protonephridia

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ In Situ Hybridization Data

  ▻ Sequences

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  protonephridia


DEFINITON:

  Excretory organs consisting of flame cells, proximal tubules, and distal tubules connected to a mesenchymal collecting duct.


TERM DEFINITION CITATIONS:

  PMID:21828097, PMID:26057828, OCLC:16809160


TERM CITATIONS:


TERM ID:

  PLANA:0000020


ABOUT THIS TERM:

protonephridia

  ↳is a material entity and organ

  ↳contained in tail, copulatory region, posterior region of the whole animal, parapharyngeal region, prepharyngeal region, head, dorsal region of the whole animal and anterior region of the whole animal

  ↳develops from protonephridial progenitor cell

  ↳existence overlaps Stage 6, juvenile, asexual adult, adult hermaphrodite, Stage 8 and Stage 7

  ↳part of renal system


  → protonephridial progenitor cell develops into protonephridia


Expand to see terms that part of protonephridia


DEPICTED BY:


BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30021661Carbonic anhydrase 7CAVII-1Stage 6, Stage 7, Stage 8distal tubule, protonephridia, renal system
SMED30030379POU domain proteinpou2/3Stage 5, Stage 6, Stage 7, Stage 8protonephridia, renal system, protonephridial progenitor cell
SMED30030007RootletinH.2.8b, croccStage 5, Stage 6, Stage 7, Stage 8protonephridia, renal system, integumental system, Category 5 cell, proximal tubule
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30030007 ID=SMED30030007|Name=Rootletin|organism=Schmidtea mediterranea sexual|type=transcript|length=6612bp
GTTGTTTTTAAATCACTATTTTTTTTATTTCATCTGATTATAATTTTTTTTTATTGAAATTTGTATTTTGAAATTGGTGA
ACAATGAGTGAGATAGATTATTCCGCTATTGTTCGGAGACGCATTGGAGATATCGATGGGGATTCAAGTGAAGATTCCAG
TTCAAAGGGTTTGCTTCAAGTTAACTTGGAACTGAGAAAGCGCTTAGAGGAAGAACACAATGAGTATCGTAGAAAGCTGA
TAGTTTTCCAAGACAGCCAACAGAAACAAGCGCAATTGGTTCAAAGATTGCAGAAAAAGGTATTGCAATACAAAGAAAAA
TGCACGGAACTTGAATCTAAAATGCAATTTGGCGATTATGAGACTCGAAAAACGAAGTATGGAAGTCCAACGAATAACGG
CTATGGGTCGCGTAGTGAGAATCCCTACGACAATCTGGATTTGGAGAGCACACTCATTAAGTTAGAAGAGGAACAAAAAA
AAACAAATTATCTAACGGAGTTCAATGAACGGCTTCAAGAACAATTAACTCAAGCAACTCAATCAAACCAGAATTTGACG
AGAGACATCAGTAAGCTTTCCGAAGAATGGCAGAGATCAAGGGAGGAGCTTGAACAGAGAGAAAAAATTTGGCGAAATGA
AGAAATGTCATTTAATGACTATTTAGCATCTGAGCATTCGAATCTGCAAAATTTGCAACGCAATACGATAAATTTCCGCC
GTCAATTTATAGAATTGAAAGCTTCAACTGAACGGGAAATAAATAATTTGAAAAATGAATTCAACCGACAGGCACGCTGT
TTGCAAACTGCTTGTTCCAATCTTTCGTGCAACATGAAATCTGCAGAATCTAAACAACAATTGAGTACTGAACGAGAAAG
TCGGGACAAGTTGAATCTCGAAAATCAACTGCGAGAAAAAAACAGAGAATTAACTGATTACCAAACTCGGTATGAATGTG
AAATGACAGAATTGCAACACCGAGTGAAAGAATTAACAGTTCTCAGTGACAAACTGAAAATTCAAAACCTGGAAAAGGAT
CGAGCATTGACAGCTTTGCAAAGAATTAAGAATGGAGATACCGCAGGAGAAATAAATATGGAAGACAAAGCTACAAGAGT
TCTTATTGAAGACACAGAAAGTATGCATCAAGCACTTCGAAATATTTCTCAAGTAGTACTAAATGATTCTGACTATTTCG
ATGCAGAAGACACAGGATTTGAAACAGTTCGAAAGAATAATCGTTCGCCAAGTCCAAGGAGAAATCGTAGCGTCAGTCCT
AACTCAAGATCAGCTAAAACACCGCCATTTGCCGATGCAACGTATGCGGCGGTTCAGTCGGCTATAAATAAAAAATCTCT
ACAGATTCAAGAGCTTAAATCAAAATTAAACAGTTCTAAAGAGAGTTGTACAAACTTCAAAAGACAAATTGATGACAATG
AAAATGAACGTCGACGATTAGAGAATCAAGTTCTCGCCATGAGAGATGAAATTGAAAGTTTACGACGAGATAAAGATGAT
AGTTTTAGAGAAGCGGATCGGTTTAAAAATGCTCTGAACATCACTTCAAATGAACGAAGCCAATTGGAAAAGATTCGATC
ATCACTAAACGATCAAATTGAGCAGCAACTCACAGAAATTGAACGACTTAAGTCAGCCAATCACGAATTACAACGATTGA
GAGAGGCATTGGAAGATGAGCAAGAAGATACTAAAAAAGACTTAGAAAGACAAATTAAAGAAAGTGAAAGATGCCAACGA
TCGATTGATGTTTTGGAAGATAAAATAAGTCGATTTAAAGAAGACGTAGTTAATTACAAAGAGGCAATTAATAAATACCA
ATTAGAAAAAGAAGTATTGGTGCAAGAAAAGGATGAGATTGGTGATGCTTTAAGTCGTTGTGAAATTTCTAAAGCCGAAT
TAGAAATCGAGGTGAATAAACGGCAAACTATTGAAGTAAATTTGGAAGAAAACATTTCAAAATTATCCTCAGAAATCGAA
GAATTGAATGATAAGCGAGCTGAAAACCACAGAACTATTAAACAGCTGGAACATGAAAGAAGTTCTCTTTTGAATGAAAA
ACGATTTTTGGAACAAGAAAAAAGTGGTTTGAAAGATGAGCTTGTTCGATCTGAACAAGAGGCTCTTGGTTTGTCAAATG
AGAAAGCCATTCAACGTCAAAGAATCGAACAACTTGAAATTAATACAGAAAGATTAGAAGAAGAGTTATCGGAACTCAAT
CGAGAAAAGCTAGATCTTACTGAACAAATAGGCTGTTTGCAGAGGCAGAAATCGGCTCTTGCAGAAGAATTGTTGCAATG
TCGTAGAGAATTAGAACGATCTAATAACAGTGTCAACAACTTATCAAAAGAAAAGGAATATCTTACCAAAGAGAAAGGAG
AACTCGTCGTTCAAGTTACAGCTTGCGAAAGGGAAAATCGTCAACAGTCAGAAGTTATTGCTTCTTTGAATTCCGATAGA
GAACAACTGGAAGCTACTCTTTATGATGCTCAACAATTAATCATTCAGTTGGAAACTCGAAAAGAGCAATTAGAAGGCGA
AAACCAAGAGTTGATTGTGAAAAAAGAAAATCTAAATGGAGAACTAGTCAGATTACGACAAGAGTTTCAACTAGAATACG
AGAAGGTTGTTAATTCACGAGAACAATTAAATTGCAGATATCAACAAATGGATAAAGAATATAAGATGGCAATTCAACAA
GAGCGAGATTCTCATGCTGAAGATGTAGAAAGACTAACTAAGATAAACGAAAGCAATCGTCATGGATCTGAAAACGAACG
AGAAGAGCTTATTCATCGATTCAATATGGAGCGTGACGACATGATTCAAAATTACGAACAAGAGAAACAAGAAATGGCCC
AGGAAATCATGACGATCCAACGAGAACGAGATGACTCATTATTAATGGCGGAAAATGAAAAGCAGCAATCATTGAGTTTA
TTAGAACAAGAAAAATGTGCAATCAATGAAAAGCTTATCAAAACGCAATTTGAACTGCAATCGGTTGAGTCGGAATTGGA
TCGCATTAAAAAGGAGTCGTCCAATCGTCAGGAGCAAGACAAACAGAACATTGCCGGCTTGTCGAGTGAACTCAAATCAT
TTAGATCTCAATTTGAGGATAAATGCCAAAATCACGAAATGGAAGTTAAAAGCCTAAATAGTGGAATCAAGGATCTAACA
TTAATGAAAGATCAAGCTCTCAAAGAAGTCCATGATTTGCATACCGGATTAAAAATAGCTGAAGAAACCCGTGATAATTT
GCGTCGGGAAATCATGGAAATGAATCGGAAATTGAAAGAAGCTGAGGAAGCCAAAGAGCACTTAAAGCGTGAAATTAATG
AATTGAAACGTGGATTATGCGAAGAACAAAGGGAAAAAGAAAATGTTATTAACTCAAATGAGAATTTGAGAAAGAAAATT
AAAGATGTTGAAACAGAAAGAATTGATTTGCACAGACAAGTAACGGATTCCAAACAAAAGGTTGCAGTACAAGATGAACA
ATTGGTCAATTCCAAACAAGAGGTCAATGAGTTAAGAAACAATCTTAAAGACGTAGAAAAAGCTCGATTAGATGTCAAAA
GAGAGTTACAAGAACTCAGACGCCATATCAAAGAGCTAGATACGGAAAGGGGCAAATTGACTAAAGAAGTCAATGATTTG
CAAACTCGTGTTGCTAGAGATGAAGAAAAAGAGGATGAAGCTCGTCGGGAAAATTTCGGTCTCAAACAAAAAGTTGTTGA
AACGGAAGCTTCAAGAGAAGCCGTTCGTAAAGATCTTGCTAATGCTCAACGACATATTGTTGATTTGGAAAATGTTCTGC
AGAGCAAAGACAGAGATTTCAGTTCCATGGTGGAATCGAGCCGCCGGGATTATAGGAAACTTGCTGATGCGAGAAATAGC
CTGCAACAAGTATATGATACGATGGTGGCCGATAATAATGAGCTGAGAATTGCTCTCAGTGGAGCAGAAGGTCGGGTCAG
TGCTCTGGAGTCACACATCGCACGAGTTGAAGGAGCTAAGAAAGAAATTGAATTCAAATTGGCTTCTATCCATAGCTCAT
TGCGAAGGCTGATAGGATTCCGACAGGAGAATGTAGTTACTATTCGGTCGAGAAACAACTCCAAATCTCCAGTTAGAGGT
CGATCAGTTAGTCCTCTTAGAAGTAGGCCGGTGTCGCCAACCAAAGGATTTGACAATACCTATGCTACTACAACTGATGG
AAAAGGTAGCCCTATCCCGCGCACAGGGTCTCCGAGTTCTAAACGAAGGCAATTATCAAGATCTCCGTCTAATTGCGATT
TCAATCCAGTCGATATAAATCCAGAAGCAGTTCGTCTGGCCTTGCGAGAATTCGTACAGCAGTTGGTTGATGCTGAACGA
GATAGAGATGACGCTTTTGCTCAAGCTCGCAGCCTAGAATCTCGATTGAAAGAACAAGAAGAACAAAATGAATATGCTGA
AAACCGTTTACAACAACTACAACAAGCTCTGTGTGATGCAGAAGAAGACAAAAAAGGCATTGATGGAAGATTGTCATCAG
CCCAAACTGCCTTAATGATGCAAGAAGAGACTATTCGGCGCAATGAGAGAGATAGAAAAGCAATGGCGGAAAAGTTGAGT
AATTACGATAGAACATTTGCATCCATGGAATCAGAAAAACGACAATTGGAAGATCGGTTGAATAAATTCCGTCATCATGA
TGCCCGATTGGAAGAAGAACATAAGCAGAGCAAAAAAGCTATTGAAAATGCTGAAAATAGAATAACTCAGCTTCAGCTTG
CCAAGCGATCGTTAGAAGGAGATCTTCAAAGAATGAAAATGGCGTTGACAGATAAAGAAACAGAAACCGAAGTTTTGGAT
GACCGCGTAAATAGTTTACTCAAACAAATACAAGATCTCGAGGGAAAATCTCAATCACTTCAACTAACGATTGACAGAAT
GAGTGTCGCCCTTGCAAAAACTGAGGAAGAAGGCAGTTTTCATAAGGACAAAATGCAACAGTTGAATATGAGTTTGAGCA
CTCATTCACAACAACTGGAACAATTACAGAATAAGATTTCTCAATTACAAAAAGCACTCGGCAGTTCAGAACAAGATCGT
CGGCTCTTAGAGGAACGATTAGAAAGCTCTAAAGGAGCATTGCATGAGGCAAAACATCAAAATAATTTGTTGATGGAAAG
AATACAAATAATTCAATCCGATTTAAATGATTCGGAAAATCGTCGATCAGAATTGGAAGGATTAAATCGACAGAGTAACA
CTTTGATTGTACAAAGACAAGAAGCTGAACAAGAACTCAATCAAAAATATCAGAAATTGAACTCGGAGAAAAACACATTA
CAAGAGCGAGTGAATAGCATGCAACGAAATTTGGCTTTGGCAGAAGCAGAAAAACAAGAAATAATAAAAAACCACGGAAA
ATTGGAAAAGGATAGATCTGCCTTGAAAAAGAGTCTTGGAAAAGTTGAACGTCAGAAATTGAAAACCGAAGAAATTGCTA
GCAAAACTGTTTTTGAACGTTCAGAATTAGATCAAATTTTAAGGAGACTTGAAGATGAAAATTGTGAATTACAGAGACAA
GTTGGAATTCTTCAAAATCAATTAGCAGAAGCTGAGCAAGCTCACTGCCACCATTTGATGGAAATCAATTCCCGCCATCG
CCAGGAAATGTCCATGGAAATGGAGCATTTGAGAGCATCGAATGTTCAAATAGAACGAACTCTAGAAGGCAGAGAACGAG
CCCACAGACAAAGAGTTAAGGGTCTGGAAGAACAGATCTCCACCCTCAAAGACCAGCTGACTCATGAAATGCAGAGGCGG
ATGGATAGTGGATATTACGAGTCTACCAGAAAGTCTAATCAATACGATTCAACTGGTGACTTGCGACATGTTCTGGATTC
CAGTTTAACTCGAGTTGCAAAAGACCCTCAACTGGACGCAATGCTACTGGAAACCGAAGCCAGGCGACTCGATGAGTCGA
TATTCATGTGTGGCAGTCGTGATCAGTCTCCGACCCGGCAGAAGCGAATCGAAATGTCAAAGAAGTCCGCAGCCCCTAAC
AATTCCAATCGGCGATTAACTGCCGGCCGTCGCAAATGAACTCGGCCTGTTCCAGTCCGTCCAGAGATGTTATGAAGCCA
CTTTTTAGATGCGTGAGTGTGAGTTCGTGTTGGTGACTGATTCATTTTTAGTAAACAGATTCTGGATTTTTGTTTTTATT
GATAGTGTAATTTCCTAATGCAGATCTGATAGTTGACTTGTTGTTCTTACGTATTCGGTATTTGTGATTCACATAGTCTG
TCATTGTTACTGTGATTTATCCTCTGTGTGACTTTTGTGATTTACTTACTTTATTGCCCCTATAATCAATAAATGGATTT
ATCGATAGTTCAGCCCTCCCCTCCAGCCCTCGTTTTGGGATCCGTAAATTTTGTTTCAATTGAGATCATTATAGTGATTT
TATTCCTTCGAAACCAAACCTTTGGGAGGGACATAAAATTAAATTATTGATTTTTTATTATCTTAGAAGTGAAAGATGTT
TATTTCCCAAATTAACTAATATCAATAATAACTTTAATTTATATCTTCATTA
>SMED30028196 ID=SMED30028196|Name=POU domain protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1170bp
GTATTTAGTAATTTAAAAATAACCTATTTATATTATTGATTAACATAATATAAATATTTAACATCTATAAGATTTCATGA
ATTATTACTACCAATAATTTTTTTAAACTTAAAACACTTGATAAGTATCATGAAATGTTTTTTATTTCCTATTGAATCTA
CAGAAAAGGATAAGTCTTGCACCTTTGTTCTGAAAGATATTAATGAAATTCGAATTTCTGTTCCTATAAAGATATCAGCA
AATAATGATTGTAATAAAACAATTAGCTTTTCTAATTCAGATTTAGAAACTTTAGCCAAAGAAATATCAGCTGCTTTTTC
TAGTAATACTATTGAAAAGAGTACAGAAATAAAAACACTGAATGATTTTATACTTAATCAAAACAAAGATCTTCAAAATT
ATATTAATCATGTTAATGATATACCTACTTTAGATGACTGTTTGCGAAGTAAAAATTTTATATTCAAAACCGAACAAGAT
TTAGAAAGTTTGCATAAAACTCCTTCGACGGCTAGCGAGCAAGAGTCATTAAATATACTATTGAATAAATCTTTGGTTTT
TGATCTGGATTTTATTAAGCAATTTACTAAAGAATTTAAACAATTTCGACAAAATTTAGGAGTAACCCAAATGGAAGTCG
GCCAGTCCATGAAATATTATTTGAAAAGTGATTTCAGTCAAACAACGATTTGTCGATTTGAGTCTATGACGCTGGCATCA
ACAAATATGTTTGAATTGATTCCATATTTCCGAAAATGGATATCCAAAGTATATAATCCCGACAGAACCAAGACAATTAA
AAATGTCATTTCTAAACTGGAATCAATTGACATTTCTCGAGCATTGGAAGACGAGTTTGCGAAAGATAAAACGGACAGCG
AGTCCAGCAATAACAGTAATGGTGATGAAATGGTAAATGTCAAAAGCAAAACTCGGAAACAACGAATCCAATTTACGAGA
TTTCAGTTGAAAAAAATGGAAAGTCTTTTTCAAACAGTCAAACATACGCAAATTACACCGCATGTTTACAAGAAATATGC
TAAAGAATTGAAATTGAGTGAGAAACAAATCCGATGTTGGTTTACTAAGCGCAGAAGGAGTGATAGAATGCACAAGAATA
AAATGAAAATGGAAAAATTTAATTTATAAATAAAATTATGAAAATTTACG
>SMED30010910 ID=SMED30010910|Name=POU domain protein|organism=Schmidtea mediterranea sexual|type=transcript|length=3203bp
TAGGGCTAAATGTAACGCTACTTATCGGTATTGCCACAATTATATTAAGGCAGTGGCACAAACTTATTTTCTCTACCAGG
CCTGCTGAATCGACAAACAAACATATTCATCGTCATTAAATGGGCAGTAGTAGTAGAAACACAGTGGTAAAGACATGGCA
AACACAGCAGCATCAGTGATAGCTGGAAGAGATAGCTACAGCATCAGCAGCAGTAACTCTCGCAGCTAATAATGAAGATA
ATGAGCTAGACTTAATTATCTTGGCTAATAATTTCAAATAAAATATCGCAACTAATTTTGTCATTCGTATTCTGTGAGGA
TAAATCACAAATTTGTTTCGATTGTTGGAAATTTAAATTTTTTTCCCTCGTATTTTCCAAATACTCCAGAGTTTGAAGAG
TATAATGAATTTGTTACCGAATCCGTTACTCACAAATGTGCTGGATATGACTAAACTTGACCAACAAAACCAAATTATCT
CGTGTGGCAATTCGACAAATTTCACCAACAAAAACACAATTGACAGCTCTTCAAATGATACCACACAAGTCAGTTCAACA
GCCAACAACATCAGTTCAATTGAACATTTCCTTTCATCCCGCAATTTAACAAATCAGCTGATAAATAATTCCGGACTCCC
ATTAGGGGCACAGATATTCACCATTCCGGCATCATTGGCGACATTCCCGAATTCGGATTTGATTCCAGTATTCATCAACA
GTTTAGGACAAATGGTTCTGGCAAATACTGGGAATATTCTGGCGAACAGTTTGGCAAGTTTGGCCACCACACTCACGTCA
ATCCAGCAGCTGTCCGTGAACCGTGAATCGAATGTCATCAACACTAATCAAACTACTAACCCAAATGCAGCTATCATAGA
GCACATGATGCAGCAATACCAACAGCTTCAGCTGCTGAAGAACTCAATGATCCATCAATCATGGCCGAATGAGTTCCAGC
AGACATCCTCAAACAACCAAACCAATTCATTTATTGCAAATAATATACCAGTAGCAACTACAAATTCTAGTACAATTAAA
CCCATAGATAAAGTTAATGGCAGTACGCAATTCCAAATTCCGTTGAATTGCAATCCTGCTCCTCTTCAAAATGAAAAATT
TACTACCAATATCATCTCCATAAATGATCGTGCTATAGATAACAAATCCCCAAGCGTCAACTCTTCGGTATCCTCTAGAT
CAGTAGGAAACAAAATTTGTCAAATGATTGACGTCAGTCATGATTACATTTTAAGTCAAGAAGATCATCTGGTGAAAGAA
AAAGCCGCAGAATTACTCCGACATTCACACAACCAAAAAAACGCTATCAAACATGCCCAATGTTCTGATAAATCAGAACC
AACAGCACATAATGTCACAGTGGATGGTGTTGATCTCGGTGAAATCAAAGAATTTGCCCGTAATTTCAAAATTAGACGTC
TCAGCATGGGGTTAACTCAAACACAAGTCGGTCAAGCGCTGACTGCAGCAGAAGGTCCGGCATACAGTCAAAGTGCAATC
TGCAGATTCGAAAAGTTGGATATCACACCGAAATCGGCTCAGAAAATTAAACCAATTCTAGAGAAATGGATCAAAGAATC
CGAAGAAAAATATCTCAGTGGATCGAACAGTGTTGATGATGGATCCGGATCTGACATCAATAAAAAACGGAAACGTCGAA
CGAGTTTTACACCACAAGCACTGGAAATTCTGAATATTCATTTTGAGAGGAAATCTCATCCGACTGGATCGGAAATGCGA
GCATTGGCTAACGACCTCAATTATGACAGAGAGGTCATTAGAGTTTGGTTTTGCAACAAAAGACAAGCGTTAAAGAATTC
TGCCAAGCGAATTAAACAATGTACACCAAACAGCGAATCAAACAACCAGCACATATCTCCCCAAGTCATGAACAGCAACA
GCAACAGCAACAACACCACCATCACCAACCGGGCAGTCACCTAGGCCAAATGCATCCATCCATGATGGACATGTATCAGC
CACACGCGTTCTCAAGACCCATTACTGCTGAATACCAACAGAGTCTCAATCGGCAACAATATCGACGCAGCGACAGCGAT
TGTGGAACTCATGAGCCTGGATATTCGTACCTGCCGACTCCTCATGGGCCAGAAGTGGTGTCATCTCGTCAACATACTCT
CAATAGTCTTCCAGAACAACCGATGGACAATAACAATCATGATCAGCATGATTCTCCAGTACCGATTATTGCCAACAGTA
GCAACAGTAACATCAACAATAACAACAGCAGTTCTGGTCGACATCATCATCGTCGCAAAACCAGATCTCGACAAACCAAT
AATCAAGAGCCGACATCACTAGAACGGAGCCAAGTAATGAAAAATCACAACGACATACCACCAATGTTAGCGCCACGGAC
AAAATTGCCGTATTCCGAGCATCAGGGAATTCATCGTCTATCCGCTCATGAAATGAATACCATTGACAGTCGTGACAATG
CTGTCAATGATTGCAATTCTGAATCCAATACCGCTGGCGCTGTCAGCGATAATTTCGACCCTCCTCTTCATACTCCGGCC
ATTACGATACCAATGAGTCGAAGTACCGCATGGATTGCAACATCGATATGAATGAAAATGAAGCAACTCCCAGTAATTCT
CTGTTGATTGAGAACCTTCCCAGAGTTAGAGATGTTTCCGAGTATGGAATACCTATAAACAATAACAATCACAACATGAA
ACAAGCTCCCGTGCCTCCTCTTAAATCGAATAGTCGACATAATCCTGTGCCTAACAACAGTTACGGTCTCGAGTGCAATC
CTGATTATTATTCATCTGCCACATCTAGTGACAGATCCGGTCCCAGTCCTCCCCCTAAATATGCGCCAGGAGTAGTTCTT
CCTGCCCGTGCTGATGAAATATATATGCGCGATCAAAGAGAAGGAATGTACTATCACGGAGATACTCATTGTTGATAATT
GTATTTCACAATTTCGTTTCATCGGGTGTTCTCGATTGCTGATACTCTATCTCATACCTTTCGATGAATTTCTGATCCCA
ACTGACAGTTGTACAATTCTTATCATCATCATCATCTTCCTCATCTTTTCATATTTTATCTAGTCCTACTTGCAATCTTC
TCCGTGTGCTCTCCACAGTGCGATTATTATTATAATAATAAATTATTGCTATTGATTATTATAATTATTGTTATTGATAA
TAA
>SMED30001958 ID=SMED30001958|Name=POU domain protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1820bp
GAAGATTTCAACCAATTTCATTGTTAAAATTTTCATAAAATCGCCGTAATTGGCTGTCCGTTGCGGCAGTGGCAGTCAGG
CAACTCCGTTCACTCAGCAGCCAATAAACTCGTTTGGAAATATTCCTACTCAAATCAAATTGATTTCTCATAAAAAAATT
TGCATATCTTCTCACTTTTTCTATATGCATTTCATTGTTACTTGGTGAAAACTGAATGCCATGACCCAAGTTAGTCACAT
AGGTTCCTCTCATTTCAATATTAATTCTTCAATCAAAACTGCTCTTCCTTTAATTAATTCTCAATACAATTCATTGGTAA
CCGAAACATCTATTGGTTCCAACATCAACCTACCGTTTCGACTCGATGCTCCATCTCTATTCAATGGGCTACCGGAAGAA
TGGGGTCCCACTGACAGCGAGTTAACTCAAGCGGTCAATCATGTAAATTACGCCGGATTATCCGAGTCGAGCATTGATTA
CAAGTTTTGCAGCACTCTCAATTCTTATTTTGACTCAAATCAAAGATTTGGAAATGTACCAAACGACACGTATTTAATGG
CAAATTCCATGGCAGCCAACATTGAGAACAATAGCTGGCATAACAGCCGATATTACTTCGACAGTAATCATCCTCTCAGC
CAATGGCTCCCGGTGCCCGTTAACTGTTGGTCCAATAACAATTACATTCGCGATGACTTTTACGAGAAATCTCTCCAGGA
AGATGAGTTCAAATCCCGCTCGGTAATACAAGCAACTGAGAAGAATTCCAATCCGGTAAATCCCGACCTGAATCCTTACA
AATCTATCATTTCCGATGAATCAGAAAGCATGAAAATGGCTAAAACCTCCCACAACCTTATAAATAATGACTCGATGAAT
ATGTGTAGATTTCCTCAAAATGATATTATTATGCCAGATTTAATAAATGCCCCAAGTCCATCACTGACAAATAATAATAA
TAATAATAAAGTAATAAATAATTATTATATAATGAAAATTAATATATTAATAAAAAATATTTATGCACGGTCTCAATTTA
CATCTAAATGCCATCAAATTTGGCAGGGATACTTCTAATATAAAACCTAGATCAGCTGAAAGACTTTTATATTAGATAAA
TAATCGTTAATAAATAAAACCCAATTTGCGATAAATTATGTGTGGCCTCCAGGCGGTTCCTATCAAATAAACATATGTAA
TTATACGTGTAAACACGTGCATTAAATATCTTCACAAAGTCAAATGAGTTGATTGGACAGAAAAATTAGAATCGGAACTA
ATTCTGCAATCATTCAAAAATTTGAGCTAATCTTTATTCTTTAAAAAGCAGAGAATCAGCGGTTCTTTACATTCATGCCA
GTAATGAAAAAAGTAAACCGCAAATGACTTTTATTACTGTTCTAGTAAATGCATCCCCATAAGGAGAGTAATTCACATAA
AACTTTAATTGTCAATAAAATTATTACTGGGACATCAGCGCATCCTGGCATGCACCGCAGCAATGAAAAAGTAGACCGAG
AAACTCTGAGATTATTGAGCCATCAAACGTATCACTCATTTTCTTATGTTTGAATAAAATATTTACAAATTTTAATACAG
AGATAATCGATGGAGGAGGAACACTACTATTTTTGCTATCTATAGCAATCAATAATTATGTGAAAATATAGCTGATCAAA
ACAAGATGCATTAAAACAATTTTACTTCCTATTATATACGTTTTTGAATCCTGAGTGAAGCCAGTCGGGTTAACGAATAT
TATTAAAATGAAAATAACTATAAATCAATAACTATACCTCATCACATGATGAATGGTCCA
>SMED30015552 ID=SMED30015552|Name=POU domain protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1696bp
TTATTTTTAAAGTGTATCTTAATATTTCAAGAAACTGTATTATAAATTTCACAAATTAAAATATTTGGGATATTTGTAAA
TTGTTAATAACTCTTCATAAATGTCTCAATCAGATGGAAATTTCAACTCCTTTAAAAATATTCACATTGAACAGTTATTT
AAAATTATTCAACACCAAGCAGAACAAATTGAAGCACAAAAAGTTCAAATAAACGCTTTAATAAAGTCACAGCAAACGAT
ACTAGAAAGTATGAGACCTCAAAATGATGCAAGCGTCAATTTAAATCCTTTGTCAATGAATTACCTTAATCACAATATCC
GACAATCTTTGTTGAATTCTTCCTTAATGCCTTCAAAAAATATTTTAAACAATCCCTCATTAAATTGTGCTAGCAACAGC
AACAGTAACAGCAGCAACGTCATCATCAACAACAACAACAGCAATATTGATGTTTCAGACCATTTTCTTCAAGACTACAA
TAGTCGATTAACACAACAAATTCTTCTTCAGCCTTCCTTGAATATTCCTCGCTCAAATCCCACAATAAAATCCCCTCATT
TGCCAACGAATATTGGAGGCTCAGGAAATCTAACTCCCACAACTTGTCTTAGCAACGAAACATCTGAATTGAGACCCATG
GAAAATTGGTCCAATTTTAAGTTGCAAGCTCATTCCGATACTCAAAACGTAATCAAAAAAGAAGTAGCAGATCAATCAGA
CAATTGTAACAATTCTGAAATTCCAATTATCGAAAATGATCCAAATGAAGATGAAGGAGAAATGGATTTGTCATCTCTCC
AAGAGTTCGCCGCAAAATTTAAAATGAGTCGTATTGAAATGGGATTCACGCAAAGAGATGTCGGTGTTTGTTTGGGTTTG
ATGCAGGGCAACGATTTTAGCCAGACCACACTGAGTCGGTTTGAAGCTTTAAATCTGAGTTATAGGAATATGAAGAAACT
GCAACCGTTGCTACAAAGGTGGCTGGATGATATTCAACGAGAAGGTCGTGATGCCGTTATGAGTCGCATAACGGCTTTTT
ATCAACAACAAAAAGCGATGGTGGAGGAAGACTGTGATAACAATGACCTCCAAATAGTCAGTGGCTCAAGTAGGAAAAGA
ATTGCAAATGAAGGATTGCTAATATCCGACGAGTTACCCGAAGAACGACATTCAGTCAATGCAGATTCGACTACTATGAA
TTCCAAATTATCACAAAATCAATTACTTCGCACTTGTATAGGAAATATATCGAATAGTCTTTCACCTAGTCTGCTCGGCA
ATTTGACTAATGGGTTTTCTACAAGTCTTTCCACCTCGCTCCCAACTAACCTCACTCACAGTTTTCCGAATATTCAGTTT
CAATCTTCATTACTCCACGACCAAATCGCCAACGGATTCAACAGAAATCTTTCTTCCCAACCAAAAAAACGACGTAAACG
ACCTCTAATATTGGAAGAAGGCAAATCAAGATCGGAATTGTTTCCCGATATTTTGAGACCGTAATCAGACCGGTGGAAAA
GAATCAAAAAAACAACACAAGTTCTACGGCTATTTTATTTATTTTCGCCATTTCTCGCATTGTAATATTTTGTAATTATT
AATATCCTATCTATTGTTTTATAAAATCATATTTTTTTCAAATTGAATTTTTTATTATTTTTCATTTTTATTGACCTGGT
TTGTGAGTGTTCGGAA
>SMED30002016 ID=SMED30002016|Name=POU domain protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1339bp
GTTGAATTTTTCAAAAACCAAATTTACTTATTTTGAATTGCCATAATGGAAAATGGAGTTGCAACAAGCTGTTCACTTCT
AGCTAATGGTGGATATCATAACTCTGCCTCCGTCGGTTGGAGGTTTCCGCAGAACAATTCAGCCAGCGATTCCGTTGAGA
ACGAATTTATATCAAATGCAAATCTCAAAATTACCTCTTCGAATATTCCAAACTTTTTTTACCAATGTCCGGAAAACAGT
CAATCAACGAGCAATTCTAACGGATTTTATTCAGTGGATACGAATTGCTCGGCTGGATTCCAAGACATGAATACTTACTA
TTCAAGGGTTGCAGCAGGCTTCAATCAATCCTTCGACTTGATACCTCAACACCAGTCTTTTGTGAGGCTCAATTCAACTG
GGCTATCGGAAACTGACCAAATGACTTATATAAATCCAAATCTTCATAGTTCATTTCATCGAAATATTTCATATCCGAAT
TACGGTAGTAACTGTCCTCCTAATGTTAACATAGGAGGAGTTTCCATGGTTCAAGGGTCTTCGTCATCCTTTTTAGGCTC
CAATTATTCAGGCATGCAACAACCAATTCAAGCCGTGAATCAAGGTGACATTGAATATGAAACCCGAGAATTAGAAGCTT
TTGCTGAATGGTTTAAACAAAGAAGAATAAAACTGAGAGTGACTCAGGCGGATGTTGGCCGAGCTCTCGGGAATTTAAAA
TTAGCCGGTGTTGGATCATTGAGTCAATCAACAATTTGTCGGTTTGAATCACTAACTCTCAGTCATAACAATATGATTGC
TCTTAAGCCAGTTTTGCAAACCTGGCTCGAAGACGCTGAAACCGAAGCTAAGGAAAGATTAAATGGCTCTGATGCTTTCT
CTGACATAGATGAAAGAAAACGCAAACGAACTTCAATCACAGATTCAGAAAAACGATCACTGGAAGCATTTTTTACGATT
CAACCACGCCCATCAAGCGAGAAAATTATCCAAATTGCGGAGAAATTGAATTTGAAGAAAAACGTTGTTCGAGTATGGTT
TTGTAATCAGCGCCAAAAACAGAAACGAATGAAGTTTTCCACTCTCGGTTTTCAGCACAACTCGTCAAACATGTGAAATC
CTATTTCTGTACAGGACAAATACCAAGCATTGACCCCTCTGTCTTATTACAAAAAGTGGTATGATTAAAAGTAGAATAAA
AATGATTTTTATTATTTCTTGACCGTAGCTTTTGTTTAAATTGTTTGACTTCATTTTTACGAAACTGTTATTTTTCCCAC
TGGACTGAGTCTTAGGTTCAAATGTGAGATTTGAGGTTGAGCTTTTGCTGAGAATGACA
>SMED30030379 ID=SMED30030379|Name=POU domain protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1625bp
AATTAGCTATGCGAGCTGCTTTATCAGGCATGACTGTGATAAAACTGTCATTATTTATGCGCATAATTTGCCGTTAGTAT
TTGCTCAACCAATTTGACGTTCAACAACAACAGCAACAACATCCACCACCTCCACCAACATCCTCATTATCATTATTATT
ATTGTCATGTTAACAAGCGGACTTAATCAGGAACAATCATCGCCTTTAACAATCGTAGGCATGAGTGAGTCTCAGTTTTT
CAACGAATCTATCAGATATTTGCCTCCGGAAACCGTGGAGAGACAAAGCCAATTTTATGCAAATAATAATTATCCCCTTG
GTGAGTTTTGGAATCCACAATCCGAATATGCACAATACTTGCAAAATACCCAGCCAGTCTCGGGGCCTCAATTCATTACT
TCGCCGGCGGTTGGAGAGGCATTCTATCCATCTCTTTATATCAATACTATCCATGAAAATGTATTACTACCTTCGGTTGA
TTCCTTCAATCCTCCCAGTGGATTTATGATTTCGGGATATTCACAGCAAGACCAAACCTTTCCCACGGTCAATGAACCGA
CGTATGACAATATCCCAAACAATTGGAATTATGTTGATCATTGGGTTGATTCCAAGCCAACAACAGTGAATTCTCAGCTG
TTGCCAACCTCGTCAATTTCCGCCGTCCCCATTCAGAATTCGTTTTGGGACTGCGAGTCGATTGACCAATCAGAATATTG
TCCCACAAATGTTGATACCGAGCTCCAAGATCAAATTGATTCCAACGGAGAAATCAGTAGACTCAATCAAAAGATTTCTA
CTGACGAGTTGGAGCAGTTTGCGAAAATTTTCAAACAGCGAAGAATCAAACTCGGATTTACACAAGCCGACGTCGGGTTA
GCCCTCGGTAATTTATACGGCAGCGTGTTCAGTCAAACAACAATTTGCCGGTTTGAGGCACTGCAGCTCAGTTTTAAAAA
CATGTGCAAACTTCGACCTCTGTTAGGGAAGTGGTTGCAAGAAGCCGACTCAACCGGATGTGCTCCGTCCGGTATTGACA
AAGTCACAGCTGCTGGACGAAAACGAAAAAAGCGAACCAGCATTGAGGTTGGAGTGAAAAATGCACTGGAATCTCACTTT
TCTCGACAAAGCAAACCGACAGCCCAAATCATTACACAGCTTGCAGACAGTCTCGGATTGGAAAAAGAAGTTGTCAGGGT
ATGGTTCTGTAATCGGCGACAGAAGGAAAAACGAATGACGCCTCCGCCACTGAATGGAACAAGCTCAGATTTATTTCCAC
ATCCTGGTTTAACTGTCGGAACTGATAGTTCTCCTCATTCCTCATCTCACAGTAATCATGATTCATTCTCGTCCATTGGT
AACCAGTCAAGCTTCAATCGAATAGGTGATCCCTCCTCGACTCATCCCGGAGTCATTGTCACATCTTGCGGTTATTACTA
TGGTCATGTTCCAAATGAATCACTTCTCAATTGTGGGCCTTACCCTCACAACATCATCAACAATTACGAATTCAGACAGT
CCAATGATCCCAATATCCTCAATGTCAAATCCGAGTGCATCAGCTGACTCATGTCGAACTCACCGAAAAGAAAGCTAATA
ATATTCTATTTCAATAATAATAAAA
>SMED30008552 ID=SMED30008552|Name=Carbonic anhydrase 7|organism=Schmidtea mediterranea sexual|type=transcript|length=911bp
CCGATCTAAATAATTTAATTCAATAAATAATTTCAACTAAAGTTTTTATGATTTCTGAAGATTGGGGATATGGACCTGAG
AACGGTCCACATTTATGGCACAAATCGTATTCCAGTGCGGGAGGATGTTCCCAATCTCCTATCAATATAGATCTTTCACA
GACAAAATACGATATGACTTTAAATTTACATCCTTTAAAAATATGCATTGATAGTTCGAGGACATCAAGTCAGACTTTGG
TATTTACAGGACATAATTTCCGAATCGACTGTGAAGGAGCACTATGCGCATCGGGAGGCCCAATTCCCTATGGTCAAATG
TACAAAATTTCCCAAATTGTGTTTCATTGGGGCAGTACAATTTATGGAGGATCTGAACATTTGATAAATTGTTTTCAATT
CCCATGTGAATGCCAAATGACCTGCTACAATGCCACTCGTTATAGGTGCTTCAATGAGGCGGTAAATAAAAGAGATGGGC
TAATTATCCTATCTACAATGATATTGGGAACAAAAATAAAACCCTCGATCGTTTATTGGGTCCTTTGACGTCGATTCACT
TTTTCAAACACCATGACTTCCGGCAAGAAACCGAACTGTTAGATTTGAAATGTCTTTTACCAGATTGCATCAATCGATAC
TTCACCTACACTGGGTCATTGACTACCCCACCTTGCTATGAAACTGTTACGTGGATCATATTCGAAGGATCCAACACAAT
CAGTGAGGATCAACTAAATCTCATGCAGAAAGTTCACGTAGCCGACGGCTGTAATGGCTTTGACAACTTCAGACCGGTTT
GCTCACTCGGCCAAAGAATCATTACCAGAAATTTTGTTTGAGCCTTTTTTGAACTTGATTTATTTAAATTTTATTTTTTT
AATTGCTACTGTAGTGGATGTTATGGGGAAT
>SMED30021661 ID=SMED30021661|Name=Carbonic anhydrase 7|organism=Schmidtea mediterranea sexual|type=transcript|length=1073bp
CATACATATATATATATATATATTGAGACTATTCATTTTTTTCCATACAAAATTCAAACAAAATGAAACCATTTCTATTT
CTATTTTTATTTCTTGTCTCATCTCTTGATCTGAAGATCACCGAGGCTTCAGGCACCGGAAATTGGGGCTATACGTCAAC
CAGTGACATCAAAGGCCCCTCGGACTGGAAAGACATTAATCCAACTTGCGACGGAGCTCGGCAATCACCGATTGATATCG
TGACAAGAAGTGCGGTTTATTTGAAAGATTTACAAAGGATTGAAATTAAAAAAATTGACAACTTTGCTAACTTTTCCACT
CTCGAAAGACATGAAACCTCTATTTACTTAAAGCTTAATAACAGTTGGGGAATCACTTTCGGAGGAAATCAATGCCTAAG
ACCTGACTCCATTCATTGGCATTGGGGATCCAAGGGTACTTTAGGATCGGAACACTCTCTAGATGGGAAGCATTATCCAA
TAGAAGGCCATCTGTTGTCATATAATTGTATGAAATACAGTTCTTTGAATGAAGCAAAATCGAGTCCGGAAGGTCTTTAT
GTAATTGGTATTTTTTATAAAATCGGAAAAAAAAATATGTTAATTGACAAAATTATCCCGGCAATGCAAAGTCTGATTTC
CAGTAGTGATATCTCGAGCGTGATCATTAACGAGATTTCGGTGGAGGAAATTCTACCGAAAAATTTGGACAAGTATTATC
AATATGACGGCTCATTGACGACCCCTCCATGTACAGAAAACGTCAGGTGGACAGTGCTAAATGAAGAGCTAACTATAGAT
GAATCTCAATTGGAAGTTTTTCGCCAATTCGACTTCGAATCTCCCAATTCTGGGGAAATGGAGAACAATTTCCGACCAAT
CTTATCAAAGTTCAATGAAAAACGAACAATATATTCCTCATTCAAAACGGGGTCCAGTTAGACAATCTTATTATGGGTGC
TTTGTGCAATCTTCATGTGCCTGAATAGTCGATAATATGATGTTCATAACACTCAAATAGCACATTTAATTCATTTTGAT
TAACACTATTTTTCATTTCATTTATGTCAATTA
>SMED30021108 ID=SMED30021108|Name=POU domain protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1667bp
TTCTGGATTACGAATAGCCTATTGCAATTAATAACCGAGTTTTTTTCAAGATTGTCCTACAATGATCATTAAATAAAAAT
AATCCACATGAGTATATCAGAAAATAATAAAGAAAAAGATATTATTTACGGCTTGGAAGCAAAGCATATTGTAGATTTCA
ATGTTGCATCTCATTTAGATGAAGAACAAGACGCAATTTCAAAATCTATTGGGCGCAACCAAAAAACTGATAAACACTCT
CAGTCGTTAAATGGGAAAACTCCCAATGAACCACTGGATCACAATTCATATATCAAAGCCTATAACGATGCGCTGTTTGA
ACAGCGGACTAATTTCAATGGTTTGAATTCAGATTTAAGCTATTCATTTTTATCTCAGTATGGCTATAATAATGATGAAA
GAATGGATTTTACACCGTATTCTTTGCCAATTGATATGATTGAACAATCTTATAATTCCTGGTCTAAATCTAACGCATGC
ACATTTACAGAGGCGCATCTAAATTCACCTTGGTACAATCATTATCCGTATCCAGGATATGCATCATATAATTCTTATAT
GTGTAATATTCCACCGGTTGCAACTTCATCTATCAATGATCAATCTAATATGAGTTTTCCTAATCATCCAGCATTCTCAG
ATCTGGAAGAGTATGAACAATTAAAACAATTCCAAGCAAGTAATTATTCTGTATTTCCACAAGATTCTTTTTTAAATCAT
TCAATATCAACTCTAATGCCTCCGTTAAGGAATTCTCAAAGCACCACCCCTTTCAACTCAATCAATCCATCATCTCATTG
GTTGGATGTTAAAAATTGGCCGAAATCTGCCTCTCAATCAGATCAATTCGATCAAAATTCATTGAAACGTCAAATTGATC
ATTTTCCTTTGAATATCCCAACGGCGTTTTCTTATCAATCATCCAACTCAATGTCCCTACTCGGCTCTCAACAGCCAGAA
ATCAGTAAAGATCTCTTTTTGTCCGATTCCATAATTGAAAATTCAAAACTAAGCACGATGGACTGTCGAGAATTGGAACA
ATTTGCCAAGACTTTCAAACAAAGACGAATCAAGCTAGGATTTACTCAGGCTGATGTCGGTCTGGCGTTGGGTACGTTAT
ACGGGAACGTATTCAGTCAAACCACAATTTGCCGATTTGAAGCATTACAGTTAAGCTTTAAGAACATGAACAAGTTGCGA
CCGTTATTAAGCAAATGGTTAGAAGAGGCTGATTTGTCCTTGTCAAACACAGTCGTGAATGTAGAGAAATTAGCGAACCA
AAATCGACAAAGAAAGAAAAGAACAAATATAGAAATGAATACCAAAGATATATTGGAATCAAGTTTCAATAAAGATCCAA
AACCAACTGCTGCTCATATTATATCATTGTCAGAGAGAATTTTAATGGATAAAGAAGTAGTTCGGGTTTGGTTTTGTAAT
AGAAGACAGAAAGAAAAAAAATCCAGTTTAACCAAATCTATTTCCAGTAGTTAATACAATCTTTCCAAAAAGAAATTCTT
TTACAGATTCGACGTTTTATTATGGAAATGGTGTGAATAAATAATTTCTTCCCATAAATTTTGCCGGTTTTCTAGCTTGT
ACAGATAAAGAAAAATACCCGTTTTTACATTTTCCTAAACTTAAAATATTCAACATTAATTTTGAAC

 

back to top



PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in protonephridia. Click this link to learn more about PAGE.


PAGE Curations: 1741


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
protonephridiaSMED30008950SMED30008950SMESG000071333.1 dd_Smed_v4_3647_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019692DUF3421 domain-containing proteinSMESG000046732.1 dd_Smed_v4_844_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010695coiled-coil domain-containing protein 170SMESG000048767.1 dd_Smed_v4_7066_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018495ATPase_AAA_core domain-containing proteinSMESG000073596.1 dd_Smed_v4_9484_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018495ATPase_AAA_core domain-containing proteinSMESG000073596.1 dd_Smed_v4_9568_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019315SMED30019315SMESG000022726.1 dd_Smed_v4_2668_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012118Pyruvate kinaseSMESG000017671.1 dd_Smed_v4_6483_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013161SMED30013161SMESG000051379.1 dd_Smed_v4_2630_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017300SMED30017300SMESG000001317.1 dd_Smed_v4_520_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007558SMED30007558SMESG000071865.1 dd_Smed_v4_4209_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010520SMED30010520SMESG000066861.1 SMESG000059630.1 SMESG000066862.1 dd_Smed_v4_6647_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022710dual specificity protein kinase CLK2SMESG000071751.1 dd_Smed_v4_6141_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3002901916 kDa calcium-binding proteinSMESG000066843.1 dd_Smed_v4_299_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024736transmembrane protein 180SMESG000017241.1 dd_Smed_v4_4630_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030289Actin-1SMESG000058003.1 SMESG000057992.1 SMESG000057988.1 SMESG000057914.1 SMESG000057913.1 dd_Smed_v4_8957_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030289Actin-1SMESG000066035.1 SMESG000066029.1 SMESG000066027.1 SMESG000066020.1 dd_Smed_v4_90_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022840SMED30022840SMESG000025410.1 dd_Smed_v4_777_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030842SMED30030842SMESG000017044.1 dd_Smed_v4_5248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024041Tumor protein D54SMESG000037796.1 SMESG000057565.1 SMESG000057564.1 dd_Smed_v4_2842_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031260SMED30031260SMESG000013211.1 dd_Smed_v4_2357_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028430Secretory carrier-associated membrane proteinSMESG000035622.1 dd_Smed_v4_2702_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023570SMED30023570SMESG000056075.1 SMESG000056059.1 dd_Smed_v4_770_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030637SMED30030637SMESG000056889.1 dd_Smed_v4_4060_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023059EF-hand calcium-binding domain-containing protein 6SMESG000052556.1 SMESG000052552.1 dd_Smed_v4_7065_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027354Myeloid leukemia factor 1SMESG000025667.1 dd_Smed_v4_4787_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026127sperm-associated antigen 8SMESG000072188.1 dd_Smed_v4_6123_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022973Rho GTPase-activating protein 12SMESG000012042.1 dd_Smed_v4_4253_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024860SMED30024860SMESG000001317.1 dd_Smed_v4_520_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025401Trifunctional purine biosynthetic protein adenosine-3SMESG000044482.1 dd_Smed_v4_3037_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026334Nucleolar protein isoform 2SMESG000007822.1 dd_Smed_v4_7593_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028718Epsin 2SMESG000042233.1 dd_Smed_v4_4779_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021222Meiosis specific nuclear structural 1SMESG000036318.1 dd_Smed_v4_4463_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022233SPATA6 domain-containing proteinSMESG000013811.1 dd_Smed_v4_4304_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028170SMED30028170SMESG000037796.1 SMESG000057565.1 SMESG000057564.1 dd_Smed_v4_2842_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025830Ornithine decarboxylaseSMESG000015244.1 SMESG000015241.1 SMESG000004848.1 SMESG000004822.1 SMESG000004820.1 SMESG000004806.1 dd_Smed_v4_280_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030925SMED30030925SMESG000038398.1 dd_Smed_v4_4195_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012229Cilia- and flagella-associated protein 20SMESG000081781.1 dd_Smed_v4_3751_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015096Family with sequence similarity 183 member ASMESG000024586.1 dd_Smed_v4_8725_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012160SMED30012160SMESG000069851.1 dd_Smed_v4_9493_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011084Epidermal growth factor receptor kinase substrate 8SMESG000070650.1 dd_Smed_v4_4256_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010317MFS domain-containing proteinSMESG000026516.1 dd_Smed_v4_6235_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017794Coiled-coil domain containing 191SMESG000064321.1 dd_Smed_v4_8967_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019742Geranylgeranyl transferase type-2 subunit alphaSMESG000011257.1 dd_Smed_v4_7183_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009700Dynein light chain roadblockSMESG000061103.1 dd_Smed_v4_7991_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015955Growth arrest-specific protein 8SMESG000013356.1 dd_Smed_v4_2848_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011770Unconventional myosin-XVISMESG000041981.1 dd_Smed_v4_4268_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005588Zinc finger RNA-binding proteinSMESG000022723.1 dd_Smed_v4_3762_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010881SMED30010881SMESG000004195.1 dd_Smed_v4_991_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001360Lipopolysaccharide cholineSMESG000060269.1 dd_Smed_v4_6457_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30003507Adenylate kinase 9SMESG000043841.1 dd_Smed_v4_9617_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014980LaminSMESG000009886.1 dd_Smed_v4_850_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012572Leucine--tRNA ligaseSMESG000071689.1 dd_Smed_v4_9705_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006117Tyrosine-protein phosphatase non-receptor typeSMESG000018862.1 dd_Smed_v4_6996_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005449SMED30005449SMESG000014251.1 dd_Smed_v4_9793_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009251coiled-coil domain-containing protein 146SMESG000006416.1 dd_Smed_v4_6858_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006208Aconitate hydratase, mitochondrialSMESG000002904.1 dd_Smed_v4_979_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010890Y box binding protein 1SMESG000008704.1 dd_Smed_v4_347_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000132SMED30000132SMESG000017239.1 dd_Smed_v4_4431_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002133PolyubiquitinSMESG000039444.1 SMESG000014081.1 dd_Smed_v4_34_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014689Usp domain-containing proteinSMESG000020952.1 dd_Smed_v4_985_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012546Coiled-coil domain-containing protein 65SMESG000021331.1 dd_Smed_v4_6152_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011943Fibronectin type III and ankyrin repeat domains 1SMESG000033969.1 dd_Smed_v4_7571_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012139slc2a-2SMESG000081673.1 dd_Smed_v4_3190_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000788SMED30000788SMESG000035357.1 dd_Smed_v4_2571_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001702SMED30001702SMESG000042167.1 dd_Smed_v4_8527_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018439XK-related proteinSMESG000080414.1 dd_Smed_v4_2770_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026859PlsC domain-containing proteinSMESG000028760.1 dd_Smed_v4_8757_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022889SeptinSMESG000079489.1 SMESG000049701.1 dd_Smed_v4_2586_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021641SMED30021641SMESG000040565.1 dd_Smed_v4_4660_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027478SMED30027478SMESG000081245.1 dd_Smed_v4_3287_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032941TNF receptor associated factor 4SMESG000025998.1 SMESG000025982.1 SMESG000025980.1 SMESG000025963.1 SMESG000025934.1 SMESG000025901.1 SMESG000025797.1 SMESG000025794.1 SMESG000025517.1 dd_Smed_v4_1139_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032610WD_REPEATS_REGION domain-containing proteinSMESG000060483.1 dd_Smed_v4_8615_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031216Oxysterol-binding proteinSMESG000023068.1 dd_Smed_v4_3268_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028883peptidoglycan recognition protein-1SMESG000063454.1 SMESG000063448.1 SMESG000047150.1 SMESG000037421.1 dd_Smed_v4_9550_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026109Hydin_ADK domain-containing proteinSMESG000016228.1 dd_Smed_v4_7302_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032945SMED30032945SMESG000078236.1 dd_Smed_v4_6011_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020977SMED30020977SMESG000069851.1 dd_Smed_v4_9493_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022193SMED30022193SMESG000069851.1 dd_Smed_v4_9493_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033909UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 4SMESG000066601.1 dd_Smed_v4_12354_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035942SMED30035942SMESG000041949.1 dd_Smed_v4_9876_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032668Axonemal dynein light chain domain containing 1SMESG000011833.1 dd_Smed_v4_8788_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030126Neurexin-4SMESG000080138.1 dd_Smed_v4_2622_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021410SMED30021410SMESG000078466.1 SMESG000050786.1 SMESG000024968.1 dd_Smed_v4_3128_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031361Ig-like domain-containing proteinSMESG000026986.1 dd_Smed_v4_9128_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032523SMED30032523SMESG000042167.1 dd_Smed_v4_8527_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020269MyophilinSMESG000081505.1 SMESG000049198.1 SMESG000047694.1 SMESG000035451.1 SMESG000035348.1 dd_Smed_v4_395_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027510G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000063454.1 SMESG000063448.1 SMESG000047150.1 SMESG000037421.1 dd_Smed_v4_9550_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028623SMED30028623SMESG000029914.1 dd_Smed_v4_7742_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034464Ig-like domain-containing proteinSMESG000012091.1 dd_Smed_v4_2864_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024442Serine/threonine kinaseSMESG000079489.1 SMESG000049701.1 dd_Smed_v4_2586_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033149Calcipressin-2-likeSMESG000068854.1 SMESG000068847.1 dd_Smed_v4_14266_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034220Flotillin-1SMESG000004975.1 dd_Smed_v4_1637_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021957SMED30021957SMESG000039476.1 dd_Smed_v4_9685_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031405SMED30031405SMESG000051910.1 SMESG000051904.1 dd_Smed_v4_298_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033655Bestrophin homologSMESG000069980.1 dd_Smed_v4_9590_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032372Coiled-coil domain containing 40SMESG000008312.1 dd_Smed_v4_6338_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035939Actinin alpha 4SMESG000074430.1 dd_Smed_v4_7964_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30029274SMED30029274SMESG000014251.1 dd_Smed_v4_9793_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020991Outer dynein arm protein 1SMESG000055998.1 SMESG000055997.1 dd_Smed_v4_4191_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025990NPHP1SMESG000061008.1 dd_Smed_v4_9990_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021613Nesprin-1SMESG000077685.1 dd_Smed_v4_15904_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025910Microtubule-associated protein futschSMESG000044270.1 SMESG000030021.1 SMESG000025422.1 dd_Smed_v4_1999_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026225SMED30026225SMESG000059698.1 dd_Smed_v4_188_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023228SMED30023228SMESG000016978.1 dd_Smed_v4_19646_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020398Kinesin-like proteinSMESG000007019.1 dd_Smed_v4_10965_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025062G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000018450.1 dd_Smed_v4_1699_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025747SMED30025747SMESG000049533.1 dd_Smed_v4_2058_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023749Lysophosphatidylcholine acyltransferaseSMESG000003820.1 dd_Smed_v4_2022_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025573cGMP-dependent protein kinase,putativeSMESG000018148.1 SMESG000018146.1 dd_Smed_v4_10515_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026893SMED30026893SMESG000036214.1 dd_Smed_v4_10854_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001861mitochondrial sodium/calcium exchanger proteinSMESG000022808.1 dd_Smed_v4_20334_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000584SMED30000584SMESG000016256.1 SMESG000016255.1 SMESG000010584.1 SMESG000009925.1 dd_Smed_v4_2090_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010835Cadherin-23SMESG000081529.1 SMESG000081574.1 dd_Smed_v4_15356_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000514SMED30000514SMESG000036214.1 dd_Smed_v4_10854_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013692Small HSP proteinSMESG000059879.1 SMESG000059868.1 SMESG000059853.1 dd_Smed_v4_1039_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013686MAP3K-1SMESG000054386.1 dd_Smed_v4_5198_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000146GLI-3SMESG000078300.1 dd_Smed_v4_17566_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021661Carbonic anhydrase 7SMESG000017176.1 SMESG000017171.1 dd_Smed_v4_4841_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026227SMED30026227SMESG000055174.1 SMESG000055172.1 dd_Smed_v4_10518_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030007RootletinSMESG000071494.1 dd_Smed_v4_1404_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020710Succinyl-CoA:3-ketoacid-coenzyme A transferaseSMESG000080424.1 dd_Smed_v4_1189_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033245InnexinSMESG000061679.1 dd_Smed_v4_8390_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3000013460S ribosomal protein L4SMESG000009479.1 dd_Smed_v4_211_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014446SMEDWI-2SMESG000069984.1 SMESG000069981.1 dd_Smed_v4_756_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014813Y box protein-1SMESG000058013.1 dd_Smed_v4_35_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004532Y box protein-1SMESG000058013.1 dd_Smed_v4_35_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30003346slc12a-4SMESG000019076.1 dd_Smed_v4_4389_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009038SMED30009038SMESG000068141.1 dd_Smed_v4_1067_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001515AnnexinSMESG000042839.1 dd_Smed_v4_1104_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010061APOBEC1 complementation factorSMESG000032489.1 dd_Smed_v4_2228_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30003800SMED30003800SMESG000052963.1 SMESG000047933.1 dd_Smed_v4_20623_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019184Protein NDRG3SMESG000005138.1 SMESG000005122.1 dd_Smed_v4_1911_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009893RNA-binding proteinSMESG000006741.1 dd_Smed_v4_11008_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016457SMED30016457SMESG000040036.1 dd_Smed_v4_21280_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000377Membrane-associated guanylate kinase, WW and PDZ domain-containing protein 1SMESG000026494.1 dd_Smed_v4_5498_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001601Zinc finger-like proteinSMESG000026829.1 dd_Smed_v4_2946_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001853Protein kinase domain-containing proteinSMESG000003859.1 dd_Smed_v4_1897_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009913Beta-ureidopropionaseSMESG000060425.1 dd_Smed_v4_1584_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010503CEP135SMESG000077870.1 dd_Smed_v4_5218_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007371nuclear mitotic apparatus protein 1 isoform X2SMESG000071994.1 dd_Smed_v4_10823_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3000109640S ribosomal protein S23SMESG000017264.1 dd_Smed_v4_290_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016238Kinesin-like proteinSMESG000071604.1 dd_Smed_v4_12639_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009188Radial spoke head 14-like proteinSMESG000077061.1 dd_Smed_v4_1917_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014981Gelsolin-like proteinSMESG000015924.1 dd_Smed_v4_1673_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019592Guanylate cyclaseSMESG000041839.1 dd_Smed_v4_12933_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016609SMED30016609SMESG000044186.1 dd_Smed_v4_13633_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000756EGFR-5SMESG000044603.1 dd_Smed_v4_11310_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019538SMED30019538SMESG000078196.1 dd_Smed_v4_3823_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021194Calcitonin-like receptorSMESG000080399.1 dd_Smed_v4_7328_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034888Dynein heavy chain 5, axonemalSMESG000049144.1 dd_Smed_v4_4569_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3002169814-3-3 protein epsilonSMESG000047644.1 dd_Smed_v4_36_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026870SWIM-type domain-containing proteinSMESG000060198.1 dd_Smed_v4_5330_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027735SMED30027735SMESG000069765.1 SMESG000070035.1 dd_Smed_v4_5256_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3002728060S acidic ribosomal protein P0SMESG000079482.1 dd_Smed_v4_161_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032665SMED30032665SMESG000024489.1 dd_Smed_v4_5366_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3002125360S ribosomal protein L35SMESG000035332.1 SMESG000031365.1 SMESG000077214.1 SMESG000075241.1 SMESG000075191.1 dd_Smed_v4_168_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025783NADPH--cytochrome P450 reductaseSMESG000022047.1 dd_Smed_v4_542_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027015MAGUK p55 subfamily member 5SMESG000007837.1 dd_Smed_v4_5287_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031329Protein tyrosine phosphatase receptor type BSMESG000050003.1 SMESG000005247.1 dd_Smed_v4_5794_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020768SMED30020768SMESG000072019.1 SMESG000071607.1 dd_Smed_v4_3316_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30029834Hemoglobin C1 polymerSMESG000048630.1 SMESG000022261.1 dd_Smed_v4_4497_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021956Actin-related protein 3SMESG000078631.1 dd_Smed_v4_453_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034903cilia- and flagella-associated protein 77SMESG000042608.1 dd_Smed_v4_5179_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033094AdenosylhomocysteinaseSMESG000055982.1 dd_Smed_v4_5492_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027197UMP-CMP kinaseSMESG000056620.1 SMESG000031498.1 dd_Smed_v4_3353_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022142SMED30022142SMESG000070064.1 SMESG000070059.1 dd_Smed_v4_3829_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028254Polyglutamine-binding protein 1SMESG000040247.1 dd_Smed_v4_3489_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027256SMED30027256SMESG000050003.1 SMESG000005247.1 dd_Smed_v4_5794_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025750Myb/SANT-like DNA-binding domainSMESG000016880.1 dd_Smed_v4_4381_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032456Aldehyde dehydrogenase,putativeSMESG000001708.1 dd_Smed_v4_400_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022681Dynein heavy chain 7 axonemalSMESG000012956.1 dd_Smed_v4_5350_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022681Dynein heavy chain 7 axonemalSMESG000012956.1 dd_Smed_v4_13792_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033412CLIP-associating protein 1SMESG000072426.1 dd_Smed_v4_5069_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034376slc6a-5SMESG000042091.1 dd_Smed_v4_4290_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021567dedicator of cytokinesis protein 5SMESG000068985.1 dd_Smed_v4_3618_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032624cilia- and flagella-associated protein 53SMESG000004919.1 dd_Smed_v4_3219_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032591arf-GAP with Rho-GAP domain, ANK repeat and PH domain-containing protein 1-likeSMESG000006535.1 dd_Smed_v4_4332_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021145SMED30021145SMESG000023086.1 dd_Smed_v4_6287_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022991transducin-like enhancer protein 3 isoform X4SMESG000026880.1 dd_Smed_v4_4112_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017036AP-2 complex subunit alphaSMESG000036030.1 dd_Smed_v4_1423_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002774SMED30002774SMESG000017229.1 dd_Smed_v4_613_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013257Tektin-2SMESG000026446.1 SMESG000026445.1 SMESG000026429.1 dd_Smed_v4_2694_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005698SMED30005698SMESG000052123.1 dd_Smed_v4_2845_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005770Cell number regulator 7SMESG000060415.1 dd_Smed_v4_743_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013863Rac-1SMESG000024961.1 dd_Smed_v4_610_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010340NeuroliginSMESG000012303.1 dd_Smed_v4_7946_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015151Phosphatidylinositol transfer protein alpha isoformSMESG000014949.1 dd_Smed_v4_580_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009837Diacylglycerol kinaseSMESG000075921.1 dd_Smed_v4_6249_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009514histone H2BSMESG000067931.1 dd_Smed_v4_2520_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010475EF Hand type proteinSMESG000065951.1 dd_Smed_v4_8441_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009142Hepatoma derived growth factor proteinSMESG000037796.1 SMESG000057565.1 SMESG000057564.1 dd_Smed_v4_2842_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013498LIM zinc-binding domain-containing proteinSMESG000072162.1 dd_Smed_v4_537_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006784ras-related protein Rab-7aSMESG000014290.1 dd_Smed_v4_419_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012628ADP ribosylation factorSMESG000033952.1 dd_Smed_v4_2125_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015103Branched-chain-amino-acid aminotransferaseSMESG000021421.1 dd_Smed_v4_3721_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014094Kinesin-like proteinSMESG000016386.1 dd_Smed_v4_11012_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010627Homeobox proteinSMESG000078684.1 dd_Smed_v4_8553_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013591Fructose-bisphosphate aldolaseSMESG000027545.1 dd_Smed_v4_398_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001782Fibronectin type III domain-containing proteinSMESG000024682.1 dd_Smed_v4_3381_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011027Dynein axonemal assembly factor 4SMESG000052823.1 dd_Smed_v4_12396_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30003934Sodium leak channel non-selective proteinSMESG000076454.1 SMESG000076415.1 dd_Smed_v4_7314_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005465Ras-related protein Rab-11ASMESG000073334.1 dd_Smed_v4_867_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015890Protein lethal(2) giant larvaeSMESG000072512.1 dd_Smed_v4_7127_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002428Gamma-aminobutyric acid receptor-associated proteinSMESG000026465.1 dd_Smed_v4_600_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008757Piezo-type mechanosensitive ion channel componentSMESG000051188.1 dd_Smed_v4_7182_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016674WD-40 repeat proteinSMESG000075220.1 dd_Smed_v4_14617_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016950DystrophinSMESG000020523.1 dd_Smed_v4_5325_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012694Krueppel-like factor 11SMESG000025482.1 dd_Smed_v4_3638_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010855Receptor-type tyrosine-protein phosphatase FSMESG000038449.1 SMESG000035516.1 dd_Smed_v4_22581_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010855Receptor-type tyrosine-protein phosphatase FSMESG000038449.1 SMESG000038447.1 SMESG000035516.1 dd_Smed_v4_8199_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018731MORN repeat-containing protein 5SMESG000023247.1 dd_Smed_v4_7020_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30003951Tektin-4SMESG000016881.1 dd_Smed_v4_37536_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004520SMED30004520SMESG000037711.1 dd_Smed_v4_8837_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015967Neurotracting/lsamp/neurotrimin/obcam related cell adhesion moleculeSMESG000068491.1 dd_Smed_v4_2826_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016840PhosphodiesteraseSMESG000019038.1 dd_Smed_v4_8595_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014640Small heat shock protein p36SMESG000028601.1 dd_Smed_v4_6399_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002042Ring finger and FYVE-like domain containing E3 ubiquitin protein ligaseSMESG000021295.1 dd_Smed_v4_9114_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005765PhosphodiesteraseSMESG000019038.1 dd_Smed_v4_8595_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006263SMED30006263SMESG000056318.1 dd_Smed_v4_2292_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006263SMED30006263SMESG000056319.1 SMESG000056318.1 SMESG000022275.1 dd_Smed_v4_674_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005837SMED30005837SMESG000016663.1 dd_Smed_v4_229_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016591Protein big brotherSMESG000068819.1 dd_Smed_v4_2875_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002094SMED30002094SMESG000003128.1 SMESG000003117.1 dd_Smed_v4_2294_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002736DNA topoisomerase ISMESG000055403.1 dd_Smed_v4_2421_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011381HORMA domain-containing proteinSMESG000066514.1 dd_Smed_v4_2201_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014184Tumor necrosis factor alpha-induced protein 8-like proteinSMESG000002914.1 dd_Smed_v4_2386_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004149Protein kinase-like domainSMESG000016842.1 dd_Smed_v4_6898_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011561SMED30011561SMESG000066396.1 dd_Smed_v4_7890_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017371Adenylosuccinate lyaseSMESG000014474.1 dd_Smed_v4_2280_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005762Contactin/TAG-1 cell adhesion moleculeSMESG000036495.1 dd_Smed_v4_2673_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017841Sorting nexin-2SMESG000016192.1 dd_Smed_v4_835_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027141SMED30027141SMESG000059828.1 dd_Smed_v4_1549_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026341SMED30026341SMESG000069507.1 dd_Smed_v4_1654_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026578Peptidoglycan-recognition proteinSMESG000068025.1 dd_Smed_v4_1523_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026237Coiled-coil and C2 domain containing 2ASMESG000048372.1 dd_Smed_v4_11189_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033718SMED30033718SMESG000061174.1 dd_Smed_v4_12214_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028237PMP-22/EMP/MP20/Claudin tight junctionSMESG000028931.1 dd_Smed_v4_2132_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031175SMED30031175SMESG000064100.1 SMESG000064099.1 dd_Smed_v4_14322_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026112Sorting nexin-27SMESG000081127.1 dd_Smed_v4_2513_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032157SMED30032157SMESG000032745.1 dd_Smed_v4_2208_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028462Zinc finger protein castor-like protein 1SMESG000024266.1 dd_Smed_v4_2206_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034048SMED30034048SMESG000051762.1 dd_Smed_v4_13419_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028743Regulator of G-protein signaling 22SMESG000069110.1 dd_Smed_v4_11778_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020779PhosphodiesteraseSMESG000019038.1 dd_Smed_v4_8595_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027376SMED30027376SMESG000007018.1 SMESG000007017.1 dd_Smed_v4_1969_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024568Parathyroid hormone/parathyroid hormone peptide receptorSMESG000081404.1 dd_Smed_v4_12602_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031582InnexinSMESG000081749.1 dd_Smed_v4_11302_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031582InnexinSMESG000081749.1 dd_Smed_v4_10287_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000404SMED30000404SMESG000012897.1 dd_Smed_v4_6875_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018188Lysosome-associated membrane glycoprotein 2SMESG000025677.1 dd_Smed_v4_722_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010725Ras-related protein Rab-13SMESG000078273.1 dd_Smed_v4_3889_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008852Geranylgeranyl transferase type-1 subunit betaSMESG000057312.1 dd_Smed_v4_4004_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002656Unconventional myosin-XVSMESG000061386.1 dd_Smed_v4_7193_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011587SMED30011587SMESG000002176.1 dd_Smed_v4_8691_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012599E3 ubiquitin-protein ligase TM129SMESG000022818.1 dd_Smed_v4_8706_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014794SMED30014794SMESG000075514.1 dd_Smed_v4_1900_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014561SMED30014561SMESG000000219.1 dd_Smed_v4_862_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017953SMED30017953SMESG000011944.1 dd_Smed_v4_3820_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018763Mitochondrial pyruvate carrierSMESG000004344.1 dd_Smed_v4_8071_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000360TetraspaninSMESG000052597.1 dd_Smed_v4_9647_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006481WD repeat-containing protein 49SMESG000041940.1 dd_Smed_v4_13248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002598Histone-lysine N-methyltransferaseSMESG000039926.1 dd_Smed_v4_99_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011667Serine/threonine-protein phosphataseSMESG000077398.1 dd_Smed_v4_5669_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002895ThioredoxinSMESG000023197.1 dd_Smed_v4_6702_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008476LRRC50SMESG000004118.1 SMESG000004112.1 dd_Smed_v4_9766_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011308SMED30011308SMESG000012340.1 dd_Smed_v4_5536_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011700Calcium-binding protein ASMESG000052083.1 SMESG000048475.1 dd_Smed_v4_605_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006985WD repeat-containing protein 49SMESG000041940.1 dd_Smed_v4_13248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008115TPR repeat-containing protein DDB_G0287407 isoform X2SMESG000012448.1 dd_Smed_v4_12326_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007385SMED30007385SMESG000003089.1 dd_Smed_v4_780_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015100SMED30015100SMESG000024438.1 dd_Smed_v4_7255_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006256SMED30006256SMESG000034101.1 dd_Smed_v4_9313_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013227WD repeat-containing proteinSMESG000042025.1 dd_Smed_v4_9187_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005253EF-hand domain-containing family member C2SMESG000076759.1 dd_Smed_v4_6035_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED300189611.C3.2SMESG000049306.1 dd_Smed_v4_406_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010277SMED30010277SMESG000000133.1 dd_Smed_v4_8640_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006773Calpain-BSMESG000039299.1 dd_Smed_v4_1752_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010008SMED30010008SMESG000075346.1 dd_Smed_v4_6802_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017438RanBP-type and C3HC4-type zinc finger-containing protein 1SMESG000013684.1 dd_Smed_v4_4440_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005654SMED30005654SMESG000044586.1 dd_Smed_v4_6921_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000174Ribosomal protein S6 kinase delta-1SMESG000004118.1 SMESG000004112.1 dd_Smed_v4_9766_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014565Angiotensin-converting enzymeSMESG000005704.1 SMESG000005698.1 dd_Smed_v4_3745_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015660SMED30015660SMESG000018225.1 SMESG000017035.1 dd_Smed_v4_1426_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009463WD repeat-containing protein 49SMESG000041940.1 dd_Smed_v4_13248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006819Cyclin L1SMESG000075514.1 dd_Smed_v4_1900_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007967slc30a-3SMESG000022672.1 dd_Smed_v4_5007_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014133EF-hand calcium-binding domain-containing protein 10-likeSMESG000023074.1 dd_Smed_v4_6477_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017243Protein-glucosylgalactosylhydroxylysine glucosidaseSMESG000009911.1 SMESG000009910.1 dd_Smed_v4_606_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008553Phosphoenolpyruvate carboxykinase [GTP]SMESG000062868.1 dd_Smed_v4_196_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017180Dynein regulatory complex protein 1SMESG000072168.1 dd_Smed_v4_8761_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000995Pyruvate kinaseSMESG000052083.1 SMESG000048475.1 dd_Smed_v4_605_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010098Receptor protein serine/threonine kinaseSMESG000068827.1 dd_Smed_v4_7151_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033594Microtubule-associated protein 1ASMESG000014298.1 dd_Smed_v4_1301_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033594Microtubule-associated protein 1ASMESG000014298.1 dd_Smed_v4_3654_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035468DNAHb-1SMESG000072114.1 SMESG000072113.1 SMESG000072112.1 dd_Smed_v4_3670_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031945UPF0638 protein BSMESG000003269.1 dd_Smed_v4_10707_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021989Phosphatidylinositol N-acetylglucosaminyltransferase subunit PSMESG000077599.1 dd_Smed_v4_6100_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020821SMED30020821SMESG000014298.1 dd_Smed_v4_1301_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035834slc4a-2SMESG000057490.1 dd_Smed_v4_7905_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021868coiled-coil domain-containing protein 39SMESG000072035.1 SMESG000072034.1 dd_Smed_v4_5955_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022043Protein odd-skipped-related 2SMESG000032229.1 dd_Smed_v4_10039_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033020Histone acetyltransferase KAT6ASMESG000038926.1 dd_Smed_v4_11245_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020318WD repeat-containing protein 49SMESG000041940.1 dd_Smed_v4_13248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021549Usp domain-containing proteinSMESG000079952.1 dd_Smed_v4_1092_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020160SMED30020160SMESG000005587.1 dd_Smed_v4_8117_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020268Dynamin-type G domain-containing proteinSMESG000014756.1 SMESG000014755.1 dd_Smed_v4_2390_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021910ASH1 like histone lysine methyltransferaseSMESG000051410.1 dd_Smed_v4_6521_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021693Nicotinic acetylcholine receptor alpha 6 subunitSMESG000000214.1 SMESG000000209.1 dd_Smed_v4_9864_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022264SMED30022264SMESG000012105.1 dd_Smed_v4_3599_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032126AndroglobinSMESG000053594.1 SMESG000047986.1 dd_Smed_v4_10677_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023486Intraflagellar transport 74SMESG000074086.1 dd_Smed_v4_12702_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035929SWI/SNF complex subunit SMARCC2SMESG000031576.1 SMESG000013315.1 dd_Smed_v4_1804_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016107PH domain-containing proteinSMESG000007865.1 dd_Smed_v4_3737_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008728mitochondrial sodium/calcium exchanger proteinSMESG000022802.1 dd_Smed_v4_9904_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013766Matrin-type domain-containing proteinSMESG000072403.1 dd_Smed_v4_1859_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016918UPF0466 protein-like dd_Smed_v4_5792_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008971SMED30008971 dd_Smed_v4_11595_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002228Ig-like domain-containing proteinSMESG000024613.1 dd_Smed_v4_7050_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013141Pleckstrin homology domain-containing family F member 2-like protein dd_Smed_v4_2374_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005776SMED30005776 dd_Smed_v4_11737_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019531NPHP6SMESG000072747.1 dd_Smed_v4_7145_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012721HexosyltransferaseSMESG000023046.1 SMESG000023044.1 dd_Smed_v4_6118_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED300154216-pyruvoyl tetrahydrobiopterin synthaseSMESG000077201.1 dd_Smed_v4_3156_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017410Peptidoglycan-recognition proteinSMESG000004536.1 dd_Smed_v4_817_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010668MAGUK p55 subfamily member 5SMESG000017294.1 dd_Smed_v4_6790_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016140methylmalonyl-CoA mutase, mitochondrialSMESG000014335.1 dd_Smed_v4_2255_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001880Lysine-specific demethylase 3BSMESG000051397.1 SMESG000006486.1 dd_Smed_v4_2582_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016941Cytospin-ASMESG000002849.1 dd_Smed_v4_14690_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019038SMED30019038 dd_Smed_v4_12777_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014551SMED30014551SMESG000080911.1 SMESG000080909.1 dd_Smed_v4_8194_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001635cathepsin BSMESG000048413.1 dd_Smed_v4_81_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004099SMED30004099 dd_Smed_v4_15498_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013386netrin 1SMESG000006806.1 dd_Smed_v4_9795_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017264SMED30017264SMESG000055031.1 dd_Smed_v4_2419_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015974FAST kinase domain-containing protein 1, mitochondrialSMESG000064523.1 dd_Smed_v4_8917_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004557Tyrosine-protein kinaseSMESG000015831.1 dd_Smed_v4_2291_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010506J domain-containing proteinSMESG000009124.1 dd_Smed_v4_4016_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010842EF-hand domain-containing protein 1SMESG000078434.1 dd_Smed_v4_2935_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004331SMED30004331 dd_Smed_v4_37267_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007989IQ and ubiquitin-like domain-containing proteinSMESG000006819.1 dd_Smed_v4_9227_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010326TetraspaninSMESG000078589.1 dd_Smed_v4_2698_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012747Thioredoxin domain-containing protein 3-likeSMESG000043677.1 dd_Smed_v4_8026_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012747Thioredoxin domain-containing protein 3-likeSMESG000043677.1 dd_Smed_v4_8401_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004581Dual specificity protein phosphatase 10SMESG000030100.1 dd_Smed_v4_3551_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3000245560S ribosomal protein L6SMESG000076172.1 dd_Smed_v4_205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012991endoglycoceramidaseSMESG000030369.1 SMESG000030357.1 SMESG000030353.1 dd_Smed_v4_1570_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012092SMED30012092SMESG000073142.1 dd_Smed_v4_1835_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007886SMED30007886SMESG000055169.1 dd_Smed_v4_9583_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000126Centrosomal protein 95SMESG000002923.1 dd_Smed_v4_8515_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018830Suppressor of cytokine signaling 7SMESG000051397.1 SMESG000006486.1 dd_Smed_v4_2582_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007850SMED30007850SMESG000001248.1 dd_Smed_v4_3418_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004448Thioredoxin domain-containing protein 3-likeSMESG000043677.1 dd_Smed_v4_8026_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004448Thioredoxin domain-containing protein 3-likeSMESG000043677.1 dd_Smed_v4_8401_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009279DystoninSMESG000043809.1 SMESG000043799.1 dd_Smed_v4_1205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010966Core 1 udp-galactose:n-acetylgalactosamine-alpha-r beta 1,3-galactosyltransferase, putativeSMESG000061089.1 dd_Smed_v4_2796_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017190slc4a-7SMESG000063821.1 dd_Smed_v4_2778_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015703IQ domain-containing protein DSMESG000017912.1 dd_Smed_v4_7079_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004553SMED30004553SMESG000023121.1 dd_Smed_v4_6718_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011985MRVI1-like proteinSMESG000055459.1 dd_Smed_v4_6446_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001296Actin-related protein 2SMESG000019700.1 dd_Smed_v4_623_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012648cullin-5-likeSMESG000020142.1 dd_Smed_v4_8238_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008080Transmembrane protein 45BSMESG000060226.1 SMESG000021986.1 dd_Smed_v4_1542_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013820slc24a-2SMESG000022802.1 dd_Smed_v4_9904_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015685TNF receptor-associated factor dd_Smed_v4_5740_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017219Guanylate cyclaseSMESG000039747.1 dd_Smed_v4_7619_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012829SMED30012829 dd_Smed_v4_35980_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014219cilia- and flagella-associated protein 99SMESG000025927.1 dd_Smed_v4_8538_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005553Thioredoxin domain-containing protein 3-likeSMESG000043677.1 dd_Smed_v4_8026_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005553Thioredoxin domain-containing protein 3-likeSMESG000043677.1 dd_Smed_v4_8401_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011412Ribosomal protein L37 dd_Smed_v4_97_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005211cilia- and flagella-associated protein 47SMESG000060264.1 dd_Smed_v4_8294_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013261Retrovirus-related Pol polyprotein from transposon dd_Smed_v4_15498_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010502SMED30010502SMESG000051310.1 dd_Smed_v4_15505_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012856RNA binding motif single stranded interactingSMESG000002786.1 dd_Smed_v4_7710_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004840Coiled-coil domain containing 88AaSMESG000012304.1 dd_Smed_v4_3591_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008911FascinSMESG000037971.1 dd_Smed_v4_996_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013441WD repeat domain 78SMESG000047563.1 dd_Smed_v4_8721_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014731SMED30014731 dd_Smed_v4_5494_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011285DNA polymerase subunit gamma-1SMESG000077612.1 SMESG000050769.1 dd_Smed_v4_5734_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021832alkaline phosphataseSMESG000037009.1 dd_Smed_v4_13011_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028299DDE_3 domain-containing protein dd_Smed_v4_6265_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020449low-density lipoprotein receptor-related protein 2SMESG000062507.1 dd_Smed_v4_1510_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026534Rho-related GTP-binding proteinSMESG000022390.1 dd_Smed_v4_578_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030057GLOBIN domain-containing proteinSMESG000048632.1 SMESG000022262.1 dd_Smed_v4_2237_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021348Alanine aminotransferaseSMESG000007253.1 SMESG000007248.1 dd_Smed_v4_2988_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022077Cytospin-ASMESG000039310.1 dd_Smed_v4_6934_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3003375660S ribosomal protein L37 dd_Smed_v4_97_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027370activin receptor-1SMESG000019732.1 dd_Smed_v4_6924_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030156SMED30030156SMESG000032633.1 dd_Smed_v4_6252_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027427Acetyl-coenzyme A synthetaseSMESG000023067.1 dd_Smed_v4_6561_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024661SMED30024661SMESG000060548.1 dd_Smed_v4_8385_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023613SMED30023613 dd_Smed_v4_12778_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028199Placenta specific protein 8 dd_Smed_v4_865_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025384hypothetical proteinSMESG000077040.1 dd_Smed_v4_7293_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033785Cell division cycle and apoptosis regulator protein 1 dd_Smed_v4_1181_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023103C2 domainSMESG000063814.1 dd_Smed_v4_10352_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031015slc6a-13SMESG000042086.1 SMESG000042051.1 dd_Smed_v4_3642_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031015slc6a-13SMESG000079286.1 SMESG000079280.1 SMESG000017839.1 dd_Smed_v4_11826_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027878Dynein light chainSMESG000042102.1 dd_Smed_v4_15092_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032093Protein kinase domain-containing proteinSMESG000024489.1 dd_Smed_v4_4401_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032093Protein kinase domain-containing proteinSMESG000024489.1 dd_Smed_v4_5366_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021431TTF-type domain-containing proteinSMESG000080622.1 SMESG000068757.1 SMESG000055125.1 SMESG000038294.1 SMESG000032747.1 SMESG000023322.1 dd_Smed_v4_3830_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033453Dimer_Tnp_hAT domain-containing proteinSMESG000001790.1 dd_Smed_v4_212_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024428CalmodulinSMESG000018137.1 SMESG000018135.1 dd_Smed_v4_4669_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034919Ras association domain family member 3SMESG000061902.1 dd_Smed_v4_9008_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025608X1.A.G7.1SMESG000046817.1 SMESG000046814.1 dd_Smed_v4_1507_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025231radial spoke head protein 6 homolog ASMESG000079294.1 SMESG000044179.1 dd_Smed_v4_3854_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025553Cell polarity proteinSMESG000027800.1 dd_Smed_v4_4789_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026371SMED30026371SMESG000059828.1 dd_Smed_v4_2479_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024134slc22a-5SMESG000064528.1 dd_Smed_v4_10903_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021837piggyBac transposable element-derived protein 4-likeSMESG000080622.1 SMESG000068757.1 SMESG000055125.1 SMESG000038294.1 SMESG000032747.1 SMESG000023322.1 dd_Smed_v4_3830_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3002512114-3-3 protein epsilonSMESG000076939.1 dd_Smed_v4_251_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033380Beta-hexosaminidaseSMESG000037355.1 dd_Smed_v4_576_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035584Stabilizer of axonemal microtubules 2SMESG000009389.1 dd_Smed_v4_3695_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024997ATP-dependent RNA helicase, putativeSMESG000056881.1 dd_Smed_v4_4309_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030379POU domain proteinSMESG000076173.1 dd_Smed_v4_8234_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30029771SMED30029771SMESG000075916.1 dd_Smed_v4_2326_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024929Rap guanine nucleotide exchange factor 2SMESG000033489.1 SMESG000033486.1 dd_Smed_v4_4950_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026133BTB domain-containing proteinSMESG000001053.1 dd_Smed_v4_3856_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030659Fer-1-relatedSMESG000070967.1 dd_Smed_v4_4648_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004318Triadin-like isoform X4SMESG000025109.1 dd_Smed_v4_13778_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001718Protein-serine/threonine kinaseSMESG000036411.1 dd_Smed_v4_6810_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014844Flotillin-1SMESG000004975.1 dd_Smed_v4_1637_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017925Dynein light chain Tctex-type 1SMESG000026631.1 dd_Smed_v4_1166_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010437Copper homeostasis protein CutCSMESG000016228.1 dd_Smed_v4_7302_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007867OtoferlinSMESG000010400.1 dd_Smed_v4_14162_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014265Neutral ceramidaseSMESG000003228.1 dd_Smed_v4_1726_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014810Endophilin-A3SMESG000061276.1 dd_Smed_v4_7468_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000707Sodium/hydrogen exchangerSMESG000062012.1 dd_Smed_v4_11493_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006365SMED30006365SMESG000006920.1 dd_Smed_v4_9417_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006541SMED30006541SMESG000012332.1 SMESG000012317.1 SMESG000058954.1 dd_Smed_v4_246_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018767BSD domain-containing proteinSMESG000006780.1 dd_Smed_v4_2724_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016322SeptinSMESG000016474.1 dd_Smed_v4_1198_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017883Serine/threonine-protein phosphataseSMESG000067423.1 dd_Smed_v4_1407_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30003011NPHP1SMESG000061008.1 dd_Smed_v4_9990_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018039TNF receptor-associated factorSMESG000025998.1 SMESG000025982.1 SMESG000025980.1 SMESG000025963.1 SMESG000025934.1 SMESG000025901.1 SMESG000025797.1 SMESG000025794.1 SMESG000025517.1 dd_Smed_v4_1139_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013840Tektin-2SMESG000065255.1 SMESG000050057.1 dd_Smed_v4_2339_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30003603SMED30003603SMESG000071647.1 dd_Smed_v4_9231_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011512Radial spoke head 1 homologSMESG000014300.1 dd_Smed_v4_3321_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017619TNF receptor-associated factorSMESG000025998.1 SMESG000025982.1 SMESG000025980.1 SMESG000025963.1 SMESG000025934.1 SMESG000025901.1 SMESG000025797.1 SMESG000025794.1 SMESG000025517.1 dd_Smed_v4_1139_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001808Calcium-transporting ATPaseSMESG000056345.1 dd_Smed_v4_13223_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001808Calcium-transporting ATPaseSMESG000056345.1 dd_Smed_v4_10674_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001808Calcium-transporting ATPaseSMESG000056345.1 dd_Smed_v4_9557_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007209serine/threonine-protein kinase DCLK1SMESG000078466.1 SMESG000050786.1 SMESG000024968.1 dd_Smed_v4_3128_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009173Glutamate receptor-interacting protein 2SMESG000031603.1 dd_Smed_v4_3080_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014362F-BAR domain only protein 2SMESG000078045.1 dd_Smed_v4_8587_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019097SOXP-1SMESG000010063.1 dd_Smed_v4_7227_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017369Disabled 2-interacting proteinSMESG000043888.1 dd_Smed_v4_3238_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30003382Homeobox domain-containing proteinSMESG000047763.1 dd_Smed_v4_28958_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016078Actin, cytoplasmicSMESG000012332.1 SMESG000012317.1 SMESG000058954.1 dd_Smed_v4_246_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016078Actin, cytoplasmicSMESG000012332.1 SMESG000012317.1 dd_Smed_v4_285_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016249SMED30016249SMESG000080837.1 dd_Smed_v4_3291_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006093Multiple PDZ domain crumbs cell polarity complex componentSMESG000056186.1 dd_Smed_v4_4520_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012136radial spoke head protein 9 homologSMESG000046857.1 dd_Smed_v4_4707_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009144CCDC66 domain-containing proteinSMESG000019367.1 dd_Smed_v4_11800_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017333centrosomal protein of 83 kDa-likeSMESG000033227.1 SMESG000033225.1 dd_Smed_v4_12969_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012271TalinSMESG000072542.1 dd_Smed_v4_2443_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013882Spds-1SMESG000023363.1 dd_Smed_v4_3295_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013015Flotillin-1SMESG000004975.1 dd_Smed_v4_1637_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001570Cyclin-dependent kinase 17SMESG000078466.1 SMESG000050786.1 SMESG000024968.1 dd_Smed_v4_3128_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002064Doublecortin domain-containing protein 2SMESG000040482.1 SMESG000040481.1 SMESG000040480.1 SMESG000038137.1 dd_Smed_v4_6464_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000850slc7a-8SMESG000006721.1 dd_Smed_v4_12027_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016516Protein diaphanous homolog 2SMESG000057806.1 dd_Smed_v4_2533_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004756Small nuclear ribonucleoprotein Sm D2SMESG000032344.1 dd_Smed_v4_2994_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023988Dynamin-type G domain-containing proteinSMESG000002973.1 dd_Smed_v4_9275_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025635pi3k-like proteinSMESG000011425.1 dd_Smed_v4_8025_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030038ATP-dependent RNA helicaseSMESG000011907.1 dd_Smed_v4_596_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025755DNA-binding protein RFX5SMESG000072002.1 dd_Smed_v4_6108_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034412E3 ubiquitin-protein ligase CBLSMESG000056433.1 dd_Smed_v4_6780_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027683Golgi phosphoprotein 3SMESG000073543.1 SMESG000073542.1 dd_Smed_v4_1770_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032531SMED30032531SMESG000024850.1 dd_Smed_v4_9209_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034249SMED30034249SMESG000042496.1 dd_Smed_v4_8345_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030845AfadinSMESG000037577.1 dd_Smed_v4_7215_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035987Expressed conserved proteinSMESG000044572.1 dd_Smed_v4_5021_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031975SMED30031975SMESG000021174.1 dd_Smed_v4_890_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022612Ester hydrolase C11orf54-like proteinSMESG000027576.1 SMESG000007855.1 dd_Smed_v4_1733_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034525Dynein light chainSMESG000008592.1 dd_Smed_v4_9661_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023062bruno-likeSMESG000021009.1 dd_Smed_v4_2592_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028425Anion exchange protein 3SMESG000020434.1 dd_Smed_v4_8250_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027686Bestrophin homologSMESG000054993.1 dd_Smed_v4_8314_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022804slc12a-1SMESG000043221.1 SMESG000043220.1 dd_Smed_v4_4047_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033662unconventional myosin-IdSMESG000051401.1 dd_Smed_v4_3957_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021063SMED30021063SMESG000025889.1 dd_Smed_v4_17_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027834Thymidine phosphorylaseSMESG000008845.1 dd_Smed_v4_869_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027517translin-associated factor X-interacting protein 1SMESG000041265.1 dd_Smed_v4_9718_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025923Mediator of DNA damage checkpoint protein 1SMESG000044397.1 dd_Smed_v4_4697_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026987TNF receptor-associated factorSMESG000025998.1 SMESG000025982.1 SMESG000025980.1 SMESG000025963.1 SMESG000025934.1 SMESG000025901.1 SMESG000025797.1 SMESG000025794.1 SMESG000025517.1 dd_Smed_v4_1139_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031519Tyrosine-protein kinaseSMESG000020289.1 dd_Smed_v4_9416_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026402Tyrosine-protein kinaseSMESG000045588.1 SMESG000029204.1 dd_Smed_v4_3147_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032329SMED30032329SMESG000042387.1 dd_Smed_v4_6329_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023081SMED30023081SMESG000043010.1 SMESG000007603.1 dd_Smed_v4_7118_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034947SMED30034947SMESG000077223.1 dd_Smed_v4_7005_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035950G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000055047.1 dd_Smed_v4_15925_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022992Myosin heavy chainSMESG000062420.1 dd_Smed_v4_791_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30029763histone H1SMESG000024348.1 SMESG000010800.1 dd_Smed_v4_601_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030419SMED30030419SMESG000067626.1 dd_Smed_v4_5233_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021252Sorting nexin, putativeSMESG000016883.1 dd_Smed_v4_1354_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025872Pleckstrin homology and RhoGEF domain containing G5SMESG000023541.1 SMESG000023540.1 dd_Smed_v4_10072_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025309Dimer_Tnp_hAT domain-containing proteinSMESG000066861.1 SMESG000059630.1 SMESG000066862.1 dd_Smed_v4_6647_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032800Serine/threonine-protein kinase DCLK3SMESG000072629.1 dd_Smed_v4_12689_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020076C2H2-type domain-containing proteinSMESG000055233.1 dd_Smed_v4_14364_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026877HORMA domain-containing proteinSMESG000066514.1 dd_Smed_v4_2201_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023347Kinesin motor domain-containing proteinSMESG000069689.1 dd_Smed_v4_10482_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024458SMED30024458SMESG000023541.1 SMESG000023540.1 dd_Smed_v4_10072_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031509Acid sphingomyelinase-like phosphodiesteraseSMESG000055453.1 dd_Smed_v4_15691_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024579SJCHGC07397 proteinSMESG000050581.1 dd_Smed_v4_10396_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035682SMED30035682SMESG000078345.1 dd_Smed_v4_11324_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027865Asparagine synthetase domain-containing protein 1SMESG000078345.1 dd_Smed_v4_11324_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30029555Serine/arginine-rich splicing factor 4SMESG000045501.1 dd_Smed_v4_473_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035231SMED30035231SMESG000066861.1 SMESG000059630.1 SMESG000066862.1 dd_Smed_v4_6647_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027114Protocadherin Fat 4SMESG000032466.1 dd_Smed_v4_17898_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020273Pyruvate kinaseSMESG000063570.1 dd_Smed_v4_1511_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024527non-gastric H ,K -ATPase alpha subunitSMESG000041938.1 SMESG000041937.1 SMESG000051989.1 dd_Smed_v4_1179_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023181SMED30023181SMESG000008713.1 dd_Smed_v4_28592_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023379Piezo-type mechanosensitive ion channel componentSMESG000051188.1 dd_Smed_v4_7182_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022835ras-related protein Rab-35SMESG000072655.1 dd_Smed_v4_3102_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024368chromodomain helicase DNA-binding protein 4SMESG000068192.1 dd_Smed_v4_2331_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30029034SMED30029034SMESG000080934.1 SMESG000079283.1 SMESG000076702.1 SMESG000076680.1 SMESG000064484.1 SMESG000061231.1 SMESG000057323.1 SMESG000056845.1 SMESG000050587.1 SMESG000046239.1 SMESG000020034.1 SMESG000018611.1 SMESG000017693.1 SMESG000010797.1 SMESG000007977.1 dd_Smed_v4_8128_0_2dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022385Hyaluronan binding protein 2SMESG000061109.1 dd_Smed_v4_2031_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031736SMED30031736SMESG000019122.1 dd_Smed_v4_8185_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035696PhosphodiesteraseSMESG000019038.1 dd_Smed_v4_8595_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035495Ankyrin repeat domain-containing 42SMESG000005009.1 dd_Smed_v4_10615_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035746Glycerol-3-phosphate dehydrogenase [NAD( )]SMESG000015312.1 dd_Smed_v4_2565_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031458Zinc finger, FYVE domain containing 16SMESG000036666.1 dd_Smed_v4_6618_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027019InnexinSMESG000030971.1 SMESG000030964.1 dd_Smed_v4_10061_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022121SMED30022121SMESG000042798.1 dd_Smed_v4_2204_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023180slc6a-12SMESG000055640.1 dd_Smed_v4_8727_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031722ANK_REP_REGION domain-containing proteinSMESG000022931.1 dd_Smed_v4_11187_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034096Peptidoglycan recognition protein-1SMESG000081052.1 SMESG000028122.1 dd_Smed_v4_6162_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015546Cyclic AMP-responsive element-binding protein 3SMESG000059546.1 dd_Smed_v4_1032_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012493Plastin-2SMESG000007726.1 dd_Smed_v4_11520_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011615SMED30011615SMESG000036524.1 dd_Smed_v4_11034_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015700Mitochondrial import receptor subunit TOM70SMESG000070025.1 dd_Smed_v4_10337_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007292OtopetrinSMESG000018670.1 dd_Smed_v4_13612_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006006SMED30006006SMESG000007018.1 SMESG000007017.1 dd_Smed_v4_1969_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007670DystrobrevinSMESG000078318.1 dd_Smed_v4_12275_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004959SMED30004959SMESG000046821.1 dd_Smed_v4_14435_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015887DUF4550 domain-containing proteinSMESG000000883.1 dd_Smed_v4_10058_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013472SMED30013472SMESG000072084.1 dd_Smed_v4_10830_0_2dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012798OtopetrinSMESG000018671.1 dd_Smed_v4_12986_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009119Ankyrin-2SMESG000058557.1 dd_Smed_v4_1432_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000896Coiled-coil domain-containing protein 186SMESG000062953.1 dd_Smed_v4_14004_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002486slc31a-1SMESG000005775.1 dd_Smed_v4_1513_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017326C2H2-type domain-containing proteinSMESG000042801.1 dd_Smed_v4_14176_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012379SMED30012379SMESG000058557.1 dd_Smed_v4_1432_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006653SMED30006653SMESG000058633.1 dd_Smed_v4_2131_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006290SMED30006290SMESG000072418.1 dd_Smed_v4_1561_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012981Cyclic nucleotide gated channel 1SMESG000036524.1 dd_Smed_v4_11034_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001666slc18a-1SMESG000041557.1 SMESG000041534.1 dd_Smed_v4_11917_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3001422860S ribosomal protein L6SMESG000050581.1 dd_Smed_v4_10396_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019733Voltage-dependent calcium channelSMESG000076454.1 SMESG000076415.1 dd_Smed_v4_7314_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010638DNA-binding protein inhibitor ID-2SMESG000017492.1 dd_Smed_v4_11911_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011581AP2-associated protein kinase 1-like ProteinSMESG000041938.1 SMESG000041937.1 SMESG000051989.1 dd_Smed_v4_1179_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017223Ras-related protein Rab-8ASMESG000030619.1 dd_Smed_v4_1573_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009793Dach-2SMESG000033540.1 dd_Smed_v4_11289_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009968Intraflagellar transport protein 122 homologSMESG000039305.1 SMESG000039304.1 dd_Smed_v4_11912_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018104slc5a-4SMESG000034669.1 dd_Smed_v4_13771_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007503SMED30007503SMESG000039907.1 dd_Smed_v4_13316_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011465OtopetrinSMESG000018670.1 dd_Smed_v4_13612_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008756SMED30008756SMESG000007049.1 dd_Smed_v4_14707_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007839cAMP-dependent protein kinase type I-alpha regulatory subunitSMESG000074764.1 dd_Smed_v4_2180_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002906SMED30002906SMESG000064079.1 dd_Smed_v4_11489_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015061G protein regulated inducer of neurite outgrowthSMESG000062691.1 dd_Smed_v4_10294_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018972ANK_REP_REGION domain-containing proteinSMESG000022931.1 dd_Smed_v4_11187_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3000448460S ribosomal protein L8SMESG000017087.1 dd_Smed_v4_108_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013653Protein lifeguard 4SMESG000027408.1 dd_Smed_v4_1521_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014820Centrosomal protein of 135 kDa (Cep135 protein) (Centrosomal protein 4), putativeSMESG000052451.1 dd_Smed_v4_11072_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017937WASP like actin nucleation promoting factor bSMESG000074788.1 dd_Smed_v4_1987_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018423TAR DNA-binding protein 43SMESG000042285.1 dd_Smed_v4_20304_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007001SMED30007001SMESG000072162.1 dd_Smed_v4_537_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007993GTP-binding proteinSMESG000065983.1 dd_Smed_v4_11291_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011096Centrosomal protein 131SMESG000051138.1 dd_Smed_v4_13976_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001875Dynein light chain roadblockSMESG000072361.1 dd_Smed_v4_1126_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020007Dystrobrevin betaSMESG000078318.1 dd_Smed_v4_12275_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034085SMED30034085SMESG000081261.1 dd_Smed_v4_10592_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033750Protein kinaseSMESG000070879.1 SMESG000070880.1 dd_Smed_v4_3195_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030204SMED30030204SMESG000018900.1 dd_Smed_v4_10059_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034254calreticulin-1SMESG000009012.1 dd_Smed_v4_220_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027772SMED30027772SMESG000004952.1 SMESG000004951.1 dd_Smed_v4_2235_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025223Neuropeptide Y prohormone-2SMESG000050247.1 SMESG000050248.1 dd_Smed_v4_10191_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026646Dynein light chainSMESG000009941.1 dd_Smed_v4_107_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30029350Serine incorporator 3SMESG000020805.1 dd_Smed_v4_1130_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022325SMED30022325SMESG000022410.1 SMESG000022409.1 dd_Smed_v4_1683_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019374Sodium-dependent glucose transporter 1SMESG000015183.1 dd_Smed_v4_8337_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018408SMED30018408SMESG000054324.1 dd_Smed_v4_8695_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017127Tektin 3SMESG000062615.1 dd_Smed_v4_6883_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015301SMED30015301SMESG000024440.1 dd_Smed_v4_7463_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009591Tumor protein D54SMESG000037796.1 SMESG000057565.1 SMESG000057564.1 dd_Smed_v4_2842_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008964SMED30008964SMESG000010167.1 dd_Smed_v4_8925_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008578TitinSMESG000029197.1 dd_Smed_v4_866_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012977SMED30012977SMESG000076174.1 dd_Smed_v4_2880_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015332Ciliogenesis-associated TTC17-interacting proteinSMESG000009424.1 dd_Smed_v4_5952_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019455LIM domain-containing proteinSMESG000066861.1 SMESG000059630.1 SMESG000066862.1 dd_Smed_v4_6647_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006931SMED30006931SMESG000040565.1 dd_Smed_v4_4660_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016162Golgi apparatus protein 1SMESG000020960.1 dd_Smed_v4_3691_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027279SMED30027279SMESG000070879.1 SMESG000070880.1 dd_Smed_v4_3195_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023825LITAF domain-containing proteinSMESG000020853.1 dd_Smed_v4_353_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30029098Oxygen-dependent coproporphyrinogen-III oxidaseSMESG000039696.1 dd_Smed_v4_2002_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035432SMED30035432SMESG000044186.1 dd_Smed_v4_13633_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028928mutS protein homolog 4SMESG000019325.1 dd_Smed_v4_12806_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033439Voltage-dependent L-type calcium channel subunit alphaSMESG000016041.1 SMESG000016040.1 dd_Smed_v4_9877_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034451Transmembrane protein 220SMESG000010766.1 SMESG000010767.1 dd_Smed_v4_1981_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023882Rootletin-2SMESG000081227.1 dd_Smed_v4_6573_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027451PMP-22/EMP/MP20/Claudin tight junctionSMESG000029752.1 dd_Smed_v4_2731_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028908GTP cyclohydrolase 1 feedback regulatory proteinSMESG000042387.1 dd_Smed_v4_6329_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030769SMED30030769SMESG000027067.1 dd_Smed_v4_16115_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032498NPHP8SMESG000076081.1 dd_Smed_v4_11425_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026367Bifunctional polynucleotide phosphatase/kinaseSMESG000034225.1 dd_Smed_v4_1211_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023509DH domain-containing proteinSMESG000017234.1 dd_Smed_v4_4803_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034473casein kinase I isoform X3SMESG000048912.1 SMESG000020005.1 dd_Smed_v4_172_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025672Radial spoke head 3SMESG000067698.1 dd_Smed_v4_2287_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031633enkurin isoform X1SMESG000076528.1 dd_Smed_v4_2868_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031496Leucine zipper transcription factor like 1SMESG000020499.1 dd_Smed_v4_8415_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025957PolyubiquitinSMESG000057324.1 dd_Smed_v4_458_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026124Dynein heavy chain, axonemalSMESG000040511.1 dd_Smed_v4_6557_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034775Ras-associating domain-containing proteinSMESG000002146.1 dd_Smed_v4_3216_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034335SMED30034335SMESG000009102.1 dd_Smed_v4_8341_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031564Rho GTPase-activating protein 5SMESG000072461.1 dd_Smed_v4_8436_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032457SMED30032457SMESG000077599.1 dd_Smed_v4_6100_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032587Protein kinase domain-containing proteinSMESG000056719.1 dd_Smed_v4_7028_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022232Glutathione s-transferaseSMESG000016846.1 dd_Smed_v4_1206_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031784Hemicentin-1SMESG000024603.1 dd_Smed_v4_2783_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017721SMED30017721SMESG000037259.1 dd_Smed_v4_4831_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014097Cytochrome P450 2K1-like proteinSMESG000034110.1 dd_Smed_v4_3919_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010123Sodium/potassium-transporting ATPase subunit beta-1SMESG000064593.1 dd_Smed_v4_2210_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013083SMED30013083SMESG000062614.1 dd_Smed_v4_11991_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011525SMED30011525SMESG000000175.1 dd_Smed_v4_383_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006343dynein heavy chain 5, axonemalSMESG000049144.1 dd_Smed_v4_4569_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000179MFS domain-containing proteinSMESG000060699.1 dd_Smed_v4_5351_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013205TNF receptor-associated factorSMESG000035332.1 SMESG000031365.1 SMESG000077214.1 SMESG000075241.1 SMESG000075191.1 dd_Smed_v4_168_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001036Receptor-type tyrosine-protein phosphatase betaSMESG000050003.1 SMESG000005247.1 dd_Smed_v4_5794_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011984partitioning defective 3 homolog isoform X2SMESG000071209.1 dd_Smed_v4_5548_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018724SMED30018724SMESG000036933.1 dd_Smed_v4_3235_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012622Intraflagellar transport 43SMESG000067883.1 dd_Smed_v4_5237_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015808TNF receptor-associated factorSMESG000001468.1 dd_Smed_v4_5675_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000691Eukaryotic initiation factor 4A-IIISMESG000078818.1 dd_Smed_v4_737_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010337major facilitator superfamily domain-containing protein 1SMESG000017192.1 dd_Smed_v4_1829_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013212Histone H2ASMESG000015784.1 dd_Smed_v4_469_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007392tetratricopeptide repeat protein 38SMESG000072019.1 SMESG000071607.1 dd_Smed_v4_3316_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000708Dynein heavy chain 5, axonemalSMESG000049144.1 dd_Smed_v4_4569_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30003675adenylate kinase 7-likeSMESG000075409.1 dd_Smed_v4_5880_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3000344260S ribosomal protein L23SMESG000023040.1 dd_Smed_v4_242_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007557DUF4515 domain-containing proteinSMESG000013289.1 dd_Smed_v4_13384_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3000621640S ribosomal protein S8SMESG000047167.1 dd_Smed_v4_156_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011564Ras associated and pleckstrin ySMESG000058735.1 dd_Smed_v4_17910_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011564Ras associated and pleckstrin ySMESG000058735.1 dd_Smed_v4_26418_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019505Ig-like domain-containing proteinSMESG000002617.1 dd_Smed_v4_4401_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015310DUF3421 domain-containing proteinSMESG000046710.1 SMESG000046697.1 dd_Smed_v4_54_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001419Xaa-Pro dipeptidaseSMESG000012999.1 dd_Smed_v4_1297_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002040Endothelin converting enzyme 2SMESG000069765.1 SMESG000070035.1 dd_Smed_v4_5256_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019565Radial spoke head protein 4-like protein ASMESG000044927.1 dd_Smed_v4_5346_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000566Ropporin-1-like proteinSMESG000079804.1 dd_Smed_v4_4888_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006125C2H2-type domain-containing proteinSMESG000020158.1 dd_Smed_v4_14413_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014190Catenin alphaSMESG000010738.1 dd_Smed_v4_5822_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007795Essential myosin light chainSMESG000042179.1 dd_Smed_v4_559_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017089SMED30017089SMESG000001468.1 dd_Smed_v4_5675_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005521EF-hand domain-containing proteinSMESG000006807.1 dd_Smed_v4_6707_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004846Actin-binding LIM proteinSMESG000080177.1 dd_Smed_v4_5410_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005661Ras-related protein Rab-7aSMESG000068863.1 dd_Smed_v4_491_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018827GDT1 family proteinSMESG000008670.1 dd_Smed_v4_3586_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011335Dynein heavy chain 10, axonemalSMESG000051829.1 dd_Smed_v4_5169_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011335Dynein heavy chain 10, axonemalSMESG000051829.1 dd_Smed_v4_12797_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001788PhosphoglucomutaseSMESG000069481.1 dd_Smed_v4_4058_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006886SMED30006886SMESG000024489.1 dd_Smed_v4_5366_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014550Intraflagellar transport protein 43SMESG000067883.1 dd_Smed_v4_5237_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012368Prominin (Prom) protein, putativeSMESG000025078.1 dd_Smed_v4_6506_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007097Rho guanine nucleotide exchange factor 28SMESG000021797.1 dd_Smed_v4_5252_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010581SMED30010581SMESG000056022.1 dd_Smed_v4_5285_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004194SMED30004194SMESG000009646.1 dd_Smed_v4_23871_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004194SMED30004194SMESG000009646.1 dd_Smed_v4_12139_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004412SMED30004412SMESG000025157.1 dd_Smed_v4_9730_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006260Sh3 domain-binding glutamic acid-rich-like proteinSMESG000018980.1 dd_Smed_v4_4404_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012757Tektin-4SMESG000068903.1 dd_Smed_v4_4872_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013744SMED30013744SMESG000001468.1 dd_Smed_v4_5675_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014236Transmembrane protein 86ASMESG000038930.1 dd_Smed_v4_5848_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000065SMED30000065SMESG000049103.1 dd_Smed_v4_397_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015079Dynein heavy chain 5, axonemalSMESG000049144.1 dd_Smed_v4_4569_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010935Katanin p80 WD40 repeat-containing subunit B1SMESG000068822.1 dd_Smed_v4_5495_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014233SMED30014233SMESG000045992.1 dd_Smed_v4_6974_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013563Serine/threonine-protein kinase 10SMESG000064983.1 dd_Smed_v4_5720_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001116cilia- and flagella-associated protein 44-likeSMESG000022927.1 dd_Smed_v4_8760_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005838X1.C3.3SMESG000058321.1 SMESG000058307.1 dd_Smed_v4_68_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3000665560S ribosomal protein L32SMESG000060036.1 dd_Smed_v4_149_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006391SMED30006391SMESG000026399.1 dd_Smed_v4_110_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019325Myosin regulatory light chainSMESG000000175.1 dd_Smed_v4_383_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010898Protein furry-like proteinSMESG000041948.1 dd_Smed_v4_4962_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001988Non-specific serine/threonine protein kinaseSMESG000036933.1 dd_Smed_v4_3235_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002537Y box protein-1SMESG000058013.1 dd_Smed_v4_35_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007567Lysosomal trafficking regulatorSMESG000069984.1 SMESG000069981.1 dd_Smed_v4_756_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017401Serine/threonine-protein kinase OSR1SMESG000052774.1 dd_Smed_v4_6126_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024412Guanine nucleotide-binding protein subunit gammaSMESG000014262.1 dd_Smed_v4_2883_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024153SMED30024153SMESG000035332.1 SMESG000031365.1 SMESG000077214.1 SMESG000075241.1 SMESG000075191.1 dd_Smed_v4_168_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026372Ig-like domain-containing proteinSMESG000003800.1 dd_Smed_v4_4231_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034781Thioredoxin domain-containing protein 9SMESG000016657.1 dd_Smed_v4_368_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30029745SMED30029745SMESG000003948.1 dd_Smed_v4_5093_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025753SMED30025753SMESG000016791.1 dd_Smed_v4_10_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032755Splicing factor 3a subunit 2SMESG000081421.1 dd_Smed_v4_1788_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032687Synapse-associated protein 1SMESG000070056.1 dd_Smed_v4_1295_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020070High mobility group protein B1SMESG000034017.1 dd_Smed_v4_1095_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024040Sesquipedalian-1SMESG000053122.1 dd_Smed_v4_5038_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030643Methylmalonic aciduria and homocystinuria type D-like protein, mitochondrialSMESG000030431.1 dd_Smed_v4_2046_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020347Transient receptor potential cation channelSMESG000004126.1 dd_Smed_v4_11377_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034862SMED30034862SMESG000049533.1 dd_Smed_v4_3835_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024725Protein lin-7 homologSMESG000057909.1 dd_Smed_v4_1009_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033487cilia- and flagella-associated protein 70SMESG000009189.1 dd_Smed_v4_10893_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30029711SMED30029711SMESG000039803.1 dd_Smed_v4_3788_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30029960SMED30029960SMESG000056926.1 dd_Smed_v4_270_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020534Ribonuclease t2SMESG000048912.1 SMESG000020005.1 dd_Smed_v4_172_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024754CystatinSMESG000034246.1 dd_Smed_v4_423_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032979slc6a-8SMESG000079327.1 SMESG000079326.1 dd_Smed_v4_2109_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033280SMED30033280SMESG000006336.1 dd_Smed_v4_11671_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034765Protocadherin gamma B1SMESG000035879.1 dd_Smed_v4_12023_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033302RNA-binding protein MEX3BSMESG000044270.1 SMESG000030021.1 SMESG000025422.1 dd_Smed_v4_1999_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021105Tubulin alpha chainSMESG000005506.1 SMESG000005505.1 SMESG000005493.1 SMESG000005489.1 SMESG000005487.1 dd_Smed_v4_38_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021977Beta-1,3-galactosyltransferase 1SMESG000035184.1 dd_Smed_v4_11741_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020341General transcription factor 3C polypeptide 5SMESG000017479.1 dd_Smed_v4_2071_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024150C2H2-type domain-containing proteinSMESG000004456.1 dd_Smed_v4_12617_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022344FERM domain containing-1SMESG000070273.1 dd_Smed_v4_1131_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022281Phosphatidylinositol 3-kinase catalytic subunit type 3SMESG000051502.1 dd_Smed_v4_5028_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027818Si:ch211-163l21.7SMESG000026490.1 dd_Smed_v4_3833_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022009CEP97SMESG000041551.1 dd_Smed_v4_11066_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022167SMED30022167SMESG000031417.1 dd_Smed_v4_11958_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30029727Zinc finger, C2H2 typeSMESG000073676.1 dd_Smed_v4_5177_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020981Protein NDRG3SMESG000005138.1 SMESG000005122.1 dd_Smed_v4_1911_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009690TransporterSMESG000042086.1 SMESG000042051.1 dd_Smed_v4_3642_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017663Fer-1-relatedSMESG000070967.1 dd_Smed_v4_4648_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019898Slc42a-1SMESG000048173.1 dd_Smed_v4_3286_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000883Glutathione S-transferaseSMESG000015099.1 SMESG000015094.1 SMESG000014182.1 dd_Smed_v4_1517_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015948SMED30015948SMESG000042166.1 dd_Smed_v4_4173_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016546SMED30016546SMESG000051921.1 SMESG000051913.1 dd_Smed_v4_1175_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30003118SMED30003118SMESG000006534.1 dd_Smed_v4_4662_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013095DDE_Tnp_1_7 domain-containing proteinSMESG000080622.1 SMESG000068757.1 SMESG000055125.1 SMESG000038294.1 SMESG000032747.1 SMESG000023322.1 dd_Smed_v4_3830_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006312Sodium/potassium-transporting ATPase subunit beta-1SMESG000022447.1 SMESG000022444.1 dd_Smed_v4_12062_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004158Tetratricopeptide repeat protein 25SMESG000067442.1 dd_Smed_v4_3933_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019092Glutathione S-transferaseSMESG000015099.1 SMESG000015094.1 SMESG000014182.1 dd_Smed_v4_1517_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000282X1.A.G7.1SMESG000046817.1 SMESG000046814.1 dd_Smed_v4_1507_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017508MetalloendopeptidaseSMESG000045572.1 dd_Smed_v4_11993_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014392U2 snRNP-associated SURP motif-containing proteinSMESG000026341.1 dd_Smed_v4_3029_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019836CCDC151SMESG000007771.1 dd_Smed_v4_4526_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019668Proactivator polypeptideSMESG000042333.1 dd_Smed_v4_241_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016204cyclinG-like proteinSMESG000077612.1 dd_Smed_v4_6866_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011329TetraspaninSMESG000019452.1 dd_Smed_v4_5409_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30003301RotatinSMESG000018486.1 dd_Smed_v4_13117_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011750Phosphoinositide phospholipase CSMESG000070741.1 SMESG000070728.1 dd_Smed_v4_9716_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019258Cytosolic carboxypeptidase 2SMESG000058240.1 dd_Smed_v4_13450_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006906AnoctaminSMESG000053932.1 dd_Smed_v4_5046_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008861SMED30008861SMESG000004918.1 SMESG000004915.1 dd_Smed_v4_15816_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010504SMED30010504SMESG000010514.1 dd_Smed_v4_4965_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000512cilia- and flagella-associated protein 61SMESG000059955.1 dd_Smed_v4_4908_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009181Non-specific serine/threonine protein kinaseSMESG000057003.1 SMESG000037136.1 dd_Smed_v4_4425_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015577KinaseSMESG000022299.1 dd_Smed_v4_3701_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001490ADF-H domain-containing proteinSMESG000080129.1 dd_Smed_v4_260_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012496SMED30012496SMESG000032753.1 SMESG000017208.1 dd_Smed_v4_3340_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014656SMED30014656SMESG000045005.1 dd_Smed_v4_13207_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30003975Ceramide synthase 5SMESG000060101.1 SMESG000039123.1 dd_Smed_v4_4223_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016328Cubilin (intrinsic factor-cobalamin receptor)SMESG000068883.1 dd_Smed_v4_4575_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005213Band 4.1-like protein 5SMESG000007133.1 dd_Smed_v4_4114_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006714SMED30006714SMESG000001790.1 dd_Smed_v4_212_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018435Alpha-int-2SMESG000021746.1 dd_Smed_v4_3365_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001778StAR-related lipid transfer (START) domain containing 7SMESG000018486.1 dd_Smed_v4_13117_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012889Family S33 non-peptidase homologue (S33 family)SMESG000021236.1 dd_Smed_v4_1414_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002092Sodium/potassium-transporting ATPase subunit betaSMESG000061673.1 dd_Smed_v4_2230_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018477Myc box-dependent-interacting protein 1SMESG000021147.1 dd_Smed_v4_3292_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005027Lysine-specific demethylase 6ASMESG000030162.1 dd_Smed_v4_12343_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015567Slc42a-1SMESG000048173.1 dd_Smed_v4_3286_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001235Cilia and flagella associated protein 298SMESG000074029.1 dd_Smed_v4_3612_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019318Sperm associated antigen 6SMESG000018022.1 dd_Smed_v4_3991_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013315SMED30013315SMESG000022425.1 dd_Smed_v4_3843_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015945Centrin-1SMESG000052182.1 SMESG000015458.1 dd_Smed_v4_3644_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007604SMED30007604SMESG000074719.1 dd_Smed_v4_4756_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007604SMED30007604SMESG000074719.1 dd_Smed_v4_3016_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008856SMED30008856SMESG000025888.1 dd_Smed_v4_1422_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30003084Cilia-and flagella-associated protein 45SMESG000016410.1 dd_Smed_v4_3732_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015146SMED30015146SMESG000045005.1 dd_Smed_v4_13207_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027132Calcineurin subunit B typeSMESG000081409.1 dd_Smed_v4_5589_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031446Neuronal guanine nucleotide exchange factorSMESG000003812.1 dd_Smed_v4_5524_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032055slc23a-1SMESG000066904.1 dd_Smed_v4_6597_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030240FerritinSMESG000039456.1 SMESG000014076.1 dd_Smed_v4_443_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031005A disintegrin and metalloproteinase with thrombospondin motifs 2SMESG000051172.1 dd_Smed_v4_16551_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30029024Protein F37C4.5SMESG000064758.1 dd_Smed_v4_5168_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025300SMED30025300SMESG000019783.1 SMESG000019789.1 dd_Smed_v4_4438_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026337AnkyrinSMESG000019783.1 SMESG000019789.1 dd_Smed_v4_4438_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020220Sodium/potassium-transporting ATPase subunit alphaSMESG000032753.1 SMESG000017208.1 dd_Smed_v4_3340_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028986SMED30028986SMESG000045005.1 dd_Smed_v4_13207_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034831SMED30034831SMESG000064758.1 dd_Smed_v4_5168_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022246Coiled-coil domain-containing protein 77SMESG000045184.1 dd_Smed_v4_4812_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025543Coiled-coil domain-containing protein 93SMESG000022913.1 dd_Smed_v4_2519_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034201Delta-like proteinSMESG000036778.1 dd_Smed_v4_15985_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034505Cullin-1SMESG000008644.1 dd_Smed_v4_5770_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030281BHLH domain-containing proteinSMESG000019783.1 SMESG000019789.1 dd_Smed_v4_4438_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021110Dynein heavy chain 17, axonemalSMESG000026263.1 dd_Smed_v4_10425_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031491Armadillo repeat containing 4SMESG000057827.1 dd_Smed_v4_5065_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023244TLC domain-containing protein 2SMESG000060101.1 SMESG000039123.1 dd_Smed_v4_4223_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022057SJCHGC08494 proteinSMESG000027083.1 dd_Smed_v4_2196_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024930slc15a-2SMESG000011953.1 dd_Smed_v4_8983_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021960AminopeptidaseSMESG000067986.1 dd_Smed_v4_2224_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021206Calcineurin B homologous protein 1SMESG000018297.1 dd_Smed_v4_1504_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022974slc17a-5SMESG000060615.1 dd_Smed_v4_4910_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028219SMED30028219SMESG000065952.1 dd_Smed_v4_5480_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030068SMED30030068SMESG000051921.1 SMESG000051913.1 dd_Smed_v4_1175_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023308SMED30023308SMESG000063568.1 dd_Smed_v4_762_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034629Golgi-associated plant pathogenesis-related protein 1SMESG000063568.1 dd_Smed_v4_762_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031646SMED30031646SMESG000010156.1 dd_Smed_v4_105_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023409Glutamate-rich 3SMESG000029848.1 SMESG000029846.1 dd_Smed_v4_8627_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034818Guanylate cyclaseSMESG000010241.1 dd_Smed_v4_7644_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033583SMED30033583SMESG000060313.1 SMESG000049383.1 dd_Smed_v4_158_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022560Ribosomal_L28e domain-containing proteinSMESG000026745.1 dd_Smed_v4_221_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030013GTP-binding nuclear proteinSMESG000072524.1 SMESG000072522.1 dd_Smed_v4_330_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3002420240S ribosomal protein S14SMESG000036550.1 dd_Smed_v4_139_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024115Ubiquitin-40S ribosomal protein S27aSMESG000048830.1 dd_Smed_v4_121_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3002950160S acidic ribosomal protein P1SMESG000062259.1 dd_Smed_v4_224_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025593hemipterousSMESG000000893.1 dd_Smed_v4_5234_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3002074960S acidic ribosomal protein P2SMESG000057890.1 dd_Smed_v4_556_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026807hypothetical proteinSMESG000038313.1 SMESG000038304.1 SMESG000038300.1 SMESG000035867.1 SMESG000035859.1 dd_Smed_v4_964_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031862ras-related protein Rab-27ASMESG000044557.1 dd_Smed_v4_5306_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025338E3 ubiquitin-protein ligase CBLSMESG000072524.1 SMESG000072522.1 dd_Smed_v4_330_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030055Protocadherin-9SMESG000033582.1 dd_Smed_v4_5930_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021890SMED30021890SMESG000067520.1 dd_Smed_v4_5272_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023416ANK_REP_REGION domain-containing proteinSMESG000033773.1 dd_Smed_v4_5594_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028664two pore calcium channel protein 1SMESG000045181.1 SMESG000045178.1 SMESG000045168.1 dd_Smed_v4_8333_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023243SMED30023243SMESG000009320.1 dd_Smed_v4_587_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3002418960S ribosomal protein L31SMESG000017099.1 dd_Smed_v4_113_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021386Y box protein-1SMESG000058066.1 dd_Smed_v4_52_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020388Glycerol-3-phosphate dehydrogenaseSMESG000076995.1 SMESG000076994.1 SMESG000076983.1 SMESG000076982.1 dd_Smed_v4_4928_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020312Pre-mRNA-splicing factor ATP-dependent RNA helicase DHX16-likeSMESG000014714.1 dd_Smed_v4_8001_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028223Stabilizer of axonemal microtubules 1SMESG000042230.1 dd_Smed_v4_5551_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026316Actin-related protein 2/3 complex subunit 5SMESG000023170.1 dd_Smed_v4_781_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033428SMED30033428SMESG000008865.1 dd_Smed_v4_2097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030550Mitogen-activated protein kinase kinase kinase 4SMESG000054074.1 dd_Smed_v4_3368_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030766Y box protein-1SMESG000058066.1 dd_Smed_v4_52_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025152cilia- and flagella-associated protein 91SMESG000056200.1 dd_Smed_v4_9724_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022791RNA-binding protein 26SMESG000027877.1 dd_Smed_v4_5418_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022421RIB43A-like with coiled-coils protein 2SMESG000037028.1 dd_Smed_v4_4547_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013424WD repeat domain 60SMESG000040271.1 dd_Smed_v4_10032_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011228AMMECR1 domain-containing proteinSMESG000059071.1 dd_Smed_v4_1660_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002742DystoninSMESG000043809.1 SMESG000043799.1 dd_Smed_v4_1205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000491Cornifelin-like ASMESG000023836.1 dd_Smed_v4_1291_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019396LsmAD domain-containing proteinSMESG000036673.1 dd_Smed_v4_11128_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008456Type I inositol-1,4,5-trisphosphate 5-phosphataseSMESG000074184.1 dd_Smed_v4_7958_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012763serine incorporatorSMESG000038788.1 dd_Smed_v4_1419_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018999SMED30018999SMESG000058251.1 dd_Smed_v4_10158_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017717Ras-related protein Rab-2ASMESG000076159.1 dd_Smed_v4_1113_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3000283128S ribosomal protein S10 mitochondrialSMESG000041503.1 dd_Smed_v4_2220_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002668HemocytinSMESG000041532.1 dd_Smed_v4_305_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019094Protein flightless-1SMESG000020935.1 dd_Smed_v4_1781_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002667SMED30002667SMESG000076089.1 SMESG000056400.1 dd_Smed_v4_5143_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013260SAM domain-containing proteinSMESG000054431.1 dd_Smed_v4_7610_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013260SAM domain-containing proteinSMESG000010456.1 SMESG000002915.1 dd_Smed_v4_1968_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018823ATP-dependent 6-phosphofructokinaseSMESG000029088.1 dd_Smed_v4_1604_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014919KIF3A-like proteinSMESG000075065.1 dd_Smed_v4_4343_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000411Dynamin-1SMESG000021502.1 dd_Smed_v4_2160_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022699SMED30022699SMESG000056221.1 SMESG000046858.1 SMESG000029613.1 SMESG000025472.1 SMESG000023703.1 SMESG000011090.1 dd_Smed_v4_17710_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020414SMED30020414SMESG000059071.1 dd_Smed_v4_1660_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022539SMED30022539SMESG000059071.1 dd_Smed_v4_1660_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022458Disintegrin and metalloproteinase domain-containing protein 15SMESG000076089.1 SMESG000056400.1 dd_Smed_v4_5143_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30029528Zinc finger proteinSMESG000067419.1 dd_Smed_v4_10260_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30029550ArfGAP with coiled-coil, ankyrin repeat and PH domains 1SMESG000026501.1 dd_Smed_v4_2261_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034724Actin-related protein 10-likeSMESG000009976.1 dd_Smed_v4_2141_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30029361KIF3B-like proteinSMESG000075065.1 dd_Smed_v4_4343_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035198SMED30035198SMESG000023046.1 SMESG000023044.1 dd_Smed_v4_6118_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025105Plastin 3SMESG000081126.1 SMESG000081113.1 dd_Smed_v4_749_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028071DAB2 interacting protein bSMESG000000171.1 dd_Smed_v4_3907_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026956LaminSMESG000018461.1 dd_Smed_v4_3707_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025001Armadillo repeat-containing protein 3SMESG000079416.1 dd_Smed_v4_9679_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027566SMED30027566SMESG000075236.1 dd_Smed_v4_7519_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030891Sphingolipid delta-4 desaturaseSMESG000078629.1 dd_Smed_v4_7414_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021525mutS protein homolog 5SMESG000006277.1 dd_Smed_v4_30393_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023091MORN repeat-containing protein 3SMESG000011788.1 dd_Smed_v4_3784_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011727Dedicator of cytokinesis 4bSMESG000063593.1 SMESG000063592.1 SMESG000063595.1 dd_Smed_v4_6156_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008461nuclear mitotic apparatus protein 1 isoform X2SMESG000071994.1 dd_Smed_v4_10823_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016746SMED30016746SMESG000060159.1 dd_Smed_v4_2729_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30003276Protein atonal like protein 8SMESG000056587.1 dd_Smed_v4_9899_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001871SMED30001871SMESG000045185.1 SMESG000045184.1 dd_Smed_v4_4812_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001473Lipoxygenase homology domain-containing protein 1SMESG000059926.1 SMESG000059927.1 dd_Smed_v4_10460_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018297Dynein light chainSMESG000019341.1 dd_Smed_v4_177_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001031TRAF3-interacting protein 1SMESG000006345.1 dd_Smed_v4_10562_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008486SMED30008486SMESG000014085.1 SMESG000014086.1 SMESG000014087.1 dd_Smed_v4_10249_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010150SMED30010150SMESG000067313.1 dd_Smed_v4_11060_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013390Nesprin-1SMESG000069851.1 dd_Smed_v4_10646_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015451Ig-like domain-containing proteinSMESG000025920.1 dd_Smed_v4_11533_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010620Histone acetyltransferaseSMESG000017094.1 dd_Smed_v4_12274_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006074SMED30006074SMESG000019341.1 dd_Smed_v4_177_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004636SMED30004636SMESG000061388.1 dd_Smed_v4_11530_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012419Non-specific serine/threonine protein kinaseSMESG000069962.1 SMESG000069953.1 SMESG000069952.1 dd_Smed_v4_3244_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019300Histone deacetylase,putativeSMESG000006246.1 dd_Smed_v4_1997_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3000599860s ribosomal protein l3SMESG000081260.1 dd_Smed_v4_12559_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005046Dynein heavy chain, axonemalSMESG000050247.1 SMESG000050248.1 dd_Smed_v4_10191_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005046Dynein heavy chain, axonemalSMESG000050247.1 dd_Smed_v4_13135_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED300149112-oxoglutarate dehydrogenase mitochondrialSMESG000020522.1 dd_Smed_v4_1869_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011213Osteoclast-stimulating factor 1SMESG000004952.1 SMESG000004951.1 dd_Smed_v4_2235_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002489Apical junction component 1 homologSMESG000037093.1 dd_Smed_v4_11689_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005391SMED30005391SMESG000033327.1 dd_Smed_v4_12967_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000373retinol dehydrogenase 13-likeSMESG000049264.1 SMESG000009696.1 SMESG000009679.1 dd_Smed_v4_2096_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007755LIM and SH3 domain protein 1SMESG000002154.1 dd_Smed_v4_1218_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017587cilia- and flagella-associated protein 65SMESG000069031.1 dd_Smed_v4_12428_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001402Plastin 3SMESG000007726.1 dd_Smed_v4_15254_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001810Protein NDRG3SMESG000005138.1 SMESG000005122.1 dd_Smed_v4_1911_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014702SMED30014702SMESG000069780.1 dd_Smed_v4_12876_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030330bok-2SMESG000066862.1 dd_Smed_v4_16107_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025510UHRF1-binding protein 1-likeSMESG000044305.1 dd_Smed_v4_11401_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023008HSP27SMESG000030472.1 dd_Smed_v4_2189_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021151Corepressor interacting with RBPJ 1SMESG000027503.1 SMESG000027499.1 dd_Smed_v4_1892_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032471Protocadherin gamma B1SMESG000035879.1 dd_Smed_v4_12023_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028977Sodium/potassium ATPase subunit betaSMESG000022450.1 dd_Smed_v4_14990_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023331Transposon Ty3-I Gag-Pol polyproteinSMESG000054198.1 dd_Smed_v4_6563_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030481Pyruvate kinaseSMESG000017675.1 dd_Smed_v4_2738_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030679Elongation of very long chain fatty acids proteinSMESG000068877.1 SMESG000068874.1 dd_Smed_v4_4252_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032818SCO-spondinSMESG000025547.1 SMESG000025545.1 dd_Smed_v4_7381_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022857Protocadherin Fat 3SMESG000003985.1 dd_Smed_v4_18595_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023905Protein NDRG3SMESG000005138.1 SMESG000005122.1 dd_Smed_v4_1911_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033015SMED30033015SMESG000049533.1 dd_Smed_v4_2058_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031818C-Jun-amino-terminal kinase-interacting protein 4SMESG000027094.1 dd_Smed_v4_4531_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021645SMED30021645SMESG000014085.1 SMESG000014086.1 SMESG000014087.1 dd_Smed_v4_10249_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022428RING-type domain-containing proteinSMESG000010565.1 dd_Smed_v4_10741_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035852Ubiquitin-60S ribosomal protein L40SMESG000035681.1 dd_Smed_v4_176_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020663SMED30020663SMESG000003437.1 dd_2920dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
protonephridiaSMED30020663SMED30020663SMESG000003437.1 dd_Smed_v4_2920_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034202SMED30034202SMESG000077061.1 dd_Smed_v4_1917_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021590Spectrin beta chainSMESG000081696.1 dd_Smed_v4_1122_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032655Armadillo repeat-containing protein 6SMESG000039967.1 dd_Smed_v4_1357_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016328Cubilin (intrinsic factor-cobalamin receptor)SMESG000068883.1 SMED_29161_V2_1GPL14150_gene_modelsPMID:23318641
Chen et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
protonephridiaSMED30016328Cubilin (intrinsic factor-cobalamin receptor)SMESG000068883.1 SMED_29161_V2_1GPL14150PMID:23318641
Chen et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
protonephridiaSMED30011750Phosphoinositide phospholipase CSMESG000070741.1 SMESG000070728.1 dd_Smed_v4_9716_1_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
protonephridiaSMED30015041Retinoic acid receptor betaSMESG000054304.1 SMED30015041smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
protonephridiaSMED30005523Alpha-actininSMESG000026000.1 dd_Smed_v4_1951_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002038Calsyntenin 1SMESG000002834.1 SMESG000002830.1 dd_Smed_v4_1518_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004546Receptor protein-tyrosine kinaseSMESG000044602.1 dd_Smed_v4_11608_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005845NPHS1-6SMESG000028689.1 dd_Smed_v4_10689_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004972SMED30004972SMESG000007019.1 dd_Smed_v4_10965_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006095Aspartate aminotransferaseSMESG000022764.1 dd_Smed_v4_2004_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002938SH3 and multiple ankyrin repeat domains protein 2SMESG000078048.1 dd_Smed_v4_10116_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED300059124-coumarate--CoA ligase family proteinSMESG000041777.1 dd_Smed_v4_10135_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006652dynein heavy chain 6, axonemalSMESG000004477.1 SMESG000004475.1 dd_Smed_v4_10969_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002988Bestrophin homologSMESG000030927.1 dd_Smed_v4_14800_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3000412414-3-3 protein beta/alphaSMESG000055903.1 dd_Smed_v4_138_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004725SMED30004725SMESG000023005.1 dd_Smed_v4_1571_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002809G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000042142.1 dd_Smed_v4_17288_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031695SMED30031695SMESG000009161.1 SMESG000009116.1 dd_Smed_v4_18865_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030636SMED30030636SMESG000016978.1 dd_Smed_v4_19646_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30029450Succinyl-CoA:3-ketoacid-coenzyme A transferaseSMESG000080424.1 dd_Smed_v4_1189_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30029292SMED30029292SMESG000047777.1 dd_Smed_v4_16519_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027306semaphorin-like proteinSMESG000016256.1 SMESG000016255.1 SMESG000010584.1 SMESG000009925.1 dd_Smed_v4_2090_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028293S-adenosylmethionine synthaseSMESG000013953.1 dd_Smed_v4_10278_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030309SMED30030309SMESG000075212.1 SMESG000075211.1 SMESG000074910.1 SMESG000074908.1 SMESG000074907.1 dd_Smed_v4_1061_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031468Propionyl-CoA carboxylase alpha chain, mitochondrialSMESG000034830.1 dd_Smed_v4_1247_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027697SMED30027697SMESG000012408.1 dd_Smed_v4_1776_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031309nuclear protein MDM1-like isoform X1SMESG000058479.1 dd_Smed_v4_10635_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013312CalpainSMESG000062904.1 SMESG000062902.1 dd_Smed_v4_1971_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008169EF-hand domain-containing proteinSMESG000026622.1 dd_Smed_v4_1881_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011948F-box/WD repeat-containing protein 10SMESG000002351.1 SMESG000002342.1 dd_Smed_v4_13271_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017206Band 4.1 protein 2SMESG000062476.1 dd_Smed_v4_2032_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009255Solute carrier family 12 member 9SMESG000033021.1 dd_Smed_v4_1738_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017647SMED30017647SMESG000013908.1 dd_Smed_v4_1173_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010322SMED30010322