muscle progenitor cell

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ In Situ Hybridization Data

  ▻ Sequences

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  muscle progenitor cell


DEFINITON:

  Progenitor neoblasts implicated in the maintenance and regeneration of muscle fibers.


TERM DEFINITION CITATIONS:

  PMID:25017721


TERM CITATIONS:


TERM ID:

  PLANA:0000019


ABOUT THIS TERM:

muscle progenitor cell

  ↳is a progenitor cell

  ↳part of musculature system


  → longitudinal muscle progenitor cell and circular muscle progenitor cell is a muscle progenitor cell



BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30008639AAN03696.1MyoD-like proteinmyoDStage 5, Stage 6, Stage 7, Stage 8musculature system, muscle progenitor cell
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30008639 ID=SMED30008639|Name=MyoD-like protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1606bp
GTTCATATTACCAACTGTTCGCCATTAATTCAGCCTGTTTTACGCCTCGTAACAACTGTTACTTCAACAATACCGATCCA
GCCCAATAAACAATGATACACTCCGGATCATTTCCAGGTTCCACTTGTCCGATTAACTATGACTATTCCGGTCCATACTC
AGCAGGTCTTGAGGCAGCTCCATTTTTAGTCAATCAAACCTGTCCATATAACACTGGAACAAATACAATGCCTCCTTCGT
TGTCACTAGTAGATAATATGATGATGAATAATTCCATGCATCTTTATGATAGACTGAATACTCATCATTCAGCGTCGTAT
TTTCCTCAGATTTTAAACAAAATCGAACAGAAATTACCAACAACCTCGAGTAAAACCACTCCATCAACATTGGTTTCAAC
ATCCTCCAATTCCATATCGAATTCTGAGTTTAATTCGTCGCGATCTTCGTCACAATTTCCAACATACGATTTGATTTCGT
CACTCAATAATAGCAACTACGACATGTACGATTCGCCCTATGCCGCCTATCTGGCCGCTGGTTATTATCAATCTCCTGGA
TTTGCGCTCAAACAGTACGACGCTGCTGGAACATCTCAACCATCAATGACAGATTTGTACCATTCATCACTAGCAGCCAG
TTCAGGCTTAAATTTGAATTATTCACAGCATAAATCGAGACATTTATCAGAAGATGCTGGATCATGCCAAGATCCGCAGT
CTCAAAATATCACAAGCAATAATCATCATAACAATTCGTATAGTCCAACAACTGCTGATTTCGGATCACCAAAAGCCTTA
TCAAGTAGCAGCCAGTCCATAAATGATGGAAGACAACCGACCAGTAGTAATTCCAGTCCTCAAAAACTATCACTAGCAAT
TGAACAACACTTATGTCCAAATAAAGAGGAACATGTGCTAGTTCCAGGGTCACATGGTCAATGCTTGTTGTGGGCCTGTA
AAGCTTGCAAAAAGAAAACGGTTCACGTTGATCGCCGCAAAGCGGCAACAATGCGTGAAAGACGTCGATTGAGAAAAGTG
AATGAAGCTTTTGAAACATTGAAACGAAGAACGAGCGGTAACCCAAATCAAAGAATGCCAAAAGTCGAAATTCTAAAGAA
CGCGATTGATTACATTGAGAGTTTGGAAGAGTTGTTGAATTCCGTGGGAAAATTACCTGCAACCGTTGGAGAATTGAAAG
AACGCCGCAAAAACAACCCAGAAAATTCGAGAACAGCAATCGCCGGAAAACAAAAGCCACTAAATAAAATTAATGATAAA
CAGAAAGCTGAAAACAAATATCCCGAGACCATCTGCAAACTCCCGACGACTAGGAAATCCTATGTTGCTTCCGACCTTGA
TCAGCAGATTTATCAATCAAACATGTTGAAGAGTTCAACTCTTGATCAACTTTCCTCGATAGTAGACAAAATCTCTACGA
CTAATACAACAATTGCCGACCATTCAATGGACGCTAAGCCCGAAAATAGTTGAATACATAACAAAACGCAACAAATATTA
TATTAACCTATTAATTTTGTTCTAAACTCGTTTGCCCTGATACATATTGTACATTTTCTTTCAATAGAATGTTCTTATAA
TTATAA

 

back to top



PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in muscle progenitor cell. Click this link to learn more about PAGE.


PAGE Curations: 60


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
muscle progenitor cellSMED30002925Protein jagged-1b SMED30002925smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30009076actin beta SMED30009076smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30002877IQ motif and SEC7 domain-containing protein 1 SMED30002877smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30014105protocadherin 11 Y-linked SMED30014105smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30009076actin gamma 1 SMED30009076smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30019763NudC domain containing 1 SMED30019763smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30015413RAB28, member RAS oncogene family SMED30015413smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30015467IQ motif and SEC7 domain-containing protein 1 SMED30002877smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30002081 SMED30002081smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30009380 SMED30009380smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30010450 SMED30010450smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30002753 SMED30002753smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30008639Transcription factor SUM-1 KF487099.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
muscle progenitor cellSMED30008639Transcription factor SUM-1 KF487099.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
muscle progenitor cellSMED30008639Transcription factor SUM-1 KF487099.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 5 fluorescence in situ hybridization evidence
muscle progenitor cellSMED30008639Transcription factor SUM-1 KF487099.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 5 colorimetric in situ hybridization evidence
muscle progenitor cellSMED30008639Transcription factor SUM-1 KF487099.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
muscle progenitor cellSMED30008639Transcription factor SUM-1 myoDsmed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
muscle progenitor cellSMED30008639Transcription factor SUM-1 myoDsmed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 5 fluorescence in situ hybridization evidence
muscle progenitor cellSMED30008639Transcription factor SUM-1 myoDsmed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 5 colorimetric in situ hybridization evidence
muscle progenitor cellSMED30008639Transcription factor SUM-1 myoDsmed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
muscle progenitor cellSMED30008639Transcription factor SUM-1 myoDsmed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
muscle progenitor cellSMED30008639Transcription factor SUM-1 SMED30008639smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 5 colorimetric in situ hybridization evidence
muscle progenitor cellSMED30008639Transcription factor SUM-1 SMED30008639smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
muscle progenitor cellSMED30008639Transcription factor SUM-1 SMED30008639smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
muscle progenitor cellSMED30008639Transcription factor SUM-1 SMED30008639smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 5 fluorescence in situ hybridization evidence
muscle progenitor cellSMED30008639Transcription factor SUM-1 SMED30008639smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
muscle progenitor cellSMED30009076actin beta dd_Smed_v6_37_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30009076actin beta dd_Smed_v6_90_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30009076actin gamma 1 dd_Smed_v6_37_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30009076actin gamma 1 dd_Smed_v6_90_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30025388Paramyosin; transcript_id=FBtr0076594 dd_Smed_v6_579_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30015413RAB28, member RAS oncogene family dd_Smed_v6_375_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30022232glutathione S-transferase alpha 5 dd_Smed_v6_1206_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30006119X-box-binding protein 1 dd_Smed_v6_415_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30009274EF-hand domain-containing protein dd_Smed_v6_990_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30008655tubulin alpha chain dd_Smed_v6_508_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30003429EF-hand domain-containing protein dd_Smed_v6_990_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30013416EF-hand domain-containing protein dd_Smed_v6_990_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30002983Tropomyosin 2; transcript_id=FBtr0083080 dd_Smed_v6_436_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30028938protein disulfide isomerase family A member 6 dd_Smed_v6_250_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30021896serine and arginine rich splicing factor 11 dd_Smed_v6_1935_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30026887Myosin alkali light chain 1 dd_Smed_v6_223_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30015575collagen type IV alpha 2 chain dd_Smed_v6_2337_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30015813solute carrier family 3 member 1 dd_Smed_v6_2113_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30014980lamin B1 dd_Smed_v6_850_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30027460troponin T3, fast skeletal type dd_Smed_v6_323_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30027903Calreticulin; transcript_id=FBtr0082103 dd_Smed_v6_220_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30017516collagen type XIII alpha 1 dd_Smed_v6_2197_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30034254calreticulin dd_Smed_v6_220_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30026663tropomyosin 1 dd_Smed_v6_405_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30028808Calreticulin; transcript_id=FBtr0082103 dd_Smed_v6_220_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30027976 dd_Smed_v6_15945_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30005911 dd_Smed_v6_12_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30010499 dd_Smed_v6_6915_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30009565 dd_Smed_v6_6915_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30031902 dd_Smed_v6_6915_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30020950 dd_Smed_v6_6915_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30010488 dd_Smed_v6_70_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30035658 dd_Smed_v6_6998_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Note: Hover over icons to view figure legend

 

 

back to top