protonephridia

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ In Situ Hybridization Data

  ▻ Sequences

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  protonephridia


DEFINITON:

  Excretory organs consisting of flame cells, proximal tubules, and distal tubules connected to a mesenchymal collecting duct.


TERM DEFINITION CITATIONS:

  OCLC:16809160, PMID:26057828, PMID:21828097


TERM CITATIONS:


TERM ID:

  PLANA:0000020


ABOUT THIS TERM:

protonephridia

  ↳is a material entity and organ

  ↳contained in tail region, copulatory region, posterior region of the whole animal, parapharyngeal region, prepharyngeal region, head region, dorsal region of the whole animal and anterior region of the whole animal

  ↳develops from protonephridial progenitor cell

  ↳existence overlaps Stage 6, juvenile stage, asexual adult, adult hermaphrodite, Stage 8 and Stage 7

  ↳part of renal system


  → protonephridial progenitor cell develops into protonephridia


Expand to see terms that part of protonephridia


DEPICTED BY:


BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30021661Carbonic anhydrase 7CAVII-1Stage 6, Stage 7, Stage 8distal tubule, protonephridia, renal system
SMED30030379POU domain proteinpou2/3Stage 5, Stage 6, Stage 7, Stage 8protonephridia, renal system, protonephridial progenitor cell
SMED30030007RootletinH.2.8b, croccStage 5, Stage 6, Stage 7, Stage 8protonephridia, renal system, integumental system, Category 5 cell, proximal tubule
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 ┬Ám

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30030007 ID=SMED30030007|Name=Rootletin|organism=Schmidtea mediterranea sexual|type=transcript|length=6612bp
GTTGTTTTTAAATCACTATTTTTTTTATTTCATCTGATTATAATTTTTTTTTATTGAAATTTGTATTTTGAAATTGGTGA
ACAATGAGTGAGATAGATTATTCCGCTATTGTTCGGAGACGCATTGGAGATATCGATGGGGATTCAAGTGAAGATTCCAG
TTCAAAGGGTTTGCTTCAAGTTAACTTGGAACTGAGAAAGCGCTTAGAGGAAGAACACAATGAGTATCGTAGAAAGCTGA
TAGTTTTCCAAGACAGCCAACAGAAACAAGCGCAATTGGTTCAAAGATTGCAGAAAAAGGTATTGCAATACAAAGAAAAA
TGCACGGAACTTGAATCTAAAATGCAATTTGGCGATTATGAGACTCGAAAAACGAAGTATGGAAGTCCAACGAATAACGG
CTATGGGTCGCGTAGTGAGAATCCCTACGACAATCTGGATTTGGAGAGCACACTCATTAAGTTAGAAGAGGAACAAAAAA
AAACAAATTATCTAACGGAGTTCAATGAACGGCTTCAAGAACAATTAACTCAAGCAACTCAATCAAACCAGAATTTGACG
AGAGACATCAGTAAGCTTTCCGAAGAATGGCAGAGATCAAGGGAGGAGCTTGAACAGAGAGAAAAAATTTGGCGAAATGA
AGAAATGTCATTTAATGACTATTTAGCATCTGAGCATTCGAATCTGCAAAATTTGCAACGCAATACGATAAATTTCCGCC
GTCAATTTATAGAATTGAAAGCTTCAACTGAACGGGAAATAAATAATTTGAAAAATGAATTCAACCGACAGGCACGCTGT
TTGCAAACTGCTTGTTCCAATCTTTCGTGCAACATGAAATCTGCAGAATCTAAACAACAATTGAGTACTGAACGAGAAAG
TCGGGACAAGTTGAATCTCGAAAATCAACTGCGAGAAAAAAACAGAGAATTAACTGATTACCAAACTCGGTATGAATGTG
AAATGACAGAATTGCAACACCGAGTGAAAGAATTAACAGTTCTCAGTGACAAACTGAAAATTCAAAACCTGGAAAAGGAT
CGAGCATTGACAGCTTTGCAAAGAATTAAGAATGGAGATACCGCAGGAGAAATAAATATGGAAGACAAAGCTACAAGAGT
TCTTATTGAAGACACAGAAAGTATGCATCAAGCACTTCGAAATATTTCTCAAGTAGTACTAAATGATTCTGACTATTTCG
ATGCAGAAGACACAGGATTTGAAACAGTTCGAAAGAATAATCGTTCGCCAAGTCCAAGGAGAAATCGTAGCGTCAGTCCT
AACTCAAGATCAGCTAAAACACCGCCATTTGCCGATGCAACGTATGCGGCGGTTCAGTCGGCTATAAATAAAAAATCTCT
ACAGATTCAAGAGCTTAAATCAAAATTAAACAGTTCTAAAGAGAGTTGTACAAACTTCAAAAGACAAATTGATGACAATG
AAAATGAACGTCGACGATTAGAGAATCAAGTTCTCGCCATGAGAGATGAAATTGAAAGTTTACGACGAGATAAAGATGAT
AGTTTTAGAGAAGCGGATCGGTTTAAAAATGCTCTGAACATCACTTCAAATGAACGAAGCCAATTGGAAAAGATTCGATC
ATCACTAAACGATCAAATTGAGCAGCAACTCACAGAAATTGAACGACTTAAGTCAGCCAATCACGAATTACAACGATTGA
GAGAGGCATTGGAAGATGAGCAAGAAGATACTAAAAAAGACTTAGAAAGACAAATTAAAGAAAGTGAAAGATGCCAACGA
TCGATTGATGTTTTGGAAGATAAAATAAGTCGATTTAAAGAAGACGTAGTTAATTACAAAGAGGCAATTAATAAATACCA
ATTAGAAAAAGAAGTATTGGTGCAAGAAAAGGATGAGATTGGTGATGCTTTAAGTCGTTGTGAAATTTCTAAAGCCGAAT
TAGAAATCGAGGTGAATAAACGGCAAACTATTGAAGTAAATTTGGAAGAAAACATTTCAAAATTATCCTCAGAAATCGAA
GAATTGAATGATAAGCGAGCTGAAAACCACAGAACTATTAAACAGCTGGAACATGAAAGAAGTTCTCTTTTGAATGAAAA
ACGATTTTTGGAACAAGAAAAAAGTGGTTTGAAAGATGAGCTTGTTCGATCTGAACAAGAGGCTCTTGGTTTGTCAAATG
AGAAAGCCATTCAACGTCAAAGAATCGAACAACTTGAAATTAATACAGAAAGATTAGAAGAAGAGTTATCGGAACTCAAT
CGAGAAAAGCTAGATCTTACTGAACAAATAGGCTGTTTGCAGAGGCAGAAATCGGCTCTTGCAGAAGAATTGTTGCAATG
TCGTAGAGAATTAGAACGATCTAATAACAGTGTCAACAACTTATCAAAAGAAAAGGAATATCTTACCAAAGAGAAAGGAG
AACTCGTCGTTCAAGTTACAGCTTGCGAAAGGGAAAATCGTCAACAGTCAGAAGTTATTGCTTCTTTGAATTCCGATAGA
GAACAACTGGAAGCTACTCTTTATGATGCTCAACAATTAATCATTCAGTTGGAAACTCGAAAAGAGCAATTAGAAGGCGA
AAACCAAGAGTTGATTGTGAAAAAAGAAAATCTAAATGGAGAACTAGTCAGATTACGACAAGAGTTTCAACTAGAATACG
AGAAGGTTGTTAATTCACGAGAACAATTAAATTGCAGATATCAACAAATGGATAAAGAATATAAGATGGCAATTCAACAA
GAGCGAGATTCTCATGCTGAAGATGTAGAAAGACTAACTAAGATAAACGAAAGCAATCGTCATGGATCTGAAAACGAACG
AGAAGAGCTTATTCATCGATTCAATATGGAGCGTGACGACATGATTCAAAATTACGAACAAGAGAAACAAGAAATGGCCC
AGGAAATCATGACGATCCAACGAGAACGAGATGACTCATTATTAATGGCGGAAAATGAAAAGCAGCAATCATTGAGTTTA
TTAGAACAAGAAAAATGTGCAATCAATGAAAAGCTTATCAAAACGCAATTTGAACTGCAATCGGTTGAGTCGGAATTGGA
TCGCATTAAAAAGGAGTCGTCCAATCGTCAGGAGCAAGACAAACAGAACATTGCCGGCTTGTCGAGTGAACTCAAATCAT
TTAGATCTCAATTTGAGGATAAATGCCAAAATCACGAAATGGAAGTTAAAAGCCTAAATAGTGGAATCAAGGATCTAACA
TTAATGAAAGATCAAGCTCTCAAAGAAGTCCATGATTTGCATACCGGATTAAAAATAGCTGAAGAAACCCGTGATAATTT
GCGTCGGGAAATCATGGAAATGAATCGGAAATTGAAAGAAGCTGAGGAAGCCAAAGAGCACTTAAAGCGTGAAATTAATG
AATTGAAACGTGGATTATGCGAAGAACAAAGGGAAAAAGAAAATGTTATTAACTCAAATGAGAATTTGAGAAAGAAAATT
AAAGATGTTGAAACAGAAAGAATTGATTTGCACAGACAAGTAACGGATTCCAAACAAAAGGTTGCAGTACAAGATGAACA
ATTGGTCAATTCCAAACAAGAGGTCAATGAGTTAAGAAACAATCTTAAAGACGTAGAAAAAGCTCGATTAGATGTCAAAA
GAGAGTTACAAGAACTCAGACGCCATATCAAAGAGCTAGATACGGAAAGGGGCAAATTGACTAAAGAAGTCAATGATTTG
CAAACTCGTGTTGCTAGAGATGAAGAAAAAGAGGATGAAGCTCGTCGGGAAAATTTCGGTCTCAAACAAAAAGTTGTTGA
AACGGAAGCTTCAAGAGAAGCCGTTCGTAAAGATCTTGCTAATGCTCAACGACATATTGTTGATTTGGAAAATGTTCTGC
AGAGCAAAGACAGAGATTTCAGTTCCATGGTGGAATCGAGCCGCCGGGATTATAGGAAACTTGCTGATGCGAGAAATAGC
CTGCAACAAGTATATGATACGATGGTGGCCGATAATAATGAGCTGAGAATTGCTCTCAGTGGAGCAGAAGGTCGGGTCAG
TGCTCTGGAGTCACACATCGCACGAGTTGAAGGAGCTAAGAAAGAAATTGAATTCAAATTGGCTTCTATCCATAGCTCAT
TGCGAAGGCTGATAGGATTCCGACAGGAGAATGTAGTTACTATTCGGTCGAGAAACAACTCCAAATCTCCAGTTAGAGGT
CGATCAGTTAGTCCTCTTAGAAGTAGGCCGGTGTCGCCAACCAAAGGATTTGACAATACCTATGCTACTACAACTGATGG
AAAAGGTAGCCCTATCCCGCGCACAGGGTCTCCGAGTTCTAAACGAAGGCAATTATCAAGATCTCCGTCTAATTGCGATT
TCAATCCAGTCGATATAAATCCAGAAGCAGTTCGTCTGGCCTTGCGAGAATTCGTACAGCAGTTGGTTGATGCTGAACGA
GATAGAGATGACGCTTTTGCTCAAGCTCGCAGCCTAGAATCTCGATTGAAAGAACAAGAAGAACAAAATGAATATGCTGA
AAACCGTTTACAACAACTACAACAAGCTCTGTGTGATGCAGAAGAAGACAAAAAAGGCATTGATGGAAGATTGTCATCAG
CCCAAACTGCCTTAATGATGCAAGAAGAGACTATTCGGCGCAATGAGAGAGATAGAAAAGCAATGGCGGAAAAGTTGAGT
AATTACGATAGAACATTTGCATCCATGGAATCAGAAAAACGACAATTGGAAGATCGGTTGAATAAATTCCGTCATCATGA
TGCCCGATTGGAAGAAGAACATAAGCAGAGCAAAAAAGCTATTGAAAATGCTGAAAATAGAATAACTCAGCTTCAGCTTG
CCAAGCGATCGTTAGAAGGAGATCTTCAAAGAATGAAAATGGCGTTGACAGATAAAGAAACAGAAACCGAAGTTTTGGAT
GACCGCGTAAATAGTTTACTCAAACAAATACAAGATCTCGAGGGAAAATCTCAATCACTTCAACTAACGATTGACAGAAT
GAGTGTCGCCCTTGCAAAAACTGAGGAAGAAGGCAGTTTTCATAAGGACAAAATGCAACAGTTGAATATGAGTTTGAGCA
CTCATTCACAACAACTGGAACAATTACAGAATAAGATTTCTCAATTACAAAAAGCACTCGGCAGTTCAGAACAAGATCGT
CGGCTCTTAGAGGAACGATTAGAAAGCTCTAAAGGAGCATTGCATGAGGCAAAACATCAAAATAATTTGTTGATGGAAAG
AATACAAATAATTCAATCCGATTTAAATGATTCGGAAAATCGTCGATCAGAATTGGAAGGATTAAATCGACAGAGTAACA
CTTTGATTGTACAAAGACAAGAAGCTGAACAAGAACTCAATCAAAAATATCAGAAATTGAACTCGGAGAAAAACACATTA
CAAGAGCGAGTGAATAGCATGCAACGAAATTTGGCTTTGGCAGAAGCAGAAAAACAAGAAATAATAAAAAACCACGGAAA
ATTGGAAAAGGATAGATCTGCCTTGAAAAAGAGTCTTGGAAAAGTTGAACGTCAGAAATTGAAAACCGAAGAAATTGCTA
GCAAAACTGTTTTTGAACGTTCAGAATTAGATCAAATTTTAAGGAGACTTGAAGATGAAAATTGTGAATTACAGAGACAA
GTTGGAATTCTTCAAAATCAATTAGCAGAAGCTGAGCAAGCTCACTGCCACCATTTGATGGAAATCAATTCCCGCCATCG
CCAGGAAATGTCCATGGAAATGGAGCATTTGAGAGCATCGAATGTTCAAATAGAACGAACTCTAGAAGGCAGAGAACGAG
CCCACAGACAAAGAGTTAAGGGTCTGGAAGAACAGATCTCCACCCTCAAAGACCAGCTGACTCATGAAATGCAGAGGCGG
ATGGATAGTGGATATTACGAGTCTACCAGAAAGTCTAATCAATACGATTCAACTGGTGACTTGCGACATGTTCTGGATTC
CAGTTTAACTCGAGTTGCAAAAGACCCTCAACTGGACGCAATGCTACTGGAAACCGAAGCCAGGCGACTCGATGAGTCGA
TATTCATGTGTGGCAGTCGTGATCAGTCTCCGACCCGGCAGAAGCGAATCGAAATGTCAAAGAAGTCCGCAGCCCCTAAC
AATTCCAATCGGCGATTAACTGCCGGCCGTCGCAAATGAACTCGGCCTGTTCCAGTCCGTCCAGAGATGTTATGAAGCCA
CTTTTTAGATGCGTGAGTGTGAGTTCGTGTTGGTGACTGATTCATTTTTAGTAAACAGATTCTGGATTTTTGTTTTTATT
GATAGTGTAATTTCCTAATGCAGATCTGATAGTTGACTTGTTGTTCTTACGTATTCGGTATTTGTGATTCACATAGTCTG
TCATTGTTACTGTGATTTATCCTCTGTGTGACTTTTGTGATTTACTTACTTTATTGCCCCTATAATCAATAAATGGATTT
ATCGATAGTTCAGCCCTCCCCTCCAGCCCTCGTTTTGGGATCCGTAAATTTTGTTTCAATTGAGATCATTATAGTGATTT
TATTCCTTCGAAACCAAACCTTTGGGAGGGACATAAAATTAAATTATTGATTTTTTATTATCTTAGAAGTGAAAGATGTT
TATTTCCCAAATTAACTAATATCAATAATAACTTTAATTTATATCTTCATTA
>SMED30028196 ID=SMED30028196|Name=POU domain protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1170bp
GTATTTAGTAATTTAAAAATAACCTATTTATATTATTGATTAACATAATATAAATATTTAACATCTATAAGATTTCATGA
ATTATTACTACCAATAATTTTTTTAAACTTAAAACACTTGATAAGTATCATGAAATGTTTTTTATTTCCTATTGAATCTA
CAGAAAAGGATAAGTCTTGCACCTTTGTTCTGAAAGATATTAATGAAATTCGAATTTCTGTTCCTATAAAGATATCAGCA
AATAATGATTGTAATAAAACAATTAGCTTTTCTAATTCAGATTTAGAAACTTTAGCCAAAGAAATATCAGCTGCTTTTTC
TAGTAATACTATTGAAAAGAGTACAGAAATAAAAACACTGAATGATTTTATACTTAATCAAAACAAAGATCTTCAAAATT
ATATTAATCATGTTAATGATATACCTACTTTAGATGACTGTTTGCGAAGTAAAAATTTTATATTCAAAACCGAACAAGAT
TTAGAAAGTTTGCATAAAACTCCTTCGACGGCTAGCGAGCAAGAGTCATTAAATATACTATTGAATAAATCTTTGGTTTT
TGATCTGGATTTTATTAAGCAATTTACTAAAGAATTTAAACAATTTCGACAAAATTTAGGAGTAACCCAAATGGAAGTCG
GCCAGTCCATGAAATATTATTTGAAAAGTGATTTCAGTCAAACAACGATTTGTCGATTTGAGTCTATGACGCTGGCATCA
ACAAATATGTTTGAATTGATTCCATATTTCCGAAAATGGATATCCAAAGTATATAATCCCGACAGAACCAAGACAATTAA
AAATGTCATTTCTAAACTGGAATCAATTGACATTTCTCGAGCATTGGAAGACGAGTTTGCGAAAGATAAAACGGACAGCG
AGTCCAGCAATAACAGTAATGGTGATGAAATGGTAAATGTCAAAAGCAAAACTCGGAAACAACGAATCCAATTTACGAGA
TTTCAGTTGAAAAAAATGGAAAGTCTTTTTCAAACAGTCAAACATACGCAAATTACACCGCATGTTTACAAGAAATATGC
TAAAGAATTGAAATTGAGTGAGAAACAAATCCGATGTTGGTTTACTAAGCGCAGAAGGAGTGATAGAATGCACAAGAATA
AAATGAAAATGGAAAAATTTAATTTATAAATAAAATTATGAAAATTTACG
>SMED30010910 ID=SMED30010910|Name=POU domain protein|organism=Schmidtea mediterranea sexual|type=transcript|length=3203bp
TAGGGCTAAATGTAACGCTACTTATCGGTATTGCCACAATTATATTAAGGCAGTGGCACAAACTTATTTTCTCTACCAGG
CCTGCTGAATCGACAAACAAACATATTCATCGTCATTAAATGGGCAGTAGTAGTAGAAACACAGTGGTAAAGACATGGCA
AACACAGCAGCATCAGTGATAGCTGGAAGAGATAGCTACAGCATCAGCAGCAGTAACTCTCGCAGCTAATAATGAAGATA
ATGAGCTAGACTTAATTATCTTGGCTAATAATTTCAAATAAAATATCGCAACTAATTTTGTCATTCGTATTCTGTGAGGA
TAAATCACAAATTTGTTTCGATTGTTGGAAATTTAAATTTTTTTCCCTCGTATTTTCCAAATACTCCAGAGTTTGAAGAG
TATAATGAATTTGTTACCGAATCCGTTACTCACAAATGTGCTGGATATGACTAAACTTGACCAACAAAACCAAATTATCT
CGTGTGGCAATTCGACAAATTTCACCAACAAAAACACAATTGACAGCTCTTCAAATGATACCACACAAGTCAGTTCAACA
GCCAACAACATCAGTTCAATTGAACATTTCCTTTCATCCCGCAATTTAACAAATCAGCTGATAAATAATTCCGGACTCCC
ATTAGGGGCACAGATATTCACCATTCCGGCATCATTGGCGACATTCCCGAATTCGGATTTGATTCCAGTATTCATCAACA
GTTTAGGACAAATGGTTCTGGCAAATACTGGGAATATTCTGGCGAACAGTTTGGCAAGTTTGGCCACCACACTCACGTCA
ATCCAGCAGCTGTCCGTGAACCGTGAATCGAATGTCATCAACACTAATCAAACTACTAACCCAAATGCAGCTATCATAGA
GCACATGATGCAGCAATACCAACAGCTTCAGCTGCTGAAGAACTCAATGATCCATCAATCATGGCCGAATGAGTTCCAGC
AGACATCCTCAAACAACCAAACCAATTCATTTATTGCAAATAATATACCAGTAGCAACTACAAATTCTAGTACAATTAAA
CCCATAGATAAAGTTAATGGCAGTACGCAATTCCAAATTCCGTTGAATTGCAATCCTGCTCCTCTTCAAAATGAAAAATT
TACTACCAATATCATCTCCATAAATGATCGTGCTATAGATAACAAATCCCCAAGCGTCAACTCTTCGGTATCCTCTAGAT
CAGTAGGAAACAAAATTTGTCAAATGATTGACGTCAGTCATGATTACATTTTAAGTCAAGAAGATCATCTGGTGAAAGAA
AAAGCCGCAGAATTACTCCGACATTCACACAACCAAAAAAACGCTATCAAACATGCCCAATGTTCTGATAAATCAGAACC
AACAGCACATAATGTCACAGTGGATGGTGTTGATCTCGGTGAAATCAAAGAATTTGCCCGTAATTTCAAAATTAGACGTC
TCAGCATGGGGTTAACTCAAACACAAGTCGGTCAAGCGCTGACTGCAGCAGAAGGTCCGGCATACAGTCAAAGTGCAATC
TGCAGATTCGAAAAGTTGGATATCACACCGAAATCGGCTCAGAAAATTAAACCAATTCTAGAGAAATGGATCAAAGAATC
CGAAGAAAAATATCTCAGTGGATCGAACAGTGTTGATGATGGATCCGGATCTGACATCAATAAAAAACGGAAACGTCGAA
CGAGTTTTACACCACAAGCACTGGAAATTCTGAATATTCATTTTGAGAGGAAATCTCATCCGACTGGATCGGAAATGCGA
GCATTGGCTAACGACCTCAATTATGACAGAGAGGTCATTAGAGTTTGGTTTTGCAACAAAAGACAAGCGTTAAAGAATTC
TGCCAAGCGAATTAAACAATGTACACCAAACAGCGAATCAAACAACCAGCACATATCTCCCCAAGTCATGAACAGCAACA
GCAACAGCAACAACACCACCATCACCAACCGGGCAGTCACCTAGGCCAAATGCATCCATCCATGATGGACATGTATCAGC
CACACGCGTTCTCAAGACCCATTACTGCTGAATACCAACAGAGTCTCAATCGGCAACAATATCGACGCAGCGACAGCGAT
TGTGGAACTCATGAGCCTGGATATTCGTACCTGCCGACTCCTCATGGGCCAGAAGTGGTGTCATCTCGTCAACATACTCT
CAATAGTCTTCCAGAACAACCGATGGACAATAACAATCATGATCAGCATGATTCTCCAGTACCGATTATTGCCAACAGTA
GCAACAGTAACATCAACAATAACAACAGCAGTTCTGGTCGACATCATCATCGTCGCAAAACCAGATCTCGACAAACCAAT
AATCAAGAGCCGACATCACTAGAACGGAGCCAAGTAATGAAAAATCACAACGACATACCACCAATGTTAGCGCCACGGAC
AAAATTGCCGTATTCCGAGCATCAGGGAATTCATCGTCTATCCGCTCATGAAATGAATACCATTGACAGTCGTGACAATG
CTGTCAATGATTGCAATTCTGAATCCAATACCGCTGGCGCTGTCAGCGATAATTTCGACCCTCCTCTTCATACTCCGGCC
ATTACGATACCAATGAGTCGAAGTACCGCATGGATTGCAACATCGATATGAATGAAAATGAAGCAACTCCCAGTAATTCT
CTGTTGATTGAGAACCTTCCCAGAGTTAGAGATGTTTCCGAGTATGGAATACCTATAAACAATAACAATCACAACATGAA
ACAAGCTCCCGTGCCTCCTCTTAAATCGAATAGTCGACATAATCCTGTGCCTAACAACAGTTACGGTCTCGAGTGCAATC
CTGATTATTATTCATCTGCCACATCTAGTGACAGATCCGGTCCCAGTCCTCCCCCTAAATATGCGCCAGGAGTAGTTCTT
CCTGCCCGTGCTGATGAAATATATATGCGCGATCAAAGAGAAGGAATGTACTATCACGGAGATACTCATTGTTGATAATT
GTATTTCACAATTTCGTTTCATCGGGTGTTCTCGATTGCTGATACTCTATCTCATACCTTTCGATGAATTTCTGATCCCA
ACTGACAGTTGTACAATTCTTATCATCATCATCATCTTCCTCATCTTTTCATATTTTATCTAGTCCTACTTGCAATCTTC
TCCGTGTGCTCTCCACAGTGCGATTATTATTATAATAATAAATTATTGCTATTGATTATTATAATTATTGTTATTGATAA
TAA
>SMED30001958 ID=SMED30001958|Name=POU domain protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1820bp
GAAGATTTCAACCAATTTCATTGTTAAAATTTTCATAAAATCGCCGTAATTGGCTGTCCGTTGCGGCAGTGGCAGTCAGG
CAACTCCGTTCACTCAGCAGCCAATAAACTCGTTTGGAAATATTCCTACTCAAATCAAATTGATTTCTCATAAAAAAATT
TGCATATCTTCTCACTTTTTCTATATGCATTTCATTGTTACTTGGTGAAAACTGAATGCCATGACCCAAGTTAGTCACAT
AGGTTCCTCTCATTTCAATATTAATTCTTCAATCAAAACTGCTCTTCCTTTAATTAATTCTCAATACAATTCATTGGTAA
CCGAAACATCTATTGGTTCCAACATCAACCTACCGTTTCGACTCGATGCTCCATCTCTATTCAATGGGCTACCGGAAGAA
TGGGGTCCCACTGACAGCGAGTTAACTCAAGCGGTCAATCATGTAAATTACGCCGGATTATCCGAGTCGAGCATTGATTA
CAAGTTTTGCAGCACTCTCAATTCTTATTTTGACTCAAATCAAAGATTTGGAAATGTACCAAACGACACGTATTTAATGG
CAAATTCCATGGCAGCCAACATTGAGAACAATAGCTGGCATAACAGCCGATATTACTTCGACAGTAATCATCCTCTCAGC
CAATGGCTCCCGGTGCCCGTTAACTGTTGGTCCAATAACAATTACATTCGCGATGACTTTTACGAGAAATCTCTCCAGGA
AGATGAGTTCAAATCCCGCTCGGTAATACAAGCAACTGAGAAGAATTCCAATCCGGTAAATCCCGACCTGAATCCTTACA
AATCTATCATTTCCGATGAATCAGAAAGCATGAAAATGGCTAAAACCTCCCACAACCTTATAAATAATGACTCGATGAAT
ATGTGTAGATTTCCTCAAAATGATATTATTATGCCAGATTTAATAAATGCCCCAAGTCCATCACTGACAAATAATAATAA
TAATAATAAAGTAATAAATAATTATTATATAATGAAAATTAATATATTAATAAAAAATATTTATGCACGGTCTCAATTTA
CATCTAAATGCCATCAAATTTGGCAGGGATACTTCTAATATAAAACCTAGATCAGCTGAAAGACTTTTATATTAGATAAA
TAATCGTTAATAAATAAAACCCAATTTGCGATAAATTATGTGTGGCCTCCAGGCGGTTCCTATCAAATAAACATATGTAA
TTATACGTGTAAACACGTGCATTAAATATCTTCACAAAGTCAAATGAGTTGATTGGACAGAAAAATTAGAATCGGAACTA
ATTCTGCAATCATTCAAAAATTTGAGCTAATCTTTATTCTTTAAAAAGCAGAGAATCAGCGGTTCTTTACATTCATGCCA
GTAATGAAAAAAGTAAACCGCAAATGACTTTTATTACTGTTCTAGTAAATGCATCCCCATAAGGAGAGTAATTCACATAA
AACTTTAATTGTCAATAAAATTATTACTGGGACATCAGCGCATCCTGGCATGCACCGCAGCAATGAAAAAGTAGACCGAG
AAACTCTGAGATTATTGAGCCATCAAACGTATCACTCATTTTCTTATGTTTGAATAAAATATTTACAAATTTTAATACAG
AGATAATCGATGGAGGAGGAACACTACTATTTTTGCTATCTATAGCAATCAATAATTATGTGAAAATATAGCTGATCAAA
ACAAGATGCATTAAAACAATTTTACTTCCTATTATATACGTTTTTGAATCCTGAGTGAAGCCAGTCGGGTTAACGAATAT
TATTAAAATGAAAATAACTATAAATCAATAACTATACCTCATCACATGATGAATGGTCCA
>SMED30015552 ID=SMED30015552|Name=POU domain protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1696bp
TTATTTTTAAAGTGTATCTTAATATTTCAAGAAACTGTATTATAAATTTCACAAATTAAAATATTTGGGATATTTGTAAA
TTGTTAATAACTCTTCATAAATGTCTCAATCAGATGGAAATTTCAACTCCTTTAAAAATATTCACATTGAACAGTTATTT
AAAATTATTCAACACCAAGCAGAACAAATTGAAGCACAAAAAGTTCAAATAAACGCTTTAATAAAGTCACAGCAAACGAT
ACTAGAAAGTATGAGACCTCAAAATGATGCAAGCGTCAATTTAAATCCTTTGTCAATGAATTACCTTAATCACAATATCC
GACAATCTTTGTTGAATTCTTCCTTAATGCCTTCAAAAAATATTTTAAACAATCCCTCATTAAATTGTGCTAGCAACAGC
AACAGTAACAGCAGCAACGTCATCATCAACAACAACAACAGCAATATTGATGTTTCAGACCATTTTCTTCAAGACTACAA
TAGTCGATTAACACAACAAATTCTTCTTCAGCCTTCCTTGAATATTCCTCGCTCAAATCCCACAATAAAATCCCCTCATT
TGCCAACGAATATTGGAGGCTCAGGAAATCTAACTCCCACAACTTGTCTTAGCAACGAAACATCTGAATTGAGACCCATG
GAAAATTGGTCCAATTTTAAGTTGCAAGCTCATTCCGATACTCAAAACGTAATCAAAAAAGAAGTAGCAGATCAATCAGA
CAATTGTAACAATTCTGAAATTCCAATTATCGAAAATGATCCAAATGAAGATGAAGGAGAAATGGATTTGTCATCTCTCC
AAGAGTTCGCCGCAAAATTTAAAATGAGTCGTATTGAAATGGGATTCACGCAAAGAGATGTCGGTGTTTGTTTGGGTTTG
ATGCAGGGCAACGATTTTAGCCAGACCACACTGAGTCGGTTTGAAGCTTTAAATCTGAGTTATAGGAATATGAAGAAACT
GCAACCGTTGCTACAAAGGTGGCTGGATGATATTCAACGAGAAGGTCGTGATGCCGTTATGAGTCGCATAACGGCTTTTT
ATCAACAACAAAAAGCGATGGTGGAGGAAGACTGTGATAACAATGACCTCCAAATAGTCAGTGGCTCAAGTAGGAAAAGA
ATTGCAAATGAAGGATTGCTAATATCCGACGAGTTACCCGAAGAACGACATTCAGTCAATGCAGATTCGACTACTATGAA
TTCCAAATTATCACAAAATCAATTACTTCGCACTTGTATAGGAAATATATCGAATAGTCTTTCACCTAGTCTGCTCGGCA
ATTTGACTAATGGGTTTTCTACAAGTCTTTCCACCTCGCTCCCAACTAACCTCACTCACAGTTTTCCGAATATTCAGTTT
CAATCTTCATTACTCCACGACCAAATCGCCAACGGATTCAACAGAAATCTTTCTTCCCAACCAAAAAAACGACGTAAACG
ACCTCTAATATTGGAAGAAGGCAAATCAAGATCGGAATTGTTTCCCGATATTTTGAGACCGTAATCAGACCGGTGGAAAA
GAATCAAAAAAACAACACAAGTTCTACGGCTATTTTATTTATTTTCGCCATTTCTCGCATTGTAATATTTTGTAATTATT
AATATCCTATCTATTGTTTTATAAAATCATATTTTTTTCAAATTGAATTTTTTATTATTTTTCATTTTTATTGACCTGGT
TTGTGAGTGTTCGGAA
>SMED30002016 ID=SMED30002016|Name=POU domain protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1339bp
GTTGAATTTTTCAAAAACCAAATTTACTTATTTTGAATTGCCATAATGGAAAATGGAGTTGCAACAAGCTGTTCACTTCT
AGCTAATGGTGGATATCATAACTCTGCCTCCGTCGGTTGGAGGTTTCCGCAGAACAATTCAGCCAGCGATTCCGTTGAGA
ACGAATTTATATCAAATGCAAATCTCAAAATTACCTCTTCGAATATTCCAAACTTTTTTTACCAATGTCCGGAAAACAGT
CAATCAACGAGCAATTCTAACGGATTTTATTCAGTGGATACGAATTGCTCGGCTGGATTCCAAGACATGAATACTTACTA
TTCAAGGGTTGCAGCAGGCTTCAATCAATCCTTCGACTTGATACCTCAACACCAGTCTTTTGTGAGGCTCAATTCAACTG
GGCTATCGGAAACTGACCAAATGACTTATATAAATCCAAATCTTCATAGTTCATTTCATCGAAATATTTCATATCCGAAT
TACGGTAGTAACTGTCCTCCTAATGTTAACATAGGAGGAGTTTCCATGGTTCAAGGGTCTTCGTCATCCTTTTTAGGCTC
CAATTATTCAGGCATGCAACAACCAATTCAAGCCGTGAATCAAGGTGACATTGAATATGAAACCCGAGAATTAGAAGCTT
TTGCTGAATGGTTTAAACAAAGAAGAATAAAACTGAGAGTGACTCAGGCGGATGTTGGCCGAGCTCTCGGGAATTTAAAA
TTAGCCGGTGTTGGATCATTGAGTCAATCAACAATTTGTCGGTTTGAATCACTAACTCTCAGTCATAACAATATGATTGC
TCTTAAGCCAGTTTTGCAAACCTGGCTCGAAGACGCTGAAACCGAAGCTAAGGAAAGATTAAATGGCTCTGATGCTTTCT
CTGACATAGATGAAAGAAAACGCAAACGAACTTCAATCACAGATTCAGAAAAACGATCACTGGAAGCATTTTTTACGATT
CAACCACGCCCATCAAGCGAGAAAATTATCCAAATTGCGGAGAAATTGAATTTGAAGAAAAACGTTGTTCGAGTATGGTT
TTGTAATCAGCGCCAAAAACAGAAACGAATGAAGTTTTCCACTCTCGGTTTTCAGCACAACTCGTCAAACATGTGAAATC
CTATTTCTGTACAGGACAAATACCAAGCATTGACCCCTCTGTCTTATTACAAAAAGTGGTATGATTAAAAGTAGAATAAA
AATGATTTTTATTATTTCTTGACCGTAGCTTTTGTTTAAATTGTTTGACTTCATTTTTACGAAACTGTTATTTTTCCCAC
TGGACTGAGTCTTAGGTTCAAATGTGAGATTTGAGGTTGAGCTTTTGCTGAGAATGACA
>SMED30030379 ID=SMED30030379|Name=POU domain protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1625bp
AATTAGCTATGCGAGCTGCTTTATCAGGCATGACTGTGATAAAACTGTCATTATTTATGCGCATAATTTGCCGTTAGTAT
TTGCTCAACCAATTTGACGTTCAACAACAACAGCAACAACATCCACCACCTCCACCAACATCCTCATTATCATTATTATT
ATTGTCATGTTAACAAGCGGACTTAATCAGGAACAATCATCGCCTTTAACAATCGTAGGCATGAGTGAGTCTCAGTTTTT
CAACGAATCTATCAGATATTTGCCTCCGGAAACCGTGGAGAGACAAAGCCAATTTTATGCAAATAATAATTATCCCCTTG
GTGAGTTTTGGAATCCACAATCCGAATATGCACAATACTTGCAAAATACCCAGCCAGTCTCGGGGCCTCAATTCATTACT
TCGCCGGCGGTTGGAGAGGCATTCTATCCATCTCTTTATATCAATACTATCCATGAAAATGTATTACTACCTTCGGTTGA
TTCCTTCAATCCTCCCAGTGGATTTATGATTTCGGGATATTCACAGCAAGACCAAACCTTTCCCACGGTCAATGAACCGA
CGTATGACAATATCCCAAACAATTGGAATTATGTTGATCATTGGGTTGATTCCAAGCCAACAACAGTGAATTCTCAGCTG
TTGCCAACCTCGTCAATTTCCGCCGTCCCCATTCAGAATTCGTTTTGGGACTGCGAGTCGATTGACCAATCAGAATATTG
TCCCACAAATGTTGATACCGAGCTCCAAGATCAAATTGATTCCAACGGAGAAATCAGTAGACTCAATCAAAAGATTTCTA
CTGACGAGTTGGAGCAGTTTGCGAAAATTTTCAAACAGCGAAGAATCAAACTCGGATTTACACAAGCCGACGTCGGGTTA
GCCCTCGGTAATTTATACGGCAGCGTGTTCAGTCAAACAACAATTTGCCGGTTTGAGGCACTGCAGCTCAGTTTTAAAAA
CATGTGCAAACTTCGACCTCTGTTAGGGAAGTGGTTGCAAGAAGCCGACTCAACCGGATGTGCTCCGTCCGGTATTGACA
AAGTCACAGCTGCTGGACGAAAACGAAAAAAGCGAACCAGCATTGAGGTTGGAGTGAAAAATGCACTGGAATCTCACTTT
TCTCGACAAAGCAAACCGACAGCCCAAATCATTACACAGCTTGCAGACAGTCTCGGATTGGAAAAAGAAGTTGTCAGGGT
ATGGTTCTGTAATCGGCGACAGAAGGAAAAACGAATGACGCCTCCGCCACTGAATGGAACAAGCTCAGATTTATTTCCAC
ATCCTGGTTTAACTGTCGGAACTGATAGTTCTCCTCATTCCTCATCTCACAGTAATCATGATTCATTCTCGTCCATTGGT
AACCAGTCAAGCTTCAATCGAATAGGTGATCCCTCCTCGACTCATCCCGGAGTCATTGTCACATCTTGCGGTTATTACTA
TGGTCATGTTCCAAATGAATCACTTCTCAATTGTGGGCCTTACCCTCACAACATCATCAACAATTACGAATTCAGACAGT
CCAATGATCCCAATATCCTCAATGTCAAATCCGAGTGCATCAGCTGACTCATGTCGAACTCACCGAAAAGAAAGCTAATA
ATATTCTATTTCAATAATAATAAAA
>SMED30008552 ID=SMED30008552|Name=Carbonic anhydrase 7|organism=Schmidtea mediterranea sexual|type=transcript|length=911bp
CCGATCTAAATAATTTAATTCAATAAATAATTTCAACTAAAGTTTTTATGATTTCTGAAGATTGGGGATATGGACCTGAG
AACGGTCCACATTTATGGCACAAATCGTATTCCAGTGCGGGAGGATGTTCCCAATCTCCTATCAATATAGATCTTTCACA
GACAAAATACGATATGACTTTAAATTTACATCCTTTAAAAATATGCATTGATAGTTCGAGGACATCAAGTCAGACTTTGG
TATTTACAGGACATAATTTCCGAATCGACTGTGAAGGAGCACTATGCGCATCGGGAGGCCCAATTCCCTATGGTCAAATG
TACAAAATTTCCCAAATTGTGTTTCATTGGGGCAGTACAATTTATGGAGGATCTGAACATTTGATAAATTGTTTTCAATT
CCCATGTGAATGCCAAATGACCTGCTACAATGCCACTCGTTATAGGTGCTTCAATGAGGCGGTAAATAAAAGAGATGGGC
TAATTATCCTATCTACAATGATATTGGGAACAAAAATAAAACCCTCGATCGTTTATTGGGTCCTTTGACGTCGATTCACT
TTTTCAAACACCATGACTTCCGGCAAGAAACCGAACTGTTAGATTTGAAATGTCTTTTACCAGATTGCATCAATCGATAC
TTCACCTACACTGGGTCATTGACTACCCCACCTTGCTATGAAACTGTTACGTGGATCATATTCGAAGGATCCAACACAAT
CAGTGAGGATCAACTAAATCTCATGCAGAAAGTTCACGTAGCCGACGGCTGTAATGGCTTTGACAACTTCAGACCGGTTT
GCTCACTCGGCCAAAGAATCATTACCAGAAATTTTGTTTGAGCCTTTTTTGAACTTGATTTATTTAAATTTTATTTTTTT
AATTGCTACTGTAGTGGATGTTATGGGGAAT
>SMED30021661 ID=SMED30021661|Name=Carbonic anhydrase 7|organism=Schmidtea mediterranea sexual|type=transcript|length=1073bp
CATACATATATATATATATATATTGAGACTATTCATTTTTTTCCATACAAAATTCAAACAAAATGAAACCATTTCTATTT
CTATTTTTATTTCTTGTCTCATCTCTTGATCTGAAGATCACCGAGGCTTCAGGCACCGGAAATTGGGGCTATACGTCAAC
CAGTGACATCAAAGGCCCCTCGGACTGGAAAGACATTAATCCAACTTGCGACGGAGCTCGGCAATCACCGATTGATATCG
TGACAAGAAGTGCGGTTTATTTGAAAGATTTACAAAGGATTGAAATTAAAAAAATTGACAACTTTGCTAACTTTTCCACT
CTCGAAAGACATGAAACCTCTATTTACTTAAAGCTTAATAACAGTTGGGGAATCACTTTCGGAGGAAATCAATGCCTAAG
ACCTGACTCCATTCATTGGCATTGGGGATCCAAGGGTACTTTAGGATCGGAACACTCTCTAGATGGGAAGCATTATCCAA
TAGAAGGCCATCTGTTGTCATATAATTGTATGAAATACAGTTCTTTGAATGAAGCAAAATCGAGTCCGGAAGGTCTTTAT
GTAATTGGTATTTTTTATAAAATCGGAAAAAAAAATATGTTAATTGACAAAATTATCCCGGCAATGCAAAGTCTGATTTC
CAGTAGTGATATCTCGAGCGTGATCATTAACGAGATTTCGGTGGAGGAAATTCTACCGAAAAATTTGGACAAGTATTATC
AATATGACGGCTCATTGACGACCCCTCCATGTACAGAAAACGTCAGGTGGACAGTGCTAAATGAAGAGCTAACTATAGAT
GAATCTCAATTGGAAGTTTTTCGCCAATTCGACTTCGAATCTCCCAATTCTGGGGAAATGGAGAACAATTTCCGACCAAT
CTTATCAAAGTTCAATGAAAAACGAACAATATATTCCTCATTCAAAACGGGGTCCAGTTAGACAATCTTATTATGGGTGC
TTTGTGCAATCTTCATGTGCCTGAATAGTCGATAATATGATGTTCATAACACTCAAATAGCACATTTAATTCATTTTGAT
TAACACTATTTTTCATTTCATTTATGTCAATTA
>SMED30021108 ID=SMED30021108|Name=POU domain protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1667bp
TTCTGGATTACGAATAGCCTATTGCAATTAATAACCGAGTTTTTTTCAAGATTGTCCTACAATGATCATTAAATAAAAAT
AATCCACATGAGTATATCAGAAAATAATAAAGAAAAAGATATTATTTACGGCTTGGAAGCAAAGCATATTGTAGATTTCA
ATGTTGCATCTCATTTAGATGAAGAACAAGACGCAATTTCAAAATCTATTGGGCGCAACCAAAAAACTGATAAACACTCT
CAGTCGTTAAATGGGAAAACTCCCAATGAACCACTGGATCACAATTCATATATCAAAGCCTATAACGATGCGCTGTTTGA
ACAGCGGACTAATTTCAATGGTTTGAATTCAGATTTAAGCTATTCATTTTTATCTCAGTATGGCTATAATAATGATGAAA
GAATGGATTTTACACCGTATTCTTTGCCAATTGATATGATTGAACAATCTTATAATTCCTGGTCTAAATCTAACGCATGC
ACATTTACAGAGGCGCATCTAAATTCACCTTGGTACAATCATTATCCGTATCCAGGATATGCATCATATAATTCTTATAT
GTGTAATATTCCACCGGTTGCAACTTCATCTATCAATGATCAATCTAATATGAGTTTTCCTAATCATCCAGCATTCTCAG
ATCTGGAAGAGTATGAACAATTAAAACAATTCCAAGCAAGTAATTATTCTGTATTTCCACAAGATTCTTTTTTAAATCAT
TCAATATCAACTCTAATGCCTCCGTTAAGGAATTCTCAAAGCACCACCCCTTTCAACTCAATCAATCCATCATCTCATTG
GTTGGATGTTAAAAATTGGCCGAAATCTGCCTCTCAATCAGATCAATTCGATCAAAATTCATTGAAACGTCAAATTGATC
ATTTTCCTTTGAATATCCCAACGGCGTTTTCTTATCAATCATCCAACTCAATGTCCCTACTCGGCTCTCAACAGCCAGAA
ATCAGTAAAGATCTCTTTTTGTCCGATTCCATAATTGAAAATTCAAAACTAAGCACGATGGACTGTCGAGAATTGGAACA
ATTTGCCAAGACTTTCAAACAAAGACGAATCAAGCTAGGATTTACTCAGGCTGATGTCGGTCTGGCGTTGGGTACGTTAT
ACGGGAACGTATTCAGTCAAACCACAATTTGCCGATTTGAAGCATTACAGTTAAGCTTTAAGAACATGAACAAGTTGCGA
CCGTTATTAAGCAAATGGTTAGAAGAGGCTGATTTGTCCTTGTCAAACACAGTCGTGAATGTAGAGAAATTAGCGAACCA
AAATCGACAAAGAAAGAAAAGAACAAATATAGAAATGAATACCAAAGATATATTGGAATCAAGTTTCAATAAAGATCCAA
AACCAACTGCTGCTCATATTATATCATTGTCAGAGAGAATTTTAATGGATAAAGAAGTAGTTCGGGTTTGGTTTTGTAAT
AGAAGACAGAAAGAAAAAAAATCCAGTTTAACCAAATCTATTTCCAGTAGTTAATACAATCTTTCCAAAAAGAAATTCTT
TTACAGATTCGACGTTTTATTATGGAAATGGTGTGAATAAATAATTTCTTCCCATAAATTTTGCCGGTTTTCTAGCTTGT
ACAGATAAAGAAAAATACCCGTTTTTACATTTTCCTAAACTTAAAATATTCAACATTAATTTTGAAC

 

back to top



PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in protonephridia. Click this link to learn more about PAGE.


PAGE Curations: 1742


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
protonephridiaSMED30016328Cubilin (intrinsic factor-cobalamin receptor)SMESG000068883.1 SMED_29161_V2_1GPL14150_gene_modelsPMID:23318641
Chen et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
protonephridiaSMED30016328Cubilin (intrinsic factor-cobalamin receptor)SMESG000068883.1 SMED_29161_V2_1GPL14150PMID:23318641
Chen et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
protonephridiaSMED30011750Phosphoinositide phospholipase CSMESG000070741.1 SMESG000070728.1 dd_Smed_v4_9716_1_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
protonephridiaSMED30015041Retinoic acid receptor betaSMESG000054304.1 SMED30015041smed_20140614PMID:29100657
Cheng et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
protonephridiaSMED30012493Plastin-2SMESG000007726.1 dd_Smed_v4_11520_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011134SMED30011134SMESG000063657.1 dd_Smed_v4_10132_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007292OtopetrinSMESG000018670.1 dd_Smed_v4_13612_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014844Flotillin-1SMESG000004975.1 dd_Smed_v4_1637_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3001369960S ribosomal protein L9SMESG000003774.1 dd_Smed_v4_150_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009913Beta-ureidopropionaseSMESG000060425.1 dd_Smed_v4_1584_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012991endoglycoceramidaseSMESG000030369.1 SMESG000030357.1 SMESG000030353.1 dd_Smed_v4_1570_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010457cell division cycle and apoptosis regulator protein 1SMESG000052430.1 dd_Smed_v4_1608_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014212SMED30014212SMESG000064028.1 dd_Smed_v4_10207_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014355LIM domain only protein 7SMESG000039067.1 dd_Smed_v4_10011_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011465OtopetrinSMESG000018670.1 dd_Smed_v4_13612_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008349Histone-lysine N-methyltransferase SETMARSMESG000017253.1 SMESG000015137.1 dd_Smed_v4_1612_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015660SMED30015660SMESG000018225.1 SMESG000017035.1 dd_Smed_v4_1426_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009956SMED30009956SMESG000022272.1 dd_Smed_v4_10991_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013015Flotillin-1SMESG000004975.1 dd_Smed_v4_1637_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008856SMED30008856SMESG000025888.1 dd_Smed_v4_1422_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010502SMED30010502SMESG000051310.1 dd_Smed_v4_15505_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007993GTP-binding proteinSMESG000065983.1 dd_Smed_v4_11291_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011096Centrosomal protein 131SMESG000051138.1 dd_Smed_v4_13976_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004318Triadin-like isoform X4SMESG000025109.1 dd_Smed_v4_13778_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007107SMED30007107SMESG000050890.1 dd_Smed_v4_1847_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002038Calsyntenin 1SMESG000002834.1 SMESG000002830.1 dd_Smed_v4_1518_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001362SMEDWI-3SMESG000081970.1 dd_Smed_v4_1258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009112plexin-D1-likeSMESG000033280.1 dd_Smed_v4_11809_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3000621640S ribosomal protein S8SMESG000047167.1 dd_Smed_v4_156_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008169EF-hand domain-containing proteinSMESG000026622.1 dd_Smed_v4_1881_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002486slc31a-1SMESG000005775.1 dd_Smed_v4_1513_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009255Solute carrier family 12 member 9SMESG000033021.1 dd_Smed_v4_1738_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006773Calpain-BSMESG000039299.1 dd_Smed_v4_1752_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013692Small HSP proteinSMESG000059879.1 SMESG000059868.1 SMESG000059853.1 dd_Smed_v4_1039_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001495Ribosomal protein L15SMESG000056940.1 dd_Smed_v4_193_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008080Transmembrane protein 45BSMESG000060226.1 SMESG000021986.1 dd_Smed_v4_1542_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30003346slc12a-4SMESG000019076.1 dd_Smed_v4_4389_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001414UPF0728 protein C10orf53 homologSMESG000073355.1 dd_Smed_v4_10501_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002809G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000042142.1 dd_Smed_v4_17288_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030679Elongation of very long chain fatty acids proteinSMESG000068877.1 SMESG000068874.1 dd_Smed_v4_4252_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011644tRNA wybutosine-synthesizing protein 3 homologSMESG000069968.1 SMESG000069969.1 dd_Smed_v4_180_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010923SMED30010923SMESG000017103.1 dd_Smed_v4_19436_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007867OtoferlinSMESG000010400.1 dd_Smed_v4_14162_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007557DUF4515 domain-containing proteinSMESG000013289.1 dd_Smed_v4_13384_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014415Protein FAM32ASMESG000034920.1 dd_Smed_v4_1341_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019094Protein flightless-1SMESG000020935.1 dd_Smed_v4_1781_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012889Family S33 non-peptidase homologue (S33 family)SMESG000021236.1 dd_Smed_v4_1414_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022699SMED30022699SMESG000056221.1 SMESG000046858.1 SMESG000029613.1 SMESG000025472.1 SMESG000023703.1 SMESG000011090.1 dd_Smed_v4_17710_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020215AnnexinSMESG000030132.1 dd_Smed_v4_1735_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021019CYTOSOL_AP domain-containing proteinSMESG000037599.1 dd_Smed_v4_181_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021270ANK_REP_REGION domain-containing proteinSMESG000057916.1 SMESG000057915.1 dd_Smed_v4_15179_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022678Semaphorin-like proteinSMESG000010584.1 SMESG000009925.1 dd_Smed_v4_13490_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015041Retinoic acid receptor betaSMESG000054304.1 dd_Smed_v4_8796_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001853Protein kinase domain-containing proteinSMESG000003859.1 dd_Smed_v4_1897_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002213Zinc finger, C2H2 typeSMESG000075102.1 dd_Smed_v4_3443_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004459Cytoplasmic FMR1-interacting proteinSMESG000062092.1 dd_Smed_v4_1820_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006125C2H2-type domain-containing proteinSMESG000020158.1 dd_Smed_v4_14413_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014813Y box protein-1SMESG000058013.1 dd_Smed_v4_35_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007209serine/threonine-protein kinase DCLK1SMESG000078466.1 SMESG000050786.1 SMESG000024968.1 dd_Smed_v4_3128_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002668HemocytinSMESG000041532.1 dd_Smed_v4_305_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30003066NEK8-1SMESG000053193.1 dd_Smed_v4_8692_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004532Y box protein-1SMESG000058013.1 dd_Smed_v4_35_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000146GLI-3SMESG000078300.1 dd_Smed_v4_17566_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015407Diaphanous, putativeSMESG000036976.1 dd_Smed_v4_18017_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3000665560S ribosomal protein L32SMESG000060036.1 dd_Smed_v4_149_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001570Cyclin-dependent kinase 17SMESG000078466.1 SMESG000050786.1 SMESG000024968.1 dd_Smed_v4_3128_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025591porcupine-like proteinSMESG000051516.1 dd_Smed_v4_413_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021063SMED30021063SMESG000025889.1 dd_Smed_v4_17_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001286DNA polymerase nuSMESG000032684.1 dd_Smed_v4_10383_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000054Rab-GAP TBC domain-containing proteinSMESG000003946.1 dd_Smed_v4_10066_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000883Glutathione S-transferaseSMESG000015099.1 SMESG000015094.1 SMESG000014182.1 dd_Smed_v4_1517_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004959SMED30004959SMESG000046821.1 dd_Smed_v4_14435_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000282X1.A.G7.1SMESG000046817.1 SMESG000046814.1 dd_Smed_v4_1507_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002938SH3 and multiple ankyrin repeat domains protein 2SMESG000078048.1 dd_Smed_v4_10116_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001808Calcium-transporting ATPaseSMESG000056345.1 dd_Smed_v4_13223_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001808Calcium-transporting ATPaseSMESG000056345.1 dd_Smed_v4_10674_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001808Calcium-transporting ATPaseSMESG000056345.1 dd_Smed_v4_9557_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002988Bestrophin homologSMESG000030927.1 dd_Smed_v4_14800_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004636SMED30004636SMESG000061388.1 dd_Smed_v4_11530_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034880Discoidin domain-containing receptor 2SMESG000067438.1 dd_Smed_v4_10406_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020710Succinyl-CoA:3-ketoacid-coenzyme A transferaseSMESG000080424.1 dd_Smed_v4_1189_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022232Glutathione s-transferaseSMESG000016846.1 dd_Smed_v4_1206_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013257Tektin-2SMESG000026446.1 SMESG000026445.1 SMESG000026429.1 dd_Smed_v4_2694_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000831Golgi-associated plant pathogenesis protein 1SMESG000036937.1 dd_Smed_v4_2081_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006230Sperm surface protein Sp17SMESG000046919.1 dd_Smed_v4_2279_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006230Sperm surface protein Sp17SMESG000046919.1 dd_Smed_v4_4783_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006006SMED30006006SMESG000007018.1 SMESG000007017.1 dd_Smed_v4_1969_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016140methylmalonyl-CoA mutase, mitochondrialSMESG000014335.1 dd_Smed_v4_2255_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006095Aspartate aminotransferaseSMESG000022764.1 dd_Smed_v4_2004_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004557Tyrosine-protein kinaseSMESG000015831.1 dd_Smed_v4_2291_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015706Twinfilin-1SMESG000041071.1 dd_Smed_v4_2563_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006653SMED30006653SMESG000058633.1 dd_Smed_v4_2131_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013840Tektin-2SMESG000065255.1 SMESG000050057.1 dd_Smed_v4_2339_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002257SMED30002257SMESG000010550.1 dd_Smed_v4_2590_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30003609Chloride intracellular channel protein 4SMESG000054543.1 dd_Smed_v4_2382_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019586SMED30019586SMESG000009892.1 dd_Smed_v4_2418_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002664SMED30002664SMESG000002943.1 dd_Smed_v4_2782_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007660Degenerin unc-8SMESG000073267.1 dd_Smed_v4_22386_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30003382Homeobox domain-containing proteinSMESG000047763.1 dd_Smed_v4_28958_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007839cAMP-dependent protein kinase type I-alpha regulatory subunitSMESG000074764.1 dd_Smed_v4_2180_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002092Sodium/potassium-transporting ATPase subunit betaSMESG000061673.1 dd_Smed_v4_2230_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008163Usp domain-containing proteinSMESG000039918.1 dd_Smed_v4_2433_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000078SMED30000078SMESG000009892.1 dd_Smed_v4_2418_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002094SMED30002094SMESG000003128.1 SMESG000003117.1 dd_Smed_v4_2294_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011381HORMA domain-containing proteinSMESG000066514.1 dd_Smed_v4_2201_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004756Small nuclear ribonucleoprotein Sm D2SMESG000032344.1 dd_Smed_v4_2994_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007142Sperm surface protein Sp17SMESG000046919.1 dd_Smed_v4_2279_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007142Sperm surface protein Sp17SMESG000046919.1 dd_Smed_v4_4783_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026859PlsC domain-containing proteinSMESG000028760.1 dd_Smed_v4_8757_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3002737860S ribosomal protein L3SMESG000022732.1 dd_Smed_v4_127_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034066Hemicentin-2SMESG000015102.1 dd_Smed_v4_13275_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021348Alanine aminotransferaseSMESG000007253.1 SMESG000007248.1 dd_Smed_v4_2988_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033718SMED30033718SMESG000061174.1 dd_Smed_v4_12214_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031175SMED30031175SMESG000064100.1 SMESG000064099.1 dd_Smed_v4_14322_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3002077640S ribosomal protein S21SMESG000004954.1 dd_Smed_v4_84_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034681cAMP-dependent protein kinase catalytic subunitSMESG000016651.1 dd_Smed_v4_911_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034525Dynein light chainSMESG000008592.1 dd_Smed_v4_9661_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026112Sorting nexin-27SMESG000081127.1 dd_Smed_v4_2513_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031005A disintegrin and metalloproteinase with thrombospondin motifs 2SMESG000051172.1 dd_Smed_v4_16551_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022560Ribosomal_L28e domain-containing proteinSMESG000026745.1 dd_Smed_v4_221_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023570SMED30023570SMESG000056075.1 SMESG000056059.1 dd_Smed_v4_770_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028986SMED30028986SMESG000045005.1 dd_Smed_v4_13207_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026278Pre-mRNA-splicing factor ISY1SMESG000047126.1 SMESG000004187.1 dd_Smed_v4_8243_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027517translin-associated factor X-interacting protein 1SMESG000041265.1 dd_Smed_v4_9718_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032411E3 ubiquitin-protein ligaseSMESG000030063.1 dd_Smed_v4_9145_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032655Armadillo repeat-containing protein 6SMESG000039967.1 dd_Smed_v4_1357_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035942SMED30035942SMESG000041949.1 dd_Smed_v4_9876_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026402Tyrosine-protein kinaseSMESG000045588.1 SMESG000029204.1 dd_Smed_v4_3147_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026807hypothetical proteinSMESG000038313.1 SMESG000038304.1 SMESG000038300.1 SMESG000035867.1 SMESG000035859.1 dd_Smed_v4_964_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027279SMED30027279SMESG000070879.1 SMESG000070880.1 dd_Smed_v4_3195_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031361Ig-like domain-containing proteinSMESG000026986.1 dd_Smed_v4_9128_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3002143360S ribosomal protein L39 dd_Smed_v4_394_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032523SMED30032523SMESG000042167.1 dd_Smed_v4_8527_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026877HORMA domain-containing proteinSMESG000066514.1 dd_Smed_v4_2201_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034173Calcium-dependent protein kinaseSMESG000033648.1 dd_Smed_v4_13677_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031468Propionyl-CoA carboxylase alpha chain, mitochondrialSMESG000034830.1 dd_Smed_v4_1247_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028928mutS protein homolog 4SMESG000019325.1 dd_Smed_v4_12806_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031308ATP synthase F0 subunit 6 dd_Smed_v4_258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034623cytochrome c oxidase subunit III dd_Smed_v4_258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035260SMED30035260SMESG000035564.1 dd_Smed_v4_12208_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033439Voltage-dependent L-type calcium channel subunit alphaSMESG000016041.1 SMESG000016040.1 dd_Smed_v4_9877_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031822SMED30031822SMESG000077258.1 dd_Smed_v4_8993_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031015slc6a-13SMESG000079286.1 SMESG000079280.1 SMESG000017839.1 dd_Smed_v4_11826_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031015slc6a-13SMESG000042086.1 SMESG000042051.1 dd_Smed_v4_3642_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3003151240S ribosomal protein S21SMESG000004954.1 dd_Smed_v4_84_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020312Pre-mRNA-splicing factor ATP-dependent RNA helicase DHX16-likeSMESG000014714.1 dd_Smed_v4_8001_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024394Dynein light chainSMESG000005286.1 dd_Smed_v4_898_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30029104ProtocadherinSMESG000002712.1 dd_Smed_v4_9106_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED300316316-phosphogluconate dehydrogenase, decarboxylatingSMESG000005721.1 dd_Smed_v4_366_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020268Dynamin-type G domain-containing proteinSMESG000014756.1 SMESG000014755.1 dd_Smed_v4_2390_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033280SMED30033280SMESG000006336.1 dd_Smed_v4_11671_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025058SMED30025058 dd_Smed_v4_38794_0_2dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021957SMED30021957SMESG000039476.1 dd_Smed_v4_9685_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031727ubiquitin fusion degradation protein 1 homologSMESG000037419.1 SMESG000037430.1 dd_Smed_v4_11833_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033407C2H2-type domain-containing proteinSMESG000059040.1 dd_Smed_v4_9365_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034919Ras association domain family member 3SMESG000061902.1 dd_Smed_v4_9008_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020166Coiled-coil domain-containing proteinSMESG000005080.1 dd_Smed_v4_9816_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033740SMED30033740 dd_Smed_v4_258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025902Calponin-homology (CH) domain-containing proteinSMESG000078209.1 dd_Smed_v4_9419_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025317Universal stress protein MSMEG_3950/MSMEI_3859SMESG000016283.1 SMESG000016282.1 dd_Smed_v4_402_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023749Lysophosphatidylcholine acyltransferaseSMESG000003820.1 dd_Smed_v4_2022_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031496Leucine zipper transcription factor like 1SMESG000020499.1 dd_Smed_v4_8415_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023086U1 small nuclear ribonucleoprotein CSMESG000010972.1 dd_Smed_v4_3772_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025844SMED30025844 dd_Smed_v4_4311_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034376slc6a-5SMESG000042091.1 dd_Smed_v4_4290_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026477SMED30026477 dd_Smed_v4_275_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022121SMED30022121SMESG000042798.1 dd_Smed_v4_2204_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030294SMED30030294SMESG000026870.1 dd_Smed_v4_2495_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024875SMED30024875 dd_Smed_v4_20913_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019176Glyco_hydro_59M domain-containing proteinSMESG000068390.1 dd_Smed_v4_2699_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008852Geranylgeranyl transferase type-1 subunit betaSMESG000057312.1 dd_Smed_v4_4004_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011690Heterogeneous nuclear ribonucleoprotein A2SMESG000050993.1 SMESG000050994.1 dd_Smed_v4_1194_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014170Luc7-like protein 3SMESG000047550.1 SMESG000047494.1 dd_Smed_v4_3724_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013205TNF receptor-associated factorSMESG000035332.1 SMESG000031365.1 SMESG000077214.1 SMESG000075241.1 SMESG000075191.1 dd_Smed_v4_168_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019184Protein NDRG3SMESG000005138.1 SMESG000005122.1 dd_Smed_v4_1911_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010337major facilitator superfamily domain-containing protein 1SMESG000017192.1 dd_Smed_v4_1829_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3000905260S ribosomal protein L18SMESG000017166.1 dd_Smed_v4_128_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012798OtopetrinSMESG000018671.1 dd_Smed_v4_12986_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013312CalpainSMESG000062904.1 SMESG000062902.1 dd_Smed_v4_1971_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012628ADP ribosylation factorSMESG000033952.1 dd_Smed_v4_2125_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007024G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000078415.1 dd_Smed_v4_24316_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017508MetalloendopeptidaseSMESG000045572.1 dd_Smed_v4_11993_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016457SMED30016457SMESG000040036.1 dd_Smed_v4_21280_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010506J domain-containing proteinSMESG000009124.1 dd_Smed_v4_4016_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019668Proactivator polypeptideSMESG000042333.1 dd_Smed_v4_241_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015473Actin cytoplasmic type 5SMESG000080982.1 SMESG000080969.1 dd_Smed_v4_2624_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010326TetraspaninSMESG000078589.1 dd_Smed_v4_2698_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012763serine incorporatorSMESG000038788.1 dd_Smed_v4_1419_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018039TNF receptor-associated factorSMESG000025998.1 SMESG000025982.1 SMESG000025980.1 SMESG000025963.1 SMESG000025934.1 SMESG000025901.1 SMESG000025797.1 SMESG000025794.1 SMESG000025517.1 dd_Smed_v4_1139_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007853Family with sequence similarity 49 member ASMESG000040316.1 dd_Smed_v4_1856_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017619TNF receptor-associated factorSMESG000025998.1 SMESG000025982.1 SMESG000025980.1 SMESG000025963.1 SMESG000025934.1 SMESG000025901.1 SMESG000025797.1 SMESG000025794.1 SMESG000025517.1 dd_Smed_v4_1139_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016238Kinesin-like proteinSMESG000071604.1 dd_Smed_v4_12639_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013901SMED30013901SMESG000019480.1 dd_Smed_v4_12627_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012935TGc domain-containing proteinSMESG000080370.1 dd_Smed_v4_4149_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015584Nesprin-1SMESG000016745.1 dd_Smed_v4_16850_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013159LimbinSMESG000017303.1 dd_Smed_v4_10777_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009188Radial spoke head 14-like proteinSMESG000077061.1 dd_Smed_v4_1917_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019592Guanylate cyclaseSMESG000041839.1 dd_Smed_v4_12933_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3000245560S ribosomal protein L6SMESG000076172.1 dd_Smed_v4_205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008476LRRC50SMESG000004118.1 SMESG000004112.1 dd_Smed_v4_9766_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007886SMED30007886SMESG000055169.1 dd_Smed_v4_9583_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010855Receptor-type tyrosine-protein phosphatase FSMESG000038449.1 SMESG000035516.1 dd_Smed_v4_22581_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010855Receptor-type tyrosine-protein phosphatase FSMESG000038449.1 SMESG000038447.1 SMESG000035516.1 dd_Smed_v4_8199_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010504SMED30010504SMESG000010514.1 dd_Smed_v4_4965_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002344Bax inhibitor-1 proteinSMESG000038559.1 dd_Smed_v4_319_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010538Phospholipid scramblaseSMESG000043802.1 dd_Smed_v4_4899_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019538SMED30019538SMESG000078196.1 dd_Smed_v4_3823_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30003951Tektin-4SMESG000016881.1 dd_Smed_v4_37536_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010581SMED30010581SMESG000056022.1 dd_Smed_v4_5285_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009776Collagen IV NC1 domain-containing proteinSMESG000066546.1 dd_Smed_v4_2500_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009173Glutamate receptor-interacting protein 2SMESG000031603.1 dd_Smed_v4_3080_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006260Sh3 domain-binding glutamic acid-rich-like proteinSMESG000018980.1 dd_Smed_v4_4404_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008950SMED30008950SMESG000071333.1 dd_Smed_v4_3647_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008952Serine/threonine kinaseSMESG000046962.1 SMESG000046951.1 SMESG000040592.1 SMESG000034034.1 dd_Smed_v4_489_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30003975Ceramide synthase 5SMESG000060101.1 SMESG000039123.1 dd_Smed_v4_4223_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016328Cubilin (intrinsic factor-cobalamin receptor)SMESG000068883.1 dd_Smed_v4_4575_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013021SMED30013021SMESG000025420.1 dd_Smed_v4_2995_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002366cAMP-dependent protein kinase regulatory subunitSMESG000052390.1 dd_Smed_v4_7586_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006714SMED30006714SMESG000001790.1 dd_Smed_v4_212_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005765PhosphodiesteraseSMESG000019038.1 dd_Smed_v4_8595_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011985MRVI1-like proteinSMESG000055459.1 dd_Smed_v4_6446_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002736DNA topoisomerase ISMESG000055403.1 dd_Smed_v4_2421_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001116cilia- and flagella-associated protein 44-likeSMESG000022927.1 dd_Smed_v4_8760_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000788SMED30000788SMESG000035357.1 dd_Smed_v4_2571_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000373retinol dehydrogenase 13-likeSMESG000049264.1 SMESG000009696.1 SMESG000009679.1 dd_Smed_v4_2096_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000740ets-1SMESG000033821.1 dd_Smed_v4_9165_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000740ets-1SMESG000033821.1 dd_Smed_v4_9185_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30003084Cilia-and flagella-associated protein 45SMESG000016410.1 dd_Smed_v4_3732_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002537Y box protein-1SMESG000058013.1 dd_Smed_v4_35_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017381Protein polybromo-1SMESG000004446.1 dd_Smed_v4_4218_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30003962Granulin bSMESG000018760.1 dd_Smed_v4_2701_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030330bok-2SMESG000066862.1 dd_Smed_v4_16107_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027141SMED30027141SMESG000059828.1 dd_Smed_v4_1549_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033594Microtubule-associated protein 1ASMESG000014298.1 dd_Smed_v4_1301_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033594Microtubule-associated protein 1ASMESG000014298.1 dd_Smed_v4_3654_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035970transcription initiation factor TFIID subunit 2SMESG000037189.1 dd_Smed_v4_15494_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028480slc22a-3SMESG000031472.1 dd_Smed_v4_11135_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026341SMED30026341SMESG000069507.1 dd_Smed_v4_1654_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031945UPF0638 protein BSMESG000003269.1 dd_Smed_v4_10707_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032055slc23a-1SMESG000066904.1 dd_Smed_v4_6597_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022857Protocadherin Fat 3SMESG000003985.1 dd_Smed_v4_18595_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3003191640S ribosomal protein S30SMESG000065562.1 dd_Smed_v4_126_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027457Neurogenic locus Notch proteinSMESG000066558.1 dd_Smed_v4_12732_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024115Ubiquitin-40S ribosomal protein S27aSMESG000048830.1 dd_Smed_v4_121_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020663SMED30020663SMESG000003437.1 dd_2920dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
protonephridiaSMED30020663SMED30020663SMESG000003437.1 dd_Smed_v4_2920_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3003573414-3-3 protein epsilonSMESG000075252.1 dd_Smed_v4_1702_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024568Parathyroid hormone/parathyroid hormone peptide receptorSMESG000081404.1 dd_Smed_v4_12602_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033291SMED30033291SMESG000030545.1 dd_Smed_v4_11177_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3002930240S ribosomal protein S16SMESG000018349.1 SMESG000018333.1 dd_Smed_v4_170_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032800Serine/threonine-protein kinase DCLK3SMESG000072629.1 dd_Smed_v4_12689_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024930slc15a-2SMESG000011953.1 dd_Smed_v4_8983_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023347Kinesin motor domain-containing proteinSMESG000069689.1 dd_Smed_v4_10482_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031509Acid sphingomyelinase-like phosphodiesteraseSMESG000055453.1 dd_Smed_v4_15691_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024579SJCHGC07397 proteinSMESG000050581.1 dd_Smed_v4_10396_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034085SMED30034085SMESG000081261.1 dd_Smed_v4_10592_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034787Sodium/potassium-transporting ATPase subunit beta-1SMESG000032752.1 dd_Smed_v4_1688_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035504Sepiapterin reductaseSMESG000026493.1 dd_Smed_v4_4189_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033487cilia- and flagella-associated protein 70SMESG000009189.1 dd_Smed_v4_10893_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033145Protein kinase domain-containing proteinSMESG000026756.1 dd_Smed_v4_11663_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033750Protein kinaseSMESG000070879.1 SMESG000070880.1 dd_Smed_v4_3195_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30029047GTP cyclohydrolase 1SMESG000064560.1 dd_Smed_v4_11172_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027114Protocadherin Fat 4SMESG000032466.1 dd_Smed_v4_17898_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024527non-gastric H ,K -ATPase alpha subunitSMESG000041938.1 SMESG000041937.1 SMESG000051989.1 dd_Smed_v4_1179_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025062G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000018450.1 dd_Smed_v4_1699_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30029139Ubiquitin-conjugating enzyme E2 L3SMESG000069968.1 SMESG000069969.1 dd_Smed_v4_180_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032456Aldehyde dehydrogenase,putativeSMESG000001708.1 dd_Smed_v4_400_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026367Bifunctional polynucleotide phosphatase/kinaseSMESG000034225.1 dd_Smed_v4_1211_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035360Peptidyl-prolyl cis-trans isomeraseSMESG000006589.1 dd_Smed_v4_133_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027349CLUMA_CG020609, isoform ASMESG000019984.1 dd_Smed_v4_396_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026646Dynein light chainSMESG000009941.1 dd_Smed_v4_107_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028292Protein KIAA0556 homologSMESG000009541.1 dd_Smed_v4_10945_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023486Intraflagellar transport 74SMESG000074086.1 dd_Smed_v4_12702_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032821SMED30032821SMESG000026756.1 dd_Smed_v4_11663_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032591arf-GAP with Rho-GAP domain, ANK repeat and PH domain-containing protein 1-likeSMESG000006535.1 dd_Smed_v4_4332_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035929SWI/SNF complex subunit SMARCC2SMESG000031576.1 SMESG000013315.1 dd_Smed_v4_1804_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001792Retinal pigment epithelium-derived rhodopsin homologSMESG000045023.1 dd_Smed_v4_7301_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015405Adiponectin receptor protein dd_Smed_v4_19374_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010123Sodium/potassium-transporting ATPase subunit beta-1SMESG000064593.1 dd_Smed_v4_2210_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013366Sodium/potassium-transporting ATPase subunit alphaSMESG000078146.1 dd_Smed_v4_2828_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008971SMED30008971 dd_Smed_v4_11595_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002656Unconventional myosin-XVSMESG000061386.1 dd_Smed_v4_7193_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016525SMED30016525 dd_Smed_v4_20626_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005776SMED30005776 dd_Smed_v4_11737_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009514histone H2BSMESG000067931.1 dd_Smed_v4_2520_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005620Homeobox protein SIX1SMESG000005975.1 dd_Smed_v4_9774_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001861mitochondrial sodium/calcium exchanger proteinSMESG000022808.1 dd_Smed_v4_20334_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012599E3 ubiquitin-protein ligase TM129SMESG000022818.1 dd_Smed_v4_8706_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009142Hepatoma derived growth factor proteinSMESG000037796.1 SMESG000057565.1 SMESG000057564.1 dd_Smed_v4_2842_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014561SMED30014561SMESG000000219.1 dd_Smed_v4_862_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019038SMED30019038 dd_Smed_v4_12777_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014164Vacuolar protein sorting-associated protein 29 dd_Smed_v4_1727_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004099SMED30004099 dd_Smed_v4_15498_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018763Mitochondrial pyruvate carrierSMESG000004344.1 dd_Smed_v4_8071_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013386netrin 1SMESG000006806.1 dd_Smed_v4_9795_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017264SMED30017264SMESG000055031.1 dd_Smed_v4_2419_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015974FAST kinase domain-containing protein 1, mitochondrialSMESG000064523.1 dd_Smed_v4_8917_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018518Protein chibby 1 dd_Smed_v4_11618_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017223Ras-related protein Rab-8ASMESG000030619.1 dd_Smed_v4_1573_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017079LRRCC1SMESG000016752.1 dd_Smed_v4_10086_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013109Heterogeneous nuclear ribonucleoprotein QSMESG000071117.1 dd_Smed_v4_10996_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018104slc5a-4SMESG000034669.1 dd_Smed_v4_13771_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3001238340S ribosomal protein SASMESG000071180.1 dd_Smed_v4_171_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002133PolyubiquitinSMESG000039444.1 SMESG000014081.1 dd_Smed_v4_34_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016078Actin, cytoplasmicSMESG000012332.1 SMESG000012317.1 dd_Smed_v4_285_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016078Actin, cytoplasmicSMESG000012332.1 SMESG000012317.1 SMESG000058954.1 dd_Smed_v4_246_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017231NEPH-3SMESG000022777.1 dd_Smed_v4_11280_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017231NEPH-3SMESG000022777.1 dd_Smed_v4_13803_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3001301840S ribosomal protein S6SMESG000000674.1 dd_Smed_v4_178_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000065SMED30000065SMESG000049103.1 dd_Smed_v4_397_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000174Ribosomal protein S6 kinase delta-1SMESG000004118.1 SMESG000004112.1 dd_Smed_v4_9766_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013241SMED30013241SMESG000007775.1 dd_Smed_v4_137_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011326SJCHGC02540 proteinSMESG000056369.1 dd_Smed_v4_16852_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED300149112-oxoglutarate dehydrogenase mitochondrialSMESG000020522.1 dd_Smed_v4_1869_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018972ANK_REP_REGION domain-containing proteinSMESG000022931.1 dd_Smed_v4_11187_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017940Cathepsin L2SMESG000049722.1 dd_Smed_v4_175_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010405SMED30010405SMESG000043444.1 SMESG000043435.1 dd_Smed_v4_18_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014820Centrosomal protein of 135 kDa (Cep135 protein) (Centrosomal protein 4), putativeSMESG000052451.1 dd_Smed_v4_11072_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3001449360S ribosomal protein L5SMESG000004748.1 dd_Smed_v4_151_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011623SMED30011623SMESG000043444.1 SMESG000043435.1 dd_Smed_v4_18_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001402Plastin 3SMESG000007726.1 dd_Smed_v4_15254_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016345ThyroglobulinSMESG000016977.1 dd_Smed_v4_1024_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030198Lamin-B receptorSMESG000042131.1 dd_Smed_v4_2016_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020449low-density lipoprotein receptor-related protein 2SMESG000062507.1 dd_Smed_v4_1510_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025175Ethanolamine kinase 1SMESG000039287.1 SMESG000039275.1 dd_Smed_v4_10949_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028977Sodium/potassium ATPase subunit betaSMESG000022450.1 dd_Smed_v4_14990_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031695SMED30031695SMESG000009161.1 SMESG000009116.1 dd_Smed_v4_18865_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031773Msh2SMESG000016751.1 dd_Smed_v4_11434_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026585UbiquitinSMESG000003212.1 dd_Smed_v4_104_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022612Ester hydrolase C11orf54-like proteinSMESG000027576.1 SMESG000007855.1 dd_Smed_v4_1733_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021661Carbonic anhydrase 7SMESG000017176.1 SMESG000017171.1 dd_Smed_v4_4841_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023062bruno-likeSMESG000021009.1 dd_Smed_v4_2592_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3002420240S ribosomal protein S14SMESG000036550.1 dd_Smed_v4_139_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032070SMED30032070SMESG000079312.1 dd_Smed_v4_16775_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035852Ubiquitin-60S ribosomal protein L40SMESG000035681.1 dd_Smed_v4_176_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032665SMED30032665SMESG000024489.1 dd_Smed_v4_5366_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028743Regulator of G-protein signaling 22SMESG000069110.1 dd_Smed_v4_11778_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025753SMED30025753SMESG000016791.1 dd_Smed_v4_10_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021281TIR domain-containing proteinSMESG000079651.1 dd_Smed_v4_1838_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030425Ubiquitin carboxyl-terminal hydrolase 7SMESG000050890.1 dd_Smed_v4_1847_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021252Sorting nexin, putativeSMESG000016883.1 dd_Smed_v4_1354_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025872Pleckstrin homology and RhoGEF domain containing G5SMESG000023541.1 SMESG000023540.1 dd_Smed_v4_10072_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024108C2H2-type domain-containing proteinSMESG000010914.1 dd_Smed_v4_11240_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022713SMED30022713SMESG000017126.1 dd_Smed_v4_15999_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027929Tubulin beta chainSMESG000022928.1 dd_Smed_v4_471_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027929Tubulin beta chainSMESG000022928.1 dd_Smed_v4_341_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025883Forkhead associated phosphopeptide binding domain 1SMESG000071072.1 dd_Smed_v4_14350_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020347Transient receptor potential cation channelSMESG000004126.1 dd_Smed_v4_11377_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028737Tubby-like proteinSMESG000009644.1 dd_Smed_v4_10462_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024458SMED30024458SMESG000023541.1 SMESG000023540.1 dd_Smed_v4_10072_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027542CRAL-TRIO domain-containing proteinSMESG000019717.1 dd_Smed_v4_1619_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021613Nesprin-1SMESG000077685.1 dd_Smed_v4_10214_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021613Nesprin-1SMESG000077685.1 dd_Smed_v4_15904_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021083Monocarboxylate transporterSMESG000010271.1 dd_Smed_v4_10683_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023661Reverse transcriptase domain-containing proteinSMESG000042224.1 dd_Smed_v4_11697_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021549Usp domain-containing proteinSMESG000079952.1 dd_Smed_v4_1092_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027865Asparagine synthetase domain-containing protein 1SMESG000078345.1 dd_Smed_v4_11324_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3002317260s ribosomal protein L14SMESG000022343.1 dd_Smed_v4_167_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028839hemicentin-1 isoform X2SMESG000003113.1 dd_Smed_v4_13903_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027878Dynein light chainSMESG000042102.1 dd_Smed_v4_15092_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033149Calcipressin-2-likeSMESG000068854.1 SMESG000068847.1 dd_Smed_v4_14266_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030769SMED30030769SMESG000027067.1 dd_Smed_v4_16115_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033846Inositol 2-dehydrogenase-like proteinSMESG000002045.1 dd_Smed_v4_1689_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025608X1.A.G7.1SMESG000046817.1 SMESG000046814.1 dd_Smed_v4_1507_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022344FERM domain containing-1SMESG000070273.1 dd_Smed_v4_1131_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035696PhosphodiesteraseSMESG000019038.1 dd_Smed_v4_8595_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026998cilia- and flagella-associated protein 251SMESG000037291.1 dd_Smed_v4_11127_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024134slc22a-5SMESG000064528.1 dd_Smed_v4_10903_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022844NEPH-3SMESG000022777.1 dd_Smed_v4_11280_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025573cGMP-dependent protein kinase,putativeSMESG000018148.1 SMESG000018146.1 dd_Smed_v4_10515_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022009CEP97SMESG000041551.1 dd_Smed_v4_11066_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022167SMED30022167SMESG000031417.1 dd_Smed_v4_11958_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023266cilia- and flagella-associated protein 43SMESG000000491.1 dd_Smed_v4_10271_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011708Neural cell adhesion molecule 1SMESG000077686.1 dd_Smed_v4_3768_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012229Cilia- and flagella-associated protein 20SMESG000081781.1 dd_Smed_v4_3751_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005698SMED30005698SMESG000052123.1 dd_Smed_v4_2845_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005945dishevelled-associated activator of morphogenesis 1SMESG000040024.1 dd_Smed_v4_3928_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010725Ras-related protein Rab-13SMESG000078273.1 dd_Smed_v4_3889_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30003079Prominin (Prom) protein, putativeSMESG000062666.1 dd_Smed_v4_4461_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005158WD_REPEATS_REGION domain-containing proteinSMESG000071691.1 dd_Smed_v4_6137_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011525SMED30011525SMESG000000175.1 dd_Smed_v4_383_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011844Very-long-chain 3-oxoacyl-CoA reductaseSMESG000075064.1 dd_Smed_v4_3371_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30003800SMED30003800SMESG000052963.1 SMESG000047933.1 dd_Smed_v4_20623_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011084Epidermal growth factor receptor kinase substrate 8SMESG000070650.1 dd_Smed_v4_4256_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010380SJCHGC04139 proteinSMESG000022419.1 dd_Smed_v4_4617_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009218Receptor expression-enhancing proteinSMESG000036637.1 dd_Smed_v4_1995_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3000344260S ribosomal protein L23SMESG000023040.1 dd_Smed_v4_242_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010842EF-hand domain-containing protein 1SMESG000078434.1 dd_Smed_v4_2935_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3000013460S ribosomal protein L4SMESG000009479.1 dd_Smed_v4_211_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001158SMED30001158SMESG000009491.1 dd_Smed_v4_9572_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008550intraflagellar transport protein 20 homologSMESG000067757.1 dd_Smed_v4_9545_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000732Leucine-rich repeat-containing protein 45SMESG000060194.1 dd_Smed_v4_9495_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014243Lysosomal aspartic proteaseSMESG000035344.1 dd_Smed_v4_329_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011750Phosphoinositide phospholipase CSMESG000070741.1 SMESG000070728.1 dd_Smed_v4_9716_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004508E3 ubiquitin-protein ligase MIB2SMESG000017279.1 dd_Smed_v4_5196_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011512Radial spoke head 1 homologSMESG000014300.1 dd_Smed_v4_3321_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009268SMED30009268SMESG000065344.1 dd_Smed_v4_3354_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004505START domain-containing proteinSMESG000048192.1 dd_Smed_v4_498_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026578Peptidoglycan-recognition proteinSMESG000068025.1 dd_Smed_v4_1523_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026237Coiled-coil and C2 domain containing 2ASMESG000048372.1 dd_Smed_v4_11189_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031987SMED30031987 dd_Smed_v4_3434_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3003375660S ribosomal protein L37 dd_Smed_v4_97_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022428RING-type domain-containing proteinSMESG000010565.1 dd_Smed_v4_10741_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035631SMED30035631 dd_Smed_v4_339_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3002728060S acidic ribosomal protein P0SMESG000079482.1 dd_Smed_v4_161_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028199Placenta specific protein 8 dd_Smed_v4_865_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024376SMED30024376 dd_Smed_v4_19998_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023262GRAM domain-containing proteinSMESG000072545.1 dd_Smed_v4_1309_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034676G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000002498.1 dd_Smed_v4_15630_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021960AminopeptidaseSMESG000067986.1 dd_Smed_v4_2224_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020007Dystrobrevin betaSMESG000078318.1 dd_Smed_v4_12275_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028728GTP-binding protein rhoASMESG000076727.1 dd_Smed_v4_2784_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025953SMED30025953 dd_Smed_v4_5792_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026188ER membrane protein complex subunit 10 dd_Smed_v4_2594_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025647Ig-like domain-containing proteinSMESG000079961.1 dd_Smed_v4_12974_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30029212PiggyBac transposable element-derived protein 4 dd_Smed_v4_19998_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020958SMED30020958SMESG000079286.1 SMESG000079280.1 SMESG000017839.1 dd_Smed_v4_11826_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3003333640S ribosomal protein S29 dd_Smed_v4_214_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035174SMED30035174 dd_Smed_v4_6013_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30029665Cation-transporting ATPaseSMESG000002031.1 dd_Smed_v4_1640_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030887SMED30030887 dd_Smed_v4_339_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032979slc6a-8SMESG000079327.1 SMESG000079326.1 dd_Smed_v4_2109_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033428SMED30033428SMESG000008865.1 dd_Smed_v4_2097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034254calreticulin-1SMESG000009012.1 dd_Smed_v4_220_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033302RNA-binding protein MEX3BSMESG000044270.1 SMESG000030021.1 SMESG000025422.1 dd_Smed_v4_1999_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024150C2H2-type domain-containing proteinSMESG000004456.1 dd_Smed_v4_12617_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033869SMED30033869 dd_Smed_v4_6382_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031165TNF receptor-associated factor dd_Smed_v4_5740_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022007SMED30022007 dd_Smed_v4_90717_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024629inositol 1,4,5-trisphosphate receptor type 3 isoform X13SMESG000060659.1 SMESG000060658.1 SMESG000060657.1 dd_Smed_v4_13538_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023388GRB2 associated binding protein-1 dd_Smed_v4_5117_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033252Cell adhesion molecule-related/down-regulated by oncogenesSMESG000010456.1 SMESG000002915.1 dd_Smed_v4_1968_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034080SMED30034080SMESG000020939.1 SMESG000020938.1 dd_Smed_v4_2743_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30003118SMED30003118SMESG000006534.1 dd_Smed_v4_4662_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015700Mitochondrial import receptor subunit TOM70SMESG000070025.1 dd_Smed_v4_10337_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000179MFS domain-containing proteinSMESG000060699.1 dd_Smed_v4_5351_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014199MyosinSMESG000047361.1 dd_Smed_v4_4503_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006092SMED30006092SMESG000020731.1 SMESG000020729.1 dd_Smed_v4_11220_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019396LsmAD domain-containing proteinSMESG000036673.1 dd_Smed_v4_11128_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012622Intraflagellar transport 43SMESG000067883.1 dd_Smed_v4_5237_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000584SMED30000584SMESG000016256.1 SMESG000016255.1 SMESG000010584.1 SMESG000009925.1 dd_Smed_v4_2090_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004908L1-like cell adhesion moleculeSMESG000025433.1 dd_Smed_v4_1916_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012300SMED30012300SMESG000013739.1 dd_Smed_v4_5519_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015069ANK_REP_REGION domain-containing proteinSMESG000063648.1 dd_Smed_v4_10764_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011329TetraspaninSMESG000019452.1 dd_Smed_v4_5409_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017048cilia- and flagella-associated protein 206SMESG000021247.1 dd_Smed_v4_11199_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012464SMED30012464SMESG000035411.1 dd_Smed_v4_49258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002040Endothelin converting enzyme 2SMESG000069765.1 SMESG000070035.1 dd_Smed_v4_5256_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED300059124-coumarate--CoA ligase family proteinSMESG000041777.1 dd_Smed_v4_10135_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011667Serine/threonine-protein phosphataseSMESG000077398.1 dd_Smed_v4_5669_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007371nuclear mitotic apparatus protein 1 isoform X2SMESG000071994.1 dd_Smed_v4_10823_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007581cilia- and flagella-associated protein 69SMESG000047535.1 dd_Smed_v4_7432_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010777Lysosomal-associated transmembrane protein 4ASMESG000042736.1 SMESG000032757.1 SMESG000017350.1 SMESG000010536.1 SMESG000042735.1 SMESG000012070.1 dd_Smed_v4_495_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018766Centrosomal protein of 120 kDaSMESG000006990.1 dd_Smed_v4_10444_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008076Reverse transcriptase domain-containing proteinSMESG000008737.1 dd_Smed_v4_540_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008461nuclear mitotic apparatus protein 1 isoform X2SMESG000071994.1 dd_Smed_v4_10823_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3001160940S ribosomal protein S3SMESG000016955.1 dd_Smed_v4_269_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005484CAAX prenyl proteaseSMESG000031464.1 dd_Smed_v4_5271_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008486SMED30008486SMESG000014085.1 SMESG000014086.1 SMESG000014087.1 dd_Smed_v4_10249_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010350SMED30010350SMESG000017804.1 SMESG000017801.1 dd_Smed_v4_1_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013686MAP3K-1SMESG000054386.1 dd_Smed_v4_5198_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002667SMED30002667SMESG000076089.1 SMESG000056400.1 dd_Smed_v4_5143_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010117SMED30010117SMESG000000893.1 dd_Smed_v4_5234_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010935Katanin p80 WD40 repeat-containing subunit B1SMESG000068822.1 dd_Smed_v4_5495_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008052SMED30008052SMESG000075212.1 SMESG000075211.1 SMESG000074910.1 SMESG000074908.1 SMESG000074907.1 dd_Smed_v4_1061_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000248Ras-related protein Rab-11ASMESG000016036.1 dd_Smed_v4_4964_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007598Centaurin-gamma-1ASMESG000069229.1 dd_Smed_v4_5984_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005762Contactin/TAG-1 cell adhesion moleculeSMESG000036495.1 dd_Smed_v4_2673_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004319Coiled-coil domain containing 88CSMESG000066575.1 SMESG000066583.1 dd_Smed_v4_5291_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007001SMED30007001SMESG000072162.1 dd_Smed_v4_537_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010520SMED30010520SMESG000066861.1 SMESG000059630.1 SMESG000066862.1 dd_Smed_v4_6647_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031646SMED30031646SMESG000010156.1 dd_Smed_v4_105_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022458Disintegrin and metalloproteinase domain-containing protein 15SMESG000076089.1 SMESG000056400.1 dd_Smed_v4_5143_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021645SMED30021645SMESG000014085.1 SMESG000014086.1 SMESG000014087.1 dd_Smed_v4_10249_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021219Retinol dehydrogenase 13SMESG000010175.1 dd_Smed_v4_10881_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021590Spectrin beta chainSMESG000081696.1 dd_Smed_v4_1122_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020342SMED30020342SMESG000071366.1 dd_Smed_v4_1049_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031862ras-related protein Rab-27ASMESG000044557.1 dd_Smed_v4_5306_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021110Dynein heavy chain 17, axonemalSMESG000026263.1 dd_Smed_v4_10425_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035923S-adenosylmethionine decarboxylase proenzymeSMESG000011356.1 dd_Smed_v4_1099_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025309Dimer_Tnp_hAT domain-containing proteinSMESG000066861.1 SMESG000059630.1 SMESG000066862.1 dd_Smed_v4_6647_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031491Armadillo repeat containing 4SMESG000057827.1 dd_Smed_v4_5065_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030309SMED30030309SMESG000075212.1 SMESG000075211.1 SMESG000074910.1 SMESG000074908.1 SMESG000074907.1 dd_Smed_v4_1061_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030824ENTH domain-containing proteinSMESG000019746.1 dd_Smed_v4_1065_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032236Arachidonate 5-lipoxygenaseSMESG000077360.1 dd_Smed_v4_7204_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023103C2 domainSMESG000063814.1 dd_Smed_v4_10352_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30029555Serine/arginine-rich splicing factor 4SMESG000045501.1 dd_Smed_v4_473_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034430Arp2/3 complex 34 kDa subunitSMESG000073809.1 dd_Smed_v4_693_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035231SMED30035231SMESG000066861.1 SMESG000059630.1 SMESG000066862.1 dd_Smed_v4_6647_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030550Mitogen-activated protein kinase kinase kinase 4SMESG000054074.1 dd_Smed_v4_3368_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035495Ankyrin repeat domain-containing 42SMESG000005009.1 dd_Smed_v4_10615_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025223Neuropeptide Y prohormone-2SMESG000050247.1 SMESG000050248.1 dd_Smed_v4_10191_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032126AndroglobinSMESG000053594.1 SMESG000047986.1 dd_Smed_v4_10677_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026124Dynein heavy chain, axonemalSMESG000040511.1 dd_Smed_v4_6557_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034335SMED30034335SMESG000009102.1 dd_Smed_v4_8341_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032624cilia- and flagella-associated protein 53SMESG000004919.1 dd_Smed_v4_3219_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032587Protein kinase domain-containing proteinSMESG000056719.1 dd_Smed_v4_7028_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035848Tubulin beta chainSMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044888.1 SMESG000035755.1 dd_Smed_v4_83_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3001553460S ribosomal protein L21SMESG000040216.1 dd_Smed_v4_189_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015577KinaseSMESG000022299.1 dd_Smed_v4_3701_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED300189611.C3.2SMESG000049306.1 dd_Smed_v4_406_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018297Dynein light chainSMESG000019341.1 dd_Smed_v4_177_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010966Core 1 udp-galactose:n-acetylgalactosamine-alpha-r beta 1,3-galactosyltransferase, putativeSMESG000061089.1 dd_Smed_v4_2796_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017032slc2a-11SMESG000025420.1 dd_Smed_v4_2995_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010620Histone acetyltransferaseSMESG000017094.1 dd_Smed_v4_12274_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018386Inositol 1,4,5-trisphosphate receptor type 3SMESG000070557.1 dd_Smed_v4_14214_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014052Endothelin-converting enzyme 1SMESG000003235.1 SMESG000003226.1 SMESG000003222.1 dd_Smed_v4_1910_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019300Histone deacetylase,putativeSMESG000006246.1 dd_Smed_v4_1997_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012139slc2a-2SMESG000081673.1 dd_Smed_v4_3190_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018630High mobility group proteinSMESG000052032.1 dd_Smed_v4_1331_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009144CCDC66 domain-containing proteinSMESG000019367.1 dd_Smed_v4_11800_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3001360660S ribosomal protein L7SMESG000022296.1 dd_Smed_v4_276_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009933WH1 domain-containing proteinSMESG000052345.1 dd_Smed_v4_1714_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009797Clathrin light chainSMESG000012224.1 dd_Smed_v4_1361_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017371Adenylosuccinate lyaseSMESG000014474.1 dd_Smed_v4_2280_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018423TAR DNA-binding protein 43SMESG000042285.1 dd_Smed_v4_20304_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008553Phosphoenolpyruvate carboxykinase [GTP]SMESG000062868.1 dd_Smed_v4_196_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033047SMED30033047SMESG000046962.1 SMESG000046951.1 SMESG000040592.1 SMESG000034034.1 dd_Smed_v4_489_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028521Cadmium metallothionein (MT-Cd) (Cd-MT)SMESG000013781.1 dd_Smed_v4_3412_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033243Rho GTPase-activating protein 7SMESG000062707.1 dd_Smed_v4_6129_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026534Rho-related GTP-binding proteinSMESG000022390.1 dd_Smed_v4_578_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021151Corepressor interacting with RBPJ 1SMESG000027503.1 SMESG000027499.1 dd_Smed_v4_1892_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030481Pyruvate kinaseSMESG000017675.1 dd_Smed_v4_2738_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030636SMED30030636SMESG000016978.1 dd_Smed_v4_19646_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031139WASH complex subunit 2CSMESG000014537.1 SMESG000014534.1 dd_Smed_v4_19560_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024833SMED30024833SMESG000017984.1 SMESG000017957.1 dd_Smed_v4_20923_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030240FerritinSMESG000039456.1 SMESG000014076.1 dd_Smed_v4_443_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032157SMED30032157SMESG000032745.1 dd_Smed_v4_2208_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024279slc44a-3SMESG000065604.1 SMESG000015886.1 dd_Smed_v4_4192_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030156SMED30030156SMESG000032633.1 dd_Smed_v4_6252_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033349Ribosomal protein S6 kinaseSMESG000059433.1 dd_Smed_v4_4316_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024423Family with sequence similarity 135 member ASMESG000040644.1 dd_Smed_v4_4890_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022804slc12a-1SMESG000043221.1 SMESG000043220.1 dd_Smed_v4_4047_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3002125360S ribosomal protein L35SMESG000035332.1 SMESG000031365.1 SMESG000077214.1 SMESG000075241.1 SMESG000075191.1 dd_Smed_v4_168_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033340DUF4476 domain-containing proteinSMESG000055714.1 dd_Smed_v4_3608_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030419SMED30030419SMESG000067626.1 dd_Smed_v4_5233_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034381Malate dehydrogenaseSMESG000056995.1 dd_Smed_v4_467_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024040Sesquipedalian-1SMESG000053122.1 dd_Smed_v4_5038_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023244TLC domain-containing protein 2SMESG000060101.1 SMESG000039123.1 dd_Smed_v4_4223_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30029490SMED30029490SMESG000049096.1 dd_Smed_v4_8321_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030055Protocadherin-9SMESG000033582.1 dd_Smed_v4_5930_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30029834Hemoglobin C1 polymerSMESG000048630.1 SMESG000022261.1 dd_Smed_v4_4497_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023825LITAF domain-containing proteinSMESG000020853.1 dd_Smed_v4_353_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032389slc24a-1SMESG000010390.1 dd_Smed_v4_5868_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030822A-kinase anchor protein 17ASMESG000071777.1 SMESG000071776.1 dd_Smed_v4_3404_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026956LaminSMESG000018461.1 dd_Smed_v4_3707_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024093TetraspaninSMESG000020341.1 dd_Smed_v4_440_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30029060SMED30029060SMESG000043664.1 dd_Smed_v4_2316_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022677sphingolipid delta(4)-desaturase DES1SMESG000025057.1 dd_Smed_v4_1100_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034110Dynein intermediate chain 3, ciliarySMESG000075110.1 dd_Smed_v4_2644_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025401Trifunctional purine biosynthetic protein adenosine-3SMESG000044482.1 dd_Smed_v4_3037_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023228SMED30023228SMESG000016978.1 dd_Smed_v4_19646_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034464Ig-like domain-containing proteinSMESG000012091.1 dd_Smed_v4_2864_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025075SMED30025075SMESG000048253.1 dd_Smed_v4_5617_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032093Protein kinase domain-containing proteinSMESG000024489.1 dd_Smed_v4_5366_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032093Protein kinase domain-containing proteinSMESG000024489.1 dd_Smed_v4_4401_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023181SMED30023181SMESG000008713.1 dd_Smed_v4_28592_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028718Epsin 2SMESG000042233.1 dd_Smed_v4_4779_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022835ras-related protein Rab-35SMESG000072655.1 dd_Smed_v4_3102_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026759Leishmanolysin-like peptidaseSMESG000008414.1 dd_Smed_v4_4448_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025750Myb/SANT-like DNA-binding domainSMESG000016880.1 dd_Smed_v4_4381_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028223Stabilizer of axonemal microtubules 1SMESG000042230.1 dd_Smed_v4_5551_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021977Beta-1,3-galactosyltransferase 1SMESG000035184.1 dd_Smed_v4_11741_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034467Protein tyrosine phosphatase type IVASMESG000078978.1 SMESG000078867.1 SMESG000010171.1 dd_Smed_v4_2239_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032372Coiled-coil domain containing 40SMESG000008312.1 dd_Smed_v4_6338_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026808EF-hand domain-containing proteinSMESG000081370.1 dd_Smed_v4_446_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022681Dynein heavy chain 7 axonemalSMESG000012956.1 dd_Smed_v4_13792_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022681Dynein heavy chain 7 axonemalSMESG000012956.1 dd_Smed_v4_5350_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025830Ornithine decarboxylaseSMESG000015244.1 SMESG000015241.1 SMESG000004848.1 SMESG000004822.1 SMESG000004820.1 SMESG000004806.1 dd_Smed_v4_280_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035584Stabilizer of axonemal microtubules 2SMESG000009389.1 dd_Smed_v4_3695_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020981Protein NDRG3SMESG000005138.1 SMESG000005122.1 dd_Smed_v4_1911_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016820Serine/threonine-protein kinase Nek4SMESG000005635.1 dd_Smed_v4_11387_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3000170160S ribosomal protein L7aSMESG000020535.1 dd_Smed_v4_296_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016546SMED30016546SMESG000051921.1 SMESG000051913.1 dd_Smed_v4_1175_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013424WD repeat domain 60SMESG000040271.1 dd_Smed_v4_10032_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014404SMED30014404SMESG000009905.1 dd_Smed_v4_14091_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013472SMED30013472SMESG000072084.1 dd_Smed_v4_10830_0_2dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006784ras-related protein Rab-7aSMESG000014290.1 dd_Smed_v4_419_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019092Glutathione S-transferaseSMESG000015099.1 SMESG000015094.1 SMESG000014182.1 dd_Smed_v4_1517_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016941Cytospin-ASMESG000002849.1 dd_Smed_v4_14690_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014265Neutral ceramidaseSMESG000003228.1 dd_Smed_v4_1726_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3001927340S ribosomal protein S3aSMESG000066540.1 SMESG000066537.1 dd_Smed_v4_163_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018560SMED30018560SMESG000004196.1 dd_Smed_v4_1162_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011564Ras associated and pleckstrin ySMESG000058735.1 dd_Smed_v4_26418_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011564Ras associated and pleckstrin ySMESG000058735.1 dd_Smed_v4_17910_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001782Fibronectin type III domain-containing proteinSMESG000024682.1 dd_Smed_v4_3381_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019288Reticulocalbin 3SMESG000012033.1 dd_Smed_v4_1417_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017326C2H2-type domain-containing proteinSMESG000042801.1 dd_Smed_v4_14176_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006290SMED30006290SMESG000072418.1 dd_Smed_v4_1561_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018688TNF receptor-associated factorSMESG000070130.1 SMESG000070126.1 dd_Smed_v4_1439_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3001616360S ribosomal protein L27aSMESG000034631.1 dd_Smed_v4_155_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017647SMED30017647SMESG000013908.1 dd_Smed_v4_1173_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3000109640S ribosomal protein S23SMESG000017264.1 dd_Smed_v4_290_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012092SMED30012092SMESG000073142.1 dd_Smed_v4_1835_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006886SMED30006886SMESG000024489.1 dd_Smed_v4_5366_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002306SMED30002306SMESG000071777.1 SMESG000071776.1 dd_Smed_v4_3404_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011715Splicing factor, arginine/serine-rich 6SMESG000041210.1 dd_Smed_v4_1177_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019321TIR domain-containing proteinSMESG000079651.1 dd_Smed_v4_1838_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013493slc5a-2SMESG000013622.1 dd_Smed_v4_6663_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016265Tubulin beta chainSMESG000022928.1 dd_Smed_v4_341_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015890Protein lethal(2) giant larvaeSMESG000072512.1 dd_Smed_v4_7127_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007989IQ and ubiquitin-like domain-containing proteinSMESG000006819.1 dd_Smed_v4_9227_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017004Kunitz-type serine protease inhibitorSMESG000037995.1 dd_Smed_v4_300_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000566Ropporin-1-like proteinSMESG000079804.1 dd_Smed_v4_4888_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012747Thioredoxin domain-containing protein 3-likeSMESG000043677.1 dd_Smed_v4_8401_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012747Thioredoxin domain-containing protein 3-likeSMESG000043677.1 dd_Smed_v4_8026_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002428Gamma-aminobutyric acid receptor-associated proteinSMESG000026465.1 dd_Smed_v4_600_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002895ThioredoxinSMESG000023197.1 dd_Smed_v4_6702_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012267Kinesin-like proteinSMESG000073771.1 dd_Smed_v4_6755_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015423Cilia- and flagella-associated protein 20SMESG000057288.1 dd_Smed_v4_4843_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001788PhosphoglucomutaseSMESG000069481.1 dd_Smed_v4_4058_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001980Protein phosphatase 1KSMESG000008048.1 dd_Smed_v4_3067_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018830Suppressor of cytokine signaling 7SMESG000051397.1 SMESG000006486.1 dd_Smed_v4_2582_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001196Myosin headSMESG000049494.1 dd_Smed_v4_2912_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013157KHD-1SMESG000070471.1 dd_Smed_v4_294_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000512cilia- and flagella-associated protein 61SMESG000059955.1 dd_Smed_v4_4908_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019006Tubulin beta chainSMESG000022928.1 dd_Smed_v4_341_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004448Thioredoxin domain-containing protein 3-likeSMESG000043677.1 dd_Smed_v4_8401_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004448Thioredoxin domain-containing protein 3-likeSMESG000043677.1 dd_Smed_v4_8026_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018897Phorbol-ester/DAG-type domain-containing proteinSMESG000056465.1 dd_Smed_v4_2451_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004412SMED30004412SMESG000025157.1 dd_Smed_v4_9730_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005213Band 4.1-like protein 5SMESG000007133.1 dd_Smed_v4_4114_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016249SMED30016249SMESG000080837.1 dd_Smed_v4_3291_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012826SMED30012826SMESG000017012.1 SMESG000017011.1 dd_Smed_v4_309_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004214SMED30004214SMESG000055805.1 dd_Smed_v4_857_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012419Non-specific serine/threonine protein kinaseSMESG000069962.1 SMESG000069953.1 SMESG000069952.1 dd_Smed_v4_3244_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015567Slc42a-1SMESG000048173.1 dd_Smed_v4_3286_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016591Protein big brotherSMESG000068819.1 dd_Smed_v4_2875_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018744GAS2 protein 1SMESG000041563.1 dd_Smed_v4_8709_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004616Lipopolysaccharide choline phosphotransferase proteinSMESG000025873.1 dd_Smed_v4_5971_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013882Spds-1SMESG000023363.1 dd_Smed_v4_3295_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000449SMED30000449SMESG000020436.1 dd_Smed_v4_5646_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017219Guanylate cyclaseSMESG000039747.1 dd_Smed_v4_7619_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007604SMED30007604SMESG000074719.1 dd_Smed_v4_3016_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007604SMED30007604SMESG000074719.1 dd_Smed_v4_4756_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017099SMED30017099SMESG000030373.1 dd_Smed_v4_595_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005553Thioredoxin domain-containing protein 3-likeSMESG000043677.1 dd_Smed_v4_8401_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005553Thioredoxin domain-containing protein 3-likeSMESG000043677.1 dd_Smed_v4_8026_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004840Coiled-coil domain containing 88AaSMESG000012304.1 dd_Smed_v4_3591_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30003484SMED30003484SMESG000049494.1 dd_Smed_v4_2912_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012605FERM domain-containing proteinSMESG000034888.1 dd_Smed_v4_4999_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017180Dynein regulatory complex protein 1SMESG000072168.1 dd_Smed_v4_8761_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023276T cell activation inhibitor, mitochondrialSMESG000063165.1 dd_Smed_v4_2607_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030057GLOBIN domain-containing proteinSMESG000048632.1 SMESG000022262.1 dd_Smed_v4_2237_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30029745SMED30029745SMESG000003948.1 dd_Smed_v4_5093_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021194Calcitonin-like receptorSMESG000080399.1 dd_Smed_v4_7328_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034888Dynein heavy chain 5, axonemalSMESG000049144.1 dd_Smed_v4_4569_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031265Scavenger receptor class B member 1SMESG000058914.1 dd_Smed_v4_2951_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024736transmembrane protein 180SMESG000017241.1 dd_Smed_v4_4630_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025757JUNLI-1SMESG000067959.1 dd_Smed_v4_4878_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023889SMED30023889SMESG000055805.1 dd_Smed_v4_857_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025348SMED30025348SMESG000027631.1 dd_Smed_v4_5686_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026870SWIM-type domain-containing proteinSMESG000060198.1 dd_Smed_v4_5330_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030013GTP-binding nuclear proteinSMESG000072524.1 SMESG000072522.1 dd_Smed_v4_330_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3002669640S ribosomal protein S19SMESG000023987.1 SMESG000009719.1 dd_Smed_v4_202_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021868coiled-coil domain-containing protein 39SMESG000072035.1 SMESG000072034.1 dd_Smed_v4_5955_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027834Thymidine phosphorylaseSMESG000008845.1 dd_Smed_v4_869_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022246Coiled-coil domain-containing protein 77SMESG000045184.1 dd_Smed_v4_4812_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025543Coiled-coil domain-containing protein 93SMESG000022913.1 dd_Smed_v4_2519_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3002074960S acidic ribosomal protein P2SMESG000057890.1 dd_Smed_v4_556_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022992Myosin heavy chainSMESG000062420.1 dd_Smed_v4_791_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027015MAGUK p55 subfamily member 5SMESG000007837.1 dd_Smed_v4_5287_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021461Histone H2BSMESG000067906.1 dd_Smed_v4_4808_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025338E3 ubiquitin-protein ligase CBLSMESG000072524.1 SMESG000072522.1 dd_Smed_v4_330_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022057SJCHGC08494 proteinSMESG000027083.1 dd_Smed_v4_2196_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023430set nuclear proto-oncogeneSMESG000031906.1 SMESG000031905.1 dd_Smed_v4_618_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021956Actin-related protein 3SMESG000078631.1 dd_Smed_v4_453_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021616Rho GTPase-activating proteinSMESG000060252.1 dd_Smed_v4_3376_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022974slc17a-5SMESG000060615.1 dd_Smed_v4_4910_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022142SMED30022142SMESG000070064.1 SMESG000070059.1 dd_Smed_v4_3829_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028423Leishmanolysin-like peptidaseSMESG000008405.1 dd_Smed_v4_2320_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021431TTF-type domain-containing proteinSMESG000080622.1 SMESG000068757.1 SMESG000055125.1 SMESG000038294.1 SMESG000032747.1 SMESG000023322.1 dd_Smed_v4_3830_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024428CalmodulinSMESG000018137.1 SMESG000018135.1 dd_Smed_v4_4669_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023751Coactosin-like proteinSMESG000073127.1 dd_Smed_v4_63_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021222Meiosis specific nuclear structural 1SMESG000036318.1 dd_Smed_v4_4463_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020341General transcription factor 3C polypeptide 5SMESG000017479.1 dd_Smed_v4_2071_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3002512114-3-3 protein epsilonSMESG000076939.1 dd_Smed_v4_251_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020666Glutamine-rich protein 2SMESG000081231.1 dd_Smed_v4_6048_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021873Alpha-methylacyl-CoA racemaseSMESG000027631.1 dd_Smed_v4_5686_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022421RIB43A-like with coiled-coils protein 2SMESG000037028.1 dd_Smed_v4_4547_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030659Fer-1-relatedSMESG000070967.1 dd_Smed_v4_4648_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012075SMED30012075SMESG000059352.1 SMESG000059351.1 dd_Smed_v4_420_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016107PH domain-containing proteinSMESG000007865.1 dd_Smed_v4_3737_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004353Bestrophin homologSMESG000030918.1 dd_Smed_v4_9659_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010206Placenta-specific gene 8 proteinSMESG000050245.1 SMESG000050244.1 dd_Smed_v4_6151_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001718Protein-serine/threonine kinaseSMESG000036411.1 dd_Smed_v4_6810_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015096Family with sequence similarity 183 member ASMESG000024586.1 dd_Smed_v4_8725_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013863Rac-1SMESG000024961.1 dd_Smed_v4_610_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008506SMED30008506SMESG000037104.1 SMESG000037103.1 dd_Smed_v4_407_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002228Ig-like domain-containing proteinSMESG000024613.1 dd_Smed_v4_7050_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019874CalmodulinSMESG000010769.1 dd_Smed_v4_255_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005336Phtf-FEM1B_bdg domain-containing proteinSMESG000058788.1 dd_Smed_v4_8465_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013735Elongation factor 1-alphaSMESG000061164.1 SMESG000061099.1 dd_Smed_v4_30_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001036Receptor-type tyrosine-protein phosphatase betaSMESG000050003.1 SMESG000005247.1 dd_Smed_v4_5794_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000691Eukaryotic initiation factor 4A-IIISMESG000078818.1 dd_Smed_v4_737_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006884Protein dpy-30-likeSMESG000008786.1 dd_Smed_v4_9103_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007392tetratricopeptide repeat protein 38SMESG000072019.1 SMESG000071607.1 dd_Smed_v4_3316_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007579SMED30007579SMESG000038305.1 SMESG000038298.1 SMESG000038313.1 SMESG000035859.1 dd_Smed_v4_9798_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3000317640S ribosomal protein S2SMESG000051503.1 dd_Smed_v4_226_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005911SMED30005911 dd_Smed_v4_12_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005465Ras-related protein Rab-11ASMESG000073334.1 dd_Smed_v4_867_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004331SMED30004331 dd_Smed_v4_37267_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015411GLTP domain-containing protein dd_Smed_v4_2621_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019742Geranylgeranyl transferase type-2 subunit alphaSMESG000011257.1 dd_Smed_v4_7183_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017206Band 4.1 protein 2SMESG000062476.1 dd_Smed_v4_2032_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000360TetraspaninSMESG000052597.1 dd_Smed_v4_9647_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012212NADH dehydrogenase subunit 1 dd_Smed_v4_258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001799NADH dehydrogenase subunit 5 dd_Smed_v4_258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008716SMED30008716SMESG000020939.1 SMESG000020938.1 dd_Smed_v4_2743_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009591Tumor protein D54SMESG000037796.1 SMESG000057565.1 SMESG000057564.1 dd_Smed_v4_2842_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000126Centrosomal protein 95SMESG000002923.1 dd_Smed_v4_8515_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006256SMED30006256SMESG000034101.1 dd_Smed_v4_9313_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008578TitinSMESG000029197.1 dd_Smed_v4_866_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3001198260S ribosomal protein L17SMESG000009564.1 dd_Smed_v4_95_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012977SMED30012977SMESG000076174.1 dd_Smed_v4_2880_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010881SMED30010881SMESG000004195.1 dd_Smed_v4_991_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014980LaminSMESG000009886.1 dd_Smed_v4_850_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014923ADP-ribosylation factorSMESG000052763.1 dd_Smed_v4_2013_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016593SMED30016593 dd_Smed_v4_13795_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016430SMED30016430 dd_Smed_v4_275_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005692Cytoplasmic dynein 2 heavy chain 1SMESG000008384.1 SMESG000008382.1 dd_Smed_v4_9136_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000682SMED30000682 dd_Smed_v4_1303_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001490ADF-H domain-containing proteinSMESG000080129.1 dd_Smed_v4_260_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001870SMED30001870 dd_Smed_v4_4311_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006208Aconitate hydratase, mitochondrialSMESG000002904.1 dd_Smed_v4_979_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3000236940S ribosomal protein S17SMESG000037102.1 dd_Smed_v4_195_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001836SMED30001836SMESG000070066.1 dd_Smed_v4_8830_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013260SAM domain-containing proteinSMESG000010456.1 SMESG000002915.1 dd_Smed_v4_1968_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013260SAM domain-containing proteinSMESG000054431.1 dd_Smed_v4_7610_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000212Vacuolar protein sorting-associated protein 26BSMESG000026617.1 dd_Smed_v4_912_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014689Usp domain-containing proteinSMESG000020952.1 dd_Smed_v4_985_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005555Tigger transposable element-derived protein 1 dd_Smed_v4_20966_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004553SMED30004553SMESG000023121.1 dd_Smed_v4_6718_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005654SMED30005654SMESG000044586.1 dd_Smed_v4_6921_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007498Ribosomal protein L19SMESG000057653.1 dd_Smed_v4_228_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009510intraflagellar transport protein 80 homologSMESG000066998.1 dd_Smed_v4_9110_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005838X1.C3.3SMESG000058321.1 SMESG000058307.1 dd_Smed_v4_68_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011213Osteoclast-stimulating factor 1SMESG000004952.1 SMESG000004951.1 dd_Smed_v4_2235_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012648cullin-5-likeSMESG000020142.1 dd_Smed_v4_8238_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013161SMED30013161SMESG000051379.1 dd_Smed_v4_2630_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001702SMED30001702SMESG000042167.1 dd_Smed_v4_8527_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012829SMED30012829 dd_Smed_v4_35980_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008157Rhodanese-like proteinSMESG000030828.1 dd_Smed_v4_880_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011383NEDD8 dd_Smed_v4_403_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013261Retrovirus-related Pol polyprotein from transposon dd_Smed_v4_15498_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018369Phosphatidylinositol 3,4,5-trisphosphate 3-phosphatase and dual-specificity protein phosphatase PTENSMESG000072902.1 dd_Smed_v4_7478_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010157SMED30010157 dd_Smed_v4_28622_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013441WD repeat domain 78SMESG000047563.1 dd_Smed_v4_8721_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017937WASP like actin nucleation promoting factor bSMESG000074788.1 dd_Smed_v4_1987_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020002BEN domain-containing proteinSMESG000080064.1 dd_Smed_v4_7370_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034920G protein gamma domain-containing proteinSMESG000066557.1 dd_Smed_v4_1237_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028237PMP-22/EMP/MP20/Claudin tight junctionSMESG000028931.1 dd_Smed_v4_2132_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024041Tumor protein D54SMESG000037796.1 SMESG000057565.1 SMESG000057564.1 dd_Smed_v4_2842_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023613SMED30023613 dd_Smed_v4_12778_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034870SMED30034870SMESG000047469.1 dd_Smed_v4_16220_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033785Cell division cycle and apoptosis regulator protein 1 dd_Smed_v4_1181_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034936SMED30034936 dd_Smed_v4_13714_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025910Microtubule-associated protein futschSMESG000044270.1 SMESG000030021.1 SMESG000025422.1 dd_Smed_v4_1999_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020160SMED30020160SMESG000005587.1 dd_Smed_v4_8117_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035139TOG array regulator of axonemal microtubules 1SMESG000016691.1 dd_Smed_v4_13421_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30036035SMED30036035 dd_Smed_v4_11595_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035694SMED30035694SMESG000023025.1 dd_Smed_v4_13548_0_2dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034308Integrase catalytic domain-containing protein dd_Smed_v4_12778_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027772SMED30027772SMESG000004952.1 SMESG000004951.1 dd_Smed_v4_2235_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30029781SMED30029781 dd_Smed_v4_1213_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028170SMED30028170SMESG000037796.1 SMESG000057565.1 SMESG000057564.1 dd_Smed_v4_2842_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028337SAP domain-containing protein dd_Smed_v4_1181_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025152cilia- and flagella-associated protein 91SMESG000056200.1 dd_Smed_v4_9724_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021397Kunitz-type serine protease inhibitor dd_Smed_v4_12691_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005523Alpha-actininSMESG000026000.1 dd_Smed_v4_1951_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017721SMED30017721SMESG000037259.1 dd_Smed_v4_4831_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED300154216-pyruvoyl tetrahydrobiopterin synthaseSMESG000077201.1 dd_Smed_v4_3156_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006312Sodium/potassium-transporting ATPase subunit beta-1SMESG000022447.1 SMESG000022444.1 dd_Smed_v4_12062_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004937Elongation factor 2SMESG000042430.1 dd_Smed_v4_186_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3000598860S ribosomal protein L24SMESG000007869.1 SMESG000007858.1 SMESG000007847.1 dd_Smed_v4_172_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000707Sodium/hydrogen exchangerSMESG000062012.1 dd_Smed_v4_11493_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019565Radial spoke head protein 4-like protein ASMESG000044927.1 dd_Smed_v4_5346_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30003301RotatinSMESG000018486.1 dd_Smed_v4_13117_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010503CEP135SMESG000077870.1 dd_Smed_v4_5218_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015955Growth arrest-specific protein 8SMESG000013356.1 dd_Smed_v4_2848_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004594Dynamin 2SMESG000027378.1 SMESG000027377.1 dd_Smed_v4_2583_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007726Spo11SMESG000009092.1 dd_Smed_v4_43889_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008964SMED30008964SMESG000010167.1 dd_Smed_v4_8925_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007850SMED30007850SMESG000001248.1 dd_Smed_v4_3418_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004447Family with sequence similarity 184 member ASMESG000058677.1 dd_Smed_v4_16975_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013227WD repeat-containing proteinSMESG000042025.1 dd_Smed_v4_9187_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009181Non-specific serine/threonine protein kinaseSMESG000057003.1 SMESG000037136.1 dd_Smed_v4_4425_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012572Leucine--tRNA ligaseSMESG000071689.1 dd_Smed_v4_9705_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016162Golgi apparatus protein 1SMESG000020960.1 dd_Smed_v4_3691_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004194SMED30004194SMESG000009646.1 dd_Smed_v4_12139_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004194SMED30004194SMESG000009646.1 dd_Smed_v4_23871_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010277SMED30010277SMESG000000133.1 dd_Smed_v4_8640_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012757Tektin-4SMESG000068903.1 dd_Smed_v4_4872_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012496SMED30012496SMESG000032753.1 SMESG000017208.1 dd_Smed_v4_3340_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017369Disabled 2-interacting proteinSMESG000043888.1 dd_Smed_v4_3238_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002606Cilia-and flagella-associated protein 74SMESG000043377.1 dd_Smed_v4_18628_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000421TPR_REGION domain-containing proteinSMESG000071973.1 dd_Smed_v4_11462_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006074SMED30006074SMESG000019341.1 dd_Smed_v4_177_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035373histone deacetylase 1SMESG000060876.1 dd_Smed_v4_695_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018188Lysosome-associated membrane glycoprotein 2SMESG000025677.1 dd_Smed_v4_722_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017239SMED30017239SMESG000048407.1 SMESG000002220.1 SMESG000002212.1 SMESG000001733.1 dd_Smed_v4_9947_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016057Receptor protein-tyrosine kinaseSMESG000070834.1 dd_Smed_v4_8641_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008882Cilia and flagella associated protein 157SMESG000036345.1 dd_Smed_v4_9862_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015587Dual specificity protein phosphatase 14SMESG000037868.1 dd_Smed_v4_7558_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015532FYVE-type domain-containing proteinSMESG000008512.1 dd_Smed_v4_5283_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015563Meiosis expressed protein 1SMESG000031493.1 dd_Smed_v4_4620_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010317MFS domain-containing proteinSMESG000026516.1 dd_Smed_v4_6235_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007943AP complex subunit betaSMESG000029143.1 SMESG000029126.1 dd_Smed_v4_893_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009712epidermal growth factor receptor 1SMESG000070834.1 dd_Smed_v4_8641_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014810Endophilin-A3SMESG000061276.1 dd_Smed_v4_7468_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018177insulin receptor-like 1 proteinSMESG000042173.1 dd_Smed_v4_9272_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018527Guanylate cyclaseSMESG000010241.1 dd_Smed_v4_7644_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009456SMED30009456SMESG000039759.1 SMESG000039758.1 dd_Smed_v4_5133_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019702SMED30019702SMESG000016033.1 SMESG000000571.1 dd_Smed_v4_661_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019836CCDC151SMESG000007771.1 dd_Smed_v4_4526_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014791adenylate kinase 8-likeSMESG000027219.1 dd_Smed_v4_7317_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30003011NPHP1SMESG000061008.1 dd_Smed_v4_9990_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002598Histone-lysine N-methyltransferaseSMESG000039926.1 dd_Smed_v4_99_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008757Piezo-type mechanosensitive ion channel componentSMESG000051188.1 dd_Smed_v4_7182_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013025Corticotropin-releasing factor receptor 1SMESG000051050.1 dd_Smed_v4_6632_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006906AnoctaminSMESG000053932.1 dd_Smed_v4_5046_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011516hypothetical proteinSMESG000039929.1 dd_Smed_v4_5959_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004587early endosome antigen 1-likeSMESG000008512.1 dd_Smed_v4_5283_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007097Rho guanine nucleotide exchange factor 28SMESG000021797.1 dd_Smed_v4_5252_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017611SMED30017611SMESG000038056.1 dd_Smed_v4_9903_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005237Zinc finger proteinSMESG000055679.1 dd_Smed_v4_8858_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012475PPFIA binding protein 1bSMESG000054431.1 dd_Smed_v4_7610_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005253EF-hand domain-containing family member C2SMESG000076759.1 dd_Smed_v4_6035_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004520SMED30004520SMESG000037711.1 dd_Smed_v4_8837_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008534cGMP-dependent protein kinaseSMESG000052811.1 dd_Smed_v4_5704_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3000928360S ribosomal protein L18aSMESG000060163.1 dd_Smed_v4_437_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010695coiled-coil domain-containing protein 170SMESG000048767.1 dd_Smed_v4_7066_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007217Death domain-containing proteinSMESG000078437.1 dd_Smed_v4_7428_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013563Serine/threonine-protein kinase 10SMESG000064983.1 dd_Smed_v4_5720_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012262SMED30012262SMESG000013006.1 dd_Smed_v4_6779_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017364SMED30017364SMESG000057626.1 dd_Smed_v4_6808_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30003729Dynein light chainSMESG000048100.1 dd_Smed_v4_5884_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008911FascinSMESG000037971.1 dd_Smed_v4_996_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008638SMED30008638SMESG000013006.1 dd_Smed_v4_6779_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023988Dynamin-type G domain-containing proteinSMESG000002973.1 dd_Smed_v4_9275_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022501Fatty acid-binding protein, heartSMESG000029500.1 dd_Smed_v4_599_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033551PhosphotransferaseSMESG000043559.1 dd_Smed_v4_4327_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030038ATP-dependent RNA helicaseSMESG000011907.1 dd_Smed_v4_596_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034135Leucine-rich repeat-containing protein 23SMESG000003705.1 dd_Smed_v4_8299_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022077Cytospin-ASMESG000039310.1 dd_Smed_v4_6934_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035317Phosphoglycerate kinaseSMESG000039090.1 dd_Smed_v4_972_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035047Sperm associated antigen 17SMESG000038878.1 dd_Smed_v4_9301_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022840SMED30022840SMESG000025410.1 dd_Smed_v4_777_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031389CalnexinSMESG000016275.1 dd_Smed_v4_632_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025346SMED30025346SMESG000048407.1 SMESG000002220.1 SMESG000002212.1 SMESG000001733.1 dd_Smed_v4_9947_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031818C-Jun-amino-terminal kinase-interacting protein 4SMESG000027094.1 dd_Smed_v4_4531_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034818Guanylate cyclaseSMESG000010241.1 dd_Smed_v4_7644_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025071Calcium/calmodulin-dependent protein kinase type IISMESG000008997.1 dd_Smed_v4_7480_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30029024Protein F37C4.5SMESG000064758.1 dd_Smed_v4_5168_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025300SMED30025300SMESG000019783.1 SMESG000019789.1 dd_Smed_v4_4438_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026337AnkyrinSMESG000019783.1 SMESG000019789.1 dd_Smed_v4_4438_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023490SMED30023490SMESG000076531.1 dd_Smed_v4_7027_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034831SMED30034831SMESG000064758.1 dd_Smed_v4_5168_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032329SMED30032329SMESG000042387.1 dd_Smed_v4_6329_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024138Armadillo repeat protein deleted in velo-cardio-facial syndrome-likeSMESG000061216.1 dd_Smed_v4_6256_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030281BHLH domain-containing proteinSMESG000019783.1 SMESG000019789.1 dd_Smed_v4_4438_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026782Cilia-and flagella-associated protein 58SMESG000061980.1 dd_Smed_v4_5727_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033797SMED30033797SMESG000039759.1 SMESG000039758.1 dd_Smed_v4_5133_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025001Armadillo repeat-containing protein 3SMESG000079416.1 dd_Smed_v4_9679_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028659Cilia-and flagella-associated protein 100SMESG000033127.1 dd_Smed_v4_6518_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028908GTP cyclohydrolase 1 feedback regulatory proteinSMESG000042387.1 dd_Smed_v4_6329_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026316Actin-related protein 2/3 complex subunit 5SMESG000023170.1 dd_Smed_v4_781_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023598Vps16_C domain-containing proteinSMESG000048407.1 SMESG000002220.1 SMESG000002212.1 SMESG000001733.1 dd_Smed_v4_9947_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021693Nicotinic acetylcholine receptor alpha 6 subunitSMESG000000214.1 SMESG000000209.1 dd_Smed_v4_9864_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031736SMED30031736SMESG000019122.1 dd_Smed_v4_8185_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031458Zinc finger, FYVE domain containing 16SMESG000036666.1 dd_Smed_v4_6618_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023180slc6a-12SMESG000055640.1 dd_Smed_v4_8727_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30029668Adenylate kinase isoenzyme 5SMESG000020486.1 SMESG000020480.1 dd_Smed_v4_5119_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034016Sperm surface protein Sp17SMESG000046919.1 dd_Smed_v4_4783_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020991Outer dynein arm protein 1SMESG000055998.1 SMESG000055997.1 dd_Smed_v4_4191_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032100F-box domain-containing proteinSMESG000060632.1 dd_Smed_v4_5335_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025990NPHP1SMESG000061008.1 dd_Smed_v4_9990_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008732SMED30008732SMESG000064322.1 dd_Smed_v4_4685_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016090Translocated promoter region b, nuclear basket proteinSMESG000025908.1 dd_Smed_v4_2899_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012431Conserved plasma membrane proteinSMESG000042684.1 dd_Smed_v4_2904_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009690TransporterSMESG000042086.1 SMESG000042051.1 dd_Smed_v4_3642_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016875Rho-associated kinaseSMESG000057753.1 dd_Smed_v4_2914_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019898Slc42a-1SMESG000048173.1 dd_Smed_v4_3286_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014044SMED30014044SMESG000079607.1 SMESG000072955.1 SMESG000049847.1 SMESG000049844.1 SMESG000049832.1 SMESG000049812.1 SMESG000049806.1 SMESG000049805.1 SMESG000049772.1 SMESG000049767.1 SMESG000049756.1 SMESG000049745.1 SMESG000049740.1 SMESG000049739.1 SMESG000049695.1 SMESG000049688.1 SMESG000049683.1 SMESG000049676.1 SMESG000049665.1 SMESG000049663.1 SMESG000049647.1 SMESG000049621.1 SMESG000049614.1 SMESG000049601.1 SMESG000049567.1 SMESG000049548.1 SMESG000040301.1 SMESG000040257.1 SMESG000032755.1 SMESG000032715.1 SMESG000022696.1 SMESG000022691.1 SMESG000022676.1 SMESG000022665.1 SMESG000022640.1 SMESG000022619.1 SMESG000022612.1 dd_Smed_v4_490_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015948SMED30015948SMESG000042166.1 dd_Smed_v4_4173_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012966SMED30012966SMESG000079607.1 SMESG000072955.1 SMESG000049847.1 SMESG000049844.1 SMESG000049832.1 SMESG000049812.1 SMESG000049806.1 SMESG000049805.1 SMESG000049772.1 SMESG000049767.1 SMESG000049756.1 SMESG000049745.1 SMESG000049740.1 SMESG000049739.1 SMESG000049695.1 SMESG000049688.1 SMESG000049683.1 SMESG000049676.1 SMESG000049665.1 SMESG000049663.1 SMESG000049647.1 SMESG000049621.1 SMESG000049614.1 SMESG000049601.1 SMESG000049567.1 SMESG000049548.1 SMESG000040301.1 SMESG000040257.1 SMESG000032755.1 SMESG000032715.1 SMESG000022696.1 SMESG000022691.1 SMESG000022676.1 SMESG000022665.1 SMESG000022640.1 SMESG000022619.1 SMESG000022612.1 dd_Smed_v4_490_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008280Class E vacuolar protein-sorting machinery protein HSE1SMESG000077597.1 dd_Smed_v4_4190_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015151Phosphatidylinositol transfer protein alpha isoformSMESG000014949.1 dd_Smed_v4_580_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011587SMED30011587SMESG000002176.1 dd_Smed_v4_8691_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013095DDE_Tnp_1_7 domain-containing proteinSMESG000080622.1 SMESG000068757.1 SMESG000055125.1 SMESG000038294.1 SMESG000032747.1 SMESG000023322.1 dd_Smed_v4_3830_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012721HexosyltransferaseSMESG000023046.1 SMESG000023044.1 dd_Smed_v4_6118_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017410Peptidoglycan-recognition proteinSMESG000004536.1 dd_Smed_v4_817_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000058SMED30000058SMESG000022049.1 dd_Smed_v4_499_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011984partitioning defective 3 homolog isoform X2SMESG000071209.1 dd_Smed_v4_5548_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000409mitfl-2 proteinSMESG000077129.1 dd_Smed_v4_7316_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013212Histone H2ASMESG000015784.1 dd_Smed_v4_469_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014551SMED30014551SMESG000080911.1 SMESG000080909.1 dd_Smed_v4_8194_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016196SMED30016196SMESG000059283.1 dd_Smed_v4_62_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016840PhosphodiesteraseSMESG000019038.1 dd_Smed_v4_8595_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001778StAR-related lipid transfer (START) domain containing 7SMESG000018486.1 dd_Smed_v4_13117_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017438RanBP-type and C3HC4-type zinc finger-containing protein 1SMESG000013684.1 dd_Smed_v4_4440_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014640Small heat shock protein p36SMESG000028601.1 dd_Smed_v4_6399_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012136radial spoke head protein 9 homologSMESG000046857.1 dd_Smed_v4_4707_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009973mxi-1 proteinSMESG000047681.1 SMESG000016277.1 dd_Smed_v4_4415_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3000599860s ribosomal protein l3SMESG000081260.1 dd_Smed_v4_12559_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019315SMED30019315SMESG000022726.1 dd_Smed_v4_2668_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012271TalinSMESG000072542.1 dd_Smed_v4_2443_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012382Macrophage-expressed gene 1 proteinSMESG000020341.1 dd_Smed_v4_440_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015945Centrin-1SMESG000052182.1 SMESG000015458.1 dd_Smed_v4_3644_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014184Tumor necrosis factor alpha-induced protein 8-like proteinSMESG000002914.1 dd_Smed_v4_2386_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019325Myosin regulatory light chainSMESG000000175.1 dd_Smed_v4_383_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006684Calsyntenin-1-like proteinSMESG000057121.1 dd_Smed_v4_3122_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007558SMED30007558SMESG000071865.1 dd_Smed_v4_4209_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001810Protein NDRG3SMESG000005138.1 SMESG000005122.1 dd_Smed_v4_1911_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006792Argonaute 1SMESG000050993.1 SMESG000050994.1 dd_Smed_v4_1194_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020220Sodium/potassium-transporting ATPase subunit alphaSMESG000032753.1 SMESG000017208.1 dd_Smed_v4_3340_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020779PhosphodiesteraseSMESG000019038.1 dd_Smed_v4_8595_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020678G-protein, gamma subunit,domain-containing proteinSMESG000066557.1 dd_Smed_v4_1237_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021890SMED30021890SMESG000067520.1 dd_Smed_v4_5272_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30029098Oxygen-dependent coproporphyrinogen-III oxidaseSMESG000039696.1 dd_Smed_v4_2002_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020388Glycerol-3-phosphate dehydrogenaseSMESG000076995.1 SMESG000076994.1 SMESG000076983.1 SMESG000076982.1 dd_Smed_v4_4928_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019374Sodium-dependent glucose transporter 1SMESG000015183.1 dd_Smed_v4_8337_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010340NeuroliginSMESG000012303.1 dd_Smed_v4_7946_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012160SMED30012160SMESG000069851.1 dd_Smed_v4_9493_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004118Tubulin beta chainSMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044888.1 SMESG000035755.1 dd_Smed_v4_83_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018404SMED30018404SMESG000032486.1 dd_Smed_v4_4574_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018724SMED30018724SMESG000036933.1 dd_Smed_v4_3235_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006820cilia- and flagella-associated protein 57SMESG000072029.1 dd_Smed_v4_3323_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010668MAGUK p55 subfamily member 5SMESG000017294.1 dd_Smed_v4_6790_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010437Copper homeostasis protein CutCSMESG000016228.1 dd_Smed_v4_7302_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017127Tektin 3SMESG000062615.1 dd_Smed_v4_6883_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017203Semaphorin-like proteinSMESG000016303.1 dd_Smed_v4_4702_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015103Branched-chain-amino-acid aminotransferaseSMESG000021421.1 dd_Smed_v4_3721_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30003675adenylate kinase 7-likeSMESG000075409.1 dd_Smed_v4_5880_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011267SMED30011267SMESG000064891.1 dd_Smed_v4_3911_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015301SMED30015301SMESG000024440.1 dd_Smed_v4_7463_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014692Histone H4SMESG000036410.1 dd_Smed_v4_506_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013334Glutathione peroxidaseSMESG000077750.1 dd_Smed_v4_662_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017053SMED30017053SMESG000004885.1 dd_Smed_v4_5297_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013731CentrinSMESG000040368.1 dd_Smed_v4_7903_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004846Actin-binding LIM proteinSMESG000080177.1 dd_Smed_v4_5410_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014446SMEDWI-2SMESG000069984.1 SMESG000069981.1 dd_Smed_v4_756_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005661Ras-related protein Rab-7aSMESG000068863.1 dd_Smed_v4_491_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011308SMED30011308SMESG000012340.1 dd_Smed_v4_5536_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007115SMED30007115SMESG000017234.1 dd_Smed_v4_5508_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016950DystrophinSMESG000020523.1 dd_Smed_v4_5325_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009176BTB domain-containing proteinSMESG000061081.1 dd_Smed_v4_7429_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009782Outer dense fiber protein 3SMESG000038718.1 dd_Smed_v4_2658_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016609SMED30016609SMESG000044186.1 dd_Smed_v4_13633_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010027SMED30010027SMESG000015329.1 dd_Smed_v4_5101_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011604Long-chain-fatty-acid--CoA ligaseSMESG000081754.1 dd_Smed_v4_2153_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult