protonephridia

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ In Situ Hybridization Data

  ▻ Sequences

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  protonephridia


DEFINITON:

  Excretory organs consisting of flame cells, proximal tubules, and distal tubules connected to a mesenchymal collecting duct.


TERM DEFINITION CITATIONS:

  PMID:21828097, PMID:26057828, OCLC:16809160


TERM CITATIONS:


TERM ID:

  PLANA:0000020


ABOUT THIS TERM:

protonephridia

  ↳is a material entity and organ

  ↳contained in tail, copulatory region, posterior region of the whole animal, parapharyngeal region, prepharyngeal region, head, dorsal region of the whole animal and anterior region of the whole animal

  ↳develops from protonephridial progenitor cell

  ↳existence overlaps Stage 6, juvenile, asexual adult, adult hermaphrodite, Stage 8 and Stage 7

  ↳part of renal system


  → protonephridial progenitor cell develops into protonephridia


Expand to see terms that part of protonephridia


DEPICTED BY:


BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30021661Carbonic anhydrase 7CAVII-1Stage 6, Stage 7, Stage 8distal tubule, protonephridia, renal system
SMED30030379POU domain proteinpou2/3Stage 5, Stage 6, Stage 7, Stage 8protonephridia, renal system, protonephridial progenitor cell
SMED30030007RootletinH.2.8b, croccStage 5, Stage 6, Stage 7, Stage 8protonephridia, renal system, integumental system, Category 5 cell, proximal tubule
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30030007 ID=SMED30030007|Name=Rootletin|organism=Schmidtea mediterranea sexual|type=transcript|length=6612bp
GTTGTTTTTAAATCACTATTTTTTTTATTTCATCTGATTATAATTTTTTTTTATTGAAATTTGTATTTTGAAATTGGTGA
ACAATGAGTGAGATAGATTATTCCGCTATTGTTCGGAGACGCATTGGAGATATCGATGGGGATTCAAGTGAAGATTCCAG
TTCAAAGGGTTTGCTTCAAGTTAACTTGGAACTGAGAAAGCGCTTAGAGGAAGAACACAATGAGTATCGTAGAAAGCTGA
TAGTTTTCCAAGACAGCCAACAGAAACAAGCGCAATTGGTTCAAAGATTGCAGAAAAAGGTATTGCAATACAAAGAAAAA
TGCACGGAACTTGAATCTAAAATGCAATTTGGCGATTATGAGACTCGAAAAACGAAGTATGGAAGTCCAACGAATAACGG
CTATGGGTCGCGTAGTGAGAATCCCTACGACAATCTGGATTTGGAGAGCACACTCATTAAGTTAGAAGAGGAACAAAAAA
AAACAAATTATCTAACGGAGTTCAATGAACGGCTTCAAGAACAATTAACTCAAGCAACTCAATCAAACCAGAATTTGACG
AGAGACATCAGTAAGCTTTCCGAAGAATGGCAGAGATCAAGGGAGGAGCTTGAACAGAGAGAAAAAATTTGGCGAAATGA
AGAAATGTCATTTAATGACTATTTAGCATCTGAGCATTCGAATCTGCAAAATTTGCAACGCAATACGATAAATTTCCGCC
GTCAATTTATAGAATTGAAAGCTTCAACTGAACGGGAAATAAATAATTTGAAAAATGAATTCAACCGACAGGCACGCTGT
TTGCAAACTGCTTGTTCCAATCTTTCGTGCAACATGAAATCTGCAGAATCTAAACAACAATTGAGTACTGAACGAGAAAG
TCGGGACAAGTTGAATCTCGAAAATCAACTGCGAGAAAAAAACAGAGAATTAACTGATTACCAAACTCGGTATGAATGTG
AAATGACAGAATTGCAACACCGAGTGAAAGAATTAACAGTTCTCAGTGACAAACTGAAAATTCAAAACCTGGAAAAGGAT
CGAGCATTGACAGCTTTGCAAAGAATTAAGAATGGAGATACCGCAGGAGAAATAAATATGGAAGACAAAGCTACAAGAGT
TCTTATTGAAGACACAGAAAGTATGCATCAAGCACTTCGAAATATTTCTCAAGTAGTACTAAATGATTCTGACTATTTCG
ATGCAGAAGACACAGGATTTGAAACAGTTCGAAAGAATAATCGTTCGCCAAGTCCAAGGAGAAATCGTAGCGTCAGTCCT
AACTCAAGATCAGCTAAAACACCGCCATTTGCCGATGCAACGTATGCGGCGGTTCAGTCGGCTATAAATAAAAAATCTCT
ACAGATTCAAGAGCTTAAATCAAAATTAAACAGTTCTAAAGAGAGTTGTACAAACTTCAAAAGACAAATTGATGACAATG
AAAATGAACGTCGACGATTAGAGAATCAAGTTCTCGCCATGAGAGATGAAATTGAAAGTTTACGACGAGATAAAGATGAT
AGTTTTAGAGAAGCGGATCGGTTTAAAAATGCTCTGAACATCACTTCAAATGAACGAAGCCAATTGGAAAAGATTCGATC
ATCACTAAACGATCAAATTGAGCAGCAACTCACAGAAATTGAACGACTTAAGTCAGCCAATCACGAATTACAACGATTGA
GAGAGGCATTGGAAGATGAGCAAGAAGATACTAAAAAAGACTTAGAAAGACAAATTAAAGAAAGTGAAAGATGCCAACGA
TCGATTGATGTTTTGGAAGATAAAATAAGTCGATTTAAAGAAGACGTAGTTAATTACAAAGAGGCAATTAATAAATACCA
ATTAGAAAAAGAAGTATTGGTGCAAGAAAAGGATGAGATTGGTGATGCTTTAAGTCGTTGTGAAATTTCTAAAGCCGAAT
TAGAAATCGAGGTGAATAAACGGCAAACTATTGAAGTAAATTTGGAAGAAAACATTTCAAAATTATCCTCAGAAATCGAA
GAATTGAATGATAAGCGAGCTGAAAACCACAGAACTATTAAACAGCTGGAACATGAAAGAAGTTCTCTTTTGAATGAAAA
ACGATTTTTGGAACAAGAAAAAAGTGGTTTGAAAGATGAGCTTGTTCGATCTGAACAAGAGGCTCTTGGTTTGTCAAATG
AGAAAGCCATTCAACGTCAAAGAATCGAACAACTTGAAATTAATACAGAAAGATTAGAAGAAGAGTTATCGGAACTCAAT
CGAGAAAAGCTAGATCTTACTGAACAAATAGGCTGTTTGCAGAGGCAGAAATCGGCTCTTGCAGAAGAATTGTTGCAATG
TCGTAGAGAATTAGAACGATCTAATAACAGTGTCAACAACTTATCAAAAGAAAAGGAATATCTTACCAAAGAGAAAGGAG
AACTCGTCGTTCAAGTTACAGCTTGCGAAAGGGAAAATCGTCAACAGTCAGAAGTTATTGCTTCTTTGAATTCCGATAGA
GAACAACTGGAAGCTACTCTTTATGATGCTCAACAATTAATCATTCAGTTGGAAACTCGAAAAGAGCAATTAGAAGGCGA
AAACCAAGAGTTGATTGTGAAAAAAGAAAATCTAAATGGAGAACTAGTCAGATTACGACAAGAGTTTCAACTAGAATACG
AGAAGGTTGTTAATTCACGAGAACAATTAAATTGCAGATATCAACAAATGGATAAAGAATATAAGATGGCAATTCAACAA
GAGCGAGATTCTCATGCTGAAGATGTAGAAAGACTAACTAAGATAAACGAAAGCAATCGTCATGGATCTGAAAACGAACG
AGAAGAGCTTATTCATCGATTCAATATGGAGCGTGACGACATGATTCAAAATTACGAACAAGAGAAACAAGAAATGGCCC
AGGAAATCATGACGATCCAACGAGAACGAGATGACTCATTATTAATGGCGGAAAATGAAAAGCAGCAATCATTGAGTTTA
TTAGAACAAGAAAAATGTGCAATCAATGAAAAGCTTATCAAAACGCAATTTGAACTGCAATCGGTTGAGTCGGAATTGGA
TCGCATTAAAAAGGAGTCGTCCAATCGTCAGGAGCAAGACAAACAGAACATTGCCGGCTTGTCGAGTGAACTCAAATCAT
TTAGATCTCAATTTGAGGATAAATGCCAAAATCACGAAATGGAAGTTAAAAGCCTAAATAGTGGAATCAAGGATCTAACA
TTAATGAAAGATCAAGCTCTCAAAGAAGTCCATGATTTGCATACCGGATTAAAAATAGCTGAAGAAACCCGTGATAATTT
GCGTCGGGAAATCATGGAAATGAATCGGAAATTGAAAGAAGCTGAGGAAGCCAAAGAGCACTTAAAGCGTGAAATTAATG
AATTGAAACGTGGATTATGCGAAGAACAAAGGGAAAAAGAAAATGTTATTAACTCAAATGAGAATTTGAGAAAGAAAATT
AAAGATGTTGAAACAGAAAGAATTGATTTGCACAGACAAGTAACGGATTCCAAACAAAAGGTTGCAGTACAAGATGAACA
ATTGGTCAATTCCAAACAAGAGGTCAATGAGTTAAGAAACAATCTTAAAGACGTAGAAAAAGCTCGATTAGATGTCAAAA
GAGAGTTACAAGAACTCAGACGCCATATCAAAGAGCTAGATACGGAAAGGGGCAAATTGACTAAAGAAGTCAATGATTTG
CAAACTCGTGTTGCTAGAGATGAAGAAAAAGAGGATGAAGCTCGTCGGGAAAATTTCGGTCTCAAACAAAAAGTTGTTGA
AACGGAAGCTTCAAGAGAAGCCGTTCGTAAAGATCTTGCTAATGCTCAACGACATATTGTTGATTTGGAAAATGTTCTGC
AGAGCAAAGACAGAGATTTCAGTTCCATGGTGGAATCGAGCCGCCGGGATTATAGGAAACTTGCTGATGCGAGAAATAGC
CTGCAACAAGTATATGATACGATGGTGGCCGATAATAATGAGCTGAGAATTGCTCTCAGTGGAGCAGAAGGTCGGGTCAG
TGCTCTGGAGTCACACATCGCACGAGTTGAAGGAGCTAAGAAAGAAATTGAATTCAAATTGGCTTCTATCCATAGCTCAT
TGCGAAGGCTGATAGGATTCCGACAGGAGAATGTAGTTACTATTCGGTCGAGAAACAACTCCAAATCTCCAGTTAGAGGT
CGATCAGTTAGTCCTCTTAGAAGTAGGCCGGTGTCGCCAACCAAAGGATTTGACAATACCTATGCTACTACAACTGATGG
AAAAGGTAGCCCTATCCCGCGCACAGGGTCTCCGAGTTCTAAACGAAGGCAATTATCAAGATCTCCGTCTAATTGCGATT
TCAATCCAGTCGATATAAATCCAGAAGCAGTTCGTCTGGCCTTGCGAGAATTCGTACAGCAGTTGGTTGATGCTGAACGA
GATAGAGATGACGCTTTTGCTCAAGCTCGCAGCCTAGAATCTCGATTGAAAGAACAAGAAGAACAAAATGAATATGCTGA
AAACCGTTTACAACAACTACAACAAGCTCTGTGTGATGCAGAAGAAGACAAAAAAGGCATTGATGGAAGATTGTCATCAG
CCCAAACTGCCTTAATGATGCAAGAAGAGACTATTCGGCGCAATGAGAGAGATAGAAAAGCAATGGCGGAAAAGTTGAGT
AATTACGATAGAACATTTGCATCCATGGAATCAGAAAAACGACAATTGGAAGATCGGTTGAATAAATTCCGTCATCATGA
TGCCCGATTGGAAGAAGAACATAAGCAGAGCAAAAAAGCTATTGAAAATGCTGAAAATAGAATAACTCAGCTTCAGCTTG
CCAAGCGATCGTTAGAAGGAGATCTTCAAAGAATGAAAATGGCGTTGACAGATAAAGAAACAGAAACCGAAGTTTTGGAT
GACCGCGTAAATAGTTTACTCAAACAAATACAAGATCTCGAGGGAAAATCTCAATCACTTCAACTAACGATTGACAGAAT
GAGTGTCGCCCTTGCAAAAACTGAGGAAGAAGGCAGTTTTCATAAGGACAAAATGCAACAGTTGAATATGAGTTTGAGCA
CTCATTCACAACAACTGGAACAATTACAGAATAAGATTTCTCAATTACAAAAAGCACTCGGCAGTTCAGAACAAGATCGT
CGGCTCTTAGAGGAACGATTAGAAAGCTCTAAAGGAGCATTGCATGAGGCAAAACATCAAAATAATTTGTTGATGGAAAG
AATACAAATAATTCAATCCGATTTAAATGATTCGGAAAATCGTCGATCAGAATTGGAAGGATTAAATCGACAGAGTAACA
CTTTGATTGTACAAAGACAAGAAGCTGAACAAGAACTCAATCAAAAATATCAGAAATTGAACTCGGAGAAAAACACATTA
CAAGAGCGAGTGAATAGCATGCAACGAAATTTGGCTTTGGCAGAAGCAGAAAAACAAGAAATAATAAAAAACCACGGAAA
ATTGGAAAAGGATAGATCTGCCTTGAAAAAGAGTCTTGGAAAAGTTGAACGTCAGAAATTGAAAACCGAAGAAATTGCTA
GCAAAACTGTTTTTGAACGTTCAGAATTAGATCAAATTTTAAGGAGACTTGAAGATGAAAATTGTGAATTACAGAGACAA
GTTGGAATTCTTCAAAATCAATTAGCAGAAGCTGAGCAAGCTCACTGCCACCATTTGATGGAAATCAATTCCCGCCATCG
CCAGGAAATGTCCATGGAAATGGAGCATTTGAGAGCATCGAATGTTCAAATAGAACGAACTCTAGAAGGCAGAGAACGAG
CCCACAGACAAAGAGTTAAGGGTCTGGAAGAACAGATCTCCACCCTCAAAGACCAGCTGACTCATGAAATGCAGAGGCGG
ATGGATAGTGGATATTACGAGTCTACCAGAAAGTCTAATCAATACGATTCAACTGGTGACTTGCGACATGTTCTGGATTC
CAGTTTAACTCGAGTTGCAAAAGACCCTCAACTGGACGCAATGCTACTGGAAACCGAAGCCAGGCGACTCGATGAGTCGA
TATTCATGTGTGGCAGTCGTGATCAGTCTCCGACCCGGCAGAAGCGAATCGAAATGTCAAAGAAGTCCGCAGCCCCTAAC
AATTCCAATCGGCGATTAACTGCCGGCCGTCGCAAATGAACTCGGCCTGTTCCAGTCCGTCCAGAGATGTTATGAAGCCA
CTTTTTAGATGCGTGAGTGTGAGTTCGTGTTGGTGACTGATTCATTTTTAGTAAACAGATTCTGGATTTTTGTTTTTATT
GATAGTGTAATTTCCTAATGCAGATCTGATAGTTGACTTGTTGTTCTTACGTATTCGGTATTTGTGATTCACATAGTCTG
TCATTGTTACTGTGATTTATCCTCTGTGTGACTTTTGTGATTTACTTACTTTATTGCCCCTATAATCAATAAATGGATTT
ATCGATAGTTCAGCCCTCCCCTCCAGCCCTCGTTTTGGGATCCGTAAATTTTGTTTCAATTGAGATCATTATAGTGATTT
TATTCCTTCGAAACCAAACCTTTGGGAGGGACATAAAATTAAATTATTGATTTTTTATTATCTTAGAAGTGAAAGATGTT
TATTTCCCAAATTAACTAATATCAATAATAACTTTAATTTATATCTTCATTA
>SMED30028196 ID=SMED30028196|Name=POU domain protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1170bp
GTATTTAGTAATTTAAAAATAACCTATTTATATTATTGATTAACATAATATAAATATTTAACATCTATAAGATTTCATGA
ATTATTACTACCAATAATTTTTTTAAACTTAAAACACTTGATAAGTATCATGAAATGTTTTTTATTTCCTATTGAATCTA
CAGAAAAGGATAAGTCTTGCACCTTTGTTCTGAAAGATATTAATGAAATTCGAATTTCTGTTCCTATAAAGATATCAGCA
AATAATGATTGTAATAAAACAATTAGCTTTTCTAATTCAGATTTAGAAACTTTAGCCAAAGAAATATCAGCTGCTTTTTC
TAGTAATACTATTGAAAAGAGTACAGAAATAAAAACACTGAATGATTTTATACTTAATCAAAACAAAGATCTTCAAAATT
ATATTAATCATGTTAATGATATACCTACTTTAGATGACTGTTTGCGAAGTAAAAATTTTATATTCAAAACCGAACAAGAT
TTAGAAAGTTTGCATAAAACTCCTTCGACGGCTAGCGAGCAAGAGTCATTAAATATACTATTGAATAAATCTTTGGTTTT
TGATCTGGATTTTATTAAGCAATTTACTAAAGAATTTAAACAATTTCGACAAAATTTAGGAGTAACCCAAATGGAAGTCG
GCCAGTCCATGAAATATTATTTGAAAAGTGATTTCAGTCAAACAACGATTTGTCGATTTGAGTCTATGACGCTGGCATCA
ACAAATATGTTTGAATTGATTCCATATTTCCGAAAATGGATATCCAAAGTATATAATCCCGACAGAACCAAGACAATTAA
AAATGTCATTTCTAAACTGGAATCAATTGACATTTCTCGAGCATTGGAAGACGAGTTTGCGAAAGATAAAACGGACAGCG
AGTCCAGCAATAACAGTAATGGTGATGAAATGGTAAATGTCAAAAGCAAAACTCGGAAACAACGAATCCAATTTACGAGA
TTTCAGTTGAAAAAAATGGAAAGTCTTTTTCAAACAGTCAAACATACGCAAATTACACCGCATGTTTACAAGAAATATGC
TAAAGAATTGAAATTGAGTGAGAAACAAATCCGATGTTGGTTTACTAAGCGCAGAAGGAGTGATAGAATGCACAAGAATA
AAATGAAAATGGAAAAATTTAATTTATAAATAAAATTATGAAAATTTACG
>SMED30010910 ID=SMED30010910|Name=POU domain protein|organism=Schmidtea mediterranea sexual|type=transcript|length=3203bp
TAGGGCTAAATGTAACGCTACTTATCGGTATTGCCACAATTATATTAAGGCAGTGGCACAAACTTATTTTCTCTACCAGG
CCTGCTGAATCGACAAACAAACATATTCATCGTCATTAAATGGGCAGTAGTAGTAGAAACACAGTGGTAAAGACATGGCA
AACACAGCAGCATCAGTGATAGCTGGAAGAGATAGCTACAGCATCAGCAGCAGTAACTCTCGCAGCTAATAATGAAGATA
ATGAGCTAGACTTAATTATCTTGGCTAATAATTTCAAATAAAATATCGCAACTAATTTTGTCATTCGTATTCTGTGAGGA
TAAATCACAAATTTGTTTCGATTGTTGGAAATTTAAATTTTTTTCCCTCGTATTTTCCAAATACTCCAGAGTTTGAAGAG
TATAATGAATTTGTTACCGAATCCGTTACTCACAAATGTGCTGGATATGACTAAACTTGACCAACAAAACCAAATTATCT
CGTGTGGCAATTCGACAAATTTCACCAACAAAAACACAATTGACAGCTCTTCAAATGATACCACACAAGTCAGTTCAACA
GCCAACAACATCAGTTCAATTGAACATTTCCTTTCATCCCGCAATTTAACAAATCAGCTGATAAATAATTCCGGACTCCC
ATTAGGGGCACAGATATTCACCATTCCGGCATCATTGGCGACATTCCCGAATTCGGATTTGATTCCAGTATTCATCAACA
GTTTAGGACAAATGGTTCTGGCAAATACTGGGAATATTCTGGCGAACAGTTTGGCAAGTTTGGCCACCACACTCACGTCA
ATCCAGCAGCTGTCCGTGAACCGTGAATCGAATGTCATCAACACTAATCAAACTACTAACCCAAATGCAGCTATCATAGA
GCACATGATGCAGCAATACCAACAGCTTCAGCTGCTGAAGAACTCAATGATCCATCAATCATGGCCGAATGAGTTCCAGC
AGACATCCTCAAACAACCAAACCAATTCATTTATTGCAAATAATATACCAGTAGCAACTACAAATTCTAGTACAATTAAA
CCCATAGATAAAGTTAATGGCAGTACGCAATTCCAAATTCCGTTGAATTGCAATCCTGCTCCTCTTCAAAATGAAAAATT
TACTACCAATATCATCTCCATAAATGATCGTGCTATAGATAACAAATCCCCAAGCGTCAACTCTTCGGTATCCTCTAGAT
CAGTAGGAAACAAAATTTGTCAAATGATTGACGTCAGTCATGATTACATTTTAAGTCAAGAAGATCATCTGGTGAAAGAA
AAAGCCGCAGAATTACTCCGACATTCACACAACCAAAAAAACGCTATCAAACATGCCCAATGTTCTGATAAATCAGAACC
AACAGCACATAATGTCACAGTGGATGGTGTTGATCTCGGTGAAATCAAAGAATTTGCCCGTAATTTCAAAATTAGACGTC
TCAGCATGGGGTTAACTCAAACACAAGTCGGTCAAGCGCTGACTGCAGCAGAAGGTCCGGCATACAGTCAAAGTGCAATC
TGCAGATTCGAAAAGTTGGATATCACACCGAAATCGGCTCAGAAAATTAAACCAATTCTAGAGAAATGGATCAAAGAATC
CGAAGAAAAATATCTCAGTGGATCGAACAGTGTTGATGATGGATCCGGATCTGACATCAATAAAAAACGGAAACGTCGAA
CGAGTTTTACACCACAAGCACTGGAAATTCTGAATATTCATTTTGAGAGGAAATCTCATCCGACTGGATCGGAAATGCGA
GCATTGGCTAACGACCTCAATTATGACAGAGAGGTCATTAGAGTTTGGTTTTGCAACAAAAGACAAGCGTTAAAGAATTC
TGCCAAGCGAATTAAACAATGTACACCAAACAGCGAATCAAACAACCAGCACATATCTCCCCAAGTCATGAACAGCAACA
GCAACAGCAACAACACCACCATCACCAACCGGGCAGTCACCTAGGCCAAATGCATCCATCCATGATGGACATGTATCAGC
CACACGCGTTCTCAAGACCCATTACTGCTGAATACCAACAGAGTCTCAATCGGCAACAATATCGACGCAGCGACAGCGAT
TGTGGAACTCATGAGCCTGGATATTCGTACCTGCCGACTCCTCATGGGCCAGAAGTGGTGTCATCTCGTCAACATACTCT
CAATAGTCTTCCAGAACAACCGATGGACAATAACAATCATGATCAGCATGATTCTCCAGTACCGATTATTGCCAACAGTA
GCAACAGTAACATCAACAATAACAACAGCAGTTCTGGTCGACATCATCATCGTCGCAAAACCAGATCTCGACAAACCAAT
AATCAAGAGCCGACATCACTAGAACGGAGCCAAGTAATGAAAAATCACAACGACATACCACCAATGTTAGCGCCACGGAC
AAAATTGCCGTATTCCGAGCATCAGGGAATTCATCGTCTATCCGCTCATGAAATGAATACCATTGACAGTCGTGACAATG
CTGTCAATGATTGCAATTCTGAATCCAATACCGCTGGCGCTGTCAGCGATAATTTCGACCCTCCTCTTCATACTCCGGCC
ATTACGATACCAATGAGTCGAAGTACCGCATGGATTGCAACATCGATATGAATGAAAATGAAGCAACTCCCAGTAATTCT
CTGTTGATTGAGAACCTTCCCAGAGTTAGAGATGTTTCCGAGTATGGAATACCTATAAACAATAACAATCACAACATGAA
ACAAGCTCCCGTGCCTCCTCTTAAATCGAATAGTCGACATAATCCTGTGCCTAACAACAGTTACGGTCTCGAGTGCAATC
CTGATTATTATTCATCTGCCACATCTAGTGACAGATCCGGTCCCAGTCCTCCCCCTAAATATGCGCCAGGAGTAGTTCTT
CCTGCCCGTGCTGATGAAATATATATGCGCGATCAAAGAGAAGGAATGTACTATCACGGAGATACTCATTGTTGATAATT
GTATTTCACAATTTCGTTTCATCGGGTGTTCTCGATTGCTGATACTCTATCTCATACCTTTCGATGAATTTCTGATCCCA
ACTGACAGTTGTACAATTCTTATCATCATCATCATCTTCCTCATCTTTTCATATTTTATCTAGTCCTACTTGCAATCTTC
TCCGTGTGCTCTCCACAGTGCGATTATTATTATAATAATAAATTATTGCTATTGATTATTATAATTATTGTTATTGATAA
TAA
>SMED30001958 ID=SMED30001958|Name=POU domain protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1820bp
GAAGATTTCAACCAATTTCATTGTTAAAATTTTCATAAAATCGCCGTAATTGGCTGTCCGTTGCGGCAGTGGCAGTCAGG
CAACTCCGTTCACTCAGCAGCCAATAAACTCGTTTGGAAATATTCCTACTCAAATCAAATTGATTTCTCATAAAAAAATT
TGCATATCTTCTCACTTTTTCTATATGCATTTCATTGTTACTTGGTGAAAACTGAATGCCATGACCCAAGTTAGTCACAT
AGGTTCCTCTCATTTCAATATTAATTCTTCAATCAAAACTGCTCTTCCTTTAATTAATTCTCAATACAATTCATTGGTAA
CCGAAACATCTATTGGTTCCAACATCAACCTACCGTTTCGACTCGATGCTCCATCTCTATTCAATGGGCTACCGGAAGAA
TGGGGTCCCACTGACAGCGAGTTAACTCAAGCGGTCAATCATGTAAATTACGCCGGATTATCCGAGTCGAGCATTGATTA
CAAGTTTTGCAGCACTCTCAATTCTTATTTTGACTCAAATCAAAGATTTGGAAATGTACCAAACGACACGTATTTAATGG
CAAATTCCATGGCAGCCAACATTGAGAACAATAGCTGGCATAACAGCCGATATTACTTCGACAGTAATCATCCTCTCAGC
CAATGGCTCCCGGTGCCCGTTAACTGTTGGTCCAATAACAATTACATTCGCGATGACTTTTACGAGAAATCTCTCCAGGA
AGATGAGTTCAAATCCCGCTCGGTAATACAAGCAACTGAGAAGAATTCCAATCCGGTAAATCCCGACCTGAATCCTTACA
AATCTATCATTTCCGATGAATCAGAAAGCATGAAAATGGCTAAAACCTCCCACAACCTTATAAATAATGACTCGATGAAT
ATGTGTAGATTTCCTCAAAATGATATTATTATGCCAGATTTAATAAATGCCCCAAGTCCATCACTGACAAATAATAATAA
TAATAATAAAGTAATAAATAATTATTATATAATGAAAATTAATATATTAATAAAAAATATTTATGCACGGTCTCAATTTA
CATCTAAATGCCATCAAATTTGGCAGGGATACTTCTAATATAAAACCTAGATCAGCTGAAAGACTTTTATATTAGATAAA
TAATCGTTAATAAATAAAACCCAATTTGCGATAAATTATGTGTGGCCTCCAGGCGGTTCCTATCAAATAAACATATGTAA
TTATACGTGTAAACACGTGCATTAAATATCTTCACAAAGTCAAATGAGTTGATTGGACAGAAAAATTAGAATCGGAACTA
ATTCTGCAATCATTCAAAAATTTGAGCTAATCTTTATTCTTTAAAAAGCAGAGAATCAGCGGTTCTTTACATTCATGCCA
GTAATGAAAAAAGTAAACCGCAAATGACTTTTATTACTGTTCTAGTAAATGCATCCCCATAAGGAGAGTAATTCACATAA
AACTTTAATTGTCAATAAAATTATTACTGGGACATCAGCGCATCCTGGCATGCACCGCAGCAATGAAAAAGTAGACCGAG
AAACTCTGAGATTATTGAGCCATCAAACGTATCACTCATTTTCTTATGTTTGAATAAAATATTTACAAATTTTAATACAG
AGATAATCGATGGAGGAGGAACACTACTATTTTTGCTATCTATAGCAATCAATAATTATGTGAAAATATAGCTGATCAAA
ACAAGATGCATTAAAACAATTTTACTTCCTATTATATACGTTTTTGAATCCTGAGTGAAGCCAGTCGGGTTAACGAATAT
TATTAAAATGAAAATAACTATAAATCAATAACTATACCTCATCACATGATGAATGGTCCA
>SMED30015552 ID=SMED30015552|Name=POU domain protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1696bp
TTATTTTTAAAGTGTATCTTAATATTTCAAGAAACTGTATTATAAATTTCACAAATTAAAATATTTGGGATATTTGTAAA
TTGTTAATAACTCTTCATAAATGTCTCAATCAGATGGAAATTTCAACTCCTTTAAAAATATTCACATTGAACAGTTATTT
AAAATTATTCAACACCAAGCAGAACAAATTGAAGCACAAAAAGTTCAAATAAACGCTTTAATAAAGTCACAGCAAACGAT
ACTAGAAAGTATGAGACCTCAAAATGATGCAAGCGTCAATTTAAATCCTTTGTCAATGAATTACCTTAATCACAATATCC
GACAATCTTTGTTGAATTCTTCCTTAATGCCTTCAAAAAATATTTTAAACAATCCCTCATTAAATTGTGCTAGCAACAGC
AACAGTAACAGCAGCAACGTCATCATCAACAACAACAACAGCAATATTGATGTTTCAGACCATTTTCTTCAAGACTACAA
TAGTCGATTAACACAACAAATTCTTCTTCAGCCTTCCTTGAATATTCCTCGCTCAAATCCCACAATAAAATCCCCTCATT
TGCCAACGAATATTGGAGGCTCAGGAAATCTAACTCCCACAACTTGTCTTAGCAACGAAACATCTGAATTGAGACCCATG
GAAAATTGGTCCAATTTTAAGTTGCAAGCTCATTCCGATACTCAAAACGTAATCAAAAAAGAAGTAGCAGATCAATCAGA
CAATTGTAACAATTCTGAAATTCCAATTATCGAAAATGATCCAAATGAAGATGAAGGAGAAATGGATTTGTCATCTCTCC
AAGAGTTCGCCGCAAAATTTAAAATGAGTCGTATTGAAATGGGATTCACGCAAAGAGATGTCGGTGTTTGTTTGGGTTTG
ATGCAGGGCAACGATTTTAGCCAGACCACACTGAGTCGGTTTGAAGCTTTAAATCTGAGTTATAGGAATATGAAGAAACT
GCAACCGTTGCTACAAAGGTGGCTGGATGATATTCAACGAGAAGGTCGTGATGCCGTTATGAGTCGCATAACGGCTTTTT
ATCAACAACAAAAAGCGATGGTGGAGGAAGACTGTGATAACAATGACCTCCAAATAGTCAGTGGCTCAAGTAGGAAAAGA
ATTGCAAATGAAGGATTGCTAATATCCGACGAGTTACCCGAAGAACGACATTCAGTCAATGCAGATTCGACTACTATGAA
TTCCAAATTATCACAAAATCAATTACTTCGCACTTGTATAGGAAATATATCGAATAGTCTTTCACCTAGTCTGCTCGGCA
ATTTGACTAATGGGTTTTCTACAAGTCTTTCCACCTCGCTCCCAACTAACCTCACTCACAGTTTTCCGAATATTCAGTTT
CAATCTTCATTACTCCACGACCAAATCGCCAACGGATTCAACAGAAATCTTTCTTCCCAACCAAAAAAACGACGTAAACG
ACCTCTAATATTGGAAGAAGGCAAATCAAGATCGGAATTGTTTCCCGATATTTTGAGACCGTAATCAGACCGGTGGAAAA
GAATCAAAAAAACAACACAAGTTCTACGGCTATTTTATTTATTTTCGCCATTTCTCGCATTGTAATATTTTGTAATTATT
AATATCCTATCTATTGTTTTATAAAATCATATTTTTTTCAAATTGAATTTTTTATTATTTTTCATTTTTATTGACCTGGT
TTGTGAGTGTTCGGAA
>SMED30002016 ID=SMED30002016|Name=POU domain protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1339bp
GTTGAATTTTTCAAAAACCAAATTTACTTATTTTGAATTGCCATAATGGAAAATGGAGTTGCAACAAGCTGTTCACTTCT
AGCTAATGGTGGATATCATAACTCTGCCTCCGTCGGTTGGAGGTTTCCGCAGAACAATTCAGCCAGCGATTCCGTTGAGA
ACGAATTTATATCAAATGCAAATCTCAAAATTACCTCTTCGAATATTCCAAACTTTTTTTACCAATGTCCGGAAAACAGT
CAATCAACGAGCAATTCTAACGGATTTTATTCAGTGGATACGAATTGCTCGGCTGGATTCCAAGACATGAATACTTACTA
TTCAAGGGTTGCAGCAGGCTTCAATCAATCCTTCGACTTGATACCTCAACACCAGTCTTTTGTGAGGCTCAATTCAACTG
GGCTATCGGAAACTGACCAAATGACTTATATAAATCCAAATCTTCATAGTTCATTTCATCGAAATATTTCATATCCGAAT
TACGGTAGTAACTGTCCTCCTAATGTTAACATAGGAGGAGTTTCCATGGTTCAAGGGTCTTCGTCATCCTTTTTAGGCTC
CAATTATTCAGGCATGCAACAACCAATTCAAGCCGTGAATCAAGGTGACATTGAATATGAAACCCGAGAATTAGAAGCTT
TTGCTGAATGGTTTAAACAAAGAAGAATAAAACTGAGAGTGACTCAGGCGGATGTTGGCCGAGCTCTCGGGAATTTAAAA
TTAGCCGGTGTTGGATCATTGAGTCAATCAACAATTTGTCGGTTTGAATCACTAACTCTCAGTCATAACAATATGATTGC
TCTTAAGCCAGTTTTGCAAACCTGGCTCGAAGACGCTGAAACCGAAGCTAAGGAAAGATTAAATGGCTCTGATGCTTTCT
CTGACATAGATGAAAGAAAACGCAAACGAACTTCAATCACAGATTCAGAAAAACGATCACTGGAAGCATTTTTTACGATT
CAACCACGCCCATCAAGCGAGAAAATTATCCAAATTGCGGAGAAATTGAATTTGAAGAAAAACGTTGTTCGAGTATGGTT
TTGTAATCAGCGCCAAAAACAGAAACGAATGAAGTTTTCCACTCTCGGTTTTCAGCACAACTCGTCAAACATGTGAAATC
CTATTTCTGTACAGGACAAATACCAAGCATTGACCCCTCTGTCTTATTACAAAAAGTGGTATGATTAAAAGTAGAATAAA
AATGATTTTTATTATTTCTTGACCGTAGCTTTTGTTTAAATTGTTTGACTTCATTTTTACGAAACTGTTATTTTTCCCAC
TGGACTGAGTCTTAGGTTCAAATGTGAGATTTGAGGTTGAGCTTTTGCTGAGAATGACA
>SMED30030379 ID=SMED30030379|Name=POU domain protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1625bp
AATTAGCTATGCGAGCTGCTTTATCAGGCATGACTGTGATAAAACTGTCATTATTTATGCGCATAATTTGCCGTTAGTAT
TTGCTCAACCAATTTGACGTTCAACAACAACAGCAACAACATCCACCACCTCCACCAACATCCTCATTATCATTATTATT
ATTGTCATGTTAACAAGCGGACTTAATCAGGAACAATCATCGCCTTTAACAATCGTAGGCATGAGTGAGTCTCAGTTTTT
CAACGAATCTATCAGATATTTGCCTCCGGAAACCGTGGAGAGACAAAGCCAATTTTATGCAAATAATAATTATCCCCTTG
GTGAGTTTTGGAATCCACAATCCGAATATGCACAATACTTGCAAAATACCCAGCCAGTCTCGGGGCCTCAATTCATTACT
TCGCCGGCGGTTGGAGAGGCATTCTATCCATCTCTTTATATCAATACTATCCATGAAAATGTATTACTACCTTCGGTTGA
TTCCTTCAATCCTCCCAGTGGATTTATGATTTCGGGATATTCACAGCAAGACCAAACCTTTCCCACGGTCAATGAACCGA
CGTATGACAATATCCCAAACAATTGGAATTATGTTGATCATTGGGTTGATTCCAAGCCAACAACAGTGAATTCTCAGCTG
TTGCCAACCTCGTCAATTTCCGCCGTCCCCATTCAGAATTCGTTTTGGGACTGCGAGTCGATTGACCAATCAGAATATTG
TCCCACAAATGTTGATACCGAGCTCCAAGATCAAATTGATTCCAACGGAGAAATCAGTAGACTCAATCAAAAGATTTCTA
CTGACGAGTTGGAGCAGTTTGCGAAAATTTTCAAACAGCGAAGAATCAAACTCGGATTTACACAAGCCGACGTCGGGTTA
GCCCTCGGTAATTTATACGGCAGCGTGTTCAGTCAAACAACAATTTGCCGGTTTGAGGCACTGCAGCTCAGTTTTAAAAA
CATGTGCAAACTTCGACCTCTGTTAGGGAAGTGGTTGCAAGAAGCCGACTCAACCGGATGTGCTCCGTCCGGTATTGACA
AAGTCACAGCTGCTGGACGAAAACGAAAAAAGCGAACCAGCATTGAGGTTGGAGTGAAAAATGCACTGGAATCTCACTTT
TCTCGACAAAGCAAACCGACAGCCCAAATCATTACACAGCTTGCAGACAGTCTCGGATTGGAAAAAGAAGTTGTCAGGGT
ATGGTTCTGTAATCGGCGACAGAAGGAAAAACGAATGACGCCTCCGCCACTGAATGGAACAAGCTCAGATTTATTTCCAC
ATCCTGGTTTAACTGTCGGAACTGATAGTTCTCCTCATTCCTCATCTCACAGTAATCATGATTCATTCTCGTCCATTGGT
AACCAGTCAAGCTTCAATCGAATAGGTGATCCCTCCTCGACTCATCCCGGAGTCATTGTCACATCTTGCGGTTATTACTA
TGGTCATGTTCCAAATGAATCACTTCTCAATTGTGGGCCTTACCCTCACAACATCATCAACAATTACGAATTCAGACAGT
CCAATGATCCCAATATCCTCAATGTCAAATCCGAGTGCATCAGCTGACTCATGTCGAACTCACCGAAAAGAAAGCTAATA
ATATTCTATTTCAATAATAATAAAA
>SMED30008552 ID=SMED30008552|Name=Carbonic anhydrase 7|organism=Schmidtea mediterranea sexual|type=transcript|length=911bp
CCGATCTAAATAATTTAATTCAATAAATAATTTCAACTAAAGTTTTTATGATTTCTGAAGATTGGGGATATGGACCTGAG
AACGGTCCACATTTATGGCACAAATCGTATTCCAGTGCGGGAGGATGTTCCCAATCTCCTATCAATATAGATCTTTCACA
GACAAAATACGATATGACTTTAAATTTACATCCTTTAAAAATATGCATTGATAGTTCGAGGACATCAAGTCAGACTTTGG
TATTTACAGGACATAATTTCCGAATCGACTGTGAAGGAGCACTATGCGCATCGGGAGGCCCAATTCCCTATGGTCAAATG
TACAAAATTTCCCAAATTGTGTTTCATTGGGGCAGTACAATTTATGGAGGATCTGAACATTTGATAAATTGTTTTCAATT
CCCATGTGAATGCCAAATGACCTGCTACAATGCCACTCGTTATAGGTGCTTCAATGAGGCGGTAAATAAAAGAGATGGGC
TAATTATCCTATCTACAATGATATTGGGAACAAAAATAAAACCCTCGATCGTTTATTGGGTCCTTTGACGTCGATTCACT
TTTTCAAACACCATGACTTCCGGCAAGAAACCGAACTGTTAGATTTGAAATGTCTTTTACCAGATTGCATCAATCGATAC
TTCACCTACACTGGGTCATTGACTACCCCACCTTGCTATGAAACTGTTACGTGGATCATATTCGAAGGATCCAACACAAT
CAGTGAGGATCAACTAAATCTCATGCAGAAAGTTCACGTAGCCGACGGCTGTAATGGCTTTGACAACTTCAGACCGGTTT
GCTCACTCGGCCAAAGAATCATTACCAGAAATTTTGTTTGAGCCTTTTTTGAACTTGATTTATTTAAATTTTATTTTTTT
AATTGCTACTGTAGTGGATGTTATGGGGAAT
>SMED30021661 ID=SMED30021661|Name=Carbonic anhydrase 7|organism=Schmidtea mediterranea sexual|type=transcript|length=1073bp
CATACATATATATATATATATATTGAGACTATTCATTTTTTTCCATACAAAATTCAAACAAAATGAAACCATTTCTATTT
CTATTTTTATTTCTTGTCTCATCTCTTGATCTGAAGATCACCGAGGCTTCAGGCACCGGAAATTGGGGCTATACGTCAAC
CAGTGACATCAAAGGCCCCTCGGACTGGAAAGACATTAATCCAACTTGCGACGGAGCTCGGCAATCACCGATTGATATCG
TGACAAGAAGTGCGGTTTATTTGAAAGATTTACAAAGGATTGAAATTAAAAAAATTGACAACTTTGCTAACTTTTCCACT
CTCGAAAGACATGAAACCTCTATTTACTTAAAGCTTAATAACAGTTGGGGAATCACTTTCGGAGGAAATCAATGCCTAAG
ACCTGACTCCATTCATTGGCATTGGGGATCCAAGGGTACTTTAGGATCGGAACACTCTCTAGATGGGAAGCATTATCCAA
TAGAAGGCCATCTGTTGTCATATAATTGTATGAAATACAGTTCTTTGAATGAAGCAAAATCGAGTCCGGAAGGTCTTTAT
GTAATTGGTATTTTTTATAAAATCGGAAAAAAAAATATGTTAATTGACAAAATTATCCCGGCAATGCAAAGTCTGATTTC
CAGTAGTGATATCTCGAGCGTGATCATTAACGAGATTTCGGTGGAGGAAATTCTACCGAAAAATTTGGACAAGTATTATC
AATATGACGGCTCATTGACGACCCCTCCATGTACAGAAAACGTCAGGTGGACAGTGCTAAATGAAGAGCTAACTATAGAT
GAATCTCAATTGGAAGTTTTTCGCCAATTCGACTTCGAATCTCCCAATTCTGGGGAAATGGAGAACAATTTCCGACCAAT
CTTATCAAAGTTCAATGAAAAACGAACAATATATTCCTCATTCAAAACGGGGTCCAGTTAGACAATCTTATTATGGGTGC
TTTGTGCAATCTTCATGTGCCTGAATAGTCGATAATATGATGTTCATAACACTCAAATAGCACATTTAATTCATTTTGAT
TAACACTATTTTTCATTTCATTTATGTCAATTA
>SMED30021108 ID=SMED30021108|Name=POU domain protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1667bp
TTCTGGATTACGAATAGCCTATTGCAATTAATAACCGAGTTTTTTTCAAGATTGTCCTACAATGATCATTAAATAAAAAT
AATCCACATGAGTATATCAGAAAATAATAAAGAAAAAGATATTATTTACGGCTTGGAAGCAAAGCATATTGTAGATTTCA
ATGTTGCATCTCATTTAGATGAAGAACAAGACGCAATTTCAAAATCTATTGGGCGCAACCAAAAAACTGATAAACACTCT
CAGTCGTTAAATGGGAAAACTCCCAATGAACCACTGGATCACAATTCATATATCAAAGCCTATAACGATGCGCTGTTTGA
ACAGCGGACTAATTTCAATGGTTTGAATTCAGATTTAAGCTATTCATTTTTATCTCAGTATGGCTATAATAATGATGAAA
GAATGGATTTTACACCGTATTCTTTGCCAATTGATATGATTGAACAATCTTATAATTCCTGGTCTAAATCTAACGCATGC
ACATTTACAGAGGCGCATCTAAATTCACCTTGGTACAATCATTATCCGTATCCAGGATATGCATCATATAATTCTTATAT
GTGTAATATTCCACCGGTTGCAACTTCATCTATCAATGATCAATCTAATATGAGTTTTCCTAATCATCCAGCATTCTCAG
ATCTGGAAGAGTATGAACAATTAAAACAATTCCAAGCAAGTAATTATTCTGTATTTCCACAAGATTCTTTTTTAAATCAT
TCAATATCAACTCTAATGCCTCCGTTAAGGAATTCTCAAAGCACCACCCCTTTCAACTCAATCAATCCATCATCTCATTG
GTTGGATGTTAAAAATTGGCCGAAATCTGCCTCTCAATCAGATCAATTCGATCAAAATTCATTGAAACGTCAAATTGATC
ATTTTCCTTTGAATATCCCAACGGCGTTTTCTTATCAATCATCCAACTCAATGTCCCTACTCGGCTCTCAACAGCCAGAA
ATCAGTAAAGATCTCTTTTTGTCCGATTCCATAATTGAAAATTCAAAACTAAGCACGATGGACTGTCGAGAATTGGAACA
ATTTGCCAAGACTTTCAAACAAAGACGAATCAAGCTAGGATTTACTCAGGCTGATGTCGGTCTGGCGTTGGGTACGTTAT
ACGGGAACGTATTCAGTCAAACCACAATTTGCCGATTTGAAGCATTACAGTTAAGCTTTAAGAACATGAACAAGTTGCGA
CCGTTATTAAGCAAATGGTTAGAAGAGGCTGATTTGTCCTTGTCAAACACAGTCGTGAATGTAGAGAAATTAGCGAACCA
AAATCGACAAAGAAAGAAAAGAACAAATATAGAAATGAATACCAAAGATATATTGGAATCAAGTTTCAATAAAGATCCAA
AACCAACTGCTGCTCATATTATATCATTGTCAGAGAGAATTTTAATGGATAAAGAAGTAGTTCGGGTTTGGTTTTGTAAT
AGAAGACAGAAAGAAAAAAAATCCAGTTTAACCAAATCTATTTCCAGTAGTTAATACAATCTTTCCAAAAAGAAATTCTT
TTACAGATTCGACGTTTTATTATGGAAATGGTGTGAATAAATAATTTCTTCCCATAAATTTTGCCGGTTTTCTAGCTTGT
ACAGATAAAGAAAAATACCCGTTTTTACATTTTCCTAAACTTAAAATATTCAACATTAATTTTGAAC

 

back to top



PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in protonephridia. Click this link to learn more about PAGE.


PAGE Curations: 1583


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
protonephridiaSMED30012419Non-specific serine/threonine protein kinaseSMESG000069962.1 SMESG000069953.1 SMESG000069952.1 dd_Smed_v4_3244_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010935Katanin p80 WD40 repeat-containing subunit B1SMESG000068822.1 dd_Smed_v4_5495_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009973mxi-1 proteinSMESG000047681.1 SMESG000016277.1 dd_Smed_v4_4415_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019361SMED30019361SMESG000026071.1 dd_Smed_v4_7785_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013161SMED30013161SMESG000051379.1 dd_Smed_v4_2630_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013820slc24a-2SMESG000022802.1 dd_Smed_v4_9904_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015945Centrin-1SMESG000052182.1 SMESG000015458.1 dd_Smed_v4_3644_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017219Guanylate cyclaseSMESG000039747.1 dd_Smed_v4_7619_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017099SMED30017099SMESG000030373.1 dd_Smed_v4_595_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014219cilia- and flagella-associated protein 99SMESG000025927.1 dd_Smed_v4_8538_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005553Thioredoxin domain-containing protein 3-likeSMESG000043677.1 dd_Smed_v4_8401_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005553Thioredoxin domain-containing protein 3-likeSMESG000043677.1 dd_Smed_v4_8026_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED300163635'-nucleotidase proteinSMESG000032250.1 dd_Smed_v4_3474_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018369Phosphatidylinositol 3,4,5-trisphosphate 3-phosphatase and dual-specificity protein phosphatase PTENSMESG000072902.1 dd_Smed_v4_7478_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007598Centaurin-gamma-1ASMESG000069229.1 dd_Smed_v4_5984_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017841Sorting nexin-2SMESG000016192.1 dd_Smed_v4_835_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021511SMED30021511SMESG000038232.1 SMESG000010788.1 dd_Smed_v4_759_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028521Cadmium metallothionein (MT-Cd) (Cd-MT)SMESG000013781.1 dd_Smed_v4_3412_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027199PalmitoyltransferaseSMESG000033660.1 dd_Smed_v4_7720_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021641SMED30021641SMESG000040565.1 dd_Smed_v4_4660_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022710dual specificity protein kinase CLK2SMESG000071751.1 dd_Smed_v4_6141_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025157SMED30025157SMESG000061841.1 dd_Smed_v4_6425_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025300SMED30025300SMESG000019783.1 SMESG000019789.1 dd_Smed_v4_4438_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024661SMED30024661SMESG000060548.1 dd_Smed_v4_8385_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024040Sesquipedalian-1SMESG000053122.1 dd_Smed_v4_5038_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024930slc15a-2SMESG000011953.1 dd_Smed_v4_8983_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021890SMED30021890SMESG000067520.1 dd_Smed_v4_5272_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020269MyophilinSMESG000081505.1 SMESG000049198.1 SMESG000047694.1 SMESG000035451.1 SMESG000035348.1 dd_Smed_v4_395_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022974slc17a-5SMESG000060615.1 dd_Smed_v4_4910_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028254Polyglutamine-binding protein 1SMESG000040247.1 dd_Smed_v4_3489_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024394Dynein light chainSMESG000005286.1 dd_Smed_v4_898_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020268Dynamin-type G domain-containing proteinSMESG000014756.1 SMESG000014755.1 dd_Smed_v4_2390_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026316Actin-related protein 2/3 complex subunit 5SMESG000023170.1 dd_Smed_v4_781_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025100TNF receptor-associated factorSMESG000015041.1 dd_Smed_v4_6890_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021145SMED30021145SMESG000023086.1 dd_Smed_v4_6287_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30029463Outer dense fiber protein 3SMESG000019620.1 dd_Smed_v4_8903_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004318Triadin-like isoform X4SMESG000025109.1 dd_Smed_v4_13778_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011615SMED30011615SMESG000036524.1 dd_Smed_v4_11034_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010702Serine/threonine-protein kinase B-rafSMESG000064517.1 dd_Smed_v4_13233_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004959SMED30004959SMESG000046821.1 dd_Smed_v4_14435_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015041Retinoic acid receptor betaSMESG000054304.1 dd_Smed_v4_8796_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009218Receptor expression-enhancing proteinSMESG000036637.1 dd_Smed_v4_1995_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008456Type I inositol-1,4,5-trisphosphate 5-phosphataseSMESG000074184.1 dd_Smed_v4_7958_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006365SMED30006365SMESG000006920.1 dd_Smed_v4_9417_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011335Dynein heavy chain 10, axonemalSMESG000051829.1 dd_Smed_v4_5169_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011335Dynein heavy chain 10, axonemalSMESG000051829.1 dd_Smed_v4_12797_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3000283128S ribosomal protein S10 mitochondrialSMESG000041503.1 dd_Smed_v4_2220_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006714SMED30006714SMESG000001790.1 dd_Smed_v4_212_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004112Dynein heavy chain 5, axonemalSMESG000012967.1 dd_Smed_v4_4113_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008856SMED30008856SMESG000025888.1 dd_Smed_v4_1422_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001402Plastin 3SMESG000007726.1 dd_Smed_v4_15254_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021960AminopeptidaseSMESG000067986.1 dd_Smed_v4_2224_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035746Glycerol-3-phosphate dehydrogenase [NAD( )]SMESG000015312.1 dd_Smed_v4_2565_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011134SMED30011134SMESG000063657.1 dd_Smed_v4_10132_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002742DystoninSMESG000043809.1 SMESG000043799.1 dd_Smed_v4_1205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019396LsmAD domain-containing proteinSMESG000036673.1 dd_Smed_v4_11128_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011027Dynein axonemal assembly factor 4SMESG000052823.1 dd_Smed_v4_12396_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001601Zinc finger-like proteinSMESG000026829.1 dd_Smed_v4_2946_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001419Xaa-Pro dipeptidaseSMESG000012999.1 dd_Smed_v4_1297_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001853Protein kinase domain-containing proteinSMESG000003859.1 dd_Smed_v4_1897_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006125C2H2-type domain-containing proteinSMESG000020158.1 dd_Smed_v4_14413_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019258Cytosolic carboxypeptidase 2SMESG000058240.1 dd_Smed_v4_13450_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004594Dynamin 2SMESG000027378.1 SMESG000027377.1 dd_Smed_v4_2583_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006886SMED30006886SMESG000024489.1 dd_Smed_v4_5366_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007209serine/threonine-protein kinase DCLK1SMESG000078466.1 SMESG000050786.1 SMESG000024968.1 dd_Smed_v4_3128_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012954centriolinSMESG000006866.1 dd_Smed_v4_10369_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009968Intraflagellar transport protein 122 homologSMESG000039305.1 SMESG000039304.1 dd_Smed_v4_11912_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009279DystoninSMESG000043809.1 SMESG000043799.1 dd_Smed_v4_1205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017231NEPH-3SMESG000022777.1 dd_Smed_v4_11280_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018972ANK_REP_REGION domain-containing proteinSMESG000022931.1 dd_Smed_v4_11187_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3000448460S ribosomal protein L8SMESG000017087.1 dd_Smed_v4_108_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034880Discoidin domain-containing receptor 2SMESG000067438.1 dd_Smed_v4_10406_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021270ANK_REP_REGION domain-containing proteinSMESG000057916.1 SMESG000057915.1 dd_Smed_v4_15179_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020571Tubulin monoglycylase TTLL3SMESG000062155.1 dd_Smed_v4_12717_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025062G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000018450.1 dd_Smed_v4_1699_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033791cilia- and flagella-associated protein 161SMESG000028972.1 dd_Smed_v4_8229_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021404ALMS_motif domain-containing proteinSMESG000077136.1 dd_Smed_v4_5064_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032456Aldehyde dehydrogenase,putativeSMESG000001708.1 dd_Smed_v4_400_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035594Tau tubulin kinase 1aSMESG000046962.1 SMESG000046951.1 SMESG000040592.1 SMESG000034034.1 dd_Smed_v4_489_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026901SMED30026901SMESG000013006.1 dd_Smed_v4_6779_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025231radial spoke head protein 6 homolog ASMESG000079294.1 SMESG000044179.1 dd_Smed_v4_3854_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025902Calponin-homology (CH) domain-containing proteinSMESG000078209.1 dd_Smed_v4_9419_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022681Dynein heavy chain 7 axonemalSMESG000012956.1 dd_Smed_v4_13792_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022681Dynein heavy chain 7 axonemalSMESG000012956.1 dd_Smed_v4_5350_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030925SMED30030925SMESG000038398.1 dd_Smed_v4_4195_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020710Succinyl-CoA:3-ketoacid-coenzyme A transferaseSMESG000080424.1 dd_Smed_v4_1189_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032624cilia- and flagella-associated protein 53SMESG000004919.1 dd_Smed_v4_3219_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022844NEPH-3SMESG000022777.1 dd_Smed_v4_11280_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022281Phosphatidylinositol 3-kinase catalytic subunit type 3SMESG000051502.1 dd_Smed_v4_5028_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3002901916 kDa calcium-binding proteinSMESG000066843.1 dd_Smed_v4_299_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031818C-Jun-amino-terminal kinase-interacting protein 4SMESG000027094.1 dd_Smed_v4_4531_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027427Acetyl-coenzyme A synthetaseSMESG000023067.1 dd_Smed_v4_6561_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028425Anion exchange protein 3SMESG000020434.1 dd_Smed_v4_8250_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025593hemipterousSMESG000000893.1 dd_Smed_v4_5234_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30029490SMED30029490SMESG000049096.1 dd_Smed_v4_8321_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027315SMED30027315SMESG000023005.1 dd_Smed_v4_8220_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025105Plastin 3SMESG000081126.1 SMESG000081113.1 dd_Smed_v4_749_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033622Protocadherin-1SMESG000059440.1 dd_Smed_v4_6251_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30029428SMED30029428SMESG000019958.1 dd_Smed_v4_5765_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30029166Coiled-coil domain-containing protein 178SMESG000021560.1 dd_Smed_v4_8905_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031309nuclear protein MDM1-like isoform X1SMESG000058479.1 dd_Smed_v4_10635_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028292Protein KIAA0556 homologSMESG000009541.1 dd_Smed_v4_10945_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021837piggyBac transposable element-derived protein 4-likeSMESG000080622.1 SMESG000068757.1 SMESG000055125.1 SMESG000038294.1 SMESG000032747.1 SMESG000023322.1 dd_Smed_v4_3830_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023486Intraflagellar transport 74SMESG000074086.1 dd_Smed_v4_12702_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033380Beta-hexosaminidaseSMESG000037355.1 dd_Smed_v4_576_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035939Actinin alpha 4SMESG000074430.1 dd_Smed_v4_7964_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025152cilia- and flagella-associated protein 91SMESG000056200.1 dd_Smed_v4_9724_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020991Outer dynein arm protein 1SMESG000055998.1 SMESG000055997.1 dd_Smed_v4_4191_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023266cilia- and flagella-associated protein 43SMESG000000491.1 dd_Smed_v4_10271_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009038SMED30009038SMESG000068141.1 dd_Smed_v4_1067_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000054Rab-GAP TBC domain-containing proteinSMESG000003946.1 dd_Smed_v4_10066_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017314Dynein regulatory complex subunit 7SMESG000078850.1 dd_Smed_v4_12588_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005620Homeobox protein SIX1SMESG000005975.1 dd_Smed_v4_9774_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001362SMEDWI-3SMESG000081970.1 dd_Smed_v4_1258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001036Receptor-type tyrosine-protein phosphatase betaSMESG000050003.1 SMESG000005247.1 dd_Smed_v4_5794_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015887DUF4550 domain-containing proteinSMESG000000883.1 dd_Smed_v4_10058_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009119Ankyrin-2SMESG000058557.1 dd_Smed_v4_1432_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008325Fatty acid synthaseSMESG000020850.1 dd_Smed_v4_10967_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014415Protein FAM32ASMESG000034920.1 dd_Smed_v4_1341_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017508MetalloendopeptidaseSMESG000045572.1 dd_Smed_v4_11993_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012379SMED30012379SMESG000058557.1 dd_Smed_v4_1432_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018999SMED30018999SMESG000058251.1 dd_Smed_v4_10158_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015584Nesprin-1SMESG000016745.1 dd_Smed_v4_16850_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016327Ras GTPase-activating protein SynGAPSMESG000060891.1 SMESG000060888.1 SMESG000060447.1 dd_Smed_v4_11115_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013159LimbinSMESG000017303.1 dd_Smed_v4_10777_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009188Radial spoke head 14-like proteinSMESG000077061.1 dd_Smed_v4_1917_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011581AP2-associated protein kinase 1-like ProteinSMESG000041938.1 SMESG000041937.1 SMESG000051989.1 dd_Smed_v4_1179_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000756EGFR-5SMESG000044603.1 dd_Smed_v4_11310_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019321TIR domain-containing proteinSMESG000079651.1 dd_Smed_v4_1838_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017223Ras-related protein Rab-8ASMESG000030619.1 dd_Smed_v4_1573_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002081SMED30002081SMESG000047315.1 dd_Smed_v4_5128_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001473Lipoxygenase homology domain-containing protein 1SMESG000059926.1 SMESG000059927.1 dd_Smed_v4_10460_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008486SMED30008486SMESG000014085.1 SMESG000014086.1 SMESG000014087.1 dd_Smed_v4_10249_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013390Nesprin-1SMESG000069851.1 dd_Smed_v4_10646_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009277Polyamine-modulated factor 1-binding protein 1SMESG000048877.1 dd_Smed_v4_3146_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002606Cilia-and flagella-associated protein 74SMESG000043377.1 dd_Smed_v4_18628_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008756SMED30008756SMESG000007049.1 dd_Smed_v4_14707_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015061G protein regulated inducer of neurite outgrowthSMESG000062691.1 dd_Smed_v4_10294_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED300149112-oxoglutarate dehydrogenase mitochondrialSMESG000020522.1 dd_Smed_v4_1869_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013313SMED30013313SMESG000060891.1 SMESG000060888.1 SMESG000060447.1 dd_Smed_v4_11115_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000449SMED30000449SMESG000020436.1 dd_Smed_v4_5646_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015419SMED30015419SMESG000021688.1 dd_Smed_v4_11297_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001875Dynein light chain roadblockSMESG000072361.1 dd_Smed_v4_1126_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033243Rho GTPase-activating protein 7SMESG000062707.1 dd_Smed_v4_6129_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026859PlsC domain-containing proteinSMESG000028760.1 dd_Smed_v4_8757_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033551PhosphotransferaseSMESG000043559.1 dd_Smed_v4_4327_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030481Pyruvate kinaseSMESG000017675.1 dd_Smed_v4_2738_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034135Leucine-rich repeat-containing protein 23SMESG000003705.1 dd_Smed_v4_8299_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032610WD_REPEATS_REGION domain-containing proteinSMESG000060483.1 dd_Smed_v4_8615_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032531SMED30032531SMESG000024850.1 dd_Smed_v4_9209_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034888Dynein heavy chain 5, axonemalSMESG000049144.1 dd_Smed_v4_4569_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031265Scavenger receptor class B member 1SMESG000058914.1 dd_Smed_v4_2951_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031725SMED30031725SMESG000034628.1 dd_Smed_v4_9307_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034249SMED30034249SMESG000042496.1 dd_Smed_v4_8345_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035987Expressed conserved proteinSMESG000044572.1 dd_Smed_v4_5021_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030842SMED30030842SMESG000017044.1 dd_Smed_v4_5248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030240FerritinSMESG000039456.1 SMESG000014076.1 dd_Smed_v4_443_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024653Large proline-rich protein bag6SMESG000051496.1 dd_Smed_v4_1102_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033823Carbonic anhydraseSMESG000078341.1 dd_Smed_v4_5784_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30029024Protein F37C4.5SMESG000064758.1 dd_Smed_v4_5168_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023062bruno-likeSMESG000021009.1 dd_Smed_v4_2592_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021645SMED30021645SMESG000014085.1 SMESG000014086.1 SMESG000014087.1 dd_Smed_v4_10249_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020821SMED30020821SMESG000014298.1 dd_Smed_v4_1301_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034831SMED30034831SMESG000064758.1 dd_Smed_v4_5168_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025753SMED30025753SMESG000016791.1 dd_Smed_v4_10_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021281TIR domain-containing proteinSMESG000079651.1 dd_Smed_v4_1838_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023081SMED30023081SMESG000043010.1 SMESG000007603.1 dd_Smed_v4_7118_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024295Mitogen-activated protein kinaseSMESG000032743.1 dd_Smed_v4_1319_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022429Rho-GAP domain-containing proteinSMESG000036300.1 dd_Smed_v4_8320_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034947SMED30034947SMESG000077223.1 dd_Smed_v4_7005_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030073Thymus, brain and testes associatedSMESG000053617.1 dd_Smed_v4_4229_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034505Cullin-1SMESG000008644.1 dd_Smed_v4_5770_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034823SMED30034823SMESG000024340.1 dd_Smed_v4_822_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030281BHLH domain-containing proteinSMESG000019783.1 SMESG000019789.1 dd_Smed_v4_4438_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025872Pleckstrin homology and RhoGEF domain containing G5SMESG000023541.1 SMESG000023540.1 dd_Smed_v4_10072_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031644Translation machinery-associated protein 7-like proteinSMESG000034009.1 dd_Smed_v4_563_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033121Phosphatidylinositol 3,4,5-trisphosphate 3-phosphatase TPTE2SMESG000060206.1 dd_Smed_v4_4925_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024786Zinc finger protein castor-like protein 1SMESG000038913.1 dd_Smed_v4_6778_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033797SMED30033797SMESG000039759.1 SMESG000039758.1 dd_Smed_v4_5133_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034862SMED30034862SMESG000049533.1 dd_Smed_v4_3835_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030822A-kinase anchor protein 17ASMESG000071777.1 SMESG000071776.1 dd_Smed_v4_3404_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024458SMED30024458SMESG000023541.1 SMESG000023540.1 dd_Smed_v4_10072_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024093TetraspaninSMESG000020341.1 dd_Smed_v4_440_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034967Myosin headSMESG000049494.1 dd_Smed_v4_2912_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025647Ig-like domain-containing proteinSMESG000079961.1 dd_Smed_v4_12974_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032236Arachidonate 5-lipoxygenaseSMESG000077360.1 dd_Smed_v4_7204_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028623SMED30028623SMESG000029914.1 dd_Smed_v4_7742_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034464Ig-like domain-containing proteinSMESG000012091.1 dd_Smed_v4_2864_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034430Arp2/3 complex 34 kDa subunitSMESG000073809.1 dd_Smed_v4_693_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024527non-gastric H ,K -ATPase alpha subunitSMESG000041938.1 SMESG000041937.1 SMESG000051989.1 dd_Smed_v4_1179_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032093Protein kinase domain-containing proteinSMESG000024489.1 dd_Smed_v4_4401_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032093Protein kinase domain-containing proteinSMESG000024489.1 dd_Smed_v4_5366_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033398N-acetyltransferase domain-containing proteinSMESG000026037.1 dd_Smed_v4_9519_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028718Epsin 2SMESG000042233.1 dd_Smed_v4_4779_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033108Rhophilin-2-like ProteinSMESG000022872.1 dd_Smed_v4_6255_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033093SMED30033093SMESG000023005.1 dd_Smed_v4_7772_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032915Alkaline phosphataseSMESG000061191.1 dd_Smed_v4_8942_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033407C2H2-type domain-containing proteinSMESG000059040.1 dd_Smed_v4_9365_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034919Ras association domain family member 3SMESG000061902.1 dd_Smed_v4_9008_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025553Cell polarity proteinSMESG000027800.1 dd_Smed_v4_4789_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008718SMED30008718SMESG000012332.1 SMESG000012317.1 SMESG000058958.1 SMESG000058954.1 dd_Smed_v6_246_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012409SMED30012409SMESG000023005.1 dd_Smed_v6_1571_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030663SMED30030663SMESG000023005.1 dd_Smed_v6_1571_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002040Endothelin converting enzyme 2SMESG000069765.1 SMESG000070035.1 dd_Smed_v6_5256_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011770Unconventional myosin-XVISMESG000041981.1 dd_Smed_v6_4268_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027735SMED30027735SMESG000069765.1 SMESG000070035.1 dd_Smed_v6_5256_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020663SMED30020663SMESG000003437.1 dd_Smed_v6_2920_0dd_Smed_v6PMID:29674432
Plass et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
protonephridiaSMED30020663SMED30020663SMESG000003437.1 dd_Smed_v6_2920_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030419SMED30030419SMESG000067626.1 dd_Smed_v6_5233_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012160SMED30012160SMESG000069851.1 dd_Smed_v6_9493_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010503CEP135SMESG000077870.1 dd_Smed_v6_5218_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016328Cubilin (intrinsic factor-cobalamin receptor)SMESG000068883.1 dd_Smed_v6_4575_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30003084Cilia-and flagella-associated protein 45SMESG000016410.1 dd_Smed_v6_3732_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008553Phosphoenolpyruvate carboxykinase [GTP]SMESG000062868.1 dd_Smed_v6_196_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020977SMED30020977SMESG000069851.1 dd_Smed_v6_9493_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022193SMED30022193SMESG000069851.1 dd_Smed_v6_9493_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30003011NPHP1SMESG000061008.1 dd_Smed_v6_9990_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025990NPHP1SMESG000061008.1 dd_Smed_v6_9990_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006818Chromodomain-helicase-DNA-binding proteinSMESG000033397.1 SMESG000033395.1 dd_Smed_v6_2597_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008729SMED30008729SMESG000061008.1 dd_Smed_v6_9990_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023331Transposon Ty3-I Gag-Pol polyproteinSMESG000054198.1 dd_Smed_v6_6563_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005762Contactin/TAG-1 cell adhesion moleculeSMESG000036495.1 dd_Smed_v4_2673_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022678Semaphorin-like proteinSMESG000010584.1 SMESG000009925.1 dd_Smed_v4_13490_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008964SMED30008964SMESG000010167.1 dd_Smed_v4_8925_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021397Kunitz-type serine protease inhibitor dd_Smed_v4_12691_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016328Cubilin (intrinsic factor-cobalamin receptor)SMESG000068883.1 dd_Smed_v4_4575_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031784Hemicentin-1SMESG000024603.1 dd_Smed_v4_2783_0_1dd_Smed_v4PMID:30962434
Cote et al., 2019
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021661Carbonic anhydrase 7SMESG000017176.1 SMESG000017171.1 EC616347ncbi_smed_estsPMID:22385657
Wagner et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
protonephridiaSMED30033594Microtubule-associated protein 1ASMESG000014298.1 dd_Smed_v4_1301_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033594Microtubule-associated protein 1ASMESG000014298.1 dd_Smed_v4_3654_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034066Hemicentin-2SMESG000015102.1 dd_Smed_v4_13275_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031945UPF0638 protein BSMESG000003269.1 dd_Smed_v4_10707_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020213tensin isoform X3SMESG000033851.1 dd_Smed_v4_5620_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022077Cytospin-ASMESG000039310.1 dd_Smed_v4_6934_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30029805Kinesin proteinSMESG000013633.1 SMESG000013625.1 dd_Smed_v4_13562_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026278Pre-mRNA-splicing factor ISY1SMESG000047126.1 SMESG000004187.1 dd_Smed_v4_8243_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034202SMED30034202SMESG000077061.1 dd_Smed_v4_1917_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033909UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 4SMESG000066601.1 dd_Smed_v4_12354_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032655Armadillo repeat-containing protein 6SMESG000039967.1 dd_Smed_v4_1357_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034870SMED30034870SMESG000047469.1 dd_Smed_v4_16220_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024138Armadillo repeat protein deleted in velo-cardio-facial syndrome-likeSMESG000061216.1 dd_Smed_v4_6256_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025883Forkhead associated phosphopeptide binding domain 1SMESG000071072.1 dd_Smed_v4_14350_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025910Microtubule-associated protein futschSMESG000044270.1 SMESG000030021.1 SMESG000025422.1 dd_Smed_v4_1999_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028219SMED30028219SMESG000065952.1 dd_Smed_v4_5480_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026225SMED30026225SMESG000059698.1 dd_Smed_v4_188_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020643Chromosome 11 open reading frame 58SMESG000030362.1 dd_Smed_v4_6127_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30029313RNA binding protein EWSSMESG000054049.1 dd_Smed_v4_1370_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028659Cilia-and flagella-associated protein 100SMESG000033127.1 dd_Smed_v4_6518_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035139TOG array regulator of axonemal microtubules 1SMESG000016691.1 dd_Smed_v4_13421_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027256SMED30027256SMESG000050003.1 SMESG000005247.1 dd_Smed_v4_5794_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027451PMP-22/EMP/MP20/Claudin tight junctionSMESG000029752.1 dd_Smed_v4_2731_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020312Pre-mRNA-splicing factor ATP-dependent RNA helicase DHX16-likeSMESG000014714.1 dd_Smed_v4_8001_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028908GTP cyclohydrolase 1 feedback regulatory proteinSMESG000042387.1 dd_Smed_v4_6329_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033302RNA-binding protein MEX3BSMESG000044270.1 SMESG000030021.1 SMESG000025422.1 dd_Smed_v4_1999_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031311SMED30031311SMESG000023046.1 SMESG000023044.1 dd_Smed_v4_6118_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017036AP-2 complex subunit alphaSMESG000036030.1 dd_Smed_v4_1423_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016673Cylindromatosis (turban tumor syndrome), bSMESG000056847.1 SMESG000056843.1 SMESG000056838.1 SMESG000044770.1 SMESG000044762.1 SMESG000007140.1 dd_Smed_v4_1137_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001782Fibronectin type III domain-containing proteinSMESG000024682.1 dd_Smed_v4_3381_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001360Lipopolysaccharide cholineSMESG000060269.1 dd_Smed_v4_6457_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000376dynein heavy chain domain-containing protein 1-likeSMESG000076398.1 dd_Smed_v4_8984_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000248Ras-related protein Rab-11ASMESG000016036.1 dd_Smed_v4_4964_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030057GLOBIN domain-containing proteinSMESG000048632.1 SMESG000022262.1 dd_Smed_v4_2237_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034048SMED30034048SMESG000051762.1 dd_Smed_v4_13419_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030425Ubiquitin carboxyl-terminal hydrolase 7SMESG000050890.1 dd_Smed_v4_1847_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035923S-adenosylmethionine decarboxylase proenzymeSMESG000011356.1 dd_Smed_v4_1099_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035432SMED30035432SMESG000044186.1 dd_Smed_v4_13633_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031468Propionyl-CoA carboxylase alpha chain, mitochondrialSMESG000034830.1 dd_Smed_v4_1247_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020318WD repeat-containing protein 49SMESG000041940.1 dd_Smed_v4_13248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034085SMED30034085SMESG000081261.1 dd_Smed_v4_10592_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034953SMED30034953SMESG000065075.1 dd_Smed_v4_102_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035694SMED30035694SMESG000023025.1 dd_Smed_v4_13548_0_2dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032498NPHP8SMESG000076081.1 dd_Smed_v4_11425_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023749Lysophosphatidylcholine acyltransferaseSMESG000003820.1 dd_Smed_v4_2022_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026998cilia- and flagella-associated protein 251SMESG000037291.1 dd_Smed_v4_11127_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026646Dynein light chainSMESG000009941.1 dd_Smed_v4_107_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019041Synaptic vesicle 2-related proteinSMESG000035457.1 dd_Smed_v4_59_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013366Sodium/potassium-transporting ATPase subunit alphaSMESG000078146.1 dd_Smed_v4_2828_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017175ras GTPase-activating protein nGAP isoform X8SMESG000037132.1 SMESG000037110.1 dd_Smed_v4_6499_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008506SMED30008506SMESG000037104.1 SMESG000037103.1 dd_Smed_v4_407_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED300154216-pyruvoyl tetrahydrobiopterin synthaseSMESG000077201.1 dd_Smed_v4_3156_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011984partitioning defective 3 homolog isoform X2SMESG000071209.1 dd_Smed_v4_5548_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018724SMED30018724SMESG000036933.1 dd_Smed_v4_3235_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010668MAGUK p55 subfamily member 5SMESG000017294.1 dd_Smed_v4_6790_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013498LIM zinc-binding domain-containing proteinSMESG000072162.1 dd_Smed_v4_537_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010317MFS domain-containing proteinSMESG000026516.1 dd_Smed_v4_6235_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014551SMED30014551SMESG000080911.1 SMESG000080909.1 dd_Smed_v4_8194_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015103Branched-chain-amino-acid aminotransferaseSMESG000021421.1 dd_Smed_v4_3721_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010627Homeobox proteinSMESG000078684.1 dd_Smed_v4_8553_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018177insulin receptor-like 1 proteinSMESG000042173.1 dd_Smed_v4_9272_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015974FAST kinase domain-containing protein 1, mitochondrialSMESG000064523.1 dd_Smed_v4_8917_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014392U2 snRNP-associated SURP motif-containing proteinSMESG000026341.1 dd_Smed_v4_3029_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011329TetraspaninSMESG000019452.1 dd_Smed_v4_5409_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015473Actin cytoplasmic type 5SMESG000080982.1 SMESG000080969.1 dd_Smed_v4_2624_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011750Phosphoinositide phospholipase CSMESG000070741.1 SMESG000070728.1 dd_Smed_v4_9716_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007795Essential myosin light chainSMESG000042179.1 dd_Smed_v4_559_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013840Tektin-2SMESG000065255.1 SMESG000050057.1 dd_Smed_v4_2339_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012267Kinesin-like proteinSMESG000073771.1 dd_Smed_v4_6755_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009700Dynein light chain roadblockSMESG000061103.1 dd_Smed_v4_7991_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015423Cilia- and flagella-associated protein 20SMESG000057288.1 dd_Smed_v4_4843_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007115SMED30007115SMESG000017234.1 dd_Smed_v4_5508_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016950DystrophinSMESG000020523.1 dd_Smed_v4_5325_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010504SMED30010504SMESG000010514.1 dd_Smed_v4_4965_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015100SMED30015100SMESG000024438.1 dd_Smed_v4_7255_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008964SMED30008964SMESG000010167.1 dd_Smed_v4_8925_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018731MORN repeat-containing protein 5SMESG000023247.1 dd_Smed_v4_7020_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3001096960S ribosomal protein L6SMESG000019835.1 dd_Smed_v4_839_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002344Bax inhibitor-1 proteinSMESG000038559.1 dd_Smed_v4_319_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009782Outer dense fiber protein 3SMESG000038718.1 dd_Smed_v4_2658_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010538Phospholipid scramblaseSMESG000043802.1 dd_Smed_v4_4899_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012368Prominin (Prom) protein, putativeSMESG000025078.1 dd_Smed_v4_6506_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014915Short-chain specific acyl-CoA dehydrogenase, mitochondrialSMESG000025139.1 dd_Smed_v4_5980_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004448Thioredoxin domain-containing protein 3-likeSMESG000043677.1 dd_Smed_v4_8401_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004448Thioredoxin domain-containing protein 3-likeSMESG000043677.1 dd_Smed_v4_8026_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017611SMED30017611SMESG000038056.1 dd_Smed_v4_9903_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005237Zinc finger proteinSMESG000055679.1 dd_Smed_v4_8858_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012475PPFIA binding protein 1bSMESG000054431.1 dd_Smed_v4_7610_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014979Protein bicaudal DSMESG000035031.1 dd_Smed_v4_758_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014362F-BAR domain only protein 2SMESG000078045.1 dd_Smed_v4_8587_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004520SMED30004520SMESG000037711.1 dd_Smed_v4_8837_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012757Tektin-4SMESG000068903.1 dd_Smed_v4_4872_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016517ATFl1SMESG000044121.1 dd_Smed_v4_3847_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015967Neurotracting/lsamp/neurotrimin/obcam related cell adhesion moleculeSMESG000068491.1 dd_Smed_v4_2826_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017369Disabled 2-interacting proteinSMESG000043888.1 dd_Smed_v4_3238_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010695coiled-coil domain-containing protein 170SMESG000048767.1 dd_Smed_v4_7066_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3000844110-formyltetrahydrofolate dehydrogenaseSMESG000005275.1 dd_Smed_v4_5787_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013026SMED30013026SMESG000076398.1 dd_Smed_v4_8984_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010112SMED30010112SMESG000037132.1 SMESG000037110.1 dd_Smed_v4_6499_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015079Dynein heavy chain 5, axonemalSMESG000049144.1 dd_Smed_v4_4569_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027566SMED30027566SMESG000075236.1 dd_Smed_v4_7519_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028609rho GTPase-activating protein 39SMESG000029199.1 dd_Smed_v4_5836_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025075SMED30025075SMESG000048253.1 dd_Smed_v4_5617_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025317Universal stress protein MSMEG_3950/MSMEI_3859SMESG000016283.1 SMESG000016282.1 dd_Smed_v4_402_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026540ProtocadherinSMESG000076551.1 dd_Smed_v4_7552_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025832SMED30025832SMESG000001878.1 dd_Smed_v4_714_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026133BTB domain-containing proteinSMESG000001053.1 dd_Smed_v4_3856_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012431Conserved plasma membrane proteinSMESG000042684.1 dd_Smed_v4_2904_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008728mitochondrial sodium/calcium exchanger proteinSMESG000022802.1 dd_Smed_v4_9904_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009690TransporterSMESG000042086.1 SMESG000042051.1 dd_Smed_v4_3642_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012229Cilia- and flagella-associated protein 20SMESG000081781.1 dd_Smed_v4_3751_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005770Cell number regulator 7SMESG000060415.1 dd_Smed_v4_743_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005424PH domain-containing proteinSMESG000061841.1 dd_Smed_v4_6425_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002690HEAT repeat-containing protein 5B-like ProteinSMESG000028228.1 dd_Smed_v4_7872_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005158WD_REPEATS_REGION domain-containing proteinSMESG000071691.1 dd_Smed_v4_6137_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010340NeuroliginSMESG000012303.1 dd_Smed_v4_7946_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008280Class E vacuolar protein-sorting machinery protein HSE1SMESG000077597.1 dd_Smed_v4_4190_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006343dynein heavy chain 5, axonemalSMESG000049144.1 dd_Smed_v4_4569_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014844Flotillin-1SMESG000004975.1 dd_Smed_v4_1637_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019184Protein NDRG3SMESG000005138.1 SMESG000005122.1 dd_Smed_v4_1911_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000409mitfl-2 proteinSMESG000077129.1 dd_Smed_v4_7316_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016140methylmalonyl-CoA mutase, mitochondrialSMESG000014335.1 dd_Smed_v4_2255_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000708Dynein heavy chain 5, axonemalSMESG000049144.1 dd_Smed_v4_4569_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007579SMED30007579SMESG000038305.1 SMESG000038298.1 SMESG000038313.1 SMESG000035859.1 dd_Smed_v4_9798_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018560SMED30018560SMESG000004196.1 dd_Smed_v4_1162_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005459SMED30005459SMESG000014884.1 dd_Smed_v4_2661_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000517Mitogen activated protein kinase kinase kinaseSMESG000017706.1 dd_Smed_v4_4486_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009556Dynein axonemal light chain 1SMESG000053050.1 dd_Smed_v4_6302_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009456SMED30009456SMESG000039759.1 SMESG000039758.1 dd_Smed_v4_5133_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019288Reticulocalbin 3SMESG000012033.1 dd_Smed_v4_1417_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008612Sorting nexin-14SMESG000057128.1 dd_Smed_v4_6581_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017717Ras-related protein Rab-2ASMESG000076159.1 dd_Smed_v4_1113_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018688TNF receptor-associated factorSMESG000070130.1 SMESG000070126.1 dd_Smed_v4_1439_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012378Clathrin heavy chainSMESG000035457.1 dd_Smed_v4_59_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3001422860S ribosomal protein L6SMESG000050581.1 dd_Smed_v4_10396_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002257SMED30002257SMESG000010550.1 dd_Smed_v4_2590_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007581cilia- and flagella-associated protein 69SMESG000047535.1 dd_Smed_v4_7432_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007886SMED30007886SMESG000055169.1 dd_Smed_v4_9583_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011506SH2 domain-containing proteinSMESG000006496.1 dd_Smed_v4_7305_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007385SMED30007385SMESG000003089.1 dd_Smed_v4_780_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005588Zinc finger RNA-binding proteinSMESG000022723.1 dd_Smed_v4_3762_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001196Myosin headSMESG000049494.1 dd_Smed_v4_2912_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000512cilia- and flagella-associated protein 61SMESG000059955.1 dd_Smed_v4_4908_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002004Ribonuclease t2SMESG000046228.1 dd_Smed_v4_6454_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006931SMED30006931SMESG000040565.1 dd_Smed_v4_4660_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006117Tyrosine-protein phosphatase non-receptor typeSMESG000018862.1 dd_Smed_v4_6996_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002549SyntaxinSMESG000043412.1 SMESG000043410.1 dd_Smed_v4_8453_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009776Collagen IV NC1 domain-containing proteinSMESG000066546.1 dd_Smed_v4_2500_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005253EF-hand domain-containing family member C2SMESG000076759.1 dd_Smed_v4_6035_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006208Aconitate hydratase, mitochondrialSMESG000002904.1 dd_Smed_v4_979_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000970Homeobox domain-containing proteinSMESG000008497.1 dd_Smed_v4_7037_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000378SMED30000378SMESG000061591.1 dd_Smed_v4_512_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30003975Ceramide synthase 5SMESG000060101.1 SMESG000039123.1 dd_Smed_v4_4223_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000132SMED30000132SMESG000017239.1 dd_Smed_v4_4431_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000212Vacuolar protein sorting-associated protein 26BSMESG000026617.1 dd_Smed_v4_912_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002366cAMP-dependent protein kinase regulatory subunitSMESG000052390.1 dd_Smed_v4_7586_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000065SMED30000065SMESG000049103.1 dd_Smed_v4_397_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014052Endothelin-converting enzyme 1SMESG000003235.1 SMESG000003226.1 SMESG000003222.1 dd_Smed_v4_1910_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006263SMED30006263SMESG000056318.1 dd_Smed_v4_2292_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006263SMED30006263SMESG000056319.1 SMESG000056318.1 SMESG000022275.1 dd_Smed_v4_674_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013241SMED30013241SMESG000007775.1 dd_Smed_v4_137_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005837SMED30005837SMESG000016663.1 dd_Smed_v4_229_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006887Gelsolin-like proteinSMESG000015927.1 dd_Smed_v4_929_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019300Histone deacetylase,putativeSMESG000006246.1 dd_Smed_v4_1997_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012914SMED30012914SMESG000028186.1 dd_Smed_v4_2368_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004616Lipopolysaccharide choline phosphotransferase proteinSMESG000025873.1 dd_Smed_v4_5971_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018823ATP-dependent 6-phosphofructokinaseSMESG000029088.1 dd_Smed_v4_1604_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009652HEAT repeat-containing protein 5BSMESG000028228.1 dd_Smed_v4_7872_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007604SMED30007604SMESG000074719.1 dd_Smed_v4_3016_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007604SMED30007604SMESG000074719.1 dd_Smed_v4_4756_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000740ets-1SMESG000033821.1 dd_Smed_v4_9165_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000740ets-1SMESG000033821.1 dd_Smed_v4_9185_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001988Non-specific serine/threonine protein kinaseSMESG000036933.1 dd_Smed_v4_3235_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004840Coiled-coil domain containing 88AaSMESG000012304.1 dd_Smed_v4_3591_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30003484SMED30003484SMESG000049494.1 dd_Smed_v4_2912_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004756Small nuclear ribonucleoprotein Sm D2SMESG000032344.1 dd_Smed_v4_2994_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005762Contactin/TAG-1 cell adhesion moleculeSMESG000036495.1 dd_Smed_v4_2673_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000035SMED30000035SMESG000069119.1 dd_Smed_v4_8577_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035970transcription initiation factor TFIID subunit 2SMESG000037189.1 dd_Smed_v4_15494_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025175Ethanolamine kinase 1SMESG000039287.1 SMESG000039275.1 dd_Smed_v4_10949_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032471Protocadherin gamma B1SMESG000035879.1 dd_Smed_v4_12023_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026237Coiled-coil and C2 domain containing 2ASMESG000048372.1 dd_Smed_v4_11189_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031773Msh2SMESG000016751.1 dd_Smed_v4_11434_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020414SMED30020414SMESG000059071.1 dd_Smed_v4_1660_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022539SMED30022539SMESG000059071.1 dd_Smed_v4_1660_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023905Protein NDRG3SMESG000005138.1 SMESG000005122.1 dd_Smed_v4_1911_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021896SMED30021896SMESG000041611.1 dd_Smed_v4_1935_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020260SMED30020260SMESG000005697.1 dd_Smed_v4_12813_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023334Partitioning defective 6SMESG000026500.1 dd_Smed_v4_1830_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035852Ubiquitin-60S ribosomal protein L40SMESG000035681.1 dd_Smed_v4_176_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031582InnexinSMESG000081749.1 dd_Smed_v4_10287_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031582InnexinSMESG000081749.1 dd_Smed_v4_11302_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021110Dynein heavy chain 17, axonemalSMESG000026263.1 dd_Smed_v4_10425_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021206Calcineurin B homologous protein 1SMESG000018297.1 dd_Smed_v4_1504_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024579SJCHGC07397 proteinSMESG000050581.1 dd_Smed_v4_10396_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034787Sodium/potassium-transporting ATPase subunit beta-1SMESG000032752.1 dd_Smed_v4_1688_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023661Reverse transcriptase domain-containing proteinSMESG000042224.1 dd_Smed_v4_11697_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033145Protein kinase domain-containing proteinSMESG000026756.1 dd_Smed_v4_11663_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033750Protein kinaseSMESG000070879.1 SMESG000070880.1 dd_Smed_v4_3195_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028839hemicentin-1 isoform X2SMESG000003113.1 dd_Smed_v4_13903_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031015slc6a-13SMESG000042086.1 SMESG000042051.1 dd_Smed_v4_3642_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031015slc6a-13SMESG000079286.1 SMESG000079280.1 SMESG000017839.1 dd_Smed_v4_11826_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020273Pyruvate kinaseSMESG000063570.1 dd_Smed_v4_1511_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030586slc10a-2SMESG000064833.1 dd_Smed_v4_10199_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022717SMED30022717SMESG000005697.1 dd_Smed_v4_12813_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034220Flotillin-1SMESG000004975.1 dd_Smed_v4_1637_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034765Protocadherin gamma B1SMESG000035879.1 dd_Smed_v4_12023_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032821SMED30032821SMESG000026756.1 dd_Smed_v4_11663_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30029350Serine incorporator 3SMESG000020805.1 dd_Smed_v4_1130_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022167SMED30022167SMESG000031417.1 dd_Smed_v4_11958_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033252Cell adhesion molecule-related/down-regulated by oncogenesSMESG000010456.1 SMESG000002915.1 dd_Smed_v4_1968_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020981Protein NDRG3SMESG000005138.1 SMESG000005122.1 dd_Smed_v4_1911_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008732SMED30008732SMESG000064322.1 dd_Smed_v4_4685_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013257Tektin-2SMESG000026446.1 SMESG000026445.1 SMESG000026429.1 dd_Smed_v4_2694_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011708Neural cell adhesion molecule 1SMESG000077686.1 dd_Smed_v4_3768_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018188Lysosome-associated membrane glycoprotein 2SMESG000025677.1 dd_Smed_v4_722_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019374Sodium-dependent glucose transporter 1SMESG000015183.1 dd_Smed_v4_8337_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019874CalmodulinSMESG000010769.1 dd_Smed_v4_255_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016597SMED30016597SMESG000063165.1 dd_Smed_v4_2607_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010061APOBEC1 complementation factorSMESG000032489.1 dd_Smed_v4_2228_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000058SMED30000058SMESG000022049.1 dd_Smed_v4_499_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018404SMED30018404SMESG000032486.1 dd_Smed_v4_4574_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010437Copper homeostasis protein CutCSMESG000016228.1 dd_Smed_v4_7302_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014561SMED30014561SMESG000000219.1 dd_Smed_v4_862_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017953SMED30017953SMESG000011944.1 dd_Smed_v4_3820_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000584SMED30000584SMESG000016256.1 SMESG000016255.1 SMESG000010584.1 SMESG000009925.1 dd_Smed_v4_2090_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018763Mitochondrial pyruvate carrierSMESG000004344.1 dd_Smed_v4_8071_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019742Geranylgeranyl transferase type-2 subunit alphaSMESG000011257.1 dd_Smed_v4_7183_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014791adenylate kinase 8-likeSMESG000027219.1 dd_Smed_v4_7317_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010326TetraspaninSMESG000078589.1 dd_Smed_v4_2698_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012747Thioredoxin domain-containing protein 3-likeSMESG000043677.1 dd_Smed_v4_8401_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012747Thioredoxin domain-containing protein 3-likeSMESG000043677.1 dd_Smed_v4_8026_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006653SMED30006653SMESG000058633.1 dd_Smed_v4_2131_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009268SMED30009268SMESG000065344.1 dd_Smed_v4_3354_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004581Dual specificity protein phosphatase 10SMESG000030100.1 dd_Smed_v4_3551_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001666slc18a-1SMESG000041557.1 SMESG000041534.1 dd_Smed_v4_11917_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3000245560S ribosomal protein L6SMESG000076172.1 dd_Smed_v4_205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010322SMED30010322SMESG000006336.1 dd_Smed_v4_11671_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015955Growth arrest-specific protein 8SMESG000013356.1 dd_Smed_v4_2848_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002306SMED30002306SMESG000071777.1 SMESG000071776.1 dd_Smed_v4_3404_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010777Lysosomal-associated transmembrane protein 4ASMESG000042736.1 SMESG000032757.1 SMESG000017350.1 SMESG000010536.1 SMESG000042735.1 SMESG000012070.1 dd_Smed_v4_495_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007097Rho guanine nucleotide exchange factor 28SMESG000021797.1 dd_Smed_v4_5252_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018897Phorbol-ester/DAG-type domain-containing proteinSMESG000056465.1 dd_Smed_v4_2451_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015802Trans-L-3-hydroxyproline dehydrataseSMESG000021283.1 dd_Smed_v4_7144_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009173Glutamate receptor-interacting protein 2SMESG000031603.1 dd_Smed_v4_3080_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013379IQ motif containing GSMESG000075453.1 dd_Smed_v4_7221_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014928Formin-like proteinSMESG000044336.1 dd_Smed_v4_3917_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019097SOXP-1SMESG000010063.1 dd_Smed_v4_7227_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014656SMED30014656SMESG000045005.1 dd_Smed_v4_13207_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013021SMED30013021SMESG000025420.1 dd_Smed_v4_2995_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016078Actin, cytoplasmicSMESG000012332.1 SMESG000012317.1 dd_Smed_v4_285_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016078Actin, cytoplasmicSMESG000012332.1 SMESG000012317.1 SMESG000058954.1 dd_Smed_v4_246_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017032slc2a-11SMESG000025420.1 dd_Smed_v4_2995_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007503SMED30007503SMESG000039907.1 dd_Smed_v4_13316_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015703IQ domain-containing protein DSMESG000017912.1 dd_Smed_v4_7079_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017438RanBP-type and C3HC4-type zinc finger-containing protein 1SMESG000013684.1 dd_Smed_v4_4440_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019315SMED30019315SMESG000022726.1 dd_Smed_v4_2668_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030643Methylmalonic aciduria and homocystinuria type D-like protein, mitochondrialSMESG000030431.1 dd_Smed_v4_2046_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030309SMED30030309SMESG000075212.1 SMESG000075211.1 SMESG000074910.1 SMESG000074908.1 SMESG000074907.1 dd_Smed_v4_1061_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028737Tubby-like proteinSMESG000009644.1 dd_Smed_v4_10462_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023347Kinesin motor domain-containing proteinSMESG000069689.1 dd_Smed_v4_10482_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031509Acid sphingomyelinase-like phosphodiesteraseSMESG000055453.1 dd_Smed_v4_15691_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028928mutS protein homolog 4SMESG000019325.1 dd_Smed_v4_12806_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021549Usp domain-containing proteinSMESG000079952.1 dd_Smed_v4_1092_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020574Dynein heavy chain axonemalSMESG000017294.1 dd_Smed_v4_6790_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022385Hyaluronan binding protein 2SMESG000061109.1 dd_Smed_v4_2031_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021977Beta-1,3-galactosyltransferase 1SMESG000035184.1 dd_Smed_v4_11741_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021116SMED30021116SMESG000060548.1 dd_Smed_v4_8385_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020504Serine/threonine-protein phosphataseSMESG000060548.1 dd_Smed_v4_8385_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032126AndroglobinSMESG000053594.1 SMESG000047986.1 dd_Smed_v4_10677_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017526SMED30017526SMESG000037419.1 SMESG000037430.1 dd_Smed_v4_11833_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019176Glyco_hydro_59M domain-containing proteinSMESG000068390.1 dd_Smed_v4_2699_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014097Cytochrome P450 2K1-like proteinSMESG000034110.1 dd_Smed_v4_3919_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011844Very-long-chain 3-oxoacyl-CoA reductaseSMESG000075064.1 dd_Smed_v4_3371_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012721HexosyltransferaseSMESG000023046.1 SMESG000023044.1 dd_Smed_v4_6118_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014794SMED30014794SMESG000075514.1 dd_Smed_v4_1900_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007392tetratricopeptide repeat protein 38SMESG000072019.1 SMESG000071607.1 dd_Smed_v4_3316_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007024G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000078415.1 dd_Smed_v4_24316_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014810Endophilin-A3SMESG000061276.1 dd_Smed_v4_7468_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011267SMED30011267SMESG000064891.1 dd_Smed_v4_3911_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015310DUF3421 domain-containing proteinSMESG000046710.1 SMESG000046697.1 dd_Smed_v4_54_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019565Radial spoke head protein 4-like protein ASMESG000044927.1 dd_Smed_v4_5346_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014190Catenin alphaSMESG000010738.1 dd_Smed_v4_5822_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004846Actin-binding LIM proteinSMESG000080177.1 dd_Smed_v4_5410_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005661Ras-related protein Rab-7aSMESG000068863.1 dd_Smed_v4_491_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011700Calcium-binding protein ASMESG000052083.1 SMESG000048475.1 dd_Smed_v4_605_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010044Rho GTPase-activating protein 7SMESG000056012.1 dd_Smed_v4_9530_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019455LIM domain-containing proteinSMESG000066861.1 SMESG000059630.1 SMESG000066862.1 dd_Smed_v4_6647_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001490ADF-H domain-containing proteinSMESG000080129.1 dd_Smed_v4_260_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010890Y box binding protein 1SMESG000008704.1 dd_Smed_v4_347_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002133PolyubiquitinSMESG000039444.1 SMESG000014081.1 dd_Smed_v4_34_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012546Coiled-coil domain-containing protein 65SMESG000021331.1 dd_Smed_v4_6152_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018435Alpha-int-2SMESG000021746.1 dd_Smed_v4_3365_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012826SMED30012826SMESG000017012.1 SMESG000017011.1 dd_Smed_v4_309_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018495ATPase_AAA_core domain-containing proteinSMESG000073596.1 dd_Smed_v4_9568_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018495ATPase_AAA_core domain-containing proteinSMESG000073596.1 dd_Smed_v4_9484_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017474WD repeat-containing protein on Y chromosomeSMESG000033045.1 dd_Smed_v4_5437_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019318Sperm associated antigen 6SMESG000018022.1 dd_Smed_v4_3991_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016384Thymidylate kinaseSMESG000016256.1 SMESG000016255.1 SMESG000010584.1 SMESG000009925.1 dd_Smed_v4_2090_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004149Protein kinase-like domainSMESG000016842.1 dd_Smed_v4_6898_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013470Rho-related GTP-binding proteinSMESG000001635.1 dd_Smed_v4_813_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002064Doublecortin domain-containing protein 2SMESG000040482.1 SMESG000040481.1 SMESG000040480.1 SMESG000038137.1 dd_Smed_v4_6464_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017243Protein-glucosylgalactosylhydroxylysine glucosidaseSMESG000009911.1 SMESG000009910.1 dd_Smed_v4_606_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015146SMED30015146SMESG000045005.1 dd_Smed_v4_13207_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011285DNA polymerase subunit gamma-1SMESG000077612.1 SMESG000050769.1 dd_Smed_v4_5734_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000995Pyruvate kinaseSMESG000052083.1 SMESG000048475.1 dd_Smed_v4_605_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010520SMED30010520SMESG000066861.1 SMESG000059630.1 SMESG000066862.1 dd_Smed_v4_6647_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035468DNAHb-1SMESG000072114.1 SMESG000072113.1 SMESG000072112.1 dd_Smed_v4_3670_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3002169814-3-3 protein epsilonSMESG000047644.1 dd_Smed_v4_36_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031260SMED30031260SMESG000013211.1 dd_Smed_v4_2357_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028462Zinc finger protein castor-like protein 1SMESG000024266.1 dd_Smed_v4_2206_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030156SMED30030156SMESG000032633.1 dd_Smed_v4_6252_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033349Ribosomal protein S6 kinaseSMESG000059433.1 dd_Smed_v4_4316_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021868coiled-coil domain-containing protein 39SMESG000072035.1 SMESG000072034.1 dd_Smed_v4_5955_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028986SMED30028986SMESG000045005.1 dd_Smed_v4_13207_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027306semaphorin-like proteinSMESG000016256.1 SMESG000016255.1 SMESG000010584.1 SMESG000009925.1 dd_Smed_v4_2090_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024108C2H2-type domain-containing proteinSMESG000010914.1 dd_Smed_v4_11240_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025309Dimer_Tnp_hAT domain-containing proteinSMESG000066861.1 SMESG000059630.1 SMESG000066862.1 dd_Smed_v4_6647_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020768SMED30020768SMESG000072019.1 SMESG000071607.1 dd_Smed_v4_3316_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020347Transient receptor potential cation channelSMESG000004126.1 dd_Smed_v4_11377_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032389slc24a-1SMESG000010390.1 dd_Smed_v4_5868_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023416ANK_REP_REGION domain-containing proteinSMESG000033773.1 dd_Smed_v4_5594_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034903cilia- and flagella-associated protein 77SMESG000042608.1 dd_Smed_v4_5179_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035231SMED30035231SMESG000066861.1 SMESG000059630.1 SMESG000066862.1 dd_Smed_v4_6647_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022835ras-related protein Rab-35SMESG000072655.1 dd_Smed_v4_3102_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED300316316-phosphogluconate dehydrogenase, decarboxylatingSMESG000005721.1 dd_Smed_v4_366_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033280SMED30033280SMESG000006336.1 dd_Smed_v4_11671_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031727ubiquitin fusion degradation protein 1 homologSMESG000037419.1 SMESG000037430.1 dd_Smed_v4_11833_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022233SPATA6 domain-containing proteinSMESG000013811.1 dd_Smed_v4_4304_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031405SMED30031405SMESG000051910.1 SMESG000051904.1 dd_Smed_v4_298_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023327Growth inhibition and differentiation-related protein 88SMESG000023190.1 dd_Smed_v4_7944_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025223Neuropeptide Y prohormone-2SMESG000050247.1 SMESG000050248.1 dd_Smed_v4_10191_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034775Ras-associating domain-containing proteinSMESG000002146.1 dd_Smed_v4_3216_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032591arf-GAP with Rho-GAP domain, ANK repeat and PH domain-containing protein 1-likeSMESG000006535.1 dd_Smed_v4_4332_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025573cGMP-dependent protein kinase,putativeSMESG000018148.1 SMESG000018146.1 dd_Smed_v4_10515_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027818Si:ch211-163l21.7SMESG000026490.1 dd_Smed_v4_3833_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017721SMED30017721SMESG000037259.1 dd_Smed_v4_4831_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010725Ras-related protein Rab-13SMESG000078273.1 dd_Smed_v4_3889_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011587SMED30011587SMESG000002176.1 dd_Smed_v4_8691_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018408SMED30018408SMESG000054324.1 dd_Smed_v4_8695_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012599E3 ubiquitin-protein ligase TM129SMESG000022818.1 dd_Smed_v4_8706_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006541SMED30006541SMESG000012332.1 SMESG000012317.1 SMESG000058954.1 dd_Smed_v4_246_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011050hypothetical proteinSMESG000044135.1 dd_Smed_v4_8839_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005465Ras-related protein Rab-11ASMESG000073334.1 dd_Smed_v4_867_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015890Protein lethal(2) giant larvaeSMESG000072512.1 dd_Smed_v4_7127_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30003603SMED30003603SMESG000071647.1 dd_Smed_v4_9231_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011667Serine/threonine-protein phosphataseSMESG000077398.1 dd_Smed_v4_5669_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013025Corticotropin-releasing factor receptor 1SMESG000051050.1 dd_Smed_v4_6632_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013800slc15a-3SMESG000042203.1 dd_Smed_v4_4941_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019305wdr-1SMESG000045753.1 SMESG000037894.1 dd_Smed_v4_2585_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016746SMED30016746SMESG000060159.1 dd_Smed_v4_2729_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002664SMED30002664SMESG000002943.1 dd_Smed_v4_2782_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014689Usp domain-containing proteinSMESG000020952.1 dd_Smed_v4_985_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014640Small heat shock protein p36SMESG000028601.1 dd_Smed_v4_6399_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001235Cilia and flagella associated protein 298SMESG000074029.1 dd_Smed_v4_3612_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014565Angiotensin-converting enzymeSMESG000005704.1 SMESG000005698.1 dd_Smed_v4_3745_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008911FascinSMESG000037971.1 dd_Smed_v4_996_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032818SCO-spondinSMESG000025547.1 SMESG000025545.1 dd_Smed_v4_7381_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030636SMED30030636SMESG000016978.1 dd_Smed_v4_19646_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024833SMED30024833SMESG000017984.1 SMESG000017957.1 dd_Smed_v4_20923_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022840SMED30022840SMESG000025410.1 dd_Smed_v4_777_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031175SMED30031175SMESG000064100.1 SMESG000064099.1 dd_Smed_v4_14322_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022612Ester hydrolase C11orf54-like proteinSMESG000027576.1 SMESG000007855.1 dd_Smed_v4_1733_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020220Sodium/potassium-transporting ATPase subunit alphaSMESG000032753.1 SMESG000017208.1 dd_Smed_v4_3340_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027834Thymidine phosphorylaseSMESG000008845.1 dd_Smed_v4_869_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033291SMED30033291SMESG000030545.1 dd_Smed_v4_11177_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023854Carbonic anhydraseSMESG000017178.1 dd_Smed_v4_9270_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030406RBR-type E3 ubiquitin transferaseSMESG000062924.1 dd_Smed_v4_4771_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023103C2 domainSMESG000063814.1 dd_Smed_v4_10352_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023228SMED30023228SMESG000016978.1 dd_Smed_v4_19646_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023181SMED30023181SMESG000008713.1 dd_Smed_v4_28592_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023379Piezo-type mechanosensitive ion channel componentSMESG000051188.1 dd_Smed_v4_7182_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033149Calcipressin-2-likeSMESG000068854.1 SMESG000068847.1 dd_Smed_v4_14266_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020490SMED30020490SMESG000030489.1 dd_Smed_v4_11685_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016107PH domain-containing proteinSMESG000007865.1 dd_Smed_v4_3737_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002774SMED30002774SMESG000017229.1 dd_Smed_v4_613_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016875Rho-associated kinaseSMESG000057753.1 dd_Smed_v4_2914_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017239SMED30017239SMESG000048407.1 SMESG000002220.1 SMESG000002212.1 SMESG000001733.1 dd_Smed_v4_9947_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018300slc42a-2SMESG000005978.1 dd_Smed_v4_2323_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008852Geranylgeranyl transferase type-1 subunit betaSMESG000057312.1 dd_Smed_v4_4004_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002656Unconventional myosin-XVSMESG000061386.1 dd_Smed_v4_7193_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015151Phosphatidylinositol transfer protein alpha isoformSMESG000014949.1 dd_Smed_v4_580_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004957AnoctaminSMESG000033730.1 SMESG000033728.1 dd_Smed_v4_6514_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015563Meiosis expressed protein 1SMESG000031493.1 dd_Smed_v4_4620_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010380SJCHGC04139 proteinSMESG000022419.1 dd_Smed_v4_4617_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018527Guanylate cyclaseSMESG000010241.1 dd_Smed_v4_7644_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016204cyclinG-like proteinSMESG000077612.1 dd_Smed_v4_6866_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017004Kunitz-type serine protease inhibitorSMESG000037995.1 dd_Smed_v4_300_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000360TetraspaninSMESG000052597.1 dd_Smed_v4_9647_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004508E3 ubiquitin-protein ligase MIB2SMESG000017279.1 dd_Smed_v4_5196_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011512Radial spoke head 1 homologSMESG000014300.1 dd_Smed_v4_3321_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000222RNA binding protein MEX3BSMESG000071674.1 dd_Smed_v4_6053_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004505START domain-containing proteinSMESG000048192.1 dd_Smed_v4_498_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008716SMED30008716SMESG000020939.1 SMESG000020938.1 dd_Smed_v4_2743_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006906AnoctaminSMESG000053932.1 dd_Smed_v4_5046_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016964AnoctaminSMESG000033730.1 SMESG000033728.1 dd_Smed_v4_6514_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009176BTB domain-containing proteinSMESG000061081.1 dd_Smed_v4_7429_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010677SMED30010677SMESG000022725.1 dd_Smed_v4_9435_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001306SMED30001306SMESG000060566.1 SMESG000060556.1 dd_Smed_v4_4002_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019538SMED30019538SMESG000078196.1 dd_Smed_v4_3823_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015332Ciliogenesis-associated TTC17-interacting proteinSMESG000009424.1 dd_Smed_v4_5952_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010581SMED30010581SMESG000056022.1 dd_Smed_v4_5285_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015577KinaseSMESG000022299.1 dd_Smed_v4_3701_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005484CAAX prenyl proteaseSMESG000031464.1 dd_Smed_v4_5271_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017910SMED30017910SMESG000061777.1 dd_Smed_v4_4589_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010008SMED30010008SMESG000075346.1 dd_Smed_v4_6802_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001826SMED30001826SMESG000049480.1 dd_Smed_v4_7716_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016840PhosphodiesteraseSMESG000019038.1 dd_Smed_v4_8595_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010017E3 ubiquitin-protein ligase TRIP12SMESG000019763.1 SMESG000007808.1 dd_Smed_v4_2525_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004553SMED30004553SMESG000023121.1 dd_Smed_v4_6718_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005765PhosphodiesteraseSMESG000019038.1 dd_Smed_v4_8595_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018477Myc box-dependent-interacting protein 1SMESG000021147.1 dd_Smed_v4_3292_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005027Lysine-specific demethylase 6ASMESG000030162.1 dd_Smed_v4_12343_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012118Pyruvate kinaseSMESG000017671.1 dd_Smed_v4_6483_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009933WH1 domain-containing proteinSMESG000052345.1 dd_Smed_v4_1714_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012432SMED30012432SMESG000060566.1 SMESG000060556.1 dd_Smed_v4_4002_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014184Tumor necrosis factor alpha-induced protein 8-like proteinSMESG000002914.1 dd_Smed_v4_2386_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014133EF-hand calcium-binding domain-containing protein 10-likeSMESG000023074.1 dd_Smed_v4_6477_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010502SMED30010502SMESG000051310.1 dd_Smed_v4_15505_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012856RNA binding motif single stranded interactingSMESG000002786.1 dd_Smed_v4_7710_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002537Y box protein-1SMESG000058013.1 dd_Smed_v4_35_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017401Serine/threonine-protein kinase OSR1SMESG000052774.1 dd_Smed_v4_6126_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024412Guanine nucleotide-binding protein subunit gammaSMESG000014262.1 dd_Smed_v4_2883_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030198Lamin-B receptorSMESG000042131.1 dd_Smed_v4_2016_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023331Transposon Ty3-I Gag-Pol polyproteinSMESG000054198.1 dd_Smed_v4_6563_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031446Neuronal guanine nucleotide exchange factorSMESG000003812.1 dd_Smed_v4_5524_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030289Actin-1SMESG000058003.1 SMESG000057992.1 SMESG000057988.1 SMESG000057914.1 SMESG000057913.1 dd_Smed_v4_8957_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025346SMED30025346SMESG000048407.1 SMESG000002220.1 SMESG000002212.1 SMESG000001733.1 dd_Smed_v4_9947_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034818Guanylate cyclaseSMESG000010241.1 dd_Smed_v4_7644_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032070SMED30032070SMESG000079312.1 dd_Smed_v4_16775_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033662unconventional myosin-IdSMESG000051401.1 dd_Smed_v4_3957_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3003573414-3-3 protein epsilonSMESG000075252.1 dd_Smed_v4_1702_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031079Leishmanolysin-like peptidaseSMESG000036783.1 dd_Smed_v4_7495_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020779PhosphodiesteraseSMESG000019038.1 dd_Smed_v4_8595_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028544Zinc finger SWIM domain-containing proteinSMESG000007319.1 dd_Smed_v4_5222_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024568Parathyroid hormone/parathyroid hormone peptide receptorSMESG000081404.1 dd_Smed_v4_12602_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020070High mobility group protein B1SMESG000034017.1 dd_Smed_v4_1095_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027354Myeloid leukemia factor 1SMESG000025667.1 dd_Smed_v4_4787_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022713SMED30022713SMESG000017126.1 dd_Smed_v4_15999_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022057SJCHGC08494 proteinSMESG000027083.1 dd_Smed_v4_2196_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020007Dystrobrevin betaSMESG000078318.1 dd_Smed_v4_12275_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030948Thyroid hormone receptorSMESG000059170.1 dd_Smed_v4_7352_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028071DAB2 interacting protein bSMESG000000171.1 dd_Smed_v4_3907_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028423Leishmanolysin-like peptidaseSMESG000008405.1 dd_Smed_v4_2320_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020398Kinesin-like proteinSMESG000007019.1 dd_Smed_v4_10965_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020534Ribonuclease t2SMESG000048912.1 SMESG000020005.1 dd_Smed_v4_172_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026334Nucleolar protein isoform 2SMESG000007822.1 dd_Smed_v4_7593_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019192SMED30019192SMESG000072463.1 dd_Smed_v4_12173_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012694Krueppel-like factor 11SMESG000025482.1 dd_Smed_v4_3638_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012572Leucine--tRNA ligaseSMESG000071689.1 dd_Smed_v4_9705_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017079LRRCC1SMESG000016752.1 dd_Smed_v4_10086_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009793Dach-2SMESG000033540.1 dd_Smed_v4_11289_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010277SMED30010277SMESG000000133.1 dd_Smed_v4_8640_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001871SMED30001871SMESG000045185.1 SMESG000045184.1 dd_Smed_v4_4812_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005622G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000051347.1 dd_Smed_v4_16800_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013744SMED30013744SMESG000001468.1 dd_Smed_v4_5675_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016328Cubilin (intrinsic factor-cobalamin receptor)SMESG000068883.1 dd_Smed_v4_4575_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004519Novel proteinSMESG000039682.1 dd_Smed_v4_2676_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015451Ig-like domain-containing proteinSMESG000025920.1 dd_Smed_v4_11533_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010117SMED30010117SMESG000000893.1 dd_Smed_v4_5234_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000174Ribosomal protein S6 kinase delta-1SMESG000004118.1 SMESG000004112.1 dd_Smed_v4_9766_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012136radial spoke head protein 9 homologSMESG000046857.1 dd_Smed_v4_4707_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016591Protein big brotherSMESG000068819.1 dd_Smed_v4_2875_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002094SMED30002094SMESG000003128.1 SMESG000003117.1 dd_Smed_v4_2294_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015660SMED30015660SMESG000018225.1 SMESG000017035.1 dd_Smed_v4_1426_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017333centrosomal protein of 83 kDa-likeSMESG000033227.1 SMESG000033225.1 dd_Smed_v4_12969_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009956SMED30009956SMESG000022272.1 dd_Smed_v4_10991_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012648cullin-5-likeSMESG000020142.1 dd_Smed_v4_8238_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016203SMED30016203SMESG000030489.1 dd_Smed_v4_11685_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30003084Cilia-and flagella-associated protein 45SMESG000016410.1 dd_Smed_v4_3732_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013396perilipin-2 isoform X1SMESG000075481.1 dd_Smed_v4_154_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017300SMED30017300SMESG000001317.1 dd_Smed_v4_520_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017381Protein polybromo-1SMESG000004446.1 dd_Smed_v4_4218_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017180Dynein regulatory complex protein 1SMESG000072168.1 dd_Smed_v4_8761_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010098Receptor protein serine/threonine kinaseSMESG000068827.1 dd_Smed_v4_7151_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027132Calcineurin subunit B typeSMESG000081409.1 dd_Smed_v4_5589_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028591Protein kinaseSMESG000030545.1 dd_Smed_v4_11177_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031216Oxysterol-binding proteinSMESG000023068.1 dd_Smed_v4_3268_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028237PMP-22/EMP/MP20/Claudin tight junctionSMESG000028931.1 dd_Smed_v4_2132_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034525Dynein light chainSMESG000008592.1 dd_Smed_v4_9661_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020977SMED30020977SMESG000069851.1 dd_Smed_v4_9493_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022193SMED30022193SMESG000069851.1 dd_Smed_v4_9493_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022428RING-type domain-containing proteinSMESG000010565.1 dd_Smed_v4_10741_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028743Regulator of G-protein signaling 22SMESG000069110.1 dd_Smed_v4_11778_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032668Axonemal dynein light chain domain containing 1SMESG000011833.1 dd_Smed_v4_8788_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028023adenylate kinase 7SMESG000075900.1 dd_Smed_v4_7959_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031361Ig-like domain-containing proteinSMESG000026986.1 dd_Smed_v4_9128_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020076C2H2-type domain-containing proteinSMESG000055233.1 dd_Smed_v4_14364_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30029550ArfGAP with coiled-coil, ankyrin repeat and PH domains 1SMESG000026501.1 dd_Smed_v4_2261_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034724Actin-related protein 10-likeSMESG000009976.1 dd_Smed_v4_2141_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020090Zinc finger protein 541SMESG000015209.1 dd_Smed_v4_6649_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30029792PolyubiquitinSMESG000079959.1 dd_Smed_v4_2001_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3002338613 kDa deflagellation-inducible proteinSMESG000050233.1 dd_Smed_v4_3576_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021083Monocarboxylate transporterSMESG000010271.1 dd_Smed_v4_10683_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024416Potassium channel tetramerization domain containing 1SMESG000067417.1 dd_Smed_v4_3793_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024860SMED30024860SMESG000001317.1 dd_Smed_v4_520_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035260SMED30035260SMESG000035564.1 dd_Smed_v4_12208_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032094RIIa domain-containing protein 1SMESG000079320.1 dd_Smed_v4_4716_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034451Transmembrane protein 220SMESG000010766.1 SMESG000010767.1 dd_Smed_v4_1981_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027878Dynein light chainSMESG000042102.1 dd_Smed_v4_15092_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024754CystatinSMESG000034246.1 dd_Smed_v4_423_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033453Dimer_Tnp_hAT domain-containing proteinSMESG000001790.1 dd_Smed_v4_212_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025750Myb/SANT-like DNA-binding domainSMESG000016880.1 dd_Smed_v4_4381_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021957SMED30021957SMESG000039476.1 dd_Smed_v4_9685_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032675Glutamine-rich protein 2SMESG000081231.1 dd_Smed_v4_6048_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027019InnexinSMESG000030971.1 SMESG000030964.1 dd_Smed_v4_10061_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026124Dynein heavy chain, axonemalSMESG000040511.1 dd_Smed_v4_6557_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022121SMED30022121SMESG000042798.1 dd_Smed_v4_2204_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020666Glutamine-rich protein 2SMESG000081231.1 dd_Smed_v4_6048_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022009CEP97SMESG000041551.1 dd_Smed_v4_11066_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022421RIB43A-like with coiled-coils protein 2SMESG000037028.1 dd_Smed_v4_4547_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013041SMED30013041SMESG000049878.1 dd_Smed_v4_4914_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30003079Prominin (Prom) protein, putativeSMESG000062666.1 dd_Smed_v4_4461_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012741SMED30012741SMESG000027631.1 dd_Smed_v4_5686_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30003800SMED30003800SMESG000052963.1 SMESG000047933.1 dd_Smed_v4_20623_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011084Epidermal growth factor receptor kinase substrate 8SMESG000070650.1 dd_Smed_v4_4256_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015587Dual specificity protein phosphatase 14SMESG000037868.1 dd_Smed_v4_7558_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009142Hepatoma derived growth factor proteinSMESG000037796.1 SMESG000057565.1 SMESG000057564.1 dd_Smed_v4_2842_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001880Lysine-specific demethylase 3BSMESG000051397.1 SMESG000006486.1 dd_Smed_v4_2582_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30003887c-Myc-binding proteinSMESG000001466.1 dd_Smed_v4_891_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000896Coiled-coil domain-containing protein 186SMESG000062953.1 dd_Smed_v4_14004_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019836CCDC151SMESG000007771.1 dd_Smed_v4_4526_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002486slc31a-1SMESG000005775.1 dd_Smed_v4_1513_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000514SMED30000514SMESG000036214.1 dd_Smed_v4_10854_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30003011NPHP1SMESG000061008.1 dd_Smed_v4_9990_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30003301RotatinSMESG000018486.1 dd_Smed_v4_13117_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015301SMED30015301SMESG000024440.1 dd_Smed_v4_7463_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017053SMED30017053SMESG000004885.1 dd_Smed_v4_5297_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018827GDT1 family proteinSMESG000008670.1 dd_Smed_v4_3586_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001788PhosphoglucomutaseSMESG000069481.1 dd_Smed_v4_4058_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009591Tumor protein D54SMESG000037796.1 SMESG000057565.1 SMESG000057564.1 dd_Smed_v4_2842_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009076ActinSMESG000066035.1 SMESG000066029.1 SMESG000066027.1 SMESG000066020.1 dd_Smed_v4_37_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018830Suppressor of cytokine signaling 7SMESG000051397.1 SMESG000006486.1 dd_Smed_v4_2582_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019006Tubulin beta chainSMESG000022928.1 dd_Smed_v4_341_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007850SMED30007850SMESG000001248.1 dd_Smed_v4_3418_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012977SMED30012977SMESG000076174.1 dd_Smed_v4_2880_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014980LaminSMESG000009886.1 dd_Smed_v4_850_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30003951Tektin-4SMESG000016881.1 dd_Smed_v4_37536_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013686MAP3K-1SMESG000054386.1 dd_Smed_v4_5198_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030943SMED30030943SMESG000014776.1 dd_Smed_v4_5015_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033655Bestrophin homologSMESG000069980.1 dd_Smed_v4_9590_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031458Zinc finger, FYVE domain containing 16SMESG000036666.1 dd_Smed_v4_6618_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034139Receptor-type tyrosine-protein phosphatase betaSMESG000005260.1 dd_Smed_v4_5733_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026808EF-hand domain-containing proteinSMESG000081370.1 dd_Smed_v4_446_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031238Tyrosine-protein kinaseSMESG000053399.1 dd_Smed_v4_8740_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030294SMED30030294SMESG000026870.1 dd_Smed_v4_2495_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30029274SMED30029274SMESG000014251.1 dd_Smed_v4_9793_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008971SMED30008971 dd_Smed_v4_11595_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005776SMED30005776 dd_Smed_v4_11737_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014164Vacuolar protein sorting-associated protein 29 dd_Smed_v4_1727_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004099SMED30004099 dd_Smed_v4_15498_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005911SMED30005911 dd_Smed_v4_12_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001449Propionyl-CoA carboxylase subunit beta dd_Smed_v4_513_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011727Dedicator of cytokinesis 4bSMESG000063593.1 SMESG000063592.1 SMESG000063595.1 dd_Smed_v4_6156_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000682SMED30000682 dd_Smed_v4_1303_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006990SMED30006990 dd_Smed_v4_9735_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005555Tigger transposable element-derived protein 1 dd_Smed_v4_20966_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013261Retrovirus-related Pol polyprotein from transposon dd_Smed_v4_15498_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034412E3 ubiquitin-protein ligase CBLSMESG000056433.1 dd_Smed_v4_6780_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035317Phosphoglycerate kinaseSMESG000039090.1 dd_Smed_v4_972_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034629Golgi-associated plant pathogenesis-related protein 1SMESG000063568.1 dd_Smed_v4_762_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035834slc4a-2SMESG000057490.1 dd_Smed_v4_7905_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035175AnoctaminSMESG000065607.1 dd_Smed_v4_6809_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034196Tyrosine-protein phosphatase non-receptor typeSMESG000023435.1 dd_Smed_v4_6928_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015405Adiponectin receptor protein dd_Smed_v4_19374_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016918UPF0466 protein-like dd_Smed_v4_5792_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013863Rac-1SMESG000024961.1 dd_Smed_v4_610_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30003118SMED30003118SMESG000006534.1 dd_Smed_v4_4662_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016525SMED30016525 dd_Smed_v4_20626_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013141Pleckstrin homology domain-containing family F member 2-like protein dd_Smed_v4_2374_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019038SMED30019038 dd_Smed_v4_12777_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018518Protein chibby 1 dd_Smed_v4_11618_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004331SMED30004331 dd_Smed_v4_37267_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015411GLTP domain-containing protein dd_Smed_v4_2621_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002024ATP-binding cassette sub-family D member 3SMESG000031072.1 dd_Smed_v4_6907_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011747SMED30011747 dd_Smed_v4_494_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017863SMED30017863 dd_Smed_v4_3302_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016593SMED30016593 dd_Smed_v4_13795_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016430SMED30016430 dd_Smed_v4_275_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001870SMED30001870 dd_Smed_v4_4311_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015685TNF receptor-associated factor dd_Smed_v4_5740_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012829SMED30012829 dd_Smed_v4_35980_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011383NEDD8 dd_Smed_v4_403_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010157SMED30010157 dd_Smed_v4_28622_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013441WD repeat domain 78SMESG000047563.1 dd_Smed_v4_8721_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014731SMED30014731 dd_Smed_v4_5494_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024009ADP-ribosylation factor-like protein 16 dd_Smed_v4_5801_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028299DDE_3 domain-containing protein dd_Smed_v4_6265_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031987SMED30031987 dd_Smed_v4_3434_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023308SMED30023308SMESG000063568.1 dd_Smed_v4_762_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035631SMED30035631 dd_Smed_v4_339_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023613SMED30023613 dd_Smed_v4_12778_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024376SMED30024376 dd_Smed_v4_19998_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034936SMED30034936 dd_Smed_v4_13714_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025953SMED30025953 dd_Smed_v4_5792_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026188ER membrane protein complex subunit 10 dd_Smed_v4_2594_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30029212PiggyBac transposable element-derived protein 4 dd_Smed_v4_19998_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034824SMED30034824SMESG000035183.1 dd_Smed_v4_951_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033439Voltage-dependent L-type calcium channel subunit alphaSMESG000016041.1 SMESG000016040.1 dd_Smed_v4_9877_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3003333640S ribosomal protein S29 dd_Smed_v4_214_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035174SMED30035174 dd_Smed_v4_6013_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026350slc26a-8SMESG000064562.1 dd_Smed_v4_4250_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30036035SMED30036035 dd_Smed_v4_11595_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030887SMED30030887 dd_Smed_v4_339_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025058SMED30025058 dd_Smed_v4_38794_0_2dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034308Integrase catalytic domain-containing protein dd_Smed_v4_12778_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30029781SMED30029781 dd_Smed_v4_1213_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033869SMED30033869 dd_Smed_v4_6382_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025844SMED30025844 dd_Smed_v4_4311_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035382C2 domainSMESG000068709.1 dd_Smed_v4_7138_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026477SMED30026477 dd_Smed_v4_275_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031165TNF receptor-associated factor dd_Smed_v4_5740_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30024875SMED30024875 dd_Smed_v4_20913_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022007SMED30022007 dd_Smed_v4_90717_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023388GRB2 associated binding protein-1 dd_Smed_v4_5117_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021397Kunitz-type serine protease inhibitor dd_Smed_v4_12691_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001792Retinal pigment epithelium-derived rhodopsin homologSMESG000045023.1 dd_Smed_v4_7301_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30015546Cyclic AMP-responsive element-binding protein 3SMESG000059546.1 dd_Smed_v4_1032_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004353Bestrophin homologSMESG000030918.1 dd_Smed_v4_9659_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013766Matrin-type domain-containing proteinSMESG000072403.1 dd_Smed_v4_1859_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000883Glutathione S-transferaseSMESG000015099.1 SMESG000015094.1 SMESG000014182.1 dd_Smed_v4_1517_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017854SMED30017854SMESG000014767.1 dd_Smed_v4_75560_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005336Phtf-FEM1B_bdg domain-containing proteinSMESG000058788.1 dd_Smed_v4_8465_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012622Intraflagellar transport 43SMESG000067883.1 dd_Smed_v4_5237_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010475EF Hand type proteinSMESG000065951.1 dd_Smed_v4_8441_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006820cilia- and flagella-associated protein 57SMESG000072029.1 dd_Smed_v4_3323_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019535Protein lifeguard 2SMESG000057144.1 dd_Smed_v4_1586_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019092Glutathione S-transferaseSMESG000015099.1 SMESG000015094.1 SMESG000014182.1 dd_Smed_v4_1517_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017127Tektin 3SMESG000062615.1 dd_Smed_v4_6883_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006095Aspartate aminotransferaseSMESG000022764.1 dd_Smed_v4_2004_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013493slc5a-2SMESG000013622.1 dd_Smed_v4_6663_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016265Tubulin beta chainSMESG000022928.1 dd_Smed_v4_341_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30003152Lambda-crystallin homologSMESG000050288.1 dd_Smed_v4_1696_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013386netrin 1SMESG000006806.1 dd_Smed_v4_9795_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017264SMED30017264SMESG000055031.1 dd_Smed_v4_2419_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000377Membrane-associated guanylate kinase, WW and PDZ domain-containing protein 1SMESG000026494.1 dd_Smed_v4_5498_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010842EF-hand domain-containing protein 1SMESG000078434.1 dd_Smed_v4_2935_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017794Coiled-coil domain containing 191SMESG000064321.1 dd_Smed_v4_8967_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012300SMED30012300SMESG000013739.1 dd_Smed_v4_5519_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002040Endothelin converting enzyme 2SMESG000069765.1 SMESG000070035.1 dd_Smed_v4_5256_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008550intraflagellar transport protein 20 homologSMESG000067757.1 dd_Smed_v4_9545_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002213Zinc finger, C2H2 typeSMESG000075102.1 dd_Smed_v4_3443_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004459Cytoplasmic FMR1-interacting proteinSMESG000062092.1 dd_Smed_v4_1820_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009913Beta-ureidopropionaseSMESG000060425.1 dd_Smed_v4_1584_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009255Solute carrier family 12 member 9SMESG000033021.1 dd_Smed_v4_1738_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30003609Chloride intracellular channel protein 4SMESG000054543.1 dd_Smed_v4_2382_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011770Unconventional myosin-XVISMESG000041981.1 dd_Smed_v4_4268_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011516hypothetical proteinSMESG000039929.1 dd_Smed_v4_5959_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010638DNA-binding protein inhibitor ID-2SMESG000017492.1 dd_Smed_v4_11911_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000126Centrosomal protein 95SMESG000002923.1 dd_Smed_v4_8515_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008578TitinSMESG000029197.1 dd_Smed_v4_866_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011715Splicing factor, arginine/serine-rich 6SMESG000041210.1 dd_Smed_v4_1177_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014550Intraflagellar transport protein 43SMESG000067883.1 dd_Smed_v4_5237_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004447Family with sequence similarity 184 member ASMESG000058677.1 dd_Smed_v4_16975_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018766Centrosomal protein of 120 kDaSMESG000006990.1 dd_Smed_v4_10444_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008076Reverse transcriptase domain-containing proteinSMESG000008737.1 dd_Smed_v4_540_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005692Cytoplasmic dynein 2 heavy chain 1SMESG000008384.1 SMESG000008382.1 dd_Smed_v4_9136_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001031TRAF3-interacting protein 1SMESG000006345.1 dd_Smed_v4_10562_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006773Calpain-BSMESG000039299.1 dd_Smed_v4_1752_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005213Band 4.1-like protein 5SMESG000007133.1 dd_Smed_v4_4114_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30001828dynein assembly factor 3, axonemalSMESG000017259.1 dd_Smed_v4_6686_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002042Ring finger and FYVE-like domain containing E3 ubiquitin protein ligaseSMESG000021295.1 dd_Smed_v4_9114_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011985MRVI1-like proteinSMESG000055459.1 dd_Smed_v4_6446_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013563Serine/threonine-protein kinase 10SMESG000064983.1 dd_Smed_v4_5720_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000749Cell wall integrity and stress response component 1SMESG000035060.1 dd_Smed_v4_5024_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010405SMED30010405SMESG000043444.1 SMESG000043435.1 dd_Smed_v4_18_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012262SMED30012262SMESG000013006.1 dd_Smed_v4_6779_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008385Solute carrier family 13 member 2SMESG000041335.1 dd_Smed_v4_12964_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014820Centrosomal protein of 135 kDa (Cep135 protein) (Centrosomal protein 4), putativeSMESG000052451.1 dd_Smed_v4_11072_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011623SMED30011623SMESG000043444.1 SMESG000043435.1 dd_Smed_v4_18_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017371Adenylosuccinate lyaseSMESG000014474.1 dd_Smed_v4_2280_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007558SMED30007558SMESG000071865.1 dd_Smed_v4_4209_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008638SMED30008638SMESG000013006.1 dd_Smed_v4_6779_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022699SMED30022699SMESG000056221.1 SMESG000046858.1 SMESG000029613.1 SMESG000025472.1 SMESG000023703.1 SMESG000011090.1 dd_Smed_v4_17710_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035047Sperm associated antigen 17SMESG000038878.1 dd_Smed_v4_9301_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028883peptidoglycan recognition protein-1SMESG000063454.1 SMESG000063448.1 SMESG000047150.1 SMESG000037421.1 dd_Smed_v4_9550_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025071Calcium/calmodulin-dependent protein kinase type IISMESG000008997.1 dd_Smed_v4_7480_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020825Protein I'm not dead yetSMESG000041335.1 dd_Smed_v4_12964_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027735SMED30027735SMESG000069765.1 SMESG000070035.1 dd_Smed_v4_5256_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023490SMED30023490SMESG000076531.1 dd_Smed_v4_7027_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027686Bestrophin homologSMESG000054993.1 dd_Smed_v4_8314_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30029528Zinc finger proteinSMESG000067419.1 dd_Smed_v4_10260_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032665SMED30032665SMESG000024489.1 dd_Smed_v4_5366_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027991L-2-hydroxyglutarate dehydrogenase, mitochondrialSMESG000046453.1 SMESG000024353.1 dd_Smed_v4_1758_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30029450Succinyl-CoA:3-ketoacid-coenzyme A transferaseSMESG000080424.1 dd_Smed_v4_1189_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30032411E3 ubiquitin-protein ligaseSMESG000030063.1 dd_Smed_v4_9145_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021143Basal body-orientation factor 1SMESG000078046.1 dd_Smed_v4_9328_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031519Tyrosine-protein kinaseSMESG000020289.1 dd_Smed_v4_9416_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3002989139S ribosomal protein L50, mitochondrialSMESG000043091.1 dd_Smed_v4_5023_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021410SMED30021410SMESG000078466.1 SMESG000050786.1 SMESG000024968.1 dd_Smed_v4_3128_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020678G-protein, gamma subunit,domain-containing proteinSMESG000066557.1 dd_Smed_v4_1237_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034381Malate dehydrogenaseSMESG000056995.1 dd_Smed_v4_467_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30026782Cilia-and flagella-associated protein 58SMESG000061980.1 dd_Smed_v4_5727_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031794Myocyte-specific enhancer factor 2A homologSMESG000040479.1 SMESG000040478.1 SMESG000038141.1 dd_Smed_v4_6889_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027929Tubulin beta chainSMESG000022928.1 dd_Smed_v4_341_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027929Tubulin beta chainSMESG000022928.1 dd_Smed_v4_471_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30029834Hemoglobin C1 polymerSMESG000048630.1 SMESG000022261.1 dd_Smed_v4_4497_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30027510G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000063454.1 SMESG000063448.1 SMESG000047150.1 SMESG000037421.1 dd_Smed_v4_9550_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033094AdenosylhomocysteinaseSMESG000055982.1 dd_Smed_v4_5492_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30022142SMED30022142SMESG000070064.1 SMESG000070059.1 dd_Smed_v4_3829_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30029711SMED30029711SMESG000039803.1 dd_Smed_v4_3788_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034660Spectrin beta chain, non-erythrocytic 5SMESG000023006.1 dd_Smed_v4_2514_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30030286Tctex1 domain containing 2SMESG000027829.1 dd_Smed_v4_7666_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30028223Stabilizer of axonemal microtubules 1SMESG000042230.1 dd_Smed_v4_5551_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30021222Meiosis specific nuclear structural 1SMESG000036318.1 dd_Smed_v4_4463_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025672Radial spoke head 3SMESG000067698.1 dd_Smed_v4_2287_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031633enkurin isoform X1SMESG000076528.1 dd_Smed_v4_2868_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035495Ankyrin repeat domain-containing 42SMESG000005009.1 dd_Smed_v4_10615_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025325Neurogenic locus notch proteinSMESG000063217.1 dd_Smed_v4_7067_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30033412CLIP-associating protein 1SMESG000072426.1 dd_Smed_v4_5069_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30025830Ornithine decarboxylaseSMESG000015244.1 SMESG000015241.1 SMESG000004848.1 SMESG000004822.1 SMESG000004820.1 SMESG000004806.1 dd_Smed_v4_280_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30034376slc6a-5SMESG000042091.1 dd_Smed_v4_4290_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30020525Dynein intermediate chain 2, ciliarySMESG000001839.1 SMESG000001830.1 dd_Smed_v4_4753_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031564Rho GTPase-activating protein 5SMESG000072461.1 dd_Smed_v4_8436_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30031722ANK_REP_REGION domain-containing proteinSMESG000022931.1 dd_Smed_v4_11187_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30023210PhosphodiesteraseSMESG000034055.1 SMESG000034048.1 dd_Smed_v4_9276_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30035226AnnexinSMESG000023108.1 dd_Smed_v4_5798_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012075SMED30012075SMESG000059352.1 SMESG000059351.1 dd_Smed_v4_420_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000404SMED30000404SMESG000012897.1 dd_Smed_v4_6875_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017663Fer-1-relatedSMESG000070967.1 dd_Smed_v4_4648_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005945dishevelled-associated activator of morphogenesis 1SMESG000040024.1 dd_Smed_v4_3928_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008211Dedicator of cytokinesisSMESG000079286.1 SMESG000079280.1 SMESG000017839.1 dd_Smed_v4_11826_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011644tRNA wybutosine-synthesizing protein 3 homologSMESG000069968.1 SMESG000069969.1 dd_Smed_v4_180_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006230Sperm surface protein Sp17SMESG000046919.1 dd_Smed_v4_4783_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006230Sperm surface protein Sp17SMESG000046919.1 dd_Smed_v4_2279_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002228Ig-like domain-containing proteinSMESG000024613.1 dd_Smed_v4_7050_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004118Tubulin beta chainSMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044888.1 SMESG000035755.1 dd_Smed_v4_83_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30019531NPHP6SMESG000072747.1 dd_Smed_v4_7145_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014170Luc7-like protein 3SMESG000047550.1 SMESG000047494.1 dd_Smed_v4_3724_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007670DystrobrevinSMESG000078318.1 dd_Smed_v4_12275_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004972SMED30004972SMESG000007019.1 dd_Smed_v4_10965_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009893RNA-binding proteinSMESG000006741.1 dd_Smed_v4_11008_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007867OtoferlinSMESG000010400.1 dd_Smed_v4_14162_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012628ADP ribosylation factorSMESG000033952.1 dd_Smed_v4_2125_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009112plexin-D1-likeSMESG000033280.1 dd_Smed_v4_11809_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013591Fructose-bisphosphate aldolaseSMESG000027545.1 dd_Smed_v4_398_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016457SMED30016457SMESG000040036.1 dd_Smed_v4_21280_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010506J domain-containing proteinSMESG000009124.1 dd_Smed_v4_4016_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30016322SeptinSMESG000016474.1 dd_Smed_v4_1198_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002938SH3 and multiple ankyrin repeat domains protein 2SMESG000078048.1 dd_Smed_v4_10116_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED300059124-coumarate--CoA ligase family proteinSMESG000041777.1 dd_Smed_v4_10135_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010664SMED30010664SMESG000053423.1 dd_Smed_v4_8209_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007517IQ domain-containing protein E-likeSMESG000013899.1 SMESG000013896.1 dd_Smed_v4_7345_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30012763serine incorporatorSMESG000038788.1 dd_Smed_v4_1419_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007314Stimulated by retinoic acid gene 6-like proteinSMESG000031046.1 dd_Smed_v4_10051_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005521EF-hand domain-containing proteinSMESG000006807.1 dd_Smed_v4_6707_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30017647SMED30017647SMESG000013908.1 dd_Smed_v4_1173_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014981Gelsolin-like proteinSMESG000015924.1 dd_Smed_v4_1673_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014813Y box protein-1SMESG000058013.1 dd_Smed_v4_35_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30013227WD repeat-containing proteinSMESG000042025.1 dd_Smed_v4_9187_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009181Non-specific serine/threonine protein kinaseSMESG000057003.1 SMESG000037136.1 dd_Smed_v4_4425_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008606CD164SMESG000008757.1 dd_Smed_v4_828_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004194SMED30004194SMESG000009646.1 dd_Smed_v4_12139_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004194SMED30004194SMESG000009646.1 dd_Smed_v4_23871_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30010619Potassium voltage-gated channel subfamily KQT member 1SMESG000078460.1 dd_Smed_v4_10387_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED300189611.C3.2SMESG000049306.1 dd_Smed_v4_406_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002256coiled-coil domain-containing protein 81SMESG000036887.1 dd_Smed_v4_6753_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009251coiled-coil domain-containing protein 146SMESG000006416.1 dd_Smed_v4_6858_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006260Sh3 domain-binding glutamic acid-rich-like proteinSMESG000018980.1 dd_Smed_v4_4404_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30004532Y box protein-1SMESG000058013.1 dd_Smed_v4_35_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005883Coiled-coil domain containing 81SMESG000036887.1 dd_Smed_v4_6753_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30000421TPR_REGION domain-containing proteinSMESG000071973.1 dd_Smed_v4_11462_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30006047EF-hand calcium-binding domain-containing protein 5SMESG000053423.1 dd_Smed_v4_8209_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014236Transmembrane protein 86ASMESG000038930.1 dd_Smed_v4_5848_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008163Usp domain-containing proteinSMESG000039918.1 dd_Smed_v4_2433_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30007217Death domain-containing proteinSMESG000078437.1 dd_Smed_v4_7428_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30005654SMED30005654SMESG000044586.1 dd_Smed_v4_6921_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30008349Histone-lysine N-methyltransferase SETMARSMESG000017253.1 SMESG000015137.1 dd_Smed_v4_1612_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30018386Inositol 1,4,5-trisphosphate receptor type 3SMESG000070557.1 dd_Smed_v4_14214_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30014233SMED30014233SMESG000045992.1 dd_Smed_v4_6974_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED3000599860s ribosomal protein l3SMESG000081260.1 dd_Smed_v4_12559_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30011296SMED30011296SMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044888.1 SMESG000035755.1 dd_Smed_v4_83_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30002736DNA topoisomerase ISMESG000055403.1 dd_Smed_v4_2421_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult single-cell RNA-sequencing evidence
protonephridiaSMED30009510intraflagellar transport protein 80 homologSMESG000066998.1 dd_Smed_v4_9110_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult