pharynx

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ Description

  ▻ Figures

  ▻ In Situ Hybridization Data

  ▻ Sequences

  ▻ References

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  pharynx


DEFINITON:

  A plicate and protrusible organ that is the sole point of entry and exit for the Triclad gut. It contains epithelial, muscular, secretory and neuronal cell types.


TERM DEFINITION CITATIONS:

  OCLC:16809160


TERM CITATIONS:

Expand publication list


TERM ID:

  PLANA:0000016


ABOUT THIS TERM:

pharynx

  ↳is a material entity and organ

  ↳contained in posterior region of the whole animal and parapharyngeal region

  ↳existence overlaps Stage 6, juvenile, Stage 5, asexual adult, adult hermaphrodite, Stage 8 and Stage 7

  ↳existence starts during or after Stage 5

  ↳part of digestive system


  → pharynx progenitor cell and pharynx primordium develops into pharynx


Expand to see terms that part of pharynx


BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


DESCRIPTION:   

foxA1, a pioneer transcription factor required for pharynx maintenance and regeneration during adulthood (Adler et al., 2014; Scimone et al., 2014), may similarly be required for construction of the definitive pharynx during embryogenesis. Development of the definitive pharynx, the single opening of the Smed digestive tract, commenced during S4-S5 with the onset of foxA1 expression in parenchymal cells, many of which were located in the oral hemisphere (Figure 1 – figure supplement 14A). The distribution of foxA1+ cells remained concentrated in and around the developing definitive pharynx rudiment during S6-S8, a pattern reminiscent of that observed in S. polychroa embryos (Martín-Durán et al., 2010), as well as in intact and regenerating Smed asexual adults (Adler et al., 2014; Scimone et al., 2014). The definitive pharynx develops beneath the degenerating temporary embryonic pharynx, and marks the ventral side of the embryos during S6 and thereafter (Martín-Durán and Romero, 2011). foxA1 upregulation during S5-S8 was statistically significant, albeit the adjusted p-values were above the thresholds set for inclusion in the enriched transcript lists presented in Figure 1 – source data 5, Figure 1 – source data 6, Figure 1 – source data 7, Figure 1 – source data 8. meis, a transcription factor coexpressed in foxA1+ neoblasts and expressed within the regenerating pharynx (Scimone et al., 2014), was among the S5 enriched transcripts (Figure 1 – source data 5); its expression trend was similar to foxA1 during embryogenesis (Figure 1 – figure supplement 14B). Two markers exhibiting pharynx-restricted expression in adults, laminin and npp-1 (Adler et al., 2014), were upregulated during S6-S8, after development of the definitive pharynx rudiment was evident (Figure 1 – figure supplement 14B).


 

back to top


FIGURES:


Figure 1 – figure supplement 14: Molecular markers for the definitive pharynx

A: WISH developmental time course using foxA1 riboprobes (blue), S3-S8.  foxA1 expression was consistently detected in the embryonic pharynx lumen during S3-S5 (black arrowheads). Anterior: top (S6-S8). Black arrowheads: embryonic pharynx. Red arrowheads: definitive pharynx. O: oral hemisphere. A: aboral hemisphere. D: dorsal. V: ventral. Scale bars: 100 µm.

B: Average RPKM values per embryo for the definitive pharynx markers foxA1, meis, laminin, npp-1 during embryogenesis (Adler et al., 2014; Scimone et al., 2014), Y (yolk), Stage (S) S2-S8. 

 

 

back to top


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30027428AFJ24799.1forkhead box A-1foxA1Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, digestive system, pharynx, pharynx progenitor cell, embryonic pharynx
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30027428 ID=SMED30027428|Name=forkhead box A-1|organism=Schmidtea mediterranea sexual|type=transcript|length=2149bp
ATCACTTGGTGCTGCTTTTTGCCCCGATAAATCTCTCGGTGCTCCAAAATTTGTGTAAGCGAGCAAAAGATGATTGGGCA
ATTTCTAGCACGTCATTCGGCAACGATGTTTACAAGTTTCTCTGATTGGATGATAAAGTAGAAACTTTCCGAAAATGAAA
CTTCTCCGAACATGCGCATACCGACTGAAAATTAACTCTAAGCCAGCCAATGGAATTGAAGCAAAATTCAAGAGAATATT
AATTGACTTCGCGAATGAACTCAAATTTTCTATTGGCGTATTGTGTGTGCCTCATTGTGAGTGGTTGCGATCGCATCTCA
AATTATTTACACACAAAAAAATAACGCACACAGACATTGAATAGATATATTTGATCAAGTCAATATCACAATGTCAATAT
TAGCTTTTTCTGAAGAAAGAAGACGAACTAGAAGAAAAACAACAACGAAATAGATTCGATAAGGCTACTGAGCGATTTTC
ATAATCTAAATATTATTTTATTATTGATACGGACAAAAATTGGTCTTTTACCAAGTACTACTAGATTGTTGATAAAGAGA
GGTTATTTAGATGCTTGGAAAAAATCCTTATGAAACTGCAATGAGCAACGTGTATTCTCTACCTCCGGGAGGTTCTATTT
ACAATATGAACCCGATGAGTATATCATCAGCTGGCTACAACTCTCAACAAGTATCAACACTATCGTTGAACTTGACCGGA
ATCGGACCTCATTCATTAAGCCCAATGAGTGCAAGCATGTCGGGTATAGCTGCAATGGCCGGTGGAATGAGACAAGGTCT
TGAGTTGGGTCTTGGTAGAAGTGATAGTCCAAGAGATAAAAATTCAATTTCCAATAACAACCGACCATATCAAAGAAGTT
ACACTCATGCCAAGCCTCCATACAGTTATATAAGTTTGATAACAATGGCGATTCAAAATTCTCCAGTAAACATGTGCACT
CTATCGGAGATCTATCAATTCATTATGGATCATTTTCCATACTATCGTCAAAATCAACAGCGATGGCAGAATTCGATTCG
ACATTCTTTGTCCTTCAACGATTGCTTTGTTAAGGTTAGTAGAAGCCCAGAAAAACCAGGTAAAGGCTCATATTGGACCT
TGCATCCTCAATCAGGTAACATGTTTGAAAACGGTTGTTATCTCAGAAGACAAAAGCGATTCAAAGATCCACACAGAGAA
ATCGGCAGACAGAGTCAAAGAGCTGCCACTGGTCCTGGATCAAATGTCACAGAAAACAATCACGACAACGCATCGCAAGA
AGCTAGTGATAACGCAGAAAGTGATACGAAACCCAACATCAAGCAACTTGATTTATCAAGCGATCTCTTAACTAATCAAG
GTCATAATATTAAAAATACTAATCCAACTTCTGTTAGTCAGAGTTGTTCGATGTTTCATCGGAAAAAGGAAAACTGCTCA
CCAGTAGAAATGAAATTGAATAACCAAAACCAACAATCAAACCAGCAAGAACATCCACAAATCCATTACAATCCCAATCA
GCAATTCTACTCAAATCAGCAAAACATTTTCCAACAAAGTTCTCTTGATCATTACAGTCTATTAGCATCCGATGATCCTC
TTGGTCAAGGTATGCACTTGCCACCAGGTGCAAATAGTGTTTTCGGACTTTACGGGGCACATAACTTACCAAACGATGAT
CAAATTTCAGTGTCATTACCATCGATATCCTTATCCGGACATCCGTATGACAATTTATCAACAGCAATGGCATATCAATA
TGAAGCATCTCAACACAATTCTTCATTACTAACGACAAGTAATCCGTTCTCAATAGATCGTTTGATGCATCCAAGACTAG
TCGCTGCAGCGATGGGGGTCAGTCCCCATGATACTCTATACGCAGGAGCTACCGGCCCATCAGTTGATCTAGAACACATG
AAATACTACTCAAACTACAACAATGTGCCTCCTTATTCCTCTGCAATGTCTGACTACTACAAATATGTACAAAATCCTCA
GCCGGGCAACAGCGACATGAGTCTTTGAATTGAGTCCATTGAAGTCTACGGCAGTTTCCTCGAAATTTCACATTCAACCA
GATGTTTATCGCCTAATATAAAGCTGTGTTTTTTTATTTATTTACAATTAAATCTTTGTACAAGAGATC

 

back to top


ADDITIONAL REFERENCES:


Adler, C.E., Seidel, C.W., McKinney, S.A., and Sánchez Alvarado, A. (2014). Selective amputation of the pharynx identifies a FoxA-dependent regeneration program in planaria. Elife 3, e02238.

Martín-Durán, J.M., Amaya, E., and Romero, R. (2010). Germ layer specification and axial patterning in the embryonic development of the freshwater planarian Schmidtea polychroa. Dev Biol 340, 145-158.

Martín-Durán, J.M., and Romero, R. (2011). Evolutionary implications of morphogenesis and molecular patterning of the blind gut in the planarian Schmidtea polychroa. Dev Biol 352, 164-176.

Scimone, M.L., Kravarik, K.M., Lapan, S.W., and Reddien, P.W. (2014). Neoblast specialization in regeneration of the planarian Schmidtea mediterranea. Stem Cell Reports 3, 339-352.

 

back to top





PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in pharynx. Click this link to learn more about PAGE.


PAGE Curations: 2578


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
pharynxSMED30009279DystoninSMESG000043809.1 SMESG000043799.1 dd_Smed_v4_1205_0_1dd_Smed_v4PMID:29674431
pharynxSMED30002742DystoninSMESG000043809.1 SMESG000043799.1 dd_Smed_v4_1205_0_1dd_Smed_v4PMID:29674431
pharynxSMED30006652dynein heavy chain 6, axonemalSMESG000004477.1 SMESG000004475.1 dd_Smed_v4_10969_0_1dd_Smed_v4PMID:29674431
pharynxSMED30006822SMED30006822SMESG000043386.1 dd_Smed_v4_15542_0_1dd_Smed_v4PMID:29674431
pharynxSMED30005421CAP-Gly domain-containing proteinSMESG000006189.1 dd_Smed_v4_12985_0_1dd_Smed_v4PMID:29674431
pharynxSMED30005421CAP-Gly domain-containing proteinSMESG000006189.1 dd_Smed_v4_14698_0_1dd_Smed_v4PMID:29674431
pharynxSMED30002932SMED30002932SMESG000055983.1 dd_Smed_v4_15350_0_1dd_Smed_v4PMID:29674431
pharynxSMED30004318Triadin-like isoform X4SMESG000025109.1 dd_Smed_v4_22537_0_1dd_Smed_v4PMID:29674431
pharynxSMED30004318Triadin-like isoform X4SMESG000025109.1 dd_Smed_v4_13778_0_1dd_Smed_v4PMID:29674431
pharynxSMED30000831Golgi-associated plant pathogenesis protein 1SMESG000036937.1 dd_Smed_v4_2081_0_1dd_Smed_v4PMID:29674431
pharynxSMED30001404Dual specificity tyrosine-phosphorylation-regulated kinase 2SMESG000076586.1 SMESG000076583.1 dd_Smed_v4_12119_1_1dd_Smed_v4PMID:29674431
pharynxSMED30000158Dipeptidyl peptidase 3SMESG000079740.1 dd_Smed_v4_1031_0_1dd_Smed_v4PMID:29674431
pharynxSMED30000158Dipeptidyl peptidase 3SMESG000079740.1 dd_Smed_v6_1031_0dd_Smed_v6PMID:29674432
pharynxSMED30002038Calsyntenin 1SMESG000002834.1 SMESG000002830.1 dd_Smed_v4_1518_0_1dd_Smed_v4PMID:29674431
pharynxSMED30002038Calsyntenin 1SMESG000002834.1 SMESG000002830.1 dd_Smed_v6_1518_0dd_Smed_v6PMID:29674432
pharynxSMED300051503' histone mRNA exonuclease 1SMESG000058668.1 dd_Smed_v4_1266_0_1dd_Smed_v4PMID:29674431
pharynxSMED30003469FerritinSMESG000068032.1 SMESG000068030.1 SMESG000068027.1 dd_Smed_v4_1033_0_1dd_Smed_v4PMID:29674431
pharynxSMED30016080Deoxyhypusine hydroxylaseSMESG000051726.1 SMESG000051721.1 dd_Smed_v4_703_0_1dd_Smed_v4PMID:29674431
pharynxSMED30016080Deoxyhypusine hydroxylaseSMESG000051726.1 SMESG000051721.1 dd_Smed_v6_703_0dd_Smed_v6PMID:29674432
pharynxSMED30004945slc22a-9SMESG000025834.1 dd_Smed_v4_11120_0_1dd_Smed_v4PMID:29674431
pharynxSMED30003443Membrane-bound O-acyltransferase domain-containing protein 2SMESG000075570.1 SMED30003443smed_20140614PMID:18063757
pharynxSMED30006189SMED30006189SMESG000001434.1 dd_Smed_v4_16150_0_1dd_Smed_v4PMID:29674431
pharynxSMED30005771SMED30005771SMESG000042003.1 dd_Smed_v4_12482_0_1dd_Smed_v4PMID:29674431
pharynxSMED30013445TetraspaninSMESG000063435.1 dd_Smed_v4_389_0_1dd_Smed_v4PMID:29674431
pharynxSMED30013445TetraspaninSMESG000063435.1 dd_Smed_v6_389_0dd_Smed_v6PMID:29674432
pharynxSMED30006714SMED30006714SMESG000001790.1 dd_Smed_v4_212_0_1dd_Smed_v4PMID:29674431
pharynxSMED30001366SMED30001366SMESG000014648.1 dd_Smed_v4_1227_0_1dd_Smed_v4PMID:29674431
pharynxSMED30003458Ras-related protein Rab-27BSMESG000077907.1 dd_Smed_v4_10266_0_1dd_Smed_v4PMID:29674431
pharynxSMED30004648Dual specificity tyrosine phosphorylation regulated kinase 2SMESG000076586.1 SMESG000076583.1 dd_Smed_v4_12119_1_1dd_Smed_v4PMID:29674431
pharynxSMED30001515AnnexinSMESG000042839.1 dd_Smed_v4_1104_0_1dd_Smed_v4PMID:29674431
pharynxSMED30000840Coiled-coil domain-containing protein 42-like proteinSMESG000046807.1 dd_Smed_v4_12378_0_1dd_Smed_v4PMID:29674431
pharynxSMED30006464TCF15SMESG000044395.1 AFD29618smed_ncbi_20200123PMID:24173799
pharynxSMED30001301TPA_inf: secreted peptide prohormone-16SMESG000079890.1 BK007042smed_ncbi_20200123PMID:20967238
pharynxSMED30004606Cytochrome P450 2K1-like proteinSMESG000020470.1 Contig1680GPL15192PMID:23079596
pharynxSMED30010096TPA_inf: prohormone convertase 2SMESG000008070.1 SMESG000008069.1 BK007043smed_ncbi_20200123PMID:20967238
pharynxSMED30001414UPF0728 protein C10orf53 homologSMESG000073355.1 dd_Smed_v4_10501_0_1dd_Smed_v4PMID:29674431
pharynxSMED30033656axis inhibition protein ASMESG000039725.1 GU808528.1smed_ncbi_20200123PMID:21806978
pharynxSMED30033656axis inhibition protein ASMESG000039725.1 GU808528.1smed_ncbi_20200123PMID:18063757
pharynxSMED30033656axis inhibition protein ASMESG000039725.1 ADW27177.1smed_ncbi_20200123PMID:21806978
pharynxSMED30033656axis inhibition protein ASMESG000039725.1 SMED30033656smed_20140614PMID:21806978
pharynxSMED30032613HoxD-like proteinSMESG000044469.1 EU082824.1smed_ncbi_20200123PMID:21282632
pharynxSMED30032613HoxD-like proteinSMESG000044469.1 EU082824.1smed_ncbi_20200123PMID:21806978
pharynxSMED30032613HoxD-like proteinSMESG000044469.1 EU082824.1smed_ncbi_20200123PMID:20422023
pharynxSMED30035066axis inhibition protein BSMESG000025925.1 GU808529.1smed_ncbi_20200123PMID:18063757
pharynxSMED30025388Myosin heavy chainSMESG000013389.1 EC386316ncbi_smed_estsPMID:22385657
pharynxSMED30004654Triosephosphate isomeraseSMESG000027305.1 dd_Smed_v4_1402_0_1dd_Smed_v4PMID:29674431
pharynxSMED30014199MyosinSMESG000047361.1 dd_Smed_v4_4503_0_1dd_Smed_v4PMID:29674431
pharynxSMED30000491Cornifelin-like ASMESG000023836.1 dd_Smed_v4_1291_0_1dd_Smed_v4PMID:29674431
pharynxSMED30000491Cornifelin-like ASMESG000023836.1 dd_Smed_v6_1291_0dd_Smed_v6PMID:29674432
pharynxSMED30002156TNF receptor associated factor-2SMESG000065606.1 SMESG000000563.1 SMESG000000559.1 SMESG000000493.1 SMESG000000294.1 dd_Smed_v4_1243_0_1dd_Smed_v4PMID:29674431
pharynxSMED30001056AcetylCoA_hyd_C domain-containing proteinSMESG000063866.1 dd_Smed_v4_1775_0_1dd_Smed_v4PMID:29674431
pharynxSMED30000421TPR_REGION domain-containing proteinSMESG000071973.1 dd_Smed_v4_11462_0_1dd_Smed_v4PMID:29674431
pharynxSMED30031862ras-related protein Rab-27ASMESG000044557.1 dd_Smed_v4_5306_0_1dd_Smed_v4PMID:29674431
pharynxSMED30031862ras-related protein Rab-27ASMESG000044557.1 SMED30031862smed_20140614PMID:26457503
pharynxSMED30005523Alpha-actininSMESG000026000.1 dd_Smed_v4_1951_0_1dd_Smed_v4PMID:29674431
pharynxSMED30001257NADH dehydrogenase [ubiquinone] flavoprotein 1, mitochondrialSMESG000074136.1 dd_Smed_v4_1843_0_1dd_Smed_v4PMID:29674431
pharynxSMED30004403GCR079SMESG000014330.1 dd_Smed_v4_11910_0_1dd_Smed_v4PMID:29674431
pharynxSMED30001185Transmembrane protein 231SMESG000032658.1 dd_Smed_v4_16131_0_1dd_Smed_v4PMID:29674431
pharynxSMED30007853Family with sequence similarity 49 member ASMESG000040316.1 dd_Smed_v4_1856_0_1dd_Smed_v4PMID:29674431
pharynxSMED30002772LipaseSMESG000044132.1 dd_Smed_v4_11504_0_1dd_Smed_v4PMID:29674431
pharynxSMED30007470Coiled-coil domain-containing protein 180SMESG000039547.1 dd_Smed_v4_12302_0_1dd_Smed_v4PMID:29674431
pharynxSMED30016078Actin, cytoplasmicSMESG000012332.1 SMESG000012317.1 dd_Smed_v4_285_0_1dd_Smed_v4PMID:29674431
pharynxSMED30016078Actin, cytoplasmicSMESG000012332.1 SMESG000012317.1 dd_Smed_v6_285_0dd_Smed_v6PMID:29674432
pharynxSMED30016078Actin, cytoplasmicSMESG000012332.1 SMESG000012317.1 SMESG000058954.1 dd_Smed_v4_246_0_1dd_Smed_v4PMID:29674431
pharynxSMED30002886SMED30002886SMESG000017779.1 dd_Smed_v4_11049_0_1dd_Smed_v4PMID:29674431
pharynxSMED30004112Dynein heavy chain 5, axonemalSMESG000012967.1 dd_Smed_v4_17773_0_1dd_Smed_v4PMID:29674431
pharynxSMED30004112Dynein heavy chain 5, axonemalSMESG000012967.1 dd_Smed_v4_4113_0_1dd_Smed_v4PMID:29674431
pharynxSMED30021059V(D)J recombination-activating protein 1SMESG000012339.1 dd_Smed_v4_11354_0_1dd_Smed_v4PMID:29674431
pharynxSMED30021059V(D)J recombination-activating protein 1SMESG000012339.1 SMED30021059smed_20140614PMID:26457503
pharynxSMED30026063TNF receptor-associated factorSMESG000044583.1 dd_Smed_v4_11100_0_1dd_Smed_v4PMID:29674431
pharynxSMED30010123Sodium/potassium-transporting ATPase subunit beta-1SMESG000064593.1 dd_Smed_v4_2210_0_1dd_Smed_v4PMID:29674431
pharynxSMED30008609SMED30008609SMESG000059918.1 SMESG000052306.1 dd_Smed_v4_12223_0_1dd_Smed_v4PMID:29674431
pharynxSMED30008609SMED30008609SMESG000059918.1 SMESG000052306.1 SMESG000022407.1 dd_Smed_v6_474_0dd_Smed_v6PMID:29674432
pharynxSMED30013082Dynein light chainSMESG000081226.1 SMESG000081215.1 dd_Smed_v4_1888_0_1dd_Smed_v4PMID:29674431
pharynxSMED30014360Choline dehydrogenaseSMESG000055690.1 SMESG000055689.1 SMESG000055687.1 dd_Smed_v4_1744_0_1dd_Smed_v4PMID:29674431
pharynxSMED30014360Choline dehydrogenaseSMESG000055690.1 SMESG000055689.1 SMESG000055687.1 dd_Smed_v6_1744_0dd_Smed_v6PMID:29674432
pharynxSMED30011948F-box/WD repeat-containing protein 10SMESG000002351.1 SMESG000002342.1 dd_Smed_v4_13271_0_1dd_Smed_v4PMID:29674431
pharynxSMED30009282EF-hand calcium binding domain 2SMESG000049879.1 SMESG000003119.1 dd_Smed_v4_11976_0_1dd_Smed_v4PMID:29674431
pharynxSMED30009188Radial spoke head 14-like proteinSMESG000077061.1 dd_Smed_v4_1917_0_1dd_Smed_v4PMID:29674431
pharynxSMED30009793Dach-2SMESG000033540.1 dd_Smed_v4_11289_0_1dd_Smed_v4PMID:29674431
pharynxSMED30013865OFD1SMESG000046592.1 dd_Smed_v4_13339_0_1dd_Smed_v4PMID:29674431
pharynxSMED30014310ANK_REP_REGION domain-containing proteinSMESG000055419.1 dd_Smed_v4_13629_0_1dd_Smed_v4PMID:29674431
pharynxSMED30012638DUF4200 domain-containing proteinSMESG000028991.1 dd_Smed_v4_11371_0_1dd_Smed_v4PMID:29674431
pharynxSMED30011431SMED30011431SMESG000063184.1 dd_Smed_v4_2217_0_1dd_Smed_v4PMID:29674431
pharynxSMED30011431SMED30011431SMESG000063184.1 dd_Smed_v6_2217_0dd_Smed_v6PMID:29674432
pharynxSMED30013653Protein lifeguard 4SMESG000027408.1 dd_Smed_v4_1521_0_1dd_Smed_v4PMID:29674431
pharynxSMED30011453Facilitated trehalose transporter Tret1SMESG000063382.1 dd_Smed_v4_11168_0_1dd_Smed_v4PMID:29674431
pharynxSMED30008856SMED30008856SMESG000025888.1 dd_Smed_v4_1422_0_1dd_Smed_v4PMID:29674431
pharynxSMED30013374Transmembrane protein 232SMESG000060638.1 dd_Smed_v4_15138_0_1dd_Smed_v4PMID:29674431
pharynxSMED30030305Peptidase_M14 domain-containing proteinSMESG000037626.1 Contig1315GPL15192PMID:23079596
pharynxSMED30030305Peptidase_M14 domain-containing proteinSMESG000048042.1 Contig1315GPL15192PMID:23079596
pharynxSMED30029698Caspase-7SMESG000053168.1 Contig2992GPL15192PMID:23079596
pharynxSMED30029698Caspase-7SMESG000053168.1 dd_Smed_v4_1167_0_1dd_Smed_v4PMID:29674431
pharynxSMED30032233SMED30032233SMESG000080577.1 dd_Smed_v4_19517_0_1dd_Smed_v4PMID:29674431
pharynxSMED30027106SMED30027106SMESG000008070.1 SMESG000008069.1 BK007043smed_ncbi_20200123PMID:20967238
pharynxSMED30024787SMED30024787SMESG000056261.1 dd_Smed_v4_8391_0_1dd_Smed_v4PMID:29674431
pharynxSMED30029551Acyl-CoA-binding proteinSMESG000036533.1 dd_Smed_v4_160_0_1dd_Smed_v4PMID:29674431
pharynxSMED30026493TPA_inf: pyrokinin prohormone like-1SMESG000013290.1 BK007007smed_ncbi_20200123PMID:20967238
pharynxSMED30026493TPA_inf: pyrokinin prohormone like-1SMESG000013290.1 BK007007smed_ncbi_20200123PMID:20967238
pharynxSMED30032126AndroglobinSMESG000053594.1 SMESG000047986.1 dd_Smed_v4_10677_0_1dd_Smed_v4PMID:29674431
pharynxSMED30032126AndroglobinSMESG000053594.1 SMESG000047986.1 dd_Smed_v6_10677_0dd_Smed_v6PMID:29674432
pharynxSMED30028103SMED30028103SMESG000081188.1 dd_Smed_v4_11827_0_1dd_Smed_v4PMID:29674431
pharynxSMED30030795Vault protein inter alpha trypsin-1SMESG000053671.1 SMESG000053669.1 SMESG000053667.1 SMESG000053664.1 SMESG000053657.1 SMESG000053638.1 dd_Smed_v4_1027_0_1dd_Smed_v4PMID:29674431
pharynxSMED30030795Vault protein inter alpha trypsin-1SMESG000053671.1 SMESG000053669.1 SMESG000053664.1 SMESG000053657.1 SMESG000053638.1 SMESG000053667.1 dd_Smed_v6_1027_0dd_Smed_v6PMID:29674432
pharynxSMED30032821SMED30032821SMESG000026756.1 dd_Smed_v4_11663_0_1dd_Smed_v4PMID:29674431
pharynxSMED30031722ANK_REP_REGION domain-containing proteinSMESG000022931.1 dd_Smed_v4_11187_0_1dd_Smed_v4PMID:29674431
pharynxSMED30031722ANK_REP_REGION domain-containing proteinSMESG000022931.1 dd_Smed_v6_11187_0dd_Smed_v6PMID:29674432
pharynxSMED30028624Synaptotagmin, putativeSMESG000034832.1 dd_Smed_v4_13224_0_1dd_Smed_v4PMID:29674431
pharynxSMED30034847Secreted peptide prohormone-11SMESG000069589.1 BK007014smed_ncbi_20200123PMID:20967238
pharynxSMED30029802MKS transition zone complex subunit 1SMESG000058562.1 dd_Smed_v4_14053_0_1dd_Smed_v4PMID:29674431
pharynxSMED30031879Protein kinase domain-containing proteinSMESG000043386.1 dd_Smed_v4_15542_0_1dd_Smed_v4PMID:29674431
pharynxSMED30014968CRAL-TRIO domain-containing proteinSMESG000009877.1 dd_Smed_v4_6149_0_1dd_Smed_v4PMID:29674431
pharynxSMED30012198UPF0764 protein C16orf89 homolog isoform X3SMESG000053422.1 dd_Smed_v4_4213_0_1dd_Smed_v4PMID:29674431
pharynxSMED30009505SMED30009505SMESG000015390.1 dd_Smed_v4_4166_0_1dd_Smed_v4PMID:29674431
pharynxSMED30009505SMED30009505SMESG000015390.1 dd_Smed_v6_4166_0dd_Smed_v6PMID:29674432
pharynxSMED30014374Low affinity cationic amino acid transporterSMESG000049007.1 dd_Smed_v4_2552_0_1dd_Smed_v4PMID:29674431
pharynxSMED30016397Transforming acidic coiled-coil-containing protein 3SMESG000056367.1 PL08003B2C03ncbi_smed_estsPMID:23079596
pharynxSMED30006820cilia- and flagella-associated protein 57SMESG000072029.1 dd_Smed_v4_3323_0_1dd_Smed_v4PMID:29674431
pharynxSMED30015310DUF3421 domain-containing proteinSMESG000046710.1 SMESG000046697.1 PL020001000E05ncbi_smed_estsPMID:23079596
pharynxSMED30004739TNF receptor-associated factorSMESG000014725.1 SMESG000014724.1 SMESG000014706.1 SMESG000014702.1 SMESG000014700.1 dd_Smed_v4_4420_0_1dd_Smed_v4PMID:29674431
pharynxSMED30005066Multiple epidermal growth factor domains protein 6SMESG000002074.1 dd_Smed_v4_5630_0_1dd_Smed_v4PMID:30962434
pharynxSMED30005066Multiple epidermal growth factor domains protein 6SMESG000002074.1 dd_Smed_v4_5630_0_1dd_Smed_v4PMID:29674431
pharynxSMED3000109640S ribosomal protein S23SMESG000017264.1 dd_Smed_v4_290_0_1dd_Smed_v4PMID:29674431
pharynxSMED30006563SEC7 domain-containing proteinSMESG000042180.1 dd_Smed_v4_9423_0_1dd_Smed_v4PMID:29674431
pharynxSMED30001933Heterogeneous nuclear ribonucleoproteinSMESG000055008.1 dd_Smed_v4_2383_0_1dd_Smed_v4PMID:29674431
pharynxSMED30007124EF-hand domain-containing proteinSMESG000062171.1 dd_Smed_v4_3568_0_1dd_Smed_v4PMID:29674431
pharynxSMED30012368Prominin (Prom) protein, putativeSMESG000025078.1 dd_Smed_v4_6506_0_1dd_Smed_v4PMID:29674431
pharynxSMED30004363cAMP-dependent protein kinase catalytic subunit alphaSMESG000063155.1 dd_Smed_v4_5162_0_1dd_Smed_v4PMID:29674431
pharynxSMED30013430Vigilin High density lipoprotein-binding proteinSMESG000018596.1 SMESG000006601.1 dd_Smed_v4_6161_0_1dd_Smed_v4PMID:29674431
pharynxSMED30008618Adenosine deaminaseSMESG000022051.1 dd_Smed_v4_3903_0_1dd_Smed_v4PMID:29674431
pharynxSMED30006334TBC1 domain family member 12SMESG000071846.1 SMESG000020373.1 dd_Smed_v4_7827_0_1dd_Smed_v4PMID:29674431
pharynxSMED30011189Arfaptin-2SMESG000011384.1 dd_Smed_v4_5732_0_1dd_Smed_v4PMID:29674431
pharynxSMED30005744FGFR1 oncogene partnerSMESG000006505.1 dd_Smed_v4_5371_0_1dd_Smed_v4PMID:29674431
pharynxSMED30011561SMED30011561SMESG000066396.1 dd_Smed_v4_7890_0_1dd_Smed_v4PMID:29674431
pharynxSMED30004840Coiled-coil domain containing 88AaSMESG000012304.1 dd_Smed_v4_3591_0_1dd_Smed_v4PMID:29674431
pharynxSMED30012605FERM domain-containing proteinSMESG000034888.1 dd_Smed_v4_4999_0_1dd_Smed_v4PMID:29674431
pharynxSMED30004319Coiled-coil domain containing 88CSMESG000066575.1 SMESG000066583.1 dd_Smed_v4_5291_0_1dd_Smed_v4PMID:29674431
pharynxSMED30010494Glutamine synthetaseSMESG000003836.1 dd_Smed_v4_9056_0_1dd_Smed_v4PMID:29674431
pharynxSMED30030330bok-2SMESG000066862.1 dd_Smed_v4_16107_0_1dd_Smed_v4PMID:29674431
pharynxSMED30024986SMED30024986SMESG000069890.1 dd_Smed_v4_16311_0_1dd_Smed_v4PMID:29674431
pharynxSMED30026777Exonuclease 3'-5' domain-containing protein 1SMESG000036160.1 dd_Smed_v4_14291_0_1dd_Smed_v4PMID:29674431
pharynxSMED30033014Phosphatidylinositol-4,5-bisphosphate 4-phosphataseSMESG000063221.1 Contig1068GPL15192PMID:23079596
pharynxSMED30029033SMED30029033SMESG000067215.1 dd_Smed_v4_14329_0_1dd_Smed_v4PMID:29674431
pharynxSMED30031175SMED30031175SMESG000064100.1 SMESG000064099.1 dd_Smed_v4_14322_0_1dd_Smed_v4PMID:29674431
pharynxSMED30030159SMED30030159SMESG000000606.1 dd_Smed_v4_2072_0_1dd_Smed_v4PMID:29674431
pharynxSMED30028302SMED30028302SMESG000056261.1 dd_Smed_v4_8391_0_1dd_Smed_v4PMID:29674431
pharynxSMED30029471Collagen alpha-1(XXVIII) chainSMESG000033673.1 dd_Smed_v4_1071_0_1dd_Smed_v4PMID:29674431
pharynxSMED30029471Collagen alpha-1(XXVIII) chainSMESG000033673.1 dd_Smed_v4_1071_0_1dd_Smed_v4PMID:30962434
pharynxSMED30029471Collagen alpha-1(XXVIII) chainSMESG000033673.1 dd_Smed_v6_1071_0dd_Smed_v6PMID:29674432
pharynxSMED30029471Collagen alpha-1(XXVIII) chainSMESG000033673.1 dd_1071dd_Smed_v4PMID:29674431
pharynxSMED30036004SMED30036004SMESG000015790.1 dd_Smed_v4_10265_0_1dd_Smed_v4PMID:29674431
pharynxSMED30035563Tripartite motif-containing protein 2SMESG000037506.1 dd_Smed_v4_13659_0_1dd_Smed_v4PMID:29674431
pharynxSMED30030054SMED30030054SMESG000031900.1 dd_Smed_v4_13724_0_1dd_Smed_v4PMID:29674431
pharynxSMED30027682NAD(P)H-dependent FMN reductaseSMESG000060640.1 Contig3408newmark_estsPMID:23079596
pharynxSMED30027682NAD(P)H-dependent FMN reductaseSMESG000060640.1 Contig3408uc_Smed_v2PMID:23079596
pharynxSMED30027682NAD(P)H-dependent FMN reductaseSMESG000074871.1 Contig3408newmark_estsPMID:23079596
pharynxSMED30027682NAD(P)H-dependent FMN reductaseSMESG000074871.1 Contig3408uc_Smed_v2PMID:23079596
pharynxSMED30030643Methylmalonic aciduria and homocystinuria type D-like protein, mitochondrialSMESG000030431.1 dd_Smed_v4_2046_0_1dd_Smed_v4PMID:29674431
pharynxSMED30026602Wnt2-1SMESG000002069.1 FJ463753.1smed_ncbi_20200123PMID:23318641
pharynxSMED30034953SMED30034953SMESG000065075.1 dd_Smed_v4_102_0_1dd_Smed_v4PMID:29674431
pharynxSMED30034953SMED30034953SMESG000065075.1 dd_Smed_v6_102_0dd_Smed_v6PMID:29674432
pharynxSMED30035260SMED30035260SMESG000035564.1 dd_Smed_v4_12208_0_1dd_Smed_v4PMID:29674431
pharynxSMED30035260SMED30035260SMESG000035564.1 dd_Smed_v6_12208_0dd_Smed_v6PMID:29674432
pharynxSMED30033145Protein kinase domain-containing proteinSMESG000026756.1 dd_Smed_v4_11663_0_1dd_Smed_v4PMID:29674431
pharynxSMED30029761lhx1-5-1SMESG000043039.1 SMESG000016568.1 dd_Smed_v4_11521_0_1dd_Smed_v4PMID:29674431
pharynxSMED30035470SMED30035470SMESG000076482.1 SMESG000076409.1 SMESG000076405.1 SMESG000076390.1 SMESG000076375.1 SMESG000076364.1 SMESG000076223.1 SMESG000040665.1 SMESG000019753.1 dd_Smed_v4_1097_0_1dd_Smed_v4PMID:29674431
pharynxSMED30028653IQ domain-containing protein HSMESG000037909.1 dd_Smed_v4_10544_0_1dd_Smed_v4PMID:29674431
pharynxSMED30026256vault protein inter alpha trypsin-1SMESG000053671.1 SMESG000053669.1 SMESG000053667.1 SMESG000053664.1 SMESG000053657.1 SMESG000053638.1 dd_Smed_v4_1027_0_1dd_Smed_v4PMID:29674431
pharynxSMED30026256vault protein inter alpha trypsin-1SMESG000053671.1 SMESG000053669.1 SMESG000053664.1 SMESG000053657.1 SMESG000053638.1 SMESG000053667.1 dd_Smed_v6_1027_0dd_Smed_v6PMID:29674432
pharynxSMED30030586slc10a-2SMESG000064833.1 dd_Smed_v4_10199_0_1dd_Smed_v4PMID:29674431
pharynxSMED30035769Four and a half LIM domains proteinSMESG000023063.1 dd_Smed_v4_1251_0_1dd_Smed_v4PMID:29674431
pharynxSMED30031405SMED30031405SMESG000051911.1 dd_Smed_v4_5276_0_1dd_Smed_v4PMID:29674431
pharynxSMED30031405SMED30031405SMESG000051910.1 SMESG000051904.1 dd_Smed_v6_298_0dd_Smed_v6PMID:29674432
pharynxSMED30026004SMED30026004SMESG000016872.1 dd_Smed_v4_3108_0_1dd_Smed_v4PMID:29674431
pharynxSMED30031745Fatty-acid amide hydrolase 1-likeSMESG000034791.1 dd_Smed_v4_4966_0_1dd_Smed_v4PMID:29674431
pharynxSMED30020617Endophilin-B1SMESG000013676.1 dd_Smed_v4_4055_0_1dd_Smed_v4PMID:29674431
pharynxSMED30020617Endophilin-B1SMESG000013676.1 dd_Smed_v6_4055_0dd_Smed_v6PMID:29674432
pharynxSMED30035584Stabilizer of axonemal microtubules 2SMESG000009389.1 dd_Smed_v4_3695_0_1dd_Smed_v4PMID:29674431
pharynxSMED30032448Expressed conserved proteinSMESG000064362.1 dd_Smed_v4_3795_0_1dd_Smed_v4PMID:29674431
pharynxSMED30021332Cytochrome cSMESG000045852.1 dd_Smed_v4_464_0_1dd_Smed_v4PMID:29674431
pharynxSMED30027818Si:ch211-163l21.7SMESG000026490.1 dd_Smed_v4_3833_0_1dd_Smed_v4PMID:29674431
pharynxSMED30033097SMED30033097SMESG000044449.1 SMESG000044448.1 dd_Smed_v4_4457_0_1dd_Smed_v4PMID:29674431
pharynxSMED30015409cAMP-responsive element modulatorSMESG000016695.1 Contig4585GPL15192PMID:23079596
pharynxSMED30015409cAMP-responsive element modulatorSMESG000033655.1 Contig4585GPL15192PMID:23079596
pharynxSMED30008732SMED30008732SMESG000064322.1 dd_Smed_v4_4685_1_1dd_Smed_v4PMID:29674431
pharynxSMED30006149protein pitchforkSMESG000045346.1 dd_Smed_v4_5490_0_1dd_Smed_v4PMID:29674431
pharynxSMED30019576SMED30019576SMESG000079563.1 SMESG000052448.1 dd_Smed_v4_3113_1_1dd_Smed_v4PMID:29674431
pharynxSMED30005280SMED30005280SMESG000077104.1 dd_Smed_v4_4063_0_1dd_Smed_v4PMID:29674431
pharynxSMED30018815Sperm flagellar protein 1SMESG000014677.1 dd_Smed_v4_5648_0_1dd_Smed_v4PMID:29674431
pharynxSMED30020000RNA binding motif single stranded interactingSMESG000010632.1 dd_Smed_v4_3575_0_1dd_Smed_v4PMID:29674431
pharynxSMED30001049Ubiquitin carboxyl-terminal hydrolaseSMESG000038532.1 SMESG000038519.1 SMESG000038510.1 SMESG000036103.1 SMESG000036102.1 SMESG000036062.1 dd_Smed_v4_8017_0_1dd_Smed_v4PMID:29674431
pharynxSMED30011075SMED30011075SMESG000027616.1 dd_Smed_v4_6146_0_1dd_Smed_v4PMID:29674431
pharynxSMED30004855Glutaredoxin-1SMESG000053749.1 dd_Smed_v4_4565_0_1dd_Smed_v4PMID:29674431
pharynxSMED30005336Phtf-FEM1B_bdg domain-containing proteinSMESG000058788.1 Contig2701GPL15192PMID:23079596
pharynxSMED30018122MADS-box domain-containing proteinSMESG000005612.1 Contig594GPL15192PMID:23079596
pharynxSMED30018122MADS-box domain-containing proteinSMESG000011575.1 Contig594GPL15192PMID:23079596
pharynxSMED30019571Protein kinase domain containing proteinSMESG000024532.1 dd_Smed_v4_2822_0_1dd_Smed_v4PMID:29674431
pharynxSMED30012622Intraflagellar transport 43SMESG000067883.1 dd_Smed_v4_5237_0_1dd_Smed_v4PMID:29674431
pharynxSMED30009457reticulocalbin-1SMESG000034805.1 dd_Smed_v4_493_0_1dd_Smed_v4PMID:29674431
pharynxSMED30009297kinesin light chainSMESG000007554.1 dd_Smed_v4_6239_0_1dd_Smed_v4PMID:29674431
pharynxSMED30010380SJCHGC04139 proteinSMESG000022419.1 dd_Smed_v4_4617_0_1dd_Smed_v4PMID:29674431
pharynxSMED30000184Nucleoside diphosphate kinaseSMESG000039529.1 dd_Smed_v4_3890_0_1dd_Smed_v4PMID:29674431
pharynxSMED30005488X1.C.D3.1SMESG000005130.1 dd_Smed_v4_3257_0_1dd_Smed_v4PMID:29674431
pharynxSMED30015706Twinfilin-1SMESG000041071.1 Contig2453GPL15192PMID:23079596
pharynxSMED30018802SMED30018802SMESG000030480.1 dd_Smed_v4_2310_0_1dd_Smed_v4PMID:29674431
pharynxSMED30010565SMED30010565SMESG000068609.1 dd_Smed_v4_34185_0_1dd_Smed_v4PMID:29674431
pharynxSMED30010503CEP135SMESG000077870.1 dd_Smed_v4_5218_0_1dd_Smed_v4PMID:29674431
pharynxSMED30010503CEP135SMESG000077870.1 dd_Smed_v6_5218_0dd_Smed_v6PMID:29674432
pharynxSMED30011512Radial spoke head 1 homologSMESG000014300.1 dd_Smed_v4_3321_0_1dd_Smed_v4PMID:29674431
pharynxSMED30011512Radial spoke head 1 homologSMESG000014300.1 dd_Smed_v6_3321_0dd_Smed_v6PMID:29674432
pharynxSMED30008476LRRC50SMESG000004118.1 SMESG000004112.1 dd_Smed_v4_9766_0_1dd_Smed_v4PMID:29674431
pharynxSMED30010504SMED30010504SMESG000010514.1 dd_Smed_v4_4965_0_1dd_Smed_v4PMID:29674431
pharynxSMED30001306SMED30001306SMESG000060566.1 SMESG000060556.1 dd_Smed_v4_4002_0_1dd_Smed_v4PMID:29674431
pharynxSMED30001306SMED30001306SMESG000060566.1 SMESG000060556.1 SMESG000060487.1 dd_Smed_v6_4002_0dd_Smed_v6PMID:29674432
pharynxSMED30013676nesprin-1-likeSMESG000016747.1 SMESG000016745.1 dd_Smed_v4_5365_0_1dd_Smed_v4PMID:29674431
pharynxSMED30013676nesprin-1-likeSMESG000016747.1 SMESG000016745.1 dd_Smed_v6_5365_0dd_Smed_v6PMID:29674432
pharynxSMED30003873nuclear factor Y subunit BSMESG000017262.1 dd_Smed_v4_5828_0_1dd_Smed_v4PMID:29674431
pharynxSMED30017463SMED30017463SMESG000016833.1 dd_Smed_v4_4940_0_1dd_Smed_v4PMID:29674431
pharynxSMED30007845Family S60 non-peptidase homologue (S60 family)SMESG000027224.1 dd_Smed_v4_2523_0_1dd_Smed_v4PMID:29674431
pharynxSMED30017476Intraflagellar transport protein 57SMESG000013668.1 dd_Smed_v4_7099_0_1dd_Smed_v4PMID:29674431
pharynxSMED30005160Kinesin light chainSMESG000018116.1 dd_Smed_v4_8136_0_1dd_Smed_v4PMID:29674431
pharynxSMED30007546SMED30007546SMESG000015060.1 dd_Smed_v4_3222_0_1dd_Smed_v4PMID:29674431
pharynxSMED30008812AP complex subunit sigmaSMESG000038889.1 Contig2145GPL15192PMID:23079596
pharynxSMED30002822RING-type domain-containing proteinSMESG000076385.1 SMESG000076375.1 SMESG000076363.1 SMESG000076223.1 SMESG000076482.1 SMESG000076470.1 SMESG000076410.1 SMESG000076358.1 Contig1645GPL15192PMID:23079596
pharynxSMED30002822RING-type domain-containing proteinSMESG000076482.1 SMESG000076470.1 SMESG000076469.1 SMESG000076410.1 SMESG000076409.1 SMESG000076408.1 SMESG000076407.1 SMESG000076406.1 SMESG000076390.1 SMESG000076389.1 SMESG000076385.1 SMESG000076375.1 SMESG000076371.1 SMESG000076369.1 SMESG000076363.1 SMESG000076358.1 SMESG000076223.1 SMESG000040665.1 dd_Smed_v6_645_0dd_Smed_v6PMID:29674432
pharynxSMED30002822RING-type domain-containing proteinSMESG000076482.1 SMESG000076470.1 SMESG000076469.1 SMESG000076410.1 SMESG000076409.1 SMESG000076408.1 SMESG000076407.1 SMESG000076406.1 SMESG000076390.1 SMESG000076389.1 SMESG000076385.1 SMESG000076375.1 SMESG000076371.1 SMESG000076363.1 SMESG000076358.1 SMESG000076223.1 SMESG000040665.1 dd_Smed_v4_645_0_1dd_Smed_v4PMID:29674431
pharynxSMED30011521Zinc finger A20 and AN1 domain-containing stress-associated protein 6SMESG000081228.1 dd_Smed_v4_4892_0_1dd_Smed_v4PMID:29674431
pharynxSMED30014928Formin-like proteinSMESG000044336.1 Contig1407newmark_estsPMID:23079596
pharynxSMED30014928Formin-like proteinSMESG000015063.1 Contig1407newmark_estsPMID:23079596
pharynxSMED30005213Band 4.1-like protein 5SMESG000007133.1 dd_Smed_v4_4114_0_1dd_Smed_v4PMID:29674431
pharynxSMED30006047EF-hand calcium-binding domain-containing protein 5SMESG000053423.1 dd_Smed_v4_8209_0_1dd_Smed_v4PMID:29674431
pharynxSMED30002554B9 domain-containing protein 2SMESG000000764.1 dd_Smed_v4_7362_0_1dd_Smed_v4PMID:29674431
pharynxSMED30016141lissencephaly-1SMESG000054739.1 SMESG000035997.1 JQ650355.1smed_ncbi_20200123PMID:22411224
pharynxSMED30004214SMED30004214SMESG000055805.1 dd_Smed_v4_857_0_1dd_Smed_v4PMID:29674431
pharynxSMED30012419Non-specific serine/threonine protein kinaseSMESG000069962.1 SMESG000069953.1 SMESG000069952.1 dd_Smed_v4_3244_0_1dd_Smed_v4PMID:29674431
pharynxSMED30012139slc2a-2SMESG000081673.1 dd_Smed_v4_3190_0_1dd_Smed_v4PMID:29674431
pharynxSMED30013563Serine/threonine-protein kinase 10SMESG000064983.1 dd_Smed_v4_5720_0_1dd_Smed_v4PMID:29674431
pharynxSMED30009873SMED30009873SMESG000016812.1 SMESG000016788.1 SMESG000016785.1 SMESG000016784.1 SMESG000016778.1 SMESG000016777.1 SMESG000016774.1 SMESG000016773.1 SMESG000016772.1 dd_Smed_v4_422_0_1dd_Smed_v4PMID:29674431
pharynxSMED30014184Tumor necrosis factor alpha-induced protein 8-like proteinSMESG000002914.1 dd_Smed_v4_2386_0_1dd_Smed_v4PMID:29674431
pharynxSMED30007543nesprin-1-likeSMESG000016747.1 SMESG000016745.1 dd_Smed_v4_5365_0_1dd_Smed_v4PMID:29674431
pharynxSMED30007543nesprin-1-likeSMESG000016747.1 SMESG000016745.1 dd_Smed_v6_5365_0dd_Smed_v6PMID:29674432
pharynxSMED30019325Myosin regulatory light chainSMESG000068156.1 SMESG000064685.1 SMESG000043474.1 SMESG000010609.1 SMESG000076470.1 SMESG000073857.1 SMESG000062429.1 SMESG000058575.1 SMESG000053533.1 SMESG000020635.1 SMESG000015751.1 SMESG000005260.1 Contig246GPL15192PMID:23079596
pharynxSMED30019325Myosin regulatory light chainSMESG000000175.1 Contig246GPL15192PMID:23079596
pharynxSMED30019325Myosin regulatory light chainSMESG000000175.1 Contig2068GPL15192PMID:23079596
pharynxSMED30007939Lysophosphatidylglycerol acyltransferase 1SMESG000066297.1 dd_Smed_v4_7263_0_1dd_Smed_v4PMID:29674431
pharynxSMED30003729Dynein light chainSMESG000048100.1 dd_Smed_v4_5884_0_1dd_Smed_v4PMID:29674431
pharynxSMED30002064Doublecortin domain-containing protein 2SMESG000040482.1 SMESG000040481.1 SMESG000040480.1 SMESG000038137.1 dd_Smed_v4_6464_0_1dd_Smed_v4PMID:29674431
pharynxSMED30017714Basement membrane-specific heparan sulfate proteoglycan core proteinSMESG000075928.1 DN293829.1ncbi_smed_estsPMID:23318635
pharynxSMED30017714Basement membrane-specific heparan sulfate proteoglycan core proteinSMESG000075928.1 DN293829.1ncbi_smed_estsPMID:24523458
pharynxSMED30017714Basement membrane-specific heparan sulfate proteoglycan core proteinSMESG000075928.1 dd_8356dd_Smed_v4PMID:29674431
pharynxSMED30017714Basement membrane-specific heparan sulfate proteoglycan core proteinSMESG000075928.1 dd_8356dd_Smed_v4PMID:29674431
pharynxSMED30005322SMED30005322SMESG000078208.1 dd_2727dd_Smed_v4PMID:29674431
pharynxSMED30005322SMED30005322SMESG000078208.1 dd_2727dd_Smed_v4PMID:29674431
pharynxSMED30005762Contactin/TAG-1 cell adhesion moleculeSMESG000036495.1 dd_Smed_v4_2673_0_1dd_Smed_v4PMID:29674431
pharynxSMED30018439XK-related proteinSMESG000080414.1 dd_Smed_v4_2770_0_1dd_Smed_v4PMID:29674431
pharynxSMED30004315Bestrophin homologSMESG000070057.1 dd_Smed_v4_8073_0_1dd_Smed_v4PMID:29674431
pharynxSMED30022414SMED30022414SMESG000076482.1 SMESG000076409.1 SMESG000076405.1 SMESG000076390.1 SMESG000076375.1 SMESG000076364.1 SMESG000076223.1 SMESG000040665.1 SMESG000019753.1 dd_Smed_v4_1097_0_1dd_Smed_v4PMID:29674431
pharynxSMED30022414SMED30022414SMESG000076482.1 SMESG000076470.1 SMESG000076469.1 SMESG000076410.1 SMESG000076409.1 SMESG000076408.1 SMESG000076407.1 SMESG000076406.1 SMESG000076390.1 SMESG000076389.1 SMESG000076385.1 SMESG000076375.1 SMESG000076371.1 SMESG000076369.1 SMESG000076363.1 SMESG000076358.1 SMESG000076223.1 SMESG000040665.1 dd_Smed_v6_645_0dd_Smed_v6PMID:29674432
pharynxSMED30022414SMED30022414SMESG000076482.1 SMESG000076470.1 SMESG000076469.1 SMESG000076410.1 SMESG000076409.1 SMESG000076408.1 SMESG000076407.1 SMESG000076406.1 SMESG000076390.1 SMESG000076389.1 SMESG000076385.1 SMESG000076375.1 SMESG000076371.1 SMESG000076363.1 SMESG000076358.1 SMESG000076223.1 SMESG000040665.1 dd_Smed_v4_645_0_1dd_Smed_v4PMID:29674431
pharynxSMED30020814SMED30020814SMESG000076482.1 SMESG000076409.1 SMESG000076405.1 SMESG000076390.1 SMESG000076375.1 SMESG000076364.1 SMESG000076223.1 SMESG000040665.1 SMESG000019753.1 dd_Smed_v4_1097_0_1dd_Smed_v4PMID:29674431
pharynxSMED30028489START domain-containing proteinSMESG000028630.1 dd_Smed_v4_3237_0_1dd_Smed_v4PMID:29674431
pharynxSMED30022997ELMO domain containing 3SMESG000008416.1 dd_Smed_v4_13608_0_1dd_Smed_v4PMID:29674431
pharynxSMED30027707S-adenosylmethionine synthaseSMESG000027587.1 dd_Smed_v4_1580_0_1dd_Smed_v4PMID:29674431
pharynxSMED30022370Calcium-activated potassium channel slo-1, putativeSMESG000049145.1 dd_Smed_v4_12503_0_1dd_Smed_v4PMID:29674431
pharynxSMED30007555GCR098SMESG000033655.1 Contig4585uc_Smed_v2PMID:23079596
pharynxSMED30000132SMED30000132SMESG000017239.1 dd_Smed_v4_4431_0_1dd_Smed_v4PMID:29674431
pharynxSMED30000647Cell wall integrity and stress response component 1SMESG000035037.1 SMESG000035036.1 dd_Smed_v4_6380_0_1dd_Smed_v4PMID:29674431
pharynxSMED30007716Ankyrin repeat domain 28bSMESG000060640.1 Contig3408GPL15192PMID:23079596
pharynxSMED30007716Ankyrin repeat domain 28bSMESG000074871.1 Contig3408GPL15192PMID:23079596
pharynxSMED30000745SMED30000745SMESG000027028.1 dd_Smed_v4_14847_0_1dd_Smed_v4PMID:29674431
pharynxSMED30012546Coiled-coil domain-containing protein 65SMESG000021331.1 dd_Smed_v4_6152_0_1dd_Smed_v4PMID:29674431
pharynxSMED30001294Phosphatidylinositol-binding clathrin assembly proteinSMESG000043423.1 Contig1792GPL15192PMID:23079596
pharynxSMED30001294Phosphatidylinositol-binding clathrin assembly proteinSMESG000072544.1 Contig1792GPL15192PMID:23079596
pharynxSMED30005745Protein kinaseSMESG000079303.1 Contig2289GPL15192PMID:23079596
pharynxSMED30005745Protein kinaseSMESG000017260.1 Contig2289GPL15192PMID:23079596
pharynxSMED30007217Death domain-containing proteinSMESG000078437.1 dd_Smed_v4_7428_0_1dd_Smed_v4PMID:29674431
pharynxSMED30018451Lipopolysaccharide-induced TNF-alpha factorSMESG000020870.1 SMESG000046087.1 SMESG000046084.1 dd_Smed_v4_2768_0_1dd_Smed_v4PMID:29674431
pharynxSMED30010468RBR-type E3 ubiquitin transferaseSMESG000062644.1 dd_Smed_v4_3281_0_1dd_Smed_v4PMID:29674431
pharynxSMED30010468RBR-type E3 ubiquitin transferaseSMESG000062644.1 dd_Smed_v6_3281_0dd_Smed_v6PMID:29674432
pharynxSMED30012136radial spoke head protein 9 homologSMESG000046857.1 dd_Smed_v4_4707_0_1dd_Smed_v4PMID:29674431
pharynxSMED30011909SMED30011909SMESG000027686.1 Contig2364GPL15192PMID:23079596
pharynxSMED30011909SMED30011909SMESG000012131.1 SMESG000012127.1 Contig2364GPL15192PMID:23079596
pharynxSMED30014233SMED30014233SMESG000045992.1 dd_Smed_v4_6974_0_1dd_Smed_v4PMID:29674431
pharynxSMED30011213Osteoclast-stimulating factor 1SMESG000004952.1 Contig516GPL15192PMID:23079596
pharynxSMED30000565Dynein heavy chainSMESG000065732.1 dd_Smed_v4_6941_0_1dd_Smed_v4PMID:29674431
pharynxSMED30001248SMED30001248SMESG000013596.1 dd_Smed_v4_6322_0_1dd_Smed_v4PMID:29674431
pharynxSMED30001248SMED30001248SMESG000013596.1 dd_Smed_v6_6322_0dd_Smed_v6PMID:29674432
pharynxSMED30013882Spds-1SMESG000023363.1 dd_Smed_v4_3295_0_1dd_Smed_v4PMID:29674431
pharynxSMED30015801SMED30015801SMESG000079303.1 Contig2289newmark_estsPMID:23079596
pharynxSMED30015801SMED30015801SMESG000017260.1 Contig2289newmark_estsPMID:23079596
pharynxSMED30001668SMED30001668SMESG000033527.1 Contig2307GPL15192PMID:23079596
pharynxSMED30001630Ras-related C3 botulinum toxin substrate 1SMESG000005612.1 Contig594newmark_estsPMID:23079596
pharynxSMED30001630Ras-related C3 botulinum toxin substrate 1SMESG000005612.1 Contig594uc_Smed_v2PMID:23079596
pharynxSMED30001630Ras-related C3 botulinum toxin substrate 1SMESG000011575.1 Contig594newmark_estsPMID:23079596
pharynxSMED30001630Ras-related C3 botulinum toxin substrate 1SMESG000011575.1 Contig594uc_Smed_v2PMID:23079596
pharynxSMED30009834TNF receptor-associated factorSMESG000047296.1 dd_Smed_v4_2916_0_1dd_Smed_v4PMID:29674431
pharynxSMED30009834TNF receptor-associated factorSMESG000047296.1 dd_Smed_v6_2916_0dd_Smed_v6PMID:29674432
pharynxSMED30016338Alpha-adducinSMESG000051636.1 dd_Smed_v4_2345_0_1dd_Smed_v4PMID:29674431
pharynxSMED30015345TropomyosinSMESG000066854.1 Contig3688newmark_estsPMID:23079596
pharynxSMED30015345TropomyosinSMESG000066854.1 Contig3688uc_Smed_v2PMID:23079596
pharynxSMED30015345TropomyosinSMESG000026500.1 Contig3688newmark_estsPMID:23079596
pharynxSMED30015345TropomyosinSMESG000026500.1 Contig3688uc_Smed_v2PMID:23079596
pharynxSMED30017971ANK_REP_REGION domain-containing proteinSMESG000026132.1 dd_Smed_v4_6201_0_1dd_Smed_v4PMID:29674431
pharynxSMED30004453SMED30004453SMESG000038305.1 SMESG000038313.1 SMESG000035859.1 dd_Smed_v4_2262_0_1dd_Smed_v4PMID:29674431
pharynxSMED30028521Cadmium metallothionein (MT-Cd) (Cd-MT)SMESG000013781.1 dd_Smed_v4_3412_0_1dd_Smed_v4PMID:29674431
pharynxSMED30021112Metallophos domain-containing proteinSMESG000036416.1 dd_Smed_v4_4496_0_1dd_Smed_v4PMID:29674431
pharynxSMED30032906SMED30032906SMESG000022399.1 dd_Smed_v4_8295_0_1dd_Smed_v4PMID:29674431
pharynxSMED30035468DNAHb-1SMESG000072114.1 SMESG000072113.1 SMESG000072112.1 dd_Smed_v4_3670_0_1dd_Smed_v4PMID:29674431
pharynxSMED30021589Agrin, putativeSMESG000028865.1 SMESG000028859.1 dd_Smed_v4_3649_0_1dd_Smed_v4PMID:29674431
pharynxSMED30021589Agrin, putativeSMESG000028865.1 SMESG000028859.1 dd_Smed_v4_3649_0_1dd_Smed_v4PMID:30962434
pharynxSMED30021589Agrin, putativeSMESG000028865.1 SMESG000028859.1 dd_Smed_v6_3649_0dd_Smed_v6PMID:29674432
pharynxSMED30031216Oxysterol-binding proteinSMESG000023068.1 dd_Smed_v4_3268_0_1dd_Smed_v4PMID:29674431
pharynxSMED30031687TNF receptor-associated factorSMESG000014725.1 SMESG000014724.1 SMESG000014706.1 SMESG000014702.1 SMESG000014700.1 dd_Smed_v4_4420_0_1dd_Smed_v4PMID:29674431
pharynxSMED30032042SMED30032042SMESG000065355.1 SMESG000065350.1 SMESG000065349.1 dd_531dd_Smed_v4PMID:29674431
pharynxSMED30032042SMED30032042SMESG000065355.1 SMESG000065350.1 SMESG000065349.1 dd_531dd_Smed_v4PMID:29674431
pharynxSMED30032042SMED30032042SMESG000065355.1 SMESG000065350.1 SMESG000065349.1 dd_Smed_v4_531_0_1dd_Smed_v4PMID:29674431
pharynxSMED30026420Leucyl aminopeptidaseSMESG000037609.1 dd_Smed_v4_2903_0_1dd_Smed_v4PMID:29674431
pharynxSMED30029491Outer dense fiber of sperm tails 2SMESG000016357.1 dd_Smed_v4_3609_0_1dd_Smed_v4PMID:29674431
pharynxSMED30024475Si:ch211-106h4.9SMESG000026729.1 dd_Smed_v4_3756_0_1dd_Smed_v4PMID:29674431
pharynxSMED30031654SMED30031654SMESG000064362.1 dd_Smed_v4_3795_0_1dd_Smed_v4PMID:29674431
pharynxSMED30027228Protein FAM166BSMESG000069725.1 dd_Smed_v4_5010_0_1dd_Smed_v4PMID:29674431
pharynxSMED30029349AdenosylhomocysteinaseSMESG000029405.1 dd_Smed_v4_3408_0_1dd_Smed_v4PMID:29674431
pharynxSMED30024358Protein 4.1SMESG000029732.1 dd_Smed_v4_2825_0_1dd_Smed_v4PMID:29674431
pharynxSMED30024358Protein 4.1SMESG000029732.1 dd_Smed_v4_5331_0_1dd_Smed_v4PMID:29674431
pharynxSMED30033098WD repeat-containing protein 97 isoform X2SMESG000010382.1 dd_Smed_v4_11828_0_1dd_Smed_v4PMID:29674431
pharynxSMED30033476Zinc finger protein, putativeSMESG000068172.1 Contig3306GPL15192PMID:23079596
pharynxSMED30033476Zinc finger protein, putativeSMESG000025870.1 Contig3306GPL15192PMID:23079596
pharynxSMED30033644titin homologSMESG000002539.1 dd_Smed_v4_8111_0_1dd_Smed_v4PMID:29674431
pharynxSMED30033644titin homologSMESG000002539.1 dd_Smed_v6_8111_0dd_Smed_v6PMID:29674432
pharynxSMED30030871Dual specificity tyrosine-phosphorylation-regulated kinase 1BSMESG000064415.1 dd_Smed_v4_3773_0_1dd_Smed_v4PMID:29674431
pharynxSMED30026942Dynein light chainSMESG000052937.1 SMESG000027765.1 dd_Smed_v4_2487_0_1dd_Smed_v4PMID:29674431
pharynxSMED30031405SMED30031405SMESG000051910.1 SMESG000051904.1 dd_Smed_v4_298_0_1dd_Smed_v4PMID:29674431
pharynxSMED30025510UHRF1-binding protein 1-likeSMESG000044305.1 dd_Smed_v4_11401_0_1dd_Smed_v4PMID:29674431
pharynxSMED30022249Clathrin interactor 1SMESG000032527.1 SMESG000022725.1 dd_Smed_v4_1563_0_1dd_Smed_v4PMID:29674431
pharynxSMED30033779SMED30033779SMESG000022691.1 SMESG000022690.1 dd_Smed_v4_2130_0_1dd_Smed_v4PMID:29674431
pharynxSMED30033779SMED30033779SMESG000079607.1 SMESG000049847.1 SMESG000049832.1 SMESG000049756.1 SMESG000040301.1 SMESG000022640.1 SMESG000072592.1 SMESG000049745.1 SMESG000049740.1 SMESG000049695.1 SMESG000049683.1 SMESG000049676.1 SMESG000049665.1 SMESG000049663.1 SMESG000049601.1 SMESG000049567.1 SMESG000040257.1 SMESG000022691.1 SMESG000022676.1 SMESG000049548.1 SMESG000049895.1 SMESG000049844.1 SMESG000049812.1 SMESG000022696.1 SMESG000022690.1 SMESG000022619.1 SMESG000072955.1 SMESG000049806.1 SMESG000049805.1 SMESG000032755.1 SMESG000032715.1 SMESG000022665.1 SMESG000000563.1 SMESG000000371.1 SMESG000049772.1 SMESG000049767.1 SMESG000049739.1 SMESG000049688.1 SMESG000049647.1 SMESG000049621.1 SMESG000049614.1 SMESG000022612.1 SMESG000029699.1 SMESG000000559.1 SMESG000000302.1 SMESG000049565.1 SMESG000065603.1 SMESG000000411.1 SMESG000000372.1 dd_Smed_v6_490_0dd_Smed_v6PMID:29674432
pharynxSMED30030227flotillin-2SMESG000059332.1 Contig5500GPL15192PMID:23079596
pharynxSMED30030227flotillin-2SMESG000024114.1 Contig5500GPL15192PMID:23079596
pharynxSMED30032529SMED30032529SMESG000077536.1 dd_Smed_v4_11079_0_1dd_Smed_v4PMID:29674431
pharynxSMED30025153SMED30025153SMESG000029777.1 dd_Smed_v4_13914_0_1dd_Smed_v4PMID:29674431
pharynxSMED30025226CalmodulinSMESG000004980.1 dd_Smed_v4_13205_0_1dd_Smed_v4PMID:29674431
pharynxSMED30027661PhosphodiesteraseSMESG000044149.1 dd_Smed_v4_15950_0_1dd_Smed_v4PMID:29674431
pharynxSMED30027661PhosphodiesteraseSMESG000044149.1 dd_Smed_v4_35318_0_1dd_Smed_v4PMID:29674431
pharynxSMED30034212SMED30034212SMESG000023080.1 dd_Smed_v4_8763_0_1dd_Smed_v4PMID:29674431
pharynxSMED30021821Transient receptor potential cation channel subfamily M memberSMESG000078720.1 dd_Smed_v4_17981_0_1dd_Smed_v4PMID:29674431
pharynxSMED30024538Beta-amyloid-like proteinSMESG000025222.1 SMESG000025214.1 SMESG000025213.1 dd_Smed_v4_2561_0_1dd_Smed_v4PMID:29674431
pharynxSMED30024538Beta-amyloid-like proteinSMESG000025222.1 SMESG000025214.1 SMESG000025213.1 dd_Smed_v6_2561_0dd_Smed_v6PMID:29674432
pharynxSMED30035901Abelson helper integration site 1SMESG000005183.1 SMESG000005182.1 dd_Smed_v4_11557_0_1dd_Smed_v4PMID:29674431
pharynxSMED30027299PBXSMESG000022232.1 SMESG000001913.1 KC353351.1smed_ncbi_20200123PMID:23318641
pharynxSMED30033577Neural cell adhesion molecule 1SMESG000006414.1 KU850495.2smed_ncbi_20200123PMID:27122174
pharynxSMED30033577Neural cell adhesion molecule 1SMESG000006414.1 KU850495smed_ncbi_20200123PMID:27122174
pharynxSMED30024572SMED30024572SMESG000022691.1 SMESG000022690.1 dd_Smed_v4_2130_0_1dd_Smed_v4PMID:29674431
pharynxSMED30021616Rho GTPase-activating proteinSMESG000060252.1 dd_Smed_v4_3376_0_1dd_Smed_v4PMID:29674431
pharynxSMED30033197SMED30033197SMESG000073811.1 dd_Smed_v4_116_0_1dd_Smed_v4PMID:29674431
pharynxSMED30034173Calcium-dependent protein kinaseSMESG000033648.1 dd_Smed_v4_13677_0_1dd_Smed_v4PMID:29674431
pharynxSMED30028503SMED30028503SMESG000040102.1 dd_Smed_v4_5390_0_1dd_Smed_v4PMID:29674431
pharynxSMED30028503SMED30028503SMESG000040102.1 dd_Smed_v6_5390_0dd_Smed_v6PMID:29674432
pharynxSMED30027542CRAL-TRIO domain-containing proteinSMESG000019717.1 dd_Smed_v6_1619_0dd_Smed_v6PMID:29674432
pharynxSMED30027542CRAL-TRIO domain-containing proteinSMESG000019717.1 dd_Smed_v4_1619_0_1dd_Smed_v4PMID:29674431
pharynxSMED30021940SMED30021940SMESG000017261.1 dd_Smed_v4_2030_0_1dd_Smed_v4PMID:29674431
pharynxSMED30028347Engulfment and cell motility 3SMESG000013936.1 Contig1935GPL15192PMID:23079596
pharynxSMED30028347Engulfment and cell motility 3SMESG000039535.1 Contig1935GPL15192PMID:23079596
pharynxSMED30023228SMED30023228SMESG000058720.1 dd_Smed_v4_7931_0_1dd_Smed_v4PMID:29674431
pharynxSMED30027451PMP-22/EMP/MP20/Claudin tight junctionSMESG000029752.1 dd_Smed_v4_2731_0_1dd_Smed_v4PMID:29674431
pharynxSMED30029139Ubiquitin-conjugating enzyme E2 L3SMESG000069968.1 SMESG000069969.1 dd_Smed_v4_180_0_1dd_Smed_v4PMID:29674431
pharynxSMED30021154Calmodulin, putativeSMESG000040933.1 SMESG000040932.1 dd_Smed_v4_603_0_1dd_Smed_v4PMID:29674431
pharynxSMED30022921Netrin 1SMESG000050895.1 dd_Smed_v4_14852_0_1dd_Smed_v4PMID:29674431
pharynxSMED30022921Netrin 1SMESG000050895.1 dd_Smed_v4_14852_0_1dd_Smed_v4PMID:30962434
pharynxSMED30025517PhosphodiesteraseSMESG000044149.1 dd_Smed_v4_15950_0_1dd_Smed_v4PMID:29674431
pharynxSMED30032947cilia- and flagella-associated protein 46SMESG000014116.1 SMESG000014118.1 dd_Smed_v4_14103_0_1dd_Smed_v4PMID:29674431
pharynxSMED30027213Solute carrier family 49 member 3SMESG000032659.1 dd_Smed_v4_5238_0_1dd_Smed_v4PMID:29674431
pharynxSMED30027019InnexinSMESG000030971.1 SMESG000030964.1 dd_Smed_v4_10061_0_1dd_Smed_v4PMID:29674431
pharynxSMED30026646Dynein light chainSMESG000009941.1 dd_Smed_v4_107_0_1dd_Smed_v4PMID:29674431
pharynxSMED30033541SMED30033541SMESG000061837.1 dd_Smed_v4_14985_0_1dd_Smed_v4PMID:29674431
pharynxSMED30035194DnaJ-like subfamily C member 27SMESG000071551.1 dd_Smed_v4_11963_0_1dd_Smed_v4PMID:29674431
pharynxSMED30031141Tubulin polyglutamylase ttll6SMESG000075764.1 dd_Smed_v4_8131_0_1dd_Smed_v4PMID:29674431
pharynxSMED30025527coiled-coil domain-containing protein 105SMESG000077974.1 dd_Smed_v4_14773_0_1dd_Smed_v4PMID:29674431
pharynxSMED30030892Intraflagellar transport protein 172SMESG000028841.1 dd_Smed_v4_10638_0_1dd_Smed_v4PMID:29674431
pharynxSMED30030892Intraflagellar transport protein 172SMESG000028841.1 dd_Smed_v4_7533_0_1dd_Smed_v4PMID:29674431
pharynxSMED30021685Bestrophin homologSMESG000070057.1 dd_Smed_v4_8073_0_1dd_Smed_v4PMID:29674431
pharynxSMED30028417Bardet-Biedl syndrome 1 protein homologSMESG000009880.1 EG344641.1ncbi_smed_estsPMID:19852954
pharynxSMED30028417Bardet-Biedl syndrome 1 protein homologSMESG000009880.1 dd_Smed_v4_7298_0_1dd_Smed_v4PMID:29674431
pharynxSMED30032202Doublecortin domain-containing proteinSMESG000017756.1 dd_Smed_v4_11770_0_1dd_Smed_v4PMID:29674431
pharynxSMED30027202Progestin and adipoQ receptor family member 6SMESG000044081.1 dd_Smed_v4_14141_0_1dd_Smed_v4PMID:29674431
pharynxSMED30020811SMED30020811SMESG000005612.1 Contig594newmark_estsPMID:23079596
pharynxSMED30020811SMED30020811SMESG000005612.1 Contig594uc_Smed_v2PMID:23079596
pharynxSMED30020811SMED30020811SMESG000011575.1 Contig594newmark_estsPMID:23079596
pharynxSMED30020811SMED30020811SMESG000011575.1 Contig594uc_Smed_v2PMID:23079596
pharynxSMED30012526slc39a-8SMESG000009752.1 SMESG000009750.1 dd_Smed_v4_4776_0_1dd_Smed_v4PMID:29674431
pharynxSMED30005413SMED30005413SMESG000017261.1 dd_Smed_v4_2030_0_1dd_Smed_v4PMID:29674431
pharynxSMED30019921SMED30019921SMESG000058949.1 dd_Smed_v4_10877_0_1dd_Smed_v4PMID:29674431
pharynxSMED30007102slc43a-2SMESG000043544.1 SMESG000043543.1 dd_Smed_v4_9711_0_1dd_Smed_v4PMID:29674431
pharynxSMED30002663TNF receptor-associated factorSMESG000018404.1 dd_Smed_v4_4392_0_1dd_Smed_v4PMID:29674431
pharynxSMED30015948SMED30015948SMESG000042166.1 dd_Smed_v4_4173_0_1dd_Smed_v4PMID:29674431
pharynxSMED30016586tubulin polyglutamylase complex subunit 2SMESG000041945.1 dd_Smed_v4_13845_0_1dd_Smed_v4PMID:29674431
pharynxSMED30018829Insulin like growth factor 2 receptorSMESG000023958.1 SMESG000023953.1 dd_Smed_v4_14729_0_1dd_Smed_v4PMID:29674431
pharynxSMED30015809SMED30015809SMESG000069776.1 dd_Smed_v4_10177_0_1dd_Smed_v4PMID:29674431
pharynxSMED30015453Poly [ADP-ribose] polymeraseSMESG000011115.1 dd_Smed_v4_2611_0_1dd_Smed_v4PMID:29674431
pharynxSMED30005665SMED30005665SMESG000074689.1 dd_Smed_v4_2429_0_1dd_Smed_v4PMID:29674431
pharynxSMED30008907SMED30008907SMESG000017261.1 dd_Smed_v4_2030_0_1dd_Smed_v4PMID:29674431
pharynxSMED30015209Calcyphosin proteinSMESG000005291.1 dd_Smed_v4_7209_0_1dd_Smed_v4PMID:29674431
pharynxSMED30002502Choline-phosphate cytidylyltransferaseSMESG000081359.1 dd_Smed_v4_5385_0_1dd_Smed_v4PMID:29674431
pharynxSMED30014810Endophilin-A3SMESG000061276.1 dd_Smed_v4_7468_0_1dd_Smed_v4PMID:29674431
pharynxSMED30012344SMED30012344SMESG000017261.1 dd_Smed_v4_2030_0_1dd_Smed_v4PMID:29674431
pharynxSMED30015890Protein lethal(2) giant larvaeSMESG000072512.1 dd_Smed_v4_7127_0_1dd_Smed_v4PMID:29674431
pharynxSMED30016010SMED30016010SMESG000042231.1 dd_Smed_v4_10980_0_1dd_Smed_v4PMID:29674431
pharynxSMED30016664SMED30016664SMESG000011618.1 BK007009smed_ncbi_20200123PMID:20967238
pharynxSMED30015473Actin cytoplasmic type 5SMESG000080982.1 SMESG000080969.1 dd_Smed_v4_2624_0_1dd_Smed_v4PMID:29674431
pharynxSMED30002428Gamma-aminobutyric acid receptor-associated proteinSMESG000026465.1 dd_Smed_v4_600_0_1dd_Smed_v4PMID:29674431
pharynxSMED30002428Gamma-aminobutyric acid receptor-associated proteinSMESG000026465.1 dd_Smed_v6_600_0dd_Smed_v6PMID:29674432
pharynxSMED30011748SMED30011748SMESG000013713.1 dd_Smed_v4_9787_0_1dd_Smed_v4PMID:29674431
pharynxSMED30017647SMED30017647SMESG000013908.1 dd_Smed_v4_1173_0_1dd_Smed_v4PMID:29674431
pharynxSMED30009430Fructose-bisphosphate aldolaseSMESG000006056.1 dd_Smed_v4_591_0_1dd_Smed_v4PMID:29674431
pharynxSMED30009430Fructose-bisphosphate aldolaseSMESG000006056.1 dd_Smed_v6_591_0dd_Smed_v6PMID:29674432
pharynxSMED30003609Chloride intracellular channel protein 4SMESG000054543.1 dd_Smed_v4_2382_0_1dd_Smed_v4PMID:29674431
pharynxSMED30016950DystrophinSMESG000020523.1 dd_Smed_v4_5325_0_1dd_Smed_v4PMID:29674431
pharynxSMED30001479G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000029294.1 SMESG000029291.1 dd_Smed_v4_2802_0_1dd_Smed_v4PMID:29674431
pharynxSMED30001479G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000029291.1 dd_Smed_v4_6716_0_1dd_Smed_v4PMID:29674431
pharynxSMED30001479G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000029294.1 SMESG000029291.1 dd_Smed_v6_2802_0dd_Smed_v6PMID:29674432
pharynxSMED30013808fos-1SMESG000003328.1 dd_Smed_v4_2789_0_1dd_Smed_v4PMID:29674431
pharynxSMED30014872beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase 3SMESG000051810.1 SMESG000051787.1 SMESG000043068.1 SMESG000043067.1 SMESG000043052.1 SMESG000009027.1 SMESG000008972.1 dd_Smed_v4_6205_0_1dd_Smed_v4PMID:29674431
pharynxSMED30014131RPTOR independent companion of MTOR, complex 2 aSMESG000024212.1 SMESG000033570.1 dd_Smed_v4_9324_0_1dd_Smed_v4PMID:29674431
pharynxSMED30003519SMED30003519SMESG000018116.1 dd_Smed_v4_8136_0_1dd_Smed_v4PMID:29674431
pharynxSMED30013884SMED30013884SMESG000049207.1 SMESG000049205.1 SMESG000049063.1 dd_Smed_v4_11081_0_1dd_Smed_v4PMID:29674431
pharynxSMED30017667SMED30017667SMESG000044691.1 SMESG000022166.1 dd_Smed_v4_10233_0_1dd_Smed_v4PMID:29674431
pharynxSMED30015967Neurotracting/lsamp/neurotrimin/obcam related cell adhesion moleculeSMESG000068491.1 dd_Smed_v4_2826_0_1dd_Smed_v4PMID:29674431
pharynxSMED30017369Disabled 2-interacting proteinSMESG000043888.1 dd_Smed_v4_3238_0_1dd_Smed_v4PMID:29674431
pharynxSMED30001828dynein assembly factor 3, axonemalSMESG000017259.1 dd_Smed_v4_6686_0_1dd_Smed_v4PMID:29674431
pharynxSMED30019261SMED30019261SMESG000022691.1 SMESG000022690.1 dd_Smed_v4_2130_0_1dd_Smed_v4PMID:29674431
pharynxSMED30017731ADP-ribosylation factor-like protein 3SMESG000074427.1 SMESG000058739.1 SMESG000012243.1 dd_Smed_v4_3162_0_1dd_Smed_v4PMID:29674431
pharynxSMED30000485SMED30000485SMESG000069311.1 dd_Smed_v4_11840_0_1dd_Smed_v4PMID:28292427
pharynxSMED30017892Semaphorin-5A-likeSMESG000045754.1 SMESG000037895.1 dd_Smed_v4_5479_0_1dd_Smed_v4PMID:29674431
pharynxSMED30001779SMED30001779SMESG000012423.1 dd_Smed_v4_5949_0_1dd_Smed_v4PMID:29674431
pharynxSMED30017021PhosphodiesteraseSMESG000044149.1 dd_Smed_v4_15950_0_1dd_Smed_v4PMID:29674431
pharynxSMED30000174Ribosomal protein S6 kinase delta-1SMESG000004118.1 SMESG000004112.1 dd_Smed_v4_9766_0_1dd_Smed_v4PMID:29674431
pharynxSMED30019431SMED30019431SMESG000032527.1 SMESG000022725.1 dd_Smed_v4_1563_0_1dd_Smed_v4PMID:29674431
pharynxSMED30018632Protein kinase domain-containing proteinSMESG000017261.1 dd_Smed_v4_2030_0_1dd_Smed_v4PMID:29674431
pharynxSMED30017934TPA_inf: neuropeptide precursor-4SMESG000036661.1 BK007037smed_ncbi_20200123PMID:20967238
pharynxSMED30013161SMED30013161SMESG000051379.1 dd_Smed_v4_2630_0_1dd_Smed_v4PMID:29674431
pharynxSMED30013161SMED30013161SMESG000051379.1 dd_Smed_v6_2630_0dd_Smed_v6PMID:29674432
pharynxSMED30000950slc16a-22SMESG000077590.1 dd_Smed_v4_6317_0_1dd_Smed_v4PMID:29674431
pharynxSMED30018224Adenylate kinaseSMESG000077377.1 SMESG000076900.1 SMESG000063429.1 SMESG000060686.1 SMESG000043019.1 SMESG000031308.1 SMESG000028811.1 SMESG000023833.1 SMESG000023573.1 SMESG000019820.1 SMESG000011532.1 SMESG000052813.1 dd_Smed_v4_1229_0_1dd_Smed_v4PMID:29674431
pharynxSMED30014459bak-2SMESG000008222.1 dd_Smed_v4_1767_0_1dd_Smed_v4PMID:29674431
pharynxSMED30016654Intraflagellar transport protein 140SMESG000001316.1 dd_Smed_v4_11300_0_1dd_Smed_v4PMID:29674431
pharynxSMED30018369Phosphatidylinositol 3,4,5-trisphosphate 3-phosphatase and dual-specificity protein phosphatase PTENSMESG000072902.1 AY066355smed_ncbi_20200123PMID:19048075
pharynxSMED30015588SMED30015588SMESG000009089.1 dd_Smed_v4_5692_0_1dd_Smed_v4PMID:29674431
pharynxSMED30015588SMED30015588SMESG000009089.1 dd_Smed_v6_5692_0dd_Smed_v6PMID:29674432
pharynxSMED30017702SMED30017702SMESG000077437.1 dd_Smed_v4_7346_0_1dd_Smed_v4PMID:29674431
pharynxSMED30009623SMED30009623SMESG000047804.1 SMESG000038532.1 SMESG000038520.1 SMESG000036112.1 SMESG000036060.1 dd_Smed_v4_4251_0_1dd_Smed_v4PMID:29674431
pharynxSMED30024215intraflagellar transport protein 81 homologSMESG000026141.1 dd_Smed_v4_8803_0_1dd_Smed_v4PMID:29674431
pharynxSMED30031485Lipoxygenase homology domain-containing protein 1SMESG000001054.1 dd_Smed_v4_10315_0_1dd_Smed_v4PMID:29674431
pharynxSMED30034247SMED30034247SMESG000005178.1 dd_Smed_v4_10371_0_1dd_Smed_v4PMID:29674431
pharynxSMED30014135ankyrin repeat and MYND domain-containing protein 1-likeSMESG000039917.1 dd_Smed_v4_12515_0_1dd_Smed_v4PMID:29674431
pharynxSMED30017846Serpin family proteinSMESG000032448.1 SMESG000032440.1 SMESG000032430.1 dd_Smed_v4_1741_0_1dd_Smed_v4PMID:29674431
pharynxSMED30010853slc25a-21SMESG000073400.1 dd_Smed_v4_13134_0_1dd_Smed_v4PMID:29674431
pharynxSMED30018203Oxysterol-binding proteinSMESG000016876.1 dd_Smed_v4_12759_0_1dd_Smed_v4PMID:29674431
pharynxSMED30008091Serine/threonine-protein kinase PLKSMESG000012131.1 SMESG000012127.1 Contig809GPL15192PMID:23079596
pharynxSMED30008091Serine/threonine-protein kinase PLKSMESG000027686.1 Contig2364GPL15192PMID:23079596
pharynxSMED30008091Serine/threonine-protein kinase PLKSMESG000012131.1 SMESG000012127.1 Contig2364GPL15192PMID:23079596
pharynxSMED30008091Serine/threonine-protein kinase PLKSMESG000012127.1 dd_Smed_v4_1620_0_1dd_Smed_v4PMID:29674431
pharynxSMED30009210Protein kinase domain-containing proteinSMESG000039711.1 dd_Smed_v4_13767_0_1dd_Smed_v4PMID:29674431
pharynxSMED30007858netrin receptor-like proteinSMESG000042475.1 DQ086493smed_ncbi_20200123PMID:16033796
pharynxSMED30001665Secreted peptide prohormone-13SMESG000009971.1 BK007029smed_ncbi_20200123PMID:20967238
pharynxSMED30010632E3 ubiquitin-protein ligase RGLG4SMESG000076482.1 SMESG000076409.1 SMESG000076405.1 SMESG000076390.1 SMESG000076375.1 SMESG000076364.1 SMESG000076223.1 SMESG000040665.1 SMESG000019753.1 dd_Smed_v4_1097_0_1dd_Smed_v4PMID:29674431
pharynxSMED30009357ubiquilin-1SMESG000045386.1 Contig2009GPL15192PMID:23079596
pharynxSMED30013095DDE_Tnp_1_7 domain-containing proteinSMESG000080622.1 SMESG000068757.1 SMESG000055125.1 SMESG000038294.1 SMESG000032747.1 SMESG000023322.1 dd_Smed_v4_3830_0_1dd_Smed_v4PMID:29674431
pharynxSMED30012881BLUF domain-containing proteinSMESG000015580.1 dd_Smed_v4_11000_0_1dd_Smed_v4PMID:29674431
pharynxSMED30005772vault protein inter alpha trypsin-1SMESG000053671.1 SMESG000053669.1 SMESG000053667.1 SMESG000053664.1 SMESG000053657.1 SMESG000053638.1 dd_Smed_v4_1027_0_1dd_Smed_v4PMID:29674431
pharynxSMED30005772vault protein inter alpha trypsin-1SMESG000053671.1 SMESG000053669.1 SMESG000053664.1 SMESG000053657.1 SMESG000053638.1 SMESG000053667.1 dd_Smed_v6_1027_0dd_Smed_v6PMID:29674432
pharynxSMED30010487Serine/threonine kinaseSMESG000054195.1 SMESG000035615.1 dd_Smed_v4_11271_0_1dd_Smed_v4PMID:29674431
pharynxSMED30000014slc20a-1SMESG000012546.1 dd_Smed_v4_1270_0_1dd_Smed_v4PMID:29674431
pharynxSMED30008195Non-specific serine/threonine protein kinaseSMESG000022413.1 dd_Smed_v4_10848_0_1dd_Smed_v4PMID:29674431
pharynxSMED30003887c-Myc-binding proteinSMESG000001466.1 dd_Smed_v4_891_0_1dd_Smed_v4PMID:29674431
pharynxSMED30011055Evi/WlsSMESG000068488.1 FJ463748smed_ncbi_20200123PMID:19211673
pharynxSMED30011055Evi/WlsSMESG000068488.1 FJ463748.1smed_ncbi_20200123PMID:19211673
pharynxSMED30007867OtoferlinSMESG000010400.1 dd_Smed_v4_14162_0_1dd_Smed_v4PMID:29674431
pharynxSMED30007867OtoferlinSMESG000010400.1 dd_Smed_v4_13850_0_1dd_Smed_v4PMID:29674431
pharynxSMED30000977PhosphomannomutaseSMESG000079671.1 SMESG000079384.1 dd_Smed_v4_1964_0_1dd_Smed_v4PMID:29674431
pharynxSMED30002182Neuropeptide Y prohormone-11SMESG000064810.1 BK007021smed_ncbi_20200123PMID:20967238
pharynxSMED30014094Kinesin-like proteinSMESG000016386.1 dd_Smed_v4_11012_0_1dd_Smed_v4PMID:29674431
pharynxSMED30009121Galectin domain-containing proteinSMESG000022399.1 dd_Smed_v4_10749_0_1dd_Smed_v4PMID:29674431
pharynxSMED30015821Neuropeptide-22SMESG000043852.1 BK007038smed_ncbi_20200123PMID:20967238
pharynxSMED30015821Neuropeptide-22SMESG000043852.1 BK007038smed_ncbi_20200123PMID:20967238
pharynxSMED30011238Kinesin-like proteinSMESG000035453.1 dd_Smed_v4_13424_0_1dd_Smed_v4PMID:29674431
pharynxSMED30011238Kinesin-like proteinSMESG000035453.1 dd_Smed_v4_10765_0_1dd_Smed_v4PMID:29674431
pharynxSMED30019722secreted frizzled related protein 3SMESG000058717.1 HM751832.1smed_ncbi_20200123PMID:20707997
pharynxSMED30019722secreted frizzled related protein 3SMESG000058717.1 HM751832.1smed_ncbi_20200123PMID:18063757
pharynxSMED30012631Phospholipid-transporting ATPaseSMESG000011472.1 dd_Smed_v4_10737_0_1dd_Smed_v4PMID:29674431
pharynxSMED30002394Dehydrogenase/reductase SDR family member 7BSMESG000047014.1 dd_Smed_v4_3512_0_1dd_Smed_v4PMID:29674431
pharynxSMED30015069ANK_REP_REGION domain-containing proteinSMESG000063648.1 HQ141793.1smed_ncbi_20200123PMID:21282632
pharynxSMED30015069ANK_REP_REGION domain-containing proteinSMESG000063648.1 dd_Smed_v4_10764_0_1dd_Smed_v4PMID:29674431
pharynxSMED30009115Polypyrimidine tract-binding protein 1SMESG000033951.1 dd_Smed_v4_14748_0_1dd_Smed_v4PMID:29674431
pharynxSMED30012677Coiled-coil domain-containing protein 51SMESG000058452.1 Contig1190newmark_estsPMID:23079596
pharynxSMED30012677Coiled-coil domain-containing protein 51SMESG000058452.1 Contig1190uc_Smed_v2PMID:23079596
pharynxSMED30012677Coiled-coil domain-containing protein 51SMESG000057519.1 Contig1190newmark_estsPMID:23079596
pharynxSMED30012677Coiled-coil domain-containing protein 51SMESG000057519.1 Contig1190uc_Smed_v2PMID:23079596
pharynxSMED30016479SMED30016479SMESG000037733.1 dd_Smed_v4_12359_0_1dd_Smed_v4PMID:29674431
pharynxSMED30016189SMED30016189SMESG000046852.1 dd_Smed_v4_13109_0_1dd_Smed_v4PMID:29674431
pharynxSMED30018221Epithelial cell transforming 2 likeSMESG000074748.1 dd_Smed_v4_14243_0_1dd_Smed_v4PMID:29674431
pharynxSMED30017206Band 4.1 protein 2SMESG000062476.1 dd_Smed_v4_2032_0_1dd_Smed_v4PMID:29674431
pharynxSMED30017206Band 4.1 protein 2SMESG000062476.1 dd_Smed_v6_2032_0dd_Smed_v6PMID:29674432
pharynxSMED30019327EF-hand domain-containing proteinSMESG000073512.1 SMESG000073508.1 dd_Smed_v4_14506_0_1dd_Smed_v4PMID:29674431
pharynxSMED30013319Long-chain-fatty-acid--CoA ligase ACSBG2SMESG000027204.1 dd_Smed_v4_1026_0_1dd_Smed_v4PMID:29674431
pharynxSMED30001043SMED30001043SMESG000036225.1 dd_Smed_v4_372_0_1dd_Smed_v4PMID:29674431
pharynxSMED30001043SMED30001043SMESG000036225.1 dd_Smed_v6_372_0dd_Smed_v6PMID:29674432
pharynxSMED30001666slc18a-1SMESG000041557.1 SMESG000041534.1 dd_Smed_v4_11917_0_1dd_Smed_v4PMID:29674431
pharynxSMED30011335Dynein heavy chain 10, axonemalSMESG000051829.1 dd_Smed_v4_12797_0_1dd_Smed_v4PMID:29674431
pharynxSMED30011335Dynein heavy chain 10, axonemalSMESG000051829.1 dd_Smed_v4_5169_0_1dd_Smed_v4PMID:29674431
pharynxSMED30002257SMED30002257SMESG000010550.1 dd_Smed_v4_2590_0_1dd_Smed_v4PMID:29674431
pharynxSMED30012985Protein FAM188BSMESG000064698.1 dd_Smed_v4_13105_0_1dd_Smed_v4PMID:29674431
pharynxSMED30000771SMED30000771SMESG000059918.1 SMESG000052306.1 SMESG000022407.1 dd_Smed_v4_474_0_1dd_Smed_v4PMID:29674431
pharynxSMED30000771SMED30000771SMESG000059918.1 SMESG000052306.1 SMESG000022407.1 dd_Smed_v6_1996_0dd_Smed_v6PMID:29674432
pharynxSMED30000771SMED30000771SMESG000059918.1 SMESG000052306.1 SMESG000022407.1 dd_Smed_v6_474_0dd_Smed_v6PMID:29674432
pharynxSMED30000771SMED30000771SMESG000059918.1 SMESG000052306.1 SMESG000022407.1 dd_Smed_v4_1996_0_1dd_Smed_v4PMID:29674431
pharynxSMED30002761Transcription factor AP-4SMESG000062271.1 DN305431ncbi_smed_estsPMID:24173799
pharynxSMED30000946Calpain-BSMESG000067761.1 dd_Smed_v4_4020_0_1dd_Smed_v4PMID:29674431
pharynxSMED30001380Zinc finger FYVE domain-containing proteinSMESG000014968.1 dd_Smed_v4_4344_0_1dd_Smed_v4PMID:29674431
pharynxSMED30008147SMED30008147SMESG000053405.1 Contig1766newmark_estsPMID:23079596
pharynxSMED30008147SMED30008147SMESG000053405.1 Contig1766uc_Smed_v2PMID:23079596
pharynxSMED30008147SMED30008147SMESG000046314.1 SMESG000028362.1 Contig1766newmark_estsPMID:23079596
pharynxSMED30008147SMED30008147SMESG000046314.1 SMESG000028362.1 Contig1766uc_Smed_v2PMID:23079596
pharynxSMED30017196noggin 1SMESG000032158.1 EF633690.1smed_ncbi_20200123PMID:21295483
pharynxSMED30017196noggin 1SMESG000032158.1 EF633690.1smed_ncbi_20200123PMID:17905225
pharynxSMED30017196noggin 1SMESG000032158.1 EF633690.1smed_ncbi_20200123PMID:19174194
pharynxSMED30018450Neuropeptide Y prohormone-7SMESG000002722.1 BK007020smed_ncbi_20200123PMID:20967238
pharynxSMED30019555TIMELESS-interacting proteinSMESG000025543.1 dd_Smed_v4_12580_0_1dd_Smed_v4PMID:29674431
pharynxSMED30015748SMED30015748SMESG000036160.1 dd_Smed_v4_14291_0_1dd_Smed_v4PMID:29674431
pharynxSMED30027474Succinate dehydrogenase cytochrome b560 subunitSMESG000017174.1 dd_Smed_v4_748_0_1dd_Smed_v4PMID:29674431
pharynxSMED30021186Glyoxylate reductase/hydroxypyruvate reductaseSMESG000004374.1 dd_Smed_v4_3230_0_1dd_Smed_v4PMID:29674431
pharynxSMED30026601Dynein heavy chain axonemalSMESG000033128.1 dd_Smed_v4_7062_0_1dd_Smed_v4PMID:29674431
pharynxSMED30029097Neuropeptide-1SMESG000024498.1 BK007036smed_ncbi_20200123PMID:20967238
pharynxSMED30029097Neuropeptide-1SMESG000024498.1 dd_Smed_v4_2575_0_1dd_Smed_v4PMID:29674431
pharynxSMED30029379Gamma-aminobutyric acid receptor-associated protein-like 2SMESG000033716.1 dd_Smed_v4_1441_0_1dd_Smed_v4PMID:29674431
pharynxSMED30023043SMED30023043SMESG000019067.1 dd_Smed_v4_13671_0_1dd_Smed_v4PMID:29674431
pharynxSMED30025535TNF receptor associated factor-2SMESG000049688.1 SMESG000049683.1 SMESG000049676.1 SMESG000049663.1 SMESG000049649.1 SMESG000049621.1 SMESG000049614.1 SMESG000049603.1 SMESG000049567.1 SMESG000008530.1 SMESG000008521.1 dd_Smed_v4_2003_0_1dd_Smed_v4PMID:29674431
pharynxSMED30023917SMED30023917SMESG000058631.1 BK007024smed_ncbi_20200123PMID:20967238
pharynxSMED30031282cAMP-dependent protein kinase regulatory subunitSMESG000078515.1 dd_Smed_v4_13623_0_1dd_Smed_v4PMID:29674431
pharynxSMED30034202SMED30034202SMESG000077061.1 dd_Smed_v4_1917_0_1dd_Smed_v4PMID:29674431
pharynxSMED30023050Aldehyde dehydrogenase, mitochondrialSMESG000016195.1 dd_Smed_v4_1339_0_1dd_Smed_v4PMID:29674431
pharynxSMED30022030EGR-like protein 1SMESG000000960.1 dd_Smed_v4_7731_0_1dd_Smed_v4PMID:29674431
pharynxSMED30022030EGR-like protein 1SMESG000000959.1 dd_Smed_v4_12410_0_1dd_Smed_v4PMID:29674431
pharynxSMED30022020Phospholipid scramblaseSMESG000016647.1 dd_Smed_v4_13534_0_1dd_Smed_v4PMID:29674431
pharynxSMED30027376SMED30027376SMESG000007017.1 dd_Smed_v4_7377_0_1dd_Smed_v4PMID:29674431
pharynxSMED30027376SMED30027376SMESG000007018.1 SMESG000007017.1 dd_Smed_v6_1969_0dd_Smed_v6PMID:29674432
pharynxSMED30027376SMED30027376SMESG000007018.1 SMESG000007017.1 dd_Smed_v4_1969_0_1dd_Smed_v4PMID:29674431
pharynxSMED30027392SMED30027392SMESG000074013.1 dd_Smed_v4_5067_0_1dd_Smed_v4PMID:29674431
pharynxSMED30031582InnexinSMESG000081749.1 dd_Smed_v4_10287_0_1dd_Smed_v4PMID:29674431
pharynxSMED30031582InnexinSMESG000081749.1 dd_Smed_v4_11302_0_1dd_Smed_v4PMID:29674431
pharynxSMED30031582InnexinSMESG000081749.1 dd_Smed_v6_10287_0dd_Smed_v6PMID:29674432
pharynxSMED30031582InnexinSMESG000081749.1 dd_Smed_v6_11302_0dd_Smed_v6PMID:29674432
pharynxSMED30026311SMED30026311SMESG000030467.1 dd_Smed_v4_15263_0_1dd_Smed_v4PMID:29674431
pharynxSMED30025883Forkhead associated phosphopeptide binding domain 1SMESG000071072.1 dd_Smed_v4_14350_0_1dd_Smed_v4PMID:29674431
pharynxSMED30021887Dual specificity protein phosphatase CDC14ASMESG000057887.1 dd_Smed_v4_7798_0_1dd_Smed_v4PMID:29674431
pharynxSMED30028737Tubby-like proteinSMESG000009644.1 dd_Smed_v4_10462_0_1dd_Smed_v4PMID:29674431
pharynxSMED30034523SMED30034523SMESG000009543.1 dd_Smed_v4_12682_0_1dd_Smed_v4PMID:29674431
pharynxSMED30033333SMED30033333SMESG000004952.1 Contig516newmark_estsPMID:23079596
pharynxSMED30024390Synaptotagmin like 4SMESG000042371.1 dd_Smed_v4_7945_0_1dd_Smed_v4PMID:29674431
pharynxSMED30021042Phosphoenolpyruvate synthaseSMESG000026514.1 dd_Smed_v4_2604_0_1dd_Smed_v4PMID:29674431
pharynxSMED30021807SMED30021807SMESG000030582.1 dd_Smed_v4_1124_0_1dd_Smed_v4PMID:29674431
pharynxSMED30025898SMED30025898SMESG000051187.1 dd_Smed_v4_16909_0_1dd_Smed_v4PMID:29674431
pharynxSMED30023196Glycosyl hydrolase family 25SMESG000049688.1 SMESG000049683.1 SMESG000049676.1 SMESG000049663.1 SMESG000049649.1 SMESG000049621.1 SMESG000049614.1 SMESG000049603.1 SMESG000049567.1 SMESG000008530.1 SMESG000008521.1 dd_Smed_v4_2003_0_1dd_Smed_v4PMID:29674431
pharynxSMED30030128SMED30030128SMESG000017016.1 dd_Smed_v4_933_0_1dd_Smed_v4PMID:29674431
pharynxSMED30032354EOG090X01A3SMESG000068156.1 SMESG000064685.1 SMESG000043474.1 SMESG000010609.1 SMESG000076470.1 SMESG000073857.1 SMESG000062429.1 SMESG000058575.1 SMESG000053533.1 SMESG000020635.1 SMESG000015751.1 SMESG000005260.1 Contig246newmark_estsPMID:23079596
pharynxSMED30032354EOG090X01A3SMESG000000175.1 Contig246newmark_estsPMID:23079596
pharynxSMED30025497secreted frizzled related protein 2SMESG000050379.1 ADO51625.1smed_ncbi_20200123PMID:20707997
pharynxSMED30022163Tubulin polyglutamylase TTLL7SMESG000055128.1 dd_Smed_v4_13600_0_1dd_Smed_v4PMID:29674431
pharynxSMED30021297Disks large homolog 1SMESG000020502.1 dd_Smed_v4_3493_1_1dd_Smed_v4PMID:29674431
pharynxSMED30034635Tubulin tyrosine ligase-like family, member 7SMESG000055128.1 dd_Smed_v4_13600_0_1dd_Smed_v4PMID:29674431
pharynxSMED30022312COesterase domain-containing proteinSMESG000064723.1 dd_Smed_v4_18958_0_1dd_Smed_v4PMID:29674431
pharynxSMED30032272FMN_red domain-containing proteinSMESG000023871.1 dd_Smed_v4_1834_0_1dd_Smed_v4PMID:29674431
pharynxSMED30034675Sphingomyelin synthase-related protein 1SMESG000049879.1 SMESG000003119.1 dd_Smed_v4_11976_0_1dd_Smed_v4PMID:29674431
pharynxSMED30021122Tyrosine--tRNA ligaseSMESG000055897.1 SMESG000019862.1 dd_Smed_v4_1795_0_1dd_Smed_v4PMID:29674431
pharynxSMED30023471Myosin, light chain kinase aSMESG000081274.1 dd_Smed_v4_3482_0_1dd_Smed_v4PMID:29674431
pharynxSMED30022344FERM domain containing-1SMESG000070273.1 dd_Smed_v4_1131_0_1dd_Smed_v4PMID:29674431
pharynxSMED30022344FERM domain containing-1SMESG000070273.1 dd_Smed_v6_1131_0dd_Smed_v6PMID:29674432
pharynxSMED30024248SMED30024248SMESG000055844.1 dd_Smed_v4_6835_0_1dd_Smed_v4PMID:29674431
pharynxSMED30023112SMED30023112SMESG000047804.1 SMESG000038532.1 SMESG000038520.1 SMESG000036112.1 SMESG000036060.1 dd_Smed_v4_4251_0_1dd_Smed_v4PMID:29674431
pharynxSMED30023486Intraflagellar transport 74SMESG000074086.1 dd_Smed_v4_12702_0_1dd_Smed_v4PMID:29674431
pharynxSMED30005164coe proteinSMESG000069088.1 KF487109smed_ncbi_20200123PMID:24173799
pharynxSMED30009105Neuropeptide 8SMESG000069019.1 GU295189smed_ncbi_20200123PMID:20967238
pharynxSMED30003118SMED30003118SMESG000006534.1 dd_Smed_v4_4662_0_1dd_Smed_v4PMID:29674431
pharynxSMED30002656Unconventional myosin-XVSMESG000061386.1 dd_Smed_v4_7193_0_1dd_Smed_v4PMID:29674431
pharynxSMED30002656Unconventional myosin-XVSMESG000061386.1 dd_Smed_v6_7193_0dd_Smed_v6PMID:29674432
pharynxSMED30004590Ras-related protein Rab-27ASMESG000023446.1 dd_Smed_v4_2678_0_1dd_Smed_v4PMID:29674431
pharynxSMED30016022SMED30016022SMESG000053405.1 Contig1766newmark_estsPMID:23079596
pharynxSMED30016022SMED30016022SMESG000053405.1 Contig1766uc_Smed_v2PMID:23079596
pharynxSMED30016022SMED30016022SMESG000046314.1 SMESG000028362.1 Contig1766newmark_estsPMID:23079596
pharynxSMED30016022SMED30016022SMESG000046314.1 SMESG000028362.1 Contig1766uc_Smed_v2PMID:23079596
pharynxSMED30015768adenomatous polyposis coli-like proteinSMESG000045688.1 SMESG000005328.1 EU130785smed_ncbi_20200123PMID:18063757
pharynxSMED30015768adenomatous polyposis coli-like proteinSMESG000045688.1 SMESG000005328.1 EU130785.1smed_ncbi_20200123PMID:18063757
pharynxSMED30009218Receptor expression-enhancing proteinSMESG000036637.1 dd_Smed_v4_1995_0_1dd_Smed_v4PMID:29674431
pharynxSMED30003675adenylate kinase 7-likeSMESG000075409.1 dd_Smed_v4_5880_0_1dd_Smed_v4PMID:29674431
pharynxSMED30009712epidermal growth factor receptor 1SMESG000070834.1 HM777018smed_ncbi_20200123PMID:21458439
pharynxSMED30009712epidermal growth factor receptor 1SMESG000070834.1 HM777018smed_ncbi_20200123PMID:27122174
pharynxSMED30009712epidermal growth factor receptor 1SMESG000070834.1 HM777018.1smed_ncbi_20200123PMID:27122174
pharynxSMED30009712epidermal growth factor receptor 1SMESG000070834.1 dd_Smed_v4_8641_0_1dd_Smed_v4PMID:29674431
pharynxSMED30013386netrin 1SMESG000006806.1 dd_Smed_v4_9795_0_1dd_Smed_v4PMID:29674431
pharynxSMED30013386netrin 1SMESG000006806.1 dd_Smed_v4_9795_0_1dd_Smed_v4PMID:30962434
pharynxSMED30015974FAST kinase domain-containing protein 1, mitochondrialSMESG000064523.1 dd_Smed_v4_8917_0_1dd_Smed_v4PMID:29674431
pharynxSMED30008165Connector enhancer of kinase suppressor of ras 2SMESG000044449.1 SMESG000044448.1 dd_Smed_v4_4457_0_1dd_Smed_v4PMID:29674431
pharynxSMED30009456SMED30009456SMESG000039758.1 GU295180smed_ncbi_20200123PMID:20967238
pharynxSMED30004908L1-like cell adhesion moleculeSMESG000025433.1 dd_Smed_v4_1916_0_1dd_Smed_v4PMID:29674431
pharynxSMED30002545Myomodulin prohormone like-2SMESG000036321.1 BK007016smed_ncbi_20200123PMID:20967238
pharynxSMED30004568Receptor protein-tyrosine kinaseSMESG000005947.1 dd_Smed_v4_7012_0_1dd_Smed_v4PMID:29674431
pharynxSMED30007879SMED30007879SMESG000014356.1 dd_Smed_v4_4641_0_1dd_Smed_v4PMID:29674431
pharynxSMED30016277TNF receptor-associated factorSMESG000015087.1 dd_Smed_v4_2354_0_1dd_Smed_v4PMID:29674431
pharynxSMED30002013SMED30002013SMESG000060484.1 dd_Smed_v4_6979_0_1dd_Smed_v4PMID:29674431
pharynxSMED30005345SMED30005345SMESG000059907.1 dd_Smed_v4_125_0_1dd_Smed_v4PMID:29674431
pharynxSMED30005345SMED30005345SMESG000059907.1 dd_Smed_v6_125_0dd_Smed_v6PMID:29674432
pharynxSMED30006764Phosphatidylinositol 3-kinase regulatory subunit alphaSMESG000078199.1 dd_Smed_v4_4794_0_1dd_Smed_v4PMID:29674431
pharynxSMED30012487SMED30012487SMESG000009419.1 dd_Smed_v4_5926_0_1dd_Smed_v4PMID:29674431
pharynxSMED30018507Calcium-transporting ATPaseSMESG000038461.1 dd_Smed_v4_3170_0_1dd_Smed_v4PMID:29674431
pharynxSMED30018507Calcium-transporting ATPaseSMESG000038461.1 dd_Smed_v4_4559_0_1dd_Smed_v4PMID:29674431
pharynxSMED30018507Calcium-transporting ATPaseSMESG000038461.1 dd_Smed_v6_4559_0dd_Smed_v6PMID:29674432
pharynxSMED30004187SMED30004187SMESG000043423.1 Contig1792newmark_estsPMID:23079596
pharynxSMED30004187SMED30004187SMESG000043423.1 Contig1792uc_Smed_v2PMID:23079596
pharynxSMED30004187SMED30004187SMESG000072544.1 Contig1792newmark_estsPMID:23079596
pharynxSMED30004187SMED30004187SMESG000072544.1 Contig1792uc_Smed_v2PMID:23079596
pharynxSMED30001081NudC nuclear distribution proteinSMESG000036795.1 DN303982.1ncbi_smed_estsPMID:22411224
pharynxSMED30012787MANSC domain-containing proteinSMESG000015184.1 dd_Smed_v4_5586_0_1dd_Smed_v4PMID:29674431
pharynxSMED30001195da proteinSMESG000032044.1 KF487093smed_ncbi_20200123PMID:24173799
pharynxSMED30010649max-like protein xSMESG000025391.1 HO006087ncbi_smed_estsPMID:24173799
pharynxSMED30019678SMED30019678SMESG000040636.1 GU295176smed_ncbi_20200123PMID:20967238
pharynxSMED30015161Vacuolar protein sorting-associated protein 45SMESG000053405.1 Contig1766GPL15192PMID:23079596
pharynxSMED30015161Vacuolar protein sorting-associated protein 45SMESG000046314.1 SMESG000028362.1 Contig1766GPL15192PMID:23079596
pharynxSMED30013845Phosphoglucomutase-1SMESG000046578.1 dd_Smed_v4_3503_0_1dd_Smed_v4PMID:29674431
pharynxSMED30008321SMED30008321SMESG000068172.1 Contig3306newmark_estsPMID:23079596
pharynxSMED30008321SMED30008321SMESG000068172.1 Contig3306uc_Smed_v2PMID:23079596
pharynxSMED30008321SMED30008321SMESG000025870.1 Contig3306newmark_estsPMID:23079596
pharynxSMED30008321SMED30008321SMESG000025870.1 Contig3306uc_Smed_v2PMID:23079596
pharynxSMED30013227WD repeat-containing proteinSMESG000042025.1 dd_Smed_v4_9187_0_1dd_Smed_v4PMID:29674431
pharynxSMED30019538SMED30019538SMESG000078196.1 dd_Smed_v4_3823_0_1dd_Smed_v4PMID:29674431
pharynxSMED30008112Mitogen-activated protein kinaseSMESG000081061.1 dd_Smed_v4_6769_0_1dd_Smed_v4PMID:29674431
pharynxSMED30016446Root phototropism protein 2SMESG000067415.1 dd_Smed_v4_8081_0_1dd_Smed_v4PMID:29674431
pharynxSMED30013955WD repeat-containing protein 35SMESG000066519.1 dd_Smed_v4_9653_0_1dd_Smed_v4PMID:29674431
pharynxSMED30006846Bardet-Biedl syndrome 9SMESG000064061.1 EE673351.1ncbi_smed_estsPMID:19852954
pharynxSMED30000196Vang-2SMESG000053210.1 HQ141794.1smed_ncbi_20200123PMID:21282632
pharynxSMED30002469TPA_inf: pedal peptide prohormone like-1SMESG000035027.1 BK007041smed_ncbi_20200123PMID:20967238
pharynxSMED30015650FGFR1 oncogene partnerSMESG000006505.1 dd_Smed_v4_5371_0_1dd_Smed_v4PMID:29674431
pharynxSMED30010941dnaJ homolog subfamily B member 13SMESG000076708.1 dd_Smed_v4_4820_0_1dd_Smed_v4PMID:29674431
pharynxSMED30017888TLC domain-containing proteinSMESG000068531.1 dd_Smed_v4_9135_0_1dd_Smed_v4PMID:29674431
pharynxSMED30009277Polyamine-modulated factor 1-binding protein 1SMESG000048877.1 dd_Smed_v4_3146_0_1dd_Smed_v4PMID:29674431
pharynxSMED30009277Polyamine-modulated factor 1-binding protein 1SMESG000048877.1 dd_Smed_v6_3146_0dd_Smed_v6PMID:29674432
pharynxSMED30007555GCR098SMESG000016695.1 Contig4585newmark_estsPMID:23079596
pharynxSMED30007555GCR098SMESG000016695.1 Contig4585uc_Smed_v2PMID:23079596
pharynxSMED30007555GCR098SMESG000033655.1 Contig4585newmark_estsPMID:23079596
pharynxSMED30000837Histone H4SMESG000048698.1 SMESG000004193.1 dd_Smed_v4_16283_0_1dd_Smed_v4PMID:29674431
pharynxSMED30001237Tubulin polymerization-promoting protein family member 3SMESG000002261.1 dd_Smed_v4_650_0_1dd_Smed_v4PMID:29674431
pharynxSMED30001237Tubulin polymerization-promoting protein family member 3SMESG000002261.1 dd_Smed_v6_650_0dd_Smed_v6PMID:29674432
pharynxSMED30001031TRAF3-interacting protein 1SMESG000006345.1 dd_Smed_v4_10562_0_1dd_Smed_v4PMID:29674431
pharynxSMED30015125SMED30015125SMESG000061766.1 dd_Smed_v4_12632_0_1dd_Smed_v4PMID:29674431
pharynxSMED30013054Protein kinase domain-containing proteinSMESG000020466.1 dd_Smed_v4_11366_0_1dd_Smed_v4PMID:29674431
pharynxSMED30010991SMED30010991SMESG000014346.1 dd_Smed_v4_2231_0_1dd_Smed_v4PMID:29674431
pharynxSMED30010991SMED30010991SMESG000014346.1 dd_Smed_v4_6441_0_1dd_Smed_v4PMID:29674431
pharynxSMED30013390Nesprin-1SMESG000069851.1 dd_Smed_v4_10646_0_1dd_Smed_v4PMID:29674431
pharynxSMED30013390Nesprin-1SMESG000069851.1 dd_Smed_v6_10646_0dd_Smed_v6PMID:29674432
pharynxSMED30011515Secreted peptide prohormone-13SMESG000009971.1 BK007029smed_ncbi_20200123PMID:20967238
pharynxSMED30017231NEPH-3SMESG000022777.1 dd_Smed_v4_11280_0_1dd_Smed_v4PMID:29674431
pharynxSMED30013241SMED30013241SMESG000007775.1 dd_Smed_v4_137_0_1dd_Smed_v4PMID:29674431
pharynxSMED30013241SMED30013241SMESG000007775.1 dd_Smed_v6_137_0dd_Smed_v6PMID:29674432
pharynxSMED30009144CCDC66 domain-containing proteinSMESG000019367.1 dd_Smed_v4_11800_0_1dd_Smed_v4PMID:29674431
pharynxSMED30015660SMED30015660SMESG000018225.1 SMESG000017035.1 dd_Smed_v4_1426_0_1dd_Smed_v4PMID:29674431
pharynxSMED30018972ANK_REP_REGION domain-containing proteinSMESG000022931.1 dd_Smed_v4_11187_0_1dd_Smed_v4PMID:29674431
pharynxSMED30018972ANK_REP_REGION domain-containing proteinSMESG000022931.1 dd_Smed_v6_11187_0dd_Smed_v6PMID:29674432
pharynxSMED30015943SMED30015943SMESG000014346.1 dd_Smed_v4_2231_0_1dd_Smed_v4PMID:29674431
pharynxSMED30017214SMED30017214SMESG000068350.1 dd_Smed_v4_18752_0_1dd_Smed_v4PMID:29674431
pharynxSMED30007500coiled-coil domain-containing protein 170SMESG000074429.1 dd_Smed_v4_10140_0_1dd_Smed_v4PMID:29674431
pharynxSMED30009090Mushroom body large-type Kenyon-related proteinSMESG000070784.1 dd_Smed_v4_17498_0_1dd_Smed_v4PMID:29674431
pharynxSMED30015183Leucine-rich repeat-containing protein 9SMESG000021671.1 dd_Smed_v4_14851_0_1dd_Smed_v4PMID:29674431
pharynxSMED30010461Dynamin-binding proteinSMESG000001434.1 dd_Smed_v4_16150_0_1dd_Smed_v4PMID:29674431
pharynxSMED30005718Guanine nucleotide-binding protein G(I) subunit alphaSMESG000026774.1 HQ121519smed_ncbi_20200123PMID:23318635
pharynxSMED30005718Guanine nucleotide-binding protein G(I) subunit alphaSMESG000026774.1 HQ121519smed_ncbi_20200123PMID:21806978
pharynxSMED30005718Guanine nucleotide-binding protein G(I) subunit alphaSMESG000026774.1 HQ121519smed_ncbi_20200123PMID:24523458
pharynxSMED30005718Guanine nucleotide-binding protein G(I) subunit alphaSMESG000026774.1 Gpassmed_ncbi_20200123PMID:22125640
pharynxSMED30005718Guanine nucleotide-binding protein G(I) subunit alphaSMESG000026774.1 Gpassmed_ncbi_20200123PMID:24992682
pharynxSMED30005718Guanine nucleotide-binding protein G(I) subunit alphaSMESG000026774.1 HQ121519.1smed_ncbi_20200123PMID:21282632
pharynxSMED30013396perilipin-2 isoform X1SMESG000075481.1 dd_Smed_v4_154_0_1dd_Smed_v4PMID:29674431
pharynxSMED30013396perilipin-2 isoform X1SMESG000075481.1 dd_Smed_v6_154_0dd_Smed_v6PMID:29674432
pharynxSMED30001197SMED30001197SMESG000004996.1 dd_Smed_v4_4124_0_1dd_Smed_v4PMID:29674431
pharynxSMED30026578Peptidoglycan-recognition proteinSMESG000068025.1 dd_Smed_v4_1523_0_1dd_Smed_v4PMID:29674431
pharynxSMED30026237Coiled-coil and C2 domain containing 2ASMESG000048372.1 dd_Smed_v4_11189_0_1dd_Smed_v4PMID:29674431
pharynxSMED30026449Kinase-like domain-containing proteinSMESG000074921.1 SMESG000074915.1 dd_Smed_v4_1634_0_1dd_Smed_v4PMID:29674431
pharynxSMED30022468secreted frizzled-related protein 1SMESG000075831.1 SMESG000029446.1 EU130790smed_ncbi_20200123PMID:18063757
pharynxSMED30022468secreted frizzled-related protein 1SMESG000075831.1 SMESG000029446.1 EU296635smed_ncbi_20200123PMID:18063755
pharynxSMED30022468secreted frizzled-related protein 1SMESG000075831.1 SMESG000029446.1 EU296635smed_ncbi_20200123PMID:20707997
pharynxSMED30022468secreted frizzled-related protein 1SMESG000075831.1 SMESG000029446.1 EU296635smed_ncbi_20200123PMID:23318635
pharynxSMED30022468secreted frizzled-related protein 1SMESG000075831.1 SMESG000029446.1 EU296635smed_ncbi_20200123PMID:19805089
pharynxSMED30022468secreted frizzled-related protein 1SMESG000075831.1 SMESG000029446.1 EU296635smed_ncbi_20200123PMID:21806978
pharynxSMED30022468secreted frizzled-related protein 1SMESG000075831.1 SMESG000029446.1 EU296635smed_ncbi_20200123PMID:18063757
pharynxSMED30022468secreted frizzled-related protein 1SMESG000075831.1 SMESG000029446.1 EU296635smed_ncbi_20200123PMID:24704339
pharynxSMED30022468secreted frizzled-related protein 1SMESG000075831.1 SMESG000029446.1 EU296635smed_ncbi_20200123PMID:25558068
pharynxSMED30022468secreted frizzled-related protein 1SMESG000075831.1 SMESG000029446.1 ABY85212.1smed_ncbi_20200123PMID:20707997
pharynxSMED30022468secreted frizzled-related protein 1SMESG000075831.1 SMESG000029446.1 ABY85212.1smed_ncbi_20200123PMID:19805089
pharynxSMED30022468secreted frizzled-related protein 1SMESG000075831.1 SMESG000029446.1 EU130790.1smed_ncbi_20200123PMID:19805089
pharynxSMED30028237PMP-22/EMP/MP20/Claudin tight junctionSMESG000028931.1 dd_Smed_v4_2132_0_1dd_Smed_v4PMID:29674431
pharynxSMED30033015SMED30033015SMESG000049533.1 dd_Smed_v4_2058_0_1dd_Smed_v4PMID:29674431
pharynxSMED30026061SMED30026061SMESG000076482.1 SMESG000076409.1 SMESG000076405.1 SMESG000076390.1 SMESG000076375.1 SMESG000076364.1 SMESG000076223.1 SMESG000040665.1 SMESG000019753.1 dd_Smed_v4_1097_0_1dd_Smed_v4PMID:29674431
pharynxSMED30025004Magnesium-dependent phosphatase 1SMESG000025378.1 dd_Smed_v4_1958_0_1dd_Smed_v4PMID:29674431
pharynxSMED30026337AnkyrinSMESG000000606.1 dd_Smed_v4_2072_0_1dd_Smed_v4PMID:29674431
pharynxSMED30025664TSNAXIP1_N domain-containing proteinSMESG000060720.1 dd_Smed_v4_13434_0_1dd_Smed_v4PMID:29674431
pharynxSMED30020508SMED30020508SMESG000021243.1 dd_Smed_v4_12661_0_1dd_Smed_v4PMID:29674431
pharynxSMED30021590Spectrin beta chainSMESG000081696.1 dd_Smed_v4_1122_0_1dd_Smed_v4PMID:29674431
pharynxSMED30028787TNF receptor-associated factorSMESG000015087.1 dd_Smed_v4_2354_0_1dd_Smed_v4PMID:29674431
pharynxSMED30027186SMED30027186SMESG000022949.1 dd_Smed_v4_14572_0_1dd_Smed_v4PMID:29674431
pharynxSMED30022848Synaptotagmin VIaSMESG000043595.1 dd_Smed_v4_12716_0_1dd_Smed_v4PMID:29674431
pharynxSMED30021505Serpin B6SMESG000032448.1 SMESG000032440.1 SMESG000032430.1 dd_Smed_v4_1741_0_1dd_Smed_v4PMID:29674431
pharynxSMED30021317sim proteinSMESG000031846.1 KF487121smed_ncbi_20200123PMID:24173799
pharynxSMED30026702SMED30026702SMESG000038479.1 SMESG000038478.1 dd_Smed_v4_1931_0_1dd_Smed_v4PMID:29674431
pharynxSMED30022362Synaptotagmin-2SMESG000011583.1 dd_Smed_v4_12772_0_1dd_Smed_v4PMID:29674431
pharynxSMED30025310SMED30025310SMESG000050440.1 dd_Smed_v4_1552_1_1dd_Smed_v4PMID:29674431
pharynxSMED30025310SMED30025310SMESG000050440.1 dd_Smed_v6_1552_1dd_Smed_v6PMID:29674432
pharynxSMED30021105Tubulin alpha chainSMESG000005506.1 SMESG000005505.1 SMESG000005493.1 SMESG000005489.1 SMESG000005487.1 dd_Smed_v4_38_0_1dd_Smed_v4PMID:29674431
pharynxSMED30021105Tubulin alpha chainSMESG000005506.1 SMESG000005505.1 SMESG000005493.1 SMESG000005489.1 SMESG000005487.1 dd_Smed_v6_38_0dd_Smed_v6PMID:29674432
pharynxSMED30031005A disintegrin and metalloproteinase with thrombospondin motifs 2SMESG000051172.1 dd_Smed_v4_16551_0_1dd_Smed_v4PMID:29674431
pharynxSMED30021812Dolichol kinase-like ProteinSMESG000022975.1 dd_Smed_v4_7896_0_1dd_Smed_v4PMID:29674431
pharynxSMED30027940cAMP-dependent protein kinase type I-alpha regulatory subunitSMESG000078298.1 dd_Smed_v4_15589_0_1dd_Smed_v4PMID:29674431
pharynxSMED30027391SMED30027391SMESG000042398.1 dd_Smed_v4_28877_0_1dd_Smed_v4PMID:29674431
pharynxSMED30031912SMED30031912SMESG000003404.1 dd_Smed_v4_2094_0_1dd_Smed_v4PMID:29674431
pharynxSMED30034947SMED30034947SMESG000077223.1 dd_Smed_v4_7005_0_1dd_Smed_v4PMID:29674431
pharynxSMED30029489Serine/threonine-protein kinaseSMESG000041899.1 SMESG000031064.1 dd_Smed_v4_8347_0_1dd_Smed_v4PMID:29674431
pharynxSMED30029112Pol polyproteinSMESG000074961.1 dd_Smed_v4_15720_0_1dd_Smed_v4PMID:29674431
pharynxSMED30021637Adenosine monophosphate-protein transferase FICDSMESG000007402.1 dd_Smed_v4_11524_0_1dd_Smed_v4PMID:29674431
pharynxSMED30026339Phospholipase A2SMESG000048503.1 Contig51228newmark_estsPMID:27612384
pharynxSMED30026339Phospholipase A2SMESG000048503.1 Contig51228uc_Smed_v2PMID:27612384
pharynxSMED30021824centromere protein JSMESG000028453.1 dd_Smed_v4_13670_0_1dd_Smed_v4PMID:29674431
pharynxSMED30034849Kyphoscoliosis peptidaseSMESG000061907.1 dd_Smed_v4_1109_0_1dd_Smed_v4PMID:29674431
pharynxSMED30022337SJCHGC07163 proteinSMESG000034423.1 dd_Smed_v4_8079_0_1dd_Smed_v4PMID:29674431
pharynxSMED30031425Homeobox protein Hox-D12SMESG000003389.1 SMED30031425smed_20140614PMID:27034770
pharynxSMED30030526Neurogenic locus Notch proteinSMESG000035155.1 dd_Smed_v4_11097_0_1dd_Smed_v4PMID:29674431
pharynxSMED30028207RING-type domain-containing proteinSMESG000073107.1 dd_Smed_v4_8939_0_1dd_Smed_v4PMID:29674431
pharynxSMED30022055SMED30022055SMESG000039579.1 dd_Smed_v4_32066_0_1dd_Smed_v4PMID:29674431
pharynxSMED30030286Tctex1 domain containing 2SMESG000027829.1 dd_Smed_v4_7666_0_1dd_Smed_v4PMID:29674431
pharynxSMED30030891Sphingolipid delta-4 desaturaseSMESG000078629.1 dd_Smed_v4_7414_0_1dd_Smed_v4PMID:29674431
pharynxSMED30033309slc35f-3SMESG000077930.1 Contig28795newmark_estsPMID:27612384
pharynxSMED30033309slc35f-3SMESG000077930.1 Contig28795uc_Smed_v2PMID:27612384
pharynxSMED30029380Protein transport protein Sec24ASMESG000029685.1 SMESG000012934.1 dd_Smed_v4_6525_0_1dd_Smed_v4PMID:29674431
pharynxSMED30034950SMED30034950SMESG000028882.1 dd_Smed_v4_13703_0_1dd_Smed_v4PMID:29674431
pharynxSMED30020689ETS domain-containing proteinSMESG000009191.1 dd_Smed_v4_6626_0_1dd_Smed_v4PMID:29674431
pharynxSMED30029360Low density lipoprotein receptor class A cysteine richSMESG000073751.1 dd_Smed_v4_2114_0_1dd_Smed_v4PMID:29674431
pharynxSMED30026371SMED30026371SMESG000059828.1 dd_Smed_v4_2479_0_1dd_Smed_v4PMID:29674431
pharynxSMED30024121TetraspaninSMESG000023248.1 dd_Smed_v4_1808_0_1dd_Smed_v4PMID:29674431
pharynxSMED30030642Cytochrome P450 2C3SMESG000023530.1 SMESG000023528.1 dd_Smed_v4_7874_0_1dd_Smed_v4PMID:29674431
pharynxSMED30030642Cytochrome P450 2C3SMESG000023530.1 SMESG000023528.1 SMED30030642smed_20140614PMID:26457503
pharynxSMED30023527p2X purinoceptor 4SMESG000010795.1 Contig54325newmark_estsPMID:27612384
pharynxSMED30023527p2X purinoceptor 4SMESG000010795.1 Contig54325uc_Smed_v2PMID:27612384
pharynxSMED30020664Potassium voltage-gated channel subfamily A member 2SMESG000028841.1 dd_Smed_v4_7533_0_1dd_Smed_v4PMID:29674431
pharynxSMED30020238Protein chibby 1SMESG000006044.1 dd_Smed_v4_8722_0_1dd_Smed_v4PMID:29674431
pharynxSMED30023266cilia- and flagella-associated protein 43SMESG000000491.1 dd_Smed_v4_10271_0_1dd_Smed_v4PMID:29674431
pharynxSMED30016186SMED30016186SMESG000033673.1 dd_Smed_v4_1071_0_1dd_Smed_v4PMID:29674431
pharynxSMED30016186SMED30016186SMESG000033673.1 dd_Smed_v4_1071_0_1dd_Smed_v4PMID:30962434
pharynxSMED30016186SMED30016186SMESG000033673.1 dd_Smed_v6_1071_0dd_Smed_v6PMID:29674432
pharynxSMED30016186SMED30016186SMESG000033673.1 dd_1071dd_Smed_v4PMID:29674431
pharynxSMED30009436SMED30009436SMESG000077535.1 dd_Smed_v4_18415_0_1dd_Smed_v4PMID:29674431
pharynxSMED30001723HTH CENPB-type domain-containing proteinSMESG000004654.1 dd_Smed_v4_15381_0_1dd_Smed_v4PMID:29674431
pharynxSMED30001723HTH CENPB-type domain-containing proteinSMESG000049778.1 SMESG000048378.1 SMESG000039423.1 SMESG000024543.1 SMESG000022136.1 SMESG000002434.1 SMESG000078403.1 dd_Smed_v4_12879_0_1dd_Smed_v4PMID:29674431
pharynxSMED30019715Tumor protein p63-regulated gene 1 proteinSMESG000038153.1 SMESG000018862.1 Contig1GPL15192PMID:23079596
pharynxSMED30019715Tumor protein p63-regulated gene 1 proteinSMESG000033840.1 Contig1GPL15192PMID:23079596
pharynxSMED30018893Enkurin domain-containing proteinSMESG000081414.1 dd_Smed_v4_12339_0_1dd_Smed_v4PMID:29674431
pharynxSMED30006368Piezo-type mechanosensitive ion channel componentSMESG000080326.1 SMESG000080325.1 dd_Smed_v4_18354_0_1dd_Smed_v4PMID:29674431
pharynxSMED30009913Beta-ureidopropionaseSMESG000060425.1 dd_Smed_v4_1584_0_1dd_Smed_v4PMID:29674431
pharynxSMED30019258Cytosolic carboxypeptidase 2SMESG000058240.1 dd_Smed_v4_13450_0_1dd_Smed_v4PMID:29674431
pharynxSMED30010111TPA_inf: neuropeptide precursor-2SMESG000072719.1 BK007035smed_ncbi_20200123PMID:20967238
pharynxSMED30010111TPA_inf: neuropeptide precursor-2SMESG000072719.1 BK007035smed_ncbi_20200123PMID:20967238
pharynxSMED30006971SMED30006971SMESG000030739.1 dd_Smed_v4_14664_0_1dd_Smed_v4PMID:29674431
pharynxSMED30011832Enkurin domain-containing proteinSMESG000081414.1 dd_Smed_v4_12339_0_1dd_Smed_v4PMID:29674431
pharynxSMED30011896Golgi-associated plant pathogenesis-related protein 1SMESG000005601.1 dd_Smed_v4_15638_0_1dd_Smed_v4PMID:29674431
pharynxSMED30006051SMED30006051SMESG000010439.1 dd_Smed_v4_13617_0_1dd_Smed_v4PMID:29674431
pharynxSMED30015980SPATA1_C domain-containing proteinSMESG000004654.1 dd_Smed_v4_15381_0_1dd_Smed_v4PMID:29674431
pharynxSMED30013280Pedal peptide prohormone like-2SMESG000059588.1 BK007018smed_ncbi_20200123PMID:20967238
pharynxSMED30017079LRRCC1SMESG000016752.1 dd_Smed_v4_10086_0_1dd_Smed_v4PMID:29674431
pharynxSMED30005820SMED30005820SMESG000080577.1 dd_Smed_v4_19517_0_1dd_Smed_v4PMID:29674431
pharynxSMED30018901SMED30018901SMESG000033673.1 dd_Smed_v4_1071_0_1dd_Smed_v4PMID:29674431
pharynxSMED30018901SMED30018901SMESG000033673.1 dd_Smed_v4_1071_0_1dd_Smed_v4PMID:30962434
pharynxSMED30018901SMED30018901SMESG000033673.1 dd_Smed_v6_1071_0dd_Smed_v6PMID:29674432
pharynxSMED30018901SMED30018901SMESG000033673.1 dd_1071dd_Smed_v4PMID:29674431
pharynxSMED30005874SMED30005874SMESG000014715.1 dd_Smed_v4_2213_0_1dd_Smed_v4PMID:29674431
pharynxSMED30010357SMED30010357SMESG000002236.1 dd_Smed_v4_17805_0_1dd_Smed_v4PMID:29674431
pharynxSMED30019139CalmodulinSMESG000010244.1 dd_Smed_v4_10239_0_1dd_Smed_v4PMID:29674431
pharynxSMED30010502SMED30010502SMESG000051310.1 dd_Smed_v4_15505_0_1dd_Smed_v4PMID:29674431
pharynxSMED30006335SMED30006335SMESG000046906.1 dd_Smed_v4_10831_0_1dd_Smed_v4PMID:29674431
pharynxSMED30020784SMED30020784SMESG000011782.1 Contig1076GPL15192PMID:23079596
pharynxSMED30020784SMED30020784SMESG000011782.1 dd_Smed_v4_10359_0_1dd_Smed_v4PMID:29674431
pharynxSMED30021731Multidrug resistance protein 1-like proteinSMESG000004996.1 dd_Smed_v4_4124_0_1dd_Smed_v4PMID:29674431
pharynxSMED30028898BZIP domain-containing proteinSMESG000067543.1 dd_Smed_v4_1399_0_1dd_Smed_v4PMID:29674431
pharynxSMED30028898BZIP domain-containing proteinSMESG000067543.1 dd_Smed_v6_1399_0dd_Smed_v6PMID:29674432
pharynxSMED30030168Latent transforming growth factor beta binding protein 3SMESG000008188.1 dd_Smed_v4_1886_0_1dd_Smed_v4PMID:29674431
pharynxSMED30030168Latent transforming growth factor beta binding protein 3SMESG000008188.1 dd_Smed_v4_1886_0_1dd_Smed_v4PMID:30962434
pharynxSMED30030168Latent transforming growth factor beta binding protein 3SMESG000008188.1 dd_Smed_v6_1886_0dd_Smed_v6PMID:29674432
pharynxSMED30024396Centrosomal protein 295SMESG000023095.1 dd_Smed_v4_17079_0_1dd_Smed_v4PMID:29674431
pharynxSMED30024396Centrosomal protein 295SMESG000023095.1 dd_Smed_v4_11068_0_1dd_Smed_v4PMID:29674431
pharynxSMED30034720Smed-NDK-4SMESG000009032.1 dd_Smed_v4_12674_0_1dd_Smed_v4PMID:29674431
pharynxSMED30020829KH domain-containing proteinSMESG000069949.1 dd_Smed_v4_11601_0_1dd_Smed_v4PMID:29674431
pharynxSMED30033453Dimer_Tnp_hAT domain-containing proteinSMESG000001790.1 dd_Smed_v4_212_0_1dd_Smed_v4PMID:29674431
pharynxSMED30025747SMED30025747SMESG000049533.1 dd_Smed_v4_2058_0_1dd_Smed_v4PMID:29674431
pharynxSMED30021404ALMS_motif domain-containing proteinSMESG000077136.1 dd_Smed_v4_5064_0_1dd_Smed_v4PMID:29674431
pharynxSMED30021404ALMS_motif domain-containing proteinSMESG000077136.1 dd_Smed_v4_10880_0_1dd_Smed_v4PMID:29674431
pharynxSMED30021977Beta-1,3-galactosyltransferase 1SMESG000035184.1 dd_Smed_v4_11741_0_1dd_Smed_v4PMID:29674431
pharynxSMED30022681Dynein heavy chain 7 axonemalSMESG000012956.1 dd_Smed_v4_5350_0_1dd_Smed_v4PMID:29674431
pharynxSMED30022681Dynein heavy chain 7 axonemalSMESG000012956.1 dd_Smed_v4_13792_0_1dd_Smed_v4PMID:29674431
pharynxSMED30022844NEPH-3SMESG000022777.1 dd_Smed_v4_11280_0_1dd_Smed_v4PMID:29674431
pharynxSMED30025152cilia- and flagella-associated protein 91SMESG000056200.1 dd_Smed_v4_9724_0_1dd_Smed_v4PMID:29674431
pharynxSMED30025152cilia- and flagella-associated protein 91SMESG000056200.1 dd_Smed_v4_10405_0_1dd_Smed_v4PMID:29674431
pharynxSMED30025171SMED30025171SMESG000014769.1 dd_Smed_v4_1952_0_1dd_Smed_v4PMID:29674431
pharynxSMED30025171SMED30025171SMESG000014769.1 dd_Smed_v6_1952_0dd_Smed_v6PMID:29674432
pharynxSMED30031256wntP-2SMESG000066476.1 ABY85208.1smed_ncbi_20200123PMID:19805089
pharynxSMED30031256wntP-2SMESG000066476.1 wntP-2smed_ncbi_20200123PMID:23318641
pharynxSMED30031256wntP-2SMESG000066476.1 wntP-2smed_ncbi_20200123PMID:19805089
pharynxSMED30031256wntP-2SMESG000066476.1 EU296631.1smed_ncbi_20200123PMID:26556349
pharynxSMED30020100SMED30020100SMESG000013936.1 Contig1935newmark_estsPMID:23079596
pharynxSMED30020100SMED30020100SMESG000013936.1 Contig1935uc_Smed_v2PMID:23079596
pharynxSMED30020100SMED30020100SMESG000039535.1 Contig1935newmark_estsPMID:23079596
pharynxSMED30020100SMED30020100SMESG000039535.1 Contig1935uc_Smed_v2PMID:23079596
pharynxSMED30021431TTF-type domain-containing proteinSMESG000080622.1 SMESG000068757.1 SMESG000055125.1 SMESG000038294.1 SMESG000032747.1 SMESG000023322.1 dd_Smed_v4_3830_0_1dd_Smed_v4PMID:29674431
pharynxSMED30032916SMED30032916SMESG000060752.1 dd_Smed_v4_38544_0_1dd_Smed_v4PMID:29674431
pharynxSMED30020359Smed-NDK-3SMESG000046244.1 SMESG000046208.1 GU592832.1smed_ncbi_20200123PMID:23318641
pharynxSMED30023751Coactosin-like proteinSMESG000073127.1 dd_Smed_v4_63_0_1dd_Smed_v4PMID:29674431
pharynxSMED30023739SMED30023739SMESG000058452.1 Contig1190GPL15192PMID:23079596
pharynxSMED30023739SMED30023739SMESG000057519.1 Contig1190GPL15192PMID:23079596
pharynxSMED30027083SMED30027083SMESG000029738.1 SMESG000016032.1 SMESG000015894.1 SMESG000000563.1 SMESG000000559.1 SMESG000000493.1 SMESG000000294.1 dd_Smed_v4_529_0_1dd_Smed_v4PMID:29674431
pharynxSMED30025553Cell polarity proteinSMESG000027800.1 dd_Smed_v4_4789_0_1dd_Smed_v4PMID:29674431
pharynxSMED30025553Cell polarity proteinSMESG000027800.1 dd_Smed_v6_4789_0_1dd_Smed_v6PMID:28461239
pharynxSMED30025553Cell polarity proteinSMESG000027800.1 dd_Smed_v6_4789_0_1dd_Smed_v6PMID:28461239
pharynxSMED30020436Nuclear distribution protein nudE-like 1SMESG000016071.1 HO006501.1ncbi_smed_estsPMID:22411224
pharynxSMED30021837piggyBac transposable element-derived protein 4-likeSMESG000080622.1 SMESG000068757.1 SMESG000055125.1 SMESG000038294.1 SMESG000032747.1 SMESG000023322.1 dd_Smed_v4_3830_0_1dd_Smed_v4PMID:29674431
pharynxSMED30020537SMED30020537SMESG000040594.1 dd_Smed_v4_1676_0_1dd_Smed_v4PMID:30962434
pharynxSMED30020537SMED30020537SMESG000040594.1 dd_Smed_v4_1676_0_1dd_Smed_v4PMID:29674431
pharynxSMED30034859TetraspaninSMESG000056555.1 dd_Smed_v4_3116_0_1dd_Smed_v4PMID:29674431
pharynxSMED30034859TetraspaninSMESG000056555.1 dd_Smed_v6_3116_0dd_Smed_v6PMID:29674432
pharynxSMED30020883SMED30020883SMESG000071322.1 dd_Smed_v4_5453_0_1dd_Smed_v4PMID:29674431
pharynxSMED30033844Transcription factor AP-4SMESG000081049.1 HO007476ncbi_smed_estsPMID:24173799
pharynxSMED300212652-acylglycerol O-acyltransferase 2SMESG000052656.1 dd_Smed_v4_6550_0_1dd_Smed_v4PMID:29674431
pharynxSMED30021127SMED30021127SMESG000037626.1 Contig1315newmark_estsPMID:23079596
pharynxSMED30021127SMED30021127SMESG000037626.1 Contig1315uc_Smed_v2PMID:23079596
pharynxSMED30021127SMED30021127SMESG000048042.1 Contig1315newmark_estsPMID:23079596
pharynxSMED30021127SMED30021127SMESG000048042.1 Contig1315uc_Smed_v2PMID:23079596
pharynxSMED30026134SMED30026134SMESG000023123.1 dd_Smed_v4_8764_0_1dd_Smed_v4PMID:29674431
pharynxSMED30026134SMED30026134SMESG000023123.1 dd_Smed_v4_9554_0_1dd_Smed_v4PMID:29674431
pharynxSMED30001071Low density lipoprotein-receptor, class A,domain-containing proteinSMESG000037863.1 dd_Smed_v4_12756_0_1dd_Smed_v4PMID:29674431
pharynxSMED30001071Low density lipoprotein-receptor, class A,domain-containing proteinSMESG000037863.1 dd_Smed_v4_12756_0_1dd_Smed_v4PMID:30962434
pharynxSMED30004285SMED30004285SMESG000072376.1 dd_Smed_v4_15802_0_1dd_Smed_v4PMID:29674431
pharynxSMED30005064Homeobox domain-containing proteinSMESG000074896.1 dd_Smed_v4_18719_0_1dd_Smed_v4PMID:29674431
pharynxSMED30005434SMED30005434SMESG000038889.1 Contig2145newmark_estsPMID:23079596
pharynxSMED30013050SMED30013050SMESG000000175.1 Contig2068newmark_estsPMID:23079596
pharynxSMED30004416SMED30004416SMESG000067412.1 dd_Smed_v4_14048_0_1dd_Smed_v4PMID:29674431
pharynxSMED30014550Intraflagellar transport protein 43SMESG000067883.1 dd_Smed_v4_5237_0_1dd_Smed_v4PMID:29674431
pharynxSMED30017930SMED30017930SMESG000049597.1 Contig5044newmark_estsPMID:23079596
pharynxSMED30017930SMED30017930SMESG000004871.1 Contig5044newmark_estsPMID:23079596
pharynxSMED30013692Small HSP proteinSMESG000059879.1 SMESG000059868.1 SMESG000059853.1 dd_Smed_v4_1039_0_1dd_Smed_v4PMID:29674431
pharynxSMED30002606Cilia-and flagella-associated protein 74SMESG000043377.1 dd_Smed_v4_18628_0_1dd_Smed_v4PMID:29674431
pharynxSMED30013013Guanine nucleotide-binding protein subunit betaSMESG000061733.1 dd_Smed_v4_3309_0_1dd_Smed_v4PMID:29674431
pharynxSMED30013810TeashirtSMESG000008973.1 KP003815.1smed_ncbi_20200123PMID:25558068
pharynxSMED30013810TeashirtSMESG000008973.1 KP003815.1smed_ncbi_20200123PMID:25725068
pharynxSMED30019318Sperm associated antigen 6SMESG000018022.1 dd_Smed_v4_3991_0_1dd_Smed_v4PMID:29674431
pharynxSMED30012432SMED30012432SMESG000060566.1 SMESG000060556.1 dd_Smed_v4_4002_0_1dd_Smed_v4PMID:29674431
pharynxSMED30012432SMED30012432SMESG000060566.1 SMESG000060556.1 SMESG000060487.1 dd_Smed_v6_4002_0dd_Smed_v6PMID:29674432
pharynxSMED30012769SMED30012769SMESG000058788.1 Contig2701newmark_estsPMID:23079596
pharynxSMED30012769SMED30012769SMESG000058788.1 Contig2701uc_Smed_v2PMID:23079596
pharynxSMED30002414Delta-like proteinSMESG000022173.1 dd_Smed_v4_13823_0_1dd_Smed_v4PMID:29674431
pharynxSMED30009175Transcription elongation factor spt6SMESG000059332.1 Contig5500newmark_estsPMID:23079596
pharynxSMED30009175Transcription elongation factor spt6SMESG000059332.1 Contig5500uc_Smed_v2PMID:23079596
pharynxSMED30009175Transcription elongation factor spt6SMESG000024114.1 Contig5500newmark_estsPMID:23079596
pharynxSMED30009175Transcription elongation factor spt6SMESG000024114.1 Contig5500uc_Smed_v2PMID:23079596
pharynxSMED300163635'-nucleotidase proteinSMESG000032250.1 dd_Smed_v4_3474_0_1dd_Smed_v4PMID:29674431
pharynxSMED30026534Rho-related GTP-binding proteinSMESG000022390.1 dd_Smed_v4_578_0_1dd_Smed_v4PMID:29674431
pharynxSMED30027478SMED30027478SMESG000081245.1 dd_Smed_v4_3287_0_1dd_Smed_v4PMID:29674431
pharynxSMED30034763c-Jun N-terminal kinasesSMESG000043618.1 dd_Smed_v4_5924_0_1dd_Smed_v4PMID:29674431
pharynxSMED30022102N terminal kinase protein likeSMESG000008254.1 dd_Smed_v4_3470_0_1dd_Smed_v4PMID:29674431
pharynxSMED30027978Calcyphosin proteinSMESG000025859.1 dd_Smed_v4_4512_0_1dd_Smed_v4PMID:29674431
pharynxSMED30023111RBR-type E3 ubiquitin transferaseSMESG000054560.1 dd_Smed_v4_4845_0_1dd_Smed_v4PMID:29674431
pharynxSMED30033340DUF4476 domain-containing proteinSMESG000055714.1 dd_Smed_v4_3608_0_1dd_Smed_v4PMID:29674431
pharynxSMED30030073Thymus, brain and testes associatedSMESG000053617.1 dd_Smed_v4_4229_0_1dd_Smed_v4PMID:29674431
pharynxSMED30022806Calcyphosin proteinSMESG000025859.1 dd_Smed_v4_4512_0_1dd_Smed_v4PMID:29674431
pharynxSMED30027354Myeloid leukemia factor 1SMESG000025667.1 dd_Smed_v4_4787_0_1dd_Smed_v4PMID:29674431
pharynxSMED30034470PDZ ring finger protein 4SMESG000021620.1 dd_Smed_v4_5781_0_1dd_Smed_v4PMID:29674431
pharynxSMED30020205Si:dkey-90a13.10SMESG000035648.1 dd_Smed_v4_5452_0_1dd_Smed_v4PMID:29674431
pharynxSMED30035681Intraflagellar transport protein 88SMESG000039906.1 EE280776.1ncbi_smed_estsPMID:19852954
pharynxSMED30035681Intraflagellar transport protein 88SMESG000039906.1 dd_Smed_v4_5484_0_1dd_Smed_v4PMID:29674431
pharynxSMED30029206ANK_REP_REGION domain-containing proteinSMESG000017292.1 dd_Smed_v4_5280_0_1dd_Smed_v4PMID:29674431
pharynxSMED30020269MyophilinSMESG000081505.1 SMESG000049198.1 SMESG000047694.1 SMESG000035451.1 SMESG000035348.1 dd_Smed_v4_395_0_1dd_Smed_v4PMID:29674431
pharynxSMED30031955Intraflagellar transport protein 52SMESG000043987.1 dd_Smed_v4_5043_0_1dd_Smed_v4PMID:29674431
pharynxSMED30034903cilia- and flagella-associated protein 77SMESG000042608.1 dd_Smed_v4_5179_0_1dd_Smed_v4PMID:29674431
pharynxSMED30020849SMED30020849SMESG000044682.1 dd_Smed_v4_3494_0_1dd_Smed_v4PMID:29674431
pharynxSMED30026043UTP--glucose-1-phosphate uridylyltransferaseSMESG000043519.1 dd_Smed_v4_3057_0_1dd_Smed_v4PMID:29674431
pharynxSMED30033807SMED30033807SMESG000076385.1 SMESG000076375.1 SMESG000076363.1 SMESG000076223.1 SMESG000076482.1 SMESG000076470.1 SMESG000076410.1 SMESG000076358.1 Contig1645newmark_estsPMID:23079596
pharynxSMED30028718Epsin 2SMESG000042233.1 dd_Smed_v4_4779_0_1dd_Smed_v4PMID:29674431
pharynxSMED300316316-phosphogluconate dehydrogenase, decarboxylatingSMESG000005721.1 dd_Smed_v4_366_0_1dd_Smed_v4PMID:29674431
pharynxSMED300316316-phosphogluconate dehydrogenase, decarboxylatingSMESG000005721.1 dd_Smed_v6_366_0dd_Smed_v6PMID:29674432
pharynxSMED30020268Dynamin-type G domain-containing proteinSMESG000014756.1 SMESG000014755.1 dd_Smed_v4_2390_0_1dd_Smed_v4PMID:29674431
pharynxSMED30033389SMED30033389SMESG000079563.1 SMESG000052448.1 dd_Smed_v4_3113_1_1dd_Smed_v4PMID:29674431
pharynxSMED30032442Ectonucleoside triphosphate diphosphohydrolase 5SMESG000002990.1 dd_Smed_v4_8855_0_1dd_Smed_v4PMID:29674431
pharynxSMED30032067TRAF-4SMESG000044336.1 Contig1407GPL15192PMID:23079596
pharynxSMED30032067TRAF-4SMESG000015063.1 Contig1407GPL15192PMID:23079596
pharynxSMED30026527Serine palmitoyltransferase 2SMESG000011189.1 dd_Smed_v4_4337_0_1dd_Smed_v4PMID:29674431
pharynxSMED30030757SMED30030757SMESG000016990.1 Contig1765newmark_estsPMID:23079596
pharynxSMED30033366Leukotriene A-4 hydrolaseSMESG000014392.1 dd_Smed_v4_3027_0_1dd_Smed_v4PMID:29674431
pharynxSMED30025231radial spoke head protein 6 homolog ASMESG000079294.1 SMESG000044179.1 dd_Smed_v4_3854_0_1dd_Smed_v4PMID:29674431
pharynxSMED30032393SMED30032393SMESG000036683.1 Contig4572newmark_estsPMID:23079596
pharynxSMED30032393SMED30032393SMESG000074788.1 Contig4572newmark_estsPMID:23079596
pharynxSMED30025952Four and A half lim domainsSMESG000009923.1 dd_Smed_v4_2771_0_1dd_Smed_v4PMID:29674431
pharynxSMED30032159Oxysterol-binding proteinSMESG000046022.1 dd_Smed_v4_5423_0_1dd_Smed_v4PMID:29674431
pharynxSMED30033103Dvl-2SMESG000010246.1 EU130788.1smed_ncbi_20200123PMID:21282632
pharynxSMED30033103Dvl-2SMESG000010246.1 EU130788.1smed_ncbi_20200123PMID:18063757
pharynxSMED30024997ATP-dependent RNA helicase, putativeSMESG000056881.1 dd_Smed_v4_4309_0_1dd_Smed_v4PMID:29674431
pharynxSMED30033864pim-3SMESG000014593.1 dd_Smed_v4_6420_0_1dd_Smed_v4PMID:29674431
pharynxSMED30032757DishevelledSMESG000049876.1 EU130787.1smed_ncbi_20200123PMID:18063757
pharynxSMED30032757DishevelledSMESG000049876.1 EU130787.1smed_ncbi_20200123PMID:21282632
pharynxSMED30022944SMED30022944SMESG000049597.1 Contig5044newmark_estsPMID:23079596
pharynxSMED30022944SMED30022944SMESG000004871.1 Contig5044newmark_estsPMID:23079596
pharynxSMED30024840LactadherinSMESG000001686.1 dd_Smed_v4_5463_0_1dd_Smed_v4PMID:29674431
pharynxSMED30015586TAR DNA-binding protein 43SMESG000048176.1 dd_Smed_v4_12522_0_1dd_Smed_v4PMID:29674431
pharynxSMED30014015SMED30014015SMESG000022082.1 dd_Smed_v4_8317_0_1dd_Smed_v4PMID:29674431
pharynxSMED30002877IQ motif and SEC7 domain-containing protein 2SMESG000070179.1 SMED30002877smed_20140614PMID:26457503
pharynxSMED30005191Phospholipid scramblaseSMESG000050656.1 Contig14553newmark_estsPMID:27612384
pharynxSMED30005191Phospholipid scramblaseSMESG000050656.1 Contig14553uc_Smed_v2PMID:27612384
pharynxSMED30005191Phospholipid scramblaseSMESG000050656.1 dd_Smed_v4_6444_0_1dd_Smed_v4PMID:29674431
pharynxSMED30004278KinaseSMESG000019079.1 dd_Smed_v4_3687_0_1dd_Smed_v4PMID:29674431
pharynxSMED30008772Golgi-associated plant pathogenesis-related protein 1SMESG000035954.1 dd_Smed_v4_27440_0_1dd_Smed_v4PMID:29674431
pharynxSMED30002023ANK_REP_REGION domain-containing proteinSMESG000020576.1 dd_Smed_v4_13360_0_1dd_Smed_v4PMID:29674431
pharynxSMED30000038Ribosome-binding protein 1SMESG000031975.1 dd_Smed_v4_1111_0_1dd_Smed_v4PMID:29674431
pharynxSMED30016673Cylindromatosis (turban tumor syndrome), bSMESG000056847.1 SMESG000056843.1 SMESG000056838.1 SMESG000044770.1 SMESG000044762.1 SMESG000007140.1 dd_Smed_v4_1137_0_1dd_Smed_v4PMID:29674431
pharynxSMED30016673Cylindromatosis (turban tumor syndrome), bSMESG000056845.1 SMESG000044775.1 SMESG000007087.1 SMESG000007085.1 SMESG000056847.1 SMESG000056838.1 SMESG000044770.1 SMESG000007140.1 SMESG000044776.1 SMESG000044783.1 SMESG000038659.1 SMESG000030652.1 SMESG000025467.1 SMESG000013956.1 SMESG000056843.1 SMESG000044762.1 dd_Smed_v6_1137_0dd_Smed_v6PMID:29674432
pharynxSMED30007588SMED30007588SMESG000034112.1 dd_Smed_v4_10100_0_1dd_Smed_v4PMID:29674431
pharynxSMED30015563Meiosis expressed protein 1SMESG000031493.1 dd_Smed_v4_4620_0_1dd_Smed_v4PMID:29674431
pharynxSMED30010437Copper homeostasis protein CutCSMESG000016228.1 dd_Smed_v4_7302_1_1dd_Smed_v4PMID:29674431
pharynxSMED30014551SMED30014551SMESG000080911.1 SMESG000080909.1 dd_Smed_v4_8194_0_1dd_Smed_v4PMID:29674431
pharynxSMED30009817testis-expressed protein 52SMESG000070302.1 dd_Smed_v4_6766_0_1dd_Smed_v4PMID:29674431
pharynxSMED30000671Fibronectin type III domain proteinSMESG000043560.1 dd_Smed_v4_33732_0_1dd_Smed_v4PMID:29674431
pharynxSMED30018560SMED30018560SMESG000004196.1 dd_Smed_v4_1162_0_1dd_Smed_v4PMID:29674431
pharynxSMED30005459SMED30005459SMESG000014884.1 dd_Smed_v4_2661_0_1dd_Smed_v4PMID:29674431
pharynxSMED30009887Macrophage erythroblast attacherSMESG000048410.1 dd_Smed_v4_1168_0_1dd_Smed_v4PMID:29674431
pharynxSMED30019288Reticulocalbin 3SMESG000012033.1 dd_Smed_v4_1417_0_1dd_Smed_v4PMID:29674431
pharynxSMED30010775SMED30010775SMESG000062858.1 dd_Smed_v4_10948_0_1dd_Smed_v4PMID:29674431
pharynxSMED30014320Four and A half lim domainsSMESG000037769.1 Contig31882newmark_estsPMID:27612384
pharynxSMED30014320Four and A half lim domainsSMESG000037769.1 Contig31882uc_Smed_v2PMID:27612384
pharynxSMED30006944slc35e1SMESG000034003.1 dd_Smed_v4_5304_0_1dd_Smed_v4PMID:29674431
pharynxSMED30004964SMED30004964SMESG000014348.1 Contig55055newmark_estsPMID:27612384
pharynxSMED30004964SMED30004964SMESG000014348.1 Contig55055uc_Smed_v2PMID:27612384
pharynxSMED30015071Eyes absent homologSMESG000001561.1 SMED30015071smed_20140614PMID:25254346
pharynxSMED30013404SMED30013404SMESG000027863.1 dd_Smed_v4_16528_0_1dd_Smed_v4PMID:29674431
pharynxSMED30010940TetraspaninSMESG000021642.1 dd_Smed_v4_1257_0_1dd_Smed_v4PMID:29674431
pharynxSMED30007587serine/threonine/tyrosine-interacting-like protein 1SMESG000070767.1 dd_Smed_v4_11358_0_1dd_Smed_v4PMID:29674431
pharynxSMED30003093SMED30003093SMESG000056847.1 SMESG000056843.1 SMESG000056838.1 SMESG000044770.1 SMESG000044762.1 SMESG000007140.1 dd_Smed_v4_1137_0_1dd_Smed_v4PMID:29674431
pharynxSMED30003093SMED30003093SMESG000056845.1 SMESG000044775.1 SMESG000007087.1 SMESG000007085.1 SMESG000056847.1 SMESG000056838.1 SMESG000044770.1 SMESG000007140.1 SMESG000044776.1 SMESG000044783.1 SMESG000038659.1 SMESG000030652.1 SMESG000025467.1 SMESG000013956.1 SMESG000056843.1 SMESG000044762.1 dd_Smed_v6_1137_0dd_Smed_v6PMID:29674432
pharynxSMED30008418SMED30008418SMESG000027863.1 dd_Smed_v4_16528_0_1dd_Smed_v4PMID:29674431
pharynxSMED30004871Mitogen-activated protein kinaseSMESG000023035.1 SMESG000023025.1 dd_Smed_v4_10933_0_1dd_Smed_v4PMID:29674431
pharynxSMED30013075Voltage-dependent anion channel 3SMESG000000196.1 dd_Smed_v4_738_0_1dd_Smed_v4PMID:29674431
pharynxSMED3001096960S ribosomal protein L6SMESG000019835.1 dd_Smed_v4_839_0_1dd_Smed_v4PMID:29674431
pharynxSMED30010187HTH CENPB-type domain-containing proteinSMESG000049778.1 SMESG000048378.1 SMESG000039423.1 SMESG000024543.1 SMESG000022136.1 SMESG000002434.1 SMESG000078403.1 dd_Smed_v4_12879_0_1dd_Smed_v4PMID:29674431
pharynxSMED30002379ADP-ribosylation factor-like protein 15SMESG000061183.1 dd_Smed_v4_15424_0_1dd_Smed_v4PMID:29674431
pharynxSMED30001511SMED30001511SMESG000029772.1 dd_Smed_v4_16888_0_1dd_Smed_v4PMID:29674431
pharynxSMED30017015Deferrochelatase/peroxidase YfeXSMESG000077723.1 dd_Smed_v4_2999_0_1dd_Smed_v4PMID:29674431
pharynxSMED30010410SMED30010410SMESG000021757.1 dd_Smed_v4_8797_0_1dd_Smed_v4PMID:29674431
pharynxSMED30007307Serine/threonine kinaseSMESG000061289.1 dd_Smed_v4_12166_0_1dd_Smed_v4PMID:29674431
pharynxSMED30010364SMED30010364SMESG000056847.1 SMESG000056843.1 SMESG000056838.1 SMESG000044770.1 SMESG000044762.1 SMESG000007140.1 dd_Smed_v4_1137_0_1dd_Smed_v4PMID:29674431
pharynxSMED30010364SMED30010364SMESG000056845.1 SMESG000044775.1 SMESG000007087.1 SMESG000007085.1 SMESG000056847.1 SMESG000056838.1 SMESG000044770.1 SMESG000007140.1 SMESG000044776.1 SMESG000044783.1 SMESG000038659.1 SMESG000030652.1 SMESG000025467.1 SMESG000013956.1 SMESG000056843.1 SMESG000044762.1 dd_Smed_v6_1137_0dd_Smed_v6PMID:29674432
pharynxSMED30004860STRA6-likeSMESG000041900.1 SMESG000031061.1 dd_Smed_v4_8135_1_1dd_Smed_v4PMID:29674431
pharynxSMED30005053SMED30005053SMESG000072823.1 dd_Smed_v4_11587_0_1dd_Smed_v4PMID:29674431
pharynxSMED30011180Kinesin-like protein KIF26ASMESG000051203.1 dd_Smed_v4_8860_0_1dd_Smed_v4PMID:29674431
pharynxSMED30004519Novel proteinSMESG000039682.1 dd_Smed_v4_2676_0_1dd_Smed_v4PMID:29674431
pharynxSMED30000891SMED30000891SMESG000008013.1 dd_Smed_v4_5606_0_1dd_Smed_v4PMID:29674431
pharynxSMED30017440SMED30017440SMESG000016182.1 dd_Smed_v4_9694_0_1dd_Smed_v4PMID:29674431
pharynxSMED30007120Transient receptor potential cation channel subfamily M memberSMESG000068504.1 dd_Smed_v4_15098_0_1dd_Smed_v4PMID:29674431
pharynxSMED30010320Radial spoke head 10-like protein B2SMESG000039156.1 SMESG000039153.1 dd_Smed_v4_12762_0_1dd_Smed_v4PMID:29674431
pharynxSMED30006913C-type lectin domain-containing proteinSMESG000036968.1 dd_Smed_v4_7581_0_1dd_Smed_v4PMID:29674431
pharynxSMED30014787cGMP-dependent protein kinaseSMESG000016927.1 dd_Smed_v4_7139_0_1dd_Smed_v4PMID:29674431
pharynxSMED30012889Family S33 non-peptidase homologue (S33 family)SMESG000021236.1 dd_Smed_v4_1414_0_1dd_Smed_v4PMID:29674431
pharynxSMED30003449Steroid 17-alpha-hydroxylase/17,20 lyaseSMESG000059423.1 SMESG000059412.1 SMESG000059290.1 SMESG000048655.1 SMED30003449smed_20140614PMID:26457503
pharynxSMED30013454Bromodomain-containing protein 2SMESG000029685.1 SMESG000012934.1 dd_Smed_v4_6525_0_1dd_Smed_v4PMID:29674431
pharynxSMED30018386Inositol 1,4,5-trisphosphate receptor type 3SMESG000070557.1 dd_Smed_v4_14214_0_1dd_Smed_v4PMID:29674431
pharynxSMED30001176SMED30001176SMESG000020646.1 dd_Smed_v4_10759_0_1dd_Smed_v4PMID:29674431
pharynxSMED30002589Oxysterol-binding proteinSMESG000065901.1 dd_Smed_v4_3179_0_1dd_Smed_v4PMID:29674431
pharynxSMED30013835SMED30013835SMESG000061090.1 dd_Smed_v4_1300_0_1dd_Smed_v4PMID:29674431
pharynxSMED30011294Protein kinase domain-containing proteinSMESG000041899.1 SMESG000031064.1 dd_Smed_v4_8347_0_1dd_Smed_v4PMID:29674431
pharynxSMED30002842SMED30002842SMESG000056914.1 dd_Smed_v4_8301_0_1dd_Smed_v4PMID:29674431
pharynxSMED30014133EF-hand calcium-binding domain-containing protein 10-likeSMESG000023074.1 dd_Smed_v4_6477_0_1dd_Smed_v4PMID:29674431
pharynxSMED30011053SMED30011053SMESG000065433.1 dd_Smed_v4_2625_0_1dd_Smed_v4PMID:29674431
pharynxSMED30007072Methylmalonyl-CoA epimeraseSMESG000021684.1 dd_Smed_v4_3348_1_1dd_Smed_v4PMID:29674431
pharynxSMED30017401Serine/threonine-protein kinase OSR1SMESG000052774.1 dd_Smed_v4_6126_0_1dd_Smed_v4PMID:29674431
pharynxSMED30001875Dynein light chain roadblockSMESG000072361.1 dd_Smed_v4_1126_0_1dd_Smed_v4PMID:29674431
pharynxSMED30026934SMED30026934SMESG000050824.1 dd_Smed_v4_12162_0_1dd_Smed_v4PMID:29674431
pharynxSMED30027239Tetratricopeptide repeat protein 30ASMESG000024323.1 dd_Smed_v4_8798_0_1dd_Smed_v4PMID:29674431
pharynxSMED30032706SMED30032706SMESG000026670.1 dd_Smed_v4_14959_0_1dd_Smed_v4PMID:29674431
pharynxSMED30022424MYND-type domain-containing proteinSMESG000066740.1 dd_Smed_v4_9973_0_1dd_Smed_v4PMID:29674431
pharynxSMED30026109Hydin_ADK domain-containing proteinSMESG000016228.1 dd_Smed_v4_7302_1_1dd_Smed_v4PMID:29674431
pharynxSMED30023409Glutamate-rich 3SMESG000029848.1 SMESG000029846.1 dd_Smed_v4_8627_0_1dd_Smed_v4PMID:29674431
pharynxSMED30014474Tumor susceptibility gene 101 proteinSMESG000049597.1 Contig5044GPL15192PMID:23079596
pharynxSMED30014474Tumor susceptibility gene 101 proteinSMESG000004871.1 Contig5044GPL15192PMID:23079596
pharynxSMED30016546SMED30016546SMESG000051921.1 SMESG000051913.1 dd_Smed_v4_1175_0_1dd_Smed_v4PMID:29674431
pharynxSMED30016546SMED30016546SMESG000051921.1 SMESG000051913.1 dd_Smed_v6_1175_0dd_Smed_v6PMID:29674432
pharynxSMED30015580F-box and WD-40 domain-containing protein 1/11SMESG000025496.1 SMESG000025494.1 dd_Smed_v4_14791_0_1dd_Smed_v4PMID:29674431
pharynxSMED30015020E3 ubiquitin-protein ligase XIAPSMESG000031958.1 dd_Smed_v4_2104_0_1dd_Smed_v4PMID:29674431
pharynxSMED30015020E3 ubiquitin-protein ligase XIAPSMESG000031958.1 dd_Smed_v6_2104_0dd_Smed_v6PMID:29674432
pharynxSMED3001422860S ribosomal protein L6SMESG000050581.1 dd_Smed_v4_10396_0_1dd_Smed_v4PMID:29674431
pharynxSMED30016225Neuropeptide-49SMESG000003228.1 BK007023smed_ncbi_20200123PMID:20967238
pharynxSMED30004652SMED30004652SMESG000033527.1 Contig2307newmark_estsPMID:23079596
pharynxSMED30011604Long-chain-fatty-acid--CoA ligaseSMESG000081754.1 dd_Smed_v4_2153_0_1dd_Smed_v4PMID:29674431
pharynxSMED30011604Long-chain-fatty-acid--CoA ligaseSMESG000081754.1 dd_Smed_v6_2153_0dd_Smed_v6PMID:29674432
pharynxSMED30017833SMED30017833SMESG000053168.1 Contig2992newmark_estsPMID:23079596
pharynxSMED30012447FilaminSMESG000064795.1 dd_Smed_v4_2272_0_1dd_Smed_v4PMID:29674431
pharynxSMED30017179Membrane-associated progesterone receptor component 2SMESG000069753.1 dd_Smed_v4_7242_0_1dd_Smed_v4PMID:29674431
pharynxSMED30017615SMED30017615SMESG000016882.1 dd_Smed_v4_12216_0_1dd_Smed_v4PMID:29674431
pharynxSMED30014919KIF3A-like proteinSMESG000075065.1 dd_Smed_v4_4343_0_1dd_Smed_v4PMID:29674431
pharynxSMED30017937WASP like actin nucleation promoting factor bSMESG000036683.1 Contig4572GPL15192PMID:23079596
pharynxSMED30017937WASP like actin nucleation promoting factor bSMESG000074788.1 Contig4572GPL15192PMID:23079596
pharynxSMED30025964SMED30025964SMESG000041071.1 Contig2453newmark_estsPMID:23079596
pharynxSMED30029557SMED30029557SMESG000028899.1 Contig1093newmark_estsPMID:23079596
pharynxSMED30029557SMED30029557SMESG000071997.1 Contig1093newmark_estsPMID:23079596
pharynxSMED30020213tensin isoform X3SMESG000033851.1 dd_Smed_v4_5620_0_1dd_Smed_v4PMID:29674431
pharynxSMED30022929WntASMESG000051375.1 FJ463750.1smed_ncbi_20200123PMID:20707997
pharynxSMED30022929WntASMESG000051375.1 FJ463750.1smed_ncbi_20200123PMID:19211673
pharynxSMED30022929WntASMESG000051375.1 ACJ64865.1smed_ncbi_20200123PMID:20707997
pharynxSMED30022929WntASMESG000051375.1 FJ463750smed_ncbi_20200123PMID:20707997
pharynxSMED30022929WntASMESG000051375.1 FJ463750smed_ncbi_20200123PMID:19211673
pharynxSMED30026663Tropomyosin Tod p 1.0102SMESG000074053.1 DN312526ncbi_smed_estsPMID:16344473
pharynxSMED30021146SERPIN domain-containing proteinSMESG000054563.1 dd_Smed_v4_3824_0_1dd_Smed_v4PMID:29674431
pharynxSMED30029410Phosphatidylinositol 3,4,5-trisphosphate 3-phosphatase and dual-specificity protein phosphatase PTENSMESG000043909.1 AY068282smed_ncbi_20200123PMID:19048075
pharynxSMED30029024Protein F37C4.5SMESG000064758.1 dd_Smed_v4_5168_0_1dd_Smed_v4PMID:29674431
pharynxSMED30023334Partitioning defective 6SMESG000066854.1 Contig3688GPL15192PMID:23079596
pharynxSMED30023334Partitioning defective 6SMESG000026500.1 Contig3688GPL15192PMID:23079596
pharynxSMED30023857Calpain 5aSMESG000009459.1 dd_Smed_v4_101944_0_1dd_Smed_v4PMID:29674431
pharynxSMED30026932noggin-like protein 8SMESG000008387.1 FJ471490smed_ncbi_20200123PMID:19174194
pharynxSMED30026932noggin-like protein 8SMESG000008387.1 FJ471490.1smed_ncbi_20200123PMID:19174194
pharynxSMED30022372cytoplasmic dynein 2 light intermediate chain 1SMESG000069411.1 dd_Smed_v4_4291_0_1dd_Smed_v4PMID:29674431
pharynxSMED30035790SMED30035790SMESG000006146.1 dd_Smed_v4_28660_0_1dd_Smed_v4PMID:29674431
pharynxSMED30035441Superoxide dismutase [Cu-Zn]SMESG000051067.1 dd_Smed_v4_9810_0_1dd_Smed_v4PMID:29674431
pharynxSMED30024411Protein kinase domain-containing proteinSMESG000028899.1 Contig1093GPL15192PMID:23079596
pharynxSMED30024411Protein kinase domain-containing proteinSMESG000071997.1 Contig1093GPL15192PMID:23079596
pharynxSMED30024411Protein kinase domain-containing proteinSMESG000024532.1 dd_Smed_v4_2822_0_1dd_Smed_v4PMID:29674431
pharynxSMED30034831SMED30034831SMESG000064758.1 dd_Smed_v4_5168_0_1dd_Smed_v4PMID:29674431
pharynxSMED30032776SMED30032776SMESG000063221.1 Contig1068newmark_estsPMID:23079596
pharynxSMED30023059EF-hand calcium-binding domain-containing protein 6SMESG000052556.1 SMESG000052552.1 dd_Smed_v4_7065_0_1dd_Smed_v4PMID:29674431
pharynxSMED30022483CGG triplet repeat-binding protein 1SMESG000020470.1 Contig1680newmark_estsPMID:23079596
pharynxSMED30022483CGG triplet repeat-binding protein 1SMESG000020470.1 Contig1680uc_Smed_v2PMID:23079596
pharynxSMED30026927GCR044SMESG000020870.1 SMESG000046087.1 SMESG000046084.1 dd_Smed_v4_2768_0_1dd_Smed_v4PMID:29674431
pharynxSMED30026726RING domain ligase2 isoform 3SMESG000003596.1 dd_Smed_v4_5871_0_1dd_Smed_v4PMID:29674431
pharynxSMED30026726RING domain ligase2 isoform 3SMESG000003596.1 dd_Smed_v4_6423_0_1dd_Smed_v4PMID:29674431
pharynxSMED30027015MAGUK p55 subfamily member 5SMESG000007837.1 dd_Smed_v4_5287_0_1dd_Smed_v4PMID:29674431
pharynxSMED30032408SMED30032408SMESG000027686.1 Contig2364newmark_estsPMID:23079596
pharynxSMED30032408SMED30032408SMESG000012131.1 SMESG000012127.1 Contig2364newmark_estsPMID:23079596
pharynxSMED30029361KIF3B-like proteinSMESG000075065.1 dd_Smed_v4_4343_0_1dd_Smed_v4PMID:29674431
pharynxSMED30029361KIF3B-like proteinSMESG000020245.1 dd_Smed_v4_9308_0_1dd_Smed_v4PMID:29674431
pharynxSMED30021504SMED30021504SMESG000030479.1 dd_Smed_v4_3869_0_1dd_Smed_v4PMID:29674431
pharynxSMED30027745molybdate-anion transporter isoform X2SMESG000027072.1 dd_Smed_v4_3699_0_1dd_Smed_v4PMID:29674431
pharynxSMED30035183Chromosome 8 open reading frame 37SMESG000035388.1 dd_Smed_v4_8015_0_1dd_Smed_v4PMID:29674431
pharynxSMED30024579SJCHGC07397 proteinSMESG000050581.1 dd_Smed_v4_10396_0_1dd_Smed_v4PMID:29674431
pharynxSMED30022973Rho GTPase-activating protein 12SMESG000012042.1 dd_Smed_v4_4253_0_1dd_Smed_v4PMID:29674431
pharynxSMED30030068SMED30030068SMESG000051921.1 SMESG000051913.1 dd_Smed_v4_1175_0_1dd_Smed_v4PMID:29674431
pharynxSMED30030068SMED30030068SMESG000051921.1 SMESG000051913.1 dd_Smed_v6_1175_0dd_Smed_v6PMID:29674432
pharynxSMED30023924SMED30023924SMESG000030689.1 dd_Smed_v4_561_0_1dd_Smed_v4PMID:29674431
pharynxSMED30023924SMED30023924SMESG000030689.1 dd_Smed_v6_561_0dd_Smed_v6PMID:29674432
pharynxSMED30033263SMED30033263SMESG000011720.1 dd_Smed_v4_6041_0_1dd_Smed_v4PMID:29674431
pharynxSMED30033263SMED30033263SMESG000011720.1 dd_Smed_v6_6041_0dd_Smed_v6PMID:29674432
pharynxSMED30031780Ras-related protein Rab-5ASMESG000065500.1 Contig1027GPL15192PMID:23079596
pharynxSMED30024824beta-catenin-1SMESG000039528.1 EU082826smed_ncbi_20200123PMID:18287199
pharynxSMED30024824beta-catenin-1SMESG000039528.1 Smed-beta-catenin-1smed_ncbi_20200123PMID:18287199
pharynxSMED30024824beta-catenin-1SMESG000039528.1 Smed-beta-catenin-1smed_ncbi_20200123PMID:21806978
pharynxSMED30024824beta-catenin-1SMESG000039528.1 EU130786.1smed_ncbi_20200123PMID:18063757
pharynxSMED30023915Vacuolar-sorting protein SNF8SMESG000016990.1 Contig1765GPL15192PMID:23079596
pharynxSMED30001281SMED30001281SMESG000038153.1 SMESG000018862.1 Contig1newmark_estsPMID:23079596
pharynxSMED30001281SMED30001281SMESG000033840.1 Contig1newmark_estsPMID:23079596
pharynxSMED30011644tRNA wybutosine-synthesizing protein 3 homologSMESG000069968.1 SMESG000069969.1 dd_Smed_v4_180_0_1dd_Smed_v4PMID:29674431
pharynxSMED30015887DUF4550 domain-containing proteinSMESG000000883.1 dd_Smed_v4_10058_0_1dd_Smed_v4PMID:29674431
pharynxSMED30000282X1.A.G7.1SMESG000046817.1 SMESG000046814.1 dd_Smed_v4_1507_0_1dd_Smed_v4PMID:29674431
pharynxSMED30008113nicolin-1SMESG000079687.1 SMESG000054751.1 dd_Smed_v4_11961_0_1dd_Smed_v4PMID:29674431
pharynxSMED30015008SMED30015008SMESG000001496.1 SMESG000001495.1 dd_Smed_v4_14943_0_1dd_Smed_v4PMID:29674431
pharynxSMED30018656SMED30018656SMESG000056208.1 dd_Smed_v4_16921_0_1dd_Smed_v4PMID:29674431
pharynxSMED30016238Kinesin-like proteinSMESG000071604.1 dd_Smed_v4_12639_0_1dd_Smed_v4PMID:29674431
pharynxSMED30005458Phosphatidylinositol 4-kinase type 2-betaSMESG000074718.1 tr5_11049mu_Smed_v1PMID:25558068
pharynxSMED30001681SMED30001681SMESG000049443.1 dd_Smed_v4_1193_0_1dd_Smed_v4PMID:29674431
pharynxSMED30009071SMED30009071SMESG000017123.1 dd_Smed_v4_10551_0_1dd_Smed_v4PMID:29674431
pharynxSMED30000535CEP72SMESG000043538.1 dd_Smed_v4_12835_0_1dd_Smed_v4PMID:29674431
pharynxSMED30009521Zinc finger BED domain-containing protein 5SMESG000002129.1 dd_Smed_v4_13531_0_1dd_Smed_v4PMID:29674431
pharynxSMED30016156Alpha-1-antiproteinase 2SMESG000078713.1 SMESG000078711.1 SMESG000078710.1 dd_Smed_v4_1853_0_1dd_Smed_v4PMID:29674431
pharynxSMED30015061G protein regulated inducer of neurite outgrowthSMESG000062691.1 dd_Smed_v4_10294_0_1dd_Smed_v4PMID:29674431
pharynxSMED30019942Roc domain-containing proteinSMESG000038728.1 dd_Smed_v4_11334_0_1dd_Smed_v4PMID:29674431
pharynxSMED30019328Armadillo repeat-containing protein 2SMESG000077074.1 dd_Smed_v4_12684_0_1dd_Smed_v4PMID:29674431
pharynxSMED30014820Centrosomal protein of 135 kDa (Cep135 protein) (Centrosomal protein 4), putativeSMESG000052451.1 dd_Smed_v4_11072_0_1dd_Smed_v4PMID:29674431
pharynxSMED30015232Netrin-1SMESG000050895.1 dd_Smed_v4_14852_0_1dd_Smed_v4PMID:29674431
pharynxSMED30015232Netrin-1SMESG000050895.1 dd_Smed_v4_14852_0_1dd_Smed_v4PMID:30962434
pharynxSMED30013316Polycomb group RING finger protein 1SMESG000072501.1 dd_Smed_v4_12753_0_1dd_Smed_v4PMID:27063937
pharynxSMED30017943SMED30017943SMESG000022837.1 dd_Smed_v4_16017_0_1dd_Smed_v4PMID:29674431
pharynxSMED30011096Centrosomal protein 131SMESG000051138.1 dd_Smed_v4_13976_0_1dd_Smed_v4PMID:29674431
pharynxSMED30025982RING finger protein 32SMESG000057989.1 dd_Smed_v4_12150_0_1dd_Smed_v4PMID:29674431
pharynxSMED30026131SMED30026131SMESG000027311.1 dd_Smed_v4_1401_0_1dd_Smed_v4PMID:29674431
pharynxSMED30035079Phospholipid-transporting ATPaseSMESG000061014.1 dd_Smed_v4_2913_0_1dd_Smed_v4PMID:29674431
pharynxSMED30032970Alpha-int-3SMESG000034289.1 dd_Smed_v4_8943_0_1dd_Smed_v4PMID:29674431
pharynxSMED30025095SMED30025095SMESG000046852.1 dd_Smed_v4_11398_0_1dd_Smed_v4PMID:29674431
pharynxSMED30030499Chromosome X CXorf58 homologSMESG000061012.1 dd_Smed_v4_8151_0_1dd_Smed_v4PMID:29674431
pharynxSMED30035813SMED30035813SMESG000004300.1 dd_Smed_v4_7960_0_1dd_Smed_v4PMID:29674431
pharynxSMED30021270ANK_REP_REGION domain-containing proteinSMESG000057916.1 SMESG000057915.1 dd_Smed_v4_15179_0_1dd_Smed_v4PMID:29674431
pharynxSMED30023766SMED30023766SMESG000073811.1 dd_Smed_v4_116_0_1dd_Smed_v4PMID:29674431
pharynxSMED30021516MICOS complex subunit MIC60SMESG000066687.1 dd_Smed_v4_1605_0_1dd_Smed_v4PMID:29674431
pharynxSMED30025753SMED30025753SMESG000016791.1 dd_Smed_v4_10_0_1dd_Smed_v4PMID:29674431
pharynxSMED30024348SMED30024348SMESG000074227.1 dd_Smed_v4_19769_0_1dd_Smed_v4PMID:29674431
pharynxSMED30025084Ankyrin repeat and EF-hand domain-containing protein 1SMESG000006940.1 SMESG000006938.1 SMESG000006933.1 dd_Smed_v4_12476_0_1dd_Smed_v4PMID:29674431
pharynxSMED30020686Transmembrane protein 80SMESG000018777.1 dd_Smed_v4_13318_0_1dd_Smed_v4PMID:29674431
pharynxSMED30026544Mucin-19-like isoform X3SMESG000001496.1 SMESG000001495.1 dd_Smed_v4_14943_0_1dd_Smed_v4PMID:29674431
pharynxSMED30025688Protein tilB homologSMESG000058220.1 dd_Smed_v4_10124_0_1dd_Smed_v4PMID:29674431
pharynxSMED30026977SMED30026977SMESG000004247.1 dd_Smed_v4_19980_0_1dd_Smed_v4PMID:29674431
pharynxSMED30020574Dynein heavy chain axonemalSMESG000017294.1 dd_Smed_v4_6790_0_1dd_Smed_v4PMID:29674431
pharynxSMED30030220Helicase for meiosis 1SMESG000065404.1 dd_Smed_v4_9538_0_1dd_Smed_v4PMID:29674431
pharynxSMED30021479SMED30021479SMESG000017261.1 dd_Smed_v4_2030_0_1dd_Smed_v4PMID:29674431
pharynxSMED30033791cilia- and flagella-associated protein 161SMESG000028972.1 dd_Smed_v4_8229_0_1dd_Smed_v4PMID:29674431
pharynxSMED30030655Fibronectin type 3 and ankyrin repeat domains protein 1SMESG000030957.1 dd_Smed_v4_7496_0_1dd_Smed_v4PMID:29674431
pharynxSMED30025623SMED30025623SMESG000065670.1 SMED30027428smed_20140614PMID:28072387
pharynxSMED30025623SMED30025623SMESG000065670.1 SMED30027428smed_20140614PMID:28072387
pharynxSMED30025623SMED30025623SMESG000065670.1 SMED30027428smed_20140614PMID:28072387
pharynxSMED30025623SMED30025623SMESG000065670.1 dd_Smed_v4_10718_0_1dd_Smed_v4PMID:29674431
pharynxSMED30025608X1.A.G7.1SMESG000046817.1 SMESG000046814.1 dd_Smed_v4_1507_0_1dd_Smed_v4PMID:29674431
pharynxSMED30024952Coiled-coil domain containing 60SMESG000038986.1 dd_Smed_v4_14286_0_1dd_Smed_v4PMID:29674431
pharynxSMED30035040Protein FAM92A1SMESG000072750.1 dd_Smed_v4_5894_0_1dd_Smed_v4PMID:29674431
pharynxSMED30035859Neuropeptide Y prohormone-5SMESG000048959.1 BK007008smed_ncbi_20200123PMID:20967238
pharynxSMED30019452Ceramide glucosyltransferaseSMESG000070132.1 dd_Smed_v4_7543_0_1dd_Smed_v4PMID:29674431
pharynxSMED30015587Dual specificity protein phosphatase 14SMESG000037868.1 dd_Smed_v4_7558_0_1dd_Smed_v4PMID:29674431
pharynxSMED30016791Testis-expressed protein 9SMESG000007359.1 dd_Smed_v4_7007_0_1dd_Smed_v4PMID:29674431
pharynxSMED30014900Dimer_Tnp_hAT domain-containing proteinSMESG000051489.1 dd_Smed_v4_9709_0_1dd_Smed_v4PMID:29674431
pharynxSMED30013077SMED30013077SMESG000076350.1 dd_Smed_v4_7379_0_1dd_Smed_v4PMID:29674431
pharynxSMED30012091transmembrane protein 107SMESG000016814.1 dd_Smed_v4_9492_0_1dd_Smed_v4PMID:29674431
pharynxSMED30012464SMED30012464SMESG000035411.1 dd_Smed_v4_49258_0_1dd_Smed_v4PMID:29674431
pharynxSMED30013840Tektin-2SMESG000065255.1 SMESG000050057.1 dd_Smed_v4_2339_0_1dd_Smed_v4PMID:29674431
pharynxSMED30013334Glutathione peroxidaseSMESG000077750.1 dd_Smed_v4_662_0_1dd_Smed_v4PMID:29674431
pharynxSMED30018731MORN repeat-containing protein 5SMESG000023247.1 dd_Smed_v4_7020_0_1dd_Smed_v4PMID:29674431
pharynxSMED30013379IQ motif containing GSMESG000075453.1 dd_Smed_v4_7221_0_1dd_Smed_v4PMID:29674431
pharynxSMED30015703IQ domain-containing protein DSMESG000017912.1 dd_Smed_v4_7079_0_1dd_Smed_v4PMID:29674431
pharynxSMED30018435Alpha-int-2SMESG000021746.1 dd_Smed_v4_3365_0_1dd_Smed_v4PMID:29674431
pharynxSMED30011961Tensin 3SMESG000019881.1 dd_Smed_v4_4454_0_1dd_Smed_v4PMID:29674431
pharynxSMED30013768SMED30013768SMESG000056915.1 dd_Smed_v4_3761_0_1dd_Smed_v4PMID:29674431
pharynxSMED30015945Centrin-1SMESG000052182.1 SMESG000015458.1 dd_Smed_v4_3644_0_1dd_Smed_v4PMID:29674431
pharynxSMED30010910POU domain proteinSMESG000058834.1 dd_Smed_v4_13010_0_1dd_Smed_v4PMID:29674431
pharynxSMED30014044SMED30014044SMESG000079607.1 SMESG000072955.1 SMESG000049847.1 SMESG000049844.1 SMESG000049832.1 SMESG000049812.1 SMESG000049806.1 SMESG000049805.1 SMESG000049772.1 SMESG000049767.1 SMESG000049756.1 SMESG000049745.1 SMESG000049740.1 SMESG000049739.1 SMESG000049695.1 SMESG000049688.1 SMESG000049683.1 SMESG000049676.1 SMESG000049665.1 SMESG000049663.1 SMESG000049647.1 SMESG000049621.1 SMESG000049614.1 SMESG000049601.1 SMESG000049567.1 SMESG000049548.1 SMESG000040301.1 SMESG000040257.1 SMESG000032755.1 SMESG000032715.1 SMESG000022696.1 SMESG000022691.1 SMESG000022676.1 SMESG000022665.1 SMESG000022640.1 SMESG000022619.1 SMESG000022612.1 dd_Smed_v4_490_0_1dd_Smed_v4PMID:29674431
pharynxSMED30014044SMED30014044SMESG000079607.1 SMESG000049847.1 SMESG000049832.1 SMESG000049756.1 SMESG000040301.1 SMESG000022640.1 SMESG000072592.1 SMESG000049745.1 SMESG000049740.1 SMESG000049695.1 SMESG000049683.1 SMESG000049676.1 SMESG000049665.1 SMESG000049663.1 SMESG000049601.1 SMESG000049567.1 SMESG000040257.1 SMESG000022691.1 SMESG000022676.1 SMESG000049548.1 SMESG000049895.1 SMESG000049844.1 SMESG000049812.1 SMESG000022696.1 SMESG000022690.1 SMESG000022619.1 SMESG000072955.1 SMESG000049806.1 SMESG000049805.1 SMESG000032755.1 SMESG000032715.1 SMESG000022665.1 SMESG000000563.1 SMESG000000371.1 SMESG000049772.1 SMESG000049767.1 SMESG000049739.1 SMESG000049688.1 SMESG000049647.1 SMESG000049621.1 SMESG000049614.1 SMESG000022612.1 SMESG000029699.1 SMESG000000559.1 SMESG000000302.1 SMESG000049565.1 SMESG000065603.1 SMESG000000411.1 SMESG000000372.1 dd_Smed_v6_490_0dd_Smed_v6PMID:29674432
pharynxSMED30005770Cell number regulator 7SMESG000060415.1 dd_Smed_v4_743_0_1dd_Smed_v4PMID:29674431
pharynxSMED30004876Nuclear receptor subfamily 4 group ASMESG000063104.1 dd_Smed_v4_12229_0_1dd_Smed_v4PMID:29674431
pharynxSMED30012966SMED30012966SMESG000079607.1 SMESG000072955.1 SMESG000049847.1 SMESG000049844.1 SMESG000049832.1 SMESG000049812.1 SMESG000049806.1 SMESG000049805.1 SMESG000049772.1 SMESG000049767.1 SMESG000049756.1 SMESG000049745.1 SMESG000049740.1 SMESG000049739.1 SMESG000049695.1 SMESG000049688.1 SMESG000049683.1 SMESG000049676.1 SMESG000049665.1 SMESG000049663.1 SMESG000049647.1 SMESG000049621.1 SMESG000049614.1 SMESG000049601.1 SMESG000049567.1 SMESG000049548.1 SMESG000040301.1 SMESG000040257.1 SMESG000032755.1 SMESG000032715.1 SMESG000022696.1 SMESG000022691.1 SMESG000022676.1 SMESG000022665.1 SMESG000022640.1 SMESG000022619.1 SMESG000022612.1 dd_Smed_v4_490_0_1dd_Smed_v4PMID:29674431
pharynxSMED30012966SMED30012966SMESG000079607.1 SMESG000049847.1 SMESG000049832.1 SMESG000049756.1 SMESG000040301.1 SMESG000022640.1 SMESG000072592.1 SMESG000049745.1 SMESG000049740.1 SMESG000049695.1 SMESG000049683.1 SMESG000049676.1 SMESG000049665.1 SMESG000049663.1 SMESG000049601.1 SMESG000049567.1 SMESG000040257.1 SMESG000022691.1 SMESG000022676.1 SMESG000049548.1 SMESG000049895.1 SMESG000049844.1 SMESG000049812.1 SMESG000022696.1 SMESG000022690.1 SMESG000022619.1 SMESG000072955.1 SMESG000049806.1 SMESG000049805.1 SMESG000032755.1 SMESG000032715.1 SMESG000022665.1 SMESG000000563.1 SMESG000000371.1 SMESG000049772.1 SMESG000049767.1 SMESG000049739.1 SMESG000049688.1 SMESG000049647.1 SMESG000049621.1 SMESG000049614.1 SMESG000022612.1 SMESG000029699.1 SMESG000000559.1 SMESG000000302.1 SMESG000049565.1 SMESG000065603.1 SMESG000000411.1 SMESG000000372.1 dd_Smed_v6_490_0dd_Smed_v6PMID:29674432
pharynxSMED30008280Class E vacuolar protein-sorting machinery protein HSE1SMESG000077597.1 dd_Smed_v4_4190_0_1dd_Smed_v4PMID:29674431
pharynxSMED30008292Protein kinase domain-containing proteinSMESG000074938.1 SMESG000074937.1 dd_Smed_v4_9531_0_1dd_Smed_v4PMID:29674431
pharynxSMED30008650Beta-hexosaminidaseSMESG000008181.1 dd_Smed_v4_12408_0_1dd_Smed_v4PMID:29674431
pharynxSMED30008902inositol phosphoceramide mannosyltransferase 2-likeSMESG000059812.1 SMESG000045480.1 SMESG000045292.1 SMESG000045267.1 SMESG000037990.1 dd_Smed_v4_2174_0_1dd_Smed_v4PMID:29674431
pharynxSMED30001461SMED30001461SMESG000006530.1 meissmed_ncbi_20200123PMID:25254346
pharynxSMED30015825inositol phosphoceramide mannosyltransferase 2-likeSMESG000059812.1 SMESG000045480.1 SMESG000045292.1 SMESG000045267.1 SMESG000037990.1 dd_Smed_v4_2174_0_1dd_Smed_v4PMID:29674431
pharynxSMED30007379YTH domain-containing family protein 2SMESG000008619.1 dd_Smed_v4_7891_0_1dd_Smed_v4PMID:29674431
pharynxSMED30001292Disks large homolog 1SMESG000020500.1 dd_Smed_v4_5092_0_1dd_Smed_v4PMID:29674431
pharynxSMED30012858serine/threonine-protein kinase DCLK1SMESG000078466.1 dd_Smed_v4_13093_0_1dd_Smed_v4PMID:29674431
pharynxSMED30012858serine/threonine-protein kinase DCLK1 dd_Smed_v4_5129_0_1dd_Smed_v4PMID:29674431
pharynxSMED30000006Potassium voltage gated channel subfamily HSMESG000050992.1 dd_Smed_v4_14863_0_1dd_Smed_v4PMID:29674431
pharynxSMED30015511X-ray radiation resistance-associated protein 1SMESG000019618.1 dd_Smed_v4_13519_0_1dd_Smed_v4PMID:29674431
pharynxSMED30011784MeisSMESG000006530.1 meissmed_ncbi_20200123PMID:25254346
pharynxSMED30007680serine/threonine-protein kinase DCLK1SMESG000078466.1 dd_Smed_v4_13093_0_1dd_Smed_v4PMID:29674431
pharynxSMED30007680serine/threonine-protein kinase DCLK1 dd_Smed_v4_5129_0_1dd_Smed_v4PMID:29674431
pharynxSMED30007371nuclear mitotic apparatus protein 1 isoform X2SMESG000071994.1 dd_Smed_v4_10823_0_1dd_Smed_v4PMID:29674431
pharynxSMED30007886SMED30007886SMESG000055169.1 dd_Smed_v4_9583_0_1dd_Smed_v4PMID:29674431
pharynxSMED30001920SMED30001920SMESG000013429.1 dd_Smed_v4_21056_0_1dd_Smed_v4PMID:29674431
pharynxSMED30004208AAEL003283-PASMESG000004656.1 dd_Smed_v4_8909_0_1dd_Smed_v4PMID:29674431
pharynxSMED30006459Serine/threonine-protein kinase PLK4SMESG000076532.1 dd_Smed_v4_12637_0_1dd_Smed_v4PMID:29674431
pharynxSMED30002139Vacuole membrane protein 1SMESG000034612.1 dd_Smed_v4_1156_0_1dd_Smed_v4PMID:29674431
pharynxSMED30016387HAP1 N-terminal domain-containing proteinSMESG000065238.1 SMESG000065237.1 dd_Smed_v4_4847_0_1dd_Smed_v4PMID:29674431
pharynxSMED30007097Rho guanine nucleotide exchange factor 28SMESG000021797.1 dd_Smed_v4_5252_0_1dd_Smed_v4PMID:29674431
pharynxSMED30007279Neurocalcin-deltaSMESG000068889.1 dd_Smed_v4_2568_0_1dd_Smed_v4PMID:29674431
pharynxSMED30011699calcium/calmodulin-dependent protein kinase type IVSMESG000042100.1 dd_Smed_v4_10731_0_1dd_Smed_v4PMID:29674431
pharynxSMED30008461nuclear mitotic apparatus protein 1 isoform X2SMESG000071994.1 dd_Smed_v4_10823_0_1dd_Smed_v4PMID:29674431
pharynxSMED30015820Dual specificity tyrosine-phosphorylation-regulated kinase 4SMESG000042374.1 dd_Smed_v4_12591_0_1dd_Smed_v4PMID:29674431
pharynxSMED30013590Protein FAM221BSMESG000035378.1 dd_Smed_v4_10703_0_1dd_Smed_v4PMID:29674431
pharynxSMED30010674SPATA6 domain-containing proteinSMESG000053714.1 dd_Smed_v4_10543_0_1dd_Smed_v4PMID:29674431
pharynxSMED30017399Transmembrane protein 81SMESG000026648.1 dd_Smed_v4_10248_0_1dd_Smed_v4PMID:29674431
pharynxSMED30008363Homeobox protein Nkx-3.2SMESG000027004.1 Contig54835newmark_estsPMID:27612384
pharynxSMED30008363Homeobox protein Nkx-3.2SMESG000027004.1 Contig54835uc_Smed_v2PMID:27612384
pharynxSMED30005074Protein kinase domain-containing proteinSMESG000014613.1 dd_Smed_v4_4447_0_1dd_Smed_v4PMID:29674431
pharynxSMED30007718Flotillin-1SMESG000063612.1 dd_Smed_v4_1887_0_1dd_Smed_v4PMID:29674431
pharynxSMED30000108Glycerol-3-phosphate dehydrogenase [NAD( )]SMESG000008767.1 dd_Smed_v4_4661_0_1dd_Smed_v4PMID:29674431
pharynxSMED30014685SMED30014685SMESG000036334.1 dd_Smed_v4_13648_0_1dd_Smed_v4PMID:29674431
pharynxSMED30018823ATP-dependent 6-phosphofructokinaseSMESG000029088.1 dd_Smed_v4_1604_0_1dd_Smed_v4PMID:29674431
pharynxSMED30003662Serine/threonine-protein phosphatase 2A 55 kDa regulatory subunit BSMESG000074250.1 dd_Smed_v4_5857_0_1dd_Smed_v4PMID:29674431
pharynxSMED30018436SMED30018436SMESG000063104.1 dd_Smed_v4_16103_0_1dd_Smed_v4PMID:29674431
pharynxSMED30000740ets-1SMESG000033821.1 dd_Smed_v4_9185_0_1dd_Smed_v4PMID:29674431
pharynxSMED30003059SMED30003059SMESG000051575.1 SMESG000051531.1 dd_Smed_v4_7876_0_1dd_Smed_v4PMID:29674431
pharynxSMED30019717inositol phosphoceramide mannosyltransferase 2-likeSMESG000059812.1 SMESG000045480.1 SMESG000045292.1 SMESG000045267.1 SMESG000037990.1 dd_Smed_v4_2174_0_1dd_Smed_v4PMID:29674431
pharynxSMED30032581Protein elav-like proteinSMESG000073310.1 dd_Smed_v4_13151_0_1dd_Smed_v4PMID:29674431
pharynxSMED30031139WASH complex subunit 2CSMESG000014537.1 SMESG000014534.1 dd_Smed_v4_19560_0_1dd_Smed_v4PMID:29674431
pharynxSMED30035599meisSMESG000006530.1 meissmed_ncbi_20200123PMID:25254346
pharynxSMED30026298Protein kinase domain-containing proteinSMESG000014613.1 dd_Smed_v4_4447_0_1dd_Smed_v4PMID:29674431
pharynxSMED30022043Protein odd-skipped-related 2SMESG000032229.1 dd_Smed_v4_10039_0_1dd_Smed_v4PMID:29674431
pharynxSMED30020522ap2SMESG000022356.1 JX010470.1smed_ncbi_20200123PMID:24992682
pharynxSMED30025849Centrosome and spindle pole-associated protein 1SMESG000080361.1 dd_Smed_v4_13453_0_1dd_Smed_v4PMID:29674431
pharynxSMED30027914SMED30027914SMESG000040016.1 SMESG000040019.1 dd_Smed_v4_22578_0_1dd_Smed_v4PMID:29674431
pharynxSMED30029487Smed-NDKSMESG000062038.1 GU592830.1smed_ncbi_20200123PMID:25558068
pharynxSMED30029487Smed-NDKSMESG000062038.1 GU592830.1smed_ncbi_20200123PMID:24704339
pharynxSMED30020941beta 1,3 galactosyltransferase-1SMESG000008720.1 dd_Smed_v4_10927_0_1dd_Smed_v4PMID:29674431
pharynxSMED30034099SMED30034099SMESG000040016.1 SMESG000040019.1 dd_Smed_v4_22578_0_1dd_Smed_v4PMID:29674431
pharynxSMED30025020WD_REPEATS_REGION domain-containing proteinSMESG000023048.1 dd_Smed_v4_12135_0_1dd_Smed_v4PMID:29674431
pharynxSMED30021399Protein kintounSMESG000052588.1 dd_Smed_v4_14336_0_1dd_Smed_v4PMID:29674431
pharynxSMED30026485SMED30026485SMESG000078466.1 dd_Smed_v4_13093_0_1dd_Smed_v4PMID:29674431
pharynxSMED30035495Ankyrin repeat domain-containing 42SMESG000005009.1 dd_Smed_v4_10615_0_1dd_Smed_v4PMID:29674431
pharynxSMED30031496Leucine zipper transcription factor like 1SMESG000020499.1 dd_Smed_v4_8415_0_1dd_Smed_v4PMID:29674431
pharynxSMED30027244Protein TBATASMESG000022377.1 dd_Smed_v4_8051_0_1dd_Smed_v4PMID:29674431
pharynxSMED30033351SMED30033351SMESG000011684.1 dd_Smed_v4_15565_0_1dd_Smed_v4PMID:29674431
pharynxSMED30035382C2 domainSMESG000068709.1 dd_Smed_v4_7138_0_1dd_Smed_v4PMID:29674431
pharynxSMED30022963anaphase-promoting complex subunit 1SMESG000010770.1 SMESG000012375.1 tr5_7361mu_Smed_v1PMID:25558068
pharynxSMED30026336Beta-hexosaminidaseSMESG000008181.1 dd_Smed_v4_12408_0_1dd_Smed_v4PMID:29674431
pharynxSMED30023483INX-13SMESG000043575.1 dd_Smed_v4_11501_0_1dd_Smed_v4PMID:29674431
pharynxSMED30033245InnexinSMESG000061679.1 dd_Smed_v4_8390_0_1dd_Smed_v4PMID:29674431
pharynxSMED30033245InnexinSMESG000061679.1 dd_Smed_v6_8390_0dd_Smed_v6PMID:29674432
pharynxSMED30016902CRAL-TRIO domain-containing proteinSMESG000009876.1 dd_Smed_v4_2760_0_1dd_Smed_v4PMID:29674431
pharynxSMED30016902CRAL-TRIO domain-containing proteinSMESG000009876.1 dd_Smed_v6_2760_0dd_Smed_v6PMID:29674432
pharynxSMED30000248Ras-related protein Rab-11ASMESG000016036.1 dd_Smed_v4_4964_0_1dd_Smed_v4PMID:29674431
pharynxSMED30017210SMED30017210SMESG000004480.1 dd_Smed_v4_8607_0_1dd_Smed_v4PMID:29674431
pharynxSMED30010816SH3 and multiple ankyrin repeat domains protein 3SMESG000018129.1 dd_Smed_v4_4371_0_1dd_Smed_v4PMID:29674431
pharynxSMED30017762SMED30017762SMESG000016810.1 dd_Smed_v4_783_0_1dd_Smed_v4PMID:29674431
pharynxSMED30008679Leucine rich repeat containing 34SMESG000053819.1 dd_Smed_v4_9926_1_1dd_Smed_v4PMID:29674431
pharynxSMED30004756Small nuclear ribonucleoprotein Sm D2SMESG000032344.1 dd_Smed_v4_2994_0_1dd_Smed_v4PMID:29674431
pharynxSMED30019320Stromal interaction molecule 2SMESG000052167.1 SMESG000045892.1 SMESG000045881.1 dd_Smed_v4_7756_0_1dd_Smed_v4PMID:29674431
pharynxSMED30013183zf-3CxxC domain-containing proteinSMESG000033796.1 dd_Smed_v4_4477_0_1dd_Smed_v4PMID:29674431
pharynxSMED30009156WH2 domain-containing proteinSMESG000024265.1 dd_Smed_v4_3207_0_1dd_Smed_v4PMID:29674431
pharynxSMED30019364Si:ch211-193l2.10SMESG000062713.1 dd_Smed_v4_3203_0_1dd_Smed_v4PMID:29674431
pharynxSMED30007142Sperm surface protein Sp17SMESG000046919.1 dd_Smed_v4_4783_0_1dd_Smed_v4PMID:29674431
pharynxSMED30007142Sperm surface protein Sp17SMESG000046919.1 dd_Smed_v4_2279_0_1dd_Smed_v4PMID:29674431
pharynxSMED30014891Epoxide hydrolaseSMESG000002805.1 dd_Smed_v4_5113_0_1dd_Smed_v4PMID:29674431
pharynxSMED30021641SMED30021641SMESG000040565.1 dd_Smed_v4_4660_0_1dd_Smed_v4PMID:29674431
pharynxSMED30029745SMED30029745SMESG000003948.1 dd_Smed_v4_5093_0_1dd_Smed_v4PMID:29674431
pharynxSMED30032692Histone H3SMESG000074938.1 SMESG000074937.1 dd_Smed_v4_9531_0_1dd_Smed_v4PMID:29674431
pharynxSMED30028890Bravo_FIGEY domain-containing proteinSMESG000065363.1 SMESG000043141.1 dd_Smed_v4_1294_0_1dd_Smed_v4PMID:29674431
pharynxSMED30020178Ubiquitinyl hydrolase 1SMESG000057792.1 SMESG000057788.1 dd_Smed_v4_2744_0_1dd_Smed_v4PMID:29674431
pharynxSMED30021019CYTOSOL_AP domain-containing proteinSMESG000037599.1 dd_Smed_v4_181_0_1dd_Smed_v4PMID:29674431
pharynxSMED30021475SMED30021475SMESG000062708.1 dd_Smed_v4_18258_0_1dd_Smed_v4PMID:29674431
pharynxSMED30035586E3 ubiquitin-protein ligase ZSWIM2SMESG000064366.1 dd_Smed_v4_14099_0_1dd_Smed_v4PMID:29674431
pharynxSMED30020977SMED30020977SMESG000069851.1 dd_9493dd_Smed_v4PMID:29674431
pharynxSMED30020977SMED30020977SMESG000069851.1 dd_9493dd_Smed_v4PMID:29674431
pharynxSMED30020977SMED30020977SMESG000069851.1 dd_Smed_v6_9493_0dd_Smed_v6PMID:29674432
pharynxSMED30020977SMED30020977SMESG000069851.1 dd_Smed_v4_9493_0_1dd_Smed_v4PMID:29674431
pharynxSMED30035571Protein disulfide-isomerase A5SMESG000005268.1 dd_Smed_v4_1537_0_1dd_Smed_v4PMID:29674431
pharynxSMED30035571Protein disulfide-isomerase A5SMESG000005268.1 dd_Smed_v4_2070_0_1dd_Smed_v4PMID:29674431
pharynxSMED30022193SMED30022193SMESG000069851.1 dd_9493dd_Smed_v4PMID:29674431
pharynxSMED30022193SMED30022193SMESG000069851.1 dd_9493dd_Smed_v4PMID:29674431
pharynxSMED30022193SMED30022193SMESG000069851.1 dd_Smed_v6_9493_0dd_Smed_v6PMID:29674432
pharynxSMED30022193SMED30022193SMESG000069851.1 dd_Smed_v4_9493_0_1dd_Smed_v4PMID:29674431
pharynxSMED30032005SIAH-type domain-containing proteinSMESG000042443.1 dd_Smed_v4_13836_0_1dd_Smed_v4PMID:29674431
pharynxSMED30021868coiled-coil domain-containing protein 39SMESG000072035.1 SMESG000072034.1 dd_Smed_v4_5955_0_1dd_Smed_v4PMID:29674431
pharynxSMED30033139TNF receptor-associated factorSMESG000079607.1 SMESG000072955.1 SMESG000049847.1 SMESG000049844.1 SMESG000049832.1 SMESG000049812.1 SMESG000049806.1 SMESG000049805.1 SMESG000049772.1 SMESG000049767.1 SMESG000049756.1 SMESG000049745.1 SMESG000049740.1 SMESG000049739.1 SMESG000049695.1 SMESG000049688.1 SMESG000049683.1 SMESG000049676.1 SMESG000049665.1 SMESG000049663.1 SMESG000049647.1 SMESG000049621.1 SMESG000049614.1 SMESG000049601.1 SMESG000049567.1 SMESG000049548.1 SMESG000040301.1 SMESG000040257.1 SMESG000032755.1 SMESG000032715.1 SMESG000022696.1 SMESG000022691.1 SMESG000022676.1 SMESG000022665.1 SMESG000022640.1 SMESG000022619.1 SMESG000022612.1 dd_Smed_v4_490_0_1dd_Smed_v4PMID:29674431
pharynxSMED30033139TNF receptor-associated factorSMESG000079607.1 SMESG000049847.1 SMESG000049832.1 SMESG000049756.1 SMESG000040301.1 SMESG000022640.1 SMESG000072592.1 SMESG000049745.1 SMESG000049740.1 SMESG000049695.1 SMESG000049683.1 SMESG000049676.1 SMESG000049665.1 SMESG000049663.1 SMESG000049601.1 SMESG000049567.1 SMESG000040257.1 SMESG000022691.1 SMESG000022676.1 SMESG000049548.1 SMESG000049895.1 SMESG000049844.1 SMESG000049812.1 SMESG000022696.1 SMESG000022690.1 SMESG000022619.1 SMESG000072955.1 SMESG000049806.1 SMESG000049805.1 SMESG000032755.1 SMESG000032715.1 SMESG000022665.1 SMESG000000563.1 SMESG000000371.1 SMESG000049772.1 SMESG000049767.1 SMESG000049739.1 SMESG000049688.1 SMESG000049647.1 SMESG000049621.1 SMESG000049614.1 SMESG000022612.1 SMESG000029699.1 SMESG000000559.1 SMESG000000302.1 SMESG000049565.1 SMESG000065603.1 SMESG000000411.1 SMESG000000372.1 dd_Smed_v6_490_0dd_Smed_v6PMID:29674432
pharynxSMED30025215Fzd-1/2/7SMESG000040115.1 dd_Smed_v6_6353_0_1dd_Smed_v6PMID:28171748
pharynxSMED30031491Armadillo repeat containing 4SMESG000057827.1 dd_Smed_v4_5065_0_1dd_Smed_v4PMID:29674431
pharynxSMED30021825Expressed conserved proteinSMESG000021837.1 dd_Smed_v4_4104_0_1dd_Smed_v4PMID:29674431
pharynxSMED30021874CaveolinSMESG000052389.1 dd_Smed_v4_877_0_1dd_Smed_v4PMID:29674431
pharynxSMED30021874CaveolinSMESG000052389.1 dd_Smed_v6_877_0dd_Smed_v6PMID:29674432
pharynxSMED30031188Casein kinase ISMESG000050144.1 SMESG000050130.1 dd_Smed_v4_16169_0_1dd_Smed_v4PMID:29674431
pharynxSMED30026127sperm-associated antigen 8SMESG000072188.1 dd_Smed_v4_6123_0_1dd_Smed_v4PMID:29674431
pharynxSMED30020133SMED30020133SMESG000023496.1 dd_Smed_v4_21951_0_1dd_Smed_v4PMID:29674431
pharynxSMED30026513SMED30026513SMESG000005268.1 dd_Smed_v4_1537_0_1dd_Smed_v4PMID:29674431
pharynxSMED30029711SMED30029711SMESG000039804.1 dd_Smed_v4_5259_0_1dd_Smed_v4PMID:29674431
pharynxSMED30029711SMED30029711SMESG000039803.1 dd_Smed_v4_3788_0_1dd_Smed_v4PMID:29674431
pharynxSMED30027566SMED30027566SMESG000075236.1 dd_Smed_v4_7519_0_1dd_Smed_v4PMID:29674431
pharynxSMED30022778SMED30022778SMESG000079288.1 SMESG000017831.1 dd_Smed_v4_15746_0_1dd_Smed_v4PMID:29674431
pharynxSMED30025708SMED30025708SMESG000034967.1 dd_Smed_v4_4677_0_1dd_Smed_v4PMID:29674431
pharynxSMED30021753SMED30021753SMESG000043533.1 dd_Smed_v4_12718_0_1dd_Smed_v4PMID:29674431
pharynxSMED30021838DUF4709 domain-containing proteinSMESG000029222.1 dd_Smed_v4_13431_0_1dd_Smed_v4PMID:29674431
pharynxSMED30028223Stabilizer of axonemal microtubules 1SMESG000042230.1 dd_Smed_v4_5551_0_1dd_Smed_v4PMID:29674431
pharynxSMED30032675Glutamine-rich protein 2SMESG000081231.1 dd_Smed_v4_6048_0_1dd_Smed_v4PMID:29674431
pharynxSMED30034376slc6a-5SMESG000042091.1 Contig45795newmark_estsPMID:27612384
pharynxSMED30034376slc6a-5SMESG000042091.1 Contig45795uc_Smed_v2PMID:27612384
pharynxSMED30020666Glutamine-rich protein 2SMESG000081231.1 dd_Smed_v4_6048_0_1dd_Smed_v4PMID:29674431
pharynxSMED30020490SMED30020490SMESG000030489.1 dd_Smed_v4_11685_0_1dd_Smed_v4PMID:29674431
pharynxSMED30021882Disks large homolog 1SMESG000045568.1 dd_Smed_v4_8293_0_1dd_Smed_v4PMID:29674431
pharynxSMED30030659Fer-1-relatedSMESG000070967.1 dd_Smed_v4_4648_0_1dd_Smed_v4PMID:29674431
pharynxSMED30009429inhibin-1SMESG000062806.1 Contig48948newmark_estsPMID:27612384
pharynxSMED30009429inhibin-1SMESG000062806.1 Contig48948uc_Smed_v2PMID:27612384
pharynxSMED30017204SMED30017204SMESG000019898.1 dd_Smed_v4_4953_0_1dd_Smed_v4PMID:29674431
pharynxSMED30017663Fer-1-relatedSMESG000070967.1 dd_Smed_v4_4648_0_1dd_Smed_v4PMID:29674431
pharynxSMED30007891Galactosylceramide sulfotransferaseSMESG000021672.1 dd_Smed_v4_13130_0_1dd_Smed_v4PMID:29674431
pharynxSMED30016875Rho-associated kinaseSMESG000057753.1 dd_Smed_v4_2914_0_1dd_Smed_v4PMID:29674431
pharynxSMED30006230Sperm surface protein Sp17SMESG000046919.1 dd_Smed_v4_4783_0_1dd_Smed_v4PMID:29674431
pharynxSMED30006230Sperm surface protein Sp17SMESG000046919.1 dd_Smed_v4_2279_0_1dd_Smed_v4PMID:29674431
pharynxSMED30012160SMED30012160SMESG000069851.1 dd_9493dd_Smed_v4PMID:29674431
pharynxSMED30012160SMED30012160SMESG000069851.1 dd_9493dd_Smed_v4PMID:29674431
pharynxSMED30012160SMED30012160SMESG000069851.1 dd_Smed_v6_9493_0dd_Smed_v6PMID:29674432
pharynxSMED30012160SMED30012160SMESG000069851.1 dd_Smed_v4_9493_0_1dd_Smed_v4PMID:29674431
pharynxSMED30006343dynein heavy chain 5, axonemalSMESG000049144.1 dd_Smed_v4_4569_0_1dd_Smed_v4PMID:29674431
pharynxSMED30019874CalmodulinSMESG000010769.1 dd_Smed_v4_255_0_1dd_Smed_v4PMID:29674431
pharynxSMED30019874CalmodulinSMESG000010769.1 dd_Smed_v6_255_0dd_Smed_v6PMID:29674432
pharynxSMED30012361SMED30012361SMESG000010680.1 dd_Smed_v4_3652_0_1dd_Smed_v4PMID:29674431
pharynxSMED30017282nuclear factor Y complex B2SMESG000040141.1 KU366700smed_ncbi_20200123PMID:27304889
pharynxSMED30004957AnoctaminSMESG000033730.1 SMESG000033728.1 dd_Smed_v4_6514_0_1dd_Smed_v4PMID:29674431
pharynxSMED30010188Ankyrin repeat-containing domain proteinSMESG000011193.1 dd_Smed_v4_13251_0_1dd_Smed_v4PMID:29674431
pharynxSMED30013312CalpainSMESG000062904.1 SMESG000062902.1 dd_Smed_v4_1971_0_1dd_Smed_v4PMID:29674431
pharynxSMED30013312CalpainSMESG000062904.1 SMESG000062902.1 dd_Smed_v6_1971_0dd_Smed_v6PMID:29674432
pharynxSMED30000708Dynein heavy chain 5, axonemalSMESG000049144.1 dd_Smed_v4_4569_0_1dd_Smed_v4PMID:29674431
pharynxSMED30009735Bardet-Biedl syndrome 5 protein homologSMESG000052420.1 dd_Smed_v4_8523_0_1dd_Smed_v4PMID:29674431
pharynxSMED30007024G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000078415.1 dd_Smed_v4_24316_0_1dd_Smed_v4PMID:29674431
pharynxSMED30016511SMED30016511SMESG000072006.1 tr5_6444mu_Smed_v1PMID:25558068
pharynxSMED30009546Peptidase_M43 domain-containing proteinSMESG000019773.1 dd_Smed_v4_855_0_1dd_Smed_v4PMID:29674431
pharynxSMED30009546Peptidase_M43 domain-containing proteinSMESG000019773.1 dd_Smed_v4_855_0_1dd_Smed_v4PMID:30962434
pharynxSMED30019836CCDC151SMESG000007771.1 dd_Smed_v4_4526_0_1dd_Smed_v4PMID:29674431
pharynxSMED30019951t-SNARE coiled-coil homology domain-containing proteinSMESG000005677.1 dd_Smed_v4_4355_0_1dd_Smed_v4PMID:29674431
pharynxSMED30008550intraflagellar transport protein 20 homologSMESG000067757.1 dd_Smed_v4_9545_0_1dd_Smed_v4PMID:29674431
pharynxSMED30001242Mitogen-activated protein kinase kinase kinase 1aSMESG000017260.1 dd_Smed_v4_4322_0_1dd_Smed_v4PMID:29674431
pharynxSMED30017811Alpha actininSMESG000047739.1 dd_Smed_v4_1492_0_1dd_Smed_v4PMID:29674431
pharynxSMED30012991endoglycoceramidaseSMESG000030369.1 SMESG000030357.1 SMESG000030353.1 dd_Smed_v4_1570_0_1dd_Smed_v4PMID:29674431
pharynxSMED30015018SMED30015018SMESG000075952.1 dd_Smed_v4_4158_0_1dd_Smed_v4PMID:29674431
pharynxSMED30012814Protein CWC15-like proteinSMESG000010770.1 SMESG000012375.1 tr5_7361mu_Smed_v1PMID:25558068
pharynxSMED30016964AnoctaminSMESG000033730.1 SMESG000033728.1 dd_Smed_v4_6514_0_1dd_Smed_v4PMID:29674431
pharynxSMED30017491Spermatogenesis associated 1SMESG000029165.1 dd_Smed_v4_13541_0_1dd_Smed_v4PMID:29674431
pharynxSMED30012459SMED30012459SMESG000003156.1 dd_Smed_v4_2446_0_1dd_Smed_v4PMID:29674431
pharynxSMED30011242Synaptosomal-associated protein 29SMESG000001576.1 dd_Smed_v4_1819_0_1dd_Smed_v4PMID:29674431
pharynxSMED30010881SMED30010881SMESG000004195.1 dd_Smed_v4_991_0_1dd_Smed_v4PMID:29674431
pharynxSMED30003507Adenylate kinase 9SMESG000043841.1 dd_Smed_v4_9617_0_1dd_Smed_v4PMID:29674431
pharynxSMED30003507Adenylate kinase 9SMESG000043841.1 dd_Smed_v6_9617_0dd_Smed_v6PMID:29674432
pharynxSMED30006931SMED30006931SMESG000040565.1 dd_Smed_v4_4660_0_1dd_Smed_v4PMID:29674431
pharynxSMED30018872Ig-like domain-containing proteinSMESG000042318.1 dd_Smed_v4_11702_0_1dd_Smed_v4PMID:30962434
pharynxSMED30018872Ig-like domain-containing proteinSMESG000042318.1 dd_Smed_v4_11702_0_1dd_Smed_v4PMID:29674431
pharynxSMED30005253EF-hand domain-containing family member C2SMESG000076759.1 dd_Smed_v4_6035_0_1dd_Smed_v4PMID:29674431
pharynxSMED30001490ADF-H domain-containing proteinSMESG000080129.1 dd_Smed_v4_260_0_1dd_Smed_v4PMID:29674431
pharynxSMED30014469DUF862 domain-containing proteinSMESG000007684.1 dd_Smed_v4_1938_0_1dd_Smed_v4PMID:29674431
pharynxSMED30008950SMED30008950SMESG000071333.1 dd_Smed_v4_3647_0_1dd_Smed_v4PMID:29674431
pharynxSMED30012757Tektin-4SMESG000068903.1 dd_Smed_v4_4872_0_1dd_Smed_v4PMID:29674431
pharynxSMED30019240Protein FAM151ASMESG000000164.1 dd_Smed_v4_9939_0_1dd_Smed_v4PMID:29674431
pharynxSMED30007243Polypeptide N-acetylgalactosaminyltransferaseSMESG000081451.1 dd_Smed_v4_5333_0_1dd_Smed_v4PMID:29674431
pharynxSMED30014612SMED30014612SMESG000047053.1 dd_Smed_v4_7303_0_1dd_Smed_v4PMID:29674431
pharynxSMED30007496C-type lectin domain-containing proteinSMESG000016262.1 dd_Smed_v4_5187_0_1dd_Smed_v4PMID:30962434
pharynxSMED30007496C-type lectin domain-containing proteinSMESG000016262.1 dd_Smed_v4_5187_0_1dd_Smed_v4PMID:29674431
pharynxSMED30015079Dynein heavy chain 5, axonemalSMESG000049144.1 dd_Smed_v4_4569_0_1dd_Smed_v4PMID:29674431
pharynxSMED30009956SMED30009956SMESG000022273.1 dd_Smed_v4_8344_0_1dd_Smed_v4PMID:29674431
pharynxSMED30009956SMED30009956SMESG000022273.1 dd_Smed_v6_8344_0dd_Smed_v6PMID:29674432
pharynxSMED30009956SMED30009956SMESG000022272.1 dd_Smed_v6_10991_0dd_Smed_v6PMID:29674432
pharynxSMED30009956SMED30009956SMESG000022272.1 dd_Smed_v4_10991_0_1dd_Smed_v4PMID:29674431
pharynxSMED30008080Transmembrane protein 45BSMESG000060226.1 SMESG000021986.1 dd_Smed_v4_1542_0_1dd_Smed_v4PMID:29674431
pharynxSMED30000699Ig-like domain-containing proteinSMESG000035909.1 dd_Smed_v4_6345_0_1dd_Smed_v4PMID:29674431
pharynxSMED30016203SMED30016203SMESG000030489.1 dd_Smed_v4_11685_0_1dd_Smed_v4PMID:29674431
pharynxSMED30010749BZIP domain-containing proteinSMESG000028072.1 dd_Smed_v4_6373_0_1dd_Smed_v4PMID:29674431
pharynxSMED30002517Expressed conserved proteinSMESG000004480.1 dd_Smed_v4_8607_0_1dd_Smed_v4PMID:29674431
pharynxSMED30016899Transcription factor ETV6SMESG000035130.1 dd_Smed_v4_5087_0_1dd_Smed_v4PMID:29674431
pharynxSMED30023825LITAF domain-containing proteinSMESG000020853.1 dd_Smed_v4_353_0_1dd_Smed_v4PMID:29674431
pharynxSMED30023540Serine/threonine-protein phosphatase 2B catalytic subunitSMESG000064848.1 dd_Smed_v4_2045_0_1dd_Smed_v4PMID:29674431
pharynxSMED30025711G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000050757.1 dd_Smed_v4_23525_0_1dd_Smed_v4PMID:29674431
pharynxSMED30025105Plastin 3SMESG000081126.1 SMESG000081113.1 dd_Smed_v4_749_0_1dd_Smed_v4PMID:29674431
pharynxSMED30021417SMED30021417SMESG000051911.1 dd_Smed_v4_5276_0_1dd_Smed_v4PMID:29674431
pharynxSMED30022225Bidirectional sugar transporter SWEETSMESG000012540.1 dd_Smed_v4_12308_0_1dd_Smed_v4PMID:29674431
pharynxSMED30026803X1.D.D8.3SMESG000053883.1 dd_Smed_v4_8540_0_1dd_Smed_v4PMID:29674431
pharynxSMED30022443Ankyrin repeat proteinSMESG000009520.1 SMESG000009519.1 dd_Smed_v4_9418_0_1dd_Smed_v4PMID:29674431
pharynxSMED30029166Coiled-coil domain-containing protein 178SMESG000021560.1 dd_Smed_v4_8905_0_1dd_Smed_v4PMID:29674431
pharynxSMED30027035Pseudouridine synthaseSMESG000051935.1 dd_Smed_v4_12745_0_1dd_Smed_v4PMID:29674431
pharynxSMED30030287Serine/threonine-protein phosphataseSMESG000064848.1 dd_Smed_v4_2045_0_1dd_Smed_v4PMID:29674431
pharynxSMED30028990Protein containing PTH2 domainSMESG000055936.1 dd_Smed_v4_6409_0_1dd_Smed_v4PMID:29674431
pharynxSMED30023475SMED30023475SMESG000047326.1 dd_Smed_v4_13864_0_1dd_Smed_v4PMID:29674431
pharynxSMED30033093SMED30033093SMESG000023005.1 dd_Smed_v4_7772_0_1dd_Smed_v4PMID:29674431
pharynxSMED30033407C2H2-type domain-containing proteinSMESG000059040.1 dd_Smed_v4_9365_0_1dd_Smed_v4PMID:29674431
pharynxSMED30033407C2H2-type domain-containing proteinSMESG000059040.1 NB.10.6hsmed_ncbi_20200123PMID:19852954
pharynxSMED30034198SMED30034198SMESG000002829.1 dd_Smed_v4_12484_0_1dd_Smed_v4PMID:29674431
pharynxSMED30024951SMED30024951SMESG000004925.1 dd_Smed_v4_8053_0_1dd_Smed_v4PMID:29674431
pharynxSMED30031190SMED30031190SMESG000021216.1 dd_Smed_v4_18390_0_1dd_Smed_v4PMID:29674431
pharynxSMED30027937SMED30027937SMESG000004925.1 dd_Smed_v4_8053_0_1dd_Smed_v4PMID:29674431
pharynxSMED30030326SMED30030326SMESG000001071.1 SMESG000001061.1 SMESG000001060.1 dd_Smed_v4_9824_0_1dd_Smed_v4PMID:29674431
pharynxSMED30034490FGFR1SMESG000036598.1 SMESG000036590.1 dd_Smed_v4_6020_0_1dd_Smed_v4PMID:29674431
pharynxSMED30035848Tubulin beta chainSMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044888.1 SMESG000035755.1 dd_Smed_v4_83_0_1dd_Smed_v4PMID:29674431
pharynxSMED30035848Tubulin beta chainSMESG000022928.1 SMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044888.1 SMESG000035755.1 dd_Smed_v6_83_0dd_Smed_v6PMID:29674432
pharynxSMED30032616TSNAXIP1_N domain-containing proteinSMESG000025884.1 dd_Smed_v4_9605_0_1dd_Smed_v4PMID:29674431
pharynxSMED30031010RRM domain-containing proteinSMESG000028681.1 dd_Smed_v4_5327_0_1dd_Smed_v4PMID:29674431
pharynxSMED30031010RRM domain-containing proteinSMESG000028681.1 dd_Smed_v6_5327_0dd_Smed_v6PMID:29674432
pharynxSMED30028743Regulator of G-protein signaling 22SMESG000069110.1 dd_Smed_v4_11778_0_1dd_Smed_v4PMID:29674431
pharynxSMED30023193Tau tubulin kinaseSMESG000026133.1 dd_Smed_v4_12470_0_1dd_Smed_v4PMID:29674431
pharynxSMED30022522Centrin-3SMESG000016538.1 dd_Smed_v4_11582_0_1dd_Smed_v4PMID:29674431
pharynxSMED30029152SMED30029152SMESG000017036.1 dd_Smed_v4_12630_0_1dd_Smed_v4PMID:29674431
pharynxSMED30030365Protein FAM161ASMESG000042541.1 dd_Smed_v4_15201_0_1dd_Smed_v4PMID:29674431
pharynxSMED30020806Neuropeptide 12SMESG000038586.1 GU295182smed_ncbi_20200123PMID:20967238
pharynxSMED30035448Kinesin motor domain proteinSMESG000075721.1 dd_Smed_v4_11799_0_1dd_Smed_v4PMID:29674431
pharynxSMED30035611Fras1 related extracellular matrix proteinSMESG000032220.1 dd_Smed_v4_2407_0_1dd_Smed_v4PMID:29674431
pharynxSMED30031880Family with sequence similarity 227 member BSMESG000052176.1 SMESG000046302.1 dd_Smed_v4_15102_0_1dd_Smed_v4PMID:29674431
pharynxSMED30022914neurofilament heavy polypeptide isoform X5SMESG000058734.1 dd_Smed_v6_11421_0dd_Smed_v6PMID:29674432
pharynxSMED30022914neurofilament heavy polypeptide isoform X5SMESG000058734.1 dd_Smed_v4_11421_0_1dd_Smed_v4PMID:29674431
pharynxSMED30021916SMED30021916SMESG000001722.1 dd_Smed_v4_19988_0_1dd_Smed_v4PMID:29674431
pharynxSMED30030079SMED30030079SMESG000042010.1 dd_Smed_v4_8745_0_1dd_Smed_v4PMID:29674431
pharynxSMED30034323Ras family proteinSMESG000053083.1 dd_Smed_v4_11357_0_1dd_Smed_v4PMID:29674431
pharynxSMED30025542Leucine-rich repeat-containing protein 71SMESG000006778.1 dd_Smed_v4_12043_0_1dd_Smed_v4PMID:29674431
pharynxSMED30028668Leucine-rich repeat-containing protein 71SMESG000006778.1 dd_Smed_v4_12043_0_1dd_Smed_v4PMID:29674431
pharynxSMED30033487cilia- and flagella-associated protein 70SMESG000009189.1 dd_Smed_v4_10893_0_1dd_Smed_v4PMID:29674431
pharynxSMED30024663Dynein regulatory complex subunit 3SMESG000047633.1 SMESG000047632.1 dd_Smed_v4_12541_0_1dd_Smed_v4PMID:29674431
pharynxSMED30034649SMED30034649SMESG000026966.1 SMESG000026953.1 dd_Smed_v4_10998_0_1dd_Smed_v4PMID:29674431
pharynxSMED30034905Gonadotropin-releasing hormone like-1SMESG000061019.1 GU295185smed_ncbi_20200123PMID:20967238
pharynxSMED30034905Gonadotropin-releasing hormone like-1SMESG000061019.1 GU295185.1smed_ncbi_20200123PMID:30485821
pharynxSMED30027319SMED30027319SMESG000006149.1 dd_Smed_v4_11660_0_1dd_Smed_v4PMID:29674431
pharynxSMED30034660Spectrin beta chain, non-erythrocytic 5SMESG000023006.1 dd_Smed_v4_2514_0_1dd_Smed_v4PMID:29674431
pharynxSMED30034660Spectrin beta chain, non-erythrocytic 5SMESG000023006.1 dd_Smed_v6_2514_0dd_Smed_v6PMID:29674432
pharynxSMED30032498NPHP8SMESG000076081.1 dd_Smed_v4_11425_0_1dd_Smed_v4PMID:29674431
pharynxSMED30032498NPHP8SMESG000076081.1 dd_Smed_v6_11425_0dd_Smed_v6PMID:29674432
pharynxSMED30035592E3 ubiquitin-protein ligase mind-bombSMESG000031930.1 dd_Smed_v4_1317_0_1dd_Smed_v4PMID:29674431
pharynxSMED30030030SMED30030030SMESG000007276.1 dd_Smed_v4_11992_0_1dd_Smed_v4PMID:29674431
pharynxSMED30029517SMED30029517SMESG000071450.1 dd_Smed_v4_3079_0_1dd_Smed_v4PMID:29674431
pharynxSMED30031219deleted in lung and esophageal cancer protein 1SMESG000079694.1 dd_Smed_v4_10833_0_1dd_Smed_v4PMID:29674431
pharynxSMED30032215death domain-containing protein 1SMESG000008533.1 dd_Smed_v4_13807_0_1dd_Smed_v4PMID:29674431
pharynxSMED30032215death domain-containing protein 1SMESG000008533.1 dd_Smed_v6_13807_0dd_Smed_v6PMID:29674432
pharynxSMED30029350Serine incorporator 3SMESG000020805.1 dd_Smed_v4_1130_0_1dd_Smed_v4PMID:29674431
pharynxSMED30029668Adenylate kinase isoenzyme 5SMESG000020486.1 SMESG000020480.1 dd_Smed_v4_5119_0_1dd_Smed_v4PMID:29674431
pharynxSMED30022167SMED30022167SMESG000031417.1 dd_Smed_v4_11958_0_1dd_Smed_v4PMID:29674431
pharynxSMED30034016Sperm surface protein Sp17SMESG000046919.1 dd_Smed_v4_4783_0_1dd_Smed_v4PMID:29674431
pharynxSMED30021820Guanylate cyclaseSMESG000056411.1 dd_Smed_v4_11767_0_1dd_Smed_v4PMID:29674431
pharynxSMED30033196SMED30033196SMESG000051944.1 dd_Smed_v4_14960_0_1dd_Smed_v4PMID:29674431
pharynxSMED30034141Leucine-rich repeat-containing protein 27SMESG000073140.1 dd_Smed_v4_13740_0_1dd_Smed_v4PMID:29674431
pharynxSMED30003902Tetratricopeptide repeat protein 21BSMESG000011579.1 dd_Smed_v4_12056_0_1dd_Smed_v4PMID:29674431
pharynxSMED30017314Dynein regulatory complex subunit 7SMESG000078850.1 dd_Smed_v4_12588_0_1dd_Smed_v4PMID:29674431
pharynxSMED30013060Transcription factor IIIB 90 kDa subunitSMESG000049775.1 dd_Smed_v6_1437_0dd_Smed_v6PMID:29674432
pharynxSMED30013060Transcription factor IIIB 90 kDa subunitSMESG000049775.1 dd_Smed_v4_1437_0_1dd_Smed_v4PMID:29674431
pharynxSMED30014748Ptk7SMESG000072430.1 dd_Smed_v4_6999_0_1dd_Smed_v4PMID:29674431
pharynxSMED30000918Coiled-coil domain containing 13SMESG000058204.1 dd_Smed_v4_12055_0_1dd_Smed_v4PMID:29674431
pharynxSMED30002228Ig-like domain-containing proteinSMESG000024613.1 dd_Smed_v4_7050_0_1dd_Smed_v4PMID:29674431
pharynxSMED30008055Transient receptor potential cation channel subfamily M memberSMESG000068518.1 dd_Smed_v4_10717_0_1dd_Smed_v4PMID:29674431
pharynxSMED30006633SMED30006633SMESG000040042.1 dd_Smed_v4_11386_0_1dd_Smed_v4PMID:29674431
pharynxSMED30004875EF-hand calcium-binding domain-containing protein 6SMESG000058629.1 dd_Smed_v4_20435_0_1dd_Smed_v4PMID:29674431
pharynxSMED30005546Coronin-1BSMESG000037126.1 SMESG000026646.1 dd_Smed_v6_448_0dd_Smed_v6PMID:29674432
pharynxSMED30017410Peptidoglycan-recognition proteinSMESG000004536.1 dd_Smed_v4_817_1_1dd_Smed_v4PMID:29674431
pharynxSMED30017410Peptidoglycan-recognition proteinSMESG000004536.1 dd_Smed_v6_817_1dd_Smed_v6PMID:29674432
pharynxSMED30006515ZZ-type domain-containing proteinSMESG000055420.1 dd_Smed_v4_10173_0_1dd_Smed_v4PMID:29674431
pharynxSMED30002944GGACT domain-containing proteinSMESG000081395.1 dd_Smed_v4_8685_0_1dd_Smed_v4PMID:29674431
pharynxSMED30016140methylmalonyl-CoA mutase, mitochondrialSMESG000014335.1 dd_Smed_v4_2255_0_1dd_Smed_v4PMID:29674431
pharynxSMED30004158Tetratricopeptide repeat protein 25SMESG000067442.1 dd_Smed_v6_3933_0dd_Smed_v6PMID:29674432
pharynxSMED30004158Tetratricopeptide repeat protein 25SMESG000067442.1 dd_Smed_v4_3933_0_1dd_Smed_v4PMID:29674431
pharynxSMED30011227Decapping enzyme like-1 proteinSMESG000037126.1 SMESG000026646.1 dd_Smed_v6_448_0dd_Smed_v6PMID:29674432
pharynxSMED30008325Fatty acid synthaseSMESG000020850.1 dd_Smed_v4_10967_0_1dd_Smed_v4PMID:29674431
pharynxSMED30004042dynein heavy chain 3, axonemalSMESG000013737.1 SMESG000013731.1 dd_Smed_v4_23484_0_1dd_Smed_v4PMID:29674431
pharynxSMED30004042dynein heavy chain 3, axonemalSMESG000013738.1 SMESG000013737.1 dd_Smed_v4_9009_0_1dd_Smed_v4PMID:29674431
pharynxSMED30004423EF-hand domain-containing proteinSMESG000004207.1 dd_Smed_v4_14319_0_1dd_Smed_v4PMID:29674431
pharynxSMED30011027Dynein axonemal assembly factor 4SMESG000052823.1 dd_Smed_v4_12396_0_1dd_Smed_v4PMID:29674431
pharynxSMED30002718Family with sequence similarity 227 member BSMESG000052176.1 SMESG000046302.1 dd_Smed_v4_15102_0_1dd_Smed_v4PMID:29674431
pharynxSMED30018999SMED30018999SMESG000058251.1 dd_Smed_v4_10158_0_1dd_Smed_v4PMID:29674431
pharynxSMED30006210Coiled-coil domain-containing protein 17SMESG000052241.1 SMESG000052237.1 SMESG000052236.1 SMESG000046258.1 dd_Smed_v4_14654_0_1dd_Smed_v4PMID:29674431
pharynxSMED30005093NPHP5SMESG000005436.1 dd_Smed_v4_11329_0_1dd_Smed_v4PMID:29674431
pharynxSMED30018939tubulin polyglutamylase TTLL4-likeSMESG000056158.1 dd_Smed_v4_17034_0_1dd_Smed_v4PMID:29674431
pharynxSMED30018900Intraflagellar transport protein 56SMESG000031670.1 dd_Smed_v4_12618_0_1dd_Smed_v4PMID:29674431
pharynxSMED30012017SMED30012017SMESG000022399.1 dd_Smed_v6_708_0dd_Smed_v6PMID:29674432
pharynxSMED30012017SMED30012017SMESG000022399.1 dd_Smed_v4_708_0_1dd_Smed_v4PMID:29674431
pharynxSMED30019401Spermatogenesis-associated 17SMESG000047741.1 dd_Smed_v4_6435_0_1dd_Smed_v4PMID:29674431
pharynxSMED30005537TIGR00341 family proteinSMESG000062412.1 dd_Smed_v4_9934_0_1dd_Smed_v4PMID:29674431
pharynxSMED30008076Reverse transcriptase domain-containing proteinSMESG000008737.1 dd_Smed_v4_540_0_1dd_Smed_v4PMID:29674431
pharynxSMED30001155SMED30001155SMESG000043660.1 dd_Smed_v4_15839_0_1dd_Smed_v4PMID:29674431
pharynxSMED30012954centriolinSMESG000006866.1 dd_Smed_v4_10369_0_1dd_Smed_v4PMID:29674431
pharynxSMED30019133SMED30019133SMESG000019555.1 dd_Smed_v4_6722_0_1dd_Smed_v4PMID:29674431
pharynxSMED30005449SMED30005449SMESG000014251.1 dd_Smed_v4_9793_0_1dd_Smed_v4PMID:29674431
pharynxSMED30009251coiled-coil domain-containing protein 146SMESG000006416.1 dd_Smed_v6_6858_0dd_Smed_v6PMID:29674432
pharynxSMED30009251coiled-coil domain-containing protein 146SMESG000006416.1 dd_Smed_v4_6858_0_1dd_Smed_v4PMID:29674431
pharynxSMED30002655Ig-like domain-containing proteinSMESG000079770.1 dd_Smed_v6_1914_0dd_Smed_v6PMID:29674432
pharynxSMED30002655Ig-like domain-containing proteinSMESG000079770.1 dd_Smed_v4_1914_0_1dd_Smed_v4PMID:29674431
pharynxSMED30015973myosin-11SMESG000064787.1 dd_Smed_v4_13489_0_1dd_Smed_v4PMID:29674431
pharynxSMED30000212Vacuolar protein sorting-associated protein 26BSMESG000026617.1 dd_Smed_v4_912_0_1dd_Smed_v4PMID:29674431
pharynxSMED30008756SMED30008756SMESG000007049.1 dd_Smed_v4_14707_0_1dd_Smed_v4PMID:29674431
pharynxSMED30016369SMED30016369SMESG000022115.1 dd_Smed_v4_12348_0_1dd_Smed_v4PMID:29674431
pharynxSMED30000972Leucine-rich repeat-containing protein 71SMESG000006778.1 dd_Smed_v4_12043_0_1dd_Smed_v4PMID:29674431
pharynxSMED30011943Fibronectin type III and ankyrin repeat domains 1SMESG000033969.1 dd_Smed_v4_7571_0_1dd_Smed_v4PMID:29674431
pharynxSMED30010500Fibronectin type III domain proteinSMESG000033545.1 dd_Smed_v4_15017_0_1dd_Smed_v4PMID:29674431
pharynxSMED30006263SMED30006263SMESG000056319.1 SMESG000056318.1 SMESG000022275.1 dd_Smed_v4_674_0_1dd_Smed_v4PMID:29674431
pharynxSMED30006263SMED30006263SMESG000056318.1 dd_Smed_v4_2292_0_1dd_Smed_v4PMID:29674431
pharynxSMED30006263SMED30006263SMESG000056319.1 SMESG000056318.1 SMESG000022275.1 dd_Smed_v6_674_0dd_Smed_v6PMID:29674432
pharynxSMED30009231Transmembrane proteinSMESG000002927.1 dd_Smed_v4_12002_0_1dd_Smed_v4PMID:29674431
pharynxSMED30009231Transmembrane proteinSMESG000002927.1 dd_Smed_v4_16643_0_1dd_Smed_v4PMID:29674431
pharynxSMED30014047SMED30014047SMESG000025950.1 dd_Smed_v4_12336_0_1dd_Smed_v4PMID:29674431
pharynxSMED30003944EF-hand domain family, member D1SMESG000009754.1 dd_Smed_v4_1467_0_1dd_Smed_v4PMID:29674431
pharynxSMED30003408Centrosomal protein of 89 kDaSMESG000031345.1 dd_Smed_v4_13073_0_1dd_Smed_v4PMID:29674431
pharynxSMED30014347plexin ASMESG000049328.1 SMESG000006542.1 SMESG000006541.1 dd_Smed_v4_11934_0_1dd_Smed_v4PMID:29674431
pharynxSMED30008231Calponin-homology (CH) domain-containing proteinSMESG000036289.1 dd_Smed_v4_5824_0_1dd_Smed_v4PMID:29674431
pharynxSMED30010029T-complex-associated-testis-expressed 1SMESG000023093.1 dd_Smed_v4_12524_0_1dd_Smed_v4PMID:29674431
pharynxSMED30001570Cyclin-dependent kinase 17SMESG000078466.1 SMESG000050786.1 SMESG000024968.1 dd_Smed_v4_3128_0_1dd_Smed_v4PMID:29674431
pharynxSMED30000921RNA-binding protein Nova-1SMESG000066554.1 dd_Smed_v4_679_0_1dd_Smed_v4PMID:29674431
pharynxSMED30007783Leucine, glutamate and lysine rich 1SMESG000052799.1 dd_Smed_v4_16355_0_1dd_Smed_v4PMID:29674431
pharynxSMED30011535CRAL-TRIO domain-containing proteinSMESG000081079.1 SMESG000081078.1 dd_Smed_v4_14557_0_1dd_Smed_v4PMID:29674431
pharynxSMED30001672NADH dehydrogenase [ubiquinone] iron-sulfur protein 7, mitochondrialSMESG000035542.1 dd_Smed_v4_4432_0_1dd_Smed_v4PMID:29674431
pharynxSMED30017180Dynein regulatory complex protein 1SMESG000072168.1 dd_Smed_v4_8761_0_1dd_Smed_v4PMID:29674431
pharynxSMED30023017SMED30023017SMESG000065348.1 dd_Smed_v4_1320_0_1dd_Smed_v4PMID:29674431
pharynxSMED30023017SMED30023017SMESG000065348.1 dd_1320dd_Smed_v4PMID:29674431
pharynxSMED30023017SMED30023017SMESG000065348.1 dd_1320dd_Smed_v4PMID:29674431
pharynxSMED30031490SMED30031490SMESG000017778.1 dd_Smed_v4_10175_0_1dd_Smed_v4PMID:29674431
pharynxSMED30032610WD_REPEATS_REGION domain-containing proteinSMESG000060483.1 dd_Smed_v4_8615_0_1dd_Smed_v4PMID:29674431
pharynxSMED30034888Dynein heavy chain 5, axonemalSMESG000049144.1 dd_Smed_v4_4569_0_1dd_Smed_v4PMID:29674431
pharynxSMED30028267SMED30028267SMESG000048027.1 dd_Smed_v4_4822_0_1dd_Smed_v4PMID:29674431
pharynxSMED30025195SMED30025195SMESG000001693.1 dd_Smed_v4_10480_0_1dd_Smed_v4PMID:29674431
pharynxSMED30035460Ubiquitin-conjugating enzyme E2 D2SMESG000064169.1 dd_Smed_v6_153_0dd_Smed_v6PMID:29674432
pharynxSMED30032070SMED30032070SMESG000079312.1 dd_Smed_v4_16775_0_1dd_Smed_v4PMID:29674431
pharynxSMED30007403Protein phosphatase 1 regulatory subunit 42SMESG000014888.1 dd_Smed_v4_7268_1_1dd_Smed_v4PMID:29674431
pharynxSMED300030531-acyl-sn-glycerol-3-phosphate acyltransferase deltaSMESG000056953.1 dd_Smed_v4_5643_0_1dd_Smed_v4PMID:29674431
pharynxSMED300030531-acyl-sn-glycerol-3-phosphate acyltransferase deltaSMESG000081135.1 Contig3433GPL15192PMID:23079596
pharynxSMED30013041SMED30013041SMESG000049878.1 dd_Smed_v4_4914_0_1dd_Smed_v4PMID:29674431
pharynxSMED30013041SMED30013041SMESG000049878.1 dd_Smed_v6_4914_0dd_Smed_v6PMID:29674432
pharynxSMED30013149MIEAP domain-containing proteinSMESG000019081.1 dd_Smed_v4_6321_0_1dd_Smed_v4PMID:29674431
pharynxSMED30013149MIEAP domain-containing proteinSMESG000019081.1 dd_Smed_v6_6321_0dd_Smed_v6PMID:29674432
pharynxSMED30005158WD_REPEATS_REGION domain-containing proteinSMESG000071691.1 dd_Smed_v4_6137_0_1dd_Smed_v4PMID:29674431
pharynxSMED30003780Serine/threonine-protein kinase 36SMESG000076885.1 dd_Smed_v4_11067_0_1dd_Smed_v4PMID:29674431
pharynxSMED30003406Bestrophin homologSMESG000060552.1 dd_Smed_v4_4179_0_1dd_Smed_v4PMID:29674431
pharynxSMED30013424WD repeat domain 60SMESG000040271.1 dd_Smed_v4_10032_0_1dd_Smed_v4PMID:29674431
pharynxSMED30019531NPHP6SMESG000072747.1 dd_Smed_v4_7145_0_1dd_Smed_v4PMID:29674431
pharynxSMED30008784hypothetical proteinSMESG000047305.1 dd_Smed_v4_9312_0_1dd_Smed_v4PMID:29674431
pharynxSMED30003032SMED30003032SMESG000061110.1 dd_Smed_v4_11638_0_1dd_Smed_v4PMID:29674431
pharynxSMED30008698WSC domain-containing proteinSMESG000074503.1 dd_Smed_v4_21823_0_1dd_Smed_v4PMID:29674431
pharynxSMED30014257Oxysterol-binding proteinSMESG000008795.1 dd_Smed_v4_4931_0_1dd_Smed_v4PMID:29674431
pharynxSMED30004395DENN domain-containing protein 11SMESG000068092.1 dd_Smed_v4_8805_0_1dd_Smed_v4PMID:29674431
pharynxSMED30008351SMED30008351SMESG000081198.1 dd_Smed_v4_39279_0_1dd_Smed_v4PMID:29674431
pharynxSMED30000090SMED30000090SMESG000051911.1 dd_Smed_v4_5276_0_1dd_Smed_v4PMID:29674431
pharynxSMED30012926SMED30012926SMESG000059195.1 SMESG000059194.1 SMESG000059193.1 dd_Smed_v4_1940_0_1dd_Smed_v4PMID:29674431
pharynxSMED30012926SMED30012926SMESG000059195.1 SMESG000059194.1 SMESG000059193.1 dd_Smed_v6_1940_0dd_Smed_v6PMID:29674432
pharynxSMED30000566Ropporin-1-like proteinSMESG000079804.1 dd_Smed_v4_4888_0_1dd_Smed_v4PMID:29674431
pharynxSMED30017312Coiled-coil domain-containing protein 189SMESG000046576.1 dd_Smed_v4_12703_0_1dd_Smed_v4PMID:29674431
pharynxSMED30017201SFI1SMESG000002829.1 dd_Smed_v4_12484_0_1dd_Smed_v4PMID:29674431
pharynxSMED30015100SMED30015100SMESG000024438.1 dd_Smed_v4_7255_0_1dd_Smed_v4PMID:29674431
pharynxSMED30015100SMED30015100SMESG000024438.1 dd_Smed_v6_7255_0dd_Smed_v6PMID:29674432
pharynxSMED30012513slc7a-9SMESG000025359.1 dd_Smed_v4_4548_0_1dd_Smed_v4PMID:29674431
pharynxSMED30010892SMED30010892SMESG000021730.1 dd_Smed_v4_9188_0_1dd_Smed_v4PMID:29674431
pharynxSMED30001560SMED30001560SMESG000033391.1 dd_Smed_v4_5969_0_1dd_Smed_v4PMID:29674431
pharynxSMED30018865DUF1619 domain-containing proteinSMESG000057489.1 dd_Smed_v4_11225_0_1dd_Smed_v4PMID:29674431
pharynxSMED30003292SMED30003292SMESG000066258.1 dd_Smed_v4_19593_0_1dd_Smed_v4PMID:29674431
pharynxSMED30014980LaminSMESG000009886.1 dd_Smed_v4_850_0_1dd_Smed_v4PMID:29674431
pharynxSMED30003889SMED30003889SMESG000051911.1 dd_Smed_v4_5276_0_1dd_Smed_v4PMID:29674431
pharynxSMED30001290semaphorin 5-3SMESG000033853.1 dd_Smed_v4_9914_0_1dd_Smed_v4PMID:29674431
pharynxSMED30009968Intraflagellar transport protein 122 homologSMESG000039305.1 SMESG000039304.1 dd_Smed_v4_11912_0_1dd_Smed_v4PMID:29674431
pharynxSMED30015384ANK_REP_REGION domain-containing proteinSMESG000060742.1 dd_Smed_v4_8330_0_1dd_Smed_v4PMID:29674431
pharynxSMED30008534cGMP-dependent protein kinaseSMESG000052811.1 dd_Smed_v4_5704_0_1dd_Smed_v4PMID:29674431
pharynxSMED30007744SMED-SMAD6/7-1SMESG000002697.1 dd_Smed_v4_9186_0_1dd_Smed_v4PMID:29674431
pharynxSMED30004224Sodium/hydrogen exchanger 11SMESG000052479.1 dd_Smed_v4_10212_0_1dd_Smed_v4PMID:29674431
pharynxSMED30007804Immunoglobulin-like domain-containing proteinSMESG000010356.1 dd_Smed_v4_1827_0_1dd_Smed_v4PMID:29674431
pharynxSMED30004667Synaptotagmin 16SMESG000006557.1 dd_Smed_v4_5370_0_1dd_Smed_v4PMID:29674431
pharynxSMED30008636SMED30008636SMESG000016848.1 dd_Smed_v4_14631_0_1dd_Smed_v4PMID:29674431
pharynxSMED30013026SMED30013026SMESG000076398.1 dd_Smed_v4_8984_0_1dd_Smed_v4PMID:29674431
pharynxSMED30000065SMED30000065SMESG000049103.1 dd_Smed_v4_397_0_1dd_Smed_v4PMID:29674431
pharynxSMED30000065SMED30000065SMESG000049103.1 dd_Smed_v6_397_0dd_Smed_v6PMID:29674432
pharynxSMED30000419bok-1SMESG000021216.1 dd_Smed_v4_18390_0_1dd_Smed_v4PMID:29674431
pharynxSMED30001032Kinesin-like proteinSMESG000024428.1 dd_Smed_v4_9952_0_1dd_Smed_v4PMID:29674431
pharynxSMED30012150SMED30012150SMESG000051911.1 dd_Smed_v4_5276_0_1dd_Smed_v4PMID:29674431
pharynxSMED30013107Glyceraldehyde-3-phosphate dehydrogenaseSMESG000052353.1 dd_Smed_v4_78_0_1dd_Smed_v4PMID:29674431
pharynxSMED30001654SMED30001654SMESG000012124.1 dd_Smed_v4_11272_0_1dd_Smed_v4PMID:29674431
pharynxSMED30005046Dynein heavy chain, axonemalSMESG000050247.1 dd_Smed_v4_13135_0_1dd_Smed_v4PMID:29674431
pharynxSMED30005046Dynein heavy chain, axonemalSMESG000050247.1 SMESG000050248.1 dd_Smed_v4_10191_0_1dd_Smed_v4PMID:29674431
pharynxSMED30005046Dynein heavy chain, axonemalSMESG000050247.1 SMED30005046smed_20140614PMID:21828097
pharynxSMED30017333centrosomal protein of 83 kDa-likeSMESG000033227.1 SMESG000033225.1 dd_Smed_v4_12969_0_1dd_Smed_v4PMID:29674431
pharynxSMED30013455SMED30013455SMESG000062079.1 dd_Smed_v4_14798_0_1dd_Smed_v4PMID:29674431
pharynxSMED30002489Apical junction component 1 homologSMESG000037093.1 dd_Smed_v4_11689_0_1dd_Smed_v4PMID:29674431
pharynxSMED30005276SMED30005276SMESG000014888.1 dd_Smed_v4_7268_1_1dd_Smed_v4PMID:29674431
pharynxSMED30010770SMED30010770SMESG000019888.1 dd_Smed_v4_8158_0_1dd_Smed_v4PMID:29674431
pharynxSMED30019223Protein FAM47ESMESG000026097.1 dd_Smed_v4_10346_0_1dd_Smed_v4PMID:29674431
pharynxSMED30017099SMED30017099SMESG000030373.1 dd_Smed_v4_595_0_1dd_Smed_v4PMID:29674431
pharynxSMED30000376dynein heavy chain domain-containing protein 1-likeSMESG000076398.1 dd_Smed_v4_8984_0_1dd_Smed_v4PMID:29674431
pharynxSMED30017620SMED30017620SMESG000068887.1 dd_Smed_v4_31113_0_1dd_Smed_v4PMID:29674431
pharynxSMED30007064A-kinase anchor protein 14-likeSMESG000061885.1 dd_Smed_v4_9117_0_1dd_Smed_v4PMID:29674431
pharynxSMED30010655SMED30010655SMESG000028897.1 dd_Smed_v4_12473_0_1dd_Smed_v4PMID:29674431
pharynxSMED30016458SMED30016458SMESG000074522.1 SMESG000074521.1 dd_Smed_v4_1967_0_1dd_Smed_v4PMID:29674431
pharynxSMED30027141SMED30027141SMESG000059828.1 dd_Smed_v4_1549_0_1dd_Smed_v4PMID:29674431
pharynxSMED30026859PlsC domain-containing proteinSMESG000028760.1 dd_Smed_v4_8757_0_1dd_Smed_v4PMID:29674431
pharynxSMED30023688Leucine-rich repeat and guanylate kinase domain-containing proteinSMESG000033759.1 dd_Smed_v4_9362_0_1dd_Smed_v4PMID:29674431
pharynxSMED30025473mxi-2 proteinSMESG000060394.1 dd_Smed_v4_4048_0_1dd_Smed_v4PMID:29674431
pharynxSMED30025473mxi-2 proteinSMESG000060394.1 KF487116smed_ncbi_20200123PMID:24173799
pharynxSMED3002518133 kDa inner dynein arm light chain, axonemalSMESG000067639.1 SMESG000001266.1 dd_Smed_v4_4453_0_1dd_Smed_v4PMID:29674431
pharynxSMED30021167SMED30021167SMESG000035386.1 dd_Smed_v4_10651_0_1dd_Smed_v4PMID:29674431
pharynxSMED30027150Pleckstrin homology and RhoGEF domain containing G5SMESG000052365.1 dd_Smed_v4_14038_0_1dd_Smed_v4PMID:29674431
pharynxSMED30024561Cytochrome c oxidase subunit 5A, mitochondrialSMESG000066039.1 dd_Smed_v4_971_0_1dd_Smed_v4PMID:29674431
pharynxSMED30020321Cilia and flagella associated protein 126SMESG000048804.1 dd_Smed_v4_2157_0_1dd_Smed_v4PMID:29674431
pharynxSMED30031809SMED30031809SMESG000003238.1 dd_Smed_v4_24918_0_1dd_Smed_v4PMID:29674431
pharynxSMED30025076SMED30025076SMESG000010166.1 dd_Smed_v4_2518_0_1dd_Smed_v4PMID:29674431
pharynxSMED30025076SMED30025076SMESG000010166.1 dd_Smed_v6_2518_0dd_Smed_v6PMID:29674432
pharynxSMED30026278Pre-mRNA-splicing factor ISY1SMESG000047126.1 SMESG000004187.1 dd_Smed_v4_8243_0_1dd_Smed_v4PMID:29674431
pharynxSMED30034618von Willebrand factor A domain-containing protein 3ASMESG000022334.1 SMESG000022332.1 dd_Smed_v4_10972_0_1dd_Smed_v4PMID:29674431
pharynxSMED30022246Coiled-coil domain-containing protein 77SMESG000045184.1 dd_Smed_v4_4812_0_1dd_Smed_v4PMID:29674431
pharynxSMED30022295SMED30022295SMESG000021912.1 dd_Smed_v4_9758_0_1dd_Smed_v4PMID:29674431
pharynxSMED30029546Tektin 3SMESG000020792.1 dd_Smed_v4_3187_0_1dd_Smed_v4PMID:29674431
pharynxSMED30029694Kinesin light chainSMESG000023454.1 SMESG000018677.1 SMESG000018676.1 dd_Smed_v4_6449_0_1dd_Smed_v4PMID:29674431
pharynxSMED30025629Enkurin domain-containing proteinSMESG000020205.1 dd_Smed_v4_12663_0_1dd_Smed_v4PMID:29674431
pharynxSMED30028734SMED30028734SMESG000038532.1 SMESG000038520.1 SMESG000038497.1 SMESG000036112.1 SMESG000036067.1 dd_Smed_v4_5097_0_1dd_Smed_v4PMID:29674431
pharynxSMED30022032SMED30022032SMESG000038532.1 SMESG000038520.1 SMESG000038497.1 SMESG000036112.1 SMESG000036067.1 dd_Smed_v4_5097_0_1dd_Smed_v4PMID:29674431
pharynxSMED30035317Phosphoglycerate kinaseSMESG000039090.1 dd_Smed_v4_972_0_1dd_Smed_v4PMID:29674431
pharynxSMED30030175GTP-binding protein RhesSMESG000067334.1 dd_Smed_v4_14323_0_1dd_Smed_v4PMID:29674431
pharynxSMED30020260SMED30020260SMESG000005697.1 dd_Smed_v4_12813_0_1dd_Smed_v4PMID:29674431
pharynxSMED30024316RibokinaseSMESG000024727.1 dd_Smed_v4_3352_0_1dd_Smed_v4PMID:29674431
pharynxSMED30022653Stromal interaction molecule 1SMESG000081265.1 dd_Smed_v4_12888_0_1dd_Smed_v4PMID:29674431
pharynxSMED30030425Ubiquitin carboxyl-terminal hydrolase 7SMESG000050890.1 dd_Smed_v4_1847_0_1dd_Smed_v4PMID:29674431
pharynxSMED30020571Tubulin monoglycylase TTLL3SMESG000062155.1 dd_Smed_v4_12717_0_1dd_Smed_v4PMID:29674431
pharynxSMED30022057SJCHGC08494 proteinSMESG000027083.1 dd_Smed_v4_2196_0_1dd_Smed_v4PMID:29674431
pharynxSMED30025052histone-lysine N-methyltransferase SETD1B-ASMESG000062286.1 dd_Smed_v4_11834_0_1dd_Smed_v4PMID:29674431
pharynxSMED30026287SMED30026287SMESG000057102.1 dd_Smed_v4_45699_0_1dd_Smed_v4PMID:29674431
pharynxSMED30035198SMED30035198SMESG000023046.1 SMESG000023044.1 dd_Smed_v4_6118_0_1dd_Smed_v4PMID:29674431
pharynxSMED30031468Propionyl-CoA carboxylase alpha chain, mitochondrialSMESG000034830.1 dd_Smed_v4_1247_0_1dd_Smed_v4PMID:29674431
pharynxSMED30020318WD repeat-containing protein 49SMESG000041940.1 dd_Smed_v4_13248_0_1dd_Smed_v4PMID:29674431
pharynxSMED30029370Glucose-6-phosphate isomeraseSMESG000067583.1 dd_Smed_v4_1398_1_1dd_Smed_v4PMID:29674431
pharynxSMED30034110Dynein intermediate chain 3, ciliarySMESG000075110.1 dd_Smed_v4_2644_0_1dd_Smed_v4PMID:29674431
pharynxSMED30035963SMED30035963SMESG000071278.1 dd_Smed_v4_1649_0_1dd_Smed_v4PMID:29674431
pharynxSMED30035012SMED30035012SMESG000049841.1 dd_Smed_v4_16634_0_1dd_Smed_v4PMID:29674431
pharynxSMED30034594SMED30034594SMESG000056845.1 SMESG000044775.1 SMESG000007087.1 SMESG000007085.1 SMESG000056847.1 SMESG000056838.1 SMESG000044770.1 SMESG000007140.1 SMESG000044776.1 SMESG000044783.1 SMESG000038659.1 SMESG000030652.1 SMESG000025467.1 SMESG000013956.1 SMESG000056843.1 SMESG000044762.1 dd_Smed_v6_1137_0dd_Smed_v6PMID:29674432
pharynxSMED30035733Cylindromatosis (turban tumor syndrome), bSMESG000056845.1 SMESG000044775.1 SMESG000007087.1 SMESG000007085.1 SMESG000056847.1 SMESG000056838.1 SMESG000044770.1 SMESG000007140.1 SMESG000044776.1 SMESG000044783.1 SMESG000038659.1 SMESG000030652.1 SMESG000025467.1 SMESG000013956.1 SMESG000056843.1 SMESG000044762.1 dd_Smed_v6_1137_0dd_Smed_v6PMID:29674432
pharynxSMED30025680Anosmin-1SMESG000033070.1 dd_Smed_v4_13188_0_1dd_Smed_v4PMID:29674431
pharynxSMED30024527non-gastric H ,K -ATPase alpha subunitSMESG000041938.1 SMESG000041937.1 SMESG000051989.1 dd_Smed_v4_1179_0_1dd_Smed_v4PMID:29674431
pharynxSMED30029865Reverse transcriptaseSMESG000079542.1 dd_Smed_v4_78314_0_1dd_Smed_v4PMID:29674431
pharynxSMED30022717SMED30022717SMESG000005697.1 dd_Smed_v4_12813_0_1dd_Smed_v4PMID:29674431
pharynxSMED30030699Ephrin type-A receptor 4-BSMESG000077240.1 dd_Smed_v4_16483_0_1dd_Smed_v4PMID:29674431
pharynxSMED30021202Kunitz-type serine protease inhibitor IXSMESG000012316.1 dd_1274dd_Smed_v4PMID:29674431
pharynxSMED30029603SMED30029603SMESG000071278.1 dd_Smed_v4_1649_0_1dd_Smed_v4PMID:29674431
pharynxSMED30034138Coiled-coil domain-containing protein 96SMESG000050787.1 dd_Smed_v4_11884_0_1dd_Smed_v4PMID:29674431
pharynxSMED30028228Centrosomal protein 164SMESG000054195.1 SMESG000021687.1 dd_Smed_v4_12228_0_1dd_Smed_v4PMID:29674431
pharynxSMED30035230SMED30035230SMESG000060309.1 dd_Smed_v4_12186_0_1dd_Smed_v4PMID:29674431
pharynxSMED30024611Terminal nucleotidyltransferase 5CSMESG000079542.1 dd_Smed_v4_78314_0_1dd_Smed_v4PMID:29674431
pharynxSMED30034775Ras-associating domain-containing proteinSMESG000002146.1 dd_Smed_v4_3216_0_1dd_Smed_v4PMID:29674431
pharynxSMED30020652Eukaryotic translation initiation factor 4GSMESG000060566.1 SMESG000060556.1 SMESG000060487.1 dd_Smed_v6_4002_0dd_Smed_v6PMID:29674432
pharynxSMED30032793SMED30032793SMESG000016943.1 dd_Smed_v4_3572_0_1dd_Smed_v4PMID:29674431
pharynxSMED30027644cAMP-dependent protein kinase regulatory subunitSMESG000003135.1 dd_Smed_v4_14355_0_1dd_Smed_v4PMID:29674431
pharynxSMED30031311SMED30031311SMESG000023046.1 SMESG000023044.1 dd_Smed_v4_6118_0_1dd_Smed_v4PMID:29674431
pharynxSMED30022545Protein kinase domain-containing proteinSMESG000057044.1 dd_Smed_v4_9098_0_1dd_Smed_v4PMID:29674431
pharynxSMED30028905Chaperone protein DnaJSMESG000036198.1 dd_Smed_v4_24393_0_1dd_Smed_v4PMID:29674431
pharynxSMED30020913SMED30020913SMESG000009078.1 dd_Smed_v4_13484_0_1dd_Smed_v4PMID:29674431
pharynxSMED30025001Armadillo repeat-containing protein 3SMESG000079416.1 dd_Smed_v4_9679_0_1dd_Smed_v4PMID:29674431
pharynxSMED30032051serine/arginine repetitive matrix protein 1 isoform X3SMESG000018884.1 dd_Smed_v4_9404_0_1dd_Smed_v4PMID:29674431
pharynxSMED30020160SMED30020160SMESG000005587.1 dd_Smed_v4_8117_0_1dd_Smed_v4PMID:29674431
pharynxSMED30033750Protein kinaseSMESG000070879.1 SMESG000070880.1 dd_Smed_v4_3195_0_1dd_Smed_v4PMID:29674431
pharynxSMED30034766EnolaseSMESG000052380.1 dd_Smed_v6_510_0dd_Smed_v6PMID:29674432
pharynxSMED30034766EnolaseSMESG000052380.1 dd_Smed_v4_510_0_1dd_Smed_v4PMID:29674431
pharynxSMED30028659Cilia-and flagella-associated protein 100SMESG000033127.1 dd_Smed_v4_6518_0_1dd_Smed_v4PMID:29674431
pharynxSMED30028659Cilia-and flagella-associated protein 100SMESG000033127.1 dd_Smed_v6_6518_0dd_Smed_v6PMID:29674432
pharynxSMED30032094RIIa domain-containing protein 1SMESG000079320.1 dd_Smed_v4_4716_0_1dd_Smed_v4PMID:29674431
pharynxSMED30023882Rootletin-2SMESG000081227.1 dd_Smed_v4_6573_0_1dd_Smed_v4PMID:29674431