Category 4 cell
▻ Planarian Anatomy Ontology Class Overview
▻ Embryonic Molecular Fate Mapping
▻ In Situ Hybridization Data
▻ Sequences
▻ PAGE: Planarian Anatomy Gene Expression
Planarian Anatomy Ontology Class Overview
For more information about the ontology visit PLANA Overview
NAME:
Category 4 cell
DEFINITON:
Post-mitotic, mesenchymally and epidermally located progenitors downstream of the Category 3 cells.
TERM DEFINITION CITATIONS:
PMID:25017721, PMID:26457503
TERM CITATIONS:
Expand publication list
TERM ID:
PLANA:0000018
ABOUT THIS TERM:
Category 4 cell
↳is a epidermal cell, epidermal progenitor cell, material entity and non ciliated epithelial cell ↳contained in tail region, ventral region of the whole animal, copulatory region, posterior region of the whole animal, parapharyngeal region, prepharyngeal region, head region, dorsal region of the whole animal and anterior region of the whole animal
↳develops from Category 3 cell
↳existence overlaps Stage 6, Stage 5, juvenile stage, asexual adult, adult hermaphrodite, Stage 8 and Stage 7
↳existence starts during or after Stage 5
↳part of dorsal region of the epidermis, non-ciliated epidermis and ventral epidermis
→ Category 5 cell develops from Category 4 cell
BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):
Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.
EXPLORE ONTOLOGY GRAPH:
Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.
Embryonic Molecular Fate Mapping
All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource
IN SITU HYBRIDIZATION DATA:
Smed ID Accession Name Alias Expressed during stage(s) Tissue/Pattern Images
SMED30030681 SMED30030681 ZPUF-6 Stage 5, Stage 6, Stage 7, Stage 8 integumental system, Category 4 cell 
Click to see image symbols and abbreviations
Abbreviation or symbol Definition
O oral hemisphere
A aboral hemisphere
D dorsal
V ventral
L lateral
black arrowhead embryonic pharynx
red arrowhead definitive pharynx
black arrows primitive gut
yellow arrows primitive ectoderm cells
cyan arrows brain
cyan arrowheads nerve cords
blue arrowheads eye progenitors (trail cells)
purple arrowheads eyes
scale bar 100 µm
SEQUENCES:
smed_20140614 transcript sequences for genes validated by in situ hybridization (above).
>SMED30030681 ID=SMED30030681|Name=SMED30030681|organism=Schmidtea mediterranea sexual|type=transcript|length=732bp
TATGGATATACATATAATAAAAAGATTCTTCGTTTTTCTCAAGCTTCCAAGTTATAGTTTCGTAGTTTTAAAAAAAAAAT
TATTATACCCTATTACTAAACAAATAAAATTTTAATTATCTCAAAAACGAAATCCACATTTTAAAAAGCTATGTTTTTAT
AAATTTTGTGCACTTTCATTCGATCACATTTTCCATATCTCTGATAGATCGGATCGCATCTCAAGTGCAATTGATGTGCT
AATTTGTCGCATCTGTGATCGATAATTTCGAATTTTCTGTAACACCATTTTCTGATGACCCGGATACCTTGATCGAGTTT
GGCGTACAAATTATCAATCTCTATTCGACATGACTCAGTTTGAACGTCAACGCATTTGTGATTTGCGATTTCTTCCTTAT
ATTTCAAATGAAAATGAGCTCGGCGTTCATAACAGGCCTTGTGGAGAACATAAGCCTTTTCATCGCATTTCCGATCGGCT
CTGGCCCAGTCTCTGTCACATTTAGTGACAGCATTGTAGAATCGGTATTCGTGTTTGCTGCACTCAGTAACGATAAAAAG
AATAGCCAAAAATATTATGTATTTCATTTTCAAAATAAATTTTGAAAAAAAAAAAAAAAAAAGATAAATTTACCGTATTC
AGCGATATTTTTCTTTGGCATAGCATACATAATATTTTCCATTTTAAAAATGAAATAAAATGAATAAGCAAGTTGTTTTA
ATCAATCATTAG
PAGE: Planarian Anatomy Gene Expression
These transcripts were reported as being expressed in Category 4 cell. Click this link to learn more about PAGE.
PAGE Curations: 334
PLANA Term Reference Transcript Description Gene Models Published Transcript Transcriptome Publication Specimen Lifecycle Evidence Category 4 cell SMED30024865 Intermediate filament protein SMESG000030598.1 dd_Smed_v4_503_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30024865 Intermediate filament protein SMESG000030599.1 SMESG000030598.1 dd_Smed_v4_364_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30030845 Afadin SMESG000037577.1 dd_Smed_v4_7215_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30035834 slc4a-2 SMESG000057490.1 dd_Smed_v4_7905_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30035502 Cytochrome P450 2K1-like protein SMESG000013701.1 SMESG000013700.1 SMESG000013697.1 dd_Smed_v4_2083_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30035611 Fras1 related extracellular matrix protein SMESG000032220.1 dd_Smed_v4_2407_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30031822 SMED30031822 SMESG000077258.1 dd_Smed_v4_8993_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30033453 Dimer_Tnp_hAT domain-containing protein SMESG000001790.1 dd_Smed_v4_212_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30032915 Alkaline phosphatase SMESG000061191.1 dd_Smed_v4_8942_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30017175 ras GTPase-activating protein nGAP isoform X8 SMESG000037132.1 SMESG000037110.1 dd_Smed_v4_6499_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30019531 NPHP6 SMESG000072747.1 dd_Smed_v4_7145_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30014374 Low affinity cationic amino acid transporter SMESG000049007.1 dd_Smed_v4_2552_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30014765 Poly(U)-specific endoribonuclease-C SMESG000018876.1 dd_Smed_v4_9109_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30015453 Poly [ADP-ribose] polymerase SMESG000011115.1 dd_Smed_v4_2611_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30017966 Protein bark beetle SMESG000041025.1 dd_Smed_v4_8448_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30014810 Endophilin-A3 SMESG000061276.1 dd_Smed_v4_7468_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30015020 E3 ubiquitin-protein ligase XIAP SMESG000031958.1 dd_Smed_v4_2104_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30018563 SMED30018563 SMESG000057635.1 dd_Smed_v4_8513_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30007845 Family S60 non-peptidase homologue (S60 family) SMESG000027224.1 dd_Smed_v4_2523_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30011490 EF-hand domain-containing protein SMESG000026288.1 dd_Smed_v4_824_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30015967 Neurotracting/lsamp/neurotrimin/obcam related cell adhesion molecule SMESG000068491.1 dd_Smed_v4_2826_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30010872 Gln-synt_C domain-containing protein SMESG000003829.1 dd_Smed_v4_2247_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30009212 Ferric-chelate reductase 1 SMESG000061404.1 dd_Smed_v4_8497_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30018451 Lipopolysaccharide-induced TNF-alpha factor SMESG000020870.1 SMESG000046087.1 SMESG000046084.1 dd_Smed_v4_2768_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30010112 SMED30010112 SMESG000037132.1 SMESG000037110.1 dd_Smed_v4_6499_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30011060 SMED30011060 SMESG000018625.1 dd_Smed_v4_7135_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30009166 SMED30009166 SMESG000073246.1 dd_Smed_v4_29498_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30011294 Protein kinase domain-containing protein SMESG000041899.1 SMESG000031064.1 dd_Smed_v4_8347_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30028521 Cadmium metallothionein (MT-Cd) (Cd-MT) SMESG000013781.1 dd_Smed_v4_3412_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30028237 PMP-22/EMP/MP20/Claudin tight junction SMESG000028931.1 dd_Smed_v4_2132_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30028249 SMED30028249 SMESG000065865.1 dd_Smed_v4_2375_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30025535 TNF receptor associated factor-2 SMESG000049688.1 SMESG000049683.1 SMESG000049676.1 SMESG000049663.1 SMESG000049649.1 SMESG000049621.1 SMESG000049614.1 SMESG000049603.1 SMESG000049567.1 SMESG000008530.1 SMESG000008521.1 dd_Smed_v4_2003_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30030637 SMED30030637 SMESG000056889.1 dd_Smed_v4_4060_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30025076 SMED30025076 SMESG000010166.1 dd_Smed_v4_2518_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30025593 hemipterous SMESG000000893.1 dd_Smed_v4_5234_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30030126 Neurexin-4 SMESG000080138.1 dd_Smed_v4_2622_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30029309 C2H2-type domain-containing protein SMESG000006935.1 SMESG000006932.1 dd_Smed_v4_6216_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30025937 SMED30025937 SMESG000014771.1 dd_Smed_v4_3104_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30030455 Tetraspanin SMESG000056558.1 dd_Smed_v4_3175_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30026612 Intermediate filament protein SMESG000030599.1 SMESG000030598.1 dd_Smed_v4_364_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30025553 Cell polarity protein SMESG000027800.1 dd_Smed_v4_4789_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30026808 EF-hand domain-containing protein SMESG000081370.1 dd_Smed_v4_446_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30027078 SMED30027078 SMESG000045917.1 dd_Smed_v4_9987_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30029820 E3 ubiquitin-protein ligase MYLIP SMESG000074789.1 SMESG000054150.1 dd_Smed_v4_2867_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30013041 SMED30013041 SMESG000049878.1 dd_Smed_v4_4914_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30013082 Dynein light chain SMESG000081226.1 SMESG000081215.1 dd_Smed_v4_1888_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30001582 SMED30001582 SMESG000076741.1 dd_Smed_v4_76221_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30011798 E3 ubiquitin-protein ligase MIB2 SMESG000043477.1 SMESG000010549.1 SMESG000010347.1 SMESG000010327.1 dd_Smed_v4_593_1_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30019771 Ammonium transporter Rh type B SMESG000048384.1 dd_Smed_v4_1882_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30014517 SMED30014517 SMESG000067410.1 dd_Smed_v4_6359_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30014069 Transposable element Tcb1 transposase SMESG000010591.1 dd_Smed_v4_10661_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30008902 inositol phosphoceramide mannosyltransferase 2-like SMESG000059812.1 SMESG000045480.1 SMESG000045292.1 SMESG000045267.1 SMESG000037990.1 dd_Smed_v4_2174_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30011717 SMED30011717 SMESG000078112.1 dd_Smed_v4_16420_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30003096 Phospholipase YtpA SMESG000038738.1 dd_Smed_v4_6727_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30015825 inositol phosphoceramide mannosyltransferase 2-like SMESG000059812.1 SMESG000045480.1 SMESG000045292.1 SMESG000045267.1 SMESG000037990.1 dd_Smed_v4_2174_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30000242 Complexin SMESG000023815.1 SMESG000017115.1 dd_Smed_v4_4479_1_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30010380 SJCHGC04139 protein SMESG000022419.1 dd_Smed_v4_4617_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30012960 Calmodulin SMESG000003548.1 dd_Smed_v4_10083_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30009121 Galectin domain-containing protein SMESG000022399.1 dd_Smed_v4_10749_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30008453 SMED30008453 SMESG000074791.1 SMESG000074789.1 SMESG000054155.1 dd_Smed_v4_9776_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30008453 SMED30008453 SMESG000074789.1 SMESG000054150.1 dd_Smed_v4_2867_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30006736 colorectal mutant cancer protein SMESG000002794.1 dd_Smed_v4_5396_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30011617 Actin-related protein 2/3 complex subunit 4 SMESG000003841.1 dd_Smed_v4_977_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30015069 ANK_REP_REGION domain-containing protein SMESG000063648.1 dd_Smed_v4_10764_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30015473 Actin cytoplasmic type 5 SMESG000080982.1 SMESG000080969.1 dd_Smed_v4_2624_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30006624 Innexin SMESG000036796.1 dd_Smed_v4_30125_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30010176 SMED30010176 SMESG000008958.1 dd_Smed_v4_10363_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30012710 SMED30012710 SMESG000066979.1 dd_Smed_v4_4593_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30011970 Colobus protein SMESG000005049.1 dd_Smed_v4_4427_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30002072 Intermediate filament protein SMESG000030598.1 dd_Smed_v4_503_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30002728 Dual specificity tyrosine-phosphorylation-regulated kinase 2 SMESG000042409.1 dd_Smed_v4_10966_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30017502 slc6a-9 SMESG000009986.1 dd_Smed_v4_13317_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30014235 Myeloid differentiation primary response protein MyD88 SMESG000051766.1 SMESG000051767.1 dd_Smed_v4_4532_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30008021 SMED30008021 SMESG000023815.1 SMESG000017115.1 dd_Smed_v4_4479_1_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30016274 Golgi-associated plant pathogenesis-related protein 1 SMESG000070308.1 dd_Smed_v4_12963_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30017997 WSC domain-containing protein SMESG000057220.1 dd_Smed_v4_10762_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30007097 Rho guanine nucleotide exchange factor 28 SMESG000021797.1 dd_Smed_v4_5252_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30003846 Expressed conserved protein SMESG000068288.1 dd_Smed_v4_3595_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30006931 SMED30006931 SMESG000040565.1 dd_Smed_v4_4660_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30000746 SMED30000746 SMESG000024821.1 SMESG000024754.1 dd_Smed_v4_306_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30014183 SMED30014183 SMESG000061464.1 dd_Smed_v4_21634_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30011562 Leishmanolysin-like peptidase SMESG000063815.1 dd_Smed_v4_10609_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30009426 SMED30009426 SMESG000016940.1 dd_Smed_v4_6421_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30019398 N-acetyltransferase domain-containing protein SMESG000023874.1 dd_Smed_v4_13214_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30002655 Ig-like domain-containing protein SMESG000079770.1 dd_Smed_v4_1914_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30009418 SMED30009418 SMESG000013309.1 dd_Smed_v4_15118_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30015125 SMED30015125 SMESG000061766.1 dd_Smed_v4_12632_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30004363 cAMP-dependent protein kinase catalytic subunit alpha SMESG000063155.1 dd_Smed_v4_5162_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30009414 SMED30009414 SMESG000042497.1 dd_Smed_v4_17939_1_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30000647 Cell wall integrity and stress response component 1 SMESG000035037.1 SMESG000035036.1 dd_Smed_v4_6380_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30010117 SMED30010117 SMESG000000893.1 dd_Smed_v4_5234_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30002215 DUF862 domain-containing protein SMESG000024669.1 dd_Smed_v4_3583_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30011688 SMED30011688 SMESG000010591.1 dd_Smed_v4_10661_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30015238 SMED30015238 SMESG000061127.1 dd_Smed_v4_10789_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30005745 Protein kinase SMESG000017260.1 dd_Smed_v4_4170_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30003113 SMED30003113 SMESG000067883.1 SMESG000067876.1 dd_Smed_v4_3259_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30008057 Protein kinase C SMESG000037135.1 dd_Smed_v4_2110_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30013241 SMED30013241 SMESG000007775.1 dd_Smed_v4_137_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30012139 slc2a-2 SMESG000081673.1 dd_Smed_v4_3190_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30015660 SMED30015660 SMESG000018225.1 SMESG000017035.1 dd_Smed_v4_1426_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30030681 SMED30030681 SMESG000038678.1 SMED30030681 smed_20140614 PMID:28072387
Davies et al., 2017
Category 4 cell SMED30030681 SMED30030681 SMESG000038678.1 SMED30030681 smed_20140614 PMID:28072387
Davies et al., 2017
Category 4 cell SMED30030681 SMED30030681 SMESG000038678.1 SMED30030681 smed_20140614 PMID:28072387
Davies et al., 2017
Category 4 cell SMED30030681 SMED30030681 SMESG000038678.1 SMED30030681 smed_20140614 PMID:28072387
Davies et al., 2017
Category 4 cell SMED30013656 SMED30013656 SMESG000038678.1 SMED30030681 smed_20140614 PMID:28072387
Davies et al., 2017
Category 4 cell SMED30013656 SMED30013656 SMESG000038678.1 SMED30030681 smed_20140614 PMID:28072387
Davies et al., 2017
Category 4 cell SMED30013656 SMED30013656 SMESG000038678.1 SMED30030681 smed_20140614 PMID:28072387
Davies et al., 2017
Category 4 cell SMED30013656 SMED30013656 SMESG000038678.1 SMED30030681 smed_20140614 PMID:28072387
Davies et al., 2017
Category 4 cell SMED30013131 protein PLANT CADMIUM RESISTANCE 2-like dd_Smed_v4_4778_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30018956 SMED30018956 dd_Smed_v4_2990_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30014345 Dynein light chain roadblock dd_Smed_v4_5440_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30000238 SMED30000238 dd_Smed_v4_18916_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30018926 SMED30018926 dd_Smed_v4_21304_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30011538 SMED30011538 dd_Smed_v4_3881_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30034119 SPRY domain-containing SOCS box protein 3 dd_Smed_v4_9874_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30030152 SMED30030152 dd_Smed_v4_20927_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30022859 SMED30022859 dd_Smed_v4_20927_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30006549 SMED30006549 SMESG000016886.1 SMESG000016875.1 dd_Smed_v4_7893_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30005698 SMED30005698 SMESG000052123.1 dd_Smed_v4_2845_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30001325 slc25a-12 SMESG000064880.1 dd_Smed_v4_2449_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30002729 SMED30002729 SMESG000023322.1 dd_Smed_v4_22326_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30002066 SMED30002066 SMESG000016886.1 SMESG000016875.1 dd_Smed_v4_7893_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30003373 Tumor necrosis factor alpha-induced protein 8-like protein 2 SMESG000081288.1 dd_Smed_v4_8649_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30006454 BZIP domain-containing protein SMESG000012495.1 dd_Smed_v4_9007_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30006714 SMED30006714 SMESG000001790.1 dd_Smed_v4_212_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30000644 Kinesin protein SMESG000060958.1 dd_Smed_v4_7196_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30001191 Transcription factor Sox-2 SMESG000067682.1 SMESG000060099.1 dd_Smed_v4_8104_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30002286 formimidoyltransferase-cyclodeaminase SMESG000070969.1 dd_Smed_v4_7815_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30004315 Bestrophin homolog SMESG000070057.1 dd_Smed_v4_8073_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30027096 SMED30027096 SMESG000043600.1 dd_Smed_v4_14216_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30026856 SMED30026856 SMESG000034972.1 dd_Smed_v4_13559_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30027940 cAMP-dependent protein kinase type I-alpha regulatory subunit SMESG000078298.1 dd_Smed_v4_15589_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30028743 Regulator of G-protein signaling 22 SMESG000069110.1 dd_Smed_v4_11778_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30029450 Succinyl-CoA:3-ketoacid-coenzyme A transferase SMESG000080424.1 dd_Smed_v4_1189_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30032048 Protein CBG14354 SMESG000040050.1 dd_Smed_v4_14769_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30032048 Protein CBG14354 SMESG000040050.1 dd_Smed_v4_9805_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30030168 Latent transforming growth factor beta binding protein 3 SMESG000008188.1 dd_Smed_v4_1886_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30027564 PH domain-containing protein SMESG000023120.1 dd_Smed_v4_12160_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30035157 Mpv17-like protein 2 SMESG000022912.1 dd_Smed_v4_11900_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30018067 ADAMTS-like protein 3 SMESG000073115.1 dd_Smed_v4_12413_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30018138 SMED30018138 SMESG000017276.1 dd_Smed_v4_1245_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30018138 SMED30018138 SMESG000017276.1 dd_Smed_v4_639_1_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30015584 Nesprin-1 SMESG000016745.1 dd_Smed_v4_23532_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30015584 Nesprin-1 SMESG000016745.1 dd_Smed_v4_17767_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30015584 Nesprin-1 SMESG000016745.1 dd_Smed_v4_23535_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30015978 MFS domain-containing protein SMESG000060698.1 dd_Smed_v4_14153_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30025153 SMED30025153 SMESG000029777.1 dd_Smed_v4_13914_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30021900 SMED30021900 SMESG000043279.1 dd_Smed_v4_13818_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30022252 Transient receptor potential cation channel subfamily M member SMESG000068517.1 dd_Smed_v4_13669_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30025052 histone-lysine N-methyltransferase SETD1B-A SMESG000062286.1 dd_Smed_v4_11834_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30024409 SMED30024409 SMESG000074943.1 dd_Smed_v4_17460_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30025874 SMED30025874 SMESG000014644.1 dd_Smed_v4_1924_1_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30021122 Tyrosine--tRNA ligase SMESG000055897.1 SMESG000019862.1 dd_Smed_v4_1795_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30021321 deoxyhypusine synthase SMESG000049425.1 SMESG000049421.1 dd_Smed_v4_12485_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30026157 GAS2-like 3 SMESG000003788.1 dd_Smed_v4_12425_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30024121 Tetraspanin SMESG000023248.1 dd_Smed_v4_1808_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30021685 Bestrophin homolog SMESG000070057.1 dd_Smed_v4_8073_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30005523 Alpha-actinin SMESG000026000.1 dd_Smed_v4_1951_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30014360 Choline dehydrogenase SMESG000055690.1 SMESG000055689.1 SMESG000055687.1 dd_Smed_v4_1744_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30005007 Roc domain-containing protein SMESG000073246.1 dd_Smed_v4_29498_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30008169 EF-hand domain-containing protein SMESG000026622.1 dd_Smed_v4_1881_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30006877 SMED30006877 SMESG000017276.1 dd_Smed_v4_1245_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30014981 Gelsolin-like protein SMESG000015924.1 dd_Smed_v4_1673_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30001211 SMED30001211 SMESG000004998.1 dd_Smed_v4_18299_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30001511 SMED30001511 SMESG000029772.1 dd_Smed_v4_16888_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30008349 Histone-lysine N-methyltransferase SETMAR SMESG000017253.1 SMESG000015137.1 dd_Smed_v4_1612_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30010242 Transmembrane protein 86A SMESG000010122.1 SMESG000001487.1 dd_Smed_v4_11970_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30009956 SMED30009956 SMESG000022273.1 dd_Smed_v4_8344_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30008080 Transmembrane protein 45B SMESG000060226.1 SMESG000021986.1 dd_Smed_v4_1542_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30007755 LIM and SH3 domain protein 1 SMESG000002154.1 dd_Smed_v4_1218_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30006268 angiotensin converting enzyme-1 SMESG000005713.1 dd_Smed_v4_12355_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30012856 RNA binding motif single stranded interacting SMESG000002786.1 dd_Smed_v4_7710_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30012856 RNA binding motif single stranded interacting SMESG000002793.1 SMESG000002786.1 dd_Smed_v4_11402_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30028574 Cytochrome P450 2K1-like protein SMESG000078092.1 SMESG000078091.1 dd_Smed_v4_2351_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30020710 Succinyl-CoA:3-ketoacid-coenzyme A transferase SMESG000080424.1 dd_Smed_v4_1189_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30033551 Phosphotransferase SMESG000043559.1 dd_Smed_v4_4327_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30034681 cAMP-dependent protein kinase catalytic subunit SMESG000016651.1 dd_Smed_v4_911_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30031645 General transcription factor II-I repeat domain-containing 2A-like protein SMESG000062458.1 dd_Smed_v4_5420_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30032436 Adipocyte plasma membrane-associated protein SMESG000052602.1 dd_Smed_v4_3602_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30031461 Phosphatidylinositol 4-phosphate 5-kinase 2 SMESG000012434.1 dd_Smed_v4_9195_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30030719 SMED30030719 dd_Smed_v4_31860_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30034824 SMED30034824 SMESG000035183.1 dd_Smed_v4_951_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30030662 SMED30030662 SMESG000024141.1 dd_Smed_v4_2719_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30034660 Spectrin beta chain, non-erythrocytic 5 SMESG000023006.1 dd_Smed_v4_2514_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30030925 SMED30030925 SMESG000038398.1 dd_Smed_v4_4195_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30030659 Fer-1-related SMESG000070967.1 dd_Smed_v4_4648_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30003728 Slc43a-3 SMESG000043541.1 dd_Smed_v4_17677_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30004467 Tyrosine phosphatase domain-containing protein 1 SMESG000055316.1 SMESG000054364.1 dd_Smed_v4_13749_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30009014 Alpha/beta hydrolase SMESG000022359.1 dd_Smed_v4_10155_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30001421 SMED30001421 SMESG000078112.1 dd_Smed_v4_16420_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30002638 Protein kinase domain-containing protein SMESG000074913.1 dd_Smed_v4_12976_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30004357 SMED30004357 SMESG000060698.1 dd_Smed_v4_16395_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30008239 SMED30008239 SMESG000020557.1 dd_Smed_v4_13196_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30007120 Transient receptor potential cation channel subfamily M member SMESG000068504.1 dd_Smed_v4_15098_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30000827 SMED30000827 SMESG000043280.1 dd_Smed_v4_278_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30002963 KN motif and ankyrin repeat domain-containing protein 3 SMESG000043522.1 dd_Smed_v4_12845_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30002963 KN motif and ankyrin repeat domain-containing protein 3 SMESG000043522.1 dd_Smed_v4_11252_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30004234 SMED30004234 SMESG000017336.1 dd_Smed_v4_17564_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30025232 Dynamin-1 SMESG000067156.1 dd_Smed_v4_6863_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30030681 SMED30030681 SMESG000038678.1 dd_Smed_v4_327_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30034787 Sodium/potassium-transporting ATPase subunit beta-1 SMESG000032752.1 dd_Smed_v4_1688_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30023196 Glycosyl hydrolase family 25 SMESG000049688.1 SMESG000049683.1 SMESG000049676.1 SMESG000049663.1 SMESG000049649.1 SMESG000049621.1 SMESG000049614.1 SMESG000049603.1 SMESG000049567.1 SMESG000008530.1 SMESG000008521.1 dd_Smed_v4_2003_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30034592 Slit-2 SMESG000002157.1 dd_Smed_v4_14579_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30027256 SMED30027256 SMESG000028953.1 dd_Smed_v4_8563_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30028726 SMED30028726 SMESG000079499.1 dd_Smed_v4_26394_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30030029 SMED30030029 SMESG000010225.1 dd_Smed_v4_2502_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30027451 PMP-22/EMP/MP20/Claudin tight junction SMESG000029752.1 dd_Smed_v4_2731_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30021297 Disks large homolog 1 SMESG000020502.1 dd_Smed_v4_3493_1_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30030260 Tetraspanin SMESG000023404.1 dd_Smed_v4_6528_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30030655 Fibronectin type 3 and ankyrin repeat domains protein 1 SMESG000030957.1 dd_Smed_v4_7496_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30032913 X1.A.G7.1 SMESG000046819.1 SMESG000046815.1 SMESG000046812.1 dd_Smed_v4_7161_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30022395 Chibby homolog 1 (Drosophila) SMESG000071266.1 dd_Smed_v4_8159_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30024248 SMED30024248 SMESG000055844.1 dd_Smed_v4_6835_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30022121 SMED30022121 SMESG000042798.1 dd_Smed_v4_2204_1_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30035584 Stabilizer of axonemal microtubules 2 SMESG000009389.1 dd_Smed_v4_3695_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30029771 SMED30029771 SMESG000075916.1 dd_Smed_v4_2326_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30021882 Disks large homolog 1 SMESG000045568.1 dd_Smed_v4_8293_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30035040 Protein FAM92A1 SMESG000072750.1 dd_Smed_v4_5894_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30030750 SMED30030750 SMESG000027921.1 dd_Smed_v4_7521_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30024840 Lactadherin SMESG000001686.1 dd_Smed_v4_5463_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30034697 Testis-specific Y-encoded-like protein 1 SMESG000027817.1 SMESG000027807.1 H.96.10c smed_ncbi_20200123 PMID:18786419
Eisenhoffer et al., 2008
Category 4 cell SMED30034697 Testis-specific Y-encoded-like protein 1 SMESG000027817.1 SMESG000027807.1 H.96.10c smed_ncbi_20200123 PMID:18786419
Eisenhoffer et al., 2008
Category 4 cell SMED30009052 60S ribosomal protein L18 SMESG000017166.1 NB.38.10e smed_ncbi_20200123 PMID:18786419
Eisenhoffer et al., 2008
Category 4 cell SMED30009052 60S ribosomal protein L18 SMESG000017166.1 NB.38.10e smed_ncbi_20200123 PMID:18786419
Eisenhoffer et al., 2008
Category 4 cell SMED30015534 60S ribosomal protein L21 SMESG000040216.1 H.18.1b smed_ncbi_20200123 PMID:18786419
Eisenhoffer et al., 2008
Category 4 cell SMED30015534 60S ribosomal protein L21 SMESG000040216.1 H.18.1b smed_ncbi_20200123 PMID:18786419
Eisenhoffer et al., 2008
Category 4 cell SMED30016995 Transformer-2-related SMESG000031644.1 SMESG000031639.1 H.112.11h smed_ncbi_20200123 PMID:18786419
Eisenhoffer et al., 2008
Category 4 cell SMED30016995 Transformer-2-related SMESG000031644.1 SMESG000031639.1 H.112.11h smed_ncbi_20200123 PMID:18786419
Eisenhoffer et al., 2008
Category 4 cell SMED30017670 N-terminal Xaa-Pro-Lys N-methyltransferase 1 SMESG000059668.1 H.101.2g smed_ncbi_20200123 PMID:18786419
Eisenhoffer et al., 2008
Category 4 cell SMED30017670 N-terminal Xaa-Pro-Lys N-methyltransferase 1 SMESG000059668.1 H.101.2g smed_ncbi_20200123 PMID:18786419
Eisenhoffer et al., 2008
Category 4 cell SMED30025522 60 kDa heat shock protein, mitochondrial SMESG000065325.1 H.21.6h smed_ncbi_20200123 PMID:18786419
Eisenhoffer et al., 2008
Category 4 cell SMED30025522 60 kDa heat shock protein, mitochondrial SMESG000065325.1 H.21.6h smed_ncbi_20200123 PMID:18786419
Eisenhoffer et al., 2008
Category 4 cell SMED30017114 Elongation factor 1-gamma SMESG000018714.1 NB.21.6b smed_ncbi_20200123 PMID:18786419
Eisenhoffer et al., 2008
Category 4 cell SMED30017114 Elongation factor 1-gamma SMESG000018714.1 NB.21.6b smed_ncbi_20200123 PMID:18786419
Eisenhoffer et al., 2008
Category 4 cell SMED30006740 SJCHGC04139 protein SMESG000035447.1 dd_Smed_v4_5091_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30014578 SMED30014578 SMESG000056168.1 dd_Smed_v4_31605_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30015943 SMED30015943 SMESG000014346.1 dd_Smed_v4_2231_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30010405 SMED30010405 SMESG000043444.1 SMESG000043435.1 dd_Smed_v4_18_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30018383 C2 domain-containing protein SMESG000002888.1 dd_Smed_v4_13340_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30000740 ets-1 SMESG000033821.1 dd_Smed_v4_9165_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30000740 ets-1 SMESG000033821.1 dd_Smed_v4_9185_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30018762 ston SMESG000047629.1 dd_Smed_v4_14370_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30012700 SMED30012700 SMESG000073126.1 dd_Smed_v4_13668_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30011623 SMED30011623 SMESG000043444.1 SMESG000043435.1 dd_Smed_v4_18_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30004840 Coiled-coil domain containing 88Aa SMESG000012304.1 dd_Smed_v4_3591_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30005762 Contactin/TAG-1 cell adhesion molecule SMESG000036495.1 dd_Smed_v4_2673_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30005178 Alkaline ceramidase SMESG000043974.1 dd_Smed_v4_9570_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30031490 SMED30031490 SMESG000017778.1 dd_Smed_v4_10175_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30028890 Bravo_FIGEY domain-containing protein SMESG000065363.1 SMESG000043141.1 dd_Smed_v4_1294_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30028020 SMED30028020 SMESG000047385.1 dd_Smed_v4_11229_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30031305 Caveolin dd_Smed_v4_10578_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30023766 SMED30023766 SMESG000073811.1 dd_Smed_v4_116_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30020222 Slc43a-3 SMESG000043541.1 dd_Smed_v4_17677_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30030378 MFS domain-containing protein SMESG000060698.1 dd_Smed_v4_16395_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30032006 slc7a-2 SMESG000031905.1 dd_Smed_v4_13828_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30026726 RING domain ligase2 isoform 3 SMESG000003596.1 dd_Smed_v4_5871_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30028359 SMED30028359 SMESG000010591.1 dd_Smed_v4_10661_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30021239 SMED30021239 SMESG000010487.1 dd_Smed_v4_9329_1_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30023411 slc42a-1 SMESG000048384.1 dd_Smed_v4_1882_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30021824 centromere protein J SMESG000028453.1 dd_Smed_v4_13670_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30034849 Kyphoscoliosis peptidase SMESG000061907.1 dd_Smed_v4_1109_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30033197 SMED30033197 SMESG000073811.1 dd_Smed_v4_116_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30029814 slc17a-3 SMESG000066847.1 dd_Smed_v4_1874_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30029870 SMED30029870 SMESG000060698.1 dd_Smed_v4_16395_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30021549 Usp domain-containing protein SMESG000079952.1 dd_Smed_v4_1092_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30031927 SMED30031927 SMESG000013309.1 dd_Smed_v4_15118_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30022701 SMED30022701 SMESG000006039.1 dd_Smed_v4_10442_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30021279 Retinal-binding protein SMESG000035531.1 dd_Smed_v4_11513_1_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30032163 Transcription factor RFX4 SMESG000058756.1 dd_Smed_v4_11406_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30028306 SMED30028306 SMESG000056142.1 dd_Smed_v4_12968_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30026116 GDP-fucose transporter 1-like SMESG000071232.1 dd_Smed_v4_13367_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30031309 nuclear protein MDM1-like isoform X1 SMESG000058479.1 dd_Smed_v4_10635_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30035148 SMED30035148 SMESG000021388.1 dd_Smed_v4_1925_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30027202 Progestin and adipoQ receptor family member 6 SMESG000044081.1 dd_Smed_v4_14141_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30011708 Neural cell adhesion molecule 1 SMESG000077686.1 dd_Smed_v4_3768_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30017663 Fer-1-related SMESG000070967.1 dd_Smed_v4_4648_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30013366 Sodium/potassium-transporting ATPase subunit alpha SMESG000078146.1 dd_Smed_v4_2828_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30010340 Neuroligin SMESG000012303.1 dd_Smed_v4_7946_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30018618 SMED30018618 SMESG000070280.1 dd_Smed_v4_2485_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30016401 Venom allergen 5 SMESG000005602.1 dd_Smed_v4_1988_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30019729 Bestrophin homolog SMESG000070057.1 dd_Smed_v4_8073_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30013334 Glutathione peroxidase SMESG000077750.1 dd_Smed_v4_662_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30017727 Calpain-5 SMESG000012000.1 dd_Smed_v4_6985_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30013676 nesprin-1-like SMESG000016747.1 SMESG000016745.1 dd_Smed_v4_5365_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30018339 SMED30018339 SMESG000005125.1 dd_Smed_v4_4793_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30019133 SMED30019133 SMESG000019555.1 dd_Smed_v4_6722_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30011754 ETS domain-containing protein SMESG000021791.1 dd_Smed_v4_7040_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30017888 TLC domain-containing protein SMESG000068531.1 dd_Smed_v4_9135_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30010991 SMED30010991 SMESG000014346.1 dd_Smed_v4_6441_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30010991 SMED30010991 SMESG000014346.1 dd_Smed_v4_2231_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30014640 Small heat shock protein p36 SMESG000028601.1 dd_Smed_v4_6399_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30012419 Non-specific serine/threonine protein kinase SMESG000069962.1 SMESG000069953.1 SMESG000069952.1 dd_Smed_v4_3244_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30012419 Non-specific serine/threonine protein kinase SMESG000069952.1 dd_Smed_v4_6414_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30019923 Armadillo repeat protein deleted in velo-cardio-facial syndrome SMESG000072739.1 dd_Smed_v4_8312_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30019748 NAD-dependent protein deacylase SMESG000027361.1 dd_Smed_v4_1992_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30012118 Pyruvate kinase SMESG000017671.1 dd_Smed_v4_6483_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30013315 SMED30013315 SMESG000022425.1 dd_Smed_v4_3843_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30017618 Rho GTPase activating protein 24 SMESG000036427.1 dd_Smed_v4_6320_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30019590 notch-1 SMESG000056635.1 dd_Smed_v4_4586_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30007543 nesprin-1-like SMESG000016747.1 SMESG000016745.1 dd_Smed_v4_5365_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30019856 SMED30019856 SMESG000023815.1 SMESG000017115.1 dd_Smed_v4_4479_1_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30014321 neural proliferation differentiation and control protein 1 SMESG000034753.1 dd_Smed_v4_5338_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30019717 inositol phosphoceramide mannosyltransferase 2-like SMESG000059812.1 SMESG000045480.1 SMESG000045292.1 SMESG000045267.1 SMESG000037990.1 dd_Smed_v4_2174_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30004319 Coiled-coil domain containing 88C SMESG000066575.1 SMESG000066583.1 dd_Smed_v4_5291_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30018439 XK-related protein SMESG000080414.1 dd_Smed_v4_2770_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30033765 SMED30033765 SMESG000017154.1 dd_Smed_v4_7064_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30021641 SMED30021641 SMESG000040565.1 dd_Smed_v4_4660_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30022574 START domain-containing protein SMESG000046413.1 SMESG000037645.1 dd_Smed_v4_3734_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30034555 Acetylcholine receptor subunit alpha-like SMESG000023242.1 dd_Smed_v4_13494_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30032785 Lipopolysaccharide-induced tumor necrosis factor-alpha factor-like SMESG000064937.1 dd_Smed_v4_10754_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30035614 SMED30035614 SMESG000023661.1 dd_Smed_v4_13154_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30026964 Myosin VIIA and Rab interacting protein SMESG000012034.1 dd_Smed_v4_6834_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30029019 16 kDa calcium-binding protein SMESG000066843.1 dd_Smed_v4_299_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30027396 Fatty acid amide hydrolase 1 SMESG000052378.1 SMESG000052360.1 dd_Smed_v4_2619_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30026845 SMED30026845 SMESG000038702.1 SMESG000038692.1 dd_Smed_v4_637_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30021146 SERPIN domain-containing protein SMESG000054563.1 dd_Smed_v4_3824_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30029024 Protein F37C4.5 SMESG000064758.1 dd_Smed_v4_5168_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30021812 Dolichol kinase-like Protein SMESG000022975.1 dd_Smed_v4_7896_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30022804 slc12a-1 SMESG000043221.1 SMESG000043220.1 dd_Smed_v4_4047_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30023073 Placenta specific protein 8 SMESG000050177.1 dd_Smed_v4_3182_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30034831 SMED30034831 SMESG000064758.1 dd_Smed_v4_5168_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30026927 GCR044 SMESG000020870.1 SMESG000046087.1 SMESG000046084.1 dd_Smed_v4_2768_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30029489 Serine/threonine-protein kinase SMESG000041899.1 SMESG000031064.1 dd_Smed_v4_8347_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30022622 Centrosomal protein 350 SMESG000033533.1 dd_Smed_v4_5967_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30026809 Transporter SMESG000009987.1 dd_Smed_v4_7097_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30021825 Expressed conserved protein SMESG000021837.1 dd_Smed_v4_4104_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30022057 SJCHGC08494 protein SMESG000027083.1 dd_Smed_v4_2196_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30029902 Protein kinase domain-containing protein SMESG000074943.1 SMESG000074941.1 dd_Smed_v4_6760_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30035435 SMED30035435 SMESG000040472.1 dd_Smed_v4_5757_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30029492 KN motif and ankyrin repeat domain-containing protein 4 isoform X2 SMESG000059500.1 dd_Smed_v4_7499_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30024985 Translin-associated factor X-interacting protein 1 SMESG000051766.1 SMESG000051767.1 dd_Smed_v4_4532_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30024390 Synaptotagmin like 4 SMESG000042371.1 dd_Smed_v4_7945_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30025105 Plastin 3 SMESG000081126.1 SMESG000081113.1 dd_Smed_v4_749_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Category 4 cell SMED30024636 G_PROTEIN_RECEP_F1_2 domain-containing protein SMESG000076050.1 dd_Smed_v4_6788_0_1 dd_Smed_v4 PMID:28292427
Wurtzel et al., 2017
Note: Hover over icons to view figure legend
↳contained in tail region, ventral region of the whole animal, copulatory region, posterior region of the whole animal, parapharyngeal region, prepharyngeal region, head region, dorsal region of the whole animal and anterior region of the whole animal
↳develops from Category 3 cell
↳existence overlaps Stage 6, Stage 5, juvenile stage, asexual adult, adult hermaphrodite, Stage 8 and Stage 7
↳existence starts during or after Stage 5
↳part of dorsal region of the epidermis, non-ciliated epidermis and ventral epidermis
→ Category 5 cell develops from Category 4 cell
BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):
Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.
EXPLORE ONTOLOGY GRAPH:
Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.
Embryonic Molecular Fate Mapping
All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource
IN SITU HYBRIDIZATION DATA:
Smed ID | Accession | Name | Alias | Expressed during stage(s) | Tissue/Pattern | Images |
---|---|---|---|---|---|---|
SMED30030681 | SMED30030681 | ZPUF-6 | Stage 5, Stage 6, Stage 7, Stage 8 | integumental system, Category 4 cell | ![]() |
Click to see image symbols and abbreviations
Abbreviation or symbol | Definition |
---|---|
O | oral hemisphere |
A | aboral hemisphere |
D | dorsal |
V | ventral |
L | lateral |
black arrowhead | embryonic pharynx |
red arrowhead | definitive pharynx |
black arrows | primitive gut |
yellow arrows | primitive ectoderm cells |
cyan arrows | brain |
cyan arrowheads | nerve cords |
blue arrowheads | eye progenitors (trail cells) |
purple arrowheads | eyes |
scale bar | 100 µm |
SEQUENCES:
smed_20140614 transcript sequences for genes validated by in situ hybridization (above).
>SMED30030681 ID=SMED30030681|Name=SMED30030681|organism=Schmidtea mediterranea sexual|type=transcript|length=732bp
TATGGATATACATATAATAAAAAGATTCTTCGTTTTTCTCAAGCTTCCAAGTTATAGTTTCGTAGTTTTAAAAAAAAAAT
TATTATACCCTATTACTAAACAAATAAAATTTTAATTATCTCAAAAACGAAATCCACATTTTAAAAAGCTATGTTTTTAT
AAATTTTGTGCACTTTCATTCGATCACATTTTCCATATCTCTGATAGATCGGATCGCATCTCAAGTGCAATTGATGTGCT
AATTTGTCGCATCTGTGATCGATAATTTCGAATTTTCTGTAACACCATTTTCTGATGACCCGGATACCTTGATCGAGTTT
GGCGTACAAATTATCAATCTCTATTCGACATGACTCAGTTTGAACGTCAACGCATTTGTGATTTGCGATTTCTTCCTTAT
ATTTCAAATGAAAATGAGCTCGGCGTTCATAACAGGCCTTGTGGAGAACATAAGCCTTTTCATCGCATTTCCGATCGGCT
CTGGCCCAGTCTCTGTCACATTTAGTGACAGCATTGTAGAATCGGTATTCGTGTTTGCTGCACTCAGTAACGATAAAAAG
AATAGCCAAAAATATTATGTATTTCATTTTCAAAATAAATTTTGAAAAAAAAAAAAAAAAAAGATAAATTTACCGTATTC
AGCGATATTTTTCTTTGGCATAGCATACATAATATTTTCCATTTTAAAAATGAAATAAAATGAATAAGCAAGTTGTTTTA
ATCAATCATTAG
PAGE: Planarian Anatomy Gene Expression
These transcripts were reported as being expressed in Category 4 cell. Click this link to learn more about PAGE.
PAGE Curations: 334
PLANA Term | Reference Transcript | Description | Gene Models | Published Transcript | Transcriptome | Publication | Specimen | Lifecycle | Evidence |
---|---|---|---|---|---|---|---|---|---|
Category 4 cell | SMED30024865 | Intermediate filament protein | SMESG000030598.1 | dd_Smed_v4_503_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30024865 | Intermediate filament protein | SMESG000030599.1 SMESG000030598.1 | dd_Smed_v4_364_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30030845 | Afadin | SMESG000037577.1 | dd_Smed_v4_7215_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30035834 | slc4a-2 | SMESG000057490.1 | dd_Smed_v4_7905_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30035502 | Cytochrome P450 2K1-like protein | SMESG000013701.1 SMESG000013700.1 SMESG000013697.1 | dd_Smed_v4_2083_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30035611 | Fras1 related extracellular matrix protein | SMESG000032220.1 | dd_Smed_v4_2407_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30031822 | SMED30031822 | SMESG000077258.1 | dd_Smed_v4_8993_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30033453 | Dimer_Tnp_hAT domain-containing protein | SMESG000001790.1 | dd_Smed_v4_212_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30032915 | Alkaline phosphatase | SMESG000061191.1 | dd_Smed_v4_8942_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30017175 | ras GTPase-activating protein nGAP isoform X8 | SMESG000037132.1 SMESG000037110.1 | dd_Smed_v4_6499_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30019531 | NPHP6 | SMESG000072747.1 | dd_Smed_v4_7145_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30014374 | Low affinity cationic amino acid transporter | SMESG000049007.1 | dd_Smed_v4_2552_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30014765 | Poly(U)-specific endoribonuclease-C | SMESG000018876.1 | dd_Smed_v4_9109_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30015453 | Poly [ADP-ribose] polymerase | SMESG000011115.1 | dd_Smed_v4_2611_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30017966 | Protein bark beetle | SMESG000041025.1 | dd_Smed_v4_8448_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30014810 | Endophilin-A3 | SMESG000061276.1 | dd_Smed_v4_7468_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30015020 | E3 ubiquitin-protein ligase XIAP | SMESG000031958.1 | dd_Smed_v4_2104_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30018563 | SMED30018563 | SMESG000057635.1 | dd_Smed_v4_8513_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30007845 | Family S60 non-peptidase homologue (S60 family) | SMESG000027224.1 | dd_Smed_v4_2523_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30011490 | EF-hand domain-containing protein | SMESG000026288.1 | dd_Smed_v4_824_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30015967 | Neurotracting/lsamp/neurotrimin/obcam related cell adhesion molecule | SMESG000068491.1 | dd_Smed_v4_2826_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30010872 | Gln-synt_C domain-containing protein | SMESG000003829.1 | dd_Smed_v4_2247_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30009212 | Ferric-chelate reductase 1 | SMESG000061404.1 | dd_Smed_v4_8497_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30018451 | Lipopolysaccharide-induced TNF-alpha factor | SMESG000020870.1 SMESG000046087.1 SMESG000046084.1 | dd_Smed_v4_2768_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30010112 | SMED30010112 | SMESG000037132.1 SMESG000037110.1 | dd_Smed_v4_6499_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30011060 | SMED30011060 | SMESG000018625.1 | dd_Smed_v4_7135_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30009166 | SMED30009166 | SMESG000073246.1 | dd_Smed_v4_29498_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30011294 | Protein kinase domain-containing protein | SMESG000041899.1 SMESG000031064.1 | dd_Smed_v4_8347_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30028521 | Cadmium metallothionein (MT-Cd) (Cd-MT) | SMESG000013781.1 | dd_Smed_v4_3412_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30028237 | PMP-22/EMP/MP20/Claudin tight junction | SMESG000028931.1 | dd_Smed_v4_2132_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30028249 | SMED30028249 | SMESG000065865.1 | dd_Smed_v4_2375_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30025535 | TNF receptor associated factor-2 | SMESG000049688.1 SMESG000049683.1 SMESG000049676.1 SMESG000049663.1 SMESG000049649.1 SMESG000049621.1 SMESG000049614.1 SMESG000049603.1 SMESG000049567.1 SMESG000008530.1 SMESG000008521.1 | dd_Smed_v4_2003_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30030637 | SMED30030637 | SMESG000056889.1 | dd_Smed_v4_4060_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30025076 | SMED30025076 | SMESG000010166.1 | dd_Smed_v4_2518_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30025593 | hemipterous | SMESG000000893.1 | dd_Smed_v4_5234_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30030126 | Neurexin-4 | SMESG000080138.1 | dd_Smed_v4_2622_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30029309 | C2H2-type domain-containing protein | SMESG000006935.1 SMESG000006932.1 | dd_Smed_v4_6216_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30025937 | SMED30025937 | SMESG000014771.1 | dd_Smed_v4_3104_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30030455 | Tetraspanin | SMESG000056558.1 | dd_Smed_v4_3175_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30026612 | Intermediate filament protein | SMESG000030599.1 SMESG000030598.1 | dd_Smed_v4_364_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30025553 | Cell polarity protein | SMESG000027800.1 | dd_Smed_v4_4789_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30026808 | EF-hand domain-containing protein | SMESG000081370.1 | dd_Smed_v4_446_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30027078 | SMED30027078 | SMESG000045917.1 | dd_Smed_v4_9987_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30029820 | E3 ubiquitin-protein ligase MYLIP | SMESG000074789.1 SMESG000054150.1 | dd_Smed_v4_2867_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30013041 | SMED30013041 | SMESG000049878.1 | dd_Smed_v4_4914_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30013082 | Dynein light chain | SMESG000081226.1 SMESG000081215.1 | dd_Smed_v4_1888_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30001582 | SMED30001582 | SMESG000076741.1 | dd_Smed_v4_76221_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30011798 | E3 ubiquitin-protein ligase MIB2 | SMESG000043477.1 SMESG000010549.1 SMESG000010347.1 SMESG000010327.1 | dd_Smed_v4_593_1_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30019771 | Ammonium transporter Rh type B | SMESG000048384.1 | dd_Smed_v4_1882_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30014517 | SMED30014517 | SMESG000067410.1 | dd_Smed_v4_6359_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30014069 | Transposable element Tcb1 transposase | SMESG000010591.1 | dd_Smed_v4_10661_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30008902 | inositol phosphoceramide mannosyltransferase 2-like | SMESG000059812.1 SMESG000045480.1 SMESG000045292.1 SMESG000045267.1 SMESG000037990.1 | dd_Smed_v4_2174_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30011717 | SMED30011717 | SMESG000078112.1 | dd_Smed_v4_16420_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30003096 | Phospholipase YtpA | SMESG000038738.1 | dd_Smed_v4_6727_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30015825 | inositol phosphoceramide mannosyltransferase 2-like | SMESG000059812.1 SMESG000045480.1 SMESG000045292.1 SMESG000045267.1 SMESG000037990.1 | dd_Smed_v4_2174_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30000242 | Complexin | SMESG000023815.1 SMESG000017115.1 | dd_Smed_v4_4479_1_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30010380 | SJCHGC04139 protein | SMESG000022419.1 | dd_Smed_v4_4617_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30012960 | Calmodulin | SMESG000003548.1 | dd_Smed_v4_10083_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30009121 | Galectin domain-containing protein | SMESG000022399.1 | dd_Smed_v4_10749_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30008453 | SMED30008453 | SMESG000074791.1 SMESG000074789.1 SMESG000054155.1 | dd_Smed_v4_9776_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30008453 | SMED30008453 | SMESG000074789.1 SMESG000054150.1 | dd_Smed_v4_2867_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30006736 | colorectal mutant cancer protein | SMESG000002794.1 | dd_Smed_v4_5396_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30011617 | Actin-related protein 2/3 complex subunit 4 | SMESG000003841.1 | dd_Smed_v4_977_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30015069 | ANK_REP_REGION domain-containing protein | SMESG000063648.1 | dd_Smed_v4_10764_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30015473 | Actin cytoplasmic type 5 | SMESG000080982.1 SMESG000080969.1 | dd_Smed_v4_2624_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30006624 | Innexin | SMESG000036796.1 | dd_Smed_v4_30125_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30010176 | SMED30010176 | SMESG000008958.1 | dd_Smed_v4_10363_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30012710 | SMED30012710 | SMESG000066979.1 | dd_Smed_v4_4593_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30011970 | Colobus protein | SMESG000005049.1 | dd_Smed_v4_4427_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30002072 | Intermediate filament protein | SMESG000030598.1 | dd_Smed_v4_503_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30002728 | Dual specificity tyrosine-phosphorylation-regulated kinase 2 | SMESG000042409.1 | dd_Smed_v4_10966_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30017502 | slc6a-9 | SMESG000009986.1 | dd_Smed_v4_13317_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30014235 | Myeloid differentiation primary response protein MyD88 | SMESG000051766.1 SMESG000051767.1 | dd_Smed_v4_4532_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30008021 | SMED30008021 | SMESG000023815.1 SMESG000017115.1 | dd_Smed_v4_4479_1_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30016274 | Golgi-associated plant pathogenesis-related protein 1 | SMESG000070308.1 | dd_Smed_v4_12963_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30017997 | WSC domain-containing protein | SMESG000057220.1 | dd_Smed_v4_10762_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30007097 | Rho guanine nucleotide exchange factor 28 | SMESG000021797.1 | dd_Smed_v4_5252_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30003846 | Expressed conserved protein | SMESG000068288.1 | dd_Smed_v4_3595_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30006931 | SMED30006931 | SMESG000040565.1 | dd_Smed_v4_4660_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30000746 | SMED30000746 | SMESG000024821.1 SMESG000024754.1 | dd_Smed_v4_306_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30014183 | SMED30014183 | SMESG000061464.1 | dd_Smed_v4_21634_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30011562 | Leishmanolysin-like peptidase | SMESG000063815.1 | dd_Smed_v4_10609_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30009426 | SMED30009426 | SMESG000016940.1 | dd_Smed_v4_6421_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30019398 | N-acetyltransferase domain-containing protein | SMESG000023874.1 | dd_Smed_v4_13214_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30002655 | Ig-like domain-containing protein | SMESG000079770.1 | dd_Smed_v4_1914_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30009418 | SMED30009418 | SMESG000013309.1 | dd_Smed_v4_15118_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30015125 | SMED30015125 | SMESG000061766.1 | dd_Smed_v4_12632_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30004363 | cAMP-dependent protein kinase catalytic subunit alpha | SMESG000063155.1 | dd_Smed_v4_5162_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30009414 | SMED30009414 | SMESG000042497.1 | dd_Smed_v4_17939_1_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30000647 | Cell wall integrity and stress response component 1 | SMESG000035037.1 SMESG000035036.1 | dd_Smed_v4_6380_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30010117 | SMED30010117 | SMESG000000893.1 | dd_Smed_v4_5234_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30002215 | DUF862 domain-containing protein | SMESG000024669.1 | dd_Smed_v4_3583_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30011688 | SMED30011688 | SMESG000010591.1 | dd_Smed_v4_10661_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30015238 | SMED30015238 | SMESG000061127.1 | dd_Smed_v4_10789_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30005745 | Protein kinase | SMESG000017260.1 | dd_Smed_v4_4170_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30003113 | SMED30003113 | SMESG000067883.1 SMESG000067876.1 | dd_Smed_v4_3259_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30008057 | Protein kinase C | SMESG000037135.1 | dd_Smed_v4_2110_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30013241 | SMED30013241 | SMESG000007775.1 | dd_Smed_v4_137_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30012139 | slc2a-2 | SMESG000081673.1 | dd_Smed_v4_3190_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30015660 | SMED30015660 | SMESG000018225.1 SMESG000017035.1 | dd_Smed_v4_1426_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30030681 | SMED30030681 | SMESG000038678.1 | SMED30030681 | smed_20140614 | PMID:28072387 Davies et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30030681 | SMED30030681 | SMESG000038678.1 | SMED30030681 | smed_20140614 | PMID:28072387 Davies et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30030681 | SMED30030681 | SMESG000038678.1 | SMED30030681 | smed_20140614 | PMID:28072387 Davies et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30030681 | SMED30030681 | SMESG000038678.1 | SMED30030681 | smed_20140614 | PMID:28072387 Davies et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30013656 | SMED30013656 | SMESG000038678.1 | SMED30030681 | smed_20140614 | PMID:28072387 Davies et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30013656 | SMED30013656 | SMESG000038678.1 | SMED30030681 | smed_20140614 | PMID:28072387 Davies et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30013656 | SMED30013656 | SMESG000038678.1 | SMED30030681 | smed_20140614 | PMID:28072387 Davies et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30013656 | SMED30013656 | SMESG000038678.1 | SMED30030681 | smed_20140614 | PMID:28072387 Davies et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30013131 | protein PLANT CADMIUM RESISTANCE 2-like | dd_Smed_v4_4778_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() | |
Category 4 cell | SMED30018956 | SMED30018956 | dd_Smed_v4_2990_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() | |
Category 4 cell | SMED30014345 | Dynein light chain roadblock | dd_Smed_v4_5440_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() | |
Category 4 cell | SMED30000238 | SMED30000238 | dd_Smed_v4_18916_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() | |
Category 4 cell | SMED30018926 | SMED30018926 | dd_Smed_v4_21304_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() | |
Category 4 cell | SMED30011538 | SMED30011538 | dd_Smed_v4_3881_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() | |
Category 4 cell | SMED30034119 | SPRY domain-containing SOCS box protein 3 | dd_Smed_v4_9874_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() | |
Category 4 cell | SMED30030152 | SMED30030152 | dd_Smed_v4_20927_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() | |
Category 4 cell | SMED30022859 | SMED30022859 | dd_Smed_v4_20927_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() | |
Category 4 cell | SMED30006549 | SMED30006549 | SMESG000016886.1 SMESG000016875.1 | dd_Smed_v4_7893_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30005698 | SMED30005698 | SMESG000052123.1 | dd_Smed_v4_2845_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30001325 | slc25a-12 | SMESG000064880.1 | dd_Smed_v4_2449_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30002729 | SMED30002729 | SMESG000023322.1 | dd_Smed_v4_22326_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30002066 | SMED30002066 | SMESG000016886.1 SMESG000016875.1 | dd_Smed_v4_7893_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30003373 | Tumor necrosis factor alpha-induced protein 8-like protein 2 | SMESG000081288.1 | dd_Smed_v4_8649_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30006454 | BZIP domain-containing protein | SMESG000012495.1 | dd_Smed_v4_9007_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30006714 | SMED30006714 | SMESG000001790.1 | dd_Smed_v4_212_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30000644 | Kinesin protein | SMESG000060958.1 | dd_Smed_v4_7196_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30001191 | Transcription factor Sox-2 | SMESG000067682.1 SMESG000060099.1 | dd_Smed_v4_8104_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30002286 | formimidoyltransferase-cyclodeaminase | SMESG000070969.1 | dd_Smed_v4_7815_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30004315 | Bestrophin homolog | SMESG000070057.1 | dd_Smed_v4_8073_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30027096 | SMED30027096 | SMESG000043600.1 | dd_Smed_v4_14216_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30026856 | SMED30026856 | SMESG000034972.1 | dd_Smed_v4_13559_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30027940 | cAMP-dependent protein kinase type I-alpha regulatory subunit | SMESG000078298.1 | dd_Smed_v4_15589_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30028743 | Regulator of G-protein signaling 22 | SMESG000069110.1 | dd_Smed_v4_11778_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30029450 | Succinyl-CoA:3-ketoacid-coenzyme A transferase | SMESG000080424.1 | dd_Smed_v4_1189_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30032048 | Protein CBG14354 | SMESG000040050.1 | dd_Smed_v4_14769_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30032048 | Protein CBG14354 | SMESG000040050.1 | dd_Smed_v4_9805_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30030168 | Latent transforming growth factor beta binding protein 3 | SMESG000008188.1 | dd_Smed_v4_1886_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30027564 | PH domain-containing protein | SMESG000023120.1 | dd_Smed_v4_12160_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30035157 | Mpv17-like protein 2 | SMESG000022912.1 | dd_Smed_v4_11900_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30018067 | ADAMTS-like protein 3 | SMESG000073115.1 | dd_Smed_v4_12413_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30018138 | SMED30018138 | SMESG000017276.1 | dd_Smed_v4_1245_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30018138 | SMED30018138 | SMESG000017276.1 | dd_Smed_v4_639_1_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30015584 | Nesprin-1 | SMESG000016745.1 | dd_Smed_v4_23532_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30015584 | Nesprin-1 | SMESG000016745.1 | dd_Smed_v4_17767_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30015584 | Nesprin-1 | SMESG000016745.1 | dd_Smed_v4_23535_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30015978 | MFS domain-containing protein | SMESG000060698.1 | dd_Smed_v4_14153_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30025153 | SMED30025153 | SMESG000029777.1 | dd_Smed_v4_13914_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30021900 | SMED30021900 | SMESG000043279.1 | dd_Smed_v4_13818_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30022252 | Transient receptor potential cation channel subfamily M member | SMESG000068517.1 | dd_Smed_v4_13669_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30025052 | histone-lysine N-methyltransferase SETD1B-A | SMESG000062286.1 | dd_Smed_v4_11834_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30024409 | SMED30024409 | SMESG000074943.1 | dd_Smed_v4_17460_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30025874 | SMED30025874 | SMESG000014644.1 | dd_Smed_v4_1924_1_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30021122 | Tyrosine--tRNA ligase | SMESG000055897.1 SMESG000019862.1 | dd_Smed_v4_1795_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30021321 | deoxyhypusine synthase | SMESG000049425.1 SMESG000049421.1 | dd_Smed_v4_12485_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30026157 | GAS2-like 3 | SMESG000003788.1 | dd_Smed_v4_12425_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30024121 | Tetraspanin | SMESG000023248.1 | dd_Smed_v4_1808_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30021685 | Bestrophin homolog | SMESG000070057.1 | dd_Smed_v4_8073_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30005523 | Alpha-actinin | SMESG000026000.1 | dd_Smed_v4_1951_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30014360 | Choline dehydrogenase | SMESG000055690.1 SMESG000055689.1 SMESG000055687.1 | dd_Smed_v4_1744_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30005007 | Roc domain-containing protein | SMESG000073246.1 | dd_Smed_v4_29498_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30008169 | EF-hand domain-containing protein | SMESG000026622.1 | dd_Smed_v4_1881_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30006877 | SMED30006877 | SMESG000017276.1 | dd_Smed_v4_1245_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30014981 | Gelsolin-like protein | SMESG000015924.1 | dd_Smed_v4_1673_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30001211 | SMED30001211 | SMESG000004998.1 | dd_Smed_v4_18299_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30001511 | SMED30001511 | SMESG000029772.1 | dd_Smed_v4_16888_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30008349 | Histone-lysine N-methyltransferase SETMAR | SMESG000017253.1 SMESG000015137.1 | dd_Smed_v4_1612_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30010242 | Transmembrane protein 86A | SMESG000010122.1 SMESG000001487.1 | dd_Smed_v4_11970_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30009956 | SMED30009956 | SMESG000022273.1 | dd_Smed_v4_8344_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30008080 | Transmembrane protein 45B | SMESG000060226.1 SMESG000021986.1 | dd_Smed_v4_1542_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30007755 | LIM and SH3 domain protein 1 | SMESG000002154.1 | dd_Smed_v4_1218_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30006268 | angiotensin converting enzyme-1 | SMESG000005713.1 | dd_Smed_v4_12355_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30012856 | RNA binding motif single stranded interacting | SMESG000002786.1 | dd_Smed_v4_7710_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30012856 | RNA binding motif single stranded interacting | SMESG000002793.1 SMESG000002786.1 | dd_Smed_v4_11402_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30028574 | Cytochrome P450 2K1-like protein | SMESG000078092.1 SMESG000078091.1 | dd_Smed_v4_2351_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30020710 | Succinyl-CoA:3-ketoacid-coenzyme A transferase | SMESG000080424.1 | dd_Smed_v4_1189_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30033551 | Phosphotransferase | SMESG000043559.1 | dd_Smed_v4_4327_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30034681 | cAMP-dependent protein kinase catalytic subunit | SMESG000016651.1 | dd_Smed_v4_911_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30031645 | General transcription factor II-I repeat domain-containing 2A-like protein | SMESG000062458.1 | dd_Smed_v4_5420_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30032436 | Adipocyte plasma membrane-associated protein | SMESG000052602.1 | dd_Smed_v4_3602_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30031461 | Phosphatidylinositol 4-phosphate 5-kinase 2 | SMESG000012434.1 | dd_Smed_v4_9195_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30030719 | SMED30030719 | dd_Smed_v4_31860_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() | |
Category 4 cell | SMED30034824 | SMED30034824 | SMESG000035183.1 | dd_Smed_v4_951_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30030662 | SMED30030662 | SMESG000024141.1 | dd_Smed_v4_2719_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30034660 | Spectrin beta chain, non-erythrocytic 5 | SMESG000023006.1 | dd_Smed_v4_2514_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30030925 | SMED30030925 | SMESG000038398.1 | dd_Smed_v4_4195_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30030659 | Fer-1-related | SMESG000070967.1 | dd_Smed_v4_4648_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30003728 | Slc43a-3 | SMESG000043541.1 | dd_Smed_v4_17677_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30004467 | Tyrosine phosphatase domain-containing protein 1 | SMESG000055316.1 SMESG000054364.1 | dd_Smed_v4_13749_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30009014 | Alpha/beta hydrolase | SMESG000022359.1 | dd_Smed_v4_10155_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30001421 | SMED30001421 | SMESG000078112.1 | dd_Smed_v4_16420_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30002638 | Protein kinase domain-containing protein | SMESG000074913.1 | dd_Smed_v4_12976_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30004357 | SMED30004357 | SMESG000060698.1 | dd_Smed_v4_16395_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30008239 | SMED30008239 | SMESG000020557.1 | dd_Smed_v4_13196_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30007120 | Transient receptor potential cation channel subfamily M member | SMESG000068504.1 | dd_Smed_v4_15098_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30000827 | SMED30000827 | SMESG000043280.1 | dd_Smed_v4_278_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30002963 | KN motif and ankyrin repeat domain-containing protein 3 | SMESG000043522.1 | dd_Smed_v4_12845_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30002963 | KN motif and ankyrin repeat domain-containing protein 3 | SMESG000043522.1 | dd_Smed_v4_11252_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30004234 | SMED30004234 | SMESG000017336.1 | dd_Smed_v4_17564_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30025232 | Dynamin-1 | SMESG000067156.1 | dd_Smed_v4_6863_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30030681 | SMED30030681 | SMESG000038678.1 | dd_Smed_v4_327_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30034787 | Sodium/potassium-transporting ATPase subunit beta-1 | SMESG000032752.1 | dd_Smed_v4_1688_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30023196 | Glycosyl hydrolase family 25 | SMESG000049688.1 SMESG000049683.1 SMESG000049676.1 SMESG000049663.1 SMESG000049649.1 SMESG000049621.1 SMESG000049614.1 SMESG000049603.1 SMESG000049567.1 SMESG000008530.1 SMESG000008521.1 | dd_Smed_v4_2003_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30034592 | Slit-2 | SMESG000002157.1 | dd_Smed_v4_14579_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30027256 | SMED30027256 | SMESG000028953.1 | dd_Smed_v4_8563_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30028726 | SMED30028726 | SMESG000079499.1 | dd_Smed_v4_26394_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30030029 | SMED30030029 | SMESG000010225.1 | dd_Smed_v4_2502_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30027451 | PMP-22/EMP/MP20/Claudin tight junction | SMESG000029752.1 | dd_Smed_v4_2731_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30021297 | Disks large homolog 1 | SMESG000020502.1 | dd_Smed_v4_3493_1_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30030260 | Tetraspanin | SMESG000023404.1 | dd_Smed_v4_6528_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30030655 | Fibronectin type 3 and ankyrin repeat domains protein 1 | SMESG000030957.1 | dd_Smed_v4_7496_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30032913 | X1.A.G7.1 | SMESG000046819.1 SMESG000046815.1 SMESG000046812.1 | dd_Smed_v4_7161_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30022395 | Chibby homolog 1 (Drosophila) | SMESG000071266.1 | dd_Smed_v4_8159_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30024248 | SMED30024248 | SMESG000055844.1 | dd_Smed_v4_6835_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30022121 | SMED30022121 | SMESG000042798.1 | dd_Smed_v4_2204_1_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30035584 | Stabilizer of axonemal microtubules 2 | SMESG000009389.1 | dd_Smed_v4_3695_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30029771 | SMED30029771 | SMESG000075916.1 | dd_Smed_v4_2326_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30021882 | Disks large homolog 1 | SMESG000045568.1 | dd_Smed_v4_8293_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30035040 | Protein FAM92A1 | SMESG000072750.1 | dd_Smed_v4_5894_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30030750 | SMED30030750 | SMESG000027921.1 | dd_Smed_v4_7521_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30024840 | Lactadherin | SMESG000001686.1 | dd_Smed_v4_5463_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30034697 | Testis-specific Y-encoded-like protein 1 | SMESG000027817.1 SMESG000027807.1 | H.96.10c | smed_ncbi_20200123 | PMID:18786419 Eisenhoffer et al., 2008 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30034697 | Testis-specific Y-encoded-like protein 1 | SMESG000027817.1 SMESG000027807.1 | H.96.10c | smed_ncbi_20200123 | PMID:18786419 Eisenhoffer et al., 2008 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30009052 | 60S ribosomal protein L18 | SMESG000017166.1 | NB.38.10e | smed_ncbi_20200123 | PMID:18786419 Eisenhoffer et al., 2008 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30009052 | 60S ribosomal protein L18 | SMESG000017166.1 | NB.38.10e | smed_ncbi_20200123 | PMID:18786419 Eisenhoffer et al., 2008 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30015534 | 60S ribosomal protein L21 | SMESG000040216.1 | H.18.1b | smed_ncbi_20200123 | PMID:18786419 Eisenhoffer et al., 2008 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30015534 | 60S ribosomal protein L21 | SMESG000040216.1 | H.18.1b | smed_ncbi_20200123 | PMID:18786419 Eisenhoffer et al., 2008 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30016995 | Transformer-2-related | SMESG000031644.1 SMESG000031639.1 | H.112.11h | smed_ncbi_20200123 | PMID:18786419 Eisenhoffer et al., 2008 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30016995 | Transformer-2-related | SMESG000031644.1 SMESG000031639.1 | H.112.11h | smed_ncbi_20200123 | PMID:18786419 Eisenhoffer et al., 2008 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30017670 | N-terminal Xaa-Pro-Lys N-methyltransferase 1 | SMESG000059668.1 | H.101.2g | smed_ncbi_20200123 | PMID:18786419 Eisenhoffer et al., 2008 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30017670 | N-terminal Xaa-Pro-Lys N-methyltransferase 1 | SMESG000059668.1 | H.101.2g | smed_ncbi_20200123 | PMID:18786419 Eisenhoffer et al., 2008 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30025522 | 60 kDa heat shock protein, mitochondrial | SMESG000065325.1 | H.21.6h | smed_ncbi_20200123 | PMID:18786419 Eisenhoffer et al., 2008 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30025522 | 60 kDa heat shock protein, mitochondrial | SMESG000065325.1 | H.21.6h | smed_ncbi_20200123 | PMID:18786419 Eisenhoffer et al., 2008 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30017114 | Elongation factor 1-gamma | SMESG000018714.1 | NB.21.6b | smed_ncbi_20200123 | PMID:18786419 Eisenhoffer et al., 2008 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30017114 | Elongation factor 1-gamma | SMESG000018714.1 | NB.21.6b | smed_ncbi_20200123 | PMID:18786419 Eisenhoffer et al., 2008 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30006740 | SJCHGC04139 protein | SMESG000035447.1 | dd_Smed_v4_5091_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30014578 | SMED30014578 | SMESG000056168.1 | dd_Smed_v4_31605_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30015943 | SMED30015943 | SMESG000014346.1 | dd_Smed_v4_2231_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30010405 | SMED30010405 | SMESG000043444.1 SMESG000043435.1 | dd_Smed_v4_18_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30018383 | C2 domain-containing protein | SMESG000002888.1 | dd_Smed_v4_13340_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30000740 | ets-1 | SMESG000033821.1 | dd_Smed_v4_9165_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30000740 | ets-1 | SMESG000033821.1 | dd_Smed_v4_9185_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30018762 | ston | SMESG000047629.1 | dd_Smed_v4_14370_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30012700 | SMED30012700 | SMESG000073126.1 | dd_Smed_v4_13668_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30011623 | SMED30011623 | SMESG000043444.1 SMESG000043435.1 | dd_Smed_v4_18_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30004840 | Coiled-coil domain containing 88Aa | SMESG000012304.1 | dd_Smed_v4_3591_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30005762 | Contactin/TAG-1 cell adhesion molecule | SMESG000036495.1 | dd_Smed_v4_2673_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30005178 | Alkaline ceramidase | SMESG000043974.1 | dd_Smed_v4_9570_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30031490 | SMED30031490 | SMESG000017778.1 | dd_Smed_v4_10175_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30028890 | Bravo_FIGEY domain-containing protein | SMESG000065363.1 SMESG000043141.1 | dd_Smed_v4_1294_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30028020 | SMED30028020 | SMESG000047385.1 | dd_Smed_v4_11229_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30031305 | Caveolin | dd_Smed_v4_10578_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() | |
Category 4 cell | SMED30023766 | SMED30023766 | SMESG000073811.1 | dd_Smed_v4_116_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30020222 | Slc43a-3 | SMESG000043541.1 | dd_Smed_v4_17677_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30030378 | MFS domain-containing protein | SMESG000060698.1 | dd_Smed_v4_16395_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30032006 | slc7a-2 | SMESG000031905.1 | dd_Smed_v4_13828_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30026726 | RING domain ligase2 isoform 3 | SMESG000003596.1 | dd_Smed_v4_5871_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30028359 | SMED30028359 | SMESG000010591.1 | dd_Smed_v4_10661_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30021239 | SMED30021239 | SMESG000010487.1 | dd_Smed_v4_9329_1_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30023411 | slc42a-1 | SMESG000048384.1 | dd_Smed_v4_1882_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30021824 | centromere protein J | SMESG000028453.1 | dd_Smed_v4_13670_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30034849 | Kyphoscoliosis peptidase | SMESG000061907.1 | dd_Smed_v4_1109_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30033197 | SMED30033197 | SMESG000073811.1 | dd_Smed_v4_116_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30029814 | slc17a-3 | SMESG000066847.1 | dd_Smed_v4_1874_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30029870 | SMED30029870 | SMESG000060698.1 | dd_Smed_v4_16395_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30021549 | Usp domain-containing protein | SMESG000079952.1 | dd_Smed_v4_1092_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30031927 | SMED30031927 | SMESG000013309.1 | dd_Smed_v4_15118_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30022701 | SMED30022701 | SMESG000006039.1 | dd_Smed_v4_10442_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30021279 | Retinal-binding protein | SMESG000035531.1 | dd_Smed_v4_11513_1_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30032163 | Transcription factor RFX4 | SMESG000058756.1 | dd_Smed_v4_11406_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30028306 | SMED30028306 | SMESG000056142.1 | dd_Smed_v4_12968_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30026116 | GDP-fucose transporter 1-like | SMESG000071232.1 | dd_Smed_v4_13367_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30031309 | nuclear protein MDM1-like isoform X1 | SMESG000058479.1 | dd_Smed_v4_10635_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30035148 | SMED30035148 | SMESG000021388.1 | dd_Smed_v4_1925_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30027202 | Progestin and adipoQ receptor family member 6 | SMESG000044081.1 | dd_Smed_v4_14141_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30011708 | Neural cell adhesion molecule 1 | SMESG000077686.1 | dd_Smed_v4_3768_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30017663 | Fer-1-related | SMESG000070967.1 | dd_Smed_v4_4648_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30013366 | Sodium/potassium-transporting ATPase subunit alpha | SMESG000078146.1 | dd_Smed_v4_2828_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30010340 | Neuroligin | SMESG000012303.1 | dd_Smed_v4_7946_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30018618 | SMED30018618 | SMESG000070280.1 | dd_Smed_v4_2485_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30016401 | Venom allergen 5 | SMESG000005602.1 | dd_Smed_v4_1988_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30019729 | Bestrophin homolog | SMESG000070057.1 | dd_Smed_v4_8073_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30013334 | Glutathione peroxidase | SMESG000077750.1 | dd_Smed_v4_662_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30017727 | Calpain-5 | SMESG000012000.1 | dd_Smed_v4_6985_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30013676 | nesprin-1-like | SMESG000016747.1 SMESG000016745.1 | dd_Smed_v4_5365_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30018339 | SMED30018339 | SMESG000005125.1 | dd_Smed_v4_4793_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30019133 | SMED30019133 | SMESG000019555.1 | dd_Smed_v4_6722_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30011754 | ETS domain-containing protein | SMESG000021791.1 | dd_Smed_v4_7040_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30017888 | TLC domain-containing protein | SMESG000068531.1 | dd_Smed_v4_9135_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30010991 | SMED30010991 | SMESG000014346.1 | dd_Smed_v4_6441_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30010991 | SMED30010991 | SMESG000014346.1 | dd_Smed_v4_2231_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30014640 | Small heat shock protein p36 | SMESG000028601.1 | dd_Smed_v4_6399_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30012419 | Non-specific serine/threonine protein kinase | SMESG000069962.1 SMESG000069953.1 SMESG000069952.1 | dd_Smed_v4_3244_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30012419 | Non-specific serine/threonine protein kinase | SMESG000069952.1 | dd_Smed_v4_6414_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30019923 | Armadillo repeat protein deleted in velo-cardio-facial syndrome | SMESG000072739.1 | dd_Smed_v4_8312_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30019748 | NAD-dependent protein deacylase | SMESG000027361.1 | dd_Smed_v4_1992_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30012118 | Pyruvate kinase | SMESG000017671.1 | dd_Smed_v4_6483_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30013315 | SMED30013315 | SMESG000022425.1 | dd_Smed_v4_3843_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30017618 | Rho GTPase activating protein 24 | SMESG000036427.1 | dd_Smed_v4_6320_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30019590 | notch-1 | SMESG000056635.1 | dd_Smed_v4_4586_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30007543 | nesprin-1-like | SMESG000016747.1 SMESG000016745.1 | dd_Smed_v4_5365_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30019856 | SMED30019856 | SMESG000023815.1 SMESG000017115.1 | dd_Smed_v4_4479_1_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30014321 | neural proliferation differentiation and control protein 1 | SMESG000034753.1 | dd_Smed_v4_5338_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30019717 | inositol phosphoceramide mannosyltransferase 2-like | SMESG000059812.1 SMESG000045480.1 SMESG000045292.1 SMESG000045267.1 SMESG000037990.1 | dd_Smed_v4_2174_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30004319 | Coiled-coil domain containing 88C | SMESG000066575.1 SMESG000066583.1 | dd_Smed_v4_5291_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30018439 | XK-related protein | SMESG000080414.1 | dd_Smed_v4_2770_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30033765 | SMED30033765 | SMESG000017154.1 | dd_Smed_v4_7064_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30021641 | SMED30021641 | SMESG000040565.1 | dd_Smed_v4_4660_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30022574 | START domain-containing protein | SMESG000046413.1 SMESG000037645.1 | dd_Smed_v4_3734_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30034555 | Acetylcholine receptor subunit alpha-like | SMESG000023242.1 | dd_Smed_v4_13494_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30032785 | Lipopolysaccharide-induced tumor necrosis factor-alpha factor-like | SMESG000064937.1 | dd_Smed_v4_10754_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30035614 | SMED30035614 | SMESG000023661.1 | dd_Smed_v4_13154_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30026964 | Myosin VIIA and Rab interacting protein | SMESG000012034.1 | dd_Smed_v4_6834_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30029019 | 16 kDa calcium-binding protein | SMESG000066843.1 | dd_Smed_v4_299_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30027396 | Fatty acid amide hydrolase 1 | SMESG000052378.1 SMESG000052360.1 | dd_Smed_v4_2619_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30026845 | SMED30026845 | SMESG000038702.1 SMESG000038692.1 | dd_Smed_v4_637_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30021146 | SERPIN domain-containing protein | SMESG000054563.1 | dd_Smed_v4_3824_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30029024 | Protein F37C4.5 | SMESG000064758.1 | dd_Smed_v4_5168_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30021812 | Dolichol kinase-like Protein | SMESG000022975.1 | dd_Smed_v4_7896_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30022804 | slc12a-1 | SMESG000043221.1 SMESG000043220.1 | dd_Smed_v4_4047_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30023073 | Placenta specific protein 8 | SMESG000050177.1 | dd_Smed_v4_3182_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30034831 | SMED30034831 | SMESG000064758.1 | dd_Smed_v4_5168_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30026927 | GCR044 | SMESG000020870.1 SMESG000046087.1 SMESG000046084.1 | dd_Smed_v4_2768_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30029489 | Serine/threonine-protein kinase | SMESG000041899.1 SMESG000031064.1 | dd_Smed_v4_8347_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30022622 | Centrosomal protein 350 | SMESG000033533.1 | dd_Smed_v4_5967_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30026809 | Transporter | SMESG000009987.1 | dd_Smed_v4_7097_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30021825 | Expressed conserved protein | SMESG000021837.1 | dd_Smed_v4_4104_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30022057 | SJCHGC08494 protein | SMESG000027083.1 | dd_Smed_v4_2196_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30029902 | Protein kinase domain-containing protein | SMESG000074943.1 SMESG000074941.1 | dd_Smed_v4_6760_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30035435 | SMED30035435 | SMESG000040472.1 | dd_Smed_v4_5757_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30029492 | KN motif and ankyrin repeat domain-containing protein 4 isoform X2 | SMESG000059500.1 | dd_Smed_v4_7499_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30024985 | Translin-associated factor X-interacting protein 1 | SMESG000051766.1 SMESG000051767.1 | dd_Smed_v4_4532_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30024390 | Synaptotagmin like 4 | SMESG000042371.1 | dd_Smed_v4_7945_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30025105 | Plastin 3 | SMESG000081126.1 SMESG000081113.1 | dd_Smed_v4_749_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |
Category 4 cell | SMED30024636 | G_PROTEIN_RECEP_F1_2 domain-containing protein | SMESG000076050.1 | dd_Smed_v4_6788_0_1 | dd_Smed_v4 | PMID:28292427 Wurtzel et al., 2017 | ![]() | ![]() | ![]() |