muscle progenitor cell

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ In Situ Hybridization Data

  ▻ Sequences

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  muscle progenitor cell


DEFINITON:

  Progenitor neoblasts implicated in the maintenance and regeneration of muscle fibers.


TERM DEFINITION CITATIONS:

  PMID:25017721


TERM CITATIONS:


TERM ID:

  PLANA:0000019


ABOUT THIS TERM:

muscle progenitor cell

  ↳is a progenitor cell

  ↳part of musculature system


  → longitudinal muscle progenitor cell and circular muscle progenitor cell is a muscle progenitor cell



BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30008639AAN03696.1MyoD-like proteinmyoDStage 5, Stage 6, Stage 7, Stage 8musculature system, muscle progenitor cell
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30008639 ID=SMED30008639|Name=MyoD-like protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1606bp
GTTCATATTACCAACTGTTCGCCATTAATTCAGCCTGTTTTACGCCTCGTAACAACTGTTACTTCAACAATACCGATCCA
GCCCAATAAACAATGATACACTCCGGATCATTTCCAGGTTCCACTTGTCCGATTAACTATGACTATTCCGGTCCATACTC
AGCAGGTCTTGAGGCAGCTCCATTTTTAGTCAATCAAACCTGTCCATATAACACTGGAACAAATACAATGCCTCCTTCGT
TGTCACTAGTAGATAATATGATGATGAATAATTCCATGCATCTTTATGATAGACTGAATACTCATCATTCAGCGTCGTAT
TTTCCTCAGATTTTAAACAAAATCGAACAGAAATTACCAACAACCTCGAGTAAAACCACTCCATCAACATTGGTTTCAAC
ATCCTCCAATTCCATATCGAATTCTGAGTTTAATTCGTCGCGATCTTCGTCACAATTTCCAACATACGATTTGATTTCGT
CACTCAATAATAGCAACTACGACATGTACGATTCGCCCTATGCCGCCTATCTGGCCGCTGGTTATTATCAATCTCCTGGA
TTTGCGCTCAAACAGTACGACGCTGCTGGAACATCTCAACCATCAATGACAGATTTGTACCATTCATCACTAGCAGCCAG
TTCAGGCTTAAATTTGAATTATTCACAGCATAAATCGAGACATTTATCAGAAGATGCTGGATCATGCCAAGATCCGCAGT
CTCAAAATATCACAAGCAATAATCATCATAACAATTCGTATAGTCCAACAACTGCTGATTTCGGATCACCAAAAGCCTTA
TCAAGTAGCAGCCAGTCCATAAATGATGGAAGACAACCGACCAGTAGTAATTCCAGTCCTCAAAAACTATCACTAGCAAT
TGAACAACACTTATGTCCAAATAAAGAGGAACATGTGCTAGTTCCAGGGTCACATGGTCAATGCTTGTTGTGGGCCTGTA
AAGCTTGCAAAAAGAAAACGGTTCACGTTGATCGCCGCAAAGCGGCAACAATGCGTGAAAGACGTCGATTGAGAAAAGTG
AATGAAGCTTTTGAAACATTGAAACGAAGAACGAGCGGTAACCCAAATCAAAGAATGCCAAAAGTCGAAATTCTAAAGAA
CGCGATTGATTACATTGAGAGTTTGGAAGAGTTGTTGAATTCCGTGGGAAAATTACCTGCAACCGTTGGAGAATTGAAAG
AACGCCGCAAAAACAACCCAGAAAATTCGAGAACAGCAATCGCCGGAAAACAAAAGCCACTAAATAAAATTAATGATAAA
CAGAAAGCTGAAAACAAATATCCCGAGACCATCTGCAAACTCCCGACGACTAGGAAATCCTATGTTGCTTCCGACCTTGA
TCAGCAGATTTATCAATCAAACATGTTGAAGAGTTCAACTCTTGATCAACTTTCCTCGATAGTAGACAAAATCTCTACGA
CTAATACAACAATTGCCGACCATTCAATGGACGCTAAGCCCGAAAATAGTTGAATACATAACAAAACGCAACAAATATTA
TATTAACCTATTAATTTTGTTCTAAACTCGTTTGCCCTGATACATATTGTACATTTTCTTTCAATAGAATGTTCTTATAA
TTATAA

 

back to top



PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in muscle progenitor cell. Click this link to learn more about PAGE.


PAGE Curations: 65


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
muscle progenitor cellSMED30002877IQ motif and SEC7 domain-containing protein 2SMESG000070179.1 SMED30002877smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30002753X1.A5.1SMESG000062836.1 SMED30002753smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30002925Alpha-2-macroglobulin-like protein 1SMESG000041500.1 SMED30002925smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30009076ActinSMESG000066035.1 SMESG000066029.1 SMESG000066027.1 SMESG000066020.1 SMED30009076smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30009380SMED30009380 SMED30009380smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30014105ProtocadherinSMESG000051236.1 SMED30014105smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30010450SMED30010450 SMED30010450smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30002081SMED30002081SMESG000047315.1 SMED30002081smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30019763CS domain-containing proteinSMESG000078259.1 SMESG000075881.1 SMESG000064589.1 SMESG000031042.1 SMESG000029607.1 SMESG000021352.1 SMESG000004064.1 SMED30019763smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30015413ras-related protein Rab-28-likeSMESG000007739.1 SMESG000007738.1 SMED30015413smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30008639MyoD-like proteinSMESG000034317.1 SMED30008639smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 5 fluorescence in situ hybridization evidence
muscle progenitor cellSMED30008639MyoD-like proteinSMESG000034317.1 SMED30008639smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
muscle progenitor cellSMED30008639MyoD-like proteinSMESG000034317.1 SMED30008639smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
muscle progenitor cellSMED30008639MyoD-like proteinSMESG000034317.1 SMED30008639smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
muscle progenitor cellSMED30008639MyoD-like proteinSMESG000034317.1 SMED30008639smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 5 colorimetric in situ hybridization evidence
muscle progenitor cellSMED30008639MyoD-like proteinSMESG000034317.1 KF487099.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
muscle progenitor cellSMED30008639MyoD-like proteinSMESG000034317.1 KF487099.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
muscle progenitor cellSMED30008639MyoD-like proteinSMESG000034317.1 KF487099.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 5 fluorescence in situ hybridization evidence
muscle progenitor cellSMED30008639MyoD-like proteinSMESG000034317.1 KF487099.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 5 colorimetric in situ hybridization evidence
muscle progenitor cellSMED30008639MyoD-like proteinSMESG000034317.1 KF487099.1smed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
muscle progenitor cellSMED30008639MyoD-like proteinSMESG000034317.1 myoDsmed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
muscle progenitor cellSMED30008639MyoD-like proteinSMESG000034317.1 myoDsmed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 5 fluorescence in situ hybridization evidence
muscle progenitor cellSMED30008639MyoD-like proteinSMESG000034317.1 myoDsmed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
muscle progenitor cellSMED30008639MyoD-like proteinSMESG000034317.1 myoDsmed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
muscle progenitor cellSMED30008639MyoD-like proteinSMESG000034317.1 myoDsmed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 5 colorimetric in situ hybridization evidence
muscle progenitor cellSMED30010488SMED30010488SMESG000003538.1 dd_Smed_v6_70_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30009076ActinSMESG000066035.1 SMESG000066029.1 SMESG000066027.1 SMESG000066020.1 dd_Smed_v6_90_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30009076ActinSMESG000066035.1 SMESG000066029.1 SMESG000066027.1 SMESG000066020.1 dd_Smed_v6_37_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30025388Myosin heavy chainSMESG000013389.1 dd_Smed_v6_579_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30022232Glutathione s-transferaseSMESG000016846.1 dd_Smed_v6_1206_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30006119X-box-binding protein 1SMESG000048111.1 dd_Smed_v6_415_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30008655Tubulin alpha chainSMESG000078886.1 SMESG000078780.1 SMESG000078276.1 SMESG000077377.1 SMESG000076900.1 SMESG000070563.1 SMESG000069843.1 SMESG000067323.1 SMESG000067128.1 SMESG000066333.1 SMESG000063482.1 SMESG000063430.1 SMESG000062535.1 SMESG000055265.1 SMESG000052056.1 SMESG000051183.1 SMESG000049398.1 SMESG000047988.1 SMESG000045843.1 SMESG000043425.1 SMESG000043019.1 SMESG000041242.1 SMESG000040236.1 SMESG000039783.1 SMESG000034367.1 SMESG000031778.1 SMESG000031308.1 SMESG000028811.1 SMESG000025956.1 SMESG000023833.1 SMESG000023573.1 SMESG000023546.1 SMESG000019820.1 SMESG000018414.1 SMESG000017936.1 SMESG000015191.1 SMESG000014475.1 SMESG000009011.1 SMESG000008656.1 SMESG000005037.1 SMESG000004638.1 SMESG000003422.1 SMESG000054547.1 dd_Smed_v6_508_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30009274SMED30009274SMESG000007225.1 dd_Smed_v6_990_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30002983Tropomyosin-2SMESG000000190.1 dd_Smed_v6_436_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30033594Microtubule-associated protein 1ASMESG000014298.1 dd_Smed_v6_1301_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30033594Microtubule-associated protein 1ASMESG000014298.1 dd_Smed_v6_3654_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30027976Retrovirus-related Pol polyprotein from transposon dd_Smed_v6_15945_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30026887Myosin light chain proteinSMESG000075512.1 dd_Smed_v6_223_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30034254calreticulin-1SMESG000077304.1 SMESG000009012.1 dd_Smed_v6_220_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30028808calreticulin-2SMESG000077304.1 SMESG000009012.1 dd_Smed_v6_220_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30012075SMED30012075SMESG000059352.1 SMESG000059351.1 dd_Smed_v6_420_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30015575Collagen alpha-1(IV) chainSMESG000016766.1 dd_Smed_v6_2337_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED3001096960S ribosomal protein L6SMESG000019835.1 dd_Smed_v6_839_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30014980LaminSMESG000009886.1 dd_Smed_v6_850_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30010499SMED30010499SMESG000055070.1 dd_Smed_v6_6915_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30017516Collagen alpha-2(IV) chainSMESG000021729.1 dd_Smed_v6_2197_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30015813slc3a-1SMESG000019192.1 SMESG000019184.1 dd_Smed_v6_2113_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30010103Splicing factor arginine:serine richSMESG000041611.1 dd_Smed_v6_1935_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30005911SMED30005911 dd_Smed_v6_12_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30017430Protein disulfide-isomeraseSMESG000023147.1 SMESG000017020.1 dd_Smed_v6_250_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30011041Heat shock protein 903SMESG000041107.1 dd_Smed_v6_758_1dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30013416Reticulocalbin-1SMESG000007225.1 dd_Smed_v6_990_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30001376Collagen IV NC1 domain-containing proteinSMESG000071508.1 dd_Smed_v6_1579_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30015413ras-related protein Rab-28-likeSMESG000007739.1 SMESG000007738.1 dd_Smed_v6_375_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30021896SMED30021896SMESG000041611.1 dd_Smed_v6_1935_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30020821SMED30020821SMESG000014298.1 dd_Smed_v6_1301_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30028938Protein disulfide-isomerase A6SMESG000023147.1 SMESG000017020.1 dd_Smed_v6_250_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30027460Troponin iSMESG000002071.1 dd_Smed_v6_323_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30035658SMED30035658SMESG000015175.1 dd_Smed_v6_6998_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30030289Actin-1SMESG000066035.1 SMESG000066029.1 SMESG000066027.1 SMESG000066020.1 dd_Smed_v6_90_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30026663Tropomyosin Tod p 1.0102SMESG000074053.1 dd_Smed_v6_405_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30030234Tubulin alpha chainSMESG000041107.1 dd_Smed_v6_758_1dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30030234Tubulin alpha chainSMESG000078886.1 SMESG000078780.1 SMESG000078276.1 SMESG000077377.1 SMESG000076900.1 SMESG000070563.1 SMESG000069843.1 SMESG000067323.1 SMESG000067128.1 SMESG000066333.1 SMESG000063482.1 SMESG000063430.1 SMESG000062535.1 SMESG000055265.1 SMESG000052056.1 SMESG000051183.1 SMESG000049398.1 SMESG000047988.1 SMESG000045843.1 SMESG000043425.1 SMESG000043019.1 SMESG000041242.1 SMESG000040236.1 SMESG000039783.1 SMESG000034367.1 SMESG000031778.1 SMESG000031308.1 SMESG000028811.1 SMESG000025956.1 SMESG000023833.1 SMESG000023573.1 SMESG000023546.1 SMESG000019820.1 SMESG000018414.1 SMESG000017936.1 SMESG000015191.1 SMESG000014475.1 SMESG000009011.1 SMESG000008656.1 SMESG000005037.1 SMESG000004638.1 SMESG000003422.1 SMESG000054547.1 dd_Smed_v6_508_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30020950SMED30020950SMESG000055070.1 dd_Smed_v6_6915_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle progenitor cellSMED30033752Tyrosine-protein kinaseSMESG000059352.1 SMESG000059351.1 dd_Smed_v6_420_0dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Note: Hover over icons to view figure legend

 

 

back to top