photoreceptor neuron

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ In Situ Hybridization Data

  ▻ Sequences

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  photoreceptor neuron


DEFINITON:

  Bipolar photoreceptor neurons with dendritic projections into the optic cup and axons that innervate the underlying brain.


TERM DEFINITION CITATIONS:

  PMID:21852957, PMID:22884275


TERM CITATIONS:


TERM ID:

  PLANA:0000017


ABOUT THIS TERM:

photoreceptor neuron

  ↳is a material entity and neuron

  ↳contained in head, dorsal region of the whole animal and anterior region of the whole animal

  ↳develops from trail cell

  ↳existence overlaps juvenile, asexual adult, adult hermaphrodite, Stage 8 and Stage 7

  ↳existence starts during or after Stage 7

  ↳part of eye


Expand to see terms that part of photoreceptor neuron


BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30030594OpsinopsinStage 7, Stage 8photoreceptor neuron, visual system, eye
SMED30018592AFP48372.1ovoovoStage 6, Stage 7, Stage 8trail cell, photoreceptor neuron, optic cup, pigment cup cell, visual system, eye
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30018592 ID=SMED30018592|Name=ovo|organism=Schmidtea mediterranea sexual|type=transcript|length=1211bp
GTCATATTGAACACTGAGACTAGCTATCAATAGCTGACAATTAGACGTATAAAATGTTAGGGTACGCCTTTTTGGCCATT
ATTTCACACCAAAATTTCCATGAGTATTTTTCTAATAAGCACTCTACTCGCAAACGATGACGAAATGCCCACAGATTTGT
CATCGAAAACTGAAAAGATTGAAAACCATGAAAAATCTGAAAGGAATCTCTGCAAGTATTCCAGTCAGTTTCTTTCCTGT
TTTTATTCACAGGAAATGTTGACACTACTTATGAGAAAAAATTTCATCAATCAATATTCATTTTATTTAAAGATTTTCTC
GGGGTTTCCACAATTCGTCGATAACTTCAACTTAGTAAATCCAACAGATTTCACCGTCAATTCAAATTCAACAACAATTT
TGCCCTCATTCAACTTCCATAAAACGTCATTGAATATCGAAATGAACACCTCACTGGCCAATTCTTCAAGCACTGGTAGG
TCGTCTCCAACTGAAACTGTGTCTGAAAATCTTTGGTTAGAAAAAGTAAAGGTGGAAAAATATTTCCATTTAATTGAAAA
TCTATCACAATCCCAAGAGAACATTGAAGACATTGTCAAAACGATCAAAGTCAAACGAAGAAATTTTGCTGAATATATTA
AGAAACTTTACCTAAGTGATCCAGCCAAATTTAAGTTGACAAATGGTGGAGATGGAATAGTAAATCCATTTAGAAAACAA
TTCAAAGAAGAACGAGATAAATCTATGGACAAATTTTGCATCGAAGTTAATCACAATTATCAATGTAAGATATGTAACAA
GGTGTTTCCTTCCAAAAAGCACATGCAACGTCATATACGTTCACACGGTGTAAATTTTGATTGGTTGTGTAAATATTGTT
TTAAACCGTTTATTGATTCCTACGATTTAAAACGACATACGAGAGTCCATACAGGAGTTCAACCATACAAATGTCAAAGT
TGCACAAGAAAATTCAGTCAACGATGCTCATTGGAAAGTCATCAGGTGAAAATCCATGGAGTAGCACTGAATTATCTATA
CAAAGAAAGAAGGAACAAGTTGTATCCGTGTGAAATCTGCAGTTATAGTACGTCTTGTAAAGCAACTTGGTTGAGTCACA
TCATTCAGGAGCACCCGAATTCACTTTATGCAAAAGAAGAAGCACTCAAAGGAAAATACAACTGACTTTGAAAAATATTG
ATTTTTCAAGC
>SMED30030594 ID=SMED30030594|Name=Opsin|organism=Schmidtea mediterranea sexual|type=transcript|length=1880bp
AATAAAATGAAATTTATAATGCCATTGGTATTTACACTGTGGTTAATAACGATAATAATCAGAATTTTTAATGATAAATA
TAGTAAACGATAACTAGTAACGGTAACCCTAATAATGAATGCTATATTACATATAGTAGTGTTACCAAAATTTTGGAATT
TAAAATAATAAGTTTATTATGAGTGACCATGATAATAAAAAAGATTTTTAAATAAAATGATAATATTACTATATAGTCGG
TTATAGTTCCGATTAGTCTACTATCGTAGACGTAATAAAAAGAGTTTAGTAACCTAATTTTCAATGTTTTTTGAAAGTTG
CTCGTCTCTATGGCAACTTATTATCGTAAGGAAAATTTTCTACTTCACTATGATATTTTCGGAGTGAATTTATTGATTTA
CATTCAAGGACTTTCACTATTGCATTTACTGAAGCGATCGTTTCATTTGGAACTCATATTTTCGCCCCTAATCGTTCTGG
AATTTATTATTTATGATCCTTTATCTGACCTTAAAAATTTTCATATTCATGAGTGTCCAATCTTTTGCCAATTTGGGAAA
TAAGCTCCTAGAAAATGCTACCTTCAATAATGAATCCCTTACAAAGTCAGTATGGCATTGGGATCCTGAATTTGAATCAA
TTGTCCATCCGTACTGGCGGACTTTTGATATGGTGCCAGAAGTTTATCATTATTTAGTTGGAGTGTATATTTCTATTGTT
GGAATATCGGGAGTTCTGGGAAATCTTCTTGTTCTTTACATATTTGCAAGCGCCAAAAGTTTAAGAACTCCTCCAAATAT
GTTTATAATGAGTTTAGCAATTGGAGATTTGACATTTTCTGCTGTGAATGGCTTCCCCTTACTTACTATTTCAAGTTTTA
ACACTCGATGGGCTTGGGGAAAATTAACGTGTGAGATTTATGGTTTCATCGGTGGTCTTTTTGGGTTTATATCCATCAAC
ACAATGGCACTAATTTCTCTGGATAGGTATTTTGTTATTGCCCAACCATTTCAAACAATGAAATCCCTGACAATCAAAAG
AGCAATAATCATGTTGGTTTTCGTATGGCTTTATTCATTAATTTGGTCAACACCGCCATTTTTTGGATATGGAAATTATG
TGCCGGAAGGATTTCAAACGTCTTGTACATTCGACTATTTGACCCAATCAAAAGGTAACATAATATTCAATATTGGGATG
TACATAGGAAATTTCATAATTCCCGTTGGAATAATTATATTTTGCTATTATCAAATTGTCAAAGCAGTGCGAGTACATGA
ATTAGAAATGTTAAAAATGGCTCAAAAGATGAATGCATCTCATCCAACTTCCATGAAAACGGGTGCAAAAAAGGCTGATG
TTCAAGCTGCAAAGATTTCTGTCATAATTGTCTTTTTATATATGTTATCATGGACACCATATGCAATAATTGCCCTTATG
GCTCTCACAGGGCGTAGAGATCATCTGAATCCATACACTGCAGAATTGCCGGTACTCTTTGCTAAGACCTCAGCTATGTA
CAACCCATTTATATACGCAATAAATCATCCAAAATTTCGAATTCAGCTGGAAAAGAAATTTCCATGTTTGATTTGTTGCT
GTCCACCAAAACCAAAAGAAAGGGACACTACAAGTGCAGCATCAGCAACGAAACCGAGTAAATATCAGAGTGAAAGAGAA
AGTTCAATGTCTCAACTGGATCCTGAAGACGATAAACAAGTCGTAGAAACCACCAAGAATCAAACCACAAGTGGACATAC
AAATGAAGCTTACGAGAGTGAACAGAAGTAGTTGATGAAACTAAATTATTCTATTTTTAATGACACTAGATCTTTATAAT
AATTTTATTTAAGGGAATGAGCACTGAATTTTGCGCAAAT

 

back to top



PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in photoreceptor neuron. Click this link to learn more about PAGE.


PAGE Curations: 172


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
photoreceptor neuronSMED30007326otxASMESG000031965.1 otxAsmed_ncbi_20200123PMID:23318641
Chen et al., 2013
whole organism asexual adult fluorescence in situ hybridization evidence
photoreceptor neuronSMED30030594OpsinSMESG000074489.1 opsinsmed_ncbi_20200123PMID:22451003
González-Sastre et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30030594OpsinSMESG000074489.1 SMED30030594smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
photoreceptor neuronSMED30030594OpsinSMESG000074489.1 SMED30030594smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
photoreceptor neuronSMED30030594OpsinSMESG000074489.1 opsinsmed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
photoreceptor neuronSMED30030594OpsinSMESG000074489.1 opsinsmed_ncbi_20200123PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
photoreceptor neuronSMED30004142Calcium-dependent secretion activator 1SMESG000011756.1 SMED30004142smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30004278KinaseSMESG000019079.1 SMED30004278smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30004462Voltage gated potassium channelSMESG000017777.1 SMED30004462smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30004877Glycine receptor subunit alpha-3SMESG000032691.1 SMED30004877smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30004463Cyclic nucleotide gated channel 1SMESG000038954.1 SMED30004463smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30003418Guanine nucleotide-binding protein subunit betaSMESG000018712.1 SMED30003418smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30004455DUF2428 domain-containing proteinSMESG000032327.1 SMED30004455smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30003750Vang-3SMESG000046198.1 SMESG000046194.1 SMED30003750smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30004383SMED30004383SMESG000026568.1 SMESG000026569.1 SMED30004383smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30003444SMED30003444SMESG000033629.1 SMED30003444smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30004698Small conductance calcium-activated potassium channel proteinSMESG000076156.1 SMED30004698smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30004686Oxygen-dependent choline dehydrogenaseSMESG000064120.1 SMED30004686smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30003346slc12a-4SMESG000019076.1 SMED30003346smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30015874DNA cross-link repair 1CSMESG000028344.1 SMED30015874smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30017852Ras family proteinSMESG000019606.1 SMED30017852smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30005308SMED30005308SMESG000004298.1 SMED30005308smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30018866Diacylglycerol kinaseSMESG000051710.1 SMED30018866smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30005453slc16a-18SMESG000003109.1 SMED30005453smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30005805Homeobox domain-containing proteinSMESG000041571.1 SMED30005805smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30008588Guanylate cyclase domain-containing protein SMED30008588smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30018266Phosphatidylinositol-binding clathrin assembly proteinSMESG000020797.1 SMED30018266smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30006093Multiple PDZ domain crumbs cell polarity complex componentSMESG000056186.1 SMED30006093smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30015061G protein regulated inducer of neurite outgrowthSMESG000062691.1 SMED30015061smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED300146071-phosphatidylinositol 4,5-bisphosphate phosphodiesteraseSMESG000013964.1 SMESG000013960.1 SMESG000013958.1 SMED30014607smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30018530SMED30018530 SMED30018530smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30021280Leucine Rich repeat-containing domain proteinSMESG000006503.1 SMED30021280smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30020439aadc SMESG000066844.1 SMED30020439smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30020469LIM zinc-binding domain-containing proteinSMESG000026096.1 SMED30020469smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30027710Ras-related protein Rab-3 SMED30027710smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30034853Zinc finger protein SMED30034853smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30017182SMED30017182SMESG000017559.1 SMED30017182smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30015272SMED30015272SMESG000045574.1 SMED30015272smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30016952Frizzled 5/8 proteinSMESG000005043.1 SMED30016952smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30019358SMED30019358SMESG000017193.1 SMED30019358smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30019914Disks large homolog 1SMESG000034854.1 SMED30019914smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30017522Parathyroid hormone receptor 1SMESG000076892.1 SMED30017522smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30016078Actin, cytoplasmicSMESG000012332.1 SMESG000012317.1 SMED30016078smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30019307NAD-dependent protein deacylaseSMESG000074693.1 SMED30019307smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30017949slc7a-6SMESG000051755.1 SMED30017949smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30020715SMED30020715SMESG000016957.1 SMED30020715smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30022428RING-type domain-containing proteinSMESG000010565.1 SMED30022428smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30020678G-protein, gamma subunit,domain-containing proteinSMESG000066557.1 SMED30020678smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30021266Uncoordinated 5SMESG000073898.1 SMED30021266smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30021279Retinal-binding proteinSMESG000035531.1 SMED30021279smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30022145Kinase-like proteinSMESG000036830.1 SMED30022145smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30020051ThioninSMESG000031412.1 SMED30020051smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30020953Frizzled-5SMESG000031852.1 SMED30020953smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED300215505-hydroxytryptamine receptor 2CSMESG000032682.1 SMESG000032679.1 SMED30021550smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30014199MyosinSMESG000047361.1 SMED30014199smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30014606Copine-3SMESG000007275.1 SMED30014606smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30010835Cadherin-23SMESG000081529.1 SMESG000081574.1 SMED30010835smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30011091Ski oncogeneSMESG000044463.1 SMED30011091smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30011936slc29a-2SMESG000078543.1 SMED30011936smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30013445TetraspaninSMESG000063435.1 SMESG000027204.1 SMED30013445smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30011402Ras familySMESG000007281.1 SMED30011402smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30013686MAP3K-1SMESG000054386.1 SMED30013686smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30014577Inositol 1,4,5-trisphosphate receptorSMESG000061586.1 SMED30014577smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30015176Regulator of G-protein signaling 3SMESG000022937.1 SMED30015176smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30011469Kelch-like protein diabloSMESG000077860.1 SMED30011469smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30013790Protocadherin-9SMESG000076350.1 SMED30013790smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30013129Gamma-aminobutyric acid receptor subunit beta ASMESG000026005.1 SMED30013129smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30011215ATP-binding cassette sub-family B member 6, mitochondrialSMESG000070808.1 SMESG000070801.1 SMESG000070797.1 SMED30011215smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30000964FMRFamide-activated amiloride-sensitive sodium channelSMESG000029017.1 SMED30000964smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30001792Retinal pigment epithelium-derived rhodopsin homologSMESG000045023.1 SMED30001792smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30003048Tyrosine-protein kinaseSMESG000064511.1 SMED30003048smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30000221CDP-diacylglycerol--inositol 3-phosphatidyltransferaseSMESG000008297.1 SMED30000221smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30002301Protein kinase domain-containing proteinSMESG000011366.1 SMED30002301smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30000277SMED30000277SMESG000022971.1 SMED30000277smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30002295Glutamine-dependent NAD( ) synthetaseSMESG000004423.1 SMED30002295smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30000553Epithelial discoidin domain-containing receptorSMESG000069322.1 SMED30000553smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30003166slc4a-4SMESG000039045.1 SMED30003166smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30000596PeroxiredoxinSMESG000001807.1 SMED30000596smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30003066NEK8-1SMESG000053193.1 SMED30003066smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30000488Double C2-like domain-containing protein betaSMESG000009083.1 SMED30000488smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30003275Guanine nucleotide-binding protein G(O) subunit alphaSMESG000055191.1 SMED30003275smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30003228Dach-1SMESG000005090.1 SMED30003228smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30002758Phosphatidate cytidylyltransferaseSMESG000068325.1 SMED30002758smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30001570Cyclin-dependent kinase 17SMESG000050786.1 SMESG000050790.1 SMED30001570smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30001672NADH dehydrogenase [ubiquinone] iron-sulfur protein 7, mitochondrialSMESG000035542.1 SMED30001672smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30008195Non-specific serine/threonine protein kinaseSMESG000022413.1 SMED30008195smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30009756TNF receptor-associated factor 4SMESG000016362.1 SMED30009756smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30008456Type I inositol-1,4,5-trisphosphate 5-phosphataseSMESG000074184.1 SMED30008456smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30007389Peripheral plasma membrane protein CASKSMESG000060582.1 SMED30007389smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30009498slc4a-3SMESG000049796.1 SMED30009498smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30007480Protein kinase CSMESG000039865.1 SMESG000039854.1 SMED30007480smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30006225Cyclin dependent kinase like 1SMESG000038932.1 SMED30006225smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30008671PhosphodiesteraseSMESG000021196.1 SMED30008671smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30007610Guanine nucleotide-binding protein G(q) subunit alphaSMESG000022892.1 SMED30007610smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30008033Plasma membrane calcium-transporting ATPase 3SMESG000006504.1 SMED30008033smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30009508Phosphatidylinositol 4-kinase alphaSMESG000041715.1 SMED30009508smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30010168Cyclic nucleotide gated channel alpha 3SMESG000044898.1 SMESG000035733.1 SMED30010168smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30008157Rhodanese-like proteinSMESG000030828.1 SMED30008157smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30006813UDG domain-containing proteinSMESG000064938.1 SMED30006813smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30008651Guanylate cyclaseSMESG000019264.1 SMED30008651smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30001461SMED30001461SMESG000006530.1 Smed-meissmed_ncbi_20200123PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30018592ovoSMESG000081129.1 Smed-ovosmed_ncbi_20200123PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30011784MeisSMESG000006530.1 Smed-meissmed_ncbi_20200123PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30019744SMED-SMAD6/7-2SMESG000021574.1 JQ278720.1smed_ncbi_20200123PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30015273SMED30015273SMESG000006530.1 Smed-meissmed_ncbi_20200123PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30019065Voltage gated potassium channelSMESG000017777.1 SMED30004462smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30028012SMED30028012SMESG000045023.1 SMED30001792smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30035599meisSMESG000006530.1 Smed-meissmed_ncbi_20200123PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30025778SOXB1-1SMESG000011244.1 Smed-soxBsmed_ncbi_20200123PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30027502Potassium/sodium hyperpolarization-activated cyclic nucleotide-gated channelSMESG000038954.1 SMED30004463smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30026741klf Smed-klfsmed_ncbi_20200123PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30021413SMED30021413 SMED30018530smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30009185Transient-receptor-potential-like proteinSMESG000024108.1 SMED30025288smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30000222RNA binding protein MEX3BSMESG000066973.1 SMED30025239smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30002172Transient-receptor-potential-like proteinSMESG000024108.1 SMED30025288smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30002272SMED30002272SMESG000071928.1 SMED30028255smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30005978Cyclic nucleotide gated channel alpha 3SMESG000044898.1 SMESG000035733.1 SMED30010168smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30023733Sodium/potassium-transporting ATPase subunit beta-2SMESG000071416.1 SMED30026182smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30026934SMED30026934SMESG000050824.1 SMED30026934smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30024999CTF/NF-I domain-containing proteinSMESG000010567.1 SMED30024999smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30029327slc8a-1SMESG000077236.1 SMED30029327smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30032368C2 domain-containing proteinSMESG000059632.1 SMED30032368smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30024549Copine-3SMESG000029196.1 SMED30024549smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30026182Sodium/potassium-transporting ATPase subunit beta-2SMESG000071416.1 SMED30026182smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30030374Regulator of G protein signaling 20SMESG000073688.1 SMED30030374smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30028236slc16a-2SMESG000026519.1 SMED30028236smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30034920G protein gamma domain-containing proteinSMESG000066557.1 SMED30020678smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30028591Protein kinaseSMESG000030545.1 SMED30028591smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30025144Protein rolling stoneSMESG000077396.1 SMED30025144smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30034880Discoidin domain-containing receptor 2SMESG000067438.1 SMED30034880smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30024516slc25a-28SMESG000054493.1 SMED30024516smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30022812Receptor-type tyrosine-protein phosphatase SSMESG000068618.1 SMED30022812smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30024342Neuropeptide Y receptor, invertebrateSMESG000059151.1 SMED30024342smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30025532PhosphodiesteraseSMESG000004031.1 SMED30025532smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30027886SMED30027886SMESG000003427.1 SMED30027886smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30032892foxQ2SMESG000062929.1 SMED30032892smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30031519Tyrosine-protein kinaseSMESG000020289.1 SMED30031519smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30034201Delta-like proteinSMESG000036778.1 SMED30034201smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30023840Membrane-associated phosphatidylinositol transfer protein 1SMESG000004877.1 SMED30023840smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30034676G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000002498.1 SMED30034676smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30030065Progestin and adipoQ receptor family member 3SMESG000021251.1 SMED30030065smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30031686Gelsolin-like protein 2SMESG000015922.1 SMED30031686smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30028255RRM domain-containing proteinSMESG000071928.1 SMED30028255smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30027684SMED30027684SMESG000036851.1 SMED30027684smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30030155SMED30030155SMESG000036778.1 SMED30034201smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30025288Transient-receptor-potential-like proteinSMESG000024108.1 SMED30025288smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30034968LysM domain-containing proteinSMESG000014261.1 SMED30034968smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30032019Moesin/ezrin/radixin homolog 1SMESG000068090.1 SMED30032019smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30025239Roundabout, axon guidance receptor, homolog 1 (Drosophila)SMESG000066973.1 SMED30025239smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED300348555-hydroxytryptamine receptorSMESG000008878.1 SMED30034855smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30029026Multidrug resistance-associated protein 1SMESG000014785.1 SMED30029026smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30029255Sodium/myo-inositol cotransporterSMESG000051963.1 SMED30029255smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30030621Regulator of G-protein signaling, putativeSMESG000072045.1 SMED30030621smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30028063SH3_10 domain-containing proteinSMESG000018362.1 SMESG000018320.1 SMED30028063smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30026628Short transient receptor potential channel 4SMESG000078533.1 SMED30026628smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30035339RIMS binding protein 2SMESG000001071.1 SMESG000001061.1 SMESG000001060.1 SMED30035339smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30027767SMED30027767SMESG000065100.1 SMED30027767smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30030326SMED30030326SMESG000001071.1 SMESG000001061.1 SMESG000001060.1 SMED30035339smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30029811Tyrosine-protein kinase receptorSMESG000041792.1 SMED30029811smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30031199Beta-arrestinSMESG000006894.1 SMED30031199smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30027945Major facilitator superfamily domain containing proteinSMESG000010822.1 SMED30027945smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30036016Histone H2ASMESG000018807.1 SMED30036016smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30031651slc43a-3SMESG000043542.1 SMED30031651smed_20140614PMID:22884275
Lapan et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30007326otxASMESG000031965.1 otxAsmed_ncbi_20200123PMID:28976975
Su et al., 2017
whole organism asexual adult fluorescence in situ hybridization evidence
photoreceptor neuronSMED30002900B-catenin 4SMESG000035212.1 KY196225.1smed_ncbi_20200123PMID:28976975
Su et al., 2017
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30002900B-catenin 4SMESG000035212.1 KY196225.1smed_ncbi_20200123PMID:28976975
Su et al., 2017
whole organism asexual adult fluorescence in situ hybridization evidence
photoreceptor neuronSMED30030594OpsinSMESG000074489.1 SMED30030594smed_20140614PMID:28976975
Su et al., 2017
whole organism asexual adult fluorescence in situ hybridization evidence
photoreceptor neuronSMED30030594OpsinSMESG000074489.1 SMED30030594smed_20140614PMID:18287199
Iglesias et al., 2008
whole organism asexual adult colorimetric in situ hybridization evidence
photoreceptor neuronSMED30010096TPA_inf: prohormone convertase 2SMESG000008070.1 SMESG000008069.1 BK007043smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
photoreceptor neuronSMED30034479EYE53-1 BK007033smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism asexual adult fluorescence in situ hybridization evidence
photoreceptor neuronSMED30027106SMED30027106SMESG000008070.1 SMESG000008069.1 BK007043smed_ncbi_20200123PMID:20967238
Collins JJ et al., 2010
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
photoreceptor neuronSMED30030594OpsinSMESG000074489.1 opsinsmed_ncbi_20200123PMID:21852957
Lapan et al., 2011
whole organism asexual adult fluorescence in situ hybridization evidence
Note: Hover over icons to view figure legend

 

 

back to top