pharynx

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ Description

  ▻ Figures

  ▻ In Situ Hybridization Data

  ▻ Sequences

  ▻ References

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  pharynx


DEFINITON:

  A plicate and protrusible organ that is the sole point of entry and exit for the Triclad gut. It contains epithelial, muscular, secretory and neuronal cell types.


TERM DEFINITION CITATIONS:

  OCLC:16809160


TERM CITATIONS:

Expand publication list


TERM ID:

  PLANA:0000016


ABOUT THIS TERM:

pharynx

  ↳is a material entity and organ

  ↳contained in posterior region of the whole animal and parapharyngeal region

  ↳existence overlaps Stage 6, Stage 5, juvenile stage, asexual adult, adult hermaphrodite, Stage 8 and Stage 7

  ↳existence starts during or after Stage 5

  ↳part of digestive system


  → pharynx progenitor cell and pharynx primordium develops into pharynx


  → pharynx lumen luminal space of pharynx


Expand to see terms that part of pharynx


BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


DESCRIPTION:   

foxA1, a pioneer transcription factor required for pharynx maintenance and regeneration during adulthood (Adler et al., 2014; Scimone et al., 2014), may similarly be required for construction of the definitive pharynx during embryogenesis. Development of the definitive pharynx, the single opening of the Smed digestive tract, commenced during S4-S5 with the onset of foxA1 expression in parenchymal cells, many of which were located in the oral hemisphere (Figure 1 – figure supplement 14A). The distribution of foxA1+ cells remained concentrated in and around the developing definitive pharynx rudiment during S6-S8, a pattern reminiscent of that observed in S. polychroa embryos (Martín-Durán et al., 2010), as well as in intact and regenerating Smed asexual adults (Adler et al., 2014; Scimone et al., 2014). The definitive pharynx develops beneath the degenerating temporary embryonic pharynx, and marks the ventral side of the embryos during S6 and thereafter (Martín-Durán and Romero, 2011). foxA1 upregulation during S5-S8 was statistically significant, albeit the adjusted p-values were above the thresholds set for inclusion in the enriched transcript lists presented in Figure 1 – source data 5, Figure 1 – source data 6, Figure 1 – source data 7, Figure 1 – source data 8. meis, a transcription factor coexpressed in foxA1+ neoblasts and expressed within the regenerating pharynx (Scimone et al., 2014), was among the S5 enriched transcripts (Figure 1 – source data 5); its expression trend was similar to foxA1 during embryogenesis (Figure 1 – figure supplement 14B). Two markers exhibiting pharynx-restricted expression in adults, laminin and npp-1 (Adler et al., 2014), were upregulated during S6-S8, after development of the definitive pharynx rudiment was evident (Figure 1 – figure supplement 14B).


 

back to top


FIGURES:


Figure 1 – figure supplement 14: Molecular markers for the definitive pharynx

A: WISH developmental time course using foxA1 riboprobes (blue), S3-S8.  foxA1 expression was consistently detected in the embryonic pharynx lumen during S3-S5 (black arrowheads). Anterior: top (S6-S8). Black arrowheads: embryonic pharynx. Red arrowheads: definitive pharynx. O: oral hemisphere. A: aboral hemisphere. D: dorsal. V: ventral. Scale bars: 100 µm.

B: Average RPKM values per embryo for the definitive pharynx markers foxA1, meis, laminin, npp-1 during embryogenesis (Adler et al., 2014; Scimone et al., 2014), Y (yolk), Stage (S) S2-S8. 

 

 

back to top


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30027428AFJ24799.1forkhead box A-1foxA1Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, digestive system, pharynx, pharynx progenitor cell, embryonic pharynx
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 ┬Ám

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30027428 ID=SMED30027428|Name=forkhead box A-1|organism=Schmidtea mediterranea sexual|type=transcript|length=2149bp
ATCACTTGGTGCTGCTTTTTGCCCCGATAAATCTCTCGGTGCTCCAAAATTTGTGTAAGCGAGCAAAAGATGATTGGGCA
ATTTCTAGCACGTCATTCGGCAACGATGTTTACAAGTTTCTCTGATTGGATGATAAAGTAGAAACTTTCCGAAAATGAAA
CTTCTCCGAACATGCGCATACCGACTGAAAATTAACTCTAAGCCAGCCAATGGAATTGAAGCAAAATTCAAGAGAATATT
AATTGACTTCGCGAATGAACTCAAATTTTCTATTGGCGTATTGTGTGTGCCTCATTGTGAGTGGTTGCGATCGCATCTCA
AATTATTTACACACAAAAAAATAACGCACACAGACATTGAATAGATATATTTGATCAAGTCAATATCACAATGTCAATAT
TAGCTTTTTCTGAAGAAAGAAGACGAACTAGAAGAAAAACAACAACGAAATAGATTCGATAAGGCTACTGAGCGATTTTC
ATAATCTAAATATTATTTTATTATTGATACGGACAAAAATTGGTCTTTTACCAAGTACTACTAGATTGTTGATAAAGAGA
GGTTATTTAGATGCTTGGAAAAAATCCTTATGAAACTGCAATGAGCAACGTGTATTCTCTACCTCCGGGAGGTTCTATTT
ACAATATGAACCCGATGAGTATATCATCAGCTGGCTACAACTCTCAACAAGTATCAACACTATCGTTGAACTTGACCGGA
ATCGGACCTCATTCATTAAGCCCAATGAGTGCAAGCATGTCGGGTATAGCTGCAATGGCCGGTGGAATGAGACAAGGTCT
TGAGTTGGGTCTTGGTAGAAGTGATAGTCCAAGAGATAAAAATTCAATTTCCAATAACAACCGACCATATCAAAGAAGTT
ACACTCATGCCAAGCCTCCATACAGTTATATAAGTTTGATAACAATGGCGATTCAAAATTCTCCAGTAAACATGTGCACT
CTATCGGAGATCTATCAATTCATTATGGATCATTTTCCATACTATCGTCAAAATCAACAGCGATGGCAGAATTCGATTCG
ACATTCTTTGTCCTTCAACGATTGCTTTGTTAAGGTTAGTAGAAGCCCAGAAAAACCAGGTAAAGGCTCATATTGGACCT
TGCATCCTCAATCAGGTAACATGTTTGAAAACGGTTGTTATCTCAGAAGACAAAAGCGATTCAAAGATCCACACAGAGAA
ATCGGCAGACAGAGTCAAAGAGCTGCCACTGGTCCTGGATCAAATGTCACAGAAAACAATCACGACAACGCATCGCAAGA
AGCTAGTGATAACGCAGAAAGTGATACGAAACCCAACATCAAGCAACTTGATTTATCAAGCGATCTCTTAACTAATCAAG
GTCATAATATTAAAAATACTAATCCAACTTCTGTTAGTCAGAGTTGTTCGATGTTTCATCGGAAAAAGGAAAACTGCTCA
CCAGTAGAAATGAAATTGAATAACCAAAACCAACAATCAAACCAGCAAGAACATCCACAAATCCATTACAATCCCAATCA
GCAATTCTACTCAAATCAGCAAAACATTTTCCAACAAAGTTCTCTTGATCATTACAGTCTATTAGCATCCGATGATCCTC
TTGGTCAAGGTATGCACTTGCCACCAGGTGCAAATAGTGTTTTCGGACTTTACGGGGCACATAACTTACCAAACGATGAT
CAAATTTCAGTGTCATTACCATCGATATCCTTATCCGGACATCCGTATGACAATTTATCAACAGCAATGGCATATCAATA
TGAAGCATCTCAACACAATTCTTCATTACTAACGACAAGTAATCCGTTCTCAATAGATCGTTTGATGCATCCAAGACTAG
TCGCTGCAGCGATGGGGGTCAGTCCCCATGATACTCTATACGCAGGAGCTACCGGCCCATCAGTTGATCTAGAACACATG
AAATACTACTCAAACTACAACAATGTGCCTCCTTATTCCTCTGCAATGTCTGACTACTACAAATATGTACAAAATCCTCA
GCCGGGCAACAGCGACATGAGTCTTTGAATTGAGTCCATTGAAGTCTACGGCAGTTTCCTCGAAATTTCACATTCAACCA
GATGTTTATCGCCTAATATAAAGCTGTGTTTTTTTATTTATTTACAATTAAATCTTTGTACAAGAGATC

 

back to top


ADDITIONAL REFERENCES:


Adler, C.E., Seidel, C.W., McKinney, S.A., and Sánchez Alvarado, A. (2014). Selective amputation of the pharynx identifies a FoxA-dependent regeneration program in planaria. Elife 3, e02238.

Martín-Durán, J.M., Amaya, E., and Romero, R. (2010). Germ layer specification and axial patterning in the embryonic development of the freshwater planarian Schmidtea polychroa. Dev Biol 340, 145-158.

Martín-Durán, J.M., and Romero, R. (2011). Evolutionary implications of morphogenesis and molecular patterning of the blind gut in the planarian Schmidtea polychroa. Dev Biol 352, 164-176.

Scimone, M.L., Kravarik, K.M., Lapan, S.W., and Reddien, P.W. (2014). Neoblast specialization in regeneration of the planarian Schmidtea mediterranea. Stem Cell Reports 3, 339-352.

 

back to top



PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in pharynx. Click this link to learn more about PAGE.


PAGE Curations: 3538


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
pharynxSMED30022468secreted frizzled related protein 5 EU296635smed_ncbi_20240424PMID:24704339
Vogg et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30027297Fork head domain-containing protein FD3 KC577557smed_ncbi_20240424PMID:24704339
Vogg et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30027297Fork head domain-containing protein FD3 KC577557.1smed_ncbi_20240424PMID:24704339
Vogg et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30005045Zinc finger protein ZIC 3 KF751216.1smed_ncbi_20240424PMID:24704339
Vogg et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30029487growth factor receptor-like GU592830.1smed_ncbi_20240424PMID:24704339
Vogg et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30031256Wnt family member 4 wntP-2smed_ncbi_20240424PMID:23318641
Chen et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30027299PBX homeobox 3 KC353351.1smed_ncbi_20240424PMID:23318641
Chen et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30026602Wnt family member 2 FJ463753.1smed_ncbi_20240424PMID:23318641
Chen et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30020359Fibroblast growth factor receptor-like 1 GU592832.1smed_ncbi_20240424PMID:23318641
Chen et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30010118Forkhead box protein N3 BK013016smed_ncbi_20240424PMID:33536473
Pascual-Carreras et al., 2021
whole organism asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009316Forkhead box protein N3 BK013014smed_ncbi_20240424PMID:33536473
Pascual-Carreras et al., 2021
whole organism asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014407Forkhead box protein J1-A BK013017smed_ncbi_20240424PMID:33536473
Pascual-Carreras et al., 2021
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30035307Forkhead box C1-B BK013019smed_ncbi_20240424PMID:33536473
Pascual-Carreras et al., 2021
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30002822Ankyrin-1 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30002822Uncharacterized protein Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED300030531-acylglycerol-3-phosphate O-acyltransferase 3 Contig3433GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30005745Protein kinase domain protein Contig2289GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30014928formin like 2 Contig1407newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30001242Protein kinase domain protein Contig2289GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30031780member RAS oncogene family Contig1027GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30019715tumor protein p63 regulated 1 Contig1GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30017538Protein kinase domain protein Contig2289GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30022414ankyrin repeat and SOCS box containing 11 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30023739Ankyrin-3 Contig1190GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30022414euchromatic histone lysine methyltransferase 2 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30022414Ankyrin-3 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30020784Immunoglobulin superfamily containing leucine-rich repeat protein 2 Contig1076GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30004152Ankyrin-1 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30003036Uncharacterized protein Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30013717euchromatic histone lysine methyltransferase 2 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30003036Ankyrin-1 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30004152Uncharacterized protein Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30016291Uncharacterized protein Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30030305carboxypeptidase A6 Contig1315GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30016291Ankyrin-1 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30024411serine/threonine kinase 16 Contig1093GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30033014phosphatidylinositol-4,5-bisphosphate 4-phosphatase 1 Contig1068GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30032067TNF receptor-associated factor Contig1407GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30014645HP domain-containing protein PL04009A1F04smed_ncbi_20240424PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30003990HP domain-containing protein PL04009A1F04smed_ncbi_20240424PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30023514ubiquilin 2 Contig2009GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30008091TANK binding kinase 1 Contig2364GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30008091TANK binding kinase 1 Contig809GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30011909TANK binding kinase 1 Contig2364GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30011909TANK binding kinase 1 Contig809GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30009357ubiquilin 2 Contig2009GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30001668Complement component receptor 1-like protein Contig2307GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30008812adaptor related protein complex 2 subunit sigma 1 Contig2145GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30015161vacuolar protein sorting 45 homolog Contig1766GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30004606cytochrome P450 Contig1680GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30019325myosin light chain 12B Contig2068GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30019325myosin light chain 12B Contig246GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30021511Derived by automated computational analysis using gene prediction method Contig5776GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30001294like-AP180 Contig1792GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30014289Derived by automated computational analysis using gene prediction method Contig5776GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30006267Derived by automated computational analysis using gene prediction method Contig5776GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30028347engulfment and cell motility Contig1935GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30023915SNF8 subunit of ESCRT-II Contig1765GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30015706twinfilin actin binding protein 2 Contig2453GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30015345tropomyosin 3 Contig3688newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30015345tropomyosin 3 Contig3688uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30033476SLC2A4 regulator Contig3306GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30005336homeodomain transcription factor Contig2701GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30029698caspase 3 Contig2992GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30007716ankyrin repeat domain 28 Contig3408GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30000735SCP domain-containing protein Contig59uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30000735SCP domain-containing protein Contig59newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30022398helicase with zinc finger Contig3970GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30023334par-6 family cell polarity regulator beta Contig3688GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30011780cilia and flagella associated protein 221 Contig3433newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30011780cilia and flagella associated protein 221 Contig3433uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30024188SCP domain-containing protein Contig59newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30024188SCP domain-containing protein Contig59uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30010977tubulin beta 4B class IVb Contig5821GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30020872myosin IF Contig59GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30034573Tubulin beta chain Contig5821GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30030227flotillin 2 Contig5500GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30027682NADPH-dependent fmn reductase Contig3408newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30027682NADPH-dependent fmn reductase Contig3408uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30018122Transcription factor RLM1 Contig594GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30011213osteoclast stimulating factor 1 Contig516GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30014474tumor susceptibility 101 Contig5044GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30021698tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon Contig5316GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30007555G protein-coupled receptor 33 Contig4585uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30007555G protein-coupled receptor 33 Contig4585newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30024979hyaluronan mediated motility receptor Contig594newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30024979hyaluronan mediated motility receptor Contig594uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30016832SH3 domain-binding protein Contig4742newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30016832SH3 domain-binding protein Contig4742uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30033942hyaluronan mediated motility receptor Contig594uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30033942hyaluronan mediated motility receptor Contig594newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30020811hyaluronan mediated motility receptor Contig594uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30020811hyaluronan mediated motility receptor Contig594newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30017937WASP like actin nucleation promoting factor Contig4572GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30019149transcription elongation factor spt6 Contig5500newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30019149transcription elongation factor spt6 Contig5500uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30022560ribosomal protein L28 dd_Smed_v4_221_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017888TLC domain containing 1 dd_Smed_v4_9135_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022414euchromatic histone lysine methyltransferase 2 dd_Smed_v4_1097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006347small nuclear ribonucleoprotein polypeptide A dd_Smed_v4_2274_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022414Ankyrin-3 dd_Smed_v4_1097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007845melanotransferrin dd_Smed_v4_2523_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006769Peptidase inhibitor R3HDML dd_Smed_v4_19593_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007124multiple coagulation factor deficiency 2, ER cargo receptor complex subunit dd_Smed_v4_3568_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014233coiled-coil domain containing 153 dd_Smed_v4_6974_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015511X-ray radiation resistance-associated protein 1 dd_Smed_v4_13519_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023491Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_14238_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021589h1SMcT0018356.1 dd_Smed_v4_3649_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020784Immunoglobulin superfamily containing leucine-rich repeat protein 2 dd_Smed_v4_10359_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012447filamin A dd_Smed_v4_2272_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012451Prosaposin dd_Smed_v4_215_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010623Uncharacterized protein dd_Smed_v4_3199_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010623Uncharacterized protein dd_Smed_v4_3234_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005191phospholipid scramblase 2 dd_Smed_v4_6444_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015534ribosomal protein L21 dd_Smed_v4_189_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005765phosphodiesterase 5A dd_Smed_v4_8595_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012149Nephrin dd_Smed_v4_3391_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008609AHNAK nucleoprotein 2 dd_Smed_v4_1996_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008609AHNAK nucleoprotein 2 dd_Smed_v4_12223_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008609AHNAK nucleoprotein 2 dd_Smed_v4_474_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013054citron rho-interacting serine/threonine kinase dd_Smed_v4_11366_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010637DExD-box helicase 50 dd_Smed_v4_283_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014094Tubulin alpha-2 chain dd_Smed_v4_11012_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010320radial spoke head 10 homolog B2 dd_Smed_v4_12762_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007142caldesmon 1 dd_Smed_v4_2279_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007142caldesmon 1 dd_Smed_v4_4783_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007557coiled-coil domain containing 121 dd_Smed_v4_13384_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027150Pleckstrin homology domain-containing family G member 5 dd_Smed_v4_14038_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015232netrin 1 dd_Smed_v4_14852_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013107glyceraldehyde-3-phosphate dehydrogenase dd_Smed_v4_78_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009224ovo like zinc finger 3 dd_Smed_v4_12410_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009224ovo like zinc finger 3 dd_Smed_v4_14711_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027349Prosaposin dd_Smed_v4_215_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009566Ts translation elongation factor, mitochondrial dd_Smed_v4_4240_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013431light chain dd_Smed_v4_11942_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015584Muscle-specific protein 300 kDa dd_Smed_v4_16850_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015584Muscle-specific protein 300 kDa dd_Smed_v4_5365_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012974solute carrier family 25 member 3 dd_Smed_v4_543_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013430high density lipoprotein binding protein dd_Smed_v4_6161_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013676Muscle-specific protein 300 kDa dd_Smed_v4_16850_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013676Muscle-specific protein 300 kDa dd_Smed_v4_5365_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004158tetratricopeptide repeat domain 25 dd_Smed_v4_3933_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008984protein phosphatase, Mg2 /Mn2 dependent 1G dd_Smed_v4_2086_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011609ribosomal protein S3 dd_Smed_v4_269_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008987ribosomal protein L13 dd_Smed_v4_145_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006119X-box-binding protein 1 dd_Smed_v4_415_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000771AHNAK nucleoprotein 2 dd_Smed_v4_1996_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000771AHNAK nucleoprotein 2 dd_Smed_v4_12223_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000771AHNAK nucleoprotein 2 dd_Smed_v4_474_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005551spectrin alpha, non-erythrocytic 1 dd_Smed_v4_919_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007939lysophosphatidylglycerol acyltransferase 1 dd_Smed_v4_7263_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010188ankyrin repeat domain 16 dd_Smed_v4_13251_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012383ribosomal protein SA dd_Smed_v4_171_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006230caldesmon 1 dd_Smed_v4_2279_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006230caldesmon 1 dd_Smed_v4_4783_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026979ribosomal protein S11 dd_Smed_v4_227_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010334voltage dependent anion channel 1 dd_Smed_v4_1424_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007543Muscle-specific protein 300 kDa dd_Smed_v4_16850_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007543Muscle-specific protein 300 kDa dd_Smed_v4_5365_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002703ribosomal protein L23a dd_Smed_v4_281_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006597methylmalonyl-CoA mutase dd_Smed_v4_2255_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009090Ligand dependent nuclear receptor corepressor like dd_Smed_v4_17498_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012386glycogen phosphorylase B dd_Smed_v4_1532_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026927neuromedin U receptor 1 dd_Smed_v4_2768_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009121AHNAK nucleoprotein 2 dd_Smed_v4_708_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009121AHNAK nucleoprotein 2 dd_Smed_v4_10749_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009121AHNAK nucleoprotein 2 dd_Smed_v4_8295_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012160spectrin repeat containing nuclear envelope protein 1 dd_Smed_v4_10646_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012160spectrin repeat containing nuclear envelope protein 1 dd_Smed_v4_9493_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012160spectrin repeat containing nuclear envelope protein 1 dd_9493dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
pharynxSMED30011238kinesin family member 17 dd_Smed_v4_10765_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011238kinesin family member 17 dd_Smed_v4_13424_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002682Uncharacterized protein dd_Smed_v4_3199_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002682Uncharacterized protein dd_Smed_v4_3234_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029394Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_21196_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007371Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_10823_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009121AHNAK nucleoprotein dd_Smed_v4_708_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009121AHNAK nucleoprotein dd_Smed_v4_10749_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009121AHNAK nucleoprotein dd_Smed_v4_8295_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014184TNF alpha induced protein 8 like 1 dd_Smed_v4_2386_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013975Ras association domain-containing protein 1 homolog dd_Smed_v4_5323_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000134ribosomal protein L4 dd_Smed_v4_211_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013390spectrin repeat containing nuclear envelope protein 1 dd_Smed_v4_10646_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013390spectrin repeat containing nuclear envelope protein 1 dd_Smed_v4_9493_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013390spectrin repeat containing nuclear envelope protein 1 dd_9493dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
pharynxSMED30001056h1SMcT0010226.2 dd_Smed_v4_1775_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021960h1SMcT0016311.1 dd_Smed_v4_2224_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026887Myosin alkali light chain 1 dd_Smed_v4_223_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012743coiled-coil domain containing 169 dd_Smed_v4_12011_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008165Connector enhancer of kinase suppressor of ras dd_Smed_v4_4457_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008280growth factor receptor bound protein 2 dd_Smed_v4_4190_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009450Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_9242_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001359AHNAK nucleoprotein 2 dd_Smed_v4_1996_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001359AHNAK nucleoprotein 2 dd_Smed_v4_12223_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001359AHNAK nucleoprotein 2 dd_Smed_v4_474_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006210coiled-coil domain-containing protein 17 dd_Smed_v4_14654_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012757Tektin A; transcript_id=FBtr0080788 dd_Smed_v4_4872_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009735Bardet-Biedl syndrome 5 dd_Smed_v4_8523_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027244thymus brain and testes associated dd_Smed_v4_8051_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021838chromosome 10 open reading frame 67 dd_Smed_v4_13431_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026757Cytochrome P450 dd_Smed_v4_10722_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018716acidic nuclear phosphoprotein 32 family member E dd_Smed_v4_1396_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028063SH3 domain-containing protein dd_Smed_v4_16329_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022596Uncharacterized protein dd_Smed_v4_245_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027431protein arginine methyltransferase 7 dd_Smed_v4_8814_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025647Matrix-remodeling-associated protein 5 dd_Smed_v4_12974_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030326RIMS binding protein 2 dd_Smed_v4_9824_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009541cytochrome b5 reductase 3 dd_Smed_v4_1468_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010941DnaJ heat shock protein family (Hsp40) member B13 dd_Smed_v4_4820_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012139Major facilitator superfamily MFS profile domain-containing protein dd_Smed_v4_3190_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013549Calponin-homology CH domain-containing protein dd_Smed_v4_6577_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026757Uncharacterized protein dd_Smed_v4_10722_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021508glutamate dehydrogenase 1 dd_Smed_v4_932_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000126centrosomal protein 95 dd_Smed_v4_8515_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013549Tubulin alpha chain dd_Smed_v4_6577_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009119ankyrin 3 dd_Smed_v4_1432_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009457reticulocalbin 2 dd_Smed_v4_493_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010163Tubulin alpha chain dd_Smed_v4_6577_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021022Calponin-homology CH domain-containing protein dd_Smed_v4_6577_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008195Serine/threonine-protein kinase PAK mbt dd_Smed_v4_10848_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019318sperm associated antigen 6 dd_Smed_v4_3991_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023400ankyrin 3 dd_Smed_v4_1432_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017463Fibronectin type-III domain-containing protein dd_Smed_v4_4940_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033015Rho family-interacting cell polarization regulator 2 dd_Smed_v4_2058_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034030syntaxin 12 dd_Smed_v4_4355_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027035RluA pseudouridine synthase 2; transcript_id=FBtr0337002 dd_Smed_v4_12745_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021098Major facilitator superfamily MFS profile domain-containing protein dd_Smed_v4_3190_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029379GABA type A receptor associated protein like 2 dd_Smed_v4_1441_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034862Rho family-interacting cell polarization regulator 2 dd_Smed_v4_2058_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034862Rho family-interacting cell polarization regulator 2 dd_Smed_v4_3835_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017474EF-hand calcium binding domain 8 dd_Smed_v4_5437_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018252cathepsin V dd_Smed_v4_48_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018252cathepsin V dd_Smed_v4_175_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008476Dynein axonemal assembly factor 1 dd_Smed_v4_9766_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000158dipeptidyl peptidase 3 dd_Smed_v4_1031_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000740Ecdysone-induced protein 74EF dd_Smed_v4_9185_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028237pickel dd_Smed_v4_2132_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006638Tu translation elongation factor, mitochondrial dd_Smed_v4_818_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023388si ch73-92i20.1 dd_Smed_v4_5117_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029147ribosomal protein S7 dd_Smed_v4_204_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029147anorexia; transcript_id=FBtr0091702 dd_Smed_v4_204_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030908ribosomal protein L27 dd_Smed_v4_200_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033909leucine rich repeat containing 43 dd_Smed_v4_12354_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001362piwi like RNA-mediated gene silencing 1 dd_Smed_v4_1258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022522centrin 3 dd_Smed_v4_11582_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011784Homeobox protein dd_Smed_v4_15951_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001678succinate dehydrogenase complex iron sulfur subunit B dd_Smed_v4_925_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000248RAB42 member RAS oncogene family a dd_Smed_v4_4964_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000567Rho guanine nucleotide exchange factor dd_Smed_v4_5524_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001461Homeobox protein dd_Smed_v4_15951_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034375Tubulin alpha chain dd_Smed_v4_6577_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035840PLAC8 like 1 dd_Smed_v4_564_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014493ribosomal protein L5 dd_Smed_v4_151_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007438integrin alpha FG-GAP repeat containing 2 dd_Smed_v4_5900_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014813CSD domain-containing protein dd_Smed_v4_35_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004875EF-hand calcium-binding domain-containing protein dd_Smed_v4_20435_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002598nuclear receptor binding SET domain protein 1b dd_Smed_v4_99_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001367ADP ribosylation factor 1 dd_Smed_v4_203_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017940cathepsin V dd_Smed_v4_48_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017940cathepsin V dd_Smed_v4_175_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010461Uncharacterized protein dd_Smed_v4_16150_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003905KH-type splicing regulatory protein dd_Smed_v4_812_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002663TNF receptor-associated factor dd_Smed_v4_4392_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017015dyp-type peroxidase dd_Smed_v4_2999_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012638DUF4200 domain-containing protein dd_Smed_v4_11371_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007403protein phosphatase 1 regulatory subunit 42 dd_Smed_v4_7268_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018526solute carrier family 25 member 24 dd_Smed_v4_8134_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022907synaptotagmin 1 dd_Smed_v4_4222_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007498ribosomal protein L19 dd_Smed_v4_228_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015384ankyrin repeat domain 60 dd_Smed_v4_8330_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009968intraflagellar transport 122 dd_Smed_v4_11912_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004559CULT domain-containing protein dd_Smed_v4_11915_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016654intraflagellar transport 140 dd_Smed_v4_11300_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015273Homeobox protein dd_Smed_v4_15951_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015158ftz transcription factor 1 dd_Smed_v4_1183_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005093IQ motif containing B1 dd_Smed_v4_11329_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005093IQ motif containing B1 dd_Smed_v4_10052_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002574proteasome 26S subunit, non-ATPase 14 dd_Smed_v4_2126_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018534Muscleblind-like protein dd_Smed_v4_2838_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006189Uncharacterized protein dd_Smed_v4_16150_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034070Calponin-homology CH domain-containing protein dd_Smed_v4_6577_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010910POU domain, class 6, transcription factor 1 dd_Smed_v4_13010_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002064Doublecortin domain-containing protein dd_Smed_v4_6464_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006208aconitase 2 dd_Smed_v4_979_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010044DLC1 Rho GTPase activating protein dd_Smed_v4_9530_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016899ETS domain-containing protein ets-7 dd_Smed_v4_5087_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014347plexin A1 dd_Smed_v4_11934_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034070Tubulin alpha chain dd_Smed_v4_6577_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001341carbonic anhydrase 11 dd_Smed_v4_10750_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000372Doublesex- and mab-3-related transcription factor A2 dd_Smed_v4_31674_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006235Probable vesicular acetylcholine transporter-A dd_Smed_v4_13278_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026063Tnf receptor-associated factor dd_Smed_v4_11100_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002369ribosomal protein S17 dd_Smed_v4_195_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005428SAP domain containing ribonucleoprotein dd_Smed_v4_2297_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002256coiled-coil domain containing 81 dd_Smed_v4_6753_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000527si ch73-379j16.2 dd_Smed_v4_7973_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009869Spindle pole body-associated protein cut12 domain-containing protein dd_Smed_v4_12422_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009869Spindle pole body-associated protein cut12 domain-containing protein dd_Smed_v4_12735_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002734Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_21299_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002734Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_13847_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011189ADP ribosylation factor interacting protein 2 dd_Smed_v4_5732_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002379ADP-ribosylation factor-like protein 3 dd_Smed_v4_15424_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011746Cyclic nucleotide-binding domain-containing protein dd_Smed_v4_11034_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011615Cyclic nucleotide-binding domain-containing protein dd_Smed_v4_11034_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006859peptidylprolyl isomerase like 6 dd_Smed_v4_10327_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001242Protein kinase domain protein dd_Smed_v4_4322_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001925mucin 21, cell surface associated dd_4476dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
pharynxSMED30001925mucin 21, cell surface associated dd_Smed_v4_4476_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012464prostaglandin E receptor 2 dd_Smed_v4_49258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001271eukaryotic translation initiation factor 3 subunit J dd_Smed_v4_930_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010029t-complex-associated-testis-expressed 1 dd_Smed_v4_12524_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010702DUF4537 domain-containing protein dd_Smed_v4_13233_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007143G protein nucleolar 2 dd_Smed_v4_1134_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008739peptidylprolyl isomerase like 6 dd_Smed_v4_10327_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011535h1SMcT0021902.3 dd_Smed_v4_14557_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003292Peptidase inhibitor R3HDML dd_Smed_v4_19593_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034173EF-hand domain-containing protein dd_Smed_v4_13677_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009834MATH domain-containing protein dd_Smed_v4_2916_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006397cyclic nucleotide binding domain containing 2 dd_Smed_v4_19613_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006006hypothetical protein dd_Smed_v4_1969_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006006hypothetical protein dd_Smed_v4_7377_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007867misfire dd_Smed_v4_13850_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007867misfire dd_Smed_v4_14162_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007060LIM domain and actin-binding protein 1 dd_Smed_v4_1625_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007891Uncharacterized protein C3orf20 dd_Smed_v4_13130_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003944EF-hand domain family member D2 dd_Smed_v4_1467_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032105Polypeptide N-Acetylgalactosaminyltransferase 9; transcript_id=FBtr0087112 dd_Smed_v4_4615_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009231Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_16643_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009231Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_12002_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035707Ras association domain-containing protein 1 homolog dd_Smed_v4_5323_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007503Kinase non-catalytic C-lobe domain-containing protein 1 dd_Smed_v4_13316_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032389h1SMcT0020507.4 dd_Smed_v4_5868_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000108glycerol-3-phosphate dehydrogenase NAD dd_Smed_v4_4661_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004673Myosin light chain kinase 3 dd_Smed_v4_2745_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002656myosin XVB dd_Smed_v4_7193_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001237tubulin polymerization promoting protein dd_Smed_v4_650_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009282EF-hand calcium binding domain 2 dd_Smed_v4_11976_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005771Uncharacterized protein dd_Smed_v4_12482_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035611h1SMcT0001478.2 dd_Smed_v4_2407_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028718epsin 2 dd_Smed_v4_4779_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009281laminin subunit beta 1 dd_Smed_v4_6093_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034376solute carrier family 6 dd_Smed_v4_4290_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000918h1SMcT0013517.1 dd_Smed_v4_12055_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035696phosphodiesterase 5A dd_Smed_v4_8595_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034016caldesmon 1 dd_Smed_v4_2279_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034016caldesmon 1 dd_Smed_v4_4783_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010483ubiquitin C dd_Smed_v4_15619_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033750Serine/threonine-protein kinase WNK1 dd_Smed_v4_3195_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003501surface glycoprotein dd_Smed_v4_3240_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031955intraflagellar transport 52 dd_Smed_v4_5043_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034697SET nuclear proto-oncogene dd_Smed_v4_393_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003442ribosomal protein L23 dd_Smed_v4_242_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000831SCP domain-containing protein dd_Smed_v4_2081_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016186Derived by automated computational analysis using gene prediction method Gnomon dd_1071dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
pharynxSMED30016186Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_1071_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012017AHNAK nucleoprotein dd_Smed_v4_708_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012017AHNAK nucleoprotein dd_Smed_v4_10749_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012017AHNAK nucleoprotein dd_Smed_v4_8295_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014640Major egg antigen dd_Smed_v4_6399_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018439XK-related protein dd_Smed_v4_2770_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015820Dual specificity tyrosine-phosphorylation-regulated kinase 4 dd_Smed_v4_12591_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018511DUF4537 domain-containing protein dd_Smed_v4_10837_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017838DNA polymerase theta; transcript_id=FBtr0082662 dd_Smed_v4_42151_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017369Ras GTPase-activating protein raskol dd_Smed_v4_3238_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018397Paired box protein Pax-5 dd_Smed_v4_15732_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018901Derived by automated computational analysis using gene prediction method Gnomon dd_1071dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
pharynxSMED30018901Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_1071_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017382EF-hand domain family member D2 dd_Smed_v4_1467_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023876Tegumental antigen dd_Smed_v4_17388_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010410chromosome 9 open reading frame 135 dd_Smed_v4_8797_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015008UPF0606 protein KIAA1549L dd_Smed_v4_14943_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016603ubiquitin C dd_Smed_v4_15619_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016752Cytochrome P450 4p2 dd_Smed_v4_20345_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012957Acetylcholine receptor subunit alpha-L1 dd_Smed_v4_18201_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018451Lipopolysaccharide-induced tumor necrosis factor-alpha factor homolog dd_Smed_v4_2768_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019288novel protein; transcript_id=ENST00000532942.5 dd_Smed_v4_1417_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012017AHNAK nucleoprotein 2 dd_Smed_v4_708_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012017AHNAK nucleoprotein 2 dd_Smed_v4_10749_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012017AHNAK nucleoprotein 2 dd_Smed_v4_8295_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025226EF-hand domain-containing protein dd_Smed_v4_13205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013087MYCBP-associated dd_Smed_v4_18917_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016810KDEL endoplasmic reticulum protein retention receptor 1 dd_Smed_v4_3954_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020268Mitofusin-2 dd_Smed_v4_2390_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019951syntaxin 12 dd_Smed_v4_4355_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018939Tubulin monoglutamylase TTLL4 dd_Smed_v4_17034_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017538Protein kinase domain protein dd_Smed_v4_4322_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027189ubiquitin C dd_Smed_v4_15619_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020321Protein Flattop homolog dd_Smed_v4_2157_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022414ankyrin repeat and SOCS box containing 11 dd_Smed_v4_1097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009482Tnf receptor-associated factor dd_Smed_v4_3952_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022545cyclin dependent kinase like 2 dd_Smed_v4_9098_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016401SCP domain-containing protein dd_Smed_v4_1988_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016902h1SMcT0022483.2 dd_Smed_v4_2760_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015316Rho-related GTP-binding protein RhoU-like dd_Smed_v4_8621_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016967catechol-O-methyltransferase domain containing 1 dd_Smed_v4_1794_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023176Acetylcholine receptor subunit alpha-L1 dd_Smed_v4_18201_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012895spermatogenesis associated 6 dd_Smed_v4_4304_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030838h1SMcT0018909.1 dd_Smed_v4_4548_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016116solute carrier family 9 member A1 dd_Smed_v4_19237_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022233NIMA related kinase 5 dd_Smed_v4_4304_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028995h1SMcT0022485.1 dd_Smed_v4_14357_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014009Tubulin monoglutamylase TTLL4 dd_Smed_v4_17537_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013157KH domain-containing, RNA-binding, signal transduction-associated protein 3 dd_Smed_v4_294_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002988Bestrophin homolog dd_Smed_v4_14800_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021616Rho GTPase activating protein at 68F dd_Smed_v4_3376_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026371Uncharacterized protein dd_Smed_v4_1549_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026371Uncharacterized protein dd_Smed_v4_2479_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002455ribosomal protein L6 dd_Smed_v4_205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000967Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_87_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009793myosin VA dd_Smed_v4_11289_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022233spermatogenesis associated 6 dd_Smed_v4_4304_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017371adenylosuccinate lyase dd_Smed_v4_2280_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032005Cadherin-like beta sandwich domain-containing protein dd_Smed_v4_13836_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009279dystonin dd_Smed_v4_1205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009279dystonin dd_Smed_v4_655_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004020eukaryotic translation initiation factor 5A dd_Smed_v4_966_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029546tektin 3 dd_Smed_v4_3187_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011250granulin precursor dd_Smed_v4_442_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021399Protein kintoun dd_Smed_v4_14336_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033785cell cycle and apoptosis regulator 2 dd_Smed_v4_1181_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009048dystonin dd_Smed_v4_1205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009048dystonin dd_Smed_v4_655_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023411Rh family C glycoprotein dd_Smed_v4_1882_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006683Pleckstrin homology-like domain family B member 2 dd_Smed_v4_7833_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012895NIMA related kinase 5 dd_Smed_v4_4304_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009277ELKS/Rab6-interacting/CAST family member 1 dd_Smed_v4_3146_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008882cilia and flagella associated protein 157 dd_Smed_v4_9862_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017636calsyntenin 2 dd_Smed_v4_4147_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003236tropomodulin 2 dd_Smed_v4_3279_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016491dystonin dd_Smed_v4_1205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016491dystonin dd_Smed_v4_655_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015881uncharacterized protein dd_Smed_v4_1426_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027141Uncharacterized protein dd_Smed_v4_1549_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027141Uncharacterized protein dd_Smed_v4_2479_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031746transmembrane protein 216 dd_Smed_v4_24183_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015352asparaginase dd_Smed_v4_9826_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013825acyl-CoA thioesterase 13 dd_Smed_v4_4659_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035642granulin precursor dd_Smed_v4_442_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020166Coiled-coil domain-containing protein 177 dd_Smed_v4_9816_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009611Strictosidine synthase conserved region domain-containing protein dd_Smed_v4_1480_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025664chromosome 6 open reading frame 118 dd_Smed_v4_13434_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017123uncharacterized protein dd_Smed_v4_1426_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034412Cbl proto-oncogene dd_Smed_v4_6780_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018823phosphofructokinase, platelet dd_Smed_v4_1604_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025549spermatogenesis associated 48 dd_Smed_v4_3031_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010494lengsin, lens protein with glutamine synthetase domain dd_Smed_v4_9056_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015967Dpr-interacting protein gamma dd_Smed_v4_2826_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006510Rho GTPase activating protein at 68F dd_Smed_v4_3376_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014459Bcl-2 Bcl-2 homology region 1-3 domain-containing protein dd_Smed_v4_1767_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006193dystonin dd_Smed_v4_1205_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006193dystonin dd_Smed_v4_655_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023196glycoside hydrolase family 25 dd_Smed_v4_2003_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006820cilia and flagella associated protein 57 dd_Smed_v4_3323_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012513h1SMcT0018909.1 dd_Smed_v4_4548_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014615NIMA related kinase 5 dd_Smed_v4_4304_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031582shaking B dd_Smed_v4_10287_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031582shaking B dd_Smed_v4_11302_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022973Rho GTPase-activating protein 23 dd_Smed_v4_4253_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014615spermatogenesis associated 6 dd_Smed_v4_4304_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED300279683'-phosphoadenosine 5'-phosphosulfate synthase 1 dd_Smed_v4_2536_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005744Centrosomal protein 43 dd_Smed_v4_5371_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010766C2 domain containing 3 centriole elongation regulator dd_Smed_v4_13019_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008437RRM domain-containing protein dd_Smed_v4_3605_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010664EF-hand calcium binding domain 5 dd_Smed_v4_8209_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012889h1SMcT0015229.3 dd_Smed_v4_1414_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000305CDGSH iron sulfur domain 2 dd_Smed_v4_2098_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017114eukaryotic translation elongation factor 1 gamma dd_Smed_v4_308_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006334TBC1 domain family member dd_Smed_v4_7827_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035349ankyrin repeat and SOCS box containing 11 dd_Smed_v4_1576_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015945centrin 1 dd_Smed_v4_3644_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007718flotillin dd_Smed_v4_1887_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019305cilia and flagella associated protein 52 dd_Smed_v4_2585_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013699ribosomal protein L9 dd_Smed_v4_150_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005206serine and arginine rich splicing factor dd_Smed_v4_1192_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007674G-patch domain containing 4 dd_Smed_v4_1355_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033253Ankyrin-3 dd_Smed_v4_1576_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012198chromosome 16 open reading frame 89 dd_Smed_v4_4213_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010089RNA helicase dd_Smed_v4_1859_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026112sorting nexin 27 dd_Smed_v4_2513_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023022SEC24 homolog C, COPII coat complex component dd_Smed_v4_1764_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016363h1SMcT0001475.1 dd_Smed_v4_3474_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30024609G-protein coupled receptors family 1 profile domain-containing protein dd_Smed_v4_11910_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011335dynein axonemal heavy chain 10 dd_Smed_v4_5169_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011335dynein axonemal heavy chain 10 dd_Smed_v4_12797_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005787Vimentin type intermediate filament associated coiled-coil protein dd_Smed_v4_4718_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006971TBC1 domain containing kinase dd_Smed_v4_14664_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006971TBC1 domain containing kinase dd_Smed_v4_14664_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012985ubiquitin carboxyl-terminal hydrolase MINDY dd_Smed_v4_13105_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008091TANK binding kinase 1 dd_Smed_v4_1620_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013766RNA helicase dd_Smed_v4_1859_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012991glycoside hydrolase family 5 dd_Smed_v4_1570_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030612ankyrin repeat and SOCS box containing 11 dd_Smed_v4_1576_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020525dynein axonemal intermediate chain 1 dd_Smed_v4_4753_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023104Ankyrin-3 dd_Smed_v4_1576_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011909TANK binding kinase 1 dd_Smed_v4_1620_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017018nascent polypeptide-associated complex subunit alpha dd_Smed_v4_371_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011948F-box/WD repeat-containing protein 10 dd_Smed_v4_13271_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013845phosphoglucomutase 5 dd_Smed_v4_3503_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021207RNA helicase dd_Smed_v4_1859_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017053aluminum tubes dd_Smed_v4_5297_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012015ankyrin repeat and SOCS box containing 11 dd_Smed_v4_1576_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025931leucine rich repeat containing 59 dd_Smed_v4_2987_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020991outer dynein arm docking complex subunit 1 dd_Smed_v4_4191_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017260pre-mRNA processing factor 6 dd_Smed_v4_1153_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005421CAP-Gly domain-containing linker protein 2 dd_Smed_v4_12985_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005421CAP-Gly domain-containing linker protein 2 dd_Smed_v4_14698_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006047EF-hand calcium binding domain 5 dd_Smed_v4_8209_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011521zinc finger AN1-type containing 4 dd_Smed_v4_4892_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30024663dynein regulatory complex subunit 3 dd_Smed_v4_12541_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011832enkurin domain containing 1 dd_Smed_v4_12339_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029970TBC1 domain family member 19 dd_Smed_v4_15291_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022249Clathrin interactor 1 dd_Smed_v4_1563_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008618adenosine deaminase dd_Smed_v4_3903_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031631phosphogluconate dehydrogenase dd_Smed_v4_366_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004403G-protein coupled receptors family 1 profile domain-containing protein dd_Smed_v4_11910_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023104Uncharacterized protein dd_Smed_v4_1576_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009283ribosomal protein L18a dd_Smed_v4_437_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017018RAD23 homolog B, nucleotide excision repair protein dd_Smed_v4_371_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017811actinin alpha 1 dd_Smed_v4_1492_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025256proton channel dd_Smed_v4_12786_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021516inner membrane mitochondrial protein dd_Smed_v4_1605_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021821transient receptor potential cation channel subfamily M member 2 dd_Smed_v4_17981_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30024984armadillo repeat containing 9 dd_Smed_v4_10926_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004484ribosomal protein L8 dd_Smed_v4_108_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023882GRIP1 associated protein 1 dd_Smed_v4_6573_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021916VPS33B interacting protein apical-basolateral polarity regulator spe-39 homolog dd_Smed_v4_19988_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022905Dihydropyrimidinase dd_Smed_v4_3519_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022574START domain-containing protein dd_Smed_v4_3734_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015980spermatogenesis associated 1 dd_Smed_v4_12879_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015980spermatogenesis associated 1 dd_Smed_v4_15381_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018493RAS and EF-hand domain containing dd_Smed_v4_12567_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022035dihydroorotate dehydrogenase (quinone) dd_Smed_v4_4266_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034629SCP domain-containing protein dd_Smed_v4_762_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019555TIMELESS interacting protein dd_Smed_v4_12580_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016458neurogenic locus notch homolog protein dd_Smed_v4_1967_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022102SCY1 like pseudokinase 1 dd_Smed_v4_3470_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018186ribosomal protein L10 like dd_Smed_v4_130_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026396Receptor expression-enhancing protein dd_Smed_v4_5799_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017048cilia and flagella associated protein 206 dd_Smed_v4_11199_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032668Axonemal dynein light chain domain-containing protein 1 dd_Smed_v4_16309_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025517phosphodiesterase 10A dd_Smed_v4_35318_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025517phosphodiesterase 10A dd_Smed_v4_15950_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007804neuroplastin dd_Smed_v4_1827_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017312coiled-coil domain containing 189 dd_Smed_v4_12703_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30024091Silk gland factor 1 dd_Smed_v4_10718_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017314dynein regulatory complex subunit 7 dd_Smed_v4_12588_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004937eukaryotic translation elongation factor 2 dd_Smed_v4_186_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028343Peptidase M14 carboxypeptidase A domain-containing protein dd_Smed_v4_13454_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034660spectrin beta, non-erythrocytic 5 dd_Smed_v4_2514_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028211chromosome 16 open reading frame 89 dd_Smed_v4_4213_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021475hydroxysteroid dehydrogenase like 1 dd_Smed_v4_18258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021467phosphoglycerate mutase 1 dd_Smed_v4_1742_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006481WD repeat domain 49 dd_Smed_v4_13248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013159Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_10777_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030699EPH receptor A4 dd_Smed_v4_16483_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008553phosphoenolpyruvate carboxykinase GTP dd_Smed_v4_196_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032126androglobin dd_Smed_v4_10677_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022043huckebein; transcript_id=FBtr0078951 dd_Smed_v4_10039_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30024863SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 dd_Smed_v4_4141_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027428Silk gland factor 1 dd_Smed_v4_10718_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023266cilia and flagella associated protein 43 dd_Smed_v4_10271_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016586tubulin polyglutamylase complex subunit 2 dd_Smed_v4_13845_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029809UBX domain protein 11 dd_Smed_v4_14940_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015650Centrosomal protein 43 dd_Smed_v4_5371_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006985WD repeat domain 49 dd_Smed_v4_13248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018893enkurin domain containing 1 dd_Smed_v4_12339_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023308SCP domain-containing protein dd_Smed_v4_762_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009463WD repeat domain 49 dd_Smed_v4_13248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016580Receptor expression-enhancing protein dd_Smed_v4_5799_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008325coiled-coil domain containing 57 dd_Smed_v4_10967_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022310Peptidase M14 carboxypeptidase A domain-containing protein dd_Smed_v4_13454_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018872domain-containing protein dd_Smed_v4_11702_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030239eukaryotic translation elongation factor 2 dd_Smed_v4_186_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033302RNA-binding protein MEX3B dd_Smed_v4_1999_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020318WD repeat domain 49 dd_Smed_v4_13248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021186glyoxylate and hydroxypyruvate reductase dd_Smed_v4_3230_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019774Silk gland factor 1 dd_Smed_v4_10718_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034381malate dehydrogenase 1 dd_Smed_v4_467_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025623Silk gland factor 1 dd_Smed_v4_10718_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023484Vimentin type intermediate filament associated coiled-coil protein dd_Smed_v4_4718_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009430aldolase, fructose-bisphosphate A dd_Smed_v4_591_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025084ankyrin repeat and EF-hand domain containing 1 dd_Smed_v4_12476_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005988ribosomal protein L24 dd_Smed_v4_172_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30024138plakophilin 1 dd_Smed_v4_6256_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016156Serpin peptidase inhibitor clade H heat shock protein 47 member 1b dd_Smed_v4_1853_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017971transient receptor potential cation channel subfamily A member 1 dd_Smed_v4_6201_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032420PLAC8 like 1 dd_Smed_v4_1219_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026127antigen 8 dd_Smed_v4_6123_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026870Hillarin dd_Smed_v4_5330_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030630Hormone receptor 51; transcript_id=FBtr0114456 dd_Smed_v4_24412_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003625LUC7 like 3 pre-mRNA splicing factor dd_Smed_v4_5427_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025849centrosome and spindle pole associated protein 1 dd_Smed_v4_13453_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007783leucine, glutamate and lysine rich 1 dd_Smed_v4_16355_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007496FRAS1 related extracellular matrix 1 dd_Smed_v4_5187_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035078jgi|Batde5|23934|fgenesh1_pg C_scaffold_4000173 dd_Smed_v4_6819_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027540cathepsin W dd_Smed_v4_456_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020736NOP58 ribonucleoprotein dd_Smed_v4_1982_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016277TNF receptor-associated factor dd_Smed_v4_2354_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001933heterogeneous nuclear ribonucleoprotein F dd_Smed_v4_2383_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020653Anoctamin dd_Smed_v4_6514_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033335java no jive dd_Smed_v4_10738_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012787Dyslexia-associated protein KIAA0319 homolog dd_Smed_v4_5586_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004957Anoctamin dd_Smed_v4_6514_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023059EF-hand calcium-binding domain-containing protein 6 (Fragment) dd_Smed_v4_7065_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035360peptidylprolyl isomerase A like 4G dd_Smed_v4_133_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029370glucose-6-phosphate isomerase dd_Smed_v4_1398_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007853CYFIP related Rac1 interactor B dd_Smed_v4_1856_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011285DNA polymerase subunit gamma-1, mitochondrial dd_Smed_v4_5734_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006655ribosomal protein L32 dd_Smed_v4_149_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010853h1SMcT0012483.1 dd_Smed_v4_13134_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026696ribosomal protein S19 dd_Smed_v4_202_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004876Nuclear receptor subfamily 4immunitygroup A member 1 dd_Smed_v4_12229_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027228Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_5010_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022370Potassium calcium-activated channel subfamily U member 1 dd_Smed_v4_12503_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034775growth factor receptor bound protein 7 dd_Smed_v4_3216_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000014solute carrier family 20 member 2 dd_Smed_v4_1270_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021940Protein kinase domain-containing protein dd_Smed_v4_2030_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023729The sequence of the model RefSeq protein was modified relative to this genomic sequence to represent the inferred CDS dd_Smed_v4_392_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023825h1SMcT0015128.1 dd_Smed_v4_353_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007742SEC61 translocon subunit alpha 2 dd_Smed_v4_282_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031745fatty acid amide hydrolase dd_Smed_v4_4966_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028787TNF receptor-associated factor dd_Smed_v4_2354_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004648dual specificity tyrosine phosphorylation regulated kinase 3 dd_Smed_v4_12119_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033380hexosaminidase subunit beta dd_Smed_v4_576_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029489NIMA related kinase 6 dd_Smed_v4_8347_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008756dynein axonemal heavy chain 6 dd_Smed_v4_14707_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004519Si ch211-284k5.2 dd_Smed_v4_2676_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003084cilia and flagella associated protein 45 dd_Smed_v4_3732_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018386inositol 1,4,5-trisphosphate receptor dd_Smed_v4_14214_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3001882972 kDa type IV collagenase dd_Smed_v4_14729_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027478tektin 1 dd_Smed_v4_3287_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029349S-adenosylhomocysteine hydrolase-like protein 1 dd_Smed_v4_3408_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031980ribosomal protein S10 dd_Smed_v4_117_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034859Tetraspanin dd_Smed_v4_3116_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027451pickel; transcript_id=FBtr0070256 dd_Smed_v4_2731_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026049ribosomal protein L35a dd_Smed_v4_318_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011908heterogeneous nuclear ribonucleoprotein L dd_Smed_v4_1327_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034766enolase 1 dd_Smed_v4_510_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034152ribosomal protein L11 dd_Smed_v4_144_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031988chromosome 4 open reading frame 47 dd_Smed_v4_8186_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018632Protein kinase domain-containing protein dd_Smed_v4_2030_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006438EF-hand domain family member B dd_Smed_v4_11909_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019298heterogeneous nuclear ribonucleoprotein L dd_Smed_v4_1327_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011798Uncharacterized protein dd_Smed_v4_593_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015179ATP-dependent RNA helicase dd_Smed_v4_596_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021479Protein kinase domain-containing protein dd_Smed_v4_2030_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020070high mobility group dd_Smed_v4_1095_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020548Uncharacterized protein dd_Smed_v4_593_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016539Protein kinase domain-containing protein dd_Smed_v4_2030_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000946calpain 1 dd_Smed_v4_4020_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027566TNF receptor-associated factor 6-B dd_Smed_v4_7519_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027683golgi phosphoprotein 3 dd_Smed_v4_1770_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033232family with sequence similarity 81 member A dd_Smed_v4_13185_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007243polypeptide N-acetylgalactosaminyltransferase 12 dd_Smed_v4_5333_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014163Uncharacterized protein dd_Smed_v4_593_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001891Uncharacterized protein dd_Smed_v4_593_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035769h1SMcT0022069.1 dd_Smed_v4_1251_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009887macrophage erythroblast attacher, E3 ubiquitin ligase dd_Smed_v4_1168_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018630HMG box domain-containing protein dd_Smed_v4_1331_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000411shibire dd_Smed_v4_2160_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016539pan gu dd_Smed_v4_2030_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032947cilia and flagella associated protein 46 dd_Smed_v4_14103_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001181PLAC8 like 1 dd_Smed_v4_1219_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030038ATP-dependent RNA helicase dd_Smed_v4_596_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002414Delta; transcript_id=FBtr0083740 dd_Smed_v4_13823_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015672capping actin protein, gelsolin like dd_Smed_v4_1215_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006402progesterone immunomodulatory binding factor 1 dd_Smed_v4_13444_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001723spermatogenesis associated 1 dd_Smed_v4_12879_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001723spermatogenesis associated 1 dd_Smed_v4_15381_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031862RAB27B, member RAS oncogene family dd_Smed_v4_5306_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003829ankyrin repeat and SOCS box containing 11 dd_Smed_v4_1576_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005064BarH-like 2 homeobox protein dd_Smed_v4_18719_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029491outer dense fiber of sperm tails 2 dd_Smed_v4_3609_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031089ribosomal protein S12 dd_Smed_v4_268_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021087Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_6894_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034361core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase 1 dd_Smed_v4_4310_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011550ribosomal protein S10 dd_Smed_v4_117_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016338adducin 1 dd_Smed_v4_2345_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027818chromosome 1 open reading frame 194 dd_Smed_v4_3833_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30024316h1SMcT0005612.1 dd_Smed_v4_3352_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027707methionine adenosyltransferase 2A dd_Smed_v4_1580_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031005lymphocyte expansion molecule dd_Smed_v4_16551_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010890The sequence of the model RefSeq protein was modified relative to this genomic sequence to represent the inferred CDS dd_Smed_v4_347_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009210mitogen-activated protein kinase kinase kinase 7 dd_Smed_v4_13767_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019771Rh family C glycoprotein dd_Smed_v4_1882_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011242synaptosome associated protein 29 dd_Smed_v4_1819_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026188ER membrane protein complex subunit 10 dd_Smed_v4_2594_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000184NME/NM23 family member 5 dd_Smed_v4_3890_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028337cell cycle and apoptosis regulator 2 dd_Smed_v4_1181_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010966novel protein; transcript_id=ENST00000637680.1 dd_Smed_v4_2796_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007294solute carrier family 5 member 8 dd_Smed_v4_14173_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019094SNAP associated protein dd_Smed_v4_1781_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031547solute carrier family 9 member B2 dd_Smed_v4_7736_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008769ribosomal protein S10 dd_Smed_v4_117_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009173Multiple PDZ domain protein dd_Smed_v4_3080_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029485chloride intracellular channel 5 dd_Smed_v4_3208_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011483Alpha 1,4-glycosyltransferase domain-containing protein dd_Smed_v4_7523_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009782outer dense fiber of sperm tails 3 dd_Smed_v4_2658_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019494ubiquitin-fold modifier conjugating enzyme 1 dd_Smed_v4_4590_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029180poly(A) polymerase gamma dd_Smed_v4_3033_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016917Tctex1 domain containing 1 dd_Smed_v4_9321_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020124h1SMcT0007689.2 dd_Smed_v4_2458_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028824ankyrin repeat domain 20 family member A4, pseudogene dd_Smed_v4_8624_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006549C-type lectin domain-containing protein dd_Smed_v4_7893_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013731EF-hand domain-containing protein dd_Smed_v4_7903_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007755LIM and SH3 protein 1 dd_Smed_v4_1218_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013692Major egg antigen dd_Smed_v4_1039_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003406Bestrophin homolog dd_Smed_v4_4179_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010816Protein shank dd_Smed_v4_4371_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019729bestrophin 2 dd_Smed_v4_8073_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004315bestrophin 2 dd_Smed_v4_8073_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027686bestrophin 4 dd_Smed_v4_8314_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028496Protein disulfide-isomerase dd_Smed_v4_1893_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004447family with sequence similarity 184 member B dd_Smed_v4_16975_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019494ubiquitin-fold modifier conjugating enzyme 1 dd_Smed_v4_4590_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011703Uncharacterized protein dd_Smed_v4_11696_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023688repeats and guanylate kinase domain containing dd_Smed_v4_9362_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006563IQ motif and SEC7 domain-containing protein 1 dd_Smed_v4_9423_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027354myeloid leukemia factor 1 dd_Smed_v4_4787_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020852protein phosphatase 1 regulatory subunit 16B dd_Smed_v4_5861_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026043UDP-glucose pyrophosphorylase 2 dd_Smed_v4_3057_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013735eukaryotic translation elongation factor 1 alpha 1 dd_Smed_v4_30_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020643chromosome 1 open reading frame 158 dd_Smed_v4_6127_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015586TAR DNA-binding protein 43 dd_Smed_v4_12522_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018477bridging integrator 1 dd_Smed_v4_3292_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010892Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_9188_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027076binding protein dd_Smed_v4_10292_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020617SH3 domain containing GRB2 like endophilin B2 dd_Smed_v4_4055_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029046domain-containing protein dd_Smed_v4_6962_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025902sperm flagellar 2 dd_Smed_v4_9419_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013082antigen dd_Smed_v4_1888_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017953switching B cell complex subunit dd_Smed_v4_3820_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034903cilia and flagella associated protein 77 dd_Smed_v4_5179_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007072methylmalonyl-CoA epimerase dd_Smed_v4_3348_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008550intraflagellar transport 20 dd_Smed_v4_9545_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006279Tropomyosin dd_Smed_v4_15812_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025272laminin subunit gamma 1 dd_Smed_v4_7359_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007174NHP2 ribonucleoprotein dd_Smed_v4_3155_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006279Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_15812_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020539C-type lectin domain-containing protein dd_Smed_v4_7893_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013692SHSP domain-containing protein dd_Smed_v4_1039_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032602Neural proliferation differentiation and control protein 1 dd_Smed_v4_6930_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011483Mannosyl phosphorylinositol ceramide synthase SUR1 dd_Smed_v4_7523_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029205Glutamate receptor dd_Smed_v4_33167_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015587Dual specificity protein phosphatase 14 dd_Smed_v4_7558_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004930Irregular chiasm C-roughest protein dd_Smed_v4_12549_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019169gamma-aminobutyric acid GABA A receptor alpha dd_Smed_v4_2273_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013141pleckstrin homology and FYVE domain containing 2 dd_Smed_v4_2374_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009695RAS like proto-oncogene A dd_Smed_v4_522_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010340neuroligin 1 dd_Smed_v4_7946_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022914coiled-coil domain containing 154 dd_Smed_v4_11421_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019518Serine/threonine-protein kinase shk2 dd_Smed_v4_12680_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025923Mediator of DNA damage checkpoint protein 1 dd_Smed_v4_4697_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013392h1SMcT0011101.1 dd_Smed_v4_5080_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011204piezo type mechanosensitive ion channel component 1 dd_Smed_v4_13866_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006336PIH1 domain containing 2 dd_Smed_v4_9306_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017180dynein regulatory complex subunit 1 dd_Smed_v4_8761_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002886Uncharacterized protein dd_Smed_v4_11049_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025076Semaphorin-5B dd_Smed_v4_2518_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007588Spindle and centriole-associated protein 1 dd_Smed_v4_10100_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025004magnesium dependent phosphatase 1 dd_Smed_v4_1958_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018556pyruvate kinase dd_Smed_v4_51910_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027213solute carrier family 49 member 3 dd_Smed_v4_5238_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014374coiled dd_Smed_v4_2552_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019095microtubule actin crosslinking factor 1 dd_Smed_v4_10965_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027940cyclic nucleotide binding domain containing 2 dd_Smed_v4_15589_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014250Protein enabled dd_Smed_v4_22545_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017333centrosomal protein 83 dd_Smed_v4_12969_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010695coiled-coil domain containing 170 dd_Smed_v4_7066_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006822cyclin dependent kinase like 2 dd_Smed_v4_15542_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011545X-linked inhibitor of apoptosis dd_Smed_v4_1803_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030435serine and arginine rich splicing factor 5 dd_Smed_v4_3431_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026656CWF21 domain-containing protein dd_Smed_v4_4340_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013881nuclear receptor binding SET domain protein 1b dd_Smed_v4_99_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000605chromosome 22 open reading frame 23 dd_Smed_v4_9772_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026777Translin-associated factor X-interacting protein 1 N-terminal domain-containing protein dd_Smed_v4_14291_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030892intraflagellar transport 172 dd_Smed_v4_7533_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030892intraflagellar transport 172 dd_Smed_v4_10638_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019720nuclear receptor binding SET domain protein 1b dd_Smed_v4_99_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023859Serine/threonine-protein phosphatase 2A 56 kDa regulatory subunit delta isoform dd_Smed_v4_6134_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030925shootin 1 dd_Smed_v4_4195_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028925adiponectin receptor 2 dd_Smed_v4_2696_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026669WD repeat and SOCS box containing 1 dd_Smed_v4_1381_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035599Homeobox protein dd_Smed_v4_15951_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004754RNA binding motif protein 8A dd_Smed_v4_1169_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030448dual specificity protein phosphatase dd_Smed_v4_3617_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002599bridging integrator 1 dd_Smed_v4_3292_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001235cilia and flagella associated protein 298 dd_Smed_v4_3612_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030643metabolism of cobalamin associated D dd_Smed_v4_2046_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008506ribosomal protein S17 dd_Smed_v4_195_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031456metabolism of cobalamin associated D dd_Smed_v4_2046_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035079ATPase phospholipid transporting 9B (putative) dd_Smed_v4_2913_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018637heat shock protein family A (Hsp70) member 8 dd_Smed_v4_15_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029534Uncharacterized protein dd_Smed_v4_1940_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001818Tnf receptor-associated factor dd_Smed_v4_9703_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029899solute carrier family 25 member 6 dd_Smed_v4_50_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019189 dd_Smed_v4_140_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033197 dd_Smed_v4_116_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023766 dd_Smed_v4_116_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013257 dd_Smed_v4_2694_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000090 dd_Smed_v4_298_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000090 dd_Smed_v4_5276_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012150 dd_Smed_v4_298_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012150 dd_Smed_v4_5276_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031405 dd_Smed_v4_298_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031405 dd_Smed_v4_5276_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035448 dd_Smed_v4_11799_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035836 dd_Smed_v4_11681_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013578 dd_Smed_v4_1150_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000058 dd_Smed_v4_499_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028267 dd_Smed_v4_4822_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027761 dd_Smed_v4_54604_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015018 dd_Smed_v4_4158_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010380 dd_Smed_v4_4617_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026004 dd_Smed_v4_3108_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031423 dd_Smed_v4_428_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015310 dd_Smed_v4_54_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022855 dd_Smed_v4_691_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009546 dd_Smed_v4_855_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013144 dd_Smed_v4_6916_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022317 dd_Smed_v4_6916_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018756 dd_Smed_v4_6916_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022463 dd_Smed_v4_6916_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029774 dd_Smed_v4_6916_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012487 dd_Smed_v4_5926_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30024611 dd_Smed_v4_78314_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029865 dd_Smed_v4_78314_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021812 dd_Smed_v4_7896_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035879 dd_Smed_v4_9070_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007534 dd_Smed_v4_5414_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028990 dd_Smed_v4_6409_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035382 dd_Smed_v4_7138_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026803 dd_Smed_v4_8540_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020914 dd_Smed_v4_955_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020042 dd_Smed_v4_6346_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021601 dd_Smed_v4_6596_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022840 dd_Smed_v4_777_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017702 dd_Smed_v4_7346_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30024189 dd_Smed_v4_113_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021903 dd_Smed_v4_10729_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001414 dd_Smed_v4_10501_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020490 dd_Smed_v4_11685_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016203 dd_Smed_v4_11685_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029426 dd_Smed_v4_1187_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002516 dd_Smed_v4_1283_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028103 dd_Smed_v4_11827_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016041 dd_Smed_v4_10793_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016041 dd_Smed_v4_3976_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018999 dd_Smed_v4_10158_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30036013 dd_Smed_v4_123_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027291 dd_Smed_v4_12177_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010775 dd_Smed_v4_10948_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032667 dd_Smed_v4_976_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022295 dd_Smed_v4_9758_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032666 dd_Smed_v4_8977_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011412 dd_Smed_v4_97_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033756 dd_Smed_v4_97_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012932 dd_Smed_v4_811_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032324 dd_Smed_v4_8794_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029399 dd_Smed_v4_10874_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010231 dd_Smed_v4_10874_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001702 dd_Smed_v4_8527_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032523 dd_Smed_v4_8527_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017762 dd_Smed_v4_783_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005449 dd_Smed_v4_9793_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029274 dd_Smed_v4_9793_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017807 dd_Smed_v4_9130_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032059 dd_Smed_v4_9238_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005283 dd_Smed_v4_9995_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001158 dd_Smed_v4_9572_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009505 dd_Smed_v4_4166_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014015 dd_Smed_v4_8317_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017854 dd_Smed_v4_75560_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007246 dd_Smed_v4_797_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017204 dd_Smed_v4_4953_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026286 dd_Smed_v4_21426_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030123 dd_Smed_v4_21426_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020749 dd_Smed_v4_556_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000891 dd_Smed_v4_5606_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020686 dd_Smed_v4_13318_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033336 dd_Smed_v4_214_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031754 dd_Smed_v4_14636_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30024854 dd_Smed_v4_2273_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031021 dd_Smed_v4_2185_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031837 dd_Smed_v4_2185_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002689 dd_Smed_v4_680_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002013 dd_Smed_v4_6979_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020475 dd_Smed_v4_6979_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008273 dd_Smed_v4_15003_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017542 dd_Smed_v4_22810_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025708 dd_Smed_v4_4677_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004498 dd_Smed_v4_13051_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004582 dd_Smed_v4_13051_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020150 dd_Smed_v4_6334_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010027 dd_Smed_v4_5101_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022184 dd_Smed_v4_418_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026844MAK16 homolog dd_Smed_v4_1416_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011695galactosidase alpha dd_Smed_v4_606_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029350serine incorporator 1 dd_Smed_v4_1130_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012622intraflagellar transport dd_Smed_v4_5237_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019328armadillo repeat containing 2 dd_Smed_v4_12684_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018542solute carrier family 4 member 7 dd_Smed_v4_3003_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017201SFI1 centrin binding protein dd_Smed_v4_12484_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034198SFI1 centrin binding protein dd_Smed_v4_12484_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018542bicarbonate transporter-like dd_Smed_v4_3003_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023540Calcineurin A at 14F; transcript_id=FBtr0305198 dd_Smed_v4_2045_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022570RAB27B, member RAS oncogene family dd_Smed_v4_3594_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023736Homeobox protein six1b dd_Smed_v4_15436_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031247ftz transcription factor 1 dd_Smed_v4_1183_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032664bicarbonate transporter-like dd_Smed_v4_3003_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008744Cyclin K dd_Smed_v4_2558_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030655fibronectin type III and ankyrin repeat domains 1 dd_Smed_v4_7496_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004820microfibril associated protein 1 dd_Smed_v4_2957_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014550intraflagellar transport dd_Smed_v4_5237_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029770ABCF2-H2BE1 readthrough dd_Smed_v4_434_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007024G-protein coupled receptors family 1 profile domain-containing protein dd_Smed_v4_24316_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034752Transmembrane GTPase Marf dd_Smed_v4_2409_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031282Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_13623_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000566rhophilin associated tail protein 1 like dd_Smed_v4_4888_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004581dual specificity protein phosphatase dd_Smed_v4_3551_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031468propionyl-CoA carboxylase subunit alpha dd_Smed_v4_1247_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015748Translin-associated factor X-interacting protein 1 N-terminal domain-containing protein dd_Smed_v4_14291_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030062ankyrin repeat domain 12 dd_Smed_v4_3251_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030287Calcineurin A at 14F; transcript_id=FBtr0305198 dd_Smed_v4_2045_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013079succinate dehydrogenase complex subunit D dd_Smed_v4_982_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029761actin binding LIM protein family member 3 dd_Smed_v4_11521_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023258Caprin-1 dd_Smed_v4_936_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015974coiled-coil domain containing 173 dd_Smed_v4_8917_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002394dehydrogenase/reductase 7C dd_Smed_v4_3512_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023409Glutamate rich 3 dd_Smed_v4_8627_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035317phosphoglycerate kinase 1 dd_Smed_v4_972_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030095coiled-coil domain containing 87 dd_Smed_v4_12480_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009284heat shock protein family A (Hsp70) member 9 dd_Smed_v4_424_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033757Forkhead box protein J1-A dd_Smed_v4_14635_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032500RAB15, member RAS oncogene family dd_Smed_v4_6049_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022209ATPase family AAA domain containing 3A dd_Smed_v4_1807_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034500Early growth response protein 4 dd_Smed_v4_9273_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015453poly(ADP-ribose) polymerase family member 3 dd_Smed_v4_2611_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025105plastin 3 dd_Smed_v4_749_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035260domain-containing protein dd_Smed_v4_12208_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012926Uncharacterized protein dd_Smed_v4_1940_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027280ribosomal protein lateral stalk subunit P0 dd_Smed_v4_161_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001793O-linked N-acetylglucosamine (GlcNAc) transferase dd_Smed_v4_2939_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011715splicing factor dd_Smed_v4_1177_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30024309isocitrate dehydrogenase (NADP( )) 2 dd_Smed_v4_449_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012926serine/arginine repetitive matrix 5 dd_Smed_v4_1940_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008623phospholipase B domain containing 2 dd_Smed_v4_485_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026093Ribosomal protein S5b; transcript_id=FBtr0083006 dd_Smed_v4_295_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30024202ribosomal protein S14 dd_Smed_v4_139_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032664solute carrier family 4 member 7 dd_Smed_v4_3003_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013798dual specificity protein phosphatase dd_Smed_v4_653_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002092ATPase H /K transporting subunit beta dd_Smed_v4_2230_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007561si ch73-379j16.2 dd_Smed_v4_7973_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012874adenylate cyclase 9 dd_Smed_v4_2998_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011708limbic system associated membrane protein dd_Smed_v4_3768_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031446Rho guanine nucleotide exchange factor dd_Smed_v4_5524_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003458RAB27B, member RAS oncogene family dd_Smed_v4_10266_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023210phosphodiesterase 4B dd_Smed_v4_9276_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008653Rho guanine nucleotide exchange factor dd_Smed_v4_5524_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035451ftz transcription factor 1 dd_Smed_v4_1183_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011120amino acid transporter dd_Smed_v4_9277_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020537FAS1 domain-containing protein dd_Smed_v4_1676_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000819sphingomyelin phosphodiesterase acid like 3A dd_Smed_v4_5377_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026656cylicin 1 dd_Smed_v4_4340_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008679leucine rich repeat containing 34 dd_Smed_v4_9926_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001455Bromodomain testis-specific protein dd_Smed_v4_6525_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013227dynein axonemal intermediate chain 3 dd_Smed_v4_9187_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014822moesin dd_Smed_v4_611_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007470coiled-coil domain containing 180 dd_Smed_v4_12302_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019452ceramide glucosyltransferase dd_Smed_v4_7543_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021222meiosis specific nuclear structural 1 dd_Smed_v4_4463_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035194DnaJ heat shock protein family (Hsp40) member C27 dd_Smed_v4_11963_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012107zinc finger MYND-type containing 12 dd_Smed_v4_10079_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018550centrosomal protein 78 dd_Smed_v4_9671_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023486intraflagellar transport 74 dd_Smed_v4_12702_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035047sperm associated antigen 17 dd_Smed_v4_9301_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014181solute carrier family 23 member 2 dd_Smed_v4_9401_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000581centlein dd_Smed_v4_9882_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001515annexin A11 dd_Smed_v4_1104_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033098WD repeat domain 97 dd_Smed_v4_11828_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034041tetratricopeptide repeat domain 30B dd_Smed_v4_8798_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014181solute carrier family 23 member 1 dd_Smed_v4_9401_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025832Uncharacterized protein dd_Smed_v4_714_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034802small nuclear ribonucleoprotein D3 polypeptide dd_Smed_v4_562_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030286dynein light chain Tctex-type 2B dd_Smed_v4_7666_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012572leucyl-tRNA synthetase 2, mitochondrial dd_Smed_v4_9705_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003672translocase of inner mitochondrial membrane 17A dd_Smed_v4_904_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035206Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_16385_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025634Major facilitator superfamily MFS profile domain-containing protein dd_Smed_v4_9883_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30024215intraflagellar transport 81 dd_Smed_v4_8803_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013396novel protein; transcript_id=ENST00000570054.3 dd_Smed_v4_154_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027596partner of NOB1 homolog dd_Smed_v4_1077_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001116cilia and flagella associated protein 44 dd_Smed_v4_8760_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013262Uncharacterized protein dd_Smed_v4_11792_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000995pyruvate kinase M1/2 dd_Smed_v4_605_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011896Golgi-associated plant pathogenesis-related protein 1 dd_Smed_v4_15638_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022032coiled-coil domain containing 18 dd_Smed_v4_8017_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022032coiled-coil domain containing 18 dd_Smed_v4_9340_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019401spermatogenesis associated 17 dd_Smed_v4_6435_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021790UBX domain protein 4 dd_Smed_v4_823_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022717repeats and IQ motif containing 1 dd_Smed_v4_12813_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029555RNA-binding protein Musashi homolog 1 dd_Smed_v4_473_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005253EF-hand domain containing 2 dd_Smed_v4_6035_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030499Uncharacterized protein CXorf58 homolog dd_Smed_v4_8151_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031311Hexosyltransferase dd_Smed_v4_6118_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027015varicose; transcript_id=FBtr0089947 dd_Smed_v4_5287_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029166coiled-coil domain containing 178 dd_Smed_v4_8905_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031752unextended dd_Smed_v4_18450_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006949h1SMcT0012458.1 dd_Smed_v4_888_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031736CUB and zona pellucida-like domains 1 tandem duplicate dd_Smed_v4_8185_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035576leucine rich repeat containing 56 dd_Smed_v4_10834_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020269Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_395_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035198Hexosyltransferase dd_Smed_v4_6118_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001550Tctex1 domain-containing protein dd_Smed_v4_19018_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035040h1SMcT0009034.1 dd_Smed_v4_5894_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016040ankyrin repeat domain 20 family member A4, pseudogene dd_Smed_v4_8624_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011384ankyrin repeat domain 20 family member A4, pseudogene dd_Smed_v4_8624_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028624Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_13224_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026859glycerol-3-phosphate acyltransferase 1 mitochondrial dd_Smed_v4_8757_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018