Category 5 cell

The Planarian Anatomoy Ontology (PLANA) is a collection of terms curated from the literature and other organism anatomy ontologies to describe anatomical features, life cycle stages and developmental processes in the regenerative flatworm Schmidtea mediterranea. The latest version of the PLANA Ontology is available through the Open Biological and Biomedical Ontology Foundry (OBO) . PLANA Ontology terms are searchable at the EMBL-EBI Ontology Lookup Service (OLS) and the PLANA Ontology Terms Page.

Below, the Overview Section is populated with infomration from the OLS.

Additional experimental information related to PLANA Ontology terms can be found in the Additional Term Information Section.



    ▻ Planarian Anatomy Ontology Term Overview

    ▻ Additional Term Information

      ▻ In Situ Hybridization Data

      ▻ Sequences




    Planarian Anatomy Ontology Term Overview


    NAME:

      Category 5 cell


    DEFINITON:

      Post-mitotic, ciliated epidermal cells.


    TERM DEFINITION CITATIONS:

      PMID:25017721


    TERM ID:

      PLANA:0000022


    ABOUT THIS TERM:

      Category 5 cell "is a" ciliated epithelial cell

      Category 5 cell "contained in" dorsal compartment, tail, epidermal compartment, posterior compartment, copulatory region, ventral compartment, parapharyngeal region, anterior compartment, neck and head

      Category 5 cell "develops from" Category 4 cell

      Category 5 cell "existence overlaps" Stage 6, juvenile, asexual adult, sexually mature adult, Stage 8 and Stage 7

      Category 5 cell "existence starts at point" Stage 6

      Category 5 cell "part of" dorsal epidermis and ventral epidermis


    BROWSE ONTOLOGY TREE (IN OLS):

    Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.


    Planarian Anatomy Ontology


    EXPLORE ONTOLOGY GRAPH:


    Dynamically explore this term by selecting additional relationships to display ( checkboxes on the right ) and by expanding nodes by double clicking on a node. Single click on a node to display the definition below.

     

    back to top


    Additional Term Information


    All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


    IN SITU HYBRIDIZATION DATA:


    Smed IDAccessionNameAliasEnriched during stage(s)Tissue/PatternImages
    SMED30024865Intermediate filament b-like proteinvim-3Stage 5, Stage 6, Stage 7, Stage 8integumental system, Category 5 cell
    SMED30030007RootletinH.2.8b, croccStage 5, Stage 6, Stage 7, Stage 8integumental system, protonephridia, Category 5 cell, renal system, proximal tubule
    Click to see image symbols and abbreviations
    Abbreviation or symbolDefinition
    Ooral hemisphere
    Aaboral hemisphere
    Ddorsal
    Vventral
    Llateral
    black arrowheadembryonic pharynx
    red arrowheaddefinitive pharynx
    black arrowsprimitive gut
    yellow arrowsprimitive ectoderm cells
    cyan arrowsbrain
    cyan arrowheadsnerve cords
    blue arrowheadseye progenitors (trail cells)
    purple arrowheadseyes
    scale bar100 µm

     

    back to top


    SEQUENCES:

    smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

    >SMED30002072 ID=SMED30002072|Name=Intermediate filament b-like protein|organism=Schmidtea mediterranea sexual|type=transcript|length=2324bp
    CATAAATGGTGCACTTTTGAGAAATTTGCGTTGGAGTAAATAGAAAGCAGTCTTAACAAAAGGATAACTAGGTCAGAACA
    ATAGCTGCGTTGAAAAATCTATTATAAATATATCCAACTTTCAACTTGTTTCTCTAAAGTTATTTTTGTAATAATGGAAT
    CGTCTAAAAGAACTGTCATTACGACTTCTAAACAAGAAGGGCCGATTAGTGGCTCAAGTTCGGTTACTAGATCTGGAGTC
    TCAATGACATCAGGTTCTGGTTCTACTTACGGATCGGGATCTGGAGGAGAATTGGGCTCAGGTTCAGGATCCGGCTCTGG
    AAGTCGATATCAAAGTTCGTCTCGTGTTACTACAACAACTAGATCTGACTATCCACAATCTGGAAATGAAAGAGAAGACT
    ATAATGAATCAGGAAGTCAACAATTCAATGAAGATGGATCAGAGATTTCTGGTCGAATCGTTTCAACTACCAGATCCATG
    TATAAGCCAATAAGTCAATCAAGGAATAATTTCAAAGACTTGCAAAGAAATGCTGCATCTTTAAGTTATAGTATGCAGTC
    TGGAAACCAACAAAGTGGTTCAGTTATGCCACTCATCAGAGGTGATAGTGTAGCCTTACAGACTGGACTGAATTCGATAA
    AGAAAGGAAGAGCTCAAGAAAAAAAAGACTTACAAGAGCTGAATGAAAGATTTGCGAGTTATATAGAAAAAGCACGATTT
    TTGGAAGAGCAAAATAAGCAATTAGTCGGTGAAATTGAAGAACTCAAAGGGGGAACTATTCAAGATACATCAAAAGTTAA
    AGAGATCTATGAAGTTGAAATCAATCAACTCCGATCTTTACTAAACGAATCAGAGAAAAGTAGAGCACCACTGGAAATTC
    AAGTGAATTCCTTGGAATACGAAATAGGCGATTTGCAAAAAAGACTGCTGCTATTAGAGGATATAGGTACACAGTATAGA
    GCAACGATTGATAAACAGCGTCGAGAACTCGAGACCTTCGAAGGGGAAATGGTTGAATTGAAAAGGTTTAAAGACACTCG
    AAGTATCGATGCTACAAAAGAAAAGGATGAAACAAGCAACTTAAGAGATGAAATAAAAAAATTAAGACAAAACTATGAAA
    AAGAAGCATTAGCGCATATCACCCTTGAACATGACTTGCAGAGTTTGAGAGAAACTATGGAGTTCGAGAAACAAATCCAT
    GCTACAGAAGTAAAAGAGCTGGCAACCGTTGCATATCAAAACCCAACGAAAGAAAACATGGTTTACTGGCAAAGTGAAAT
    GGGACGTGCTTTACGGGACATTCAAACTGAATATGAAAACAAGCTTACAGGAATCAAACAAGAATTGGAGGCTTCTTATG
    GTTTACAAATGCAGGAAATACGAACAAGTAAAACCAGAGACAATGTGGAAACGACCCATTACAAAGAAGAGAACAGCCGA
    ATAAAATCTCAAATCCAAAGCATGAGATCGAGAATCGCTGATCTTGAGATGCAGAATGCTGAATACGAACACAACTTGAA
    TAATATTCGTGCTAATTACGAAGAAACTCAAAGAAGTCTTGAATTGCAGTTGTTGTATTTGCAAGAGCAATTGACAGGAA
    CTCAACAAGAATTGACAGTCGCTTTGACCGAACTCCAAAGCTTATTGGACGCGAAGTTGGGACTGGAATTAGAAATCGCA
    GCCTATGCAAAACTATTAGAATTCGAAGAGAGTCGTGTCAATTTCTCTGGTGATGGCAACGCTACTTTATCTCAATTTAT
    GAGTTTCACATCAAGTAGCGGAGCTGGAGGTGCTGGAGGGGCTGGAGGTGCTGGTGGTGCTGGAGGAGGAGGAGGAGGAA
    GCAGTGGGTTCGGATCAGGAAGTAGAATTGGAGGGTCAAGTGGTTTCAGCGGAATGACAGAAAGAGAAACAACTGACTAT
    CAGTCAAAACGAATGAAATTTAGACGAACGACAAAGGGAAACATTTCCATTGCAGAGACTGACCTTATAGGTTCAACAAT
    TATTCTGGAAAATATTGGGACCAAAGTGGAATCACTCGAAGGTATGACTATTAAAAGAGTAGTCGACGGCAGCGAAAATA
    AAATCTCATTTACCATTTCCGGAAAAGTTAACTTAAATGCTGGTGAAAAGATTTCTCTTTGTGCCAAAGGGAAAATAACC
    GGCAAAGGACGAGAAATCGAAATTGATGATGCTTCATGGGGGGTTGGTAACAATGTCGTAACAACACTTTGTGATTCAGA
    AGGAGCGGAAAAGGCAGCTCACTATCAAGAGGTTTCGGCCTAGAAACCTTGCTAAATATTAAACTGAATTTGTATGAACA
    TAAC
    >SMED30014019 ID=SMED30014019|Name=Intermediate filament b-like protein|organism=Schmidtea mediterranea sexual|type=transcript|length=768bp
    AATTAGAAATCGCAGCCTATGCAAGGTTATTAGAAATTGAGGAAGAGCGAGTTTTAAGTTCCGCTGATCAACGTTCTGTG
    ATGTCTCAATTTATGAGTTTTTCAGCTGGTGGTGGAGCTGGAGGTTCTAGTGGAGTTGGAGGATCAGGAGTTGGAGGATC
    AGGATTTGGAGGATCTAGCTTTGGAGTGTCAGGCACCGGACGATCAGGCTTTGGAGTGTCAGGTACCGGAGGATCTATGG
    GAGGAAGTAGATTTAGTGGAAGTCTAGGACTTGGGGGCGGGATTCATTCAAAAAAGATGTCTTCAAGAAGAACGACAACG
    GGAAACATTTCTATTGCCGAAAGTGATGAATCTGGGTTATTTATTGTTTTAGAAAATATGGGAAGTCAGACTCAAAGTCT
    ATCTGGCATGATGATTAAAAGAAACATAGATGGCGTAGCAAACTTTGTGACCTACTCAATTCCGAAGAAGATCGATCTAT
    CCGCTGGTGAAAGAATAACAATTTGTGGACATGGAAAGAAAACAGGTAAAGGAAAAGAACTAGAAATAGAAGAAGATTCT
    TGGGGATTTGGAGAAAACGTCATTACTGCGTTATGTGATGCGAATGGCGAGGAAAAAGCGGCTCTTTATCAAGAAATAGT
    GGCTTAAATGGCATAGCCGAAAGACTTGCAAATTTAACCTTTTATTTAATGATTTCATTTAATGTTCCTCGCGTTCATTA
    TTTGTTTGCTTCTTTCTAGATTAAAGTTTTAAATTTGTTGAAAAAAAA
    >SMED30023882 ID=SMED30023882|Name=Rootletin|organism=Schmidtea mediterranea sexual|type=transcript|length=6811bp
    TATAAATTTTAGCAATCCATATCAACTGATATGAGATTTTCAATTTCGCATTAATTTAAAATATTTATTCAAGTCACACA
    TCTTAAATCTGGTTTTATAAGAATCATAATGAGTTCCGCAAATAGAGACGAGAGATTGGAACAAGTTGCACAAAAACTGA
    ATAAATTTACAGATATATTTTACCAGAGAGTGGAAAATGTTTTAGCTGATAGAGACAATCAAGGATACTTAAAATACAAT
    TCCGGACGAATTGTAAGCAATACATCTCCTGGCATCGGCGGTTTCGACCTGTCAAACGGCGATAAACCCCAAAAAATGCC
    AGAAGTTGTTAAAGACATCATTCTGAGAGATTTTGGTGACACTGATGAGGATGAAGATTCCATAAAGGATTTACGAATGC
    CAAAACCAAACTCTCAAAACACTCAGTCAAGCAGTCGCTTACAAACCTACGGCAACGGATTAGATTCCGTAACTCAACTA
    AAAGCAGAAAATGCTACTCTTAAAGATAGCTTGTTTAATGTTGAAGAAGAACTGTTACGATTGAAAAATGAAAGAGATAA
    TCTAGCAATTAAATTCAATGCCATAAATGAAAAACTCAACAAAACATTTACAGCGGAAAAATGTGGAGATAGAAGAGTGT
    CTAATGCCAGCGAAGAACTTAGCAATGCGAATTCTTTAGCATCACAAACGATTCAATTGAGAAAACAACTTGACGACGAT
    CATCGGGAGTATAAACGCAAACTTGCCGCCCAGCACGATCACCAGATTAAGCAGGCAGAATTAATTAAAAGACTCCAACA
    AAAATTAGAACAACTCGAAGGTCGGAATGGCTTAGTGGAAAAATTAAACCAACAGAATAGTAAGCTACGGTCTGAAATAA
    GTCGGTTAAAAAACCATTTCCAAACAACAACTTCGGATTTAAATCGTCGAATTGACATTGCGGAAAATCATCTGAAATCA
    GCAGAAACCGATAAAAATATGGATCTCGAATCAGTGGTTAATGAATTGAAAGAGGAACAGTCAAAATCTATGAGTTTGTT
    GCAAATGACAGCTTTATTGAGAGACCAATTAGACGAAGCTACAAATGCAAATCAAGGCCTAACAGAGGACGTTCAAAGAC
    TGTCAGAAGAAAATAGTTTCTTGAAAAGCGAATTAGAACAAAAAGACATGGATTGGAAAGACGATGAAGCCACGTTTAGT
    CGATTCTTGATTGGTGAACAGAATCGCATTAAATCTTTGTGGAATGCAGTTGTAAATTTTAAAAGACAATTCAATGACAT
    TAAATCGTCAAATGAACGAGATTTGCATCAGTTACGGGTTAACATTGAACAATCTACTCAGTCGTTACGATTAGCTTGTT
    CAAATCTTGACACGAATCACGTAAACAGGTTAAGTCAATTACAGTTCCAACTGGATACAGAAAAAAATAATTGCTCCCAG
    TTAGAAAATTCTTTATCCAAAATGAAAGAAGAATTCCGAAAAACTGAAACTCAATATCAAAAACAGATTGAATCATTAAA
    TGAGCAATTTGTCCACGTCAATCGCTCTAATGAAAGTCTAACGAAAGAGCTTGCTGATAAAGAAAAAGTCCTAACTACTC
    TCCACAAATTAAGAAATGGCATGAATGGAGATTTAGACAATTCAATATACAACAATGATGATTCTGCTACCAGACAGTTG
    ATTATTGACACTGATGCTGTTCATCAAGCATTAAGGGATATCGCTCAACTTGTTATGAATGATGTCGATCAAGTTGATGA
    CTCTCCATGGATGCAAGATGATTATCTGGACGAATCCAAAACCACGGGACAACTGAAACCAACCCTATCCATAAATAGTT
    TGCATTCAAATAGAAGTGTGAGCCCAACTCGCCCATCGAAACGTAGCCACTTCAACTCAGGATCTTTAGACAGAAATCGC
    GTTTATCGAAATAAATCTCCAGTGAGTATTGCTGATTCAACATGTGCAGCTGTCAGATCGGCTTTACACAAACGAGCACT
    TCAAGTTCAAGATTTAACCAGCAAAATCAATTCCGCAAAAAATAATCACAATAGCGTCAAAAAACAATTGGATGACAGTG
    AAAACGAGCGCAGAAATTTAGAAAAACAATTCATTGAATTGCGAAGTGAATACGATTCAAATCATCGGGAACTGGACGAC
    ATTCAACGGGAATGTGAACGGATGCGACATACAATTTCAATGCTGGAAGAAGACAAATTAAAGTTGGACAAAAGTCGAAT
    GAATTCTTATGAAGAATGTAAATCATACAAACAAGACATGGAAAAACTAAAGACTCTTAATTACGAATTACAACGCGACA
    AAGAAAATCTAACAGATAATTGTCAAGATTTAGATAGAAATCTAGAAAGACAAACGAAAGAAGTGGAGAGATTGACGAAA
    TCAATTGAAAATTCCGAAAGTAAGAGTAGTCGACTGAAAGAAGAAATTTCTTCCCTTAAAGAATCTTTAAATCGGGCTTT
    ACTTGAGAAAGAAGTTTTAGAACAAGAAAATTCAGTTCTCACAGATTCATTGAATAAGACCGAAGTTCTAAAAGCCGAAT
    ACGAAGTTAAAGCAAACAAATTTAAAACGGAGGAAGCCAGACTTCGAGATAAATTCCATCAGTTGGAATCTATGAATCAT
    TTCTTAGTCAAAGAAAATTCTGAATTCAAAACGATCATAGATCAAACGGAATCGGAAAAGCATCGGCTTTCTGGAGAGAA
    AAAAGCCTTGGAACAAGAGAAATACGGCATCCGAGAGGAATTAATGCGGGTTGAAAATGAGAAGGAAGAATTGAATCAAA
    TGAAAGATGGTCTTCATCAGTCTATGCAAAATGTTGAAAAATCTTATGAAAATTTACAAGATGAATTATCAAAATTAAAT
    TATGAAAAAGGGCAATTAGAAACCGCTAATGTGACTTTACAACGGGAGCGAAATGCACTTTCAACAGAATTGCTCCAAGC
    GAGACGAGATGCCGAGCGATTGTCAGCTGCTGTGCAAAAATCAATGAAAGATAAAGAAGTGCTAGCTAAAGAAAAAATCG
    ATTTAATATCACAATTGACTACTTTTGAACACGAATTGAGAGAAAATGCGGACGCAATTTATGTTTTACAAGAAGAAAAA
    GAACAACTTGATGGTTCACTCTATGAAAGCCAGCAAAACATTTCTCAATTGGAGGCTAAAATAGAAGCTCTCGAATCTAA
    TTTGCAACAATTAGAAAGGAAAAGATCCATTATTTTTGACGAAAAACAACGATTGCAACATGAATTTGATGTAGAACTTC
    AAAAACTTAGTAAAGCTAAAGAATCTTTACAAATAAAACTTAACGAATCCGAGAAAGAATGGAACAAAATTCTCCGATCG
    GAAAAAGAAGCTCGCGAAGAAGACATTGAACGCTTGATTGCTGAGAGAGAAGAGCTTCGAAATGAATTCATGAAGTATAA
    AGAAGAAATAAAGCTGCAATTTCAAGAGGAAATTGATGATTTGAGACATAGATTGAATAGAGATAAAGAGGAACTGGCTC
    AAGAGATTATTACAATCCAAAGAGAAAGAGACGATTGTTTATTGGAAGCAGAAATGGGAAAACAGCACGCTATTAATTTG
    CTGGAGCAGGAAAAAATGTCAATGTATGAGAAGATTTCCCAATTGACAGATCTACTCAGAACTTCTGAATCTGATCTAGA
    GCGTACTCGAAATGAATGTGAAATTCGAGCCCAACAAGATCAAAATACAATTCAAACATTTAATGGCGATTTAAAGAAAT
    TCCGTCTTCAATTTGAACAAATTCACATCGATCATGATCGGGAAATAAAAAATTTACAATGTGCCTACAAAGAACTTGAA
    AATCAAAAATATCAAGATATGAGAGAAAATGAAGAATTGAAGTCACTATTGAAAATTGCAGAAGAAACAAGGGATAATTT
    ACGACAAGATCTATCAGAGTCAATGGGGAAAATCAGAGAAACCGAAGACCAAAGGGAAAGATTGCGCCGGGAATTAATGG
    ACGAAAAACGAAATTATTTCGAAGTGAAAAAAGAATTGGAAACTATTCAGTTGTCAAATAAGGAACTTAGAGAAAAATTG
    AAAACATCTGAAATGCAAAAAATTGATATCCAAAGACAATTACAAGATTTACAAAATAAATTATCAATTCTTGAAGAGCA
    GAAACAAGTGTTACAAAAAGAAGTAAAAGATACCAGATATAATTTACAGGATACTGAAAAAGCTCGAGTTGATGTTCGTC
    GCGAATTGGAAGAATTACGAAGTCAGGTCAAGAAACTTGATACTGAACGTGGGAAATTGGTAAATGAAGTGAGCGGATTA
    CAAGTGCGTGTAGCAACTGATGAAAATAAAGAAGTAGAAGCTAGACGAGAGAACTTTGGATTGAAACAGAAAGTAATAGA
    ATCTGAAGCGACCAAAGAAGAATTATCTAAACAGCTTTATCAATCGCTTCGAAAGAATGAGGAACTTGAAGAAATTCTCA
    ATTCCAAAGAGAAAACCACTAAACAATATTACGATGAAGTGTTAAAAGATTACAAGTCATTAGAAGAAAGTAAATTAAAT
    CTCGAGAATCAATTGGAAATCACAAATCACAATTTTGAGGAATTAAATTCAACTTTATCTACTAAAGAAAATAGAATAAG
    TCTTCTGGAAAATCAAATAAATATTTTGGATCAAAAGCGAAAAGGTGCAGAAAATCGGTTGGCAACTATACATAGTCATT
    TAAGAAAACTGATTGGATTTCGTCAGCAAATTTGTCAGACATTAAGGAACAGATCTCCGAGTCCTGGCAGACGTTCTCGA
    TCAGTGTCTCCTGAAAAAGGACGAGTTTCCAGTAGGAATTCTGTTGAATTTAATTTCTCTGAAGATCGTAAAAGAGTTGG
    AAGATTTGGTGATGTGAATCAATATTCAGAATCTGTTATTCCCGGTTCTGATCTGGATCCAGAAGCAGTTCGGATAGCAT
    TGAGAGACATTACTCAACACATTGTTTCCATAGAAAGAGAACGCGACGATATGGAAATCAAAGCTAAAAATTCCGCTTTG
    AAAAGTGATGAAACATCGGTTCAGTTAGATCAAGCTTTACAAAGAATCAATCAACTGCAGAAAAACTTTGGAGAAGTTGA
    AGAAGATAAAAAAGGAATTGATAGTAGATTGTCAAGCGCCCAGACTGCTCTGATGATGCAGGAGGAAACCATTCACAGAA
    ATGAGCGCGAAAGAAAATCTTTGATTGATAAAGTTGGGAAACTCGAAAGACAATTAGCCCACGTAGAAACTGAAAAGAAA
    TATTTACAAGAACGCGTTGATAAAATGAGAACAGGTGAATCCTATCACGAAGAAGAAAGAAGAGGTTTAATTAAAGCGGT
    TGATGATGCAGAAAATAGATGTACACAATTAGAACTTCTGCGTCGAGGTTTGGAAGGTGAGTTGCAGAGACTGAAAATGG
    GATTTAATGATAAAGAAACTGAAAACCAAGTCTTGAGGGATAGAGTAGATGCTCTAACAAAACAGATTTCCGATTTAGAA
    TCTAAAGCTCAAAGTTTACAATTAACTATAGATAGATTATCAATGAATCTTGCAAGAACCGAAGAAGAGGAGAACACGCA
    AAAAGATAAAGTTCACCAACTTAATCTTTCGTTAAGTGAACATCAAGGAAACCTTCAAAGTATGCAAGATAAATTAGTTC
    AACTTCAGAGTACTTTGGCAAGTTCGGAACATGATCGAAGAGTGCTTCAGGAAAGATTAGAGTCTGTCAAACATAATTTA
    TCAGAAGCTAAATCCCAAAATCATACTCTTGTGGATAGAATGAAGGCCACGCAGCAAGAATTGATGGAATCTGAATCCAG
    GAAACACGAAATTGAAGGTGAAATAAAACGACTAAGCCAAATTCTTTCTCAGCGACAAGAAATTGAACAAGAACTTCAAT
    CTAAAATTCATCGCTCAGCAATGGAGAAGAATTTGCTAACAGAAAGATTAAATAGTTTAACAGCTTCTCTTGCTGGCCTA
    GAATCCGAAAGAAGAGATATTGAGAAAGTTCATATAAAAACTGAAAAAGAAAAGAATTCACTTAAAAAGACATTAGACAA
    ACTTGAAAAAGAGAAAAATCGATCTGAAGAATCTATCAATCAATCACTTTTGAAACGCAGTGAATTCGATGAATTTACCC
    GCCGGCTTGAGGATGAGAATGAAGTGCTACATCGACAAGTTCAAAAATTACAAAACCAATTGGCAGAAGCTGAACAGTGC
    CATGCTCAAAGAATAATGGAATTAACTTCTCGAATAAAAAATGAAATGCTCTCTGAAATTGATAGACTAAAATCTGCTCT
    AAATTCCACTGAAAAAACTCTACAGTTTCGAGAAAGATCGCACAGACAAAAAGTAAAAAGTTTAGAAGAACAGATTAACA
    TTCTCAAAGATCAACTCTCACAGGAACTCAAAAAACGTGAATTGAATTTAAATAAATCCAATCGTGGCCTTAAAAATGAT
    ATTTGTGATATTAAAAGTATTTTGGAAAAGAATTCTAACAACATCTCAAAAACATCATTTGACAACTTACTTTACGAGCC
    AGAAATACGAAGGATGAAAGATATATTATCGGAATCTGGTTATTCTAACAACTGCAATGTAATATCCACTATGAAACAAT
    CTCAGCGTCCTGGAAGTCGCCTACAAAGCAATTCACTGTCGCGTCAAAACATATCGTCCGCCAGTCCAACTAGAGCCAAA
    AAGAAATTATAAATATCCAAATGAAACTTCAAATATTTCTTTACGAAACAGCACTTAACATAAGACGATGATTATTATTA
    TTATTATTATT
    >SMED30024865 ID=SMED30024865|Name=Intermediate filament b-like protein|organism=Schmidtea mediterranea sexual|type=transcript|length=2214bp
    GATCTTATAAATACAACATTAATTGTATAGTGAACTATGTTAGCCATTGAAATGGAGACAAGTAAAAAAATCGCAGTCAA
    AACTACGAAACAAGAAGTAAGTGGAAGTGGAAGCTCTGGTGGACTAAATGAACAACAAGCTTTTGGAAGTGGTAGCTTTC
    GAACCGGGTCTGGAGGTGTACAGATAAGTGCTAGTGGAGCAATTGGATCTAGCAGTTCAGGCGGAGTTAGTGGCACTGGC
    GGAGTTGGTAGCATTGGTGGAGGCAGTGGTGCTGGTGGTGAAGGAACAGGAGCTAGCACAGTTATCACTACAAGCAGATC
    TTATTATAAGCCTATCAGTCAACCTAGAAATAATTTAAAAGACTTACAAAAAACTTCTGGTATGAGTTACAGTGCACAAT
    CAAACTCCCAGCAAGGTTTAAGTAATATTCCATTGATTAGGGGAGACAGTGTTGCTCTACAATCTGGAGTAACTTCAATG
    AAAAAAGGACGAGCTCAAGAGAAAAGAGATCTTCAGGATCTGAATGAAAGATTCGCTAGTTACATTGAAAAAGCTCGATT
    TCTAGAGGCGCAAAATAAACAGCTAGCCAATGAGATTGAAAAGTTAAAAGGTGGAACCGTCCAGGACAACTCAAAGATCA
    AAGAAATCTATGAAGTCGAAATCAATCAACTTCGAGCTTTGGTAAATGAATCGGAAAAAAGCAAAGCTCCTTTAGAAGCT
    CAAGTTGATTCTCTTGAATACGAAATTGATGATTTGAGAAAACGATTAATGATGCTGGAAGACATCAACTCTCAGTACAA
    ATCCACCATCGATAAGCAACGCAAAGACATTTCTGGATTTGAAGGGGAATTGGTGGAGCTAAGAAGATTCAAAGGCACCC
    AAGGTGCTGATGTAAATAAAGAAAAGGAAGAAGTAAAAACACTAAGAGACGATTTGAAAAAATTGAGACAAGATTATGAG
    AAAGAAGCTCTAGCTCATCTCACCCTTGAACATGAATTACAAAGCTTGAAAGAAGCATTAGAATTCGAGAAACAAATACA
    TGACACAGAAGTAAAAGAGCTGGCAACCGTTGCATATCGAGACCCAACGAAAGAAAATATGGTTTACTGGCAAAGCGAAA
    TGGGACGCGCGTTACGAGACATTCAAACTGAATATGAAAACAAGCTTACAGGAATCAAACAAGAATTGGAGGCTTCTTAT
    GGTTTACAAATGCAGGAAATACGAACAAGTAAAACCAGAGACAATGTGGAAACGACCCATTACAAAGAAGAGAACAGCCG
    AATAAAATCTCAAATCCAAAGCATGAGATCGAGAATCGCTGATCTTGAGATGCAGAATGCTGAATACGAACACAACTTGA
    ATAATATTCGTGCTAATTACGAAGAAACTCAAAGAAGTCTTGAATTGCAGTTGTTGTATTTGCAAGAGCAATTGACAGGA
    ACTCAACAAGAATTGACAGTCGCTTTGACCGAACTCCAAAGCTTATTGGACGCGAAGTTGGGACTGGAATTAGAAATCGC
    AGCCTATGCAAAACTATTAGAATTCGAAGAGAGTCGTGTCAATTTCTCTGGTGATGGCAACGCTACTTTATCTCAATTTA
    TGAGTTTCACATCAAGTAGCGGAGCTGGAGGTGCTGGAGGGGCTGGAGGTGCTGGTGGTGCTGGAGGAGGAGGAGGAGGA
    AGCAGTGGGTTCGGATCAGGAAGTAGAATTGGAGGGTCAAGTGGTTTCAGCGGAATGACAGAAAGAGAAACAACTGACTA
    TCAGTCAAAACGAATGAAATTTAGACGAACGACAAAGGGAAACATTTCCATTGCAGAGACTGACCTTATAGGTTCAACAA
    TTATTCTGGAAAATATTGGGACCAAAGTGGAATCACTCGAAGGTATGACTATTAAAAGAGTAGTCGACGGCAGCGAAAAT
    AAAATCTCATTTACCATTTCCGGAAAAGTTAACTTAAATGCTGGTGAAAAGATTTCTCTTTGTGCCAAAGGGAAAATAAC
    CGGCAAAGGACGAGAAATCGAAATTGATGATGCTTCATGGGGGGTTGGTAACAATGTCGTAACAACACTTTGTGATTCAG
    AAGGAGCGGAAAAGGCAGCTCACTATCAAGAGGTTTCGGCCTAGAAACCTTGCTAAATATTAAACTGAATTTGTATGAAC
    ATAACAAAATTTTTAGTAATTTAATAAAAGTTTATTATTTTATAAATCCAAAAA
    >SMED30026612 ID=SMED30026612|Name=Intermediate filament b-like protein|organism=Schmidtea mediterranea sexual|type=transcript|length=2359bp
    TCTTATAAATACAACATTAATTGTATAGTGAACTATGTTAGCCATTGAAATGGAGACAAGTAAAAAAATCGCAGTCAAAA
    CTACGAAACAAGAAGTAAGTGGAAGTGGAAGCTCTGGTGGACTAAATGAACAACAAGCTTTTGGAAGTGGTAGCTTTCGA
    ACCGGGTCTGGAGGTGTACAGATAAGTGCTAGTGGAGCAATTGGATCTAGCAGTTCAGGCGGAGTTAGTGGCACTGGCGG
    AGTTGGTAGCATTGGTGGAGGCAGTGGTGCTGGTGGTGAAGGAACAGGAGCTAGCACAGTTATCACTACAAGCAGATCTT
    ATTATAAGCCTATTAGTCAACCTAGAAATAATTTAAAAGACTTACAAAAAACTTCTGGTATGAGTTACAGTGCACAATCA
    AACTCCCAGCAAGGTTCAAGTAATATTCCATTGATTAGGGGAGACAGTGTTGCTCTACAATCTGGAGTAACTTCAATGAA
    AAAAGGACGAGCTCAAGAGAAAAGAGATCTTCAGGATCTGAATGAAAGATTCGCTAGTTACATTGAAAAAGCTCGATTTC
    TAGAAGCGCAAAATAAACAATTGGTCAATGAAATTGAAAAGTTAAAAGGTGGAACCGTCCAGGACAACTCAAAGATCAAA
    GAAATCTATGAAGTCGAAATCAATCAACTTCGAACTTTGTTAAGTGATTCTGAAAAAAGCAGAGCACCCTTAGAAGTACA
    AGTTGATTCTCTTGAATACGAAATTGATGATTTGAGAAAACGATTAATGATGCTGGAAGACATAAACTCTCAGTACAAAT
    CCACCATCGATAAGCAACGCAAAGACATTTCTGGATTTGAAGGGGAATTGGTGGAGCTCAGAAGATTCAAAGGCACCCAA
    GGTGCTGATGTAAATAAAGAAAAGGAAGAAGTAAAAACACTAAGAGACGATTTGAAAAAATTGAGACAAGATTATGAGAA
    AGAAGCTCTAGCTCATCTCACCCTTGAACATGAATTACAAAGCTTGAAAGAAGCATTAGAATTCGAGAAACAAATACATG
    ACACAGAAGTAAAAGAGCTGGCAACCGTTGCATATCGAGACCCAACGAAAGAAAACATGGTTTACTGGCAAAGCGAAATG
    GGACGCGCGTTACGAGACATTCAAAATGAATATGAAAACAAGCTTACAGGAATCAAACAAGAATTGGATTCGTCATATGG
    CTCACAACTGCAGGAAATACAAACAAGCAAGACCAGGGATAATGTGGAAACGACCCATTACAAAGAAGAGAACAGCCGGG
    TAAAATCTCAAATCCAAAGCATGAGATCGAGAATCGCTGATCTTGAGATGCAGAATGCTGAATACGAACACAACTTGAAT
    AATATTCGTGCTAATTACGAAGAAACTCAAAGAAGTCTTGAATTGCAGTTGTTGAATTTGCAAGAGCAATTGACAGGAAC
    TCAACAGGACTTGACTATTACTTTGACCGAACTCCAAAGCCTATTGGACGCCAAATTGGGACTGGAATTAGAAATCGCTG
    CATACTCAAAGTTGTTAGAATTCGAAGAGAATCGTGTTAATTTTTCATCAGATGGTAACACATCACAATTTATCAGTTTT
    TCATCTGGCGTGGGAGCTGGTGGTGTAGGAGGAGGATCAAGTGGAGGGTCAGGTAGAGGATCAGGTGGAGGGTCAGGTGG
    TGGGTCAGGTGGTGGATCAGGTGGAGGATCAGGTGGGGGATTTGGAGGTGGAGCAGGATTAGGATCAGGCGGAGGAGGAG
    GATCAGGAAGTGGGTCTGGTGGAGGCGCAGGTGGGGCTGGTTCTAGTATTGGAATTGGAGGTGGGGGCAATTTTGTAGGT
    GGTTCTCTGAGATTTAACATTAATGAATTGAGCAGTACAGAGGCTGAAGAATACCAATTGAAAAGAATGAAGTTCAGACG
    AACAACTAAAGGAAACATATCAATAGCAGAAGCTGACATCAATGGACTGTTTATAGTTCTAGAGAATAACGGAACAAAAT
    TTGAATCTTTAACTGGAATGACGATTAAGAGAAATATTGATGGGAATGAGGATGCGGTTTCATTCACCATTCAAAACCGA
    ACAAGTTTGAGTTCTGGAGAAAAACTAACTATCTGGGCCAAAGGAAAGAAAACTGGCAAAGGAAAAGAACTTGAAATAGA
    AGAAGACGGCTGGGGGCTGGGGGATACTATTGTGACCTCTTTATACAATGCGGAAGGAGAAGAGAAAGCGGTCCATTATC
    AAGAAATACAGGGTTGAGCAGGTGCTCACTTAAGACTGACTTGAAATTTATTTGTTTAAATAATACTTTCAATAGGGATT
    TTAATGCTAATAAAAAGTATTTAAACTATTAAAAAAAAA
    >SMED30030007 ID=SMED30030007|Name=Rootletin|organism=Schmidtea mediterranea sexual|type=transcript|length=6612bp
    GTTGTTTTTAAATCACTATTTTTTTTATTTCATCTGATTATAATTTTTTTTTATTGAAATTTGTATTTTGAAATTGGTGA
    ACAATGAGTGAGATAGATTATTCCGCTATTGTTCGGAGACGCATTGGAGATATCGATGGGGATTCAAGTGAAGATTCCAG
    TTCAAAGGGTTTGCTTCAAGTTAACTTGGAACTGAGAAAGCGCTTAGAGGAAGAACACAATGAGTATCGTAGAAAGCTGA
    TAGTTTTCCAAGACAGCCAACAGAAACAAGCGCAATTGGTTCAAAGATTGCAGAAAAAGGTATTGCAATACAAAGAAAAA
    TGCACGGAACTTGAATCTAAAATGCAATTTGGCGATTATGAGACTCGAAAAACGAAGTATGGAAGTCCAACGAATAACGG
    CTATGGGTCGCGTAGTGAGAATCCCTACGACAATCTGGATTTGGAGAGCACACTCATTAAGTTAGAAGAGGAACAAAAAA
    AAACAAATTATCTAACGGAGTTCAATGAACGGCTTCAAGAACAATTAACTCAAGCAACTCAATCAAACCAGAATTTGACG
    AGAGACATCAGTAAGCTTTCCGAAGAATGGCAGAGATCAAGGGAGGAGCTTGAACAGAGAGAAAAAATTTGGCGAAATGA
    AGAAATGTCATTTAATGACTATTTAGCATCTGAGCATTCGAATCTGCAAAATTTGCAACGCAATACGATAAATTTCCGCC
    GTCAATTTATAGAATTGAAAGCTTCAACTGAACGGGAAATAAATAATTTGAAAAATGAATTCAACCGACAGGCACGCTGT
    TTGCAAACTGCTTGTTCCAATCTTTCGTGCAACATGAAATCTGCAGAATCTAAACAACAATTGAGTACTGAACGAGAAAG
    TCGGGACAAGTTGAATCTCGAAAATCAACTGCGAGAAAAAAACAGAGAATTAACTGATTACCAAACTCGGTATGAATGTG
    AAATGACAGAATTGCAACACCGAGTGAAAGAATTAACAGTTCTCAGTGACAAACTGAAAATTCAAAACCTGGAAAAGGAT
    CGAGCATTGACAGCTTTGCAAAGAATTAAGAATGGAGATACCGCAGGAGAAATAAATATGGAAGACAAAGCTACAAGAGT
    TCTTATTGAAGACACAGAAAGTATGCATCAAGCACTTCGAAATATTTCTCAAGTAGTACTAAATGATTCTGACTATTTCG
    ATGCAGAAGACACAGGATTTGAAACAGTTCGAAAGAATAATCGTTCGCCAAGTCCAAGGAGAAATCGTAGCGTCAGTCCT
    AACTCAAGATCAGCTAAAACACCGCCATTTGCCGATGCAACGTATGCGGCGGTTCAGTCGGCTATAAATAAAAAATCTCT
    ACAGATTCAAGAGCTTAAATCAAAATTAAACAGTTCTAAAGAGAGTTGTACAAACTTCAAAAGACAAATTGATGACAATG
    AAAATGAACGTCGACGATTAGAGAATCAAGTTCTCGCCATGAGAGATGAAATTGAAAGTTTACGACGAGATAAAGATGAT
    AGTTTTAGAGAAGCGGATCGGTTTAAAAATGCTCTGAACATCACTTCAAATGAACGAAGCCAATTGGAAAAGATTCGATC
    ATCACTAAACGATCAAATTGAGCAGCAACTCACAGAAATTGAACGACTTAAGTCAGCCAATCACGAATTACAACGATTGA
    GAGAGGCATTGGAAGATGAGCAAGAAGATACTAAAAAAGACTTAGAAAGACAAATTAAAGAAAGTGAAAGATGCCAACGA
    TCGATTGATGTTTTGGAAGATAAAATAAGTCGATTTAAAGAAGACGTAGTTAATTACAAAGAGGCAATTAATAAATACCA
    ATTAGAAAAAGAAGTATTGGTGCAAGAAAAGGATGAGATTGGTGATGCTTTAAGTCGTTGTGAAATTTCTAAAGCCGAAT
    TAGAAATCGAGGTGAATAAACGGCAAACTATTGAAGTAAATTTGGAAGAAAACATTTCAAAATTATCCTCAGAAATCGAA
    GAATTGAATGATAAGCGAGCTGAAAACCACAGAACTATTAAACAGCTGGAACATGAAAGAAGTTCTCTTTTGAATGAAAA
    ACGATTTTTGGAACAAGAAAAAAGTGGTTTGAAAGATGAGCTTGTTCGATCTGAACAAGAGGCTCTTGGTTTGTCAAATG
    AGAAAGCCATTCAACGTCAAAGAATCGAACAACTTGAAATTAATACAGAAAGATTAGAAGAAGAGTTATCGGAACTCAAT
    CGAGAAAAGCTAGATCTTACTGAACAAATAGGCTGTTTGCAGAGGCAGAAATCGGCTCTTGCAGAAGAATTGTTGCAATG
    TCGTAGAGAATTAGAACGATCTAATAACAGTGTCAACAACTTATCAAAAGAAAAGGAATATCTTACCAAAGAGAAAGGAG
    AACTCGTCGTTCAAGTTACAGCTTGCGAAAGGGAAAATCGTCAACAGTCAGAAGTTATTGCTTCTTTGAATTCCGATAGA
    GAACAACTGGAAGCTACTCTTTATGATGCTCAACAATTAATCATTCAGTTGGAAACTCGAAAAGAGCAATTAGAAGGCGA
    AAACCAAGAGTTGATTGTGAAAAAAGAAAATCTAAATGGAGAACTAGTCAGATTACGACAAGAGTTTCAACTAGAATACG
    AGAAGGTTGTTAATTCACGAGAACAATTAAATTGCAGATATCAACAAATGGATAAAGAATATAAGATGGCAATTCAACAA
    GAGCGAGATTCTCATGCTGAAGATGTAGAAAGACTAACTAAGATAAACGAAAGCAATCGTCATGGATCTGAAAACGAACG
    AGAAGAGCTTATTCATCGATTCAATATGGAGCGTGACGACATGATTCAAAATTACGAACAAGAGAAACAAGAAATGGCCC
    AGGAAATCATGACGATCCAACGAGAACGAGATGACTCATTATTAATGGCGGAAAATGAAAAGCAGCAATCATTGAGTTTA
    TTAGAACAAGAAAAATGTGCAATCAATGAAAAGCTTATCAAAACGCAATTTGAACTGCAATCGGTTGAGTCGGAATTGGA
    TCGCATTAAAAAGGAGTCGTCCAATCGTCAGGAGCAAGACAAACAGAACATTGCCGGCTTGTCGAGTGAACTCAAATCAT
    TTAGATCTCAATTTGAGGATAAATGCCAAAATCACGAAATGGAAGTTAAAAGCCTAAATAGTGGAATCAAGGATCTAACA
    TTAATGAAAGATCAAGCTCTCAAAGAAGTCCATGATTTGCATACCGGATTAAAAATAGCTGAAGAAACCCGTGATAATTT
    GCGTCGGGAAATCATGGAAATGAATCGGAAATTGAAAGAAGCTGAGGAAGCCAAAGAGCACTTAAAGCGTGAAATTAATG
    AATTGAAACGTGGATTATGCGAAGAACAAAGGGAAAAAGAAAATGTTATTAACTCAAATGAGAATTTGAGAAAGAAAATT
    AAAGATGTTGAAACAGAAAGAATTGATTTGCACAGACAAGTAACGGATTCCAAACAAAAGGTTGCAGTACAAGATGAACA
    ATTGGTCAATTCCAAACAAGAGGTCAATGAGTTAAGAAACAATCTTAAAGACGTAGAAAAAGCTCGATTAGATGTCAAAA
    GAGAGTTACAAGAACTCAGACGCCATATCAAAGAGCTAGATACGGAAAGGGGCAAATTGACTAAAGAAGTCAATGATTTG
    CAAACTCGTGTTGCTAGAGATGAAGAAAAAGAGGATGAAGCTCGTCGGGAAAATTTCGGTCTCAAACAAAAAGTTGTTGA
    AACGGAAGCTTCAAGAGAAGCCGTTCGTAAAGATCTTGCTAATGCTCAACGACATATTGTTGATTTGGAAAATGTTCTGC
    AGAGCAAAGACAGAGATTTCAGTTCCATGGTGGAATCGAGCCGCCGGGATTATAGGAAACTTGCTGATGCGAGAAATAGC
    CTGCAACAAGTATATGATACGATGGTGGCCGATAATAATGAGCTGAGAATTGCTCTCAGTGGAGCAGAAGGTCGGGTCAG
    TGCTCTGGAGTCACACATCGCACGAGTTGAAGGAGCTAAGAAAGAAATTGAATTCAAATTGGCTTCTATCCATAGCTCAT
    TGCGAAGGCTGATAGGATTCCGACAGGAGAATGTAGTTACTATTCGGTCGAGAAACAACTCCAAATCTCCAGTTAGAGGT
    CGATCAGTTAGTCCTCTTAGAAGTAGGCCGGTGTCGCCAACCAAAGGATTTGACAATACCTATGCTACTACAACTGATGG
    AAAAGGTAGCCCTATCCCGCGCACAGGGTCTCCGAGTTCTAAACGAAGGCAATTATCAAGATCTCCGTCTAATTGCGATT
    TCAATCCAGTCGATATAAATCCAGAAGCAGTTCGTCTGGCCTTGCGAGAATTCGTACAGCAGTTGGTTGATGCTGAACGA
    GATAGAGATGACGCTTTTGCTCAAGCTCGCAGCCTAGAATCTCGATTGAAAGAACAAGAAGAACAAAATGAATATGCTGA
    AAACCGTTTACAACAACTACAACAAGCTCTGTGTGATGCAGAAGAAGACAAAAAAGGCATTGATGGAAGATTGTCATCAG
    CCCAAACTGCCTTAATGATGCAAGAAGAGACTATTCGGCGCAATGAGAGAGATAGAAAAGCAATGGCGGAAAAGTTGAGT
    AATTACGATAGAACATTTGCATCCATGGAATCAGAAAAACGACAATTGGAAGATCGGTTGAATAAATTCCGTCATCATGA
    TGCCCGATTGGAAGAAGAACATAAGCAGAGCAAAAAAGCTATTGAAAATGCTGAAAATAGAATAACTCAGCTTCAGCTTG
    CCAAGCGATCGTTAGAAGGAGATCTTCAAAGAATGAAAATGGCGTTGACAGATAAAGAAACAGAAACCGAAGTTTTGGAT
    GACCGCGTAAATAGTTTACTCAAACAAATACAAGATCTCGAGGGAAAATCTCAATCACTTCAACTAACGATTGACAGAAT
    GAGTGTCGCCCTTGCAAAAACTGAGGAAGAAGGCAGTTTTCATAAGGACAAAATGCAACAGTTGAATATGAGTTTGAGCA
    CTCATTCACAACAACTGGAACAATTACAGAATAAGATTTCTCAATTACAAAAAGCACTCGGCAGTTCAGAACAAGATCGT
    CGGCTCTTAGAGGAACGATTAGAAAGCTCTAAAGGAGCATTGCATGAGGCAAAACATCAAAATAATTTGTTGATGGAAAG
    AATACAAATAATTCAATCCGATTTAAATGATTCGGAAAATCGTCGATCAGAATTGGAAGGATTAAATCGACAGAGTAACA
    CTTTGATTGTACAAAGACAAGAAGCTGAACAAGAACTCAATCAAAAATATCAGAAATTGAACTCGGAGAAAAACACATTA
    CAAGAGCGAGTGAATAGCATGCAACGAAATTTGGCTTTGGCAGAAGCAGAAAAACAAGAAATAATAAAAAACCACGGAAA
    ATTGGAAAAGGATAGATCTGCCTTGAAAAAGAGTCTTGGAAAAGTTGAACGTCAGAAATTGAAAACCGAAGAAATTGCTA
    GCAAAACTGTTTTTGAACGTTCAGAATTAGATCAAATTTTAAGGAGACTTGAAGATGAAAATTGTGAATTACAGAGACAA
    GTTGGAATTCTTCAAAATCAATTAGCAGAAGCTGAGCAAGCTCACTGCCACCATTTGATGGAAATCAATTCCCGCCATCG
    CCAGGAAATGTCCATGGAAATGGAGCATTTGAGAGCATCGAATGTTCAAATAGAACGAACTCTAGAAGGCAGAGAACGAG
    CCCACAGACAAAGAGTTAAGGGTCTGGAAGAACAGATCTCCACCCTCAAAGACCAGCTGACTCATGAAATGCAGAGGCGG
    ATGGATAGTGGATATTACGAGTCTACCAGAAAGTCTAATCAATACGATTCAACTGGTGACTTGCGACATGTTCTGGATTC
    CAGTTTAACTCGAGTTGCAAAAGACCCTCAACTGGACGCAATGCTACTGGAAACCGAAGCCAGGCGACTCGATGAGTCGA
    TATTCATGTGTGGCAGTCGTGATCAGTCTCCGACCCGGCAGAAGCGAATCGAAATGTCAAAGAAGTCCGCAGCCCCTAAC
    AATTCCAATCGGCGATTAACTGCCGGCCGTCGCAAATGAACTCGGCCTGTTCCAGTCCGTCCAGAGATGTTATGAAGCCA
    CTTTTTAGATGCGTGAGTGTGAGTTCGTGTTGGTGACTGATTCATTTTTAGTAAACAGATTCTGGATTTTTGTTTTTATT
    GATAGTGTAATTTCCTAATGCAGATCTGATAGTTGACTTGTTGTTCTTACGTATTCGGTATTTGTGATTCACATAGTCTG
    TCATTGTTACTGTGATTTATCCTCTGTGTGACTTTTGTGATTTACTTACTTTATTGCCCCTATAATCAATAAATGGATTT
    ATCGATAGTTCAGCCCTCCCCTCCAGCCCTCGTTTTGGGATCCGTAAATTTTGTTTCAATTGAGATCATTATAGTGATTT
    TATTCCTTCGAAACCAAACCTTTGGGAGGGACATAAAATTAAATTATTGATTTTTTATTATCTTAGAAGTGAAAGATGTT
    TATTTCCCAAATTAACTAATATCAATAATAACTTTAATTTATATCTTCATTA

     

    back to top