pharynx

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ Description

  ▻ Figures

  ▻ In Situ Hybridization Data

  ▻ Sequences

  ▻ References

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  pharynx


DEFINITON:

  A plicate and protrusible organ that is the sole point of entry and exit for the Triclad gut. It contains epithelial, muscular, secretory and neuronal cell types.


TERM DEFINITION CITATIONS:

  OCLC:16809160


TERM CITATIONS:

Expand publication list


TERM ID:

  PLANA:0000016


ABOUT THIS TERM:

pharynx

  ↳is a material entity and organ

  ↳contained in posterior region of the whole animal and parapharyngeal region

  ↳existence overlaps Stage 6, Stage 5, juvenile stage, asexual adult, adult hermaphrodite, Stage 8 and Stage 7

  ↳existence starts during or after Stage 5

  ↳part of digestive system


  → pharynx progenitor cell and pharynx primordium develops into pharynx


  → pharynx lumen luminal space of pharynx


Expand to see terms that part of pharynx


BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


DESCRIPTION:   

foxA1, a pioneer transcription factor required for pharynx maintenance and regeneration during adulthood (Adler et al., 2014; Scimone et al., 2014), may similarly be required for construction of the definitive pharynx during embryogenesis. Development of the definitive pharynx, the single opening of the Smed digestive tract, commenced during S4-S5 with the onset of foxA1 expression in parenchymal cells, many of which were located in the oral hemisphere (Figure 1 – figure supplement 14A). The distribution of foxA1+ cells remained concentrated in and around the developing definitive pharynx rudiment during S6-S8, a pattern reminiscent of that observed in S. polychroa embryos (Martín-Durán et al., 2010), as well as in intact and regenerating Smed asexual adults (Adler et al., 2014; Scimone et al., 2014). The definitive pharynx develops beneath the degenerating temporary embryonic pharynx, and marks the ventral side of the embryos during S6 and thereafter (Martín-Durán and Romero, 2011). foxA1 upregulation during S5-S8 was statistically significant, albeit the adjusted p-values were above the thresholds set for inclusion in the enriched transcript lists presented in Figure 1 – source data 5, Figure 1 – source data 6, Figure 1 – source data 7, Figure 1 – source data 8. meis, a transcription factor coexpressed in foxA1+ neoblasts and expressed within the regenerating pharynx (Scimone et al., 2014), was among the S5 enriched transcripts (Figure 1 – source data 5); its expression trend was similar to foxA1 during embryogenesis (Figure 1 – figure supplement 14B). Two markers exhibiting pharynx-restricted expression in adults, laminin and npp-1 (Adler et al., 2014), were upregulated during S6-S8, after development of the definitive pharynx rudiment was evident (Figure 1 – figure supplement 14B).


 

back to top


FIGURES:


Figure 1 – figure supplement 14: Molecular markers for the definitive pharynx

A: WISH developmental time course using foxA1 riboprobes (blue), S3-S8.  foxA1 expression was consistently detected in the embryonic pharynx lumen during S3-S5 (black arrowheads). Anterior: top (S6-S8). Black arrowheads: embryonic pharynx. Red arrowheads: definitive pharynx. O: oral hemisphere. A: aboral hemisphere. D: dorsal. V: ventral. Scale bars: 100 µm.

B: Average RPKM values per embryo for the definitive pharynx markers foxA1, meis, laminin, npp-1 during embryogenesis (Adler et al., 2014; Scimone et al., 2014), Y (yolk), Stage (S) S2-S8. 

 

 

back to top


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30027428AFJ24799.1forkhead box A-1foxA1Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, digestive system, pharynx, pharynx progenitor cell, embryonic pharynx
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30027428 ID=SMED30027428|Name=forkhead box A-1|organism=Schmidtea mediterranea sexual|type=transcript|length=2149bp
ATCACTTGGTGCTGCTTTTTGCCCCGATAAATCTCTCGGTGCTCCAAAATTTGTGTAAGCGAGCAAAAGATGATTGGGCA
ATTTCTAGCACGTCATTCGGCAACGATGTTTACAAGTTTCTCTGATTGGATGATAAAGTAGAAACTTTCCGAAAATGAAA
CTTCTCCGAACATGCGCATACCGACTGAAAATTAACTCTAAGCCAGCCAATGGAATTGAAGCAAAATTCAAGAGAATATT
AATTGACTTCGCGAATGAACTCAAATTTTCTATTGGCGTATTGTGTGTGCCTCATTGTGAGTGGTTGCGATCGCATCTCA
AATTATTTACACACAAAAAAATAACGCACACAGACATTGAATAGATATATTTGATCAAGTCAATATCACAATGTCAATAT
TAGCTTTTTCTGAAGAAAGAAGACGAACTAGAAGAAAAACAACAACGAAATAGATTCGATAAGGCTACTGAGCGATTTTC
ATAATCTAAATATTATTTTATTATTGATACGGACAAAAATTGGTCTTTTACCAAGTACTACTAGATTGTTGATAAAGAGA
GGTTATTTAGATGCTTGGAAAAAATCCTTATGAAACTGCAATGAGCAACGTGTATTCTCTACCTCCGGGAGGTTCTATTT
ACAATATGAACCCGATGAGTATATCATCAGCTGGCTACAACTCTCAACAAGTATCAACACTATCGTTGAACTTGACCGGA
ATCGGACCTCATTCATTAAGCCCAATGAGTGCAAGCATGTCGGGTATAGCTGCAATGGCCGGTGGAATGAGACAAGGTCT
TGAGTTGGGTCTTGGTAGAAGTGATAGTCCAAGAGATAAAAATTCAATTTCCAATAACAACCGACCATATCAAAGAAGTT
ACACTCATGCCAAGCCTCCATACAGTTATATAAGTTTGATAACAATGGCGATTCAAAATTCTCCAGTAAACATGTGCACT
CTATCGGAGATCTATCAATTCATTATGGATCATTTTCCATACTATCGTCAAAATCAACAGCGATGGCAGAATTCGATTCG
ACATTCTTTGTCCTTCAACGATTGCTTTGTTAAGGTTAGTAGAAGCCCAGAAAAACCAGGTAAAGGCTCATATTGGACCT
TGCATCCTCAATCAGGTAACATGTTTGAAAACGGTTGTTATCTCAGAAGACAAAAGCGATTCAAAGATCCACACAGAGAA
ATCGGCAGACAGAGTCAAAGAGCTGCCACTGGTCCTGGATCAAATGTCACAGAAAACAATCACGACAACGCATCGCAAGA
AGCTAGTGATAACGCAGAAAGTGATACGAAACCCAACATCAAGCAACTTGATTTATCAAGCGATCTCTTAACTAATCAAG
GTCATAATATTAAAAATACTAATCCAACTTCTGTTAGTCAGAGTTGTTCGATGTTTCATCGGAAAAAGGAAAACTGCTCA
CCAGTAGAAATGAAATTGAATAACCAAAACCAACAATCAAACCAGCAAGAACATCCACAAATCCATTACAATCCCAATCA
GCAATTCTACTCAAATCAGCAAAACATTTTCCAACAAAGTTCTCTTGATCATTACAGTCTATTAGCATCCGATGATCCTC
TTGGTCAAGGTATGCACTTGCCACCAGGTGCAAATAGTGTTTTCGGACTTTACGGGGCACATAACTTACCAAACGATGAT
CAAATTTCAGTGTCATTACCATCGATATCCTTATCCGGACATCCGTATGACAATTTATCAACAGCAATGGCATATCAATA
TGAAGCATCTCAACACAATTCTTCATTACTAACGACAAGTAATCCGTTCTCAATAGATCGTTTGATGCATCCAAGACTAG
TCGCTGCAGCGATGGGGGTCAGTCCCCATGATACTCTATACGCAGGAGCTACCGGCCCATCAGTTGATCTAGAACACATG
AAATACTACTCAAACTACAACAATGTGCCTCCTTATTCCTCTGCAATGTCTGACTACTACAAATATGTACAAAATCCTCA
GCCGGGCAACAGCGACATGAGTCTTTGAATTGAGTCCATTGAAGTCTACGGCAGTTTCCTCGAAATTTCACATTCAACCA
GATGTTTATCGCCTAATATAAAGCTGTGTTTTTTTATTTATTTACAATTAAATCTTTGTACAAGAGATC

 

back to top


ADDITIONAL REFERENCES:


Adler, C.E., Seidel, C.W., McKinney, S.A., and Sánchez Alvarado, A. (2014). Selective amputation of the pharynx identifies a FoxA-dependent regeneration program in planaria. Elife 3, e02238.

Martín-Durán, J.M., Amaya, E., and Romero, R. (2010). Germ layer specification and axial patterning in the embryonic development of the freshwater planarian Schmidtea polychroa. Dev Biol 340, 145-158.

Martín-Durán, J.M., and Romero, R. (2011). Evolutionary implications of morphogenesis and molecular patterning of the blind gut in the planarian Schmidtea polychroa. Dev Biol 352, 164-176.

Scimone, M.L., Kravarik, K.M., Lapan, S.W., and Reddien, P.W. (2014). Neoblast specialization in regeneration of the planarian Schmidtea mediterranea. Stem Cell Reports 3, 339-352.

 

back to top



PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in pharynx. Click this link to learn more about PAGE.


PAGE Curations: 3229


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
pharynxSMED30005045zinc finger protein ASMESG000022958.1 KF751216.1smed_ncbi_20200123PMID:24704339
Vogg et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30022468secreted frizzled-related protein 1SMESG000075831.1 SMESG000029446.1 EU296635smed_ncbi_20200123PMID:24704339
Vogg et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30029487Smed-NDKSMESG000062038.1 GU592830.1smed_ncbi_20200123PMID:24704339
Vogg et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30027297winged helix/forkhead transcription factorSMESG000077075.1 KC577557.1smed_ncbi_20200123PMID:24704339
Vogg et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30027297winged helix/forkhead transcription factorSMESG000077075.1 KC577557smed_ncbi_20200123PMID:24704339
Vogg et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30026602Wnt2-1SMESG000002069.1 FJ463753.1smed_ncbi_20200123PMID:23318641
Chen et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30020359Smed-NDK-3SMESG000046244.1 SMESG000046208.1 GU592832.1smed_ncbi_20200123PMID:23318641
Chen et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30031256wntP-2SMESG000066476.1 wntP-2smed_ncbi_20200123PMID:23318641
Chen et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30027299PBXSMESG000022232.1 SMESG000001913.1 KC353351.1smed_ncbi_20200123PMID:23318641
Chen et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30001630Ras-related C3 botulinum toxin substrate 1SMESG000005612.1 Contig594newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30001630Ras-related C3 botulinum toxin substrate 1SMESG000005612.1 Contig594uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30001630Ras-related C3 botulinum toxin substrate 1SMESG000011575.1 Contig594newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30001630Ras-related C3 botulinum toxin substrate 1SMESG000011575.1 Contig594uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30008091Serine/threonine-protein kinase PLKSMESG000012131.1 SMESG000012127.1 Contig809GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30008091Serine/threonine-protein kinase PLKSMESG000027686.1 Contig2364GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30008091Serine/threonine-protein kinase PLKSMESG000012131.1 SMESG000012127.1 Contig2364GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30004187SMED30004187SMESG000043423.1 Contig1792newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30004187SMED30004187SMESG000043423.1 Contig1792uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30004187SMED30004187SMESG000072544.1 Contig1792newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30004187SMED30004187SMESG000072544.1 Contig1792uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30001294Phosphatidylinositol-binding clathrin assembly proteinSMESG000043423.1 Contig1792GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30001294Phosphatidylinositol-binding clathrin assembly proteinSMESG000072544.1 Contig1792GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30004606Cytochrome P450 2K1-like proteinSMESG000020470.1 Contig1680GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED300030531-acyl-sn-glycerol-3-phosphate acyltransferase deltaSMESG000081135.1 Contig3433GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30016022SMED30016022SMESG000053405.1 Contig1766newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30016022SMED30016022SMESG000053405.1 Contig1766uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30016022SMED30016022SMESG000046314.1 SMESG000028362.1 Contig1766newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30016022SMED30016022SMESG000046314.1 SMESG000028362.1 Contig1766uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30005434SMED30005434SMESG000038889.1 Contig2145newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30013050SMED30013050SMESG000000175.1 Contig2068newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30015161Vacuolar protein sorting-associated protein 45SMESG000053405.1 Contig1766GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30015161Vacuolar protein sorting-associated protein 45SMESG000046314.1 SMESG000028362.1 Contig1766GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30008812AP complex subunit sigmaSMESG000038889.1 Contig2145GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30004652SMED30004652SMESG000033527.1 Contig2307newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30005745Protein kinaseSMESG000079303.1 Contig2289GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30005745Protein kinaseSMESG000017260.1 Contig2289GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30015801SMED30015801SMESG000079303.1 Contig2289newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30015801SMED30015801SMESG000017260.1 Contig2289newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30019325Myosin regulatory light chainSMESG000000175.1 Contig2068GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30019325Myosin regulatory light chainSMESG000068156.1 SMESG000064685.1 SMESG000043474.1 SMESG000010609.1 SMESG000076470.1 SMESG000073857.1 SMESG000062429.1 SMESG000058575.1 SMESG000053533.1 SMESG000020635.1 SMESG000015751.1 SMESG000005260.1 Contig246GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30019325Myosin regulatory light chainSMESG000000175.1 Contig246GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30001668SMED30001668SMESG000033527.1 Contig2307GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30022483CGG triplet repeat-binding protein 1SMESG000020470.1 Contig1680newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30022483CGG triplet repeat-binding protein 1SMESG000020470.1 Contig1680uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30028347Engulfment and cell motility 3SMESG000013936.1 Contig1935GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30028347Engulfment and cell motility 3SMESG000039535.1 Contig1935GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30018122MADS-box domain-containing proteinSMESG000005612.1 Contig594GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30018122MADS-box domain-containing proteinSMESG000011575.1 Contig594GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30009175Transcription elongation factor spt6SMESG000059332.1 Contig5500newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30009175Transcription elongation factor spt6SMESG000059332.1 Contig5500uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30009175Transcription elongation factor spt6SMESG000024114.1 Contig5500newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30009175Transcription elongation factor spt6SMESG000024114.1 Contig5500uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30034573Tubulin beta chainSMESG000047291.1 SMESG000044907.1 SMESG000044888.1 SMESG000035804.1 SMESG000035755.1 SMESG000047284.1 Contig5821GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30030227flotillin-2SMESG000059332.1 Contig5500GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30030227flotillin-2SMESG000024114.1 Contig5500GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30021511SMED30021511SMESG000038232.1 Contig5776GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30020811SMED30020811SMESG000005612.1 Contig594newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30020811SMED30020811SMESG000005612.1 Contig594uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30020811SMED30020811SMESG000011575.1 Contig594newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30020811SMED30020811SMESG000011575.1 Contig594uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30014474Tumor susceptibility gene 101 proteinSMESG000049597.1 Contig5044GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30014474Tumor susceptibility gene 101 proteinSMESG000004871.1 Contig5044GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30011780Si:ch73-222h13.1SMESG000081135.1 Contig3433newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30011780Si:ch73-222h13.1SMESG000081135.1 Contig3433uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30008321SMED30008321SMESG000068172.1 Contig3306newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30008321SMED30008321SMESG000068172.1 Contig3306uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30008321SMED30008321SMESG000025870.1 Contig3306newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30008321SMED30008321SMESG000025870.1 Contig3306uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30007555GCR098SMESG000016695.1 Contig4585newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30007555GCR098SMESG000016695.1 Contig4585uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30007555GCR098SMESG000033655.1 Contig4585newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30007555GCR098SMESG000033655.1 Contig4585uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30015345TropomyosinSMESG000066854.1 Contig3688newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30015345TropomyosinSMESG000066854.1 Contig3688uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30015345TropomyosinSMESG000026500.1 Contig3688newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30029557SMED30029557SMESG000071997.1 Contig1093newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30033014Phosphatidylinositol-4,5-bisphosphate 4-phosphataseSMESG000063221.1 Contig1068GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30032776SMED30032776SMESG000063221.1 Contig1068newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30033807SMED30033807SMESG000076385.1 SMESG000076375.1 SMESG000076363.1 SMESG000076223.1 SMESG000076482.1 SMESG000076470.1 SMESG000076410.1 SMESG000076358.1 Contig1645newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30030305Peptidase_M14 domain-containing proteinSMESG000037626.1 Contig1315GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30030305Peptidase_M14 domain-containing proteinSMESG000048042.1 Contig1315GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30032067TRAF-4SMESG000044336.1 Contig1407GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30032067TRAF-4SMESG000015063.1 Contig1407GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30023739SMED30023739SMESG000058452.1 Contig1190GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30023739SMED30023739SMESG000057519.1 Contig1190GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30021127SMED30021127SMESG000037626.1 Contig1315newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30021127SMED30021127SMESG000037626.1 Contig1315uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30021127SMED30021127SMESG000048042.1 Contig1315newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30021127SMED30021127SMESG000048042.1 Contig1315uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30016397Transforming acidic coiled-coil-containing protein 3SMESG000056367.1 PL08003B2C03ncbi_smed_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30017282nuclear factor Y complex B2SMESG000040141.1 KU366700smed_ncbi_20200123PMID:27304889
Iyer et al., 2016
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
pharynxSMED30025497secreted frizzled related protein 2SMESG000050379.1 ADO51625.1smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30022468secreted frizzled-related protein 1SMESG000075831.1 SMESG000029446.1 EU296635smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30022468secreted frizzled-related protein 1SMESG000075831.1 SMESG000029446.1 ABY85212.1smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30022929WntASMESG000051375.1 FJ463750.1smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30022929WntASMESG000051375.1 FJ463750smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30022929WntASMESG000051375.1 ACJ64865.1smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30019722secreted frizzled related protein 3SMESG000058717.1 SMED30019722smed_20140614PMID:20707997
Gurley et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30019722secreted frizzled related protein 3SMESG000058717.1 HM751832.1smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30020436Nuclear distribution protein nudE-like 1SMESG000016071.1 HO006501.1ncbi_smed_estsPMID:22411224
Cowles et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30016141lissencephaly-1SMESG000054739.1 SMESG000035997.1 JQ650355.1smed_ncbi_20200123PMID:22411224
Cowles et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30001081NudC nuclear distribution proteinSMESG000036795.1 DN303982.1ncbi_smed_estsPMID:22411224
Cowles et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30004930Irregular chiasm C-roughest-like isoform X2SMESG000077979.1 dd_Smed_v4_12549_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30033884FERM, RhoGEF and pleckstrin domain-containing protein 1SMESG000069407.1 dd_Smed_v4_12715_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30025810SMED30025810SMESG000019718.1 dd_Smed_v4_2749_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30013316Polycomb group RING finger protein 1SMESG000072501.1 dd_Smed_v4_12753_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30001690SMED30001690SMESG000069322.1 dd_Smed_v4_12571_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30000553Epithelial discoidin domain-containing receptorSMESG000069322.1 dd_Smed_v4_12571_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30005718Guanine nucleotide-binding protein G(I) subunit alphaSMESG000026774.1 Gpassmed_ncbi_20200123PMID:24992682
Vásquez-Doorman et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30005045zinc finger protein ASMESG000022958.1 dd_Smed_v4_22585_0_1dd_Smed_v4PMID:24992682
Vásquez-Doorman et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30005045zinc finger protein ASMESG000022958.1 KF751216.1smed_ncbi_20200123PMID:24992682
Vásquez-Doorman et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30020522ap2SMESG000022356.1 JX010470.1smed_ncbi_20200123PMID:24992682
Vásquez-Doorman et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30031425Homeobox protein Hox-D12SMESG000003389.1 SMED30031425smed_20140614PMID:27034770
Currie et al., 2016
whole organism asexual adult fluorescence in situ hybridization evidence
pharynxSMED30024673SMED30024673SMESG000067310.1 SmedASXL_065556SmedAsxl_ww_GCZZ01PMID:29158443
He et al., 2017
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30018250Telomerase-binding protein EST1A tr5_9369mu_Smed_v1PMID:25558068
Reuter et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30012814Protein CWC15-like proteinSMESG000010770.1 SMESG000012375.1 tr5_7361mu_Smed_v1PMID:25558068
Reuter et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30022468secreted frizzled-related protein 1SMESG000075831.1 SMESG000029446.1 EU296635smed_ncbi_20200123PMID:25558068
Reuter et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30016511SMED30016511SMESG000072006.1 tr5_6444mu_Smed_v1PMID:25558068
Reuter et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30005458Phosphatidylinositol 4-kinase type 2-betaSMESG000074718.1 tr5_11049mu_Smed_v1PMID:25558068
Reuter et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30013810TeashirtSMESG000008973.1 KP003815.1smed_ncbi_20200123PMID:25558068
Reuter et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
pharynxSMED30029487Smed-NDKSMESG000062038.1 GU592830.1smed_ncbi_20200123PMID:25558068
Reuter et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30022963anaphase-promoting complex subunit 1SMESG000010770.1 SMESG000012375.1 tr5_7361mu_Smed_v1PMID:25558068
Reuter et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30034772Fibrillar collagen NC1 domain-containing proteinSMESG000077977.1 tr5_2051mu_Smed_v1PMID:25558068
Reuter et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30013810TeashirtSMESG000008973.1 KP003815.1smed_ncbi_20200123PMID:25725068
Owen et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
pharynxSMED30003376Transmembrane protein 18SMESG000023757.1 SMESG000023756.1 dd_Smed_v4_10110_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000158Dipeptidyl peptidase 3SMESG000079740.1 dd_Smed_v4_1031_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002023ANK_REP_REGION domain-containing proteinSMESG000020576.1 dd_Smed_v4_13360_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005772vault protein inter alpha trypsin-1SMESG000053671.1 SMESG000053669.1 SMESG000053667.1 SMESG000053664.1 SMESG000053657.1 SMESG000053638.1 dd_Smed_v4_1027_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003716Glucose-6-phosphate isomeraseSMESG000067583.1 dd_Smed_v4_1398_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003469FerritinSMESG000068032.1 SMESG000068030.1 SMESG000068027.1 dd_Smed_v4_1033_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001192ras-related protein Rab-14SMESG000066109.1 SMESG000052687.1 SMESG000014240.1 SMESG000069832.1 SMESG000037642.1 dd_Smed_v4_106_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001473Lipoxygenase homology domain-containing protein 1SMESG000059926.1 SMESG000059927.1 dd_Smed_v4_10460_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004224Sodium/hydrogen exchanger 11SMESG000052479.1 dd_Smed_v4_10212_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002450Ubiquitin carboxyl-terminal hydrolaseSMESG000023757.1 SMESG000023756.1 dd_Smed_v4_10110_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005717BAR domain-containing proteinSMESG000000639.1 dd_Smed_v4_1387_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005046Dynein heavy chain, axonemalSMESG000050247.1 SMESG000050248.1 dd_Smed_v4_10191_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005046Dynein heavy chain, axonemalSMESG000050247.1 dd_Smed_v4_13135_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003458Ras-related protein Rab-27BSMESG000077907.1 dd_Smed_v4_10266_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015061G protein regulated inducer of neurite outgrowthSMESG000062691.1 dd_Smed_v4_10294_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022043Protein odd-skipped-related 2SMESG000032229.1 dd_Smed_v4_10039_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015586TAR DNA-binding protein 43SMESG000048176.1 dd_Smed_v4_12522_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016186SMED30016186SMESG000033673.1 dd_Smed_v4_1071_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016186SMED30016186SMESG000033673.1 dd_1071dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
pharynxSMED30018829Insulin like growth factor 2 receptorSMESG000023958.1 SMESG000023953.1 dd_Smed_v4_14729_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015480SMED30015480SMESG000064024.1 dd_Smed_v4_16354_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018999SMED30018999SMESG000058251.1 dd_Smed_v4_10158_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014558SMED30014558SMESG000023649.1 dd_Smed_v4_184_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018901SMED30018901SMESG000033673.1 dd_Smed_v4_1071_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018901SMED30018901SMESG000033673.1 dd_1071dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
pharynxSMED30014496Ribosome biogenesis protein NSA2SMESG000028599.1 dd_Smed_v4_1012_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019139CalmodulinSMESG000010244.1 dd_Smed_v4_10239_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015853SMED30015853SMESG000069882.1 dd_Smed_v4_10099_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015183Leucine-rich repeat-containing protein 9SMESG000021671.1 dd_Smed_v4_14851_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015232Netrin-1SMESG000050895.1 dd_Smed_v4_14852_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021613Nesprin-1SMESG000077685.1 dd_Smed_v4_10214_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021613Nesprin-1SMESG000077685.1 dd_Smed_v4_15904_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022921Netrin 1SMESG000050895.1 dd_Smed_v4_14852_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020537SMED30020537SMESG000040594.1 dd_Smed_v4_1676_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001341Carbonic anhydrase-relatedSMESG000054330.1 dd_Smed_v4_10750_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003780Serine/threonine-protein kinase 36SMESG000076885.1 dd_Smed_v4_11067_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002156TNF receptor associated factor-2SMESG000065606.1 SMESG000000563.1 SMESG000000559.1 SMESG000000493.1 SMESG000000294.1 dd_Smed_v4_1243_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008195Non-specific serine/threonine protein kinaseSMESG000022413.1 dd_Smed_v4_10848_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002592NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 3SMESG000016331.1 dd_Smed_v4_1078_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013319Long-chain-fatty-acid--CoA ligase ACSBG2SMESG000027204.1 dd_Smed_v4_1026_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003093SMED30003093SMESG000056847.1 SMESG000056843.1 SMESG000056838.1 SMESG000044770.1 SMESG000044762.1 SMESG000007140.1 dd_Smed_v4_1137_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002139Vacuole membrane protein 1SMESG000034612.1 dd_Smed_v4_1156_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003434SMED30003434SMESG000052485.1 dd_Smed_v4_1182_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001681SMED30001681SMESG000049443.1 dd_Smed_v4_1193_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000745SMED30000745SMESG000027028.1 dd_Smed_v4_14847_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3000448460S ribosomal protein L8SMESG000017087.1 dd_Smed_v4_108_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001414UPF0728 protein C10orf53 homologSMESG000073355.1 dd_Smed_v4_10501_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026227SMED30026227SMESG000055174.1 SMESG000055172.1 dd_Smed_v4_10518_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022522Centrin-3SMESG000016538.1 dd_Smed_v4_11582_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026063TNF receptor-associated factorSMESG000044583.1 dd_Smed_v4_11100_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006413SMED30006413SMESG000069778.1 dd_Smed_v4_18416_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004754RNA-binding protein 8ASMESG000051885.1 dd_Smed_v4_1169_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008091Serine/threonine-protein kinase PLKSMESG000012127.1 dd_Smed_v4_1620_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008055Transient receptor potential cation channel subfamily M memberSMESG000068518.1 dd_Smed_v4_10717_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007588SMED30007588SMESG000034112.1 dd_Smed_v4_10100_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004930Irregular chiasm C-roughest-like isoform X2SMESG000077979.1 dd_Smed_v4_12549_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008325Fatty acid synthaseSMESG000020850.1 dd_Smed_v4_10967_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009121Galectin domain-containing proteinSMESG000022399.1 dd_Smed_v4_10749_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006652dynein heavy chain 6, axonemalSMESG000004477.1 SMESG000004475.1 dd_Smed_v4_10969_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3000876940S ribosomal protein S10SMESG000034720.1 dd_Smed_v4_117_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004871Mitogen-activated protein kinaseSMESG000023035.1 SMESG000023025.1 dd_Smed_v4_10933_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005053SMED30005053SMESG000072823.1 dd_Smed_v4_11587_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008636SMED30008636SMESG000016848.1 dd_Smed_v4_14631_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009956SMED30009956SMESG000022272.1 dd_Smed_v4_10991_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009956SMED30009956SMESG000022273.1 dd_Smed_v4_8344_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013424WD repeat domain 60SMESG000040271.1 dd_Smed_v4_10032_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008862Transmembrane protein 17SMESG000050386.1 dd_Smed_v4_10264_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012960CalmodulinSMESG000003548.1 dd_Smed_v4_10083_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006279SMED30006279SMESG000024330.1 dd_Smed_v4_15812_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010808Elongation of very long chain fatty acids proteinSMESG000009665.1 dd_Smed_v4_10529_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006368Piezo-type mechanosensitive ion channel componentSMESG000080326.1 SMESG000080325.1 dd_Smed_v4_18354_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013404SMED30013404SMESG000027863.1 dd_Smed_v4_16528_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008418SMED30008418SMESG000027863.1 dd_Smed_v4_16528_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010316Echinoderm microtubule-associated protein-like 4SMESG000027261.1 dd_Smed_v4_10540_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014469DUF862 domain-containing proteinSMESG000007684.1 dd_Smed_v4_1938_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005820SMED30005820SMESG000080577.1 dd_Smed_v4_19517_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008973SMED30008973SMESG000017122.1 dd_Smed_v4_13867_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010674SPATA6 domain-containing proteinSMESG000053714.1 dd_Smed_v4_10543_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013779Tubulin monoglycylase TTLL3SMESG000029205.1 dd_Smed_v4_10244_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006335SMED30006335SMESG000046906.1 dd_Smed_v4_10831_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013095DDE_Tnp_1_7 domain-containing proteinSMESG000080622.1 SMESG000068757.1 SMESG000055125.1 SMESG000038294.1 SMESG000032747.1 SMESG000023322.1 dd_Smed_v4_3830_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016080Deoxyhypusine hydroxylaseSMESG000051726.1 SMESG000051721.1 dd_Smed_v4_703_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004423EF-hand domain-containing proteinSMESG000004207.1 dd_Smed_v4_14319_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004977SMED30004977SMESG000075254.1 dd_Smed_v4_12807_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015511X-ray radiation resistance-associated protein 1SMESG000019618.1 dd_Smed_v4_13519_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004416SMED30004416SMESG000067412.1 dd_Smed_v4_14048_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014131RPTOR independent companion of MTOR, complex 2 aSMESG000024212.1 SMESG000033570.1 dd_Smed_v4_9324_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008671PhosphodiesteraseSMESG000021196.1 dd_Smed_v4_8589_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007534Protein LLP homologSMESG000010838.1 dd_Smed_v4_5414_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000535CEP72SMESG000043538.1 dd_Smed_v4_12835_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004886Hsp70-Hsp90 organizing protein 1SMESG000033618.1 dd_Smed_v4_14717_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007343Tud-1SMESG000043684.1 dd_Smed_v4_3741_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030642Cytochrome P450 2C3SMESG000023530.1 SMESG000023528.1 dd_Smed_v4_7874_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010974InnexinSMESG000055742.1 SMESG000055733.1 dd_Smed_v4_1120_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019771Ammonium transporter Rh type BSMESG000048384.1 dd_Smed_v4_1882_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012881BLUF domain-containing proteinSMESG000015580.1 dd_Smed_v4_11000_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011204Piezo-type mechanosensitive ion channel componentSMESG000010240.1 dd_Smed_v4_13866_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3001927340S ribosomal protein S3aSMESG000066540.1 SMESG000066537.1 dd_Smed_v4_163_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011250Granulin precursorSMESG000029882.1 dd_Smed_v4_442_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016189SMED30016189SMESG000046852.1 dd_Smed_v4_13109_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011335Dynein heavy chain 10, axonemalSMESG000051829.1 dd_Smed_v4_5169_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011335Dynein heavy chain 10, axonemalSMESG000051829.1 dd_Smed_v4_12797_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016398Piezo-type mechanosensitive ion channel componentSMESG000010240.1 dd_Smed_v4_13866_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013578MICOS complex subunit MIC10SMESG000009106.1 dd_Smed_v4_1150_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011848SMED30011848SMESG000081465.1 dd_Smed_v4_11248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017231NEPH-3SMESG000022777.1 dd_Smed_v4_11280_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012638DUF4200 domain-containing proteinSMESG000028991.1 dd_Smed_v4_11371_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011453Facilitated trehalose transporter Tret1SMESG000063382.1 dd_Smed_v4_11168_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014544Dynein light chainSMESG000067731.1 dd_Smed_v4_11037_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011096Centrosomal protein 131SMESG000051138.1 dd_Smed_v4_13976_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020821SMED30020821SMESG000014298.1 dd_Smed_v4_1301_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021821Transient receptor potential cation channel subfamily M memberSMESG000078720.1 dd_Smed_v4_17981_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020109R3H domain containing-likeSMESG000044056.1 dd_Smed_v4_11014_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014618SMED30014618SMESG000067158.1 SMESG000079384.1 SMESG000006522.1 dd_Smed_v4_6854_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006230Sperm surface protein Sp17SMESG000046919.1 dd_Smed_v4_4783_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006230Sperm surface protein Sp17SMESG000046919.1 dd_Smed_v4_2279_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004957AnoctaminSMESG000033730.1 SMESG000033728.1 dd_Smed_v4_6514_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009457reticulocalbin-1SMESG000034805.1 dd_Smed_v4_493_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016941Cytospin-ASMESG000002849.1 dd_Smed_v4_14690_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014822Moesin/ezrin/radixin homolog 1SMESG000056380.1 dd_Smed_v4_611_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009817testis-expressed protein 52SMESG000070302.1 dd_Smed_v4_6766_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000671Fibronectin type III domain proteinSMESG000043560.1 dd_Smed_v4_33732_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005014ATP synthase subunit alphaSMESG000004897.1 dd_Smed_v4_731_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001782Fibronectin type III domain-containing proteinSMESG000024682.1 dd_Smed_v4_3381_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016041SMED30016041SMESG000067158.1 SMESG000079384.1 SMESG000006522.1 dd_Smed_v4_6854_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016041SMED30016041 dd_Smed_v4_10793_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016041SMED30016041 dd_Smed_v4_3976_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006736colorectal mutant cancer proteinSMESG000002794.1 dd_Smed_v4_5396_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012300SMED30012300SMESG000013739.1 dd_Smed_v4_5519_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017235SMED30017235SMESG000067158.1 SMESG000079384.1 SMESG000006522.1 dd_Smed_v4_6854_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011512Radial spoke head 1 homologSMESG000014300.1 dd_Smed_v4_3321_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006203Methyltranfer_dom domain-containing proteinSMESG000031406.1 dd_Smed_v4_3811_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018939tubulin polyglutamylase TTLL4-likeSMESG000056158.1 dd_Smed_v4_17034_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011700Calcium-binding protein ASMESG000052083.1 SMESG000048475.1 dd_Smed_v4_605_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016964AnoctaminSMESG000033730.1 SMESG000033728.1 dd_Smed_v4_6514_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007385SMED30007385SMESG000003089.1 dd_Smed_v4_780_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001347SMED30001347SMESG000053274.1 dd_Smed_v4_6857_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013676nesprin-1-likeSMESG000016747.1 SMESG000016745.1 dd_Smed_v4_5365_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010881SMED30010881SMESG000004195.1 dd_Smed_v4_991_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007607SMED30007607SMESG000050535.1 SMESG000050533.1 dd_Smed_v4_5107_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019133SMED30019133SMESG000019555.1 dd_Smed_v4_6722_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012757Tektin-4SMESG000068903.1 dd_Smed_v4_4872_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008534cGMP-dependent protein kinaseSMESG000052811.1 dd_Smed_v4_5704_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001836SMED30001836SMESG000070066.1 dd_Smed_v4_8830_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000212Vacuolar protein sorting-associated protein 26BSMESG000026617.1 dd_Smed_v4_912_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017440SMED30017440SMESG000016182.1 dd_Smed_v4_9694_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004553SMED30004553SMESG000023121.1 dd_Smed_v4_6718_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006397Cyclic nucleotide-binding domain-containing proteinSMESG000040419.1 SMESG000040416.1 SMESG000005563.1 dd_Smed_v4_19613_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013845Phosphoglucomutase-1SMESG000046578.1 dd_Smed_v4_3503_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017476Intraflagellar transport protein 57SMESG000013668.1 dd_Smed_v4_7099_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3001337140S ribosomal protein S26SMESG000049997.1 SMESG000005227.1 dd_Smed_v4_222_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010991SMED30010991SMESG000014346.1 dd_Smed_v4_2231_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010991SMED30010991SMESG000014346.1 dd_Smed_v4_6441_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002133PolyubiquitinSMESG000039444.1 SMESG000014081.1 dd_Smed_v4_34_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006714SMED30006714SMESG000001790.1 dd_Smed_v4_212_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013430Vigilin High density lipoprotein-binding proteinSMESG000018596.1 SMESG000006601.1 dd_Smed_v4_6161_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017224spermatogenesis-associated serine-rich protein 1-likeSMESG000043323.1 dd_Smed_v4_8305_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000174Ribosomal protein S6 kinase delta-1SMESG000004118.1 SMESG000004112.1 dd_Smed_v4_9766_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012665FERM domain-containing proteinSMESG000062741.1 SMESG000053535.1 SMESG000049374.1 SMESG000033049.1 SMESG000024644.1 SMESG000016667.1 dd_Smed_v4_6227_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009510intraflagellar transport protein 80 homologSMESG000066998.1 dd_Smed_v4_9110_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015943SMED30015943SMESG000014346.1 dd_Smed_v4_2231_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED300120465'-AMP-activated protein kinase subunit beta-1SMESG000037698.1 dd_Smed_v4_6112_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003662Serine/threonine-protein phosphatase 2A 55 kDa regulatory subunit BSMESG000074250.1 dd_Smed_v4_5857_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000740ets-1SMESG000033821.1 dd_Smed_v4_9185_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019717inositol phosphoceramide mannosyltransferase 2-likeSMESG000059812.1 SMESG000045480.1 SMESG000045292.1 SMESG000045267.1 SMESG000037990.1 dd_Smed_v4_2174_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016458SMED30016458SMESG000074522.1 SMESG000074521.1 dd_Smed_v4_1967_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008553Phosphoenolpyruvate carboxykinase [GTP]SMESG000062868.1 dd_Smed_v4_196_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014891Epoxide hydrolaseSMESG000002805.1 dd_Smed_v4_5113_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032342Hsc70-interacting proteinSMESG000040419.1 SMESG000040416.1 SMESG000005563.1 dd_Smed_v4_19613_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029806CIA30 domain-containing proteinSMESG000077270.1 dd_Smed_v4_8887_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027478SMED30027478SMESG000081245.1 dd_Smed_v4_3287_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032910Protein ANKUB1SMESG000033543.1 dd_Smed_v4_9027_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3002604960S ribosomal protein L35aSMESG000003977.1 dd_Smed_v4_318_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028237PMP-22/EMP/MP20/Claudin tight junctionSMESG000028931.1 dd_Smed_v4_2132_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022560Ribosomal_L28e domain-containing proteinSMESG000026745.1 dd_Smed_v4_221_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035599meisSMESG000006530.1 dd_Smed_v4_15951_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034500early growth response-2SMESG000004840.1 dd_Smed_v4_9273_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020948SMED30020948SMESG000024857.1 dd_Smed_v4_409_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031912SMED30031912SMESG000003404.1 dd_Smed_v4_2094_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023691sperm-tail PG-rich repeat-containing protein 2SMESG000034428.1 dd_Smed_v4_9462_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029491Outer dense fiber of sperm tails 2SMESG000016357.1 dd_Smed_v4_3609_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028759Mediator of RNA polymerase II transcription subunit 11SMESG000036125.1 dd_Smed_v4_9527_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029546Tektin 3SMESG000020792.1 dd_Smed_v4_3187_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022057SJCHGC08494 proteinSMESG000027083.1 dd_Smed_v4_2196_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023825LITAF domain-containing proteinSMESG000020853.1 dd_Smed_v4_353_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031880Family with sequence similarity 227 member BSMESG000052176.1 SMESG000046302.1 dd_Smed_v4_15102_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032389slc24a-1SMESG000010390.1 dd_Smed_v4_5868_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022841Chromosome 17 open reading frame 98SMESG000007056.1 dd_Smed_v4_9687_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025910Microtubule-associated protein futschSMESG000044270.1 SMESG000030021.1 SMESG000025422.1 dd_Smed_v4_1999_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020849SMED30020849SMESG000044682.1 dd_Smed_v4_3494_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035260SMED30035260SMESG000035564.1 dd_Smed_v4_12208_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022443Ankyrin repeat proteinSMESG000009520.1 SMESG000009519.1 dd_Smed_v4_9418_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034034SMED30034034SMESG000059880.1 dd_Smed_v4_20480_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020268Dynamin-type G domain-containing proteinSMESG000014756.1 SMESG000014755.1 dd_Smed_v4_2390_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022233SPATA6 domain-containing proteinSMESG000013811.1 dd_Smed_v4_4304_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032797DnaJ homolog subfamily A member 1SMESG000012107.1 dd_Smed_v4_147_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032947cilia- and flagella-associated protein 46SMESG000014116.1 SMESG000014118.1 dd_Smed_v4_14103_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029222Voltage-dependent calcium channel gamma-5 subunitSMESG000005361.1 dd_Smed_v4_20066_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022575pescadillo-1SMESG000032689.1 dd_Smed_v4_900_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030306ABC transporter domain-containing proteinSMESG000058880.1 SMESG000039065.1 dd_Smed_v4_4225_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033541SMED30033541SMESG000061837.1 dd_Smed_v4_14985_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033864pim-3SMESG000014593.1 dd_Smed_v4_6420_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027818Si:ch211-163l21.7SMESG000026490.1 dd_Smed_v4_3833_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030984MFS domain-containing proteinSMESG000069674.1 dd_Smed_v4_4285_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED300212652-acylglycerol O-acyltransferase 2SMESG000052656.1 dd_Smed_v4_6550_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023210PhosphodiesteraseSMESG000034055.1 SMESG000034048.1 dd_Smed_v4_9276_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033196SMED30033196SMESG000051944.1 dd_Smed_v4_14960_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017874PRKCA-binding proteinSMESG000013976.1 dd_Smed_v4_11769_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3000170160S ribosomal protein L7aSMESG000020535.1 dd_Smed_v4_296_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010632E3 ubiquitin-protein ligase RGLG4SMESG000076482.1 SMESG000076409.1 SMESG000076405.1 SMESG000076390.1 SMESG000076375.1 SMESG000076364.1 SMESG000076223.1 SMESG000040665.1 SMESG000019753.1 dd_Smed_v4_1097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012160SMED30012160SMESG000069851.1 dd_9493dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
pharynxSMED30012160SMED30012160SMESG000069851.1 dd_Smed_v4_9493_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016673Cylindromatosis (turban tumor syndrome), bSMESG000056847.1 SMESG000056843.1 SMESG000056838.1 SMESG000044770.1 SMESG000044762.1 SMESG000007140.1 dd_Smed_v4_1137_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017080FHA domain-containing proteinSMESG000061238.1 dd_Smed_v4_11335_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015887DUF4550 domain-containing proteinSMESG000000883.1 dd_Smed_v4_10058_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011238Kinesin-like proteinSMESG000035453.1 dd_Smed_v4_13424_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011238Kinesin-like proteinSMESG000035453.1 dd_Smed_v4_10765_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED300164222-oxoisovalerate dehydrogenase subunit alphaSMESG000021412.1 dd_Smed_v4_10732_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016010SMED30016010SMESG000042231.1 dd_Smed_v4_10980_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017048cilia- and flagella-associated protein 206SMESG000021247.1 dd_Smed_v4_11199_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015473Actin cytoplasmic type 5SMESG000080982.1 SMESG000080969.1 dd_Smed_v4_2624_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010775SMED30010775SMESG000062858.1 dd_Smed_v4_10948_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019518SMED30019518SMESG000073002.1 SMESG000072984.1 dd_Smed_v4_12680_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3001422860S ribosomal protein L6SMESG000050581.1 dd_Smed_v4_10396_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012107Zinc finger MYND domain-containing protein 12SMESG000023516.1 dd_Smed_v4_10079_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002257SMED30002257SMESG000010550.1 dd_Smed_v4_2590_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017201SFI1SMESG000002829.1 dd_Smed_v4_12484_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012459SMED30012459SMESG000003156.1 dd_Smed_v4_2446_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018865DUF1619 domain-containing proteinSMESG000057489.1 dd_Smed_v4_11225_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011699calcium/calmodulin-dependent protein kinase type IVSMESG000042100.1 dd_Smed_v4_10731_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010364SMED30010364SMESG000056847.1 SMESG000056843.1 SMESG000056838.1 SMESG000044770.1 SMESG000044762.1 SMESG000007140.1 dd_Smed_v4_1137_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009173Glutamate receptor-interacting protein 2SMESG000031603.1 dd_Smed_v4_3080_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018872Ig-like domain-containing proteinSMESG000042318.1 dd_Smed_v4_11702_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015125SMED30015125SMESG000061766.1 dd_Smed_v4_12632_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013590Protein FAM221BSMESG000035378.1 dd_Smed_v4_10703_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005163SMED30005163SMESG000043675.1 dd_Smed_v4_28780_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007742Protein transport protein Sec61 subunit alphaSMESG000003007.1 dd_Smed_v4_282_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011381HORMA domain-containing proteinSMESG000066514.1 dd_Smed_v4_2201_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017333centrosomal protein of 83 kDa-likeSMESG000033227.1 SMESG000033225.1 dd_Smed_v4_12969_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013161SMED30013161SMESG000051379.1 dd_Smed_v4_2630_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016516Protein diaphanous homolog 2SMESG000057806.1 dd_Smed_v4_2533_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017260Pre mRNA processing factor 6SMESG000011657.1 dd_Smed_v4_1153_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023017SMED30023017SMESG000065348.1 dd_1320dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
pharynxSMED30023017SMED30023017SMESG000065348.1 dd_Smed_v4_1320_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031485Lipoxygenase homology domain-containing protein 1SMESG000001054.1 dd_Smed_v4_10315_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034851Procollagen galactosyltransferaseSMESG000037408.1 dd_Smed_v4_10276_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031490SMED30031490SMESG000017778.1 dd_Smed_v4_10175_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018819SMED30018819SMESG000055179.1 dd_Smed_v4_8901_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007543nesprin-1-likeSMESG000016747.1 SMESG000016745.1 dd_Smed_v4_5365_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010749BZIP domain-containing proteinSMESG000028072.1 dd_Smed_v4_6373_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002842SMED30002842SMESG000056914.1 dd_Smed_v4_8301_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006336PIH1 domain-containing 2SMESG000077578.1 dd_Smed_v4_9306_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003729Dynein light chainSMESG000048100.1 dd_Smed_v4_5884_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008911FascinSMESG000037971.1 dd_Smed_v4_996_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007142Sperm surface protein Sp17SMESG000046919.1 dd_Smed_v4_4783_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007142Sperm surface protein Sp17SMESG000046919.1 dd_Smed_v4_2279_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000995Pyruvate kinaseSMESG000052083.1 SMESG000048475.1 dd_Smed_v4_605_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3002341340S ribosomal protein S25SMESG000059049.1 dd_Smed_v4_134_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032581Protein elav-like proteinSMESG000073310.1 dd_Smed_v4_13151_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3002077640S ribosomal protein S21SMESG000004954.1 dd_Smed_v4_84_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021146SERPIN domain-containing proteinSMESG000054563.1 dd_Smed_v4_3824_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032070SMED30032070SMESG000079312.1 dd_Smed_v4_16775_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022070SMED30022070SMESG000067158.1 SMESG000079384.1 SMESG000006522.1 dd_Smed_v4_6854_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027593Protein polyglycylase TTLL10SMESG000042729.1 SMESG000042734.1 dd_Smed_v4_14858_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026726RING domain ligase2 isoform 3SMESG000003596.1 dd_Smed_v4_6423_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026726RING domain ligase2 isoform 3SMESG000003596.1 dd_Smed_v4_5871_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021504SMED30021504SMESG000030479.1 dd_Smed_v4_3869_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021601SMED30021601SMESG000003951.1 dd_Smed_v4_6596_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021386Y box protein-1SMESG000058066.1 dd_Smed_v4_52_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021431TTF-type domain-containing proteinSMESG000080622.1 SMESG000068757.1 SMESG000055125.1 SMESG000038294.1 SMESG000032747.1 SMESG000023322.1 dd_Smed_v4_3830_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035592E3 ubiquitin-protein ligase mind-bombSMESG000031930.1 dd_Smed_v4_1317_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021837piggyBac transposable element-derived protein 4-likeSMESG000080622.1 SMESG000068757.1 SMESG000055125.1 SMESG000038294.1 SMESG000032747.1 SMESG000023322.1 dd_Smed_v4_3830_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030310SMED30030310SMESG000057201.1 dd_Smed_v4_1531_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034141Leucine-rich repeat-containing protein 27SMESG000073140.1 dd_Smed_v4_13740_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003406Bestrophin homologSMESG000060552.1 dd_Smed_v4_4179_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000090SMED30000090SMESG000051911.1 dd_Smed_v4_5276_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3000245560S ribosomal protein L6SMESG000076172.1 dd_Smed_v4_205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015252Mitochondrial inner membrane protein OXA1LSMESG000039158.1 dd_Smed_v4_4072_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011242Synaptosomal-associated protein 29SMESG000001576.1 dd_Smed_v4_1819_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003889SMED30003889SMESG000051911.1 dd_Smed_v4_5276_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003997SMED30003997SMESG000059318.1 SMESG000059304.1 dd_Smed_v4_483_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019094Protein flightless-1SMESG000020935.1 dd_Smed_v4_1781_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000794Luc7-like protein 3SMESG000041410.1 dd_Smed_v4_1899_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001366SMED30001366SMESG000014648.1 dd_Smed_v4_1227_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010620Histone acetyltransferaseSMESG000017094.1 dd_Smed_v4_12274_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000146GLI-3SMESG000078300.1 dd_Smed_v4_17566_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3000257426S proteasome regulatory subunit N11SMESG000056298.1 SMESG000056198.1 dd_Smed_v4_2126_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018630High mobility group proteinSMESG000052032.1 dd_Smed_v4_1331_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014047SMED30014047SMESG000025950.1 dd_Smed_v4_12336_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003236TropomodulinSMESG000054078.1 dd_Smed_v4_3279_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001834SMED30001834SMESG000068935.1 dd_Smed_v4_357_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014459bak-2SMESG000008222.1 dd_Smed_v4_1767_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010655SMED30010655SMESG000028897.1 dd_Smed_v4_12473_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001197SMED30001197SMESG000004996.1 dd_Smed_v4_4124_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004315Bestrophin homologSMESG000070057.1 dd_Smed_v4_8073_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025510UHRF1-binding protein 1-likeSMESG000044305.1 dd_Smed_v4_11401_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026237Coiled-coil and C2 domain containing 2ASMESG000048372.1 dd_Smed_v4_11189_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030679Elongation of very long chain fatty acids proteinSMESG000068877.1 SMESG000068874.1 dd_Smed_v4_4252_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028890Bravo_FIGEY domain-containing proteinSMESG000065363.1 SMESG000043141.1 dd_Smed_v4_1294_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021019CYTOSOL_AP domain-containing proteinSMESG000037599.1 dd_Smed_v4_181_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031005A disintegrin and metalloproteinase with thrombospondin motifs 2SMESG000051172.1 dd_Smed_v4_16551_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021731Multidrug resistance protein 1-like proteinSMESG000004996.1 dd_Smed_v4_4124_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033868BTEB transcription factorSMESG000032379.1 dd_Smed_v4_12264_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031752Metal transporter cnnm2SMESG000070597.1 dd_Smed_v4_18450_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025664TSNAXIP1_N domain-containing proteinSMESG000060720.1 dd_Smed_v4_13434_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025226CalmodulinSMESG000004980.1 dd_Smed_v4_13205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3002728060S acidic ribosomal protein P0SMESG000079482.1 dd_Smed_v4_161_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031582InnexinSMESG000081749.1 dd_Smed_v4_11302_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031582InnexinSMESG000081749.1 dd_Smed_v4_10287_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031491Armadillo repeat containing 4SMESG000057827.1 dd_Smed_v4_5065_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023411slc42a-1SMESG000048384.1 dd_Smed_v4_1882_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031188Casein kinase ISMESG000050144.1 SMESG000050130.1 dd_Smed_v4_16169_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033098WD repeat-containing protein 97 isoform X2SMESG000010382.1 dd_Smed_v4_11828_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026225SMED30026225SMESG000059698.1 dd_Smed_v4_188_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030526Neurogenic locus Notch proteinSMESG000035155.1 dd_Smed_v4_11097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027035Pseudouridine synthaseSMESG000051935.1 dd_Smed_v4_12745_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033750Protein kinaseSMESG000070879.1 SMESG000070880.1 dd_Smed_v4_3195_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3002418960S ribosomal protein L31SMESG000017099.1 dd_Smed_v4_113_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023484Methyltransferase-like protein 17SMESG000058278.1 SMESG000058279.1 dd_Smed_v4_4718_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022312COesterase domain-containing proteinSMESG000064723.1 dd_Smed_v4_18958_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034138Coiled-coil domain-containing protein 96SMESG000050787.1 dd_Smed_v4_11884_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028228Centrosomal protein 164SMESG000054195.1 SMESG000021687.1 dd_Smed_v4_12228_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030030SMED30030030SMESG000007276.1 dd_Smed_v4_11992_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025608X1.A.G7.1SMESG000046817.1 SMESG000046814.1 dd_Smed_v4_1507_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028624Synaptotagmin, putativeSMESG000034832.1 dd_Smed_v4_13224_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027644cAMP-dependent protein kinase regulatory subunitSMESG000003135.1 dd_Smed_v4_14355_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022844NEPH-3SMESG000022777.1 dd_Smed_v4_11280_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021685Bestrophin homologSMESG000070057.1 dd_Smed_v4_8073_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023487Protein LSM14 homolog B-ASMESG000014632.1 dd_Smed_v4_1125_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013975Ras association domain-containing protein 1SMESG000029652.1 dd_Smed_v4_5323_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010910POU domain proteinSMESG000058834.1 dd_Smed_v4_13010_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004278KinaseSMESG000019079.1 dd_Smed_v4_3687_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005787Vimentin type intermediate filament associatedSMESG000058278.1 SMESG000058279.1 dd_Smed_v4_4718_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004178SMED30004178SMESG000025475.1 dd_Smed_v4_2550_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004939SMED30004939SMESG000001797.1 dd_Smed_v4_272_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010249SMED30010249SMESG000034719.1 dd_Smed_v4_14311_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014748Ptk7SMESG000072430.1 dd_Smed_v4_6999_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001723HTH CENPB-type domain-containing proteinSMESG000004654.1 dd_Smed_v4_15381_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001723HTH CENPB-type domain-containing proteinSMESG000049778.1 SMESG000048378.1 SMESG000039423.1 SMESG000024543.1 SMESG000022136.1 SMESG000002434.1 SMESG000078403.1 dd_Smed_v4_12879_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004820Microfibrillar-associated protein 1SMESG000004991.1 dd_Smed_v4_2957_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004855Glutaredoxin-1SMESG000053749.1 dd_Smed_v4_4565_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011935SMED30011935SMESG000059652.1 dd_Smed_v4_26667_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001801NME/NM23 nucleoside diphosphate kinase 1SMESG000008082.1 dd_Smed_v4_1096_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013825Acyl-coenzyme A thioesterase 13SMESG000063995.1 dd_Smed_v4_4659_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013300Mitochondrial ATP synthase subunit 9SMESG000078181.1 dd_Smed_v4_23_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013087SMED30013087SMESG000023252.1 dd_Smed_v4_18917_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005665SMED30005665SMESG000074689.1 dd_Smed_v4_2429_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019240Protein FAM151ASMESG000000164.1 dd_Smed_v4_9939_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015426SMED30015426SMESG000038532.1 SMESG000038520.1 SMESG000038497.1 SMESG000036112.1 SMESG000036067.1 dd_Smed_v4_5097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016557AquaporinSMESG000023346.1 dd_Smed_v4_6111_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017971ANK_REP_REGION domain-containing proteinSMESG000026132.1 dd_Smed_v4_6201_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023008HSP27SMESG000030472.1 dd_Smed_v4_2189_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029624Heterogeneous nuclear ribonucleoprotein KSMESG000064674.1 dd_Smed_v4_1998_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031908SMED30031908SMESG000054111.1 dd_Smed_v4_9796_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035317Phosphoglycerate kinaseSMESG000039090.1 dd_Smed_v4_972_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031139WASH complex subunit 2CSMESG000014537.1 SMESG000014534.1 dd_Smed_v4_19560_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025757JUNLI-1SMESG000067959.1 dd_Smed_v4_4878_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035079Phospholipid-transporting ATPaseSMESG000061014.1 dd_Smed_v4_2913_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022424MYND-type domain-containing proteinSMESG000066740.1 dd_Smed_v4_9973_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031389CalnexinSMESG000016275.1 dd_Smed_v4_632_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021661Carbonic anhydrase 7SMESG000017176.1 SMESG000017171.1 dd_Smed_v4_4841_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025004Magnesium-dependent phosphatase 1SMESG000025378.1 dd_Smed_v4_1958_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026337AnkyrinSMESG000000606.1 dd_Smed_v4_2072_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030159SMED30030159SMESG000000606.1 dd_Smed_v4_2072_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031837SMED30031837SMESG000054635.1 SMESG000054602.1 SMESG000052914.1 dd_Smed_v4_2185_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026364SMED-P53SMESG000078256.1 SMESG000078255.1 dd_Smed_v4_5563_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020205Si:dkey-90a13.10SMESG000035648.1 dd_Smed_v4_5452_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030643Methylmalonic aciduria and homocystinuria type D-like protein, mitochondrialSMESG000030431.1 dd_Smed_v4_2046_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028734SMED30028734SMESG000038532.1 SMESG000038520.1 SMESG000038497.1 SMESG000036112.1 SMESG000036067.1 dd_Smed_v4_5097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022032SMED30022032SMESG000038532.1 SMESG000038520.1 SMESG000038497.1 SMESG000036112.1 SMESG000036067.1 dd_Smed_v4_5097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026287SMED30026287SMESG000057102.1 dd_Smed_v4_45699_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031571Testis-specific expressed protein 55SMESG000033391.1 dd_Smed_v4_5969_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022737tRNA 2-thiocytidine biosynthesis protein TtcASMESG000015154.1 dd_Smed_v4_98907_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034506Angiotensin-converting enzymeSMESG000005710.1 dd_Smed_v4_6160_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028223Stabilizer of axonemal microtubules 1SMESG000042230.1 dd_Smed_v4_5551_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033108Rhophilin-2-like ProteinSMESG000022872.1 dd_Smed_v4_6255_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034254calreticulin-1SMESG000009012.1 dd_Smed_v4_220_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30024787SMED30024787SMESG000056261.1 dd_Smed_v4_8391_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032159Oxysterol-binding proteinSMESG000046022.1 dd_Smed_v4_5423_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021145SMED30021145SMESG000023086.1 dd_Smed_v4_6287_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032616TSNAXIP1_N domain-containing proteinSMESG000025884.1 dd_Smed_v4_9605_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002774SMED30002774SMESG000017229.1 dd_Smed_v4_613_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005280SMED30005280SMESG000077104.1 dd_Smed_v4_4063_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011708Neural cell adhesion molecule 1SMESG000077686.1 dd_Smed_v4_3768_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005698SMED30005698SMESG000052123.1 dd_Smed_v4_2845_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020000RNA binding motif single stranded interactingSMESG000010632.1 dd_Smed_v4_3575_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008280Class E vacuolar protein-sorting machinery protein HSE1SMESG000077597.1 dd_Smed_v4_4190_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009224early growth response-3SMESG000000959.1 dd_Smed_v4_12410_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009224early growth response-3SMESG000000959.1 dd_Smed_v4_14711_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007107SMED30007107SMESG000050890.1 dd_Smed_v4_1847_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004118Tubulin beta chainSMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044888.1 SMESG000035755.1 dd_Smed_v4_83_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019874CalmodulinSMESG000010769.1 dd_Smed_v4_255_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011690Heterogeneous nuclear ribonucleoprotein A2SMESG000050993.1 SMESG000050994.1 dd_Smed_v4_1194_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000491Cornifelin-like ASMESG000023836.1 dd_Smed_v4_1291_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006437HTH CENPB-type domain-containing proteinSMESG000078713.1 SMESG000060505.1 SMESG000055485.1 SMESG000051367.1 SMESG000073216.1 SMESG000045326.1 SMESG000032032.1 SMESG000021912.1 SMESG000017091.1 dd_Smed_v4_12660_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011084Epidermal growth factor receptor kinase substrate 8SMESG000070650.1 dd_Smed_v4_4256_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001185Transmembrane protein 231SMESG000032658.1 dd_Smed_v4_16131_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017953SMED30017953SMESG000011944.1 dd_Smed_v4_3820_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014265Neutral ceramidaseSMESG000003228.1 dd_Smed_v4_1726_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010842EF-hand domain-containing protein 1SMESG000078434.1 dd_Smed_v4_2935_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015069ANK_REP_REGION domain-containing proteinSMESG000063648.1 dd_Smed_v4_10764_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018656SMED30018656SMESG000056208.1 dd_Smed_v4_16921_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003011NPHP1SMESG000061008.1 dd_Smed_v4_9990_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019951t-SNARE coiled-coil homology domain-containing proteinSMESG000005677.1 dd_Smed_v4_4355_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000006Potassium voltage gated channel subfamily HSMESG000050992.1 dd_Smed_v4_14863_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010940TetraspaninSMESG000021642.1 dd_Smed_v4_1257_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017636Calsyntenin 1SMESG000068054.1 dd_Smed_v4_4147_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002145HEAT repeat-containing protein 4SMESG000024853.1 SMESG000024852.1 dd_Smed_v4_16127_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005190SMED30005190SMESG000041069.1 dd_Smed_v4_237_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3000898760S ribosomal protein L13-like proteinSMESG000036992.1 dd_Smed_v4_145_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003507Adenylate kinase 9SMESG000043841.1 dd_Smed_v4_9617_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018899TetraspaninSMESG000078545.1 dd_Smed_v4_354_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001490ADF-H domain-containing proteinSMESG000080129.1 dd_Smed_v4_260_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015820Dual specificity tyrosine-phosphorylation-regulated kinase 4SMESG000042374.1 dd_Smed_v4_12591_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002374phytanoyl-CoA dioxygenase domain-containing protein 1 homologSMESG000077696.1 SMESG000077694.1 dd_Smed_v4_1292_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000972Leucine-rich repeat-containing protein 71SMESG000006778.1 dd_Smed_v4_12043_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016252SaposinSMESG000074184.1 SMESG000019975.1 dd_Smed_v4_266_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017021PhosphodiesteraseSMESG000044149.1 dd_Smed_v4_15950_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012419Non-specific serine/threonine protein kinaseSMESG000069962.1 SMESG000069953.1 SMESG000069952.1 dd_Smed_v4_3244_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008018Bestrophin homologSMESG000045575.1 dd_Smed_v4_15893_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010203C2H2-type domain-containing proteinSMESG000067728.1 dd_Smed_v4_1455_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011755SMED30011755SMESG000074184.1 SMESG000019975.1 dd_Smed_v4_266_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016885Phytanoyl-CoA dioxygenase family proteinSMESG000077696.1 SMESG000077694.1 dd_Smed_v4_1292_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003036SMED30003036SMESG000076482.1 SMESG000076470.1 SMESG000076469.1 SMESG000076410.1 SMESG000076409.1 SMESG000076408.1 SMESG000076407.1 SMESG000076406.1 SMESG000076390.1 SMESG000076389.1 SMESG000076385.1 SMESG000076375.1 SMESG000076371.1 SMESG000076363.1 SMESG000076358.1 SMESG000076223.1 SMESG000040665.1 dd_Smed_v4_645_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017943SMED30017943SMESG000022837.1 dd_Smed_v4_16017_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006792Argonaute 1SMESG000050993.1 SMESG000050994.1 dd_Smed_v4_1194_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026658SMED30026658SMESG000008925.1 dd_Smed_v4_376_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033402Nascent polypeptide-associated complex subunit betaSMESG000026176.1 dd_Smed_v4_358_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3003191640S ribosomal protein S30SMESG000065562.1 dd_Smed_v4_126_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025045SMED30025045SMESG000069184.1 SMESG000069172.1 dd_Smed_v4_17542_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031519Tyrosine-protein kinaseSMESG000020289.1 dd_Smed_v4_9416_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030425Ubiquitin carboxyl-terminal hydrolase 7SMESG000050890.1 dd_Smed_v4_1847_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026420Leucyl aminopeptidaseSMESG000037609.1 dd_Smed_v4_2903_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033340DUF4476 domain-containing proteinSMESG000055714.1 dd_Smed_v4_3608_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034870SMED30034870SMESG000047469.1 dd_Smed_v4_16220_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034546Protein transport protein Sec61 subunit gammaSMESG000062123.1 SMESG000063809.1 dd_Smed_v4_429_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3002930240S ribosomal protein S16SMESG000018349.1 SMESG000018333.1 dd_Smed_v4_170_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021825Expressed conserved proteinSMESG000021837.1 dd_Smed_v4_4104_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025883Forkhead associated phosphopeptide binding domain 1SMESG000071072.1 dd_Smed_v4_14350_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027186SMED30027186SMESG000022949.1 dd_Smed_v4_14572_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020269MyophilinSMESG000081505.1 SMESG000049198.1 SMESG000047694.1 SMESG000035451.1 SMESG000035348.1 dd_Smed_v4_395_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025542Leucine-rich repeat-containing protein 71SMESG000006778.1 dd_Smed_v4_12043_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022973Rho GTPase-activating protein 12SMESG000012042.1 dd_Smed_v4_4253_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028668Leucine-rich repeat-containing protein 71SMESG000006778.1 dd_Smed_v4_12043_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035963SMED30035963SMESG000071278.1 dd_Smed_v4_1649_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029770ATP-binding cassette sub-family F member 2SMESG000071613.1 dd_Smed_v4_434_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30024368chromodomain helicase DNA-binding protein 4SMESG000068192.1 dd_Smed_v4_2331_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017731ADP-ribosylation factor-like protein 3SMESG000074427.1 SMESG000058739.1 SMESG000012243.1 dd_Smed_v4_3162_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002166SMED30002166SMESG000058880.1 SMESG000039065.1 dd_Smed_v4_4225_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006074SMED30006074SMESG000019341.1 dd_Smed_v4_177_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016840PhosphodiesteraseSMESG000019038.1 dd_Smed_v4_8595_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014640Small heat shock protein p36SMESG000028601.1 dd_Smed_v4_6399_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018477Myc box-dependent-interacting protein 1SMESG000021147.1 dd_Smed_v4_3292_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018495ATPase_AAA_core domain-containing proteinSMESG000073596.1 dd_Smed_v4_9568_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018495ATPase_AAA_core domain-containing proteinSMESG000073596.1 dd_Smed_v4_9484_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002516SMED30002516SMESG000011859.1 dd_Smed_v4_1283_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018185SMED30018185SMESG000003780.1 dd_Smed_v4_9295_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014133EF-hand calcium-binding domain-containing protein 10-likeSMESG000023074.1 dd_Smed_v4_6477_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000411Dynamin-1SMESG000021502.1 dd_Smed_v4_2160_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031929zf-LYAR domain-containing proteinSMESG000081140.1 dd_Smed_v4_5281_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030431U1 small nuclear ribonucleoprotein 70 kDaSMESG000010283.1 dd_Smed_v4_633_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030670Microtubule-associated proteins 1A/1B light chain 3CSMESG000067960.1 SMESG000079855.1 SMESG000037170.1 dd_Smed_v4_2838_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3003090860S ribosomal protein L27SMESG000045074.1 dd_Smed_v4_200_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034740Guanylate cyclase domain-containing proteinSMESG000049374.1 SMESG000033049.1 SMESG000007273.1 dd_Smed_v4_9655_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022038slc47a-5SMESG000077134.1 dd_Smed_v4_9513_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025473mxi-2 proteinSMESG000060394.1 dd_Smed_v4_4048_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032531SMED30032531SMESG000024850.1 dd_Smed_v4_9209_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029780EGR-like protein 1SMESG000000960.1 dd_Smed_v4_7731_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031216Oxysterol-binding proteinSMESG000023068.1 dd_Smed_v4_3268_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033015SMED30033015SMESG000049533.1 dd_Smed_v4_2058_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030435Serine/arginine-rich splicing factorSMESG000015564.1 dd_Smed_v4_3431_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031336MusashiSMESG000071202.1 dd_Smed_v4_7323_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031809SMED30031809SMESG000003238.1 dd_Smed_v4_24918_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023490SMED30023490SMESG000076531.1 dd_Smed_v4_7027_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020779PhosphodiesteraseSMESG000019038.1 dd_Smed_v4_8595_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3002315960S acidic ribosomal protein P2SMESG000009232.1 dd_Smed_v4_96_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027376SMED30027376SMESG000007018.1 SMESG000007017.1 dd_Smed_v4_1969_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027376SMED30027376SMESG000007017.1 dd_Smed_v4_7377_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030448Dual specificity protein phosphatase 10SMESG000078269.1 dd_Smed_v4_3617_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021143Basal body-orientation factor 1SMESG000078046.1 dd_Smed_v4_9328_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020195rab-like protein 2ASMESG000031968.1 dd_Smed_v4_9251_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028023adenylate kinase 7SMESG000075900.1 dd_Smed_v4_7959_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021874CaveolinSMESG000052389.1 dd_Smed_v4_877_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030079SMED30030079SMESG000042010.1 dd_Smed_v4_8745_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3002338613 kDa deflagellation-inducible proteinSMESG000050233.1 dd_Smed_v4_3576_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025647Ig-like domain-containing proteinSMESG000079961.1 dd_Smed_v4_12974_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030319Trichoplein keratin filament-binding proteinSMESG000056471.1 dd_Smed_v4_6634_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029561SMED30029561SMESG000041756.1 dd_Smed_v4_3569_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027566SMED30027566SMESG000075236.1 dd_Smed_v4_7519_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034766EnolaseSMESG000052380.1 dd_Smed_v4_510_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028659Cilia-and flagella-associated protein 100SMESG000033127.1 dd_Smed_v4_6518_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021508Glutamate dehydrogenaseSMESG000061402.1 dd_Smed_v4_932_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022055SMED30022055SMESG000039579.1 dd_Smed_v4_32066_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033644titin homologSMESG000002539.1 dd_Smed_v4_8111_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026043UTP--glucose-1-phosphate uridylyltransferaseSMESG000043519.1 dd_Smed_v4_3057_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025747SMED30025747SMESG000049533.1 dd_Smed_v4_2058_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021154Calmodulin, putativeSMESG000040933.1 SMESG000040932.1 dd_Smed_v4_603_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033791cilia- and flagella-associated protein 161SMESG000028972.1 dd_Smed_v4_8229_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021222Meiosis specific nuclear structural 1SMESG000036318.1 dd_Smed_v4_4463_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021056Acetyl-CoA carboxylaseSMESG000056269.1 dd_Smed_v4_7823_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020375PHD finger-like domain-containing protein 5ASMESG000029843.1 dd_Smed_v4_2656_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034709DNA polymerase etaSMESG000019761.1 SMESG000010350.1 SMESG000010346.1 dd_Smed_v4_6500_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035683V-type proton ATPase subunit aSMESG000044136.1 SMESG000037609.1 dd_Smed_v4_833_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022570Ras-related protein Rab-27ASMESG000014812.1 dd_Smed_v4_3594_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033655Bestrophin homologSMESG000069980.1 dd_Smed_v4_9590_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023471Myosin, light chain kinase aSMESG000081274.1 dd_Smed_v4_3482_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032372Coiled-coil domain containing 40SMESG000008312.1 dd_Smed_v4_6338_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026811DUF3421 domain-containing proteinSMESG000074377.1 dd_Smed_v4_766_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035808Serine/threonine-protein kinase fusedSMESG000078509.1 SMESG000078507.1 dd_Smed_v4_4259_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034775Ras-associating domain-containing proteinSMESG000002146.1 dd_Smed_v4_3216_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032666Spermatogenesis associated 7SMESG000056890.1 dd_Smed_v4_8977_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032161SMED30032161SMESG000076606.1 dd_Smed_v4_8156_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030062SMED30030062SMESG000049230.1 dd_Smed_v4_3251_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035584Stabilizer of axonemal microtubules 2SMESG000009389.1 dd_Smed_v4_3695_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026732NADH dehydrogenase iron-sulfur protein 8, mitochondrialSMESG000002076.1 dd_Smed_v4_849_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026742Calpain BSMESG000017238.1 dd_Smed_v4_8673_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025549DNA-binding protein IkarosSMESG000052707.1 dd_Smed_v4_3031_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032500Ras-related protein Rab-10SMESG000052620.1 dd_Smed_v4_6049_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED300030531-acyl-sn-glycerol-3-phosphate acyltransferase deltaSMESG000056953.1 dd_Smed_v4_5643_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010123Sodium/potassium-transporting ATPase subunit beta-1SMESG000064593.1 dd_Smed_v4_2210_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008772Golgi-associated plant pathogenesis-related protein 1SMESG000035954.1 dd_Smed_v4_27440_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001916IRS-type PTB domain-containing proteinSMESG000027222.1 dd_Smed_v4_9490_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010475EF Hand type proteinSMESG000065951.1 dd_Smed_v4_8441_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006820cilia- and flagella-associated protein 57SMESG000072029.1 dd_Smed_v4_3323_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015825inositol phosphoceramide mannosyltransferase 2-likeSMESG000059812.1 SMESG000045480.1 SMESG000045292.1 SMESG000045267.1 SMESG000037990.1 dd_Smed_v4_2174_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014876SMED30014876SMESG000054780.1 SMESG000025014.1 SMESG000025004.1 dd_Smed_v4_61_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003887c-Myc-binding proteinSMESG000001466.1 dd_Smed_v4_891_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009297kinesin light chainSMESG000007554.1 dd_Smed_v4_6239_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007579SMED30007579SMESG000038305.1 SMESG000038298.1 SMESG000038313.1 SMESG000035859.1 dd_Smed_v4_9798_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000048testis-expressed protein 43SMESG000012601.1 dd_Smed_v4_9820_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012822heterogeneous nuclear ribonucleoprotein A1 A2/B1SMESG000081075.1 dd_Smed_v4_986_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009214SMED30009214SMESG000073871.1 dd_Smed_v4_5756_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3000013460S ribosomal protein L4SMESG000009479.1 dd_Smed_v4_211_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007989IQ and ubiquitin-like domain-containing proteinSMESG000006819.1 dd_Smed_v4_9227_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018588MusashiSMESG000077233.1 dd_Smed_v4_8902_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008550intraflagellar transport protein 20 homologSMESG000067757.1 dd_Smed_v4_9545_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016917Tctex1 domain containing 1SMESG000040148.1 dd_Smed_v4_9321_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008476LRRC50SMESG000004118.1 SMESG000004112.1 dd_Smed_v4_9766_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006563SEC7 domain-containing proteinSMESG000042180.1 dd_Smed_v4_9423_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015018SMED30015018SMESG000075952.1 dd_Smed_v4_4158_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000946Calpain-BSMESG000067761.1 dd_Smed_v4_4020_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013808fos-1SMESG000003328.1 dd_Smed_v4_2789_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001818TNF receptor associated factor 3SMESG000026104.1 dd_Smed_v4_9703_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010892SMED30010892SMESG000021730.1 dd_Smed_v4_9188_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003873nuclear factor Y subunit BSMESG000017262.1 dd_Smed_v4_5828_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003292SMED30003292SMESG000066258.1 dd_Smed_v4_19593_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3001198260S ribosomal protein L17SMESG000009564.1 dd_Smed_v4_95_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029100ras-related protein Rab-32SMESG000060721.1 dd_Smed_v4_6128_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023050Aldehyde dehydrogenase, mitochondrialSMESG000016195.1 dd_Smed_v4_1339_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034831SMED30034831SMESG000064758.1 dd_Smed_v4_5168_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027782SMED30027782SMESG000031406.1 dd_Smed_v4_3811_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026121Ectonucleotide pyrophosphatase/phosphodiesterase family member 6SMESG000040292.1 dd_Smed_v4_1269_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034947SMED30034947SMESG000077223.1 dd_Smed_v4_7005_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025309Dimer_Tnp_hAT domain-containing proteinSMESG000066861.1 SMESG000059630.1 SMESG000066862.1 dd_Smed_v4_6647_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028898BZIP domain-containing proteinSMESG000067543.1 dd_Smed_v4_1399_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031493RNA binding motif single stranded interactingSMESG000005941.1 dd_Smed_v4_3832_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026544Mucin-19-like isoform X3SMESG000001496.1 SMESG000001495.1 dd_Smed_v4_14943_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028919SMED30028919SMESG000067158.1 SMESG000079384.1 SMESG000006522.1 dd_Smed_v4_6854_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023756ATP-dependent RNA helicase DBP2SMESG000012031.1 dd_Smed_v4_3816_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30024930slc15a-2SMESG000011953.1 dd_Smed_v4_8983_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031654SMED30031654SMESG000064362.1 dd_Smed_v4_3795_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034903cilia- and flagella-associated protein 77SMESG000042608.1 dd_Smed_v4_5179_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034263Trifunctional enzyme subunit alpha, mitochondrialSMESG000061749.1 dd_Smed_v4_863_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034248SMED30034248SMESG000005941.1 dd_Smed_v4_3832_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031471SMED30031471SMESG000050535.1 SMESG000050533.1 dd_Smed_v4_5107_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3003151240S ribosomal protein S21SMESG000004954.1 dd_Smed_v4_84_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025680Anosmin-1SMESG000033070.1 dd_Smed_v4_13188_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033701chromobox protein homolog 1SMESG000055315.1 SMESG000055314.1 SMESG000054375.1 SMESG000054374.1 dd_Smed_v4_4855_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022362Synaptotagmin-2SMESG000011583.1 dd_Smed_v4_12772_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030060Mannose-1-phosphate guanyltransferase alphaSMESG000016171.1 dd_Smed_v4_4150_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED300316316-phosphogluconate dehydrogenase, decarboxylatingSMESG000005721.1 dd_Smed_v4_366_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028990Protein containing PTH2 domainSMESG000055936.1 dd_Smed_v4_6409_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033453Dimer_Tnp_hAT domain-containing proteinSMESG000001790.1 dd_Smed_v4_212_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032442Ectonucleoside triphosphate diphosphohydrolase 5SMESG000002990.1 dd_Smed_v4_8855_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023748SMED30023748SMESG000022731.1 dd_Smed_v4_13297_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033302RNA-binding protein MEX3BSMESG000044270.1 SMESG000030021.1 SMESG000025422.1 dd_Smed_v4_1999_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028938Protein disulfide-isomerase A6SMESG000023147.1 dd_Smed_v4_250_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030766Y box protein-1SMESG000058066.1 dd_Smed_v4_52_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034139Receptor-type tyrosine-protein phosphatase betaSMESG000005260.1 dd_Smed_v4_5733_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026517SMED30026517SMESG000054758.1 SMESG000004218.1 dd_Smed_v4_8963_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032448Expressed conserved proteinSMESG000064362.1 dd_Smed_v4_3795_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028417Bardet-Biedl syndrome 1 protein homologSMESG000009880.1 dd_Smed_v4_7298_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034016Sperm surface protein Sp17SMESG000046919.1 dd_Smed_v4_4783_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022545Protein kinase domain-containing proteinSMESG000057044.1 dd_Smed_v4_9098_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035226AnnexinSMESG000023108.1 dd_Smed_v4_5798_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017663Fer-1-relatedSMESG000070967.1 dd_Smed_v4_4648_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016875Rho-associated kinaseSMESG000057753.1 dd_Smed_v4_2914_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000459Dynamin-1-like proteinSMESG000058940.1 dd_Smed_v4_388_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000918Coiled-coil domain containing 13SMESG000058204.1 dd_Smed_v4_12055_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006343dynein heavy chain 5, axonemalSMESG000049144.1 dd_Smed_v4_4569_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002742DystoninSMESG000043809.1 SMESG000043799.1 dd_Smed_v4_1205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001071Low density lipoprotein-receptor, class A,domain-containing proteinSMESG000037863.1 dd_Smed_v4_12756_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013139SMED30013139SMESG000059266.1 SMESG000059254.1 dd_Smed_v4_301_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009737Testis-specific Y-encoded-like protein 1SMESG000026284.1 dd_Smed_v4_326_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008456Type I inositol-1,4,5-trisphosphate 5-phosphataseSMESG000074184.1 SMESG000019975.1 dd_Smed_v4_266_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000840Coiled-coil domain-containing protein 42-like proteinSMESG000046807.1 dd_Smed_v4_12378_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3000344260S ribosomal protein L23SMESG000023040.1 dd_Smed_v4_242_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006541SMED30006541SMESG000012332.1 SMESG000012317.1 SMESG000058954.1 dd_Smed_v4_246_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007886SMED30007886SMESG000055169.1 dd_Smed_v4_9583_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019873plasminogen-1SMESG000018453.1 dd_Smed_v4_23420_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016446Root phototropism protein 2SMESG000067415.1 dd_Smed_v4_8081_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001975vasohibin-2SMESG000072424.1 dd_Smed_v4_12833_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014181slc23a-2SMESG000066926.1 SMESG000066923.1 SMESG000066912.1 SMESG000066905.1 dd_Smed_v4_9401_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019057SMED30019057SMESG000016216.1 dd_Smed_v4_2283_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004335TBC1 domain family member 2BSMESG000012909.1 dd_Smed_v4_2925_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017369Disabled 2-interacting proteinSMESG000043888.1 dd_Smed_v4_3238_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011943Fibronectin type III and ankyrin repeat domains 1SMESG000033969.1 dd_Smed_v4_7571_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018451Lipopolysaccharide-induced TNF-alpha factorSMESG000020870.1 SMESG000046087.1 SMESG000046084.1 dd_Smed_v4_2768_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015079Dynein heavy chain 5, axonemalSMESG000049144.1 dd_Smed_v4_4569_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012136radial spoke head protein 9 homologSMESG000046857.1 dd_Smed_v4_4707_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013013Guanine nucleotide-binding protein subunit betaSMESG000061733.1 dd_Smed_v4_3309_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016591Protein big brotherSMESG000068819.1 dd_Smed_v4_2875_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014184Tumor necrosis factor alpha-induced protein 8-like proteinSMESG000002914.1 dd_Smed_v4_2386_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010637Nucleolar RNA helicase II/Gu proteinSMESG000065959.1 dd_Smed_v4_283_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009834TNF receptor-associated factorSMESG000047296.1 dd_Smed_v4_2916_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018439XK-related proteinSMESG000080414.1 dd_Smed_v4_2770_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021687glycogen synthase kinase 3SMESG000023764.1 dd_Smed_v4_4762_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3002609340S ribosomal protein S5SMESG000076086.1 dd_Smed_v4_295_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022907SynaptotagminSMESG000025329.1 dd_Smed_v4_4222_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025041Protein phosphatase 2cSMESG000018373.1 dd_Smed_v4_2362_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026927GCR044SMESG000020870.1 SMESG000046087.1 SMESG000046084.1 dd_Smed_v4_2768_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035315Endothelin-converting enzyme 1SMESG000025056.1 dd_Smed_v4_8276_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025634MFS domain-containing proteinSMESG000066500.1 dd_Smed_v4_9883_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026135SMED30026135SMESG000016933.1 dd_Smed_v4_2807_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019576SMED30019576SMESG000079563.1 SMESG000052448.1 dd_Smed_v4_3113_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005770Cell number regulator 7SMESG000060415.1 dd_Smed_v4_743_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017854SMED30017854SMESG000014767.1 dd_Smed_v4_75560_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012207SCP domain-containing proteinSMESG000050444.1 SMESG000050443.1 dd_Smed_v4_2187_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013141Pleckstrin homology domain-containing family F member 2-like protein dd_Smed_v4_2374_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000639Microtubule-actin cross-linking factor 1-like isoform X28SMESG000017517.1 SMESG000017520.1 SMESG000017519.1 dd_Smed_v4_6577_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010068Formin-like protein 15SMESG000035694.1 SMESG000035692.1 dd_Smed_v4_8222_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010103Splicing factor arginine:serine richSMESG000041611.1 dd_Smed_v4_1935_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013386netrin 1SMESG000006806.1 dd_Smed_v4_9795_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012451SMED30012451 dd_Smed_v4_215_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019288Reticulocalbin 3SMESG000012033.1 dd_Smed_v4_1417_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012926SMED30012926SMESG000059195.1 SMESG000059194.1 SMESG000059193.1 dd_Smed_v4_1940_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014525Dolichyl-diphosphooligosaccharide--protein glycosyltransferase 48 kDa subunitSMESG000010589.1 dd_Smed_v4_948_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009030Selenoprotein W dd_Smed_v4_572_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010503CEP135SMESG000077870.1 dd_Smed_v4_5218_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008774C2 domain-containing proteinSMESG000047389.1 dd_Smed_v4_15844_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013731CentrinSMESG000040368.1 dd_Smed_v4_7903_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010134SMED30010134 dd_Smed_v4_34037_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013571NADH dehydrogenase subunit 4L dd_Smed_v4_344_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000702cytochrome b dd_Smed_v4_344_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009611Str_synth domain-containing proteinSMESG000052600.1 dd_Smed_v4_1480_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005542SMED30005542 dd_Smed_v4_23179_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002689SMED30002689 dd_Smed_v4_680_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027937SMED30027937SMESG000004925.1 dd_Smed_v4_8053_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034490FGFR1SMESG000036598.1 SMESG000036590.1 dd_Smed_v4_6020_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30024997ATP-dependent RNA helicase, putativeSMESG000056881.1 dd_Smed_v4_4309_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020883SMED30020883SMESG000071322.1 dd_Smed_v4_5453_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022160slc25a-15SMESG000010513.1 dd_Smed_v4_8650_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033866Non-lysosomal glucosylceramidaseSMESG000080285.1 dd_Smed_v4_9887_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031311SMED30031311SMESG000023046.1 SMESG000023044.1 dd_Smed_v4_6118_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022905DihydropyrimidinaseSMESG000028784.1 SMESG000061889.1 dd_Smed_v4_3519_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021882Disks large homolog 1SMESG000045568.1 dd_Smed_v4_8293_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30024840LactadherinSMESG000001686.1 dd_Smed_v4_5463_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015158Translation initiation factor SUI1SMESG000033176.1 dd_Smed_v4_1183_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006438EF-hand domain-containing family member BSMESG000077905.1 dd_Smed_v4_11909_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3000891040S ribosomal protein S4SMESG000026320.1 dd_Smed_v4_82_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003902Tetratricopeptide repeat protein 21BSMESG000011579.1 dd_Smed_v4_12056_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001404Dual specificity tyrosine-phosphorylation-regulated kinase 2SMESG000076586.1 SMESG000076583.1 dd_Smed_v4_12119_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009505SMED30009505SMESG000015390.1 dd_Smed_v4_4166_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017925Dynein light chain Tctex-type 1SMESG000026631.1 dd_Smed_v4_1166_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008650Beta-hexosaminidaseSMESG000008181.1 dd_Smed_v4_12408_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014760Exostosin-1SMESG000018952.1 SMESG000018951.1 SMESG000018945.1 SMESG000018944.1 dd_Smed_v4_11944_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018893Enkurin domain-containing proteinSMESG000081414.1 dd_Smed_v4_12339_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013935Eukaryotic translation initiation factor 5BSMESG000012316.1 dd_1274dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
pharynxSMED30015672Gelsolin-like proteinSMESG000015928.1 dd_Smed_v4_1215_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009735Bardet-Biedl syndrome 5 protein homologSMESG000052420.1 dd_Smed_v4_8523_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009172SMED30009172SMESG000002905.1 dd_Smed_v4_8058_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009887Macrophage erythroblast attacherSMESG000048410.1 dd_Smed_v4_1168_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016015Cilia and flagella associated protein 157SMESG000020913.1 dd_Smed_v4_11523_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000846CaltractinSMESG000029908.1 dd_Smed_v4_8753_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017647SMED30017647SMESG000013908.1 dd_Smed_v4_1173_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004097SMED30004097SMESG000031258.1 dd_Smed_v4_12080_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017456epidermal growth factor receptor 3SMESG000016935.1 dd_Smed_v4_10624_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011832Enkurin domain-containing proteinSMESG000081414.1 dd_Smed_v4_12339_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012017SMED30012017SMESG000022399.1 dd_Smed_v4_708_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005882SMED30005882SMESG000056627.1 SMESG000056607.1 dd_Smed_v4_7436_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012954centriolinSMESG000006866.1 dd_Smed_v4_10369_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009071SMED30009071SMESG000017123.1 dd_Smed_v4_10551_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006031SMED30006031SMESG000079800.1 dd_Smed_v4_21545_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006208Aconitate hydratase, mitochondrialSMESG000002905.1 dd_Smed_v4_8058_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006208Aconitate hydratase, mitochondrialSMESG000002904.1 dd_Smed_v4_979_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013692Small HSP proteinSMESG000059879.1 SMESG000059868.1 SMESG000059853.1 dd_Smed_v4_1039_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013390Nesprin-1SMESG000069851.1 dd_Smed_v4_10646_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000421TPR_REGION domain-containing proteinSMESG000071973.1 dd_Smed_v4_11462_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012522Ankyrin-2SMESG000026655.1 dd_Smed_v4_10835_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009212Ferric-chelate reductase 1SMESG000061404.1 dd_Smed_v4_8497_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004214SMED30004214SMESG000055805.1 dd_Smed_v4_857_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001176SMED30001176SMESG000020646.1 dd_Smed_v4_10759_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009144CCDC66 domain-containing proteinSMESG000019367.1 dd_Smed_v4_11800_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004648Dual specificity tyrosine phosphorylation regulated kinase 2SMESG000076586.1 SMESG000076583.1 dd_Smed_v4_12119_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016203SMED30016203SMESG000030489.1 dd_Smed_v4_11685_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002517Expressed conserved proteinSMESG000004480.1 dd_Smed_v4_8607_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006859Peptidyl-prolyl cis-trans isomeraseSMESG000059112.1 dd_Smed_v4_10327_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007857SMED30007857SMESG000022810.1 dd_28465dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
pharynxSMED30013396perilipin-2 isoform X1SMESG000075481.1 dd_Smed_v4_154_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019487PhosphodiesteraseSMESG000054903.1 SMESG000054901.1 SMESG000054878.1 SMESG000044092.1 dd_Smed_v4_10593_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029426Baculoviral IAP repeat-containing protein 7SMESG000067789.1 dd_Smed_v4_1187_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034247SMED30034247SMESG000005178.1 dd_Smed_v4_10371_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027439SMED30027439SMESG000031258.1 dd_Smed_v4_12080_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033718SMED30033718SMESG000061174.1 dd_Smed_v4_12214_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027291Death domain-containing proteinSMESG000064407.1 dd_Smed_v4_12177_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035904PROG-1SMESG000024882.1 SMESG000024707.1 dd_Smed_v4_332_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023085Non-specific serine/threonine protein kinaseSMESG000004478.1 dd_Smed_v4_11674_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030597Mitogen-activated protein kinaseSMESG000033376.1 dd_Smed_v4_11396_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023766SMED30023766SMESG000073811.1 dd_Smed_v4_116_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023193Tau tubulin kinaseSMESG000026133.1 dd_Smed_v4_12470_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021637Adenosine monophosphate-protein transferase FICDSMESG000007402.1 dd_Smed_v4_11524_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035448Kinesin motor domain proteinSMESG000075721.1 dd_Smed_v4_11799_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035901Abelson helper integration site 1SMESG000005183.1 SMESG000005182.1 dd_Smed_v4_11557_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033197SMED30033197SMESG000073811.1 dd_Smed_v4_116_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027733NAD-dependent protein deacetylaseSMESG000079800.1 dd_Smed_v4_21545_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028653IQ domain-containing protein HSMESG000037909.1 dd_Smed_v4_10544_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035924SMED30035924SMESG000043662.1 dd_Smed_v4_11896_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027319SMED30027319SMESG000006149.1 dd_Smed_v4_11660_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027269Ig-like domain-containing proteinSMESG000018952.1 SMESG000018951.1 SMESG000018945.1 SMESG000018944.1 dd_Smed_v4_11944_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023708ZFP-1SMESG000066384.1 dd_Smed_v4_8720_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035840Placenta specific protein 8SMESG000050216.1 dd_Smed_v4_564_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027431Protein arginine N-methyltransferase 7SMESG000008380.1 dd_Smed_v4_8814_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030655Fibronectin type 3 and ankyrin repeat domains protein 1SMESG000030957.1 dd_Smed_v4_7496_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021202Kunitz-type serine protease inhibitor IXSMESG000012316.1 dd_1274dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
pharynxSMED30027596RNA-binding protein pno1SMESG000015341.1 dd_Smed_v4_1077_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026646Dynein light chainSMESG000009941.1 dd_Smed_v4_107_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028103SMED30028103SMESG000081188.1 dd_Smed_v4_11827_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030326SMED30030326SMESG000001071.1 SMESG000001061.1 SMESG000001060.1 dd_Smed_v4_9824_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029046ADAMTS-like protein 3SMESG000073134.1 dd_Smed_v4_6962_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029820E3 ubiquitin-protein ligase MYLIPSMESG000074789.1 SMESG000054150.1 dd_Smed_v4_2867_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026336Beta-hexosaminidaseSMESG000008181.1 dd_Smed_v4_12408_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020490SMED30020490SMESG000030489.1 dd_Smed_v4_11685_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034802Small nuclear ribonucleoprotein Sm D3SMESG000010007.1 dd_Smed_v4_562_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022167SMED30022167SMESG000031417.1 dd_Smed_v4_11958_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032202Doublecortin domain-containing proteinSMESG000017756.1 dd_Smed_v4_11770_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014374Low affinity cationic amino acid transporterSMESG000049007.1 dd_Smed_v4_2552_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014900Dimer_Tnp_hAT domain-containing proteinSMESG000051489.1 dd_Smed_v4_9709_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014439Luc7-like protein 3SMESG000063148.1 dd_Smed_v4_5427_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010437Copper homeostasis protein CutCSMESG000016228.1 dd_Smed_v4_7302_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018944SMED30018944SMESG000028183.1 dd_Smed_v4_592_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014446SMEDWI-2SMESG000069984.1 SMESG000069981.1 dd_Smed_v4_756_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016950DystrophinSMESG000020523.1 dd_Smed_v4_5325_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016387HAP1 N-terminal domain-containing proteinSMESG000065238.1 SMESG000065237.1 dd_Smed_v4_4847_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014923ADP-ribosylation factorSMESG000052763.1 dd_Smed_v4_2013_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015332Ciliogenesis-associated TTC17-interacting proteinSMESG000009424.1 dd_Smed_v4_5952_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014250WH1 domain-containing proteinSMESG000052344.1 dd_Smed_v4_22545_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011180Kinesin-like protein KIF26ASMESG000051203.1 dd_Smed_v4_8860_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012150SMED30012150SMESG000051911.1 dd_Smed_v4_5276_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004559CULT domain-containing proteinSMESG000077110.1 SMESG000077108.1 dd_Smed_v4_11915_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016293slc44a-2SMESG000015872.1 dd_Smed_v4_6488_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007498Ribosomal protein L19SMESG000057653.1 dd_Smed_v4_228_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019318Sperm associated antigen 6SMESG000018022.1 dd_Smed_v4_3991_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009873SMED30009873SMESG000016812.1 SMESG000016788.1 SMESG000016785.1 SMESG000016784.1 SMESG000016778.1 SMESG000016777.1 SMESG000016774.1 SMESG000016773.1 SMESG000016772.1 dd_Smed_v4_422_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007755LIM and SH3 domain protein 1SMESG000002154.1 dd_Smed_v4_1218_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009566SMED30009566SMESG000015985.1 dd_Smed_v4_4240_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016580SMED30016580SMESG000044545.1 dd_Smed_v4_5799_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010227SMED30010227SMESG000078872.1 dd_Smed_v4_673_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009623SMED30009623SMESG000047804.1 SMESG000038532.1 SMESG000038520.1 SMESG000036112.1 SMESG000036060.1 dd_Smed_v4_4251_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022574START domain-containing proteinSMESG000046413.1 SMESG000037645.1 dd_Smed_v4_3734_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022383TNF receptor-associated factorSMESG000047778.1 dd_Smed_v4_3201_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034888Dynein heavy chain 5, axonemalSMESG000049144.1 dd_Smed_v4_4569_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031260SMED30031260SMESG000013211.1 dd_Smed_v4_2357_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032970Alpha-int-3SMESG000034289.1 dd_Smed_v4_8943_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029077Macrophage-expressed gene 1 proteinSMESG000044681.1 dd_Smed_v4_983_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3002552260 kDa heat shock protein, mitochondrialSMESG000065325.1 dd_Smed_v4_141_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035790SMED30035790SMESG000006146.1 dd_Smed_v4_28660_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033411Dynein light chainSMESG000041239.1 dd_Smed_v4_3149_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029205SMED30029205SMESG000040424.1 dd_Smed_v4_33167_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022804slc12a-1SMESG000043221.1 SMESG000043220.1 dd_Smed_v4_4047_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023111RBR-type E3 ubiquitin transferaseSMESG000054560.1 dd_Smed_v4_4845_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021059V(D)J recombination-activating protein 1SMESG000012339.1 dd_Smed_v4_11354_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022622Centrosomal protein 350SMESG000033533.1 dd_Smed_v4_5967_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021417SMED30021417SMESG000051911.1 dd_Smed_v4_5276_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030542Dynein light chainSMESG000003543.1 dd_Smed_v4_310_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022531Triadin-like isoform X4SMESG000069834.1 dd_Smed_v4_5981_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030007RootletinSMESG000071494.1 dd_Smed_v4_1404_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030220Helicase for meiosis 1SMESG000065404.1 dd_Smed_v4_9538_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021297Disks large homolog 1SMESG000020502.1 dd_Smed_v4_3493_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027672Plac8 onzin related protein 1SMESG000050229.1 SMESG000050221.1 dd_Smed_v4_1219_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3002814060S ribosomal protein L22SMESG000001806.1 dd_Smed_v4_230_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022565SMED30022565SMESG000040891.1 dd_Smed_v4_5934_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020124Ribosome biogenesis regulatory proteinSMESG000071880.1 dd_Smed_v4_2458_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027213Solute carrier family 49 member 3SMESG000032659.1 dd_Smed_v4_5238_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034376slc6a-5SMESG000042091.1 dd_Smed_v4_4290_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020991Outer dynein arm protein 1SMESG000055998.1 SMESG000055997.1 dd_Smed_v4_4191_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030659Fer-1-relatedSMESG000070967.1 dd_Smed_v4_4648_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012075SMED30012075SMESG000059352.1 SMESG000059351.1 dd_Smed_v4_420_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018300slc42a-2SMESG000005978.1 dd_Smed_v4_2323_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011297SMED30011297SMESG000019881.1 dd_Smed_v4_4454_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006119X-box-binding protein 1SMESG000048111.1 dd_Smed_v4_415_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008522Fatty acid-binding proteinSMESG000015143.1 dd_Smed_v4_271_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002481SMED30002481SMESG000059949.1 SMESG000059950.1 dd_Smed_v4_3563_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016140methylmalonyl-CoA mutase, mitochondrialSMESG000014335.1 dd_Smed_v4_2255_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004158Tetratricopeptide repeat protein 25SMESG000067442.1 dd_Smed_v4_3933_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008351SMED30008351SMESG000081198.1 dd_Smed_v4_39279_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000299Transitional endoplasmic reticulum ATPaseSMESG000009924.1 dd_Smed_v4_482_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015310DUF3421 domain-containing proteinSMESG000046710.1 SMESG000046697.1 dd_Smed_v4_54_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016277TNF receptor-associated factorSMESG000015087.1 dd_Smed_v4_2354_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018802SMED30018802SMESG000030480.1 dd_Smed_v4_2310_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001242Mitogen-activated protein kinase kinase kinase 1aSMESG000017260.1 dd_Smed_v4_4322_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015020E3 ubiquitin-protein ligase XIAPSMESG000031958.1 dd_Smed_v4_2104_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002734echinoderm microtubule-associated protein-like 2 isoform X1SMESG000038072.1 dd_Smed_v4_21299_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001933Heterogeneous nuclear ribonucleoproteinSMESG000055008.1 dd_Smed_v4_2383_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007124EF-hand domain-containing proteinSMESG000062171.1 dd_Smed_v4_3568_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015160SMED30015160SMESG000016267.1 SMESG000058374.1 dd_Smed_v4_3391_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007845Family S60 non-peptidase homologue (S60 family)SMESG000027224.1 dd_Smed_v4_2523_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009962Lysosomal acid phosphataseSMESG000074242.1 SMESG000074232.1 dd_Smed_v4_6931_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006931SMED30006931SMESG000040565.1 dd_Smed_v4_4660_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3001160940S ribosomal protein S3SMESG000016955.1 dd_Smed_v4_269_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010027SMED30010027SMESG000015329.1 dd_Smed_v4_5101_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011604Long-chain-fatty-acid--CoA ligaseSMESG000081754.1 dd_Smed_v4_2153_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000891SMED30000891SMESG000008013.1 dd_Smed_v4_5606_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002554B9 domain-containing protein 2SMESG000000764.1 dd_Smed_v4_7362_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017892Semaphorin-5A-likeSMESG000045754.1 SMESG000037895.1 dd_Smed_v4_5479_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012447FilaminSMESG000064795.1 dd_Smed_v4_2272_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011961Tensin 3SMESG000019881.1 dd_Smed_v4_4454_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013768SMED30013768SMESG000056915.1 dd_Smed_v4_3761_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017474WD repeat-containing protein on Y chromosomeSMESG000033045.1 dd_Smed_v4_5437_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000289SMED30000289SMESG000076644.1 SMESG000076643.1 dd_Smed_v4_227_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011060SMED30011060SMESG000018625.1 dd_Smed_v4_7135_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3001990360S ribosomal protein L13aSMESG000041483.1 dd_Smed_v4_287_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012149NPHS1-7SMESG000016267.1 SMESG000058374.1 dd_Smed_v4_3391_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007406SMEDWI-1SMESG000036375.1 dd_Smed_v4_659_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016902CRAL-TRIO domain-containing proteinSMESG000009876.1 dd_Smed_v4_2760_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006756Degenerin unc-8SMESG000022995.1 dd_Smed_v4_23965_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016752Cytochrome P450 2W1SMESG000059212.1 SMESG000048645.1 dd_Smed_v4_20345_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017300SMED30017300SMESG000001317.1 dd_Smed_v4_520_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020521Glycerol-3-phosphate acyltransferase 3