photoreceptor neuron
▻ Planarian Anatomy Ontology Class Overview
▻ Embryonic Molecular Fate Mapping
▻ In Situ Hybridization Data
▻ Sequences
▻ PAGE: Planarian Anatomy Gene Expression
Planarian Anatomy Ontology Class Overview
For more information about the ontology visit PLANA Overview
NAME:
photoreceptor neuron
DEFINITON:
Bipolar photoreceptor neurons with dendritic projections into the optic cup and axons that innervate the underlying brain.
TERM DEFINITION CITATIONS:
PMID:21852957, PMID:22884275
TERM CITATIONS:
Expand publication list
- PMID:25493551
- PMID:28137894
- PMID:26017970
- PMID:19048075
- PMID:25254346
- PMID:18202849
- PMID:29674432
- PMID:21282632
- PMID:17942485
- PMID:17905225
- PMID:21852957
- PMID:27612384
- PMID:30143032
- PMID:25356635
- PMID:28495872
- PMID:22549959
- PMID:24063805
- PMID:26618653
- PMID:22445864
- PMID:28245923
- PMID:20967238
- PMID:23318641
- PMID:22339734
- ISBN:9780070316607
- PMID:28216315
- PMID:28976975
- PMID:30471994
- PMID:25772472
- PMID:29547123
- PMID:30485821
- PMID:23250205
- PMID:17251262
- PMID:30399335
- PMID:24922054
- PMID:22411224
- PMID:16033796
- PMID:29674431
- PMID:22884275
- PMID:17390146
- PMID:17553481
- PMID:27068018
- PMID:27800171
- PMID:22427692
- PMID:27606067
TERM ID:
PLANA:0000017
ABOUT THIS TERM:
photoreceptor neuron
↳is a material entity and neuron ↳contained in head, dorsal region of the whole animal and anterior region of the whole animal
↳develops from trail cell
↳existence overlaps juvenile, asexual adult, adult hermaphrodite, Stage 8 and Stage 7
↳existence starts during or after Stage 7
↳part of eye
Expand to see terms that part of photoreceptor neuron
BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):
Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.
EXPLORE ONTOLOGY GRAPH:
Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.
Embryonic Molecular Fate Mapping
All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource
IN SITU HYBRIDIZATION DATA:
Smed ID Accession Name Alias Expressed during stage(s) Tissue/Pattern Images
SMED30030594 Opsin opsin Stage 7, Stage 8 photoreceptor neuron, visual system, eye 
SMED30018592 AFP48372.1 ovo ovo Stage 6, Stage 7, Stage 8 trail cell, photoreceptor neuron, optic cup, pigment cup cell, visual system, eye 
Click to see image symbols and abbreviations
Abbreviation or symbol Definition
O oral hemisphere
A aboral hemisphere
D dorsal
V ventral
L lateral
black arrowhead embryonic pharynx
red arrowhead definitive pharynx
black arrows primitive gut
yellow arrows primitive ectoderm cells
cyan arrows brain
cyan arrowheads nerve cords
blue arrowheads eye progenitors (trail cells)
purple arrowheads eyes
scale bar 100 µm
SEQUENCES:
smed_20140614 transcript sequences for genes validated by in situ hybridization (above).
>SMED30018592 ID=SMED30018592|Name=ovo|organism=Schmidtea mediterranea sexual|type=transcript|length=1211bp
GTCATATTGAACACTGAGACTAGCTATCAATAGCTGACAATTAGACGTATAAAATGTTAGGGTACGCCTTTTTGGCCATT
ATTTCACACCAAAATTTCCATGAGTATTTTTCTAATAAGCACTCTACTCGCAAACGATGACGAAATGCCCACAGATTTGT
CATCGAAAACTGAAAAGATTGAAAACCATGAAAAATCTGAAAGGAATCTCTGCAAGTATTCCAGTCAGTTTCTTTCCTGT
TTTTATTCACAGGAAATGTTGACACTACTTATGAGAAAAAATTTCATCAATCAATATTCATTTTATTTAAAGATTTTCTC
GGGGTTTCCACAATTCGTCGATAACTTCAACTTAGTAAATCCAACAGATTTCACCGTCAATTCAAATTCAACAACAATTT
TGCCCTCATTCAACTTCCATAAAACGTCATTGAATATCGAAATGAACACCTCACTGGCCAATTCTTCAAGCACTGGTAGG
TCGTCTCCAACTGAAACTGTGTCTGAAAATCTTTGGTTAGAAAAAGTAAAGGTGGAAAAATATTTCCATTTAATTGAAAA
TCTATCACAATCCCAAGAGAACATTGAAGACATTGTCAAAACGATCAAAGTCAAACGAAGAAATTTTGCTGAATATATTA
AGAAACTTTACCTAAGTGATCCAGCCAAATTTAAGTTGACAAATGGTGGAGATGGAATAGTAAATCCATTTAGAAAACAA
TTCAAAGAAGAACGAGATAAATCTATGGACAAATTTTGCATCGAAGTTAATCACAATTATCAATGTAAGATATGTAACAA
GGTGTTTCCTTCCAAAAAGCACATGCAACGTCATATACGTTCACACGGTGTAAATTTTGATTGGTTGTGTAAATATTGTT
TTAAACCGTTTATTGATTCCTACGATTTAAAACGACATACGAGAGTCCATACAGGAGTTCAACCATACAAATGTCAAAGT
TGCACAAGAAAATTCAGTCAACGATGCTCATTGGAAAGTCATCAGGTGAAAATCCATGGAGTAGCACTGAATTATCTATA
CAAAGAAAGAAGGAACAAGTTGTATCCGTGTGAAATCTGCAGTTATAGTACGTCTTGTAAAGCAACTTGGTTGAGTCACA
TCATTCAGGAGCACCCGAATTCACTTTATGCAAAAGAAGAAGCACTCAAAGGAAAATACAACTGACTTTGAAAAATATTG
ATTTTTCAAGC
>SMED30030594 ID=SMED30030594|Name=Opsin|organism=Schmidtea mediterranea sexual|type=transcript|length=1880bp
AATAAAATGAAATTTATAATGCCATTGGTATTTACACTGTGGTTAATAACGATAATAATCAGAATTTTTAATGATAAATA
TAGTAAACGATAACTAGTAACGGTAACCCTAATAATGAATGCTATATTACATATAGTAGTGTTACCAAAATTTTGGAATT
TAAAATAATAAGTTTATTATGAGTGACCATGATAATAAAAAAGATTTTTAAATAAAATGATAATATTACTATATAGTCGG
TTATAGTTCCGATTAGTCTACTATCGTAGACGTAATAAAAAGAGTTTAGTAACCTAATTTTCAATGTTTTTTGAAAGTTG
CTCGTCTCTATGGCAACTTATTATCGTAAGGAAAATTTTCTACTTCACTATGATATTTTCGGAGTGAATTTATTGATTTA
CATTCAAGGACTTTCACTATTGCATTTACTGAAGCGATCGTTTCATTTGGAACTCATATTTTCGCCCCTAATCGTTCTGG
AATTTATTATTTATGATCCTTTATCTGACCTTAAAAATTTTCATATTCATGAGTGTCCAATCTTTTGCCAATTTGGGAAA
TAAGCTCCTAGAAAATGCTACCTTCAATAATGAATCCCTTACAAAGTCAGTATGGCATTGGGATCCTGAATTTGAATCAA
TTGTCCATCCGTACTGGCGGACTTTTGATATGGTGCCAGAAGTTTATCATTATTTAGTTGGAGTGTATATTTCTATTGTT
GGAATATCGGGAGTTCTGGGAAATCTTCTTGTTCTTTACATATTTGCAAGCGCCAAAAGTTTAAGAACTCCTCCAAATAT
GTTTATAATGAGTTTAGCAATTGGAGATTTGACATTTTCTGCTGTGAATGGCTTCCCCTTACTTACTATTTCAAGTTTTA
ACACTCGATGGGCTTGGGGAAAATTAACGTGTGAGATTTATGGTTTCATCGGTGGTCTTTTTGGGTTTATATCCATCAAC
ACAATGGCACTAATTTCTCTGGATAGGTATTTTGTTATTGCCCAACCATTTCAAACAATGAAATCCCTGACAATCAAAAG
AGCAATAATCATGTTGGTTTTCGTATGGCTTTATTCATTAATTTGGTCAACACCGCCATTTTTTGGATATGGAAATTATG
TGCCGGAAGGATTTCAAACGTCTTGTACATTCGACTATTTGACCCAATCAAAAGGTAACATAATATTCAATATTGGGATG
TACATAGGAAATTTCATAATTCCCGTTGGAATAATTATATTTTGCTATTATCAAATTGTCAAAGCAGTGCGAGTACATGA
ATTAGAAATGTTAAAAATGGCTCAAAAGATGAATGCATCTCATCCAACTTCCATGAAAACGGGTGCAAAAAAGGCTGATG
TTCAAGCTGCAAAGATTTCTGTCATAATTGTCTTTTTATATATGTTATCATGGACACCATATGCAATAATTGCCCTTATG
GCTCTCACAGGGCGTAGAGATCATCTGAATCCATACACTGCAGAATTGCCGGTACTCTTTGCTAAGACCTCAGCTATGTA
CAACCCATTTATATACGCAATAAATCATCCAAAATTTCGAATTCAGCTGGAAAAGAAATTTCCATGTTTGATTTGTTGCT
GTCCACCAAAACCAAAAGAAAGGGACACTACAAGTGCAGCATCAGCAACGAAACCGAGTAAATATCAGAGTGAAAGAGAA
AGTTCAATGTCTCAACTGGATCCTGAAGACGATAAACAAGTCGTAGAAACCACCAAGAATCAAACCACAAGTGGACATAC
AAATGAAGCTTACGAGAGTGAACAGAAGTAGTTGATGAAACTAAATTATTCTATTTTTAATGACACTAGATCTTTATAAT
AATTTTATTTAAGGGAATGAGCACTGAATTTTGCGCAAAT
PAGE: Planarian Anatomy Gene Expression
These transcripts were reported as being expressed in photoreceptor neuron. Click this link to learn more about PAGE.
PAGE Curations: 172
PLANA Term Reference Transcript Description Gene Models Published Transcript Transcriptome Publication Specimen Lifecycle Evidence photoreceptor neuron SMED30007326 otxA SMESG000031965.1 otxA smed_ncbi_20200123 PMID:23318641
Chen et al., 2013
photoreceptor neuron SMED30030594 Opsin SMESG000074489.1 opsin smed_ncbi_20200123 PMID:22451003
González-Sastre et al., 2012
photoreceptor neuron SMED30030594 Opsin SMESG000074489.1 SMED30030594 smed_20140614 PMID:28072387
Davies et al., 2017
photoreceptor neuron SMED30030594 Opsin SMESG000074489.1 SMED30030594 smed_20140614 PMID:28072387
Davies et al., 2017
photoreceptor neuron SMED30030594 Opsin SMESG000074489.1 opsin smed_ncbi_20200123 PMID:28072387
Davies et al., 2017
photoreceptor neuron SMED30030594 Opsin SMESG000074489.1 opsin smed_ncbi_20200123 PMID:28072387
Davies et al., 2017
photoreceptor neuron SMED30017182 SMED30017182 SMESG000017559.1 SMED30017182 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30003418 Guanine nucleotide-binding protein subunit beta SMESG000018712.1 SMED30003418 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30010835 Cadherin-23 SMESG000081529.1 SMESG000081574.1 SMED30010835 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30003750 Vang-3 SMESG000046198.1 SMESG000046194.1 SMED30003750 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30004383 SMED30004383 SMESG000026568.1 SMESG000026569.1 SMED30004383 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30013445 Tetraspanin SMESG000063435.1 SMESG000027204.1 SMED30013445 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30003444 SMED30003444 SMESG000033629.1 SMED30003444 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30016078 Actin, cytoplasmic SMESG000012332.1 SMESG000012317.1 SMED30016078 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30014577 Inositol 1,4,5-trisphosphate receptor SMESG000061586.1 SMED30014577 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30008588 Guanylate cyclase domain-containing protein SMED30008588 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30013790 Protocadherin-9 SMESG000076350.1 SMED30013790 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30010168 Cyclic nucleotide gated channel alpha 3 SMESG000044898.1 SMESG000035733.1 SMED30010168 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30018530 SMED30018530 SMED30018530 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30020051 Thionin SMESG000031412.1 SMED30020051 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30024999 CTF/NF-I domain-containing protein SMESG000010567.1 SMED30024999 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30029327 slc8a-1 SMESG000077236.1 SMED30029327 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30020715 SMED30020715 SMESG000016957.1 SMED30020715 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30024516 slc25a-28 SMESG000054493.1 SMED30024516 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30022812 Receptor-type tyrosine-protein phosphatase S SMESG000068618.1 SMED30022812 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30024342 Neuropeptide Y receptor, invertebrate SMESG000059151.1 SMED30024342 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30027710 Ras-related protein Rab-3 SMED30027710 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30027684 SMED30027684 SMESG000036851.1 SMED30027684 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30025239 Roundabout, axon guidance receptor, homolog 1 (Drosophila) SMESG000066973.1 SMED30025239 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30029255 Sodium/myo-inositol cotransporter SMESG000051963.1 SMED30029255 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30028063 SH3_10 domain-containing protein SMESG000018362.1 SMESG000018320.1 SMED30028063 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30027767 SMED30027767 SMESG000065100.1 SMED30027767 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30020953 Frizzled-5 SMESG000031852.1 SMED30020953 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30021550 5-hydroxytryptamine receptor 2C SMESG000032682.1 SMESG000032679.1 SMED30021550 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30019358 SMED30019358 SMESG000017193.1 SMED30019358 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30019914 Disks large homolog 1 SMESG000034854.1 SMED30019914 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30018866 Diacylglycerol kinase SMESG000051710.1 SMED30018866 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30019307 NAD-dependent protein deacylase SMESG000074693.1 SMED30019307 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30018266 Phosphatidylinositol-binding clathrin assembly protein SMESG000020797.1 SMED30018266 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30017949 slc7a-6 SMESG000051755.1 SMED30017949 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30021280 Leucine Rich repeat-containing domain protein SMESG000006503.1 SMED30021280 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30020439 aadc SMESG000066844.1 SMED30020439 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30020469 LIM zinc-binding domain-containing protein SMESG000026096.1 SMED30020469 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30022428 RING-type domain-containing protein SMESG000010565.1 SMED30022428 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30020678 G-protein, gamma subunit,domain-containing protein SMESG000066557.1 SMED30020678 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30023840 Membrane-associated phosphatidylinositol transfer protein 1 SMESG000004877.1 SMED30023840 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30021266 Uncoordinated 5 SMESG000073898.1 SMED30021266 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30021279 Retinal-binding protein SMESG000035531.1 SMED30021279 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30022145 Kinase-like protein SMESG000036830.1 SMED30022145 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30015874 DNA cross-link repair 1C SMESG000028344.1 SMED30015874 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30014199 Myosin SMESG000047361.1 SMED30014199 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30014606 Copine-3 SMESG000007275.1 SMED30014606 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30017852 Ras family protein SMESG000019606.1 SMED30017852 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30015272 SMED30015272 SMESG000045574.1 SMED30015272 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30016952 Frizzled 5/8 protein SMESG000005043.1 SMED30016952 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30011936 slc29a-2 SMESG000078543.1 SMED30011936 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30017522 Parathyroid hormone receptor 1 SMESG000076892.1 SMED30017522 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30011402 Ras family SMESG000007281.1 SMED30011402 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30013686 MAP3K-1 SMESG000054386.1 SMED30013686 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30015176 Regulator of G-protein signaling 3 SMESG000022937.1 SMED30015176 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30011469 Kelch-like protein diablo SMESG000077860.1 SMED30011469 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30015061 G protein regulated inducer of neurite outgrowth SMESG000062691.1 SMED30015061 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30013129 Gamma-aminobutyric acid receptor subunit beta A SMESG000026005.1 SMED30013129 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30011215 ATP-binding cassette sub-family B member 6, mitochondrial SMESG000070808.1 SMESG000070801.1 SMESG000070797.1 SMED30011215 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30014607 1-phosphatidylinositol 4,5-bisphosphate phosphodiesterase SMESG000013964.1 SMESG000013960.1 SMESG000013958.1 SMED30014607 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30004142 Calcium-dependent secretion activator 1 SMESG000011756.1 SMED30004142 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30004278 Kinase SMESG000019079.1 SMED30004278 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30004462 Voltage gated potassium channel SMESG000017777.1 SMED30004462 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30004877 Glycine receptor subunit alpha-3 SMESG000032691.1 SMED30004877 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30004463 Cyclic nucleotide gated channel 1 SMESG000038954.1 SMED30004463 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30005308 SMED30005308 SMESG000004298.1 SMED30005308 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30004455 DUF2428 domain-containing protein SMESG000032327.1 SMED30004455 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30005453 slc16a-18 SMESG000003109.1 SMED30005453 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30005805 Homeobox domain-containing protein SMESG000041571.1 SMED30005805 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30004698 Small conductance calcium-activated potassium channel protein SMESG000076156.1 SMED30004698 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30006093 Multiple PDZ domain crumbs cell polarity complex component SMESG000056186.1 SMED30006093 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30004686 Oxygen-dependent choline dehydrogenase SMESG000064120.1 SMED30004686 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30003346 slc12a-4 SMESG000019076.1 SMED30003346 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30008195 Non-specific serine/threonine protein kinase SMESG000022413.1 SMED30008195 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30009756 TNF receptor-associated factor 4 SMESG000016362.1 SMED30009756 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30008456 Type I inositol-1,4,5-trisphosphate 5-phosphatase SMESG000074184.1 SMED30008456 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30007389 Peripheral plasma membrane protein CASK SMESG000060582.1 SMED30007389 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30009498 slc4a-3 SMESG000049796.1 SMED30009498 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30007480 Protein kinase C SMESG000039865.1 SMESG000039854.1 SMED30007480 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30006225 Cyclin dependent kinase like 1 SMESG000038932.1 SMED30006225 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30011091 Ski oncogene SMESG000044463.1 SMED30011091 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30008671 Phosphodiesterase SMESG000021196.1 SMED30008671 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30007610 Guanine nucleotide-binding protein G(q) subunit alpha SMESG000022892.1 SMED30007610 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30008033 Plasma membrane calcium-transporting ATPase 3 SMESG000006504.1 SMED30008033 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30009508 Phosphatidylinositol 4-kinase alpha SMESG000041715.1 SMED30009508 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30008157 Rhodanese-like protein SMESG000030828.1 SMED30008157 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30006813 UDG domain-containing protein SMESG000064938.1 SMED30006813 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30008651 Guanylate cyclase SMESG000019264.1 SMED30008651 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30015273 SMED30015273 SMESG000006530.1 Smed-meis smed_ncbi_20200123 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30026934 SMED30026934 SMESG000050824.1 SMED30026934 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30032368 C2 domain-containing protein SMESG000059632.1 SMED30032368 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30024549 Copine-3 SMESG000029196.1 SMED30024549 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30026182 Sodium/potassium-transporting ATPase subunit beta-2 SMESG000071416.1 SMED30026182 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30030374 Regulator of G protein signaling 20 SMESG000073688.1 SMED30030374 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30028236 slc16a-2 SMESG000026519.1 SMED30028236 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30028591 Protein kinase SMESG000030545.1 SMED30028591 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30025144 Protein rolling stone SMESG000077396.1 SMED30025144 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30034880 Discoidin domain-containing receptor 2 SMESG000067438.1 SMED30034880 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30025532 Phosphodiesterase SMESG000004031.1 SMED30025532 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30027886 SMED30027886 SMESG000003427.1 SMED30027886 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30032892 foxQ2 SMESG000062929.1 SMED30032892 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30031519 Tyrosine-protein kinase SMESG000020289.1 SMED30031519 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30034201 Delta-like protein SMESG000036778.1 SMED30034201 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30034676 G_PROTEIN_RECEP_F1_2 domain-containing protein SMESG000002498.1 SMED30034676 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30030065 Progestin and adipoQ receptor family member 3 SMESG000021251.1 SMED30030065 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30031686 Gelsolin-like protein 2 SMESG000015922.1 SMED30031686 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30028255 RRM domain-containing protein SMESG000071928.1 SMED30028255 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30025288 Transient-receptor-potential-like protein SMESG000024108.1 SMED30025288 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30034968 LysM domain-containing protein SMESG000014261.1 SMED30034968 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30032019 Moesin/ezrin/radixin homolog 1 SMESG000068090.1 SMED30032019 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30034855 5-hydroxytryptamine receptor SMESG000008878.1 SMED30034855 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30029026 Multidrug resistance-associated protein 1 SMESG000014785.1 SMED30029026 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30030621 Regulator of G-protein signaling, putative SMESG000072045.1 SMED30030621 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30026628 Short transient receptor potential channel 4 SMESG000078533.1 SMED30026628 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30035339 RIMS binding protein 2 SMESG000001071.1 SMESG000001061.1 SMESG000001060.1 SMED30035339 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30031199 Beta-arrestin SMESG000006894.1 SMED30031199 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30027945 Major facilitator superfamily domain containing protein SMESG000010822.1 SMED30027945 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30036016 Histone H2A SMESG000018807.1 SMED30036016 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30031651 slc43a-3 SMESG000043542.1 SMED30031651 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30000964 FMRFamide-activated amiloride-sensitive sodium channel SMESG000029017.1 SMED30000964 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30001792 Retinal pigment epithelium-derived rhodopsin homolog SMESG000045023.1 SMED30001792 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30003048 Tyrosine-protein kinase SMESG000064511.1 SMED30003048 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30000221 CDP-diacylglycerol--inositol 3-phosphatidyltransferase SMESG000008297.1 SMED30000221 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30002301 Protein kinase domain-containing protein SMESG000011366.1 SMED30002301 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30000277 SMED30000277 SMESG000022971.1 SMED30000277 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30002295 Glutamine-dependent NAD( ) synthetase SMESG000004423.1 SMED30002295 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30000553 Epithelial discoidin domain-containing receptor SMESG000069322.1 SMED30000553 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30003166 slc4a-4 SMESG000039045.1 SMED30003166 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30000596 Peroxiredoxin SMESG000001807.1 SMED30000596 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30003066 NEK8-1 SMESG000053193.1 SMED30003066 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30000488 Double C2-like domain-containing protein beta SMESG000009083.1 SMED30000488 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30003275 Guanine nucleotide-binding protein G(O) subunit alpha SMESG000055191.1 SMED30003275 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30003228 Dach-1 SMESG000005090.1 SMED30003228 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30002758 Phosphatidate cytidylyltransferase SMESG000068325.1 SMED30002758 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30001570 Cyclin-dependent kinase 17 SMESG000050786.1 SMESG000050790.1 SMED30001570 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30001672 NADH dehydrogenase [ubiquinone] iron-sulfur protein 7, mitochondrial SMESG000035542.1 SMED30001672 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30009185 Transient-receptor-potential-like protein SMESG000024108.1 SMED30025288 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30002172 Transient-receptor-potential-like protein SMESG000024108.1 SMED30025288 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30002272 SMED30002272 SMESG000071928.1 SMED30028255 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30019065 Voltage gated potassium channel SMESG000017777.1 SMED30004462 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30023733 Sodium/potassium-transporting ATPase subunit beta-2 SMESG000071416.1 SMED30026182 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30034920 G protein gamma domain-containing protein SMESG000066557.1 SMED30020678 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30030155 SMED30030155 SMESG000036778.1 SMED30034201 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30027502 Potassium/sodium hyperpolarization-activated cyclic nucleotide-gated channel SMESG000038954.1 SMED30004463 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30030326 SMED30030326 SMESG000001071.1 SMESG000001061.1 SMESG000001060.1 SMED30035339 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30001461 SMED30001461 SMESG000006530.1 Smed-meis smed_ncbi_20200123 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30018592 ovo SMESG000081129.1 Smed-ovo smed_ncbi_20200123 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30011784 Meis SMESG000006530.1 Smed-meis smed_ncbi_20200123 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30019744 SMED-SMAD6/7-2 SMESG000021574.1 JQ278720.1 smed_ncbi_20200123 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30000222 RNA binding protein MEX3B SMESG000066973.1 SMED30025239 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30005978 Cyclic nucleotide gated channel alpha 3 SMESG000044898.1 SMESG000035733.1 SMED30010168 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30028012 SMED30028012 SMESG000045023.1 SMED30001792 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30035599 meis SMESG000006530.1 Smed-meis smed_ncbi_20200123 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30025778 SOXB1-1 SMESG000011244.1 Smed-soxB smed_ncbi_20200123 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30034853 Zinc finger protein SMED30034853 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30029811 Tyrosine-protein kinase receptor SMESG000041792.1 SMED30029811 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30026741 klf Smed-klf smed_ncbi_20200123 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30021413 SMED30021413 SMED30018530 smed_20140614 PMID:22884275
Lapan et al., 2012
photoreceptor neuron SMED30030594 Opsin SMESG000074489.1 SMED30030594 smed_20140614 PMID:28976975
Su et al., 2017
photoreceptor neuron SMED30002900 B-catenin 4 SMESG000035212.1 KY196225.1 smed_ncbi_20200123 PMID:28976975
Su et al., 2017
photoreceptor neuron SMED30002900 B-catenin 4 SMESG000035212.1 KY196225.1 smed_ncbi_20200123 PMID:28976975
Su et al., 2017
photoreceptor neuron SMED30007326 otxA SMESG000031965.1 otxA smed_ncbi_20200123 PMID:28976975
Su et al., 2017
photoreceptor neuron SMED30030594 Opsin SMESG000074489.1 SMED30030594 smed_20140614 PMID:18287199
Iglesias et al., 2008
photoreceptor neuron SMED30010096 TPA_inf: prohormone convertase 2 SMESG000008070.1 SMESG000008069.1 BK007043 smed_ncbi_20200123 PMID:20967238
Collins JJ et al., 2010
photoreceptor neuron SMED30034479 EYE53-1 BK007033 smed_ncbi_20200123 PMID:20967238
Collins JJ et al., 2010
photoreceptor neuron SMED30027106 SMED30027106 SMESG000008070.1 SMESG000008069.1 BK007043 smed_ncbi_20200123 PMID:20967238
Collins JJ et al., 2010
photoreceptor neuron SMED30030594 Opsin SMESG000074489.1 opsin smed_ncbi_20200123 PMID:21852957
Lapan et al., 2011
Note: Hover over icons to view figure legend
↳contained in head, dorsal region of the whole animal and anterior region of the whole animal
↳develops from trail cell
↳existence overlaps juvenile, asexual adult, adult hermaphrodite, Stage 8 and Stage 7
↳existence starts during or after Stage 7
↳part of eye
Expand to see terms that part of photoreceptor neuron
BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):
Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.
EXPLORE ONTOLOGY GRAPH:
Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.
Embryonic Molecular Fate Mapping
All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource
IN SITU HYBRIDIZATION DATA:
Smed ID | Accession | Name | Alias | Expressed during stage(s) | Tissue/Pattern | Images |
---|---|---|---|---|---|---|
SMED30030594 | Opsin | opsin | Stage 7, Stage 8 | photoreceptor neuron, visual system, eye | ![]() | |
SMED30018592 | AFP48372.1 | ovo | ovo | Stage 6, Stage 7, Stage 8 | trail cell, photoreceptor neuron, optic cup, pigment cup cell, visual system, eye | ![]() |
Click to see image symbols and abbreviations
Abbreviation or symbol | Definition |
---|---|
O | oral hemisphere |
A | aboral hemisphere |
D | dorsal |
V | ventral |
L | lateral |
black arrowhead | embryonic pharynx |
red arrowhead | definitive pharynx |
black arrows | primitive gut |
yellow arrows | primitive ectoderm cells |
cyan arrows | brain |
cyan arrowheads | nerve cords |
blue arrowheads | eye progenitors (trail cells) |
purple arrowheads | eyes |
scale bar | 100 µm |
SEQUENCES:
smed_20140614 transcript sequences for genes validated by in situ hybridization (above).
>SMED30018592 ID=SMED30018592|Name=ovo|organism=Schmidtea mediterranea sexual|type=transcript|length=1211bp
GTCATATTGAACACTGAGACTAGCTATCAATAGCTGACAATTAGACGTATAAAATGTTAGGGTACGCCTTTTTGGCCATT
ATTTCACACCAAAATTTCCATGAGTATTTTTCTAATAAGCACTCTACTCGCAAACGATGACGAAATGCCCACAGATTTGT
CATCGAAAACTGAAAAGATTGAAAACCATGAAAAATCTGAAAGGAATCTCTGCAAGTATTCCAGTCAGTTTCTTTCCTGT
TTTTATTCACAGGAAATGTTGACACTACTTATGAGAAAAAATTTCATCAATCAATATTCATTTTATTTAAAGATTTTCTC
GGGGTTTCCACAATTCGTCGATAACTTCAACTTAGTAAATCCAACAGATTTCACCGTCAATTCAAATTCAACAACAATTT
TGCCCTCATTCAACTTCCATAAAACGTCATTGAATATCGAAATGAACACCTCACTGGCCAATTCTTCAAGCACTGGTAGG
TCGTCTCCAACTGAAACTGTGTCTGAAAATCTTTGGTTAGAAAAAGTAAAGGTGGAAAAATATTTCCATTTAATTGAAAA
TCTATCACAATCCCAAGAGAACATTGAAGACATTGTCAAAACGATCAAAGTCAAACGAAGAAATTTTGCTGAATATATTA
AGAAACTTTACCTAAGTGATCCAGCCAAATTTAAGTTGACAAATGGTGGAGATGGAATAGTAAATCCATTTAGAAAACAA
TTCAAAGAAGAACGAGATAAATCTATGGACAAATTTTGCATCGAAGTTAATCACAATTATCAATGTAAGATATGTAACAA
GGTGTTTCCTTCCAAAAAGCACATGCAACGTCATATACGTTCACACGGTGTAAATTTTGATTGGTTGTGTAAATATTGTT
TTAAACCGTTTATTGATTCCTACGATTTAAAACGACATACGAGAGTCCATACAGGAGTTCAACCATACAAATGTCAAAGT
TGCACAAGAAAATTCAGTCAACGATGCTCATTGGAAAGTCATCAGGTGAAAATCCATGGAGTAGCACTGAATTATCTATA
CAAAGAAAGAAGGAACAAGTTGTATCCGTGTGAAATCTGCAGTTATAGTACGTCTTGTAAAGCAACTTGGTTGAGTCACA
TCATTCAGGAGCACCCGAATTCACTTTATGCAAAAGAAGAAGCACTCAAAGGAAAATACAACTGACTTTGAAAAATATTG
ATTTTTCAAGC
>SMED30030594 ID=SMED30030594|Name=Opsin|organism=Schmidtea mediterranea sexual|type=transcript|length=1880bp
AATAAAATGAAATTTATAATGCCATTGGTATTTACACTGTGGTTAATAACGATAATAATCAGAATTTTTAATGATAAATA
TAGTAAACGATAACTAGTAACGGTAACCCTAATAATGAATGCTATATTACATATAGTAGTGTTACCAAAATTTTGGAATT
TAAAATAATAAGTTTATTATGAGTGACCATGATAATAAAAAAGATTTTTAAATAAAATGATAATATTACTATATAGTCGG
TTATAGTTCCGATTAGTCTACTATCGTAGACGTAATAAAAAGAGTTTAGTAACCTAATTTTCAATGTTTTTTGAAAGTTG
CTCGTCTCTATGGCAACTTATTATCGTAAGGAAAATTTTCTACTTCACTATGATATTTTCGGAGTGAATTTATTGATTTA
CATTCAAGGACTTTCACTATTGCATTTACTGAAGCGATCGTTTCATTTGGAACTCATATTTTCGCCCCTAATCGTTCTGG
AATTTATTATTTATGATCCTTTATCTGACCTTAAAAATTTTCATATTCATGAGTGTCCAATCTTTTGCCAATTTGGGAAA
TAAGCTCCTAGAAAATGCTACCTTCAATAATGAATCCCTTACAAAGTCAGTATGGCATTGGGATCCTGAATTTGAATCAA
TTGTCCATCCGTACTGGCGGACTTTTGATATGGTGCCAGAAGTTTATCATTATTTAGTTGGAGTGTATATTTCTATTGTT
GGAATATCGGGAGTTCTGGGAAATCTTCTTGTTCTTTACATATTTGCAAGCGCCAAAAGTTTAAGAACTCCTCCAAATAT
GTTTATAATGAGTTTAGCAATTGGAGATTTGACATTTTCTGCTGTGAATGGCTTCCCCTTACTTACTATTTCAAGTTTTA
ACACTCGATGGGCTTGGGGAAAATTAACGTGTGAGATTTATGGTTTCATCGGTGGTCTTTTTGGGTTTATATCCATCAAC
ACAATGGCACTAATTTCTCTGGATAGGTATTTTGTTATTGCCCAACCATTTCAAACAATGAAATCCCTGACAATCAAAAG
AGCAATAATCATGTTGGTTTTCGTATGGCTTTATTCATTAATTTGGTCAACACCGCCATTTTTTGGATATGGAAATTATG
TGCCGGAAGGATTTCAAACGTCTTGTACATTCGACTATTTGACCCAATCAAAAGGTAACATAATATTCAATATTGGGATG
TACATAGGAAATTTCATAATTCCCGTTGGAATAATTATATTTTGCTATTATCAAATTGTCAAAGCAGTGCGAGTACATGA
ATTAGAAATGTTAAAAATGGCTCAAAAGATGAATGCATCTCATCCAACTTCCATGAAAACGGGTGCAAAAAAGGCTGATG
TTCAAGCTGCAAAGATTTCTGTCATAATTGTCTTTTTATATATGTTATCATGGACACCATATGCAATAATTGCCCTTATG
GCTCTCACAGGGCGTAGAGATCATCTGAATCCATACACTGCAGAATTGCCGGTACTCTTTGCTAAGACCTCAGCTATGTA
CAACCCATTTATATACGCAATAAATCATCCAAAATTTCGAATTCAGCTGGAAAAGAAATTTCCATGTTTGATTTGTTGCT
GTCCACCAAAACCAAAAGAAAGGGACACTACAAGTGCAGCATCAGCAACGAAACCGAGTAAATATCAGAGTGAAAGAGAA
AGTTCAATGTCTCAACTGGATCCTGAAGACGATAAACAAGTCGTAGAAACCACCAAGAATCAAACCACAAGTGGACATAC
AAATGAAGCTTACGAGAGTGAACAGAAGTAGTTGATGAAACTAAATTATTCTATTTTTAATGACACTAGATCTTTATAAT
AATTTTATTTAAGGGAATGAGCACTGAATTTTGCGCAAAT
PAGE: Planarian Anatomy Gene Expression
These transcripts were reported as being expressed in photoreceptor neuron. Click this link to learn more about PAGE.
PAGE Curations: 172
PLANA Term | Reference Transcript | Description | Gene Models | Published Transcript | Transcriptome | Publication | Specimen | Lifecycle | Evidence |
---|---|---|---|---|---|---|---|---|---|
photoreceptor neuron | SMED30007326 | otxA | SMESG000031965.1 | otxA | smed_ncbi_20200123 | PMID:23318641 Chen et al., 2013 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30030594 | Opsin | SMESG000074489.1 | opsin | smed_ncbi_20200123 | PMID:22451003 González-Sastre et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30030594 | Opsin | SMESG000074489.1 | SMED30030594 | smed_20140614 | PMID:28072387 Davies et al., 2017 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30030594 | Opsin | SMESG000074489.1 | SMED30030594 | smed_20140614 | PMID:28072387 Davies et al., 2017 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30030594 | Opsin | SMESG000074489.1 | opsin | smed_ncbi_20200123 | PMID:28072387 Davies et al., 2017 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30030594 | Opsin | SMESG000074489.1 | opsin | smed_ncbi_20200123 | PMID:28072387 Davies et al., 2017 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30017182 | SMED30017182 | SMESG000017559.1 | SMED30017182 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30003418 | Guanine nucleotide-binding protein subunit beta | SMESG000018712.1 | SMED30003418 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30010835 | Cadherin-23 | SMESG000081529.1 SMESG000081574.1 | SMED30010835 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30003750 | Vang-3 | SMESG000046198.1 SMESG000046194.1 | SMED30003750 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30004383 | SMED30004383 | SMESG000026568.1 SMESG000026569.1 | SMED30004383 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30013445 | Tetraspanin | SMESG000063435.1 SMESG000027204.1 | SMED30013445 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30003444 | SMED30003444 | SMESG000033629.1 | SMED30003444 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30016078 | Actin, cytoplasmic | SMESG000012332.1 SMESG000012317.1 | SMED30016078 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30014577 | Inositol 1,4,5-trisphosphate receptor | SMESG000061586.1 | SMED30014577 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30008588 | Guanylate cyclase domain-containing protein | SMED30008588 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() | |
photoreceptor neuron | SMED30013790 | Protocadherin-9 | SMESG000076350.1 | SMED30013790 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30010168 | Cyclic nucleotide gated channel alpha 3 | SMESG000044898.1 SMESG000035733.1 | SMED30010168 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30018530 | SMED30018530 | SMED30018530 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() | |
photoreceptor neuron | SMED30020051 | Thionin | SMESG000031412.1 | SMED30020051 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30024999 | CTF/NF-I domain-containing protein | SMESG000010567.1 | SMED30024999 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30029327 | slc8a-1 | SMESG000077236.1 | SMED30029327 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30020715 | SMED30020715 | SMESG000016957.1 | SMED30020715 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30024516 | slc25a-28 | SMESG000054493.1 | SMED30024516 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30022812 | Receptor-type tyrosine-protein phosphatase S | SMESG000068618.1 | SMED30022812 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30024342 | Neuropeptide Y receptor, invertebrate | SMESG000059151.1 | SMED30024342 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30027710 | Ras-related protein Rab-3 | SMED30027710 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() | |
photoreceptor neuron | SMED30027684 | SMED30027684 | SMESG000036851.1 | SMED30027684 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30025239 | Roundabout, axon guidance receptor, homolog 1 (Drosophila) | SMESG000066973.1 | SMED30025239 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30029255 | Sodium/myo-inositol cotransporter | SMESG000051963.1 | SMED30029255 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30028063 | SH3_10 domain-containing protein | SMESG000018362.1 SMESG000018320.1 | SMED30028063 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30027767 | SMED30027767 | SMESG000065100.1 | SMED30027767 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30020953 | Frizzled-5 | SMESG000031852.1 | SMED30020953 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30021550 | 5-hydroxytryptamine receptor 2C | SMESG000032682.1 SMESG000032679.1 | SMED30021550 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30019358 | SMED30019358 | SMESG000017193.1 | SMED30019358 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30019914 | Disks large homolog 1 | SMESG000034854.1 | SMED30019914 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30018866 | Diacylglycerol kinase | SMESG000051710.1 | SMED30018866 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30019307 | NAD-dependent protein deacylase | SMESG000074693.1 | SMED30019307 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30018266 | Phosphatidylinositol-binding clathrin assembly protein | SMESG000020797.1 | SMED30018266 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30017949 | slc7a-6 | SMESG000051755.1 | SMED30017949 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30021280 | Leucine Rich repeat-containing domain protein | SMESG000006503.1 | SMED30021280 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30020439 | aadc | SMESG000066844.1 | SMED30020439 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30020469 | LIM zinc-binding domain-containing protein | SMESG000026096.1 | SMED30020469 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30022428 | RING-type domain-containing protein | SMESG000010565.1 | SMED30022428 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30020678 | G-protein, gamma subunit,domain-containing protein | SMESG000066557.1 | SMED30020678 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30023840 | Membrane-associated phosphatidylinositol transfer protein 1 | SMESG000004877.1 | SMED30023840 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30021266 | Uncoordinated 5 | SMESG000073898.1 | SMED30021266 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30021279 | Retinal-binding protein | SMESG000035531.1 | SMED30021279 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30022145 | Kinase-like protein | SMESG000036830.1 | SMED30022145 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30015874 | DNA cross-link repair 1C | SMESG000028344.1 | SMED30015874 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30014199 | Myosin | SMESG000047361.1 | SMED30014199 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30014606 | Copine-3 | SMESG000007275.1 | SMED30014606 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30017852 | Ras family protein | SMESG000019606.1 | SMED30017852 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30015272 | SMED30015272 | SMESG000045574.1 | SMED30015272 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30016952 | Frizzled 5/8 protein | SMESG000005043.1 | SMED30016952 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30011936 | slc29a-2 | SMESG000078543.1 | SMED30011936 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30017522 | Parathyroid hormone receptor 1 | SMESG000076892.1 | SMED30017522 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30011402 | Ras family | SMESG000007281.1 | SMED30011402 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30013686 | MAP3K-1 | SMESG000054386.1 | SMED30013686 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30015176 | Regulator of G-protein signaling 3 | SMESG000022937.1 | SMED30015176 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30011469 | Kelch-like protein diablo | SMESG000077860.1 | SMED30011469 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30015061 | G protein regulated inducer of neurite outgrowth | SMESG000062691.1 | SMED30015061 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30013129 | Gamma-aminobutyric acid receptor subunit beta A | SMESG000026005.1 | SMED30013129 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30011215 | ATP-binding cassette sub-family B member 6, mitochondrial | SMESG000070808.1 SMESG000070801.1 SMESG000070797.1 | SMED30011215 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30014607 | 1-phosphatidylinositol 4,5-bisphosphate phosphodiesterase | SMESG000013964.1 SMESG000013960.1 SMESG000013958.1 | SMED30014607 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30004142 | Calcium-dependent secretion activator 1 | SMESG000011756.1 | SMED30004142 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30004278 | Kinase | SMESG000019079.1 | SMED30004278 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30004462 | Voltage gated potassium channel | SMESG000017777.1 | SMED30004462 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30004877 | Glycine receptor subunit alpha-3 | SMESG000032691.1 | SMED30004877 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30004463 | Cyclic nucleotide gated channel 1 | SMESG000038954.1 | SMED30004463 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30005308 | SMED30005308 | SMESG000004298.1 | SMED30005308 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30004455 | DUF2428 domain-containing protein | SMESG000032327.1 | SMED30004455 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30005453 | slc16a-18 | SMESG000003109.1 | SMED30005453 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30005805 | Homeobox domain-containing protein | SMESG000041571.1 | SMED30005805 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30004698 | Small conductance calcium-activated potassium channel protein | SMESG000076156.1 | SMED30004698 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30006093 | Multiple PDZ domain crumbs cell polarity complex component | SMESG000056186.1 | SMED30006093 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30004686 | Oxygen-dependent choline dehydrogenase | SMESG000064120.1 | SMED30004686 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30003346 | slc12a-4 | SMESG000019076.1 | SMED30003346 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30008195 | Non-specific serine/threonine protein kinase | SMESG000022413.1 | SMED30008195 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30009756 | TNF receptor-associated factor 4 | SMESG000016362.1 | SMED30009756 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30008456 | Type I inositol-1,4,5-trisphosphate 5-phosphatase | SMESG000074184.1 | SMED30008456 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30007389 | Peripheral plasma membrane protein CASK | SMESG000060582.1 | SMED30007389 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30009498 | slc4a-3 | SMESG000049796.1 | SMED30009498 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30007480 | Protein kinase C | SMESG000039865.1 SMESG000039854.1 | SMED30007480 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30006225 | Cyclin dependent kinase like 1 | SMESG000038932.1 | SMED30006225 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30011091 | Ski oncogene | SMESG000044463.1 | SMED30011091 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30008671 | Phosphodiesterase | SMESG000021196.1 | SMED30008671 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30007610 | Guanine nucleotide-binding protein G(q) subunit alpha | SMESG000022892.1 | SMED30007610 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30008033 | Plasma membrane calcium-transporting ATPase 3 | SMESG000006504.1 | SMED30008033 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30009508 | Phosphatidylinositol 4-kinase alpha | SMESG000041715.1 | SMED30009508 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30008157 | Rhodanese-like protein | SMESG000030828.1 | SMED30008157 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30006813 | UDG domain-containing protein | SMESG000064938.1 | SMED30006813 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30008651 | Guanylate cyclase | SMESG000019264.1 | SMED30008651 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30015273 | SMED30015273 | SMESG000006530.1 | Smed-meis | smed_ncbi_20200123 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30026934 | SMED30026934 | SMESG000050824.1 | SMED30026934 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30032368 | C2 domain-containing protein | SMESG000059632.1 | SMED30032368 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30024549 | Copine-3 | SMESG000029196.1 | SMED30024549 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30026182 | Sodium/potassium-transporting ATPase subunit beta-2 | SMESG000071416.1 | SMED30026182 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30030374 | Regulator of G protein signaling 20 | SMESG000073688.1 | SMED30030374 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30028236 | slc16a-2 | SMESG000026519.1 | SMED30028236 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30028591 | Protein kinase | SMESG000030545.1 | SMED30028591 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30025144 | Protein rolling stone | SMESG000077396.1 | SMED30025144 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30034880 | Discoidin domain-containing receptor 2 | SMESG000067438.1 | SMED30034880 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30025532 | Phosphodiesterase | SMESG000004031.1 | SMED30025532 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30027886 | SMED30027886 | SMESG000003427.1 | SMED30027886 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30032892 | foxQ2 | SMESG000062929.1 | SMED30032892 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30031519 | Tyrosine-protein kinase | SMESG000020289.1 | SMED30031519 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30034201 | Delta-like protein | SMESG000036778.1 | SMED30034201 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30034676 | G_PROTEIN_RECEP_F1_2 domain-containing protein | SMESG000002498.1 | SMED30034676 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30030065 | Progestin and adipoQ receptor family member 3 | SMESG000021251.1 | SMED30030065 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30031686 | Gelsolin-like protein 2 | SMESG000015922.1 | SMED30031686 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30028255 | RRM domain-containing protein | SMESG000071928.1 | SMED30028255 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30025288 | Transient-receptor-potential-like protein | SMESG000024108.1 | SMED30025288 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30034968 | LysM domain-containing protein | SMESG000014261.1 | SMED30034968 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30032019 | Moesin/ezrin/radixin homolog 1 | SMESG000068090.1 | SMED30032019 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30034855 | 5-hydroxytryptamine receptor | SMESG000008878.1 | SMED30034855 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30029026 | Multidrug resistance-associated protein 1 | SMESG000014785.1 | SMED30029026 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30030621 | Regulator of G-protein signaling, putative | SMESG000072045.1 | SMED30030621 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30026628 | Short transient receptor potential channel 4 | SMESG000078533.1 | SMED30026628 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30035339 | RIMS binding protein 2 | SMESG000001071.1 SMESG000001061.1 SMESG000001060.1 | SMED30035339 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30031199 | Beta-arrestin | SMESG000006894.1 | SMED30031199 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30027945 | Major facilitator superfamily domain containing protein | SMESG000010822.1 | SMED30027945 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30036016 | Histone H2A | SMESG000018807.1 | SMED30036016 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30031651 | slc43a-3 | SMESG000043542.1 | SMED30031651 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30000964 | FMRFamide-activated amiloride-sensitive sodium channel | SMESG000029017.1 | SMED30000964 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30001792 | Retinal pigment epithelium-derived rhodopsin homolog | SMESG000045023.1 | SMED30001792 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30003048 | Tyrosine-protein kinase | SMESG000064511.1 | SMED30003048 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30000221 | CDP-diacylglycerol--inositol 3-phosphatidyltransferase | SMESG000008297.1 | SMED30000221 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30002301 | Protein kinase domain-containing protein | SMESG000011366.1 | SMED30002301 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30000277 | SMED30000277 | SMESG000022971.1 | SMED30000277 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30002295 | Glutamine-dependent NAD( ) synthetase | SMESG000004423.1 | SMED30002295 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30000553 | Epithelial discoidin domain-containing receptor | SMESG000069322.1 | SMED30000553 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30003166 | slc4a-4 | SMESG000039045.1 | SMED30003166 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30000596 | Peroxiredoxin | SMESG000001807.1 | SMED30000596 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30003066 | NEK8-1 | SMESG000053193.1 | SMED30003066 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30000488 | Double C2-like domain-containing protein beta | SMESG000009083.1 | SMED30000488 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30003275 | Guanine nucleotide-binding protein G(O) subunit alpha | SMESG000055191.1 | SMED30003275 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30003228 | Dach-1 | SMESG000005090.1 | SMED30003228 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30002758 | Phosphatidate cytidylyltransferase | SMESG000068325.1 | SMED30002758 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30001570 | Cyclin-dependent kinase 17 | SMESG000050786.1 SMESG000050790.1 | SMED30001570 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30001672 | NADH dehydrogenase [ubiquinone] iron-sulfur protein 7, mitochondrial | SMESG000035542.1 | SMED30001672 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30009185 | Transient-receptor-potential-like protein | SMESG000024108.1 | SMED30025288 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30002172 | Transient-receptor-potential-like protein | SMESG000024108.1 | SMED30025288 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30002272 | SMED30002272 | SMESG000071928.1 | SMED30028255 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30019065 | Voltage gated potassium channel | SMESG000017777.1 | SMED30004462 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30023733 | Sodium/potassium-transporting ATPase subunit beta-2 | SMESG000071416.1 | SMED30026182 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30034920 | G protein gamma domain-containing protein | SMESG000066557.1 | SMED30020678 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30030155 | SMED30030155 | SMESG000036778.1 | SMED30034201 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30027502 | Potassium/sodium hyperpolarization-activated cyclic nucleotide-gated channel | SMESG000038954.1 | SMED30004463 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30030326 | SMED30030326 | SMESG000001071.1 SMESG000001061.1 SMESG000001060.1 | SMED30035339 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30001461 | SMED30001461 | SMESG000006530.1 | Smed-meis | smed_ncbi_20200123 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30018592 | ovo | SMESG000081129.1 | Smed-ovo | smed_ncbi_20200123 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30011784 | Meis | SMESG000006530.1 | Smed-meis | smed_ncbi_20200123 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30019744 | SMED-SMAD6/7-2 | SMESG000021574.1 | JQ278720.1 | smed_ncbi_20200123 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30000222 | RNA binding protein MEX3B | SMESG000066973.1 | SMED30025239 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30005978 | Cyclic nucleotide gated channel alpha 3 | SMESG000044898.1 SMESG000035733.1 | SMED30010168 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30028012 | SMED30028012 | SMESG000045023.1 | SMED30001792 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30035599 | meis | SMESG000006530.1 | Smed-meis | smed_ncbi_20200123 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30025778 | SOXB1-1 | SMESG000011244.1 | Smed-soxB | smed_ncbi_20200123 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30034853 | Zinc finger protein | SMED30034853 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() | |
photoreceptor neuron | SMED30029811 | Tyrosine-protein kinase receptor | SMESG000041792.1 | SMED30029811 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30026741 | klf | Smed-klf | smed_ncbi_20200123 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() | |
photoreceptor neuron | SMED30021413 | SMED30021413 | SMED30018530 | smed_20140614 | PMID:22884275 Lapan et al., 2012 | ![]() | ![]() | ![]() | |
photoreceptor neuron | SMED30030594 | Opsin | SMESG000074489.1 | SMED30030594 | smed_20140614 | PMID:28976975 Su et al., 2017 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30002900 | B-catenin 4 | SMESG000035212.1 | KY196225.1 | smed_ncbi_20200123 | PMID:28976975 Su et al., 2017 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30002900 | B-catenin 4 | SMESG000035212.1 | KY196225.1 | smed_ncbi_20200123 | PMID:28976975 Su et al., 2017 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30007326 | otxA | SMESG000031965.1 | otxA | smed_ncbi_20200123 | PMID:28976975 Su et al., 2017 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30030594 | Opsin | SMESG000074489.1 | SMED30030594 | smed_20140614 | PMID:18287199 Iglesias et al., 2008 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30010096 | TPA_inf: prohormone convertase 2 | SMESG000008070.1 SMESG000008069.1 | BK007043 | smed_ncbi_20200123 | PMID:20967238 Collins JJ et al., 2010 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30034479 | EYE53-1 | BK007033 | smed_ncbi_20200123 | PMID:20967238 Collins JJ et al., 2010 | ![]() | ![]() | ![]() | |
photoreceptor neuron | SMED30027106 | SMED30027106 | SMESG000008070.1 SMESG000008069.1 | BK007043 | smed_ncbi_20200123 | PMID:20967238 Collins JJ et al., 2010 | ![]() | ![]() | ![]() |
photoreceptor neuron | SMED30030594 | Opsin | SMESG000074489.1 | opsin | smed_ncbi_20200123 | PMID:21852957 Lapan et al., 2011 | ![]() | ![]() | ![]() |