Category 5 cell

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ In Situ Hybridization Data

  ▻ Sequences

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  Category 5 cell


DEFINITON:

  Post-mitotic, ciliated epidermal cells.


TERM DEFINITION CITATIONS:

  PMID:25017721


TERM CITATIONS:

Expand publication list

TERM ID:

  PLANA:0000022


ABOUT THIS TERM:

Category 5 cell

  ↳is a ciliated epithelial cell, epidermal cell and material entity

  ↳contained in tail, copulatory region, ventral region of the whole animal, posterior region of the whole animal, parapharyngeal region, prepharyngeal region, head, dorsal region of the whole animal and anterior region of the whole animal

  ↳develops from Category 4 cell

  ↳existence overlaps Stage 6, juvenile, asexual adult, adult hermaphrodite, Stage 8 and Stage 7

  ↳existence starts during or after Stage 6

  ↳part of dorsal region of the epidermis and ventral epidermis


BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30024865Intermediate filament proteinvim-3Stage 5, Stage 6, Stage 7, Stage 8integumental system, Category 5 cell
SMED30030007RootletinH.2.8b, croccStage 5, Stage 6, Stage 7, Stage 8protonephridia, renal system, integumental system, Category 5 cell, proximal tubule
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30002072 ID=SMED30002072|Name=Intermediate filament protein|organism=Schmidtea mediterranea sexual|type=transcript|length=2324bp
CATAAATGGTGCACTTTTGAGAAATTTGCGTTGGAGTAAATAGAAAGCAGTCTTAACAAAAGGATAACTAGGTCAGAACA
ATAGCTGCGTTGAAAAATCTATTATAAATATATCCAACTTTCAACTTGTTTCTCTAAAGTTATTTTTGTAATAATGGAAT
CGTCTAAAAGAACTGTCATTACGACTTCTAAACAAGAAGGGCCGATTAGTGGCTCAAGTTCGGTTACTAGATCTGGAGTC
TCAATGACATCAGGTTCTGGTTCTACTTACGGATCGGGATCTGGAGGAGAATTGGGCTCAGGTTCAGGATCCGGCTCTGG
AAGTCGATATCAAAGTTCGTCTCGTGTTACTACAACAACTAGATCTGACTATCCACAATCTGGAAATGAAAGAGAAGACT
ATAATGAATCAGGAAGTCAACAATTCAATGAAGATGGATCAGAGATTTCTGGTCGAATCGTTTCAACTACCAGATCCATG
TATAAGCCAATAAGTCAATCAAGGAATAATTTCAAAGACTTGCAAAGAAATGCTGCATCTTTAAGTTATAGTATGCAGTC
TGGAAACCAACAAAGTGGTTCAGTTATGCCACTCATCAGAGGTGATAGTGTAGCCTTACAGACTGGACTGAATTCGATAA
AGAAAGGAAGAGCTCAAGAAAAAAAAGACTTACAAGAGCTGAATGAAAGATTTGCGAGTTATATAGAAAAAGCACGATTT
TTGGAAGAGCAAAATAAGCAATTAGTCGGTGAAATTGAAGAACTCAAAGGGGGAACTATTCAAGATACATCAAAAGTTAA
AGAGATCTATGAAGTTGAAATCAATCAACTCCGATCTTTACTAAACGAATCAGAGAAAAGTAGAGCACCACTGGAAATTC
AAGTGAATTCCTTGGAATACGAAATAGGCGATTTGCAAAAAAGACTGCTGCTATTAGAGGATATAGGTACACAGTATAGA
GCAACGATTGATAAACAGCGTCGAGAACTCGAGACCTTCGAAGGGGAAATGGTTGAATTGAAAAGGTTTAAAGACACTCG
AAGTATCGATGCTACAAAAGAAAAGGATGAAACAAGCAACTTAAGAGATGAAATAAAAAAATTAAGACAAAACTATGAAA
AAGAAGCATTAGCGCATATCACCCTTGAACATGACTTGCAGAGTTTGAGAGAAACTATGGAGTTCGAGAAACAAATCCAT
GCTACAGAAGTAAAAGAGCTGGCAACCGTTGCATATCAAAACCCAACGAAAGAAAACATGGTTTACTGGCAAAGTGAAAT
GGGACGTGCTTTACGGGACATTCAAACTGAATATGAAAACAAGCTTACAGGAATCAAACAAGAATTGGAGGCTTCTTATG
GTTTACAAATGCAGGAAATACGAACAAGTAAAACCAGAGACAATGTGGAAACGACCCATTACAAAGAAGAGAACAGCCGA
ATAAAATCTCAAATCCAAAGCATGAGATCGAGAATCGCTGATCTTGAGATGCAGAATGCTGAATACGAACACAACTTGAA
TAATATTCGTGCTAATTACGAAGAAACTCAAAGAAGTCTTGAATTGCAGTTGTTGTATTTGCAAGAGCAATTGACAGGAA
CTCAACAAGAATTGACAGTCGCTTTGACCGAACTCCAAAGCTTATTGGACGCGAAGTTGGGACTGGAATTAGAAATCGCA
GCCTATGCAAAACTATTAGAATTCGAAGAGAGTCGTGTCAATTTCTCTGGTGATGGCAACGCTACTTTATCTCAATTTAT
GAGTTTCACATCAAGTAGCGGAGCTGGAGGTGCTGGAGGGGCTGGAGGTGCTGGTGGTGCTGGAGGAGGAGGAGGAGGAA
GCAGTGGGTTCGGATCAGGAAGTAGAATTGGAGGGTCAAGTGGTTTCAGCGGAATGACAGAAAGAGAAACAACTGACTAT
CAGTCAAAACGAATGAAATTTAGACGAACGACAAAGGGAAACATTTCCATTGCAGAGACTGACCTTATAGGTTCAACAAT
TATTCTGGAAAATATTGGGACCAAAGTGGAATCACTCGAAGGTATGACTATTAAAAGAGTAGTCGACGGCAGCGAAAATA
AAATCTCATTTACCATTTCCGGAAAAGTTAACTTAAATGCTGGTGAAAAGATTTCTCTTTGTGCCAAAGGGAAAATAACC
GGCAAAGGACGAGAAATCGAAATTGATGATGCTTCATGGGGGGTTGGTAACAATGTCGTAACAACACTTTGTGATTCAGA
AGGAGCGGAAAAGGCAGCTCACTATCAAGAGGTTTCGGCCTAGAAACCTTGCTAAATATTAAACTGAATTTGTATGAACA
TAAC
>SMED30014019 ID=SMED30014019|Name=Intermediate filament protein|organism=Schmidtea mediterranea sexual|type=transcript|length=768bp
AATTAGAAATCGCAGCCTATGCAAGGTTATTAGAAATTGAGGAAGAGCGAGTTTTAAGTTCCGCTGATCAACGTTCTGTG
ATGTCTCAATTTATGAGTTTTTCAGCTGGTGGTGGAGCTGGAGGTTCTAGTGGAGTTGGAGGATCAGGAGTTGGAGGATC
AGGATTTGGAGGATCTAGCTTTGGAGTGTCAGGCACCGGACGATCAGGCTTTGGAGTGTCAGGTACCGGAGGATCTATGG
GAGGAAGTAGATTTAGTGGAAGTCTAGGACTTGGGGGCGGGATTCATTCAAAAAAGATGTCTTCAAGAAGAACGACAACG
GGAAACATTTCTATTGCCGAAAGTGATGAATCTGGGTTATTTATTGTTTTAGAAAATATGGGAAGTCAGACTCAAAGTCT
ATCTGGCATGATGATTAAAAGAAACATAGATGGCGTAGCAAACTTTGTGACCTACTCAATTCCGAAGAAGATCGATCTAT
CCGCTGGTGAAAGAATAACAATTTGTGGACATGGAAAGAAAACAGGTAAAGGAAAAGAACTAGAAATAGAAGAAGATTCT
TGGGGATTTGGAGAAAACGTCATTACTGCGTTATGTGATGCGAATGGCGAGGAAAAAGCGGCTCTTTATCAAGAAATAGT
GGCTTAAATGGCATAGCCGAAAGACTTGCAAATTTAACCTTTTATTTAATGATTTCATTTAATGTTCCTCGCGTTCATTA
TTTGTTTGCTTCTTTCTAGATTAAAGTTTTAAATTTGTTGAAAAAAAA
>SMED30024865 ID=SMED30024865|Name=Intermediate filament protein|organism=Schmidtea mediterranea sexual|type=transcript|length=2214bp
GATCTTATAAATACAACATTAATTGTATAGTGAACTATGTTAGCCATTGAAATGGAGACAAGTAAAAAAATCGCAGTCAA
AACTACGAAACAAGAAGTAAGTGGAAGTGGAAGCTCTGGTGGACTAAATGAACAACAAGCTTTTGGAAGTGGTAGCTTTC
GAACCGGGTCTGGAGGTGTACAGATAAGTGCTAGTGGAGCAATTGGATCTAGCAGTTCAGGCGGAGTTAGTGGCACTGGC
GGAGTTGGTAGCATTGGTGGAGGCAGTGGTGCTGGTGGTGAAGGAACAGGAGCTAGCACAGTTATCACTACAAGCAGATC
TTATTATAAGCCTATCAGTCAACCTAGAAATAATTTAAAAGACTTACAAAAAACTTCTGGTATGAGTTACAGTGCACAAT
CAAACTCCCAGCAAGGTTTAAGTAATATTCCATTGATTAGGGGAGACAGTGTTGCTCTACAATCTGGAGTAACTTCAATG
AAAAAAGGACGAGCTCAAGAGAAAAGAGATCTTCAGGATCTGAATGAAAGATTCGCTAGTTACATTGAAAAAGCTCGATT
TCTAGAGGCGCAAAATAAACAGCTAGCCAATGAGATTGAAAAGTTAAAAGGTGGAACCGTCCAGGACAACTCAAAGATCA
AAGAAATCTATGAAGTCGAAATCAATCAACTTCGAGCTTTGGTAAATGAATCGGAAAAAAGCAAAGCTCCTTTAGAAGCT
CAAGTTGATTCTCTTGAATACGAAATTGATGATTTGAGAAAACGATTAATGATGCTGGAAGACATCAACTCTCAGTACAA
ATCCACCATCGATAAGCAACGCAAAGACATTTCTGGATTTGAAGGGGAATTGGTGGAGCTAAGAAGATTCAAAGGCACCC
AAGGTGCTGATGTAAATAAAGAAAAGGAAGAAGTAAAAACACTAAGAGACGATTTGAAAAAATTGAGACAAGATTATGAG
AAAGAAGCTCTAGCTCATCTCACCCTTGAACATGAATTACAAAGCTTGAAAGAAGCATTAGAATTCGAGAAACAAATACA
TGACACAGAAGTAAAAGAGCTGGCAACCGTTGCATATCGAGACCCAACGAAAGAAAATATGGTTTACTGGCAAAGCGAAA
TGGGACGCGCGTTACGAGACATTCAAACTGAATATGAAAACAAGCTTACAGGAATCAAACAAGAATTGGAGGCTTCTTAT
GGTTTACAAATGCAGGAAATACGAACAAGTAAAACCAGAGACAATGTGGAAACGACCCATTACAAAGAAGAGAACAGCCG
AATAAAATCTCAAATCCAAAGCATGAGATCGAGAATCGCTGATCTTGAGATGCAGAATGCTGAATACGAACACAACTTGA
ATAATATTCGTGCTAATTACGAAGAAACTCAAAGAAGTCTTGAATTGCAGTTGTTGTATTTGCAAGAGCAATTGACAGGA
ACTCAACAAGAATTGACAGTCGCTTTGACCGAACTCCAAAGCTTATTGGACGCGAAGTTGGGACTGGAATTAGAAATCGC
AGCCTATGCAAAACTATTAGAATTCGAAGAGAGTCGTGTCAATTTCTCTGGTGATGGCAACGCTACTTTATCTCAATTTA
TGAGTTTCACATCAAGTAGCGGAGCTGGAGGTGCTGGAGGGGCTGGAGGTGCTGGTGGTGCTGGAGGAGGAGGAGGAGGA
AGCAGTGGGTTCGGATCAGGAAGTAGAATTGGAGGGTCAAGTGGTTTCAGCGGAATGACAGAAAGAGAAACAACTGACTA
TCAGTCAAAACGAATGAAATTTAGACGAACGACAAAGGGAAACATTTCCATTGCAGAGACTGACCTTATAGGTTCAACAA
TTATTCTGGAAAATATTGGGACCAAAGTGGAATCACTCGAAGGTATGACTATTAAAAGAGTAGTCGACGGCAGCGAAAAT
AAAATCTCATTTACCATTTCCGGAAAAGTTAACTTAAATGCTGGTGAAAAGATTTCTCTTTGTGCCAAAGGGAAAATAAC
CGGCAAAGGACGAGAAATCGAAATTGATGATGCTTCATGGGGGGTTGGTAACAATGTCGTAACAACACTTTGTGATTCAG
AAGGAGCGGAAAAGGCAGCTCACTATCAAGAGGTTTCGGCCTAGAAACCTTGCTAAATATTAAACTGAATTTGTATGAAC
ATAACAAAATTTTTAGTAATTTAATAAAAGTTTATTATTTTATAAATCCAAAAA
>SMED30026612 ID=SMED30026612|Name=Intermediate filament protein|organism=Schmidtea mediterranea sexual|type=transcript|length=2359bp
TCTTATAAATACAACATTAATTGTATAGTGAACTATGTTAGCCATTGAAATGGAGACAAGTAAAAAAATCGCAGTCAAAA
CTACGAAACAAGAAGTAAGTGGAAGTGGAAGCTCTGGTGGACTAAATGAACAACAAGCTTTTGGAAGTGGTAGCTTTCGA
ACCGGGTCTGGAGGTGTACAGATAAGTGCTAGTGGAGCAATTGGATCTAGCAGTTCAGGCGGAGTTAGTGGCACTGGCGG
AGTTGGTAGCATTGGTGGAGGCAGTGGTGCTGGTGGTGAAGGAACAGGAGCTAGCACAGTTATCACTACAAGCAGATCTT
ATTATAAGCCTATTAGTCAACCTAGAAATAATTTAAAAGACTTACAAAAAACTTCTGGTATGAGTTACAGTGCACAATCA
AACTCCCAGCAAGGTTCAAGTAATATTCCATTGATTAGGGGAGACAGTGTTGCTCTACAATCTGGAGTAACTTCAATGAA
AAAAGGACGAGCTCAAGAGAAAAGAGATCTTCAGGATCTGAATGAAAGATTCGCTAGTTACATTGAAAAAGCTCGATTTC
TAGAAGCGCAAAATAAACAATTGGTCAATGAAATTGAAAAGTTAAAAGGTGGAACCGTCCAGGACAACTCAAAGATCAAA
GAAATCTATGAAGTCGAAATCAATCAACTTCGAACTTTGTTAAGTGATTCTGAAAAAAGCAGAGCACCCTTAGAAGTACA
AGTTGATTCTCTTGAATACGAAATTGATGATTTGAGAAAACGATTAATGATGCTGGAAGACATAAACTCTCAGTACAAAT
CCACCATCGATAAGCAACGCAAAGACATTTCTGGATTTGAAGGGGAATTGGTGGAGCTCAGAAGATTCAAAGGCACCCAA
GGTGCTGATGTAAATAAAGAAAAGGAAGAAGTAAAAACACTAAGAGACGATTTGAAAAAATTGAGACAAGATTATGAGAA
AGAAGCTCTAGCTCATCTCACCCTTGAACATGAATTACAAAGCTTGAAAGAAGCATTAGAATTCGAGAAACAAATACATG
ACACAGAAGTAAAAGAGCTGGCAACCGTTGCATATCGAGACCCAACGAAAGAAAACATGGTTTACTGGCAAAGCGAAATG
GGACGCGCGTTACGAGACATTCAAAATGAATATGAAAACAAGCTTACAGGAATCAAACAAGAATTGGATTCGTCATATGG
CTCACAACTGCAGGAAATACAAACAAGCAAGACCAGGGATAATGTGGAAACGACCCATTACAAAGAAGAGAACAGCCGGG
TAAAATCTCAAATCCAAAGCATGAGATCGAGAATCGCTGATCTTGAGATGCAGAATGCTGAATACGAACACAACTTGAAT
AATATTCGTGCTAATTACGAAGAAACTCAAAGAAGTCTTGAATTGCAGTTGTTGAATTTGCAAGAGCAATTGACAGGAAC
TCAACAGGACTTGACTATTACTTTGACCGAACTCCAAAGCCTATTGGACGCCAAATTGGGACTGGAATTAGAAATCGCTG
CATACTCAAAGTTGTTAGAATTCGAAGAGAATCGTGTTAATTTTTCATCAGATGGTAACACATCACAATTTATCAGTTTT
TCATCTGGCGTGGGAGCTGGTGGTGTAGGAGGAGGATCAAGTGGAGGGTCAGGTAGAGGATCAGGTGGAGGGTCAGGTGG
TGGGTCAGGTGGTGGATCAGGTGGAGGATCAGGTGGGGGATTTGGAGGTGGAGCAGGATTAGGATCAGGCGGAGGAGGAG
GATCAGGAAGTGGGTCTGGTGGAGGCGCAGGTGGGGCTGGTTCTAGTATTGGAATTGGAGGTGGGGGCAATTTTGTAGGT
GGTTCTCTGAGATTTAACATTAATGAATTGAGCAGTACAGAGGCTGAAGAATACCAATTGAAAAGAATGAAGTTCAGACG
AACAACTAAAGGAAACATATCAATAGCAGAAGCTGACATCAATGGACTGTTTATAGTTCTAGAGAATAACGGAACAAAAT
TTGAATCTTTAACTGGAATGACGATTAAGAGAAATATTGATGGGAATGAGGATGCGGTTTCATTCACCATTCAAAACCGA
ACAAGTTTGAGTTCTGGAGAAAAACTAACTATCTGGGCCAAAGGAAAGAAAACTGGCAAAGGAAAAGAACTTGAAATAGA
AGAAGACGGCTGGGGGCTGGGGGATACTATTGTGACCTCTTTATACAATGCGGAAGGAGAAGAGAAAGCGGTCCATTATC
AAGAAATACAGGGTTGAGCAGGTGCTCACTTAAGACTGACTTGAAATTTATTTGTTTAAATAATACTTTCAATAGGGATT
TTAATGCTAATAAAAAGTATTTAAACTATTAAAAAAAAA
>SMED30028789 ID=SMED30028789|Name=Intermediate filament protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1877bp
CTGAAAGATGGCAAGTAGAACTTCTGCAAGGTCCACAGTTACCATTAACAAATCGAGTCCTGCAGTAAAGGAATATGAAA
TGAGACAATCCTACAATTTTTCTGGAGCACCTATGGGGGGATCAGTTCAAATTCATAGCAATGTGTCTTCTGCTGTAGAA
GGCCGAGAAAGAGAAAAGAGAGAAATGCAAGATCTTAATGAAAGGCTAGCTAATTATATTGAAAAGGTAAGATTTCTAGA
AGCTCAAAACAAAAGATTAACAAATGAATTGAATACGTTACGTGAAAGATGGGGTAAAGAAGCTGAAAGGATACGAGCTT
TATATGAGATTGAAATGGATCAATTGAAAAAGTTATTAGACGAAGCTGAAGCTGCTAGATCAGAATTATTACCCAAAATT
AATAAACTTGAGGAGCAACTTCATGAATATTTACAAGGCATTGACGAAGCAAACAATCAGCATGGTATGGATCAAGAAAT
GATAGAGAAACTGAATCGACAATTGTCAGAATGCGAAGGAGAAATTGGTCTTCTTCGCCGAAGAATTGCAGCTTTAGAAG
AAGAACGAGGTCGTTCAAAGAAAACAATTAGTAGACTTAGAGATGAAATTAAACGTACAAGAATGGATCTCGATCAAGAA
ACAATGAATCATATTGCGTCCGAGAGCGAAGTGCAGTCGCGCAAAGATGAAATCGACTTTATGAAGGATTCCCATGATAA
TGAAATGAAAGAACTTGCCGCTTTAGCTTATCGTGACTCGACAGCTGAAAATAGAGATTTCTGGCGCAGTGAGATGGGCA
GTTCTCTTAGAGAACTTCAAATTGAATATGACAGAAAATTGGAAGCAATGAGAGGTGACTTAGAAAACCACCACAATGTC
AAAGTTCAAGAATTGCGACATTCATCTCCACGAGAAGGAGTCGAAAGTATTCACTTAAAAGAAGAAAATATCAGATTAAA
AAACCAATTGTCAAATCTTCGGTCAAAATGTCCGGAAATGGAGGCAAAGAATGCTCAATTAGAAAGATTTCTTGAAGAAT
TACGAAGAGAATTGGATCGTCAGATAAATGATTTTGAAAGTGAAAGAGATAAGTTGAGATCTGATTTACAACGAACCCAA
GATGAGTTAGATTCGATAATGAAAGAATTCCAAAACGTCATGGACATGAAATTGAGTTTGGAACTGGAAATTGCAGCATA
CCGAAAACTGCTCGAAGGTGAAGAATCGAGATCTGGCTTAAGAAATATGATGGAACAAACCATTTTCAAAACATCTGGAG
GAATTGAAGGAAATATTATATCAAAAACTGCAGGCAAAACACAAATGTCAAATTTGATGAAAAACGAAAGAAACGCAAAA
GTAAATCATCAAAGAACCGCCAAAGGAAATGTAATTATCCATGAAACATCTGCTGATGGAAAATTTATCATCTTGGAAAA
TACAGGAAAAAAAGATGAAGACATTAGTGGATTTAAAATCATTCGAAACATAGACAATGATCGCTCAATCATTCGGTACG
AAATACCGAACTCTACAATTTTAAAACCGGAAGGTCAACAAAAATTTCTAAAAATTTGGAGTAAAGGAAATCGACCAACT
GGATCCAATGATCTGGAATGCTCCAGTGCTAACTGGGGAACTGGAACACATATTTTTACAGCTTTGCTTAACAAATCCAA
TGAAGAAAGAGCAACTCATACTCAAAAGACCACATTTACAAATTAGCCACAATCGAAATGAAGTTTTGTGACAAAACATT
TAGAATAACTTTATAACTTATTAAGGAGATTATTTTGTTTTCTTGAAATTATATATTTATAATTCTTTTATATTTATTAT
TTCCTTGATAATAGGATTAATAAATACATATATTATC
>SMED30030007 ID=SMED30030007|Name=Rootletin|organism=Schmidtea mediterranea sexual|type=transcript|length=6612bp
GTTGTTTTTAAATCACTATTTTTTTTATTTCATCTGATTATAATTTTTTTTTATTGAAATTTGTATTTTGAAATTGGTGA
ACAATGAGTGAGATAGATTATTCCGCTATTGTTCGGAGACGCATTGGAGATATCGATGGGGATTCAAGTGAAGATTCCAG
TTCAAAGGGTTTGCTTCAAGTTAACTTGGAACTGAGAAAGCGCTTAGAGGAAGAACACAATGAGTATCGTAGAAAGCTGA
TAGTTTTCCAAGACAGCCAACAGAAACAAGCGCAATTGGTTCAAAGATTGCAGAAAAAGGTATTGCAATACAAAGAAAAA
TGCACGGAACTTGAATCTAAAATGCAATTTGGCGATTATGAGACTCGAAAAACGAAGTATGGAAGTCCAACGAATAACGG
CTATGGGTCGCGTAGTGAGAATCCCTACGACAATCTGGATTTGGAGAGCACACTCATTAAGTTAGAAGAGGAACAAAAAA
AAACAAATTATCTAACGGAGTTCAATGAACGGCTTCAAGAACAATTAACTCAAGCAACTCAATCAAACCAGAATTTGACG
AGAGACATCAGTAAGCTTTCCGAAGAATGGCAGAGATCAAGGGAGGAGCTTGAACAGAGAGAAAAAATTTGGCGAAATGA
AGAAATGTCATTTAATGACTATTTAGCATCTGAGCATTCGAATCTGCAAAATTTGCAACGCAATACGATAAATTTCCGCC
GTCAATTTATAGAATTGAAAGCTTCAACTGAACGGGAAATAAATAATTTGAAAAATGAATTCAACCGACAGGCACGCTGT
TTGCAAACTGCTTGTTCCAATCTTTCGTGCAACATGAAATCTGCAGAATCTAAACAACAATTGAGTACTGAACGAGAAAG
TCGGGACAAGTTGAATCTCGAAAATCAACTGCGAGAAAAAAACAGAGAATTAACTGATTACCAAACTCGGTATGAATGTG
AAATGACAGAATTGCAACACCGAGTGAAAGAATTAACAGTTCTCAGTGACAAACTGAAAATTCAAAACCTGGAAAAGGAT
CGAGCATTGACAGCTTTGCAAAGAATTAAGAATGGAGATACCGCAGGAGAAATAAATATGGAAGACAAAGCTACAAGAGT
TCTTATTGAAGACACAGAAAGTATGCATCAAGCACTTCGAAATATTTCTCAAGTAGTACTAAATGATTCTGACTATTTCG
ATGCAGAAGACACAGGATTTGAAACAGTTCGAAAGAATAATCGTTCGCCAAGTCCAAGGAGAAATCGTAGCGTCAGTCCT
AACTCAAGATCAGCTAAAACACCGCCATTTGCCGATGCAACGTATGCGGCGGTTCAGTCGGCTATAAATAAAAAATCTCT
ACAGATTCAAGAGCTTAAATCAAAATTAAACAGTTCTAAAGAGAGTTGTACAAACTTCAAAAGACAAATTGATGACAATG
AAAATGAACGTCGACGATTAGAGAATCAAGTTCTCGCCATGAGAGATGAAATTGAAAGTTTACGACGAGATAAAGATGAT
AGTTTTAGAGAAGCGGATCGGTTTAAAAATGCTCTGAACATCACTTCAAATGAACGAAGCCAATTGGAAAAGATTCGATC
ATCACTAAACGATCAAATTGAGCAGCAACTCACAGAAATTGAACGACTTAAGTCAGCCAATCACGAATTACAACGATTGA
GAGAGGCATTGGAAGATGAGCAAGAAGATACTAAAAAAGACTTAGAAAGACAAATTAAAGAAAGTGAAAGATGCCAACGA
TCGATTGATGTTTTGGAAGATAAAATAAGTCGATTTAAAGAAGACGTAGTTAATTACAAAGAGGCAATTAATAAATACCA
ATTAGAAAAAGAAGTATTGGTGCAAGAAAAGGATGAGATTGGTGATGCTTTAAGTCGTTGTGAAATTTCTAAAGCCGAAT
TAGAAATCGAGGTGAATAAACGGCAAACTATTGAAGTAAATTTGGAAGAAAACATTTCAAAATTATCCTCAGAAATCGAA
GAATTGAATGATAAGCGAGCTGAAAACCACAGAACTATTAAACAGCTGGAACATGAAAGAAGTTCTCTTTTGAATGAAAA
ACGATTTTTGGAACAAGAAAAAAGTGGTTTGAAAGATGAGCTTGTTCGATCTGAACAAGAGGCTCTTGGTTTGTCAAATG
AGAAAGCCATTCAACGTCAAAGAATCGAACAACTTGAAATTAATACAGAAAGATTAGAAGAAGAGTTATCGGAACTCAAT
CGAGAAAAGCTAGATCTTACTGAACAAATAGGCTGTTTGCAGAGGCAGAAATCGGCTCTTGCAGAAGAATTGTTGCAATG
TCGTAGAGAATTAGAACGATCTAATAACAGTGTCAACAACTTATCAAAAGAAAAGGAATATCTTACCAAAGAGAAAGGAG
AACTCGTCGTTCAAGTTACAGCTTGCGAAAGGGAAAATCGTCAACAGTCAGAAGTTATTGCTTCTTTGAATTCCGATAGA
GAACAACTGGAAGCTACTCTTTATGATGCTCAACAATTAATCATTCAGTTGGAAACTCGAAAAGAGCAATTAGAAGGCGA
AAACCAAGAGTTGATTGTGAAAAAAGAAAATCTAAATGGAGAACTAGTCAGATTACGACAAGAGTTTCAACTAGAATACG
AGAAGGTTGTTAATTCACGAGAACAATTAAATTGCAGATATCAACAAATGGATAAAGAATATAAGATGGCAATTCAACAA
GAGCGAGATTCTCATGCTGAAGATGTAGAAAGACTAACTAAGATAAACGAAAGCAATCGTCATGGATCTGAAAACGAACG
AGAAGAGCTTATTCATCGATTCAATATGGAGCGTGACGACATGATTCAAAATTACGAACAAGAGAAACAAGAAATGGCCC
AGGAAATCATGACGATCCAACGAGAACGAGATGACTCATTATTAATGGCGGAAAATGAAAAGCAGCAATCATTGAGTTTA
TTAGAACAAGAAAAATGTGCAATCAATGAAAAGCTTATCAAAACGCAATTTGAACTGCAATCGGTTGAGTCGGAATTGGA
TCGCATTAAAAAGGAGTCGTCCAATCGTCAGGAGCAAGACAAACAGAACATTGCCGGCTTGTCGAGTGAACTCAAATCAT
TTAGATCTCAATTTGAGGATAAATGCCAAAATCACGAAATGGAAGTTAAAAGCCTAAATAGTGGAATCAAGGATCTAACA
TTAATGAAAGATCAAGCTCTCAAAGAAGTCCATGATTTGCATACCGGATTAAAAATAGCTGAAGAAACCCGTGATAATTT
GCGTCGGGAAATCATGGAAATGAATCGGAAATTGAAAGAAGCTGAGGAAGCCAAAGAGCACTTAAAGCGTGAAATTAATG
AATTGAAACGTGGATTATGCGAAGAACAAAGGGAAAAAGAAAATGTTATTAACTCAAATGAGAATTTGAGAAAGAAAATT
AAAGATGTTGAAACAGAAAGAATTGATTTGCACAGACAAGTAACGGATTCCAAACAAAAGGTTGCAGTACAAGATGAACA
ATTGGTCAATTCCAAACAAGAGGTCAATGAGTTAAGAAACAATCTTAAAGACGTAGAAAAAGCTCGATTAGATGTCAAAA
GAGAGTTACAAGAACTCAGACGCCATATCAAAGAGCTAGATACGGAAAGGGGCAAATTGACTAAAGAAGTCAATGATTTG
CAAACTCGTGTTGCTAGAGATGAAGAAAAAGAGGATGAAGCTCGTCGGGAAAATTTCGGTCTCAAACAAAAAGTTGTTGA
AACGGAAGCTTCAAGAGAAGCCGTTCGTAAAGATCTTGCTAATGCTCAACGACATATTGTTGATTTGGAAAATGTTCTGC
AGAGCAAAGACAGAGATTTCAGTTCCATGGTGGAATCGAGCCGCCGGGATTATAGGAAACTTGCTGATGCGAGAAATAGC
CTGCAACAAGTATATGATACGATGGTGGCCGATAATAATGAGCTGAGAATTGCTCTCAGTGGAGCAGAAGGTCGGGTCAG
TGCTCTGGAGTCACACATCGCACGAGTTGAAGGAGCTAAGAAAGAAATTGAATTCAAATTGGCTTCTATCCATAGCTCAT
TGCGAAGGCTGATAGGATTCCGACAGGAGAATGTAGTTACTATTCGGTCGAGAAACAACTCCAAATCTCCAGTTAGAGGT
CGATCAGTTAGTCCTCTTAGAAGTAGGCCGGTGTCGCCAACCAAAGGATTTGACAATACCTATGCTACTACAACTGATGG
AAAAGGTAGCCCTATCCCGCGCACAGGGTCTCCGAGTTCTAAACGAAGGCAATTATCAAGATCTCCGTCTAATTGCGATT
TCAATCCAGTCGATATAAATCCAGAAGCAGTTCGTCTGGCCTTGCGAGAATTCGTACAGCAGTTGGTTGATGCTGAACGA
GATAGAGATGACGCTTTTGCTCAAGCTCGCAGCCTAGAATCTCGATTGAAAGAACAAGAAGAACAAAATGAATATGCTGA
AAACCGTTTACAACAACTACAACAAGCTCTGTGTGATGCAGAAGAAGACAAAAAAGGCATTGATGGAAGATTGTCATCAG
CCCAAACTGCCTTAATGATGCAAGAAGAGACTATTCGGCGCAATGAGAGAGATAGAAAAGCAATGGCGGAAAAGTTGAGT
AATTACGATAGAACATTTGCATCCATGGAATCAGAAAAACGACAATTGGAAGATCGGTTGAATAAATTCCGTCATCATGA
TGCCCGATTGGAAGAAGAACATAAGCAGAGCAAAAAAGCTATTGAAAATGCTGAAAATAGAATAACTCAGCTTCAGCTTG
CCAAGCGATCGTTAGAAGGAGATCTTCAAAGAATGAAAATGGCGTTGACAGATAAAGAAACAGAAACCGAAGTTTTGGAT
GACCGCGTAAATAGTTTACTCAAACAAATACAAGATCTCGAGGGAAAATCTCAATCACTTCAACTAACGATTGACAGAAT
GAGTGTCGCCCTTGCAAAAACTGAGGAAGAAGGCAGTTTTCATAAGGACAAAATGCAACAGTTGAATATGAGTTTGAGCA
CTCATTCACAACAACTGGAACAATTACAGAATAAGATTTCTCAATTACAAAAAGCACTCGGCAGTTCAGAACAAGATCGT
CGGCTCTTAGAGGAACGATTAGAAAGCTCTAAAGGAGCATTGCATGAGGCAAAACATCAAAATAATTTGTTGATGGAAAG
AATACAAATAATTCAATCCGATTTAAATGATTCGGAAAATCGTCGATCAGAATTGGAAGGATTAAATCGACAGAGTAACA
CTTTGATTGTACAAAGACAAGAAGCTGAACAAGAACTCAATCAAAAATATCAGAAATTGAACTCGGAGAAAAACACATTA
CAAGAGCGAGTGAATAGCATGCAACGAAATTTGGCTTTGGCAGAAGCAGAAAAACAAGAAATAATAAAAAACCACGGAAA
ATTGGAAAAGGATAGATCTGCCTTGAAAAAGAGTCTTGGAAAAGTTGAACGTCAGAAATTGAAAACCGAAGAAATTGCTA
GCAAAACTGTTTTTGAACGTTCAGAATTAGATCAAATTTTAAGGAGACTTGAAGATGAAAATTGTGAATTACAGAGACAA
GTTGGAATTCTTCAAAATCAATTAGCAGAAGCTGAGCAAGCTCACTGCCACCATTTGATGGAAATCAATTCCCGCCATCG
CCAGGAAATGTCCATGGAAATGGAGCATTTGAGAGCATCGAATGTTCAAATAGAACGAACTCTAGAAGGCAGAGAACGAG
CCCACAGACAAAGAGTTAAGGGTCTGGAAGAACAGATCTCCACCCTCAAAGACCAGCTGACTCATGAAATGCAGAGGCGG
ATGGATAGTGGATATTACGAGTCTACCAGAAAGTCTAATCAATACGATTCAACTGGTGACTTGCGACATGTTCTGGATTC
CAGTTTAACTCGAGTTGCAAAAGACCCTCAACTGGACGCAATGCTACTGGAAACCGAAGCCAGGCGACTCGATGAGTCGA
TATTCATGTGTGGCAGTCGTGATCAGTCTCCGACCCGGCAGAAGCGAATCGAAATGTCAAAGAAGTCCGCAGCCCCTAAC
AATTCCAATCGGCGATTAACTGCCGGCCGTCGCAAATGAACTCGGCCTGTTCCAGTCCGTCCAGAGATGTTATGAAGCCA
CTTTTTAGATGCGTGAGTGTGAGTTCGTGTTGGTGACTGATTCATTTTTAGTAAACAGATTCTGGATTTTTGTTTTTATT
GATAGTGTAATTTCCTAATGCAGATCTGATAGTTGACTTGTTGTTCTTACGTATTCGGTATTTGTGATTCACATAGTCTG
TCATTGTTACTGTGATTTATCCTCTGTGTGACTTTTGTGATTTACTTACTTTATTGCCCCTATAATCAATAAATGGATTT
ATCGATAGTTCAGCCCTCCCCTCCAGCCCTCGTTTTGGGATCCGTAAATTTTGTTTCAATTGAGATCATTATAGTGATTT
TATTCCTTCGAAACCAAACCTTTGGGAGGGACATAAAATTAAATTATTGATTTTTTATTATCTTAGAAGTGAAAGATGTT
TATTTCCCAAATTAACTAATATCAATAATAACTTTAATTTATATCTTCATTA

 

back to top



PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in Category 5 cell. Click this link to learn more about PAGE.


PAGE Curations: 8


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
Category 5 cellSMED30024865Intermediate filament proteinSMESG000030598.1 SMED30024865smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
Category 5 cellSMED30024865Intermediate filament proteinSMESG000030598.1 SMED30024865smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
Category 5 cellSMED30024865Intermediate filament proteinSMESG000030598.1 SMED30024865smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
Category 5 cellSMED30026612Intermediate filament proteinSMESG000030598.1 SMED30024865smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
Category 5 cellSMED30026612Intermediate filament proteinSMESG000030598.1 SMED30024865smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
Category 5 cellSMED30026612Intermediate filament proteinSMESG000030598.1 SMED30024865smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
Category 5 cellSMED30024865Intermediate filament proteinSMESG000030598.1 SMED30024865smed_20140614PMID:29357350
de Sousa et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
Category 5 cellSMED30026612Intermediate filament proteinSMESG000030598.1 SMED30024865smed_20140614PMID:29357350
de Sousa et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
Note: Hover over icons to view figure legend

 

 

back to top