCGGAT
CAGGCTGCTTTACCAGACAATACAGTTGCTCAAAAGGTTGCTCATCTTCTCGGTTTACCGGTCACAGAAATGACCAAAGC
ACTGCTGAAACCAAAATTGAAAATTGGAAGAGAAGTTGTAGCAAAAGCTCAAACTAAAGAACAAGCCGAATTTTCCGTTG
AAGCTATAAGCAAATCAACATATGAAAGAATGTTTCGATGGCTGGTAATGAGAATAAATAGATCAATTGACAGAAATAGA
CAAAAAACTAATTTCATTGGCATTCTTGATATTGCTGGCTTTGAAATATTTGAAATAAACTCTTTTGAACAATTGTGTAT
AAACTATACCAACGAGAAATTGCAACAGCTTTTCAATCATACAATGTTTGTGCTAGAACAAGAAGAATACAGAAAAGAAA
ATATCAAATGGGAATTCATTGACTTTGGTCTTGATTTGCAGCCAACTATCGAACTAATTGAAAAGCCAATGGGTATTCTT
TCTTTGTTAGATGAAGAGTGCTTTTTCCCAAAAGCTACCACAAAGACATTTGTTGAAAAATTAATTAAAAACCAATCGAC
GCACCCTAAATTGAAAGCTACTGATTTTAGAGCAAAAGCAGATTTTGGGGTTATTCATTACGCGGGAAAAGTTGATTATG
TCTCCGATAATTGGCTGGTGAAAAATATGGATCCTCTTAATGAGAACGTTGTTAGTCTCTTACAAGAATCAAATGAAAGT
TTTGTCCAGACAATTTGGAAAGATGCAGAAAACATTATTGGCTTATCAACTACTACCGCCCAAGAATCTGCCTTTGGAGG
TGCAAAAACTACTCGCAAAGGAATGTTTAGAACCGTCGGTCAGCTTTACAAAGAATCATTAACGAAATTGATGGATGTTC
TGAATAATACCAATCCCAATTTTGTGAGATGTATCATTCCCAATCATGAAAAAAAATCTGGTAAAATCGATTCAAAATTG
GTTATTGATCAATTAAAATGTAATGGTGTGCTGGAGGGTATCAGAATATGCCGACAAGGATTTCCAAACCGAATTTTATT
CCAAGAGTTCAAACAACGTTATGGAATTCTTACACCAAATGTCATACTAAAAGGTTTTATGGACGGTCGAAAAGCAACAG
AATTAATGCTTGGAGAGTTGGATATTGATGCATCAAATTACAGAATTGGTCAGAGTAAAATATTTTTCAAAGCTGGAGTT
TTGGCTAGATTAGAGGAAGATCGAGATATTAAGTTGACTGAAATCATAGTCAAATTTCAATCTTATGCACGTGGATATTT
GGCAAGAAAAAATTTACAAAATCGATCGCAAAATCTCAATGCAATTAAAATTATTCAAAGAAATTGTAATGCATACTTAA
AATTGAGAAATTGGGCCTGGTGGAAATTATTCACACGTGTTAAGCCTCTATTAAGTGTTACAAGGCAAGAGGAAGTTGTG
GCTTTGAAGGAAGAAGAATTGAAAAAATCAAAAGAAACTCTCGAAAAGATGACTGCTGATTTCGAAACAACTAAGAAAAA
TTATGAATTTCTCATGGAAGAAAAAAATAAAATTCAGGAAGATTTGGAAAAGGAGCGTTTTGCATTGCAAGATATGGAAG
GGGAAAGAGAAAATTTGATCAAGCGATTAAAAGATATTGAATCAGATGCTCAAGAATGCGAGTCAAGAGAGATGGAAACA
AAAGACAAATGCAATAAATTGGAAATCGAGAAAAATAAATTACAAAATGAAATTTCACAGCTTAGCCAAAATTTAGAATC
AGAGGAACAGAACTTGCAAAAAGCTCAAGCAGACAAATTAAGTGCTGATAAACGAATTAAGGAACTGGAACAAAAAGTGG
CCGAATTAGAAGATAAACTTAACAAGTTAACTAAAGAGAAAAAGTCTCTAGAAGAGCGATTGGCTGATGTTATGTCTACT
TTGGCGGAAGAAGAAGAAAAGAGTAAACAATTAACGAAACTCAAATCCCGTCACGAAACAAGTATCACTGAATTAGAAGA
GAGATTGAGCAGAGAACAAGCAGCTCGACAAGATTTAGAAAAAACAAAGAGACGACTAGAAACTGAATTGTCTGAAAAAT
CTGATAATTTATCATCTCAAAGCCATACATATGAAGAAATTAGAATTACTCTTGAACGAGCAGAAACACAAATAATTCAA
ATGCAAGCTAAATTAGATGAAGAAACAACGGCAAAATCGTTGGCTCAGAGACAAATTCGAGACGCAGAAAACGTAATCAC
CGAAATCAAAGAAGATCTTGAAGCTGAAAAACGTTCAAAAGAGAGAGCTGAAAAAGCTAAGAGAGATTTAGCCGAAGAAA
TAGAATCTCTTAAAATGGAATTACTCGATACGGGAAATACATCAGAAGAACAGCAAAGCGTATTGCGCAAAAAAGAAGTT
GAATTACAAAATTTTAAAAAATCTTTTGAAGATGAAACAAAACGAACTGAACTTGAAATGCAAGAAATTCGTAAAAAAGC
CGCAGTAACGATTGAAAACCTCAACAATCAAATAGAAGCTGCTAACAAATCAAAACTTGTTGTTGAAAAGGCTAAATTAC
AGTTGCAAGAAGAACTTAATGATGCAAATAACGAATTAGCAAATTTAAGATCCTCCAAAGCTGACTCTGAAAAACTTAAG
AAGAACACAGAACTACAACTTTCAGAAATATCTCATCGCCTTTCAGAATCTGAAGAACACAAGCTAGATGCTGAATCAAA
ACTTAAAAAACAAACCGAGTTGGCTGACAAATTGGCTATGAATCTCGAAGAAATTGAAAGCAAATTGTCGCAATTAACTA
AATCTGAATTATCAGTTCGAAGTCAGTTAGCAGATTTACAAAAGGACTTTGAAGAAGAAACTCGATTAAAATTGAATGCT
CAAACTACATTAAGGCAGTTAGAAAGTCAATTTGCTTTATTAAAAGATCAATTAGAAGAGGAGCAACAATCAAAAGAAAA
TTTAGAAAGTCACGTACAAGCTCTACAGAGTCAAATGCAAGATGTCAAAAAGAAAGTTGAAGAAGATGCTCAACAGCTAT
TAGAATTTGATGAATCTCGTAAAAAAGTAATGCGTGAACGAGAAGAATTGCAGATTAGACTTGAAGAAGCAATCAATCAG
ACTGAAAGATCAGAAAAAGCTAAGCGAACAATTCAAGCCGAGCTTCAAGATGCATATCATGCCCTAGAAAGTCAGAAAAA
TGACCAAACTCAAAGTGATCGAAAACTTAAAAAAATGGAATCACAAGTCAATGAAACATTGAACTTGAATAAAAAATATT
TAGCTGAAAAGGATACATTAGAAAAAGAAAATCGTGAAAAAGAAACAAAAATCATGCAATTACAGAGAGAAATGAATGCA
AATGACGATAAACTTTCGGAATTGGAAAATGCAAAATCCTTACTGACTCGGCAATTGAATGAATTGGTTTCGAGCAAAGA
TGATGTTGGTAAAAATGTTGGCAGTTTAGAAAAGGCTAAAATTCAATTAGAAACCGATTTAGAGAATTGTAAAGTTACTA
TTGAAGAATTAGAAGAAGAAAATGCAACTCTTCAAATGAATAAAGAACGAGTTGAAATGCAATTAACTGCTACTAAAGCC
CAACTGGATAGGGAGCTAGCTTCCAAAGATGAAATGCACGATGAACAGTTCAGAATTATAAACAAAAAGCTTCGTGATGC
AGAAGCGGCACTTGAAGAAGAGCAGAAATCCAAAACAGCTATGGTTTCATTGAAAAAGAAAATAGAAAATGAGAACATGG
ATTTATTAAATCAATTAACAGAATCTGAGAAGGTCAAAGAAGAGCTGGCCAGACAGATTAAAAAATACCAAGGAAATTCT
AGCAATCTTCAAAGAGAAATGCAAGAACTTGTTGCTGCTAAAAATGATTATTTGAAGCAGATTAAAGAACTAGAAAAGCG
CTTACGTACTTCTGAAAGCAATGTAAACCAATTATCCGAAGACCTTTCGCAGTCTGAACGTGCTAAGAGAACCATTGCAT
CTGAAAGAGATGAAGCTTTAGAAGAAATTGCCACAATCACTATGGCTAGGGATACAGCTATTGCAGATAAAAAACGTATT
GAGAGTAGCATTTCAGCATTAAGCATGGATAATGAAGAATTGCAATTACTTTTGTCAGAATTAGAAGACAAAAATAAGAA
AATTATTTCTCAGTTAGAACAAGTTCAAAATGAATTAAATGTTGAACGACAAAATATAAGTAGATTAGAAAATCAAAAAT
CAACTGCCGAAAGACTGAATAAAGAATTGCATGATAAAATTGAAGAATTGGAAATGGAAGCTGGTAAAAAATATAAAGCT
ACAGTTGCTGCTCAACAAAGTAAAATCCAAAGTCTTGATTCTCAGCTGGACGCTAAAATTGAGGAAATAAACCAAGCTAA
TAGAAATAACAAGAAACTAGAAAGAAAGTTGAAAGAAATTATGGCTCTTATGGCTGATGAAACAAAGCGGGCTGACAATG
CAATCGAACAGATTGAAAAAGCCACTGGCAGATTTAAAAAAGCAGAGAGAAGTTTACAGATGGAACAAGAAAACAATTCT
GCTCTAAGTACACAAAATCGCCGATTACAACGAGATTTGGAAGAAGTAAATGAAACCAAAGAAGCACGGGACCAAGAAAT
TAAAATTCTTAAAACCAAAATCGACAGATTGGAAAAAAGAACACGCGCTGGGGGTCGACCTCTTAGAGGAGACGGTGGAT
CTGATGATGGGTTATCTGGAGATGGAGAATCCGTAACTGATTCTGCTTTAAAATCTGTTCAAGAAGACTAATTCAATAAG
TCCTAAAATGAACAATAAATTCTTGAATAATTAGTTAATACAAAAATTTTTGAATAATTTATATTTGGACTAACTTTTAA
TTCCTATTTGGTTTGCTCAATATATAATTGTTTTGATATATTTAATATTTCTATTTTATCAATTTGTGTACTTGGGG
>SMED30014692 ID=SMED30014692|Name=Histone H4|organism=Schmidtea mediterranea sexual|type=transcript|length=464bp
AAATCTATATAAATCTTATATGAGATAAATGTCAGGTCGAGGAAAAGGTGGAAAAGGTCTTGGTAAAGGAGGTGCTAAGA
GGCACAGAAAAGTATTGCGTGATAATATTCAAGGAATCACTAAACCTGCAATTAGACGTTTAGCAAGAAGAGGTGGCGTT
AAACGAATATCTGGGCTGATTTATGAAGAAACACGAGGTGTGCTGAAGGTTTTTCTGGAAAATATCATCCGCGATGCTGT
CACATATACGGAACACGCGAAGCGAAAAACCGTGACTGCAATGGATGTTGTTTATGCTTTGAAACGTCAAGGTCGAACTC
TTTATGGGTTCGGTGGATAATCATTTTGTATTTTATTATTTAATGTTGTAATTGCTATAATTGTTGCTAGTATTAATCTT
ATTTTAATAAATTATTTAACTGGATTTTAATTTAAATATGTCGGTTTTGTAAATCCAATTTGTA
>SMED30023593 ID=SMED30023593|Name=Netrin 1|organism=Schmidtea mediterranea sexual|type=transcript|length=1962bp
GATCTTGAAATTCTTTTTAAAATTTCTAATCTTATTCATTGGTCTTGTGGCCTTAAATGGAGAACTGCAGACCTGCTACA
GTGCCAATGGAGATCCTAAACCTTGTGAACCATTATTAATAAATTTGGCTCAGCCAATGCATATTGAAGCTAGCTCTACG
TGTGGAGAAAACGGAGCGGAAAGTATTTGTACAGAATGGTTTGACAAACTAGGAAAAGCTCATAAGTCCTGTGAGAAATG
CAATTCTTTAGATCCTAAATTATCAAAATCGTCAAAAATGGTGGTTGATTCACATATACGAGGCAAGGAGACTTGTTGGA
TTTCAGAAGGTGTTCATGAAAGTAGTTATCCAACTAGCGTTAATCTTACATTGGGTTTGAAAAAGAGGTCATTAATATCA
TTTATTACTGTGGAATTATGTGGTCACAACCCGGATGGCATTATTATTTATAAAATGGACAGTGAAACAGATGATTGGTC
TCCTTGGCAATATTTTGCTAAAGACTGTCAACTGACATTTAAGATGCCGGCTTTAACAACGGATACAGTTAATACTTTTT
CCGATATAAATTCATTGAAACCAGTTTGTTTTGATTTGGAAAAAAGTATGGACTATGGAGGAGATGAAAAACTATTCAGA
CTTATCCCATTCAATCCAAGACAAGGCAGAAGTTTTGGAGATGTATTATCTAAAAATGAACAAAACTGGTTGGCAGCTAC
AGAAATACGAATCAGTTATATTCTAACTCCTAAAGAACATTACGGAAATCTGCTGTTGAGAGAAAAGCGAAATGCAGAAA
ATCCTGTTTATCATTTTGGTTCATCTGATATAATGATTGGTGGGCAACCTTTATGTCATGGACATGCTTCGAGAATAATC
AGAACTTCGGATGATACTTATCAGTGTGAATGTCAGCACAGTACTGCTGGAAAGGATTGTGAAAAATGCCATGAAGAATT
CAATGATCAACCGTGGAGTTCAGCAACGATTCGAAACCCAGCGGTTTGTAAAAGATGCGAGTGTAACAATCATTCGATAA
AATGTGTATTCGATTTTAATGTTTTCCTGAAATCTGGTAGAATTCATGGCAGTTCTTGCATAGATTGTGGTGATAACACT
GTCGGCCCTCAGTGTGATCAATGCGCTCCCGGATATTTCCGGCAACATGCTTATCCTATTTACCATAAAAATGCTTGTAA
ACCTTGCTTATGTCATTCAGTTGGATCTCTTTCGGGTACACCCTGCGATCAAGTAAGTGGGAAATGTTTCTGTAAGCCTG
GAGTGACTGGGAAAACATGTACCCATTGTGCACCGGGTTATAAACAAACAAATTCCCTAAAGAATCCTTGCAGAAAGATA
TCAAAATTGCGTCATTTAGTGAAATCAAATTCGAGTTGCGATTTTTGTCAAAGGAAAAGTAAAAGAATTAATTTTAAGAG
ATTTTGCAGCAAGGAAACAAATTTCAAAGTAAATATCAAGAGTAGAGAATCAAGGGGTCAGTGGATTCGGTTCATTTCTG
AAATCGAACAGGTCTGGACAAGAAATCAACAAGATCCCCGAGTATCCCAACTTAATCTAGAATCTAGTGAAGGGACTTCG
ATGTGGGTTCATAAAGATCTCGTGGACTGCGGTTGCGTTGATTTTGAATTCGGTCATTCATATTTAGTCATGGCCAATGT
GAAAACAACGGAATTTATGGGCCAAACTGAACTTATTTTAAACCAAAGTGATGTAATTGAGGATTGGAAGGAGACATGGG
AGGAGCAATTTTCTCAGTTTTATACCCAGGATAAAATGGGAAAATGCAATCGGTTTACTCGACAAAAGCGACACGTCAAG
AGGCGTAATTTTGCCTCAACCTATAACCAATATGCTATCTATTCCTGATCATTTGGACCCGGGATTAATTTAATTAACAT
TTTATCTAGCAGCTGAATGTGATGTCTTATTGTATTTATAAA
>SMED30015313 ID=SMED30015313|Name=Venom allergen 5|organism=Schmidtea mediterranea sexual|type=transcript|length=614bp
GATTTACTTTACATAAGCGATTGTATCAATAAATTATCGTTTGAGATGAATTCGAAATCAGTAAATTAATCATCGTATTC
ATAGAAAGAAAATGAGAAATTCTCTATTATTTAGTATAATGTTAGGTGTCGTTATCTCAGTTATCCAGTGTTATCTGACT
CCTGACCAACAACAACAAATATTGTATGGAACGATGAAGCTGCACAACGAGCTCAAATGTCGGCTGATCGTTGCGTTTTC
CAATATGATCAATCAAGAGATCGTCGATTTGGAGGTTATAGCTGGGTTGGTCAAAATATTGCATACTGGTCAAGCAATGA
CGTGACAGACGGTATCAAGATGTGGTTCGACGAAGTCAAAGATTACACATTCAATGGAGATAAATGTAGTGGATTTACAT
GCTTGCATTACACAGCTTTAATCTGGGCAAAAACCAAGGAATTTGGATGTGGAATAGCAGATTGTTCTCGAAAGGGTTTA
GGAAATATTTACATCGTCTGTAATTATGGACCCGGTGGAAATTGGAACAACGAAGCACCATATAAAGTTGGACAAGCATG
TTCCAGATGTCCAAATGGAACCAGATGCAGCAATGGACTATGCAGTTAGAAATA
>SMED30000139 ID=SMED30000139|Name=Macrophage-expressed gene 1 protein|organism=Schmidtea mediterranea sexual|type=transcript|length=2115bp
GTTTGATAAAAGTTATAATTTTATTATTAAATAGTGAAAATGACAATTTTTATGTTGGGTCGAGTAATTTTATTCCTCTC
AATCGGATCCATTTTGGCTGTGCTGGCTGAGGAGAAAGAGCTAAATATTACTCATCCCCACAAAAATATTGCCACTTCGA
ATTTGCCATCAGCCAAATTTGTACATGGATGCCATTTGACCAACAATCAGTATCCATTCAATGTGCTTCCTGGATCTGGC
TGGGATAATTTGTCAAACCGCGAGTTGGGACAAGTTCTAAAAGTAGCCTATTCTCGTTGCAAATCATCCAATGATGGAAC
CTTTCTCATTCCGGACAAAACAAAAATTACGGCGTTTATGAAATCTAGAGTTCAAATGGATTCAGATATTGTAACACACT
TTTCCAAATATTCCTCCTTGACTTCGAAATCAGTAAATCTTGAAGTCAGTTCTGCAACTCCGAATGTTCAGATCAGCGGT
TCATTTTCTTATGAAAAGAAAGACATCAAGGACAATCAAATGAAAGAAAAATCCGCCTTTTCTCAAACTCAGTTAAGATA
TGAATTGTATCGAGTATCCTTCGAACCGGATAGTGAATTGAATGACAGATTTCGTGAAAGGATCCTTGATCTTGGAGTAC
TTATAGAGAATAAAAAGGGTTCAGCTCATGCTCACTATCTCGCTGATTTGATTGTCAGAGATTTCGGAACTCATGTTATT
AAATCTGTTGATGCTGGAGCAATTCTTTCAAAAATTGATGTCCTAAAAGGTGACTATCTTTCAAAACACGAGGGCTCTCA
ACATTCCGTGACATTAGCTGCGTCAGTTAGTATGAGAGAAACACTTGGAATTAAAATAAGTGGTAATTACAAAACCGGTC
ATTCGGAAATGGAAGAGTACAACAAAAATTGCGTAAGCACTCGAATCTCTACAATCGGTGGTGGACCTTTCGGTTCGAAT
TTCACGCTAACAAAATGGGAAAAAACTCTTTCAACAAATCTTGTGGCCATTGACCGTATTGGGGAACCGCTTAATCACAT
TATTACCAAACGTAACGTACCGGAGTTTGACGATAAAATTGTGTATGAAATCGGAAACCATATCAAGGAAGCAATAAGCC
GATATTATTCTGCTAATACTCGAACTGGATGCATGGACATTATGTCAAAGAACTTTGATGAAAATGCAAATGCCGACAGT
GGATTATGTAATAACATTGAAAATGGAAATTTCTTTGGGGGTTTATACCAAAAATGCAGTTTAGACGATGACTCTCTCTG
TGAGAATATAATACAAAAAAATGCCGCTACTGGGGATTACTCGTGTCCAAATGGGTTCACTCCAGTCAAACTATATTCAT
TCAAGTATAAATGTGAAGGTGATAACTGTCCTATTTATGAAACCTTCTGGTGTGTCTCTAACGGTAAATCGTCAAAAGGA
TATGAAATTTTTTTCGGAGGAATCTACACAACAAATATTCAGAATCCGTTTTATAGGGCTGACAGTTGTCCGCAATACTT
CTTTCCTGCTAATGTTGGAATTAACGGTAAAGTCTGCATTTCAATGGATAAAGAACTGGGATTTAAAAATAGTTTACCAT
TTGGAGGATTTTACAGCTGTTCTATGGGAAATCCATTAGCTCAAAAGAAAGGATTTAATTCAACTGTAAATGGAAGTTAT
TTTCCAAAAGCTTGTGGAAGTGGCTATTCTTCTCATTTTGCTCTCCTAGATGGTGTCTGTCAGTTGTCCTATTGTGTTAG
TACTAATGCACTGACAAAGGGATATGACCTACCGTTGTACAGACCCCCATTTATTGATATTAAAACGGAATCAGAAGTTG
TCAACATCAACGCATTGAAAACGTCGGCTGGAATAAAAATGATTCTTTCTGAAAATGGATCTTGGGAAACAATGATTCCT
GAATTCTATTCCACGTACAAATATGCAATAATAACAGTGCTATTTCTCGTGCTATTATCCTTGCTTTTCCTGATGGCAGT
TTTAGCTTGGAAGGGTTTTAGACAATTTCTTGGAAGGATTTTCACTAAAATACCTTTAGTGAATAAAAAACAATCAAACC
ATAAACCGATTCGCGTACAAATAAAGGTGACCAGA
>SMED30015696 ID=SMED30015696|Name=Macrophage-expressed gene 1 protein|organism=Schmidtea mediterranea sexual|type=transcript|length=2665bp
AGTCGCGATAGCACGCAACGTCGACATTGCGATGACGTAATCATTGTGAATCTCTACTACAATCGGATCATTCTAATCAC
GTGCATCCTAAAACAATATAAATCTTACAAACGGGAATCCAATTGAACATTTATTTACTCAAGCGTGAAACCAATGATAC
CGTGTAGACTTAATAGTATAATATTGTTTATATTTGTTTATGGAGTTCTATCGGTTTCATGTGAAATTGAACCTAACCGA
GATCAACCATCTTCAAGACGAGTTCATGAGTGTAAACTCACCAGCAACCAATATCCAGTGAATGTTCTTCCCGGATCTGG
GTGGGATAATCTTGAAAACAAAGAACTCGGTCAAGTTTTAGAAATTTCATATAAAGGATGTTTTGGATCGAATGATGGAA
GCTTTCTCATTCCAGACAATGTGGTGATCACCCCAATAAAGAAATCTATTGTCGAGTTAACTTCAGATATATTTGACCAT
TTCTCAAATGTCACCTCTACAACGGCGATGTCTATCAACGCCGATGCCAGTTACTCAACACCAAGCTACAAAATCAGTGG
ATCATTTTCATTTGAAAAAATAAGAATAAAAAACGATCAAATCAAAGAAAAGTCGTCGATTTCGAGATCCCAGTTAAGAC
ATGAATTATATGAAGTAGCGTTCCAACCACACTCAAAACTAGACGCAAAATTCAGAAACAGAATTCTAGATATTGGAGCG
TTATTGAAAGAAGGAAAAGACACAATTTATCCACAATATTTAGCGGATTTAATTGTCCGTGACTTCGGCACTCACGTCAT
TCGGTCGGTGGATGCGGGAGCGACACTAATAAAGACTGATGTTTTAAAATCGAATTATGTCAAAGGTTTTAAAGGGGATA
CAACTAAGATTGCAGCTGCGGCATCATTCAGTATGACAACAATGCTTTCAGTCAACCTCAAAGGAACCTATGTTGGTGAT
ACCACGAGTCTCAATGAATTCAATAGTAATAGTGCAAGTACAAAAGTCGAAACTTTTGGTGGTATACCGTTTGGTTCGAA
TTTTAAGTTGGAAGATTGGGAGAAAACCCTTGAAACGAATTTGGTAGCAATTGATCGCAAAGGTGAACCGTTGTCCTATG
CTATCACACCAAAAAATCTTCCAGAATTCGATGAACAAGCAGTTTTCAAAATAGCTACGCTCATCAAAGAAGCAGTCAAT
AGATATTATGCAGCCAACACGAGAGTGGGATGTATGAATATGGAGTCAGAAAATTTCAATGACGACGCAAATGTTGACGG
TGGAAACTGCGAACCTCCTAATACATTTTACAGTTTTGGAGGAACTTTTCAAACCTGCTCAGGCCCTGATTATCAGTGTA
TGGATGTCGCGGCAAAAAACCCAGTGACCAATAGTTATGCTTGTCCTGATAACTATGATACCATTGAATTACAAAGTGGA
TTGAATAAATGCATAAATTATTGCACCAAATACTTATTTTCCACTCAATGTCATTACGAGTGTTCCCAATATGCATTGTA
TTGGTGTTCTTCTACAAACAAAACGAAAATATCAGAAGGCGCACTTTTCGGGGGATTCTACACTAATACATTTCCGAATC
CACTTACAAATTCCTATAGTTGTCCACAATACTATGTAGCGACAAGATTCGGCGTAAACGCCAAGGTTTGCACTGCACTC
AATAAGGCAGAGGCTATGGAACACCATTTGCCGTTTGGAGGATTTTATAGTTGCAAAGTTGGAAATCCTCTACTAGATGA
TCCTCTCTACAACATTACACAGGATCCCAAATATTGGCCTCAAGGTTGTTCAACCGGATATTCATCACATGTAGCTATTG
TCGACAGAGCTTGTCAAATTTCCTATTGCGTTAAAAATAACGCCCTTAGCATGAGAGAGCAACCGCCTCTCTACCGACCA
CCTTTTATTGATTTGGGATTTGGACCCAATATGACAGTAATTACCTCTCTGGACACTCCAATGGGGGTCCGATTATCTGT
TGATGAAAACGGGAAATGGAGTCATAATCACCAATACAAATTATCCAATTACAATATTATAATAATATCAGTCATTATGG
CGGCAGGAGCCAGCATTGCAATTATTATTATAATTCTTGGAGTTCAAAGATTCAGCAGAAACCGAAAAGGTCAAGTCTCA
CCGGAATCTCATGAATTTGATAGCAGATATGATTCTACTAAAGATGTTGCCAATCTTGCGTTACCCGGCGAGGTTCCACC
GTTTCGTGTTATAATTGACGGAGCGAAATGATGCTTGGAACCTTTTATTATTTCTGTTGAATCTGATCTGTAAATGTTTT
CAGAATATTTTTCTAATAAAATCGTTCTGAAATTTTAAAGTGATCCTTGATGCTATTAAATGATGGACTTTATTGTACCC
CGAATTGGGTCACCCTTGTTCACGCAAATTCGTGCTTAGGATATTTGTACGGGCTTATGCAACTTTTTAAATTTTTATTT
TTCCTTATTTTTATTAGCAATCCGTTTTATTTATAACGACAAATGCTTGATGTTTGAATCAAATTTTTATTATGTTTCTT
AATGAAACATAGTGAACAATGTGCCACTAATTTCATAACCAAGGTCTAATCAAATAGTTTGGGTAGTGAAAGCAATATTA
CAGAGTTTAGGTTTGTCATTCATAT
>SMED30025482 ID=SMED30025482|Name=Histone H4|organism=Schmidtea mediterranea sexual|type=transcript|length=552bp
TGTCATTATCAAAATATTTTCAATATATAATAAATCAGAAATCACTAAACAGTCATTACTAAACTATTCTAACTCAAAAT
GTCTGGTCGAGGAAAAGGAGGAAAAGGCTTAGGTAAAGGTGGAGCTAAAAGACATAGAAAAGTTTTGCGAGACAACATCC
AAGGAATCACGAAACCAGCTATTAGAAGGTTAGCTCGCAGAGGTGGCGTGAAAAGAATTTCTGGTCTTATCTATGAAGAA
ACTAGAGGTGTTTTAAAGGTTTTCCTTGAAAACGTAATCAGAGATGCTGTTACTTACACTGAACATGCTAAGCGTAAGAC
AGTCACAGCTATGGATGTTGTTTATGCACTTAAACGACAAGGTCGTACTTTATACGGTTTTGGAGGGCCACAAATGTTGA
TTGTAGTGAATTGTTCAAATATTGTTATTCTATCTAGTAATTCTCAGCAATTTTATTAACGTTATTTAGAAATTAATTTT
ACAATTGCTAATTTCGAATGTTATATCTGGTGTCAATGTTCAGTTATATTATTTTACAAATGACTTGAAATG

 

back to top


ADDITIONAL REFERENCES:


Adler, C.E., Seidel, C.W., McKinney, S.A., and Sánchez Alvarado, A. (2014). Selective amputation of the pharynx identifies a FoxA-dependent regeneration program in planaria. Elife 3, e02238.

Martín-Durán, J.M., and Romero, R. (2011). Evolutionary implications of morphogenesis and molecular patterning of the blind gut in the planarian Schmidtea polychroa. Dev Biol 352, 164-176.

Scimone, M.L., Kravarik, K.M., Lapan, S.W., and Reddien, P.W. (2014). Neoblast specialization in regeneration of the planarian Schmidtea mediterranea. Stem Cell Reports 3, 339-352.

 

back to top



PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in embryonic pharynx. Click this link to learn more about PAGE.


PAGE Curations: 67


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
embryonic pharynxSMED30007290GATA456SMESG000039559.1 SMESG000037031.1 SMED30007290smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 2 colorimetric in situ hybridization evidence
embryonic pharynxSMED30007290GATA456SMESG000039559.1 SMESG000037031.1 JF802198.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 2 colorimetric in situ hybridization evidence
embryonic pharynxSMED30007290GATA456SMESG000039559.1 SMESG000037031.1 AFF18488.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 2 colorimetric in situ hybridization evidence
embryonic pharynxSMED30000139Macrophage-expressed gene 1 protein SMED30000139smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 3 colorimetric in situ hybridization evidence
embryonic pharynxSMED30000139Macrophage-expressed gene 1 protein SMED30000139smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 4 colorimetric in situ hybridization evidence
embryonic pharynxSMED30014940GelsolinSMESG000035418.1 SMED30014940smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 5 colorimetric in situ hybridization evidence
embryonic pharynxSMED30014940GelsolinSMESG000035418.1 SMED30014940smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 2 colorimetric in situ hybridization evidence
embryonic pharynxSMED30014940GelsolinSMESG000035418.1 SMED30014940smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 4 colorimetric in situ hybridization evidence
embryonic pharynxSMED30014940GelsolinSMESG000035418.1 SMED30014940smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 3 colorimetric in situ hybridization evidence
embryonic pharynxSMED30005748HNF4SMESG000014588.1 SMED30005748smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 2 colorimetric in situ hybridization evidence
embryonic pharynxSMED30005748HNF4SMESG000014588.1 JF802199.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 2 colorimetric in situ hybridization evidence
embryonic pharynxSMED30005748HNF4SMESG000014588.1 AFF18489.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 2 colorimetric in situ hybridization evidence
embryonic pharynxSMED30004295Elongation factor 1-alpha 1 SMED30004295smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 2 colorimetric in situ hybridization evidence
embryonic pharynxSMED30004295Elongation factor 1-alpha 1 SMED30004295smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 3 fluorescence in situ hybridization evidence
embryonic pharynxSMED30004295Elongation factor 1-alpha 1 SMED30004295smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 3 colorimetric in situ hybridization evidence
embryonic pharynxSMED30003202Eukaryotic initiation factor 4A-like Protein SMED30003202smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 2 colorimetric in situ hybridization evidence
embryonic pharynxSMED30003202Eukaryotic initiation factor 4A-like Protein SMED30003202smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 3 colorimetric in situ hybridization evidence
embryonic pharynxSMED30003202Eukaryotic initiation factor 4A-like Protein SMED30003202smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 3 fluorescence in situ hybridization evidence
embryonic pharynxSMED30015313Venom allergen 5SMESG000047165.1 SMED30015313smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 3 colorimetric in situ hybridization evidence
embryonic pharynxSMED30015313Venom allergen 5SMESG000047165.1 SMED30015313smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 4 colorimetric in situ hybridization evidence
embryonic pharynxSMED30015313Venom allergen 5SMESG000047165.1 SMED30015313smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
embryonic pharynxSMED30015313Venom allergen 5SMESG000047165.1 SMED30015313smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 5 colorimetric in situ hybridization evidence
embryonic pharynxSMED30015696Macrophage-expressed gene 1 proteinSMESG000067839.1 SMED30015696smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 4 colorimetric in situ hybridization evidence
embryonic pharynxSMED30015696Macrophage-expressed gene 1 proteinSMESG000067839.1 SMED30015696smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 3 colorimetric in situ hybridization evidence
embryonic pharynxSMED30015696Macrophage-expressed gene 1 proteinSMESG000067839.1 SMED30015696smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 2 colorimetric in situ hybridization evidence
embryonic pharynxSMED30018602ATP dependent RNA helicase DDX5SMESG000033916.1 SMESG000033908.1 SMESG000033907.1 SMED30018602smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 2 colorimetric in situ hybridization evidence
embryonic pharynxSMED30018602ATP dependent RNA helicase DDX5SMESG000033916.1 SMESG000033908.1 SMESG000033907.1 SMED30018602smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 3 colorimetric in situ hybridization evidence
embryonic pharynxSMED30027428forkhead box A-1SMESG000065670.1 SMED30027428smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 4 colorimetric in situ hybridization evidence
embryonic pharynxSMED30027428forkhead box A-1SMESG000065670.1 SMED30027428smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 3 colorimetric in situ hybridization evidence
embryonic pharynxSMED30027428forkhead box A-1SMESG000065670.1 SMED30027428smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 5 colorimetric in situ hybridization evidence
embryonic pharynxSMED30027428forkhead box A-1SMESG000065670.1 JX010556.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 3 colorimetric in situ hybridization evidence
embryonic pharynxSMED30027428forkhead box A-1SMESG000065670.1 JX010556.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 4 colorimetric in situ hybridization evidence
embryonic pharynxSMED30027428forkhead box A-1SMESG000065670.1 JX010556.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 5 colorimetric in situ hybridization evidence
embryonic pharynxSMED30027646Transcription factor BTF3SMESG000008919.1 SMED30027646smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 3 colorimetric in situ hybridization evidence
embryonic pharynxSMED30027646Transcription factor BTF3SMESG000008919.1 SMED30027646smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 2 colorimetric in situ hybridization evidence
embryonic pharynxSMED30025427Translationally controlled tumor proteinSMESG000013566.1 SMED30025427smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 2 colorimetric in situ hybridization evidence
embryonic pharynxSMED30025427Translationally controlled tumor proteinSMESG000013566.1 SMED30025427smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 3 colorimetric in situ hybridization evidence
embryonic pharynxSMED30023593Netrin 1 SMED30023593smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 3 colorimetric in situ hybridization evidence
embryonic pharynxSMED30023593Netrin 1 SMED30023593smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
embryonic pharynxSMED30023593Netrin 1 SMED30023593smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 5 colorimetric in situ hybridization evidence
embryonic pharynxSMED30023593Netrin 1 SMED30023593smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 2 colorimetric in situ hybridization evidence
embryonic pharynxSMED30023593Netrin 1 SMED30023593smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 4 colorimetric in situ hybridization evidence
embryonic pharynxSMED30023322Cathepsin L SMED30023322smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 3 colorimetric in situ hybridization evidence
embryonic pharynxSMED30023322Cathepsin L SMED30023322smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 4 colorimetric in situ hybridization evidence
embryonic pharynxSMED30023322Cathepsin L SMED30023322smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 2 colorimetric in situ hybridization evidence
embryonic pharynxSMED30014981Gelsolin-like proteinSMESG000015924.1 gelsolin-likesmed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 4 colorimetric in situ hybridization evidence
embryonic pharynxSMED30014981Gelsolin-like proteinSMESG000015924.1 gelsolin-likesmed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 2 colorimetric in situ hybridization evidence
embryonic pharynxSMED30014981Gelsolin-like proteinSMESG000015924.1 gelsolin-likesmed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 3 colorimetric in situ hybridization evidence
embryonic pharynxSMED30014981Gelsolin-like proteinSMESG000015924.1 gelsolin-likesmed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 5 colorimetric in situ hybridization evidence
embryonic pharynxSMED30035691Macrophage-expressed gene 1 proteinSMESG000067839.1 SMED30015696smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 4 colorimetric in situ hybridization evidence
embryonic pharynxSMED30035691Macrophage-expressed gene 1 proteinSMESG000067839.1 SMED30015696smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 3 colorimetric in situ hybridization evidence
embryonic pharynxSMED30035691Macrophage-expressed gene 1 proteinSMESG000067839.1 SMED30015696smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 2 colorimetric in situ hybridization evidence
embryonic pharynxSMED30028442Lysosomal alpha-glucosidase SMED30028442smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
embryonic pharynxSMED30028442Lysosomal alpha-glucosidase SMED30028442smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 2 colorimetric in situ hybridization evidence
embryonic pharynxSMED30028442Lysosomal alpha-glucosidase SMED30028442smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 4 colorimetric in situ hybridization evidence
embryonic pharynxSMED30028442Lysosomal alpha-glucosidase SMED30028442smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 3 colorimetric in situ hybridization evidence
embryonic pharynxSMED30028442Lysosomal alpha-glucosidase SMED30028442smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
embryonic pharynxSMED30028442Lysosomal alpha-glucosidase SMED30028442smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 5 colorimetric in situ hybridization evidence
embryonic pharynxSMED30025623SMED30025623SMESG000065670.1 SMED30027428smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 4 colorimetric in situ hybridization evidence
embryonic pharynxSMED30025623SMED30025623SMESG000065670.1 SMED30027428smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 3 colorimetric in situ hybridization evidence
embryonic pharynxSMED30025623SMED30025623SMESG000065670.1 SMED30027428smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 5 colorimetric in situ hybridization evidence
embryonic pharynxSMED30034696Macrophage-expressed gene 1 protein SMED30034696smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 4 colorimetric in situ hybridization evidence
embryonic pharynxSMED30034696Macrophage-expressed gene 1 protein SMED30034696smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 3 colorimetric in situ hybridization evidence
embryonic pharynxSMED30021818SCP domain-containing proteinSMESG000047165.1 SMED30015313smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 3 colorimetric in situ hybridization evidence
embryonic pharynxSMED30021818SCP domain-containing proteinSMESG000047165.1 SMED30015313smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 4 colorimetric in situ hybridization evidence
embryonic pharynxSMED30021818SCP domain-containing proteinSMESG000047165.1 SMED30015313smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
embryonic pharynxSMED30021818SCP domain-containing proteinSMESG000047165.1 SMED30015313smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 5 colorimetric in situ hybridization evidence
Note: Hover over icons to view figure legend

 

 

back to top