Category 4 cell

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ In Situ Hybridization Data

  ▻ Sequences




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  Category 4 cell


DEFINITON:

  Post-mitotic, mesenchymally and epidermally located progenitors downstream of the Category 3 cells.


TERM DEFINITION CITATIONS:

  PMID:25017721, PMID:26457503


TERM CITATIONS:


TERM ID:

  PLANA:0000018


ABOUT THIS TERM:

Category 4 cell

  ↳is a epidermal cell, epidermal progenitor cell, material entity and non ciliated epithelial cell

  ↳contained in tail region, copulatory region, ventral region of the whole animal, posterior region of the whole animal, parapharyngeal region, prepharyngeal region, head region, dorsal region of the whole animal and anterior region of the whole animal

  ↳develops from Category 3 cell

  ↳existence overlaps Stage 6, juvenile, Stage 5, asexual adult, adult hermaphrodite, Stage 8 and Stage 7

  ↳existence starts during or after Stage 5

  ↳part of dorsal region of the epidermis, non-ciliated epidermis and ventral epidermis


  → Category 5 cell develops from Category 4 cell



BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30030681SMED30030681ZPUF-6Stage 5, Stage 6, Stage 7, Stage 8integumental system, Category 4 cell
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30030681 ID=SMED30030681|Name=SMED30030681|organism=Schmidtea mediterranea sexual|type=transcript|length=732bp
TATGGATATACATATAATAAAAAGATTCTTCGTTTTTCTCAAGCTTCCAAGTTATAGTTTCGTAGTTTTAAAAAAAAAAT
TATTATACCCTATTACTAAACAAATAAAATTTTAATTATCTCAAAAACGAAATCCACATTTTAAAAAGCTATGTTTTTAT
AAATTTTGTGCACTTTCATTCGATCACATTTTCCATATCTCTGATAGATCGGATCGCATCTCAAGTGCAATTGATGTGCT
AATTTGTCGCATCTGTGATCGATAATTTCGAATTTTCTGTAACACCATTTTCTGATGACCCGGATACCTTGATCGAGTTT
GGCGTACAAATTATCAATCTCTATTCGACATGACTCAGTTTGAACGTCAACGCATTTGTGATTTGCGATTTCTTCCTTAT
ATTTCAAATGAAAATGAGCTCGGCGTTCATAACAGGCCTTGTGGAGAACATAAGCCTTTTCATCGCATTTCCGATCGGCT
CTGGCCCAGTCTCTGTCACATTTAGTGACAGCATTGTAGAATCGGTATTCGTGTTTGCTGCACTCAGTAACGATAAAAAG
AATAGCCAAAAATATTATGTATTTCATTTTCAAAATAAATTTTGAAAAAAAAAAAAAAAAAAGATAAATTTACCGTATTC
AGCGATATTTTTCTTTGGCATAGCATACATAATATTTTCCATTTTAAAAATGAAATAAAATGAATAAGCAAGTTGTTTTA
ATCAATCATTAG

 

back to top