Category 4 cell

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ In Situ Hybridization Data

  ▻ Sequences

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  Category 4 cell


DEFINITON:

  Post-mitotic, mesenchymally and epidermally located progenitors downstream of the Category 3 cells.


TERM DEFINITION CITATIONS:

  PMID:25017721, PMID:26457503


TERM CITATIONS:


TERM ID:

  PLANA:0000018


ABOUT THIS TERM:

Category 4 cell

  ↳is a epidermal cell, epidermal progenitor cell, material entity and non ciliated epithelial cell

  ↳contained in tail, copulatory region, ventral region of the whole animal, posterior region of the whole animal, parapharyngeal region, prepharyngeal region, head, dorsal region of the whole animal and anterior region of the whole animal

  ↳develops from Category 3 cell

  ↳existence overlaps Stage 6, juvenile, Stage 5, asexual adult, adult hermaphrodite, Stage 8 and Stage 7

  ↳existence starts during or after Stage 5

  ↳part of dorsal region of the epidermis, non-ciliated epidermis and ventral epidermis


  → Category 5 cell develops from Category 4 cell



BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30030681SMED30030681ZPUF-6Stage 5, Stage 6, Stage 7, Stage 8integumental system, Category 4 cell
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30030681 ID=SMED30030681|Name=SMED30030681|organism=Schmidtea mediterranea sexual|type=transcript|length=732bp
TATGGATATACATATAATAAAAAGATTCTTCGTTTTTCTCAAGCTTCCAAGTTATAGTTTCGTAGTTTTAAAAAAAAAAT
TATTATACCCTATTACTAAACAAATAAAATTTTAATTATCTCAAAAACGAAATCCACATTTTAAAAAGCTATGTTTTTAT
AAATTTTGTGCACTTTCATTCGATCACATTTTCCATATCTCTGATAGATCGGATCGCATCTCAAGTGCAATTGATGTGCT
AATTTGTCGCATCTGTGATCGATAATTTCGAATTTTCTGTAACACCATTTTCTGATGACCCGGATACCTTGATCGAGTTT
GGCGTACAAATTATCAATCTCTATTCGACATGACTCAGTTTGAACGTCAACGCATTTGTGATTTGCGATTTCTTCCTTAT
ATTTCAAATGAAAATGAGCTCGGCGTTCATAACAGGCCTTGTGGAGAACATAAGCCTTTTCATCGCATTTCCGATCGGCT
CTGGCCCAGTCTCTGTCACATTTAGTGACAGCATTGTAGAATCGGTATTCGTGTTTGCTGCACTCAGTAACGATAAAAAG
AATAGCCAAAAATATTATGTATTTCATTTTCAAAATAAATTTTGAAAAAAAAAAAAAAAAAAGATAAATTTACCGTATTC
AGCGATATTTTTCTTTGGCATAGCATACATAATATTTTCCATTTTAAAAATGAAATAAAATGAATAAGCAAGTTGTTTTA
ATCAATCATTAG

 

back to top



PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in Category 4 cell. Click this link to learn more about PAGE.


PAGE Curations: 334


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
Category 4 cellSMED30034592Slit-2SMESG000002157.1 dd_Smed_v4_14579_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30027256SMED30027256SMESG000028953.1 dd_Smed_v4_8563_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30028726SMED30028726SMESG000079499.1 dd_Smed_v4_26394_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30027564PH domain-containing proteinSMESG000023120.1 dd_Smed_v4_12160_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30033453Dimer_Tnp_hAT domain-containing proteinSMESG000001790.1 dd_Smed_v4_212_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30030455TetraspaninSMESG000056558.1 dd_Smed_v4_3175_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30022395Chibby homolog 1 (Drosophila)SMESG000071266.1 dd_Smed_v4_8159_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30021321deoxyhypusine synthaseSMESG000049425.1 SMESG000049421.1 dd_Smed_v4_12485_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30032163Transcription factor RFX4SMESG000058756.1 dd_Smed_v4_11406_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30028306SMED30028306SMESG000056142.1 dd_Smed_v4_12968_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30026116GDP-fucose transporter 1-likeSMESG000071232.1 dd_Smed_v4_13367_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30031309nuclear protein MDM1-like isoform X1SMESG000058479.1 dd_Smed_v4_10635_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30024248SMED30024248SMESG000055844.1 dd_Smed_v4_6835_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30035157Mpv17-like protein 2SMESG000022912.1 dd_Smed_v4_11900_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30024121TetraspaninSMESG000023248.1 dd_Smed_v4_1808_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30022121SMED30022121SMESG000042798.1 dd_Smed_v4_2204_1_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30029771SMED30029771SMESG000075916.1 dd_Smed_v4_2326_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30021685Bestrophin homologSMESG000070057.1 dd_Smed_v4_8073_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30021882Disks large homolog 1SMESG000045568.1 dd_Smed_v4_8293_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30027202Progestin and adipoQ receptor family member 6SMESG000044081.1 dd_Smed_v4_14141_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED3001553460S ribosomal protein L21SMESG000040216.1 H.18.1bsmed_ncbi_20200123PMID:18786419
Eisenhoffer et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
Category 4 cellSMED3001553460S ribosomal protein L21SMESG000040216.1 H.18.1bsmed_ncbi_20200123PMID:18786419
Eisenhoffer et al., 2008
whole organism asexual adult cDNA to DNA expression microarray evidence
Category 4 cellSMED30017670N-terminal Xaa-Pro-Lys N-methyltransferase 1SMESG000059668.1 H.101.2gsmed_ncbi_20200123PMID:18786419
Eisenhoffer et al., 2008
whole organism asexual adult cDNA to DNA expression microarray evidence
Category 4 cellSMED30017670N-terminal Xaa-Pro-Lys N-methyltransferase 1SMESG000059668.1 H.101.2gsmed_ncbi_20200123PMID:18786419
Eisenhoffer et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
Category 4 cellSMED3002552260 kDa heat shock protein, mitochondrialSMESG000065325.1 H.21.6hsmed_ncbi_20200123PMID:18786419
Eisenhoffer et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
Category 4 cellSMED3002552260 kDa heat shock protein, mitochondrialSMESG000065325.1 H.21.6hsmed_ncbi_20200123PMID:18786419
Eisenhoffer et al., 2008
whole organism asexual adult cDNA to DNA expression microarray evidence
Category 4 cellSMED30017114Elongation factor 1-gammaSMESG000018714.1 NB.21.6bsmed_ncbi_20200123PMID:18786419
Eisenhoffer et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
Category 4 cellSMED30017114Elongation factor 1-gammaSMESG000018714.1 NB.21.6bsmed_ncbi_20200123PMID:18786419
Eisenhoffer et al., 2008
whole organism asexual adult cDNA to DNA expression microarray evidence
Category 4 cellSMED3000905260S ribosomal protein L18SMESG000017166.1 NB.38.10esmed_ncbi_20200123PMID:18786419
Eisenhoffer et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
Category 4 cellSMED3000905260S ribosomal protein L18SMESG000017166.1 NB.38.10esmed_ncbi_20200123PMID:18786419
Eisenhoffer et al., 2008
whole organism asexual adult cDNA to DNA expression microarray evidence
Category 4 cellSMED30016995Transformer-2-relatedSMESG000031644.1 SMESG000031639.1 H.112.11hsmed_ncbi_20200123PMID:18786419
Eisenhoffer et al., 2008
whole organism asexual adult cDNA to DNA expression microarray evidence
Category 4 cellSMED30016995Transformer-2-relatedSMESG000031644.1 SMESG000031639.1 H.112.11hsmed_ncbi_20200123PMID:18786419
Eisenhoffer et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
Category 4 cellSMED30034697Testis-specific Y-encoded-like protein 1SMESG000027817.1 SMESG000027807.1 H.96.10csmed_ncbi_20200123PMID:18786419
Eisenhoffer et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
Category 4 cellSMED30034697Testis-specific Y-encoded-like protein 1SMESG000027817.1 SMESG000027807.1 H.96.10csmed_ncbi_20200123PMID:18786419
Eisenhoffer et al., 2008
whole organism asexual adult cDNA to DNA expression microarray evidence
Category 4 cellSMED30002963KN motif and ankyrin repeat domain-containing protein 3SMESG000043522.1 dd_Smed_v4_11252_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30014345Dynein light chain roadblock dd_Smed_v4_5440_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30015660SMED30015660SMESG000018225.1 SMESG000017035.1 dd_Smed_v4_1426_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30000238SMED30000238 dd_Smed_v4_18916_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30009956SMED30009956SMESG000022273.1 dd_Smed_v4_8344_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30008080Transmembrane protein 45BSMESG000060226.1 SMESG000021986.1 dd_Smed_v4_1542_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30010405SMED30010405SMESG000043444.1 SMESG000043435.1 dd_Smed_v4_18_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30007755LIM and SH3 domain protein 1SMESG000002154.1 dd_Smed_v4_1218_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30018926SMED30018926 dd_Smed_v4_21304_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30006268angiotensin converting enzyme-1SMESG000005713.1 dd_Smed_v4_12355_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30018762stonSMESG000047629.1 dd_Smed_v4_14370_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30011623SMED30011623SMESG000043444.1 SMESG000043435.1 dd_Smed_v4_18_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30012856RNA binding motif single stranded interactingSMESG000002786.1 dd_Smed_v4_7710_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30012856RNA binding motif single stranded interactingSMESG000002793.1 SMESG000002786.1 dd_Smed_v4_11402_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30004234SMED30004234SMESG000017336.1 dd_Smed_v4_17564_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30011538SMED30011538 dd_Smed_v4_3881_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30028521Cadmium metallothionein (MT-Cd) (Cd-MT)SMESG000013781.1 dd_Smed_v4_3412_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30033551PhosphotransferaseSMESG000043559.1 dd_Smed_v4_4327_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30026964Myosin VIIA and Rab interacting proteinSMESG000012034.1 dd_Smed_v4_6834_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30028237PMP-22/EMP/MP20/Claudin tight junctionSMESG000028931.1 dd_Smed_v4_2132_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30034681cAMP-dependent protein kinase catalytic subunitSMESG000016651.1 dd_Smed_v4_911_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30029024Protein F37C4.5SMESG000064758.1 dd_Smed_v4_5168_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30035834slc4a-2SMESG000057490.1 dd_Smed_v4_7905_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30031645General transcription factor II-I repeat domain-containing 2A-like proteinSMESG000062458.1 dd_Smed_v4_5420_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30034831SMED30034831SMESG000064758.1 dd_Smed_v4_5168_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30029489Serine/threonine-protein kinaseSMESG000041899.1 SMESG000031064.1 dd_Smed_v4_8347_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30025232Dynamin-1SMESG000067156.1 dd_Smed_v4_6863_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30028359SMED30028359SMESG000010591.1 dd_Smed_v4_10661_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30030681SMED30030681SMESG000038678.1 dd_Smed_v4_327_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30021824centromere protein JSMESG000028453.1 dd_Smed_v4_13670_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30025052histone-lysine N-methyltransferase SETD1B-ASMESG000062286.1 dd_Smed_v4_11834_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30030719SMED30030719 dd_Smed_v4_31860_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30024409SMED30024409SMESG000074943.1 dd_Smed_v4_17460_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30024865Intermediate filament proteinSMESG000030599.1 SMESG000030598.1 dd_Smed_v4_364_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30024865Intermediate filament proteinSMESG000030598.1 dd_Smed_v4_503_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30021549Usp domain-containing proteinSMESG000079952.1 dd_Smed_v4_1092_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30025874SMED30025874SMESG000014644.1 dd_Smed_v4_1924_1_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30030029SMED30030029SMESG000010225.1 dd_Smed_v4_2502_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30030260TetraspaninSMESG000023404.1 dd_Smed_v4_6528_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30021279Retinal-binding proteinSMESG000035531.1 dd_Smed_v4_11513_1_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30021122Tyrosine--tRNA ligaseSMESG000055897.1 SMESG000019862.1 dd_Smed_v4_1795_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30030152SMED30030152 dd_Smed_v4_20927_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30027078SMED30027078SMESG000045917.1 dd_Smed_v4_9987_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30026157GAS2-like 3SMESG000003788.1 dd_Smed_v4_12425_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30022859SMED30022859 dd_Smed_v4_20927_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30030925SMED30030925SMESG000038398.1 dd_Smed_v4_4195_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30020710Succinyl-CoA:3-ketoacid-coenzyme A transferaseSMESG000080424.1 dd_Smed_v4_1189_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30035040Protein FAM92A1SMESG000072750.1 dd_Smed_v4_5894_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30030659Fer-1-relatedSMESG000070967.1 dd_Smed_v4_4648_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30013366Sodium/potassium-transporting ATPase subunit alphaSMESG000078146.1 dd_Smed_v4_2828_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30005698SMED30005698SMESG000052123.1 dd_Smed_v4_2845_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30010340NeuroliginSMESG000012303.1 dd_Smed_v4_7946_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30018618SMED30018618SMESG000070280.1 dd_Smed_v4_2485_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30001582SMED30001582SMESG000076741.1 dd_Smed_v4_76221_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30014765Poly(U)-specific endoribonuclease-CSMESG000018876.1 dd_Smed_v4_9109_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30019729Bestrophin homologSMESG000070057.1 dd_Smed_v4_8073_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30014810Endophilin-A3SMESG000061276.1 dd_Smed_v4_7468_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30018563SMED30018563SMESG000057635.1 dd_Smed_v4_8513_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30011490EF-hand domain-containing proteinSMESG000026288.1 dd_Smed_v4_824_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30003373Tumor necrosis factor alpha-induced protein 8-like protein 2SMESG000081288.1 dd_Smed_v4_8649_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30006454BZIP domain-containing proteinSMESG000012495.1 dd_Smed_v4_9007_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30019748NAD-dependent protein deacylaseSMESG000027361.1 dd_Smed_v4_1992_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30015943SMED30015943SMESG000014346.1 dd_Smed_v4_2231_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30018383C2 domain-containing proteinSMESG000002888.1 dd_Smed_v4_13340_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30001191Transcription factor Sox-2SMESG000067682.1 SMESG000060099.1 dd_Smed_v4_8104_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30012700SMED30012700SMESG000073126.1 dd_Smed_v4_13668_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30019717inositol phosphoceramide mannosyltransferase 2-likeSMESG000059812.1 SMESG000045480.1 SMESG000045292.1 SMESG000045267.1 SMESG000037990.1 dd_Smed_v4_2174_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30002286formimidoyltransferase-cyclodeaminaseSMESG000070969.1 dd_Smed_v4_7815_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30004315Bestrophin homologSMESG000070057.1 dd_Smed_v4_8073_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30031490SMED30031490SMESG000017778.1 dd_Smed_v4_10175_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30032785Lipopolysaccharide-induced tumor necrosis factor-alpha factor-likeSMESG000064937.1 dd_Smed_v4_10754_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30035614SMED30035614SMESG000023661.1 dd_Smed_v4_13154_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED3002901916 kDa calcium-binding proteinSMESG000066843.1 dd_Smed_v4_299_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30030845AfadinSMESG000037577.1 dd_Smed_v4_7215_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30028890Bravo_FIGEY domain-containing proteinSMESG000065363.1 SMESG000043141.1 dd_Smed_v4_1294_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30027396Fatty acid amide hydrolase 1SMESG000052378.1 SMESG000052360.1 dd_Smed_v4_2619_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30028020SMED30028020SMESG000047385.1 dd_Smed_v4_11229_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30027096SMED30027096SMESG000043600.1 dd_Smed_v4_14216_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30026856SMED30026856SMESG000034972.1 dd_Smed_v4_13559_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30025535TNF receptor associated factor-2SMESG000049688.1 SMESG000049683.1 SMESG000049676.1 SMESG000049663.1 SMESG000049649.1 SMESG000049621.1 SMESG000049614.1 SMESG000049603.1 SMESG000049567.1 SMESG000008530.1 SMESG000008521.1 dd_Smed_v4_2003_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30025153SMED30025153SMESG000029777.1 dd_Smed_v4_13914_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30031305Caveolin dd_Smed_v4_10578_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30027940cAMP-dependent protein kinase type I-alpha regulatory subunitSMESG000078298.1 dd_Smed_v4_15589_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30023766SMED30023766SMESG000073811.1 dd_Smed_v4_116_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30020222Slc43a-3SMESG000043541.1 dd_Smed_v4_17677_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30029450Succinyl-CoA:3-ketoacid-coenzyme A transferaseSMESG000080424.1 dd_Smed_v4_1189_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30021900SMED30021900SMESG000043279.1 dd_Smed_v4_13818_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30030126Neurexin-4SMESG000080138.1 dd_Smed_v4_2622_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30035502Cytochrome P450 2K1-like proteinSMESG000013701.1 SMESG000013700.1 SMESG000013697.1 dd_Smed_v4_2083_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30032006slc7a-2SMESG000031905.1 dd_Smed_v4_13828_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30021239SMED30021239SMESG000010487.1 dd_Smed_v4_9329_1_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30022252Transient receptor potential cation channel subfamily M memberSMESG000068517.1 dd_Smed_v4_13669_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30025937SMED30025937SMESG000014771.1 dd_Smed_v4_3104_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30029902Protein kinase domain-containing proteinSMESG000074943.1 SMESG000074941.1 dd_Smed_v4_6760_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30031461Phosphatidylinositol 4-phosphate 5-kinase 2SMESG000012434.1 dd_Smed_v4_9195_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30034119SPRY domain-containing SOCS box protein 3 dd_Smed_v4_9874_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30025105Plastin 3SMESG000081126.1 SMESG000081113.1 dd_Smed_v4_749_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30033197SMED30033197SMESG000073811.1 dd_Smed_v4_116_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30024636G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000076050.1 dd_Smed_v4_6788_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30023196Glycosyl hydrolase family 25SMESG000049688.1 SMESG000049683.1 SMESG000049676.1 SMESG000049663.1 SMESG000049649.1 SMESG000049621.1 SMESG000049614.1 SMESG000049603.1 SMESG000049567.1 SMESG000008530.1 SMESG000008521.1 dd_Smed_v4_2003_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30004363cAMP-dependent protein kinase catalytic subunit alphaSMESG000063155.1 dd_Smed_v4_5162_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30000647Cell wall integrity and stress response component 1SMESG000035037.1 SMESG000035036.1 dd_Smed_v4_6380_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30000644Kinesin proteinSMESG000060958.1 dd_Smed_v4_7196_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30006740SJCHGC04139 proteinSMESG000035447.1 dd_Smed_v4_5091_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30011060SMED30011060SMESG000018625.1 dd_Smed_v4_7135_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30034555Acetylcholine receptor subunit alpha-likeSMESG000023242.1 dd_Smed_v4_13494_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30028743Regulator of G-protein signaling 22SMESG000069110.1 dd_Smed_v4_11778_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30030378MFS domain-containing proteinSMESG000060698.1 dd_Smed_v4_16395_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30032048Protein CBG14354SMESG000040050.1 dd_Smed_v4_14769_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30032048Protein CBG14354SMESG000040050.1 dd_Smed_v4_9805_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30034849Kyphoscoliosis peptidaseSMESG000061907.1 dd_Smed_v4_1109_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30029814slc17a-3SMESG000066847.1 dd_Smed_v4_1874_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30034787Sodium/potassium-transporting ATPase subunit beta-1SMESG000032752.1 dd_Smed_v4_1688_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30029870SMED30029870SMESG000060698.1 dd_Smed_v4_16395_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30031927SMED30031927SMESG000013309.1 dd_Smed_v4_15118_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30015453Poly [ADP-ribose] polymeraseSMESG000011115.1 dd_Smed_v4_2611_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30015473Actin cytoplasmic type 5SMESG000080982.1 SMESG000080969.1 dd_Smed_v4_2624_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30017727Calpain-5SMESG000012000.1 dd_Smed_v4_6985_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30015967Neurotracting/lsamp/neurotrimin/obcam related cell adhesion moleculeSMESG000068491.1 dd_Smed_v4_2826_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30014640Small heat shock protein p36SMESG000028601.1 dd_Smed_v4_6399_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30018451Lipopolysaccharide-induced TNF-alpha factorSMESG000020870.1 SMESG000046087.1 SMESG000046084.1 dd_Smed_v4_2768_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30012139slc2a-2SMESG000081673.1 dd_Smed_v4_3190_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30014578SMED30014578SMESG000056168.1 dd_Smed_v4_31605_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30014321neural proliferation differentiation and control protein 1SMESG000034753.1 dd_Smed_v4_5338_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30018439XK-related proteinSMESG000080414.1 dd_Smed_v4_2770_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30033765SMED30033765SMESG000017154.1 dd_Smed_v4_7064_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30028249SMED30028249SMESG000065865.1 dd_Smed_v4_2375_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30021146SERPIN domain-containing proteinSMESG000054563.1 dd_Smed_v4_3824_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30030637SMED30030637SMESG000056889.1 dd_Smed_v4_4060_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30032436Adipocyte plasma membrane-associated proteinSMESG000052602.1 dd_Smed_v4_3602_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30026927GCR044SMESG000020870.1 SMESG000046087.1 SMESG000046084.1 dd_Smed_v4_2768_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30026809TransporterSMESG000009987.1 dd_Smed_v4_7097_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30029309C2H2-type domain-containing proteinSMESG000006935.1 SMESG000006932.1 dd_Smed_v4_6216_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30035435SMED30035435SMESG000040472.1 dd_Smed_v4_5757_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30029492KN motif and ankyrin repeat domain-containing protein 4 isoform X2SMESG000059500.1 dd_Smed_v4_7499_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30030662SMED30030662SMESG000024141.1 dd_Smed_v4_2719_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30034660Spectrin beta chain, non-erythrocytic 5SMESG000023006.1 dd_Smed_v4_2514_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30027451PMP-22/EMP/MP20/Claudin tight junctionSMESG000029752.1 dd_Smed_v4_2731_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30021297Disks large homolog 1SMESG000020502.1 dd_Smed_v4_3493_1_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30030655Fibronectin type 3 and ankyrin repeat domains protein 1SMESG000030957.1 dd_Smed_v4_7496_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30032913X1.A.G7.1SMESG000046819.1 SMESG000046815.1 SMESG000046812.1 dd_Smed_v4_7161_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30026612Intermediate filament proteinSMESG000030599.1 SMESG000030598.1 dd_Smed_v4_364_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30035584Stabilizer of axonemal microtubules 2SMESG000009389.1 dd_Smed_v4_3695_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30029820E3 ubiquitin-protein ligase MYLIPSMESG000074789.1 SMESG000054150.1 dd_Smed_v4_2867_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30030750SMED30030750SMESG000027921.1 dd_Smed_v4_7521_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30016401Venom allergen 5SMESG000005602.1 dd_Smed_v4_1988_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30013082Dynein light chainSMESG000081226.1 SMESG000081215.1 dd_Smed_v4_1888_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30014069Transposable element Tcb1 transposaseSMESG000010591.1 dd_Smed_v4_10661_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30008902inositol phosphoceramide mannosyltransferase 2-likeSMESG000059812.1 SMESG000045480.1 SMESG000045292.1 SMESG000045267.1 SMESG000037990.1 dd_Smed_v4_2174_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30014360Choline dehydrogenaseSMESG000055690.1 SMESG000055689.1 SMESG000055687.1 dd_Smed_v4_1744_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30011717SMED30011717SMESG000078112.1 dd_Smed_v4_16420_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30002729SMED30002729SMESG000023322.1 dd_Smed_v4_22326_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30015825inositol phosphoceramide mannosyltransferase 2-likeSMESG000059812.1 SMESG000045480.1 SMESG000045292.1 SMESG000045267.1 SMESG000037990.1 dd_Smed_v4_2174_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30012960CalmodulinSMESG000003548.1 dd_Smed_v4_10083_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30009121Galectin domain-containing proteinSMESG000022399.1 dd_Smed_v4_10749_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30008169EF-hand domain-containing proteinSMESG000026622.1 dd_Smed_v4_1881_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30013131protein PLANT CADMIUM RESISTANCE 2-like dd_Smed_v4_4778_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30018067ADAMTS-like protein 3SMESG000073115.1 dd_Smed_v4_12413_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30003728Slc43a-3SMESG000043541.1 dd_Smed_v4_17677_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30015069ANK_REP_REGION domain-containing proteinSMESG000063648.1 dd_Smed_v4_10764_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30004467Tyrosine phosphatase domain-containing protein 1SMESG000055316.1 SMESG000054364.1 dd_Smed_v4_13749_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30010176SMED30010176SMESG000008958.1 dd_Smed_v4_10363_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30009014Alpha/beta hydrolaseSMESG000022359.1 dd_Smed_v4_10155_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30018138SMED30018138SMESG000017276.1 dd_Smed_v4_639_1_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30018138SMED30018138SMESG000017276.1 dd_Smed_v4_1245_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30001421SMED30001421SMESG000078112.1 dd_Smed_v4_16420_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30015020E3 ubiquitin-protein ligase XIAPSMESG000031958.1 dd_Smed_v4_2104_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30002638Protein kinase domain-containing proteinSMESG000074913.1 dd_Smed_v4_12976_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30002728Dual specificity tyrosine-phosphorylation-regulated kinase 2SMESG000042409.1 dd_Smed_v4_10966_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30015584Nesprin-1SMESG000016745.1 dd_Smed_v4_23532_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30015584Nesprin-1SMESG000016745.1 dd_Smed_v4_23535_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30015584Nesprin-1SMESG000016745.1 dd_Smed_v4_17767_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30017502slc6a-9SMESG000009986.1 dd_Smed_v4_13317_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30006877SMED30006877SMESG000017276.1 dd_Smed_v4_1245_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30004357SMED30004357SMESG000060698.1 dd_Smed_v4_16395_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30014981Gelsolin-like proteinSMESG000015924.1 dd_Smed_v4_1673_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30018956SMED30018956 dd_Smed_v4_2990_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30001211SMED30001211SMESG000004998.1 dd_Smed_v4_18299_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30016274Golgi-associated plant pathogenesis-related protein 1SMESG000070308.1 dd_Smed_v4_12963_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30017997WSC domain-containing proteinSMESG000057220.1 dd_Smed_v4_10762_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30001511SMED30001511SMESG000029772.1 dd_Smed_v4_16888_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30011562Leishmanolysin-like peptidaseSMESG000063815.1 dd_Smed_v4_10609_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30008239SMED30008239SMESG000020557.1 dd_Smed_v4_13196_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30019398N-acetyltransferase domain-containing proteinSMESG000023874.1 dd_Smed_v4_13214_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30009418SMED30009418SMESG000013309.1 dd_Smed_v4_15118_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30015125SMED30015125SMESG000061766.1 dd_Smed_v4_12632_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30015978MFS domain-containing proteinSMESG000060698.1 dd_Smed_v4_14153_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30010991SMED30010991SMESG000014346.1 dd_Smed_v4_6441_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30010991SMED30010991SMESG000014346.1 dd_Smed_v4_2231_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30009414SMED30009414SMESG000042497.1 dd_Smed_v4_17939_1_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30007120Transient receptor potential cation channel subfamily M memberSMESG000068504.1 dd_Smed_v4_15098_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30006714SMED30006714SMESG000001790.1 dd_Smed_v4_212_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30010872Gln-synt_C domain-containing proteinSMESG000003829.1 dd_Smed_v4_2247_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30011688SMED30011688SMESG000010591.1 dd_Smed_v4_10661_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30015238SMED30015238SMESG000061127.1 dd_Smed_v4_10789_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30008349Histone-lysine N-methyltransferase SETMARSMESG000017253.1 SMESG000015137.1 dd_Smed_v4_1612_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30010242Transmembrane protein 86ASMESG000010122.1 SMESG000001487.1 dd_Smed_v4_11970_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30000827SMED30000827SMESG000043280.1 dd_Smed_v4_278_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30013241SMED30013241SMESG000007775.1 dd_Smed_v4_137_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30002963KN motif and ankyrin repeat domain-containing protein 3SMESG000043522.1 dd_Smed_v4_12845_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30013656SMED30013656SMESG000038678.1 SMED30030681smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
Category 4 cellSMED30013656SMED30013656SMESG000038678.1 SMED30030681smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
Category 4 cellSMED30013656SMED30013656SMESG000038678.1 SMED30030681smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 5 colorimetric in situ hybridization evidence
Category 4 cellSMED30013656SMED30013656SMESG000038678.1 SMED30030681smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
Category 4 cellSMED30030681SMED30030681SMESG000038678.1 SMED30030681smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
Category 4 cellSMED30030681SMED30030681SMESG000038678.1 SMED30030681smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
Category 4 cellSMED30030681SMED30030681SMESG000038678.1 SMED30030681smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 5 colorimetric in situ hybridization evidence
Category 4 cellSMED30030681SMED30030681SMESG000038678.1 SMED30030681smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
Category 4 cellSMED30011708Neural cell adhesion molecule 1SMESG000077686.1 dd_Smed_v4_3768_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30011798E3 ubiquitin-protein ligase MIB2SMESG000043477.1 SMESG000010549.1 SMESG000010347.1 SMESG000010327.1 dd_Smed_v4_593_1_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30006736colorectal mutant cancer proteinSMESG000002794.1 dd_Smed_v4_5396_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30011617Actin-related protein 2/3 complex subunit 4SMESG000003841.1 dd_Smed_v4_977_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30008021SMED30008021SMESG000023815.1 SMESG000017115.1 dd_Smed_v4_4479_1_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30007845Family S60 non-peptidase homologue (S60 family)SMESG000027224.1 dd_Smed_v4_2523_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30007097Rho guanine nucleotide exchange factor 28SMESG000021797.1 dd_Smed_v4_5252_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30006931SMED30006931SMESG000040565.1 dd_Smed_v4_4660_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30009426SMED30009426SMESG000016940.1 dd_Smed_v4_6421_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30011754ETS domain-containing proteinSMESG000021791.1 dd_Smed_v4_7040_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30009212Ferric-chelate reductase 1SMESG000061404.1 dd_Smed_v4_8497_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30010112SMED30010112SMESG000037132.1 SMESG000037110.1 dd_Smed_v4_6499_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30012118Pyruvate kinaseSMESG000017671.1 dd_Smed_v4_6483_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30007543nesprin-1-likeSMESG000016747.1 SMESG000016745.1 dd_Smed_v4_5365_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30009166SMED30009166SMESG000073246.1 dd_Smed_v4_29498_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30011294Protein kinase domain-containing proteinSMESG000041899.1 SMESG000031064.1 dd_Smed_v4_8347_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30006549SMED30006549SMESG000016886.1 SMESG000016875.1 dd_Smed_v4_7893_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30001325slc25a-12SMESG000064880.1 dd_Smed_v4_2449_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30000242ComplexinSMESG000023815.1 SMESG000017115.1 dd_Smed_v4_4479_1_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30002066SMED30002066SMESG000016886.1 SMESG000016875.1 dd_Smed_v4_7893_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30006624InnexinSMESG000036796.1 dd_Smed_v4_30125_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30003846Expressed conserved proteinSMESG000068288.1 dd_Smed_v4_3595_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30000746SMED30000746SMESG000024821.1 SMESG000024754.1 dd_Smed_v4_306_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30005745Protein kinaseSMESG000017260.1 dd_Smed_v4_4170_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30003113SMED30003113SMESG000067883.1 SMESG000067876.1 dd_Smed_v4_3259_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30000740ets-1SMESG000033821.1 dd_Smed_v4_9165_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30000740ets-1SMESG000033821.1 dd_Smed_v4_9185_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30004840Coiled-coil domain containing 88AaSMESG000012304.1 dd_Smed_v4_3591_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30005762Contactin/TAG-1 cell adhesion moleculeSMESG000036495.1 dd_Smed_v4_2673_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30004319Coiled-coil domain containing 88CSMESG000066575.1 SMESG000066583.1 dd_Smed_v4_5291_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30005178Alkaline ceramidaseSMESG000043974.1 dd_Smed_v4_9570_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30026726RING domain ligase2 isoform 3SMESG000003596.1 dd_Smed_v4_5871_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30030168Latent transforming growth factor beta binding protein 3SMESG000008188.1 dd_Smed_v4_1886_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30023411slc42a-1SMESG000048384.1 dd_Smed_v4_1882_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30019923Armadillo repeat protein deleted in velo-cardio-facial syndromeSMESG000072739.1 dd_Smed_v4_8312_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30019856SMED30019856SMESG000023815.1 SMESG000017115.1 dd_Smed_v4_4479_1_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30021641SMED30021641SMESG000040565.1 dd_Smed_v4_4660_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30022574START domain-containing proteinSMESG000046413.1 SMESG000037645.1 dd_Smed_v4_3734_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30026845SMED30026845SMESG000038702.1 SMESG000038692.1 dd_Smed_v4_637_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30021812Dolichol kinase-like ProteinSMESG000022975.1 dd_Smed_v4_7896_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30025076SMED30025076SMESG000010166.1 dd_Smed_v4_2518_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30022804slc12a-1SMESG000043221.1 SMESG000043220.1 dd_Smed_v4_4047_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30025593hemipterousSMESG000000893.1 dd_Smed_v4_5234_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30023073Placenta specific protein 8SMESG000050177.1 dd_Smed_v4_3182_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30022622Centrosomal protein 350SMESG000033533.1 dd_Smed_v4_5967_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30021825Expressed conserved proteinSMESG000021837.1 dd_Smed_v4_4104_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30024985Translin-associated factor X-interacting protein 1SMESG000051766.1 SMESG000051767.1 dd_Smed_v4_4532_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30024390Synaptotagmin like 4SMESG000042371.1 dd_Smed_v4_7945_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30025553Cell polarity proteinSMESG000027800.1 dd_Smed_v4_4789_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30026808EF-hand domain-containing proteinSMESG000081370.1 dd_Smed_v4_446_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30024840LactadherinSMESG000001686.1 dd_Smed_v4_5463_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30035611Fras1 related extracellular matrix proteinSMESG000032220.1 dd_Smed_v4_2407_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30034824SMED30034824SMESG000035183.1 dd_Smed_v4_951_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30031822SMED30031822SMESG000077258.1 dd_Smed_v4_8993_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30032915Alkaline phosphataseSMESG000061191.1 dd_Smed_v4_8942_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30017663Fer-1-relatedSMESG000070967.1 dd_Smed_v4_4648_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30013041SMED30013041SMESG000049878.1 dd_Smed_v4_4914_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30017175ras GTPase-activating protein nGAP isoform X8SMESG000037132.1 SMESG000037110.1 dd_Smed_v4_6499_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30019531NPHP6SMESG000072747.1 dd_Smed_v4_7145_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30014517SMED30014517SMESG000067410.1 dd_Smed_v4_6359_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30014374Low affinity cationic amino acid transporterSMESG000049007.1 dd_Smed_v4_2552_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30017966Protein bark beetleSMESG000041025.1 dd_Smed_v4_8448_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30012710SMED30012710SMESG000066979.1 dd_Smed_v4_4593_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30013334Glutathione peroxidaseSMESG000077750.1 dd_Smed_v4_662_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30014235Myeloid differentiation primary response protein MyD88SMESG000051766.1 SMESG000051767.1 dd_Smed_v4_4532_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30013676nesprin-1-likeSMESG000016747.1 SMESG000016745.1 dd_Smed_v4_5365_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30018339SMED30018339SMESG000005125.1 dd_Smed_v4_4793_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30019133SMED30019133SMESG000019555.1 dd_Smed_v4_6722_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30017888TLC domain-containing proteinSMESG000068531.1 dd_Smed_v4_9135_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30012419Non-specific serine/threonine protein kinaseSMESG000069962.1 SMESG000069953.1 SMESG000069952.1 dd_Smed_v4_3244_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30012419Non-specific serine/threonine protein kinaseSMESG000069952.1 dd_Smed_v4_6414_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30013315SMED30013315SMESG000022425.1 dd_Smed_v4_3843_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30017618Rho GTPase activating protein 24SMESG000036427.1 dd_Smed_v4_6320_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30019590notch-1SMESG000056635.1 dd_Smed_v4_4586_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30005523Alpha-actininSMESG000026000.1 dd_Smed_v4_1951_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30019771Ammonium transporter Rh type BSMESG000048384.1 dd_Smed_v4_1882_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30005007Roc domain-containing proteinSMESG000073246.1 dd_Smed_v4_29498_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30014183SMED30014183SMESG000061464.1 dd_Smed_v4_21634_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30002655Ig-like domain-containing proteinSMESG000079770.1 dd_Smed_v4_1914_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30010117SMED30010117SMESG000000893.1 dd_Smed_v4_5234_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30002215DUF862 domain-containing proteinSMESG000024669.1 dd_Smed_v4_3583_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30008057Protein kinase CSMESG000037135.1 dd_Smed_v4_2110_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30028574Cytochrome P450 2K1-like proteinSMESG000078092.1 SMESG000078091.1 dd_Smed_v4_2351_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30022057SJCHGC08494 proteinSMESG000027083.1 dd_Smed_v4_2196_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30022701SMED30022701SMESG000006039.1 dd_Smed_v4_10442_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30035148SMED30035148SMESG000021388.1 dd_Smed_v4_1925_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30003096Phospholipase YtpASMESG000038738.1 dd_Smed_v4_6727_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30010380SJCHGC04139 proteinSMESG000022419.1 dd_Smed_v4_4617_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30008453SMED30008453SMESG000074789.1 SMESG000054150.1 dd_Smed_v4_2867_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30008453SMED30008453SMESG000074791.1 SMESG000074789.1 SMESG000054155.1 dd_Smed_v4_9776_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30011970Colobus proteinSMESG000005049.1 dd_Smed_v4_4427_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Category 4 cellSMED30002072Intermediate filament proteinSMESG000030598.1 dd_Smed_v4_503_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Note: Hover over icons to view figure legend

 

 

back to top