pharynx

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ Description

  ▻ Figures

  ▻ In Situ Hybridization Data

  ▻ Sequences

  ▻ References

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  pharynx


DEFINITON:

  A plicate and protrusible organ that is the sole point of entry and exit for the Triclad gut. It contains epithelial, muscular, secretory and neuronal cell types.


TERM DEFINITION CITATIONS:

  OCLC:16809160


TERM CITATIONS:

Expand publication list


TERM ID:

  PLANA:0000016


ABOUT THIS TERM:

pharynx

  ↳is a material entity and organ

  ↳contained in posterior region of the whole animal and parapharyngeal region

  ↳existence overlaps Stage 6, juvenile, Stage 5, asexual adult, adult hermaphrodite, Stage 8 and Stage 7

  ↳existence starts during or after Stage 5

  ↳part of digestive system


  → pharynx progenitor cell and pharynx primordium develops into pharynx


Expand to see terms that part of pharynx


BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


DESCRIPTION:   

foxA1, a pioneer transcription factor required for pharynx maintenance and regeneration during adulthood (Adler et al., 2014; Scimone et al., 2014), may similarly be required for construction of the definitive pharynx during embryogenesis. Development of the definitive pharynx, the single opening of the Smed digestive tract, commenced during S4-S5 with the onset of foxA1 expression in parenchymal cells, many of which were located in the oral hemisphere (Figure 1 – figure supplement 14A). The distribution of foxA1+ cells remained concentrated in and around the developing definitive pharynx rudiment during S6-S8, a pattern reminiscent of that observed in S. polychroa embryos (Martín-Durán et al., 2010), as well as in intact and regenerating Smed asexual adults (Adler et al., 2014; Scimone et al., 2014). The definitive pharynx develops beneath the degenerating temporary embryonic pharynx, and marks the ventral side of the embryos during S6 and thereafter (Martín-Durán and Romero, 2011). foxA1 upregulation during S5-S8 was statistically significant, albeit the adjusted p-values were above the thresholds set for inclusion in the enriched transcript lists presented in Figure 1 – source data 5, Figure 1 – source data 6, Figure 1 – source data 7, Figure 1 – source data 8. meis, a transcription factor coexpressed in foxA1+ neoblasts and expressed within the regenerating pharynx (Scimone et al., 2014), was among the S5 enriched transcripts (Figure 1 – source data 5); its expression trend was similar to foxA1 during embryogenesis (Figure 1 – figure supplement 14B). Two markers exhibiting pharynx-restricted expression in adults, laminin and npp-1 (Adler et al., 2014), were upregulated during S6-S8, after development of the definitive pharynx rudiment was evident (Figure 1 – figure supplement 14B).


 

back to top


FIGURES:


Figure 1 – figure supplement 14: Molecular markers for the definitive pharynx

A: WISH developmental time course using foxA1 riboprobes (blue), S3-S8.  foxA1 expression was consistently detected in the embryonic pharynx lumen during S3-S5 (black arrowheads). Anterior: top (S6-S8). Black arrowheads: embryonic pharynx. Red arrowheads: definitive pharynx. O: oral hemisphere. A: aboral hemisphere. D: dorsal. V: ventral. Scale bars: 100 µm.

B: Average RPKM values per embryo for the definitive pharynx markers foxA1, meis, laminin, npp-1 during embryogenesis (Adler et al., 2014; Scimone et al., 2014), Y (yolk), Stage (S) S2-S8. 

 

 

back to top


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30027428AFJ24799.1forkhead box A-1foxA1Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, digestive system, pharynx, pharynx progenitor cell, embryonic pharynx
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30027428 ID=SMED30027428|Name=forkhead box A-1|organism=Schmidtea mediterranea sexual|type=transcript|length=2149bp
ATCACTTGGTGCTGCTTTTTGCCCCGATAAATCTCTCGGTGCTCCAAAATTTGTGTAAGCGAGCAAAAGATGATTGGGCA
ATTTCTAGCACGTCATTCGGCAACGATGTTTACAAGTTTCTCTGATTGGATGATAAAGTAGAAACTTTCCGAAAATGAAA
CTTCTCCGAACATGCGCATACCGACTGAAAATTAACTCTAAGCCAGCCAATGGAATTGAAGCAAAATTCAAGAGAATATT
AATTGACTTCGCGAATGAACTCAAATTTTCTATTGGCGTATTGTGTGTGCCTCATTGTGAGTGGTTGCGATCGCATCTCA
AATTATTTACACACAAAAAAATAACGCACACAGACATTGAATAGATATATTTGATCAAGTCAATATCACAATGTCAATAT
TAGCTTTTTCTGAAGAAAGAAGACGAACTAGAAGAAAAACAACAACGAAATAGATTCGATAAGGCTACTGAGCGATTTTC
ATAATCTAAATATTATTTTATTATTGATACGGACAAAAATTGGTCTTTTACCAAGTACTACTAGATTGTTGATAAAGAGA
GGTTATTTAGATGCTTGGAAAAAATCCTTATGAAACTGCAATGAGCAACGTGTATTCTCTACCTCCGGGAGGTTCTATTT
ACAATATGAACCCGATGAGTATATCATCAGCTGGCTACAACTCTCAACAAGTATCAACACTATCGTTGAACTTGACCGGA
ATCGGACCTCATTCATTAAGCCCAATGAGTGCAAGCATGTCGGGTATAGCTGCAATGGCCGGTGGAATGAGACAAGGTCT
TGAGTTGGGTCTTGGTAGAAGTGATAGTCCAAGAGATAAAAATTCAATTTCCAATAACAACCGACCATATCAAAGAAGTT
ACACTCATGCCAAGCCTCCATACAGTTATATAAGTTTGATAACAATGGCGATTCAAAATTCTCCAGTAAACATGTGCACT
CTATCGGAGATCTATCAATTCATTATGGATCATTTTCCATACTATCGTCAAAATCAACAGCGATGGCAGAATTCGATTCG
ACATTCTTTGTCCTTCAACGATTGCTTTGTTAAGGTTAGTAGAAGCCCAGAAAAACCAGGTAAAGGCTCATATTGGACCT
TGCATCCTCAATCAGGTAACATGTTTGAAAACGGTTGTTATCTCAGAAGACAAAAGCGATTCAAAGATCCACACAGAGAA
ATCGGCAGACAGAGTCAAAGAGCTGCCACTGGTCCTGGATCAAATGTCACAGAAAACAATCACGACAACGCATCGCAAGA
AGCTAGTGATAACGCAGAAAGTGATACGAAACCCAACATCAAGCAACTTGATTTATCAAGCGATCTCTTAACTAATCAAG
GTCATAATATTAAAAATACTAATCCAACTTCTGTTAGTCAGAGTTGTTCGATGTTTCATCGGAAAAAGGAAAACTGCTCA
CCAGTAGAAATGAAATTGAATAACCAAAACCAACAATCAAACCAGCAAGAACATCCACAAATCCATTACAATCCCAATCA
GCAATTCTACTCAAATCAGCAAAACATTTTCCAACAAAGTTCTCTTGATCATTACAGTCTATTAGCATCCGATGATCCTC
TTGGTCAAGGTATGCACTTGCCACCAGGTGCAAATAGTGTTTTCGGACTTTACGGGGCACATAACTTACCAAACGATGAT
CAAATTTCAGTGTCATTACCATCGATATCCTTATCCGGACATCCGTATGACAATTTATCAACAGCAATGGCATATCAATA
TGAAGCATCTCAACACAATTCTTCATTACTAACGACAAGTAATCCGTTCTCAATAGATCGTTTGATGCATCCAAGACTAG
TCGCTGCAGCGATGGGGGTCAGTCCCCATGATACTCTATACGCAGGAGCTACCGGCCCATCAGTTGATCTAGAACACATG
AAATACTACTCAAACTACAACAATGTGCCTCCTTATTCCTCTGCAATGTCTGACTACTACAAATATGTACAAAATCCTCA
GCCGGGCAACAGCGACATGAGTCTTTGAATTGAGTCCATTGAAGTCTACGGCAGTTTCCTCGAAATTTCACATTCAACCA
GATGTTTATCGCCTAATATAAAGCTGTGTTTTTTTATTTATTTACAATTAAATCTTTGTACAAGAGATC

 

back to top


ADDITIONAL REFERENCES:


Adler, C.E., Seidel, C.W., McKinney, S.A., and Sánchez Alvarado, A. (2014). Selective amputation of the pharynx identifies a FoxA-dependent regeneration program in planaria. Elife 3, e02238.

Martín-Durán, J.M., Amaya, E., and Romero, R. (2010). Germ layer specification and axial patterning in the embryonic development of the freshwater planarian Schmidtea polychroa. Dev Biol 340, 145-158.

Martín-Durán, J.M., and Romero, R. (2011). Evolutionary implications of morphogenesis and molecular patterning of the blind gut in the planarian Schmidtea polychroa. Dev Biol 352, 164-176.

Scimone, M.L., Kravarik, K.M., Lapan, S.W., and Reddien, P.W. (2014). Neoblast specialization in regeneration of the planarian Schmidtea mediterranea. Stem Cell Reports 3, 339-352.

 

back to top



PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in pharynx. Click this link to learn more about PAGE.


PAGE Curations: 3199


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
pharynxSMED30033139TNF receptor-associated factorSMESG000079607.1 SMESG000072955.1 SMESG000049847.1 SMESG000049844.1 SMESG000049832.1 SMESG000049812.1 SMESG000049806.1 SMESG000049805.1 SMESG000049772.1 SMESG000049767.1 SMESG000049756.1 SMESG000049745.1 SMESG000049740.1 SMESG000049739.1 SMESG000049695.1 SMESG000049688.1 SMESG000049683.1 SMESG000049676.1 SMESG000049665.1 SMESG000049663.1 SMESG000049647.1 SMESG000049621.1 SMESG000049614.1 SMESG000049601.1 SMESG000049567.1 SMESG000049548.1 SMESG000040301.1 SMESG000040257.1 SMESG000032755.1 SMESG000032715.1 SMESG000022696.1 SMESG000022691.1 SMESG000022676.1 SMESG000022665.1 SMESG000022640.1 SMESG000022619.1 SMESG000022612.1 dd_Smed_v4_490_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021903SMED30021903SMESG000040469.1 dd_Smed_v4_10729_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023059EF-hand calcium-binding domain-containing protein 6SMESG000052556.1 SMESG000052552.1 dd_Smed_v4_7065_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026782Cilia-and flagella-associated protein 58SMESG000061980.1 dd_Smed_v4_5727_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022295SMED30022295SMESG000021912.1 dd_Smed_v4_9758_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033164Heat shock 70 kDa proteinSMESG000041117.1 dd_Smed_v4_1378_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025688Protein tilB homologSMESG000058220.1 dd_Smed_v4_10124_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029492KN motif and ankyrin repeat domain-containing protein 4 isoform X2SMESG000059500.1 dd_Smed_v4_7499_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020941beta 1,3 galactosyltransferase-1SMESG000008720.1 dd_Smed_v4_10927_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029206ANK_REP_REGION domain-containing proteinSMESG000017292.1 dd_Smed_v4_5280_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034173Calcium-dependent protein kinaseSMESG000033648.1 dd_Smed_v4_13677_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022225Bidirectional sugar transporter SWEETSMESG000012540.1 dd_Smed_v4_12308_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022443Ankyrin repeat proteinSMESG000009520.1 SMESG000009519.1 dd_Smed_v4_9418_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029711SMED30029711SMESG000039803.1 dd_Smed_v4_3788_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029711SMED30029711SMESG000039804.1 dd_Smed_v4_5259_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031822SMED30031822SMESG000077258.1 dd_Smed_v4_8993_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034660Spectrin beta chain, non-erythrocytic 5SMESG000023006.1 dd_Smed_v4_2514_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032094RIIa domain-containing protein 1SMESG000079320.1 dd_Smed_v4_4716_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023708ZFP-1SMESG000066384.1 dd_Smed_v4_8720_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025623SMED30025623SMESG000065670.1 dd_Smed_v4_10718_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034675Sphingomyelin synthase-related protein 1SMESG000049879.1 SMESG000003119.1 dd_Smed_v4_11976_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032797DnaJ homolog subfamily A member 1SMESG000012107.1 dd_Smed_v4_147_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032947cilia- and flagella-associated protein 46SMESG000014116.1 SMESG000014118.1 dd_Smed_v4_14103_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027596RNA-binding protein pno1SMESG000015341.1 dd_Smed_v4_1077_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030306ABC transporter domain-containing proteinSMESG000058880.1 SMESG000039065.1 dd_Smed_v4_4225_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027213Solute carrier family 49 member 3SMESG000032659.1 dd_Smed_v4_5238_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026457Fumarate hydratase, class ISMESG000075499.1 SMESG000009591.1 dd_Smed_v4_2405_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031745Fatty-acid amide hydrolase 1-likeSMESG000034791.1 dd_Smed_v4_4966_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031219deleted in lung and esophageal cancer protein 1SMESG000079694.1 dd_Smed_v4_10833_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035194DnaJ-like subfamily C member 27SMESG000071551.1 dd_Smed_v4_11963_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30024160SMED30024160SMESG000046560.1 SMESG000010944.1 dd_Smed_v4_142_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035584Stabilizer of axonemal microtubules 2SMESG000009389.1 dd_Smed_v4_3695_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033864pim-3SMESG000014593.1 dd_Smed_v4_6420_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026134SMED30026134SMESG000023123.1 dd_Smed_v4_9554_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026134SMED30026134SMESG000023123.1 dd_Smed_v4_8764_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025832SMED30025832SMESG000001878.1 dd_Smed_v4_714_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023266cilia- and flagella-associated protein 43SMESG000000491.1 dd_Smed_v4_10271_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008732SMED30008732SMESG000064322.1 dd_Smed_v4_4685_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005158WD_REPEATS_REGION domain-containing proteinSMESG000071691.1 dd_Smed_v4_6137_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014968CRAL-TRIO domain-containing proteinSMESG000009877.1 dd_Smed_v4_6149_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012198UPF0764 protein C16orf89 homolog isoform X3SMESG000053422.1 dd_Smed_v4_4213_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012160SMED30012160SMESG000069851.1 dd_9493dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
pharynxSMED30012160SMED30012160SMESG000069851.1 dd_Smed_v4_9493_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004855Glutaredoxin-1SMESG000053749.1 dd_Smed_v4_4565_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011084Epidermal growth factor receptor kinase substrate 8SMESG000070650.1 dd_Smed_v4_4256_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015563Meiosis expressed protein 1SMESG000031493.1 dd_Smed_v4_4620_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009297kinesin light chainSMESG000007554.1 dd_Smed_v4_6239_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019584Ventral anterior homeobox 1SMESG000055068.1 dd_Smed_v4_49879_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009214SMED30009214SMESG000073871.1 dd_Smed_v4_5756_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007879SMED30007879SMESG000014356.1 dd_Smed_v4_4641_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015955Growth arrest-specific protein 8SMESG000013356.1 dd_Smed_v4_2848_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017636Calsyntenin 1SMESG000068054.1 dd_Smed_v4_4147_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001347SMED30001347SMESG000053274.1 dd_Smed_v4_6857_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013676nesprin-1-likeSMESG000016747.1 SMESG000016745.1 dd_Smed_v4_5365_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006931SMED30006931SMESG000040565.1 dd_Smed_v4_4660_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002822RING-type domain-containing proteinSMESG000076482.1 SMESG000076470.1 SMESG000076469.1 SMESG000076410.1 SMESG000076409.1 SMESG000076408.1 SMESG000076407.1 SMESG000076406.1 SMESG000076390.1 SMESG000076389.1 SMESG000076385.1 SMESG000076375.1 SMESG000076371.1 SMESG000076363.1 SMESG000076358.1 SMESG000076223.1 SMESG000040665.1 dd_Smed_v4_645_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001237Tubulin polymerization-promoting protein family member 3SMESG000002261.1 dd_Smed_v4_650_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000891SMED30000891SMESG000008013.1 dd_Smed_v4_5606_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012546Coiled-coil domain-containing protein 65SMESG000021331.1 dd_Smed_v4_6152_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010461Dynamin-binding proteinSMESG000001434.1 dd_Smed_v4_16150_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014219cilia- and flagella-associated protein 99SMESG000025927.1 dd_Smed_v4_8538_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018436SMED30018436SMESG000063104.1 dd_Smed_v4_16103_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013374Transmembrane protein 232SMESG000060638.1 dd_Smed_v4_15138_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009834TNF receptor-associated factorSMESG000047296.1 dd_Smed_v4_2916_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017714Basement membrane-specific heparan sulfate proteoglycan core proteinSMESG000075928.1 dd_8356dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
pharynxSMED30017180Dynein regulatory complex protein 1SMESG000072168.1 dd_Smed_v4_8761_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020215AnnexinSMESG000030132.1 dd_Smed_v4_1735_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023017SMED30023017SMESG000065348.1 dd_1320dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
pharynxSMED30023017SMED30023017SMESG000065348.1 dd_Smed_v4_1320_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032581Protein elav-like proteinSMESG000073310.1 dd_Smed_v4_13151_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029033SMED30029033SMESG000067215.1 dd_Smed_v4_14329_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031175SMED30031175SMESG000064100.1 SMESG000064099.1 dd_Smed_v4_14322_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020260SMED30020260SMESG000005697.1 dd_Smed_v4_12813_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022030EGR-like protein 1SMESG000000960.1 dd_Smed_v4_7731_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022030EGR-like protein 1SMESG000000959.1 dd_Smed_v4_12410_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027376SMED30027376SMESG000007018.1 SMESG000007017.1 dd_Smed_v4_1969_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027376SMED30027376SMESG000007017.1 dd_Smed_v4_7377_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029471Collagen alpha-1(XXVIII) chainSMESG000033673.1 dd_Smed_v4_1071_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029471Collagen alpha-1(XXVIII) chainSMESG000033673.1 dd_1071dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
pharynxSMED30035563Tripartite motif-containing protein 2SMESG000037506.1 dd_Smed_v4_13659_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025309Dimer_Tnp_hAT domain-containing proteinSMESG000066861.1 SMESG000059630.1 SMESG000066862.1 dd_Smed_v4_6647_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028898BZIP domain-containing proteinSMESG000067543.1 dd_Smed_v4_1399_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023540Serine/threonine-protein phosphatase 2B catalytic subunitSMESG000064848.1 dd_Smed_v4_2045_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30024390Synaptotagmin like 4SMESG000042371.1 dd_Smed_v4_7945_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021940SMED30021940SMESG000017261.1 dd_Smed_v4_2030_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034953SMED30034953SMESG000065075.1 dd_Smed_v4_102_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033145Protein kinase domain-containing proteinSMESG000026756.1 dd_Smed_v4_11663_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30024663Dynein regulatory complex subunit 3SMESG000047633.1 SMESG000047632.1 dd_Smed_v4_12541_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028653IQ domain-containing protein HSMESG000037909.1 dd_Smed_v4_10544_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035963SMED30035963SMESG000071278.1 dd_Smed_v4_1649_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30024770SMED30024770SMESG000035481.1 dd_Smed_v4_7894_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025680Anosmin-1SMESG000033070.1 dd_Smed_v4_13188_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021479SMED30021479SMESG000017261.1 dd_Smed_v4_2030_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021297Disks large homolog 1SMESG000020502.1 dd_Smed_v4_3493_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021467SMED30021467SMESG000013722.1 dd_Smed_v4_1742_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022717SMED30022717SMESG000005697.1 dd_Smed_v4_12813_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022312COesterase domain-containing proteinSMESG000064723.1 dd_Smed_v4_18958_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035723nesprin-1-likeSMESG000023320.1 dd_Smed_v4_10282_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035723nesprin-1-likeSMESG000023320.1 dd_Smed_v4_20344_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023748SMED30023748SMESG000022731.1 dd_Smed_v4_13297_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025310SMED30025310SMESG000050440.1 dd_Smed_v4_1552_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029603SMED30029603SMESG000071278.1 dd_Smed_v4_1649_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033541SMED30033541SMESG000061837.1 dd_Smed_v4_14985_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032821SMED30032821SMESG000026756.1 dd_Smed_v4_11663_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027707S-adenosylmethionine synthaseSMESG000027587.1 dd_Smed_v4_1580_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028343Cytosolic carboxypeptidase 2SMESG000006325.1 dd_Smed_v4_13454_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032202Doublecortin domain-containing proteinSMESG000017756.1 dd_Smed_v4_11770_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022370Calcium-activated potassium channel slo-1, putativeSMESG000049145.1 dd_Smed_v4_12503_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013975Ras association domain-containing protein 1SMESG000029652.1 dd_Smed_v4_5323_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005191Phospholipid scramblaseSMESG000050656.1 dd_Smed_v4_6444_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011708Neural cell adhesion molecule 1SMESG000077686.1 dd_Smed_v4_3768_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017663Fer-1-relatedSMESG000070967.1 dd_Smed_v4_4648_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013149MIEAP domain-containing proteinSMESG000019081.1 dd_Smed_v4_6321_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008334SMED30008334SMESG000068935.1 dd_Smed_v4_357_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017854SMED30017854SMESG000014767.1 dd_Smed_v4_75560_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015948SMED30015948SMESG000042166.1 dd_Smed_v4_4173_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017321Mitochondria localized glutamic acid rich proteinSMESG000000761.1 dd_Smed_v4_6622_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004118Tubulin beta chainSMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044888.1 SMESG000035755.1 dd_Smed_v4_83_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011798E3 ubiquitin-protein ligase MIB2SMESG000043477.1 SMESG000010549.1 SMESG000010347.1 SMESG000010327.1 dd_Smed_v4_593_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012361SMED30012361SMESG000010680.1 dd_Smed_v4_3652_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006884Protein dpy-30-likeSMESG000008786.1 dd_Smed_v4_9103_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000671Fibronectin type III domain proteinSMESG000043560.1 dd_Smed_v4_33732_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015890Protein lethal(2) giant larvaeSMESG000072512.1 dd_Smed_v4_7127_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014791adenylate kinase 8-likeSMESG000027219.1 dd_Smed_v4_7317_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003738hadrianSMESG000043826.1 SMESG000043821.1 dd_Smed_v4_3606_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012487SMED30012487SMESG000009419.1 dd_Smed_v4_5926_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008926ATP-dependent DNA helicaseSMESG000023939.1 dd_Smed_v4_6024_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001043SMED30001043SMESG000036225.1 dd_Smed_v4_372_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009268SMED30009268SMESG000065344.1 dd_Smed_v4_3354_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015316Cell division control protein 42 homologSMESG000056490.1 dd_Smed_v4_8621_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007886SMED30007886SMESG000055169.1 dd_Smed_v4_9583_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001980Protein phosphatase 1KSMESG000008048.1 dd_Smed_v4_3067_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013808fos-1SMESG000003328.1 dd_Smed_v4_2789_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012017SMED30012017SMESG000022399.1 dd_Smed_v4_708_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017476Intraflagellar transport protein 57SMESG000013668.1 dd_Smed_v4_7099_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012572Leucine--tRNA ligaseSMESG000071689.1 dd_Smed_v4_9705_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009962Lysosomal acid phosphataseSMESG000074242.1 SMESG000074232.1 dd_Smed_v4_6931_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019455LIM domain-containing proteinSMESG000066861.1 SMESG000059630.1 SMESG000066862.1 dd_Smed_v4_6647_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004085hypothetical proteinSMESG000038086.1 dd_Smed_v4_5639_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005253EF-hand domain-containing family member C2SMESG000076759.1 dd_Smed_v4_6035_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013379IQ motif containing GSMESG000075453.1 dd_Smed_v4_7221_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015650FGFR1 oncogene partnerSMESG000006505.1 dd_Smed_v4_5371_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013026SMED30013026SMESG000076398.1 dd_Smed_v4_8984_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006263SMED30006263SMESG000056319.1 SMESG000056318.1 SMESG000022275.1 dd_Smed_v4_674_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006263SMED30006263SMESG000056318.1 dd_Smed_v4_2292_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012665FERM domain-containing proteinSMESG000062741.1 SMESG000053535.1 SMESG000049374.1 SMESG000033049.1 SMESG000024644.1 SMESG000016667.1 dd_Smed_v4_6227_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011296SMED30011296SMESG000047291.1 SMESG000047284.1 SMESG000046374.1 SMESG000044888.1 SMESG000035755.1 dd_Smed_v4_83_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013563Serine/threonine-protein kinase 10SMESG000064983.1 dd_Smed_v4_5720_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED300120465'-AMP-activated protein kinase subunit beta-1SMESG000037698.1 dd_Smed_v4_6112_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001834SMED30001834SMESG000068935.1 dd_Smed_v4_357_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014133EF-hand calcium-binding domain-containing protein 10-likeSMESG000023074.1 dd_Smed_v4_6477_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016902CRAL-TRIO domain-containing proteinSMESG000009876.1 dd_Smed_v4_2760_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005744FGFR1 oncogene partnerSMESG000006505.1 dd_Smed_v4_5371_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010520SMED30010520SMESG000066861.1 SMESG000059630.1 SMESG000066862.1 dd_Smed_v4_6647_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032324SMED30032324SMESG000079516.1 dd_Smed_v4_8794_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021941SMED30021941SMESG000051593.1 dd_Smed_v4_9206_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031446Neuronal guanine nucleotide exchange factorSMESG000003812.1 dd_Smed_v4_5524_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027239Tetratricopeptide repeat protein 30ASMESG000024323.1 dd_Smed_v4_8798_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021589Agrin, putativeSMESG000028865.1 SMESG000028859.1 dd_Smed_v4_3649_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026726RING domain ligase2 isoform 3SMESG000003596.1 dd_Smed_v4_5871_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026726RING domain ligase2 isoform 3SMESG000003596.1 dd_Smed_v4_6423_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020686Transmembrane protein 80SMESG000018777.1 dd_Smed_v4_13318_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031491Armadillo repeat containing 4SMESG000057827.1 dd_Smed_v4_5065_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027186SMED30027186SMESG000022949.1 dd_Smed_v4_14572_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029361KIF3B-like proteinSMESG000075065.1 dd_Smed_v4_4343_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029361KIF3B-like proteinSMESG000020245.1 dd_Smed_v4_9308_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034323Ras family proteinSMESG000053083.1 dd_Smed_v4_11357_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027542CRAL-TRIO domain-containing proteinSMESG000019717.1 dd_Smed_v4_1619_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30024396Centrosomal protein 295SMESG000023095.1 dd_Smed_v4_17079_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30024396Centrosomal protein 295SMESG000023095.1 dd_Smed_v4_11068_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021613Nesprin-1SMESG000077685.1 dd_Smed_v4_15904_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021613Nesprin-1SMESG000077685.1 dd_Smed_v4_10214_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035090SMED30035090SMESG000005437.1 dd_Smed_v4_10052_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027035Pseudouridine synthaseSMESG000051935.1 dd_Smed_v4_12745_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021505Serpin B6SMESG000032448.1 SMESG000032440.1 SMESG000032430.1 dd_Smed_v4_1741_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029927SMED30029927SMESG000052080.1 dd_Smed_v4_14074_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020398Kinesin-like proteinSMESG000007019.1 dd_Smed_v4_10965_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020574Dynein heavy chain axonemalSMESG000017294.1 dd_Smed_v4_6790_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026699Zinc finger protein 474SMESG000009204.1 dd_Smed_v4_14765_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026702SMED30026702SMESG000038479.1 SMESG000038478.1 dd_Smed_v4_1931_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025517PhosphodiesteraseSMESG000044149.1 dd_Smed_v4_15950_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025696Carbonic anhydraseSMESG000035022.1 dd_Smed_v4_10041_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022414SMED30022414SMESG000076482.1 SMESG000076409.1 SMESG000076405.1 SMESG000076390.1 SMESG000076375.1 SMESG000076364.1 SMESG000076223.1 SMESG000040665.1 SMESG000019753.1 dd_Smed_v4_1097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022414SMED30022414SMESG000076482.1 SMESG000076470.1 SMESG000076469.1 SMESG000076410.1 SMESG000076409.1 SMESG000076408.1 SMESG000076407.1 SMESG000076406.1 SMESG000076390.1 SMESG000076389.1 SMESG000076385.1 SMESG000076375.1 SMESG000076371.1 SMESG000076363.1 SMESG000076358.1 SMESG000076223.1 SMESG000040665.1 dd_Smed_v4_645_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020814SMED30020814SMESG000076482.1 SMESG000076409.1 SMESG000076405.1 SMESG000076390.1 SMESG000076375.1 SMESG000076364.1 SMESG000076223.1 SMESG000040665.1 SMESG000019753.1 dd_Smed_v4_1097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022344FERM domain containing-1SMESG000070273.1 dd_Smed_v4_1131_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022681Dynein heavy chain 7 axonemalSMESG000012956.1 dd_Smed_v4_5350_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022681Dynein heavy chain 7 axonemalSMESG000012956.1 dd_Smed_v4_13792_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30024121TetraspaninSMESG000023248.1 dd_Smed_v4_1808_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028103SMED30028103SMESG000081188.1 dd_Smed_v4_11827_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026124Dynein heavy chain, axonemalSMESG000040511.1 dd_Smed_v4_6557_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026124Dynein heavy chain, axonemalSMESG000040511.1 SMESG000040510.1 SMESG000040507.1 dd_Smed_v4_10846_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020537SMED30020537SMESG000040594.1 dd_Smed_v4_1676_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028489START domain-containing proteinSMESG000028630.1 dd_Smed_v4_3237_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028489START domain-containing proteinSMESG000078713.1 SMESG000060505.1 SMESG000055485.1 SMESG000051367.1 SMESG000073216.1 SMESG000045326.1 SMESG000032032.1 SMESG000021912.1 SMESG000017091.1 dd_Smed_v4_12660_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026336Beta-hexosaminidaseSMESG000008181.1 dd_Smed_v4_12408_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021685Bestrophin homologSMESG000070057.1 dd_Smed_v4_8073_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025152cilia- and flagella-associated protein 91SMESG000056200.1 dd_Smed_v4_9724_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025152cilia- and flagella-associated protein 91SMESG000056200.1 dd_Smed_v4_10405_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000653Kaptin (actin binding protein)SMESG000076606.1 dd_Smed_v4_8156_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004754RNA-binding protein 8ASMESG000051885.1 dd_Smed_v4_1169_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016875Rho-associated kinaseSMESG000057753.1 dd_Smed_v4_2914_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003902Tetratricopeptide repeat protein 21BSMESG000011579.1 dd_Smed_v4_12056_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001580Serine/threonine-protein kinase PDIK1LSMESG000059621.1 dd_Smed_v4_9834_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008055Transient receptor potential cation channel subfamily M memberSMESG000068518.1 dd_Smed_v4_10717_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017410Peptidoglycan-recognition proteinSMESG000004536.1 dd_Smed_v4_817_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008862Transmembrane protein 17SMESG000050386.1 dd_Smed_v4_10264_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004930Irregular chiasm C-roughest-like isoform X2SMESG000077979.1 dd_Smed_v4_12549_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018893Enkurin domain-containing proteinSMESG000081414.1 dd_Smed_v4_12339_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3001369960S ribosomal protein L9SMESG000003774.1 dd_Smed_v4_150_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015209Calcyphosin proteinSMESG000005291.1 dd_Smed_v4_7209_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019729Bestrophin homologSMESG000070057.1 dd_Smed_v4_8073_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3001927340S ribosomal protein S3aSMESG000066540.1 SMESG000066537.1 dd_Smed_v4_163_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003468Phosphoenolpyruvate carboxykinase [GTP]SMESG000073058.1 SMESG000003144.1 dd_Smed_v4_536_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016010SMED30016010SMESG000042231.1 dd_Smed_v4_10980_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008915SMED30008915SMESG000002588.1 dd_Smed_v4_10456_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018730SOCS box domain-containing proteinSMESG000001445.1 SMESG000001437.1 dd_Smed_v4_9937_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018999SMED30018999SMESG000058251.1 dd_Smed_v4_10158_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006652dynein heavy chain 6, axonemalSMESG000004477.1 SMESG000004475.1 dd_Smed_v4_10969_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019774SMED30019774SMESG000065670.1 dd_Smed_v4_10718_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000819Acid sphingomyelinase-like phosphodiesteraseSMESG000071517.1 dd_Smed_v4_5377_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009282EF-hand calcium binding domain 2SMESG000049879.1 SMESG000003119.1 dd_Smed_v4_11976_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011832Enkurin domain-containing proteinSMESG000081414.1 dd_Smed_v4_12339_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014724Tetraspanin-CD63 receptorSMESG000041117.1 dd_Smed_v4_1378_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019401Spermatogenesis-associated 17SMESG000047741.1 dd_Smed_v4_6435_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011727Dedicator of cytokinesis 4bSMESG000063593.1 SMESG000063592.1 SMESG000063595.1 dd_Smed_v4_6156_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013445TetraspaninSMESG000063435.1 dd_Smed_v4_389_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000794Luc7-like protein 3SMESG000041410.1 dd_Smed_v4_1899_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013590Protein FAM221BSMESG000035378.1 dd_Smed_v4_10703_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018495ATPase_AAA_core domain-containing proteinSMESG000073596.1 dd_Smed_v4_9568_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018495ATPase_AAA_core domain-containing proteinSMESG000073596.1 dd_Smed_v4_9484_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018550CEP78SMESG000064712.1 dd_Smed_v4_9671_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009231Transmembrane proteinSMESG000002927.1 dd_Smed_v4_16643_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009231Transmembrane proteinSMESG000002927.1 dd_Smed_v4_12002_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014184Tumor necrosis factor alpha-induced protein 8-like proteinSMESG000002914.1 dd_Smed_v4_2386_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018823ATP-dependent 6-phosphofructokinaseSMESG000029088.1 dd_Smed_v4_1604_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001414UPF0728 protein C10orf53 homologSMESG000073355.1 dd_Smed_v4_10501_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000376dynein heavy chain domain-containing protein 1-likeSMESG000076398.1 dd_Smed_v4_8984_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005171SMED30005171SMESG000024345.1 dd_Smed_v4_629_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED300163635'-nucleotidase proteinSMESG000032250.1 dd_Smed_v4_3474_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016516Protein diaphanous homolog 2SMESG000057806.1 dd_Smed_v4_2533_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013441WD repeat domain 78SMESG000047563.1 dd_Smed_v4_8721_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017260Pre mRNA processing factor 6SMESG000011657.1 dd_Smed_v4_1153_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017943SMED30017943SMESG000022837.1 dd_Smed_v4_16017_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014544Dynein light chainSMESG000067731.1 dd_Smed_v4_11037_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027133SMED30027133SMESG000018390.1 dd_Smed_v4_42506_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026449Kinase-like domain-containing proteinSMESG000074921.1 SMESG000074915.1 dd_Smed_v4_1634_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031490SMED30031490SMESG000017778.1 dd_Smed_v4_10175_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020784SMED30020784SMESG000011782.1 dd_Smed_v4_10359_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022383TNF receptor-associated factorSMESG000047778.1 dd_Smed_v4_3201_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021167SMED30021167SMESG000035386.1 dd_Smed_v4_10651_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031336MusashiSMESG000071202.1 dd_Smed_v4_7323_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027428forkhead box A-1SMESG000065670.1 dd_Smed_v4_10718_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029097Neuropeptide-1SMESG000024498.1 dd_Smed_v4_2575_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
pharynxSMED30031687TNF receptor-associated factorSMESG000014725.1 SMESG000014724.1 SMESG000014706.1 SMESG000014702.1 SMESG000014700.1 dd_Smed_v4_4420_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020257DUF3421 domain-containing proteinSMESG000046742.1 dd_Smed_v4_1040_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023490SMED30023490SMESG000076531.1 dd_Smed_v4_7027_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021812Dolichol kinase-like ProteinSMESG000022975.1 dd_Smed_v4_7896_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031645General transcription factor II-I repeat domain-containing 2A-like proteinSMESG000062458.1 dd_Smed_v4_5420_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016832SH3 domain-binding protein 5-likeSMESG000022856.1 Contig4742newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30016832SH3 domain-binding protein 5-likeSMESG000022856.1 Contig4742uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30016022SMED30016022SMESG000053405.1 Contig1766newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30016022SMED30016022SMESG000053405.1 Contig1766uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30016022SMED30016022SMESG000046314.1 SMESG000028362.1 Contig1766newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30016022SMED30016022SMESG000046314.1 SMESG000028362.1 Contig1766uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30015161Vacuolar protein sorting-associated protein 45SMESG000053405.1 Contig1766GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30015161Vacuolar protein sorting-associated protein 45SMESG000046314.1 SMESG000028362.1 Contig1766GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30014138LIM homeobox 1bSMESG000061052.1 Contig4742GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30014138LIM homeobox 1bSMESG000022856.1 Contig4742GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30005012SMED30005012 Contig1286newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30002222SMED30002222 Contig7536newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30002222SMED30002222 Contig7536uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30032408SMED30032408SMESG000027686.1 Contig2364newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30032408SMED30032408SMESG000012131.1 SMESG000012127.1 Contig2364newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30017282nuclear factor Y complex B2SMESG000040141.1 KU366700smed_ncbi_20200123PMID:27304889
Iyer et al., 2016
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
pharynxSMED30019722secreted frizzled related protein 3SMESG000058717.1 HM751832.1smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30022468secreted frizzled-related protein 1SMESG000075831.1 SMESG000029446.1 EU296635smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30022468secreted frizzled-related protein 1SMESG000075831.1 SMESG000029446.1 ABY85212.1smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30022929WntASMESG000051375.1 FJ463750.1smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30022929WntASMESG000051375.1 ACJ64865.1smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30022929WntASMESG000051375.1 FJ463750smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30025497secreted frizzled related protein 2SMESG000050379.1 ADO51625.1smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30001081NudC nuclear distribution proteinSMESG000036795.1 DN303982.1ncbi_smed_estsPMID:22411224
Cowles et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30016141lissencephaly-1SMESG000054739.1 SMESG000035997.1 JQ650355.1smed_ncbi_20200123PMID:22411224
Cowles et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30020436Nuclear distribution protein nudE-like 1SMESG000016071.1 HO006501.1ncbi_smed_estsPMID:22411224
Cowles et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30004930Irregular chiasm C-roughest-like isoform X2SMESG000077979.1 dd_Smed_v4_12549_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30001690SMED30001690SMESG000069322.1 dd_Smed_v4_12571_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30000553Epithelial discoidin domain-containing receptorSMESG000069322.1 dd_Smed_v4_12571_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30013316Polycomb group RING finger protein 1SMESG000072501.1 dd_Smed_v4_12753_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30033884FERM, RhoGEF and pleckstrin domain-containing protein 1SMESG000069407.1 dd_Smed_v4_12715_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30025810SMED30025810SMESG000019718.1 dd_Smed_v4_2749_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30005718Guanine nucleotide-binding protein G(I) subunit alphaSMESG000026774.1 Gpassmed_ncbi_20200123PMID:24992682
Vásquez-Doorman et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30005045zinc finger protein ASMESG000022958.1 dd_Smed_v4_22585_0_1dd_Smed_v4PMID:24992682
Vásquez-Doorman et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30005045zinc finger protein ASMESG000022958.1 KF751216.1smed_ncbi_20200123PMID:24992682
Vásquez-Doorman et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30020522ap2SMESG000022356.1 JX010470.1smed_ncbi_20200123PMID:24992682
Vásquez-Doorman et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30031425Homeobox protein Hox-D12SMESG000003389.1 SMED30031425smed_20140614PMID:27034770
Currie et al., 2016
whole organism asexual adult fluorescence in situ hybridization evidence
pharynxSMED30024673SMED30024673SMESG000067310.1 SmedASXL_065556SmedAsxl_ww_GCZZ01PMID:29158443
He et al., 2017
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30022468secreted frizzled-related protein 1SMESG000075831.1 SMESG000029446.1 EU296635smed_ncbi_20200123PMID:25558068
Reuter et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30029487Smed-NDKSMESG000062038.1 GU592830.1smed_ncbi_20200123PMID:25558068
Reuter et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30016511SMED30016511SMESG000072006.1 tr5_6444mu_Smed_v1PMID:25558068
Reuter et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30013810TeashirtSMESG000008973.1 KP003815.1smed_ncbi_20200123PMID:25558068
Reuter et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
pharynxSMED30022963anaphase-promoting complex subunit 1SMESG000010770.1 SMESG000012375.1 tr5_7361mu_Smed_v1PMID:25558068
Reuter et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30034772Fibrillar collagen NC1 domain-containing proteinSMESG000077977.1 tr5_2051mu_Smed_v1PMID:25558068
Reuter et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30005458Phosphatidylinositol 4-kinase type 2-betaSMESG000074718.1 tr5_11049mu_Smed_v1PMID:25558068
Reuter et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30012814Protein CWC15-like proteinSMESG000010770.1 SMESG000012375.1 tr5_7361mu_Smed_v1PMID:25558068
Reuter et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30018250Telomerase-binding protein EST1A tr5_9369mu_Smed_v1PMID:25558068
Reuter et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30013810TeashirtSMESG000008973.1 KP003815.1smed_ncbi_20200123PMID:25725068
Owen et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
pharynxSMED30007744SMED-SMAD6/7-1SMESG000002697.1 dd_Smed_v4_9186_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007804Immunoglobulin-like domain-containing proteinSMESG000010356.1 dd_Smed_v4_1827_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002988Bestrophin homologSMESG000030927.1 dd_Smed_v4_14800_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004559CULT domain-containing proteinSMESG000077110.1 SMESG000077108.1 dd_Smed_v4_11915_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008080Transmembrane protein 45BSMESG000060226.1 SMESG000021986.1 dd_Smed_v4_1542_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004498SMED30004498SMESG000035916.1 dd_Smed_v4_13051_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED300050684-coumarate--CoA ligase 2SMESG000064101.1 dd_Smed_v4_6511_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000831Golgi-associated plant pathogenesis protein 1SMESG000036937.1 dd_Smed_v4_2081_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001071Low density lipoprotein-receptor, class A,domain-containing proteinSMESG000037863.1 dd_Smed_v4_12756_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001929F-box domain-containing proteinSMESG000077869.1 dd_Smed_v4_14890_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004582SMED30004582SMESG000035916.1 dd_Smed_v4_13051_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003093SMED30003093SMESG000056847.1 SMESG000056843.1 SMESG000056838.1 SMESG000044770.1 SMESG000044762.1 SMESG000007140.1 dd_Smed_v4_1137_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002145HEAT repeat-containing protein 4SMESG000024853.1 SMESG000024852.1 dd_Smed_v4_16127_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002139Vacuole membrane protein 1SMESG000034612.1 dd_Smed_v4_1156_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005771SMED30005771SMESG000042003.1 dd_Smed_v4_12482_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001056AcetylCoA_hyd_C domain-containing proteinSMESG000063866.1 dd_Smed_v4_1775_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001031TRAF3-interacting protein 1SMESG000006345.1 dd_Smed_v4_10562_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013692Small HSP proteinSMESG000059879.1 SMESG000059868.1 SMESG000059853.1 dd_Smed_v4_1039_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003944EF-hand domain family, member D1SMESG000009754.1 dd_Smed_v4_1467_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020508SMED30020508SMESG000021243.1 dd_Smed_v4_12661_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011615SMED30011615SMESG000036524.1 dd_Smed_v4_11034_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013095DDE_Tnp_1_7 domain-containing proteinSMESG000080622.1 SMESG000068757.1 SMESG000055125.1 SMESG000038294.1 SMESG000032747.1 SMESG000023322.1 dd_Smed_v4_3830_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000132SMED30000132SMESG000017239.1 dd_Smed_v4_4431_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004519Novel proteinSMESG000039682.1 dd_Smed_v4_2676_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001147Ras-like GTP-binding protein YPT1SMESG000044147.1 dd_Smed_v4_6181_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008007Discoidin domain-containing receptor 2SMESG000066441.1 dd_Smed_v4_6578_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007243Polypeptide N-acetylgalactosaminyltransferaseSMESG000081451.1 dd_Smed_v4_5333_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014310ANK_REP_REGION domain-containing proteinSMESG000055419.1 dd_Smed_v4_13629_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014612SMED30014612SMESG000047053.1 dd_Smed_v4_7303_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015703IQ domain-containing protein DSMESG000017912.1 dd_Smed_v4_7079_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009212Ferric-chelate reductase 1SMESG000061404.1 dd_Smed_v4_8497_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018451Lipopolysaccharide-induced TNF-alpha factorSMESG000020870.1 SMESG000046087.1 SMESG000046084.1 dd_Smed_v4_2768_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004518Dynein assembly factor with WDR repeat domains 1SMESG000008529.1 SMESG000008519.1 dd_Smed_v4_4782_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013013Guanine nucleotide-binding protein subunit betaSMESG000061733.1 dd_Smed_v4_3309_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018630High mobility group proteinSMESG000052032.1 dd_Smed_v4_1331_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009144CCDC66 domain-containing proteinSMESG000019367.1 dd_Smed_v4_11800_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000950slc16a-22SMESG000077590.1 dd_Smed_v4_6317_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015945Centrin-1SMESG000052182.1 SMESG000015458.1 dd_Smed_v4_3644_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018224Adenylate kinaseSMESG000077377.1 SMESG000076900.1 SMESG000063429.1 SMESG000060686.1 SMESG000043019.1 SMESG000031308.1 SMESG000028811.1 SMESG000023833.1 SMESG000023573.1 SMESG000019820.1 SMESG000011532.1 SMESG000052813.1 dd_Smed_v4_1229_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007568NADH-ubiquinone oxidoreductase 75 kDa subunit, mitochondrialSMESG000081864.1 dd_Smed_v4_2402_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016654Intraflagellar transport protein 140SMESG000001316.1 dd_Smed_v4_11300_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011561SMED30011561SMESG000066396.1 dd_Smed_v4_7890_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013183zf-3CxxC domain-containing proteinSMESG000033796.1 dd_Smed_v4_4477_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017971ANK_REP_REGION domain-containing proteinSMESG000026132.1 dd_Smed_v4_6201_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000995Pyruvate kinaseSMESG000052083.1 SMESG000048475.1 dd_Smed_v4_605_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032906SMED30032906SMESG000022399.1 dd_Smed_v4_8295_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029999SMED30029999SMESG000017257.1 dd_Smed_v4_12708_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023022Protein transport protein Sec24CSMESG000060905.1 dd_Smed_v4_1764_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035571Protein disulfide-isomerase A5SMESG000005268.1 dd_Smed_v4_1537_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035571Protein disulfide-isomerase A5SMESG000005268.1 dd_Smed_v4_2070_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033909UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 4SMESG000066601.1 dd_Smed_v4_12354_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3003108940S ribosomal protein S12SMESG000052688.1 dd_Smed_v4_268_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021821Transient receptor potential cation channel subfamily M memberSMESG000078720.1 dd_Smed_v4_17981_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30036005Calcium-transporting ATPaseSMESG000050554.1 dd_Smed_v4_1772_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026979SMED30026979SMESG000076644.1 SMESG000076643.1 dd_Smed_v4_227_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025542Leucine-rich repeat-containing protein 71SMESG000006778.1 dd_Smed_v4_12043_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028668Leucine-rich repeat-containing protein 71SMESG000006778.1 dd_Smed_v4_12043_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026513SMED30026513SMESG000005268.1 dd_Smed_v4_1537_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027561SMED30027561SMESG000072848.1 dd_Smed_v4_11162_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032420SMED30032420SMESG000050229.1 SMESG000050221.1 dd_Smed_v4_1219_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031823Translocating chain-associated membrane proteinSMESG000051052.1 dd_Smed_v4_1740_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033335SMED30033335SMESG000002226.1 dd_Smed_v4_10738_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020664Potassium voltage-gated channel subfamily A member 2SMESG000028841.1 dd_Smed_v4_7533_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012075SMED30012075SMESG000059352.1 SMESG000059351.1 dd_Smed_v4_420_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018815Sperm flagellar protein 1SMESG000014677.1 dd_Smed_v4_5648_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016546SMED30016546SMESG000051921.1 SMESG000051913.1 dd_Smed_v4_1175_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011297SMED30011297SMESG000019881.1 dd_Smed_v4_4454_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008882Cilia and flagella associated protein 157SMESG000036345.1 dd_Smed_v4_9862_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003406Bestrophin homologSMESG000060552.1 dd_Smed_v4_4179_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011075SMED30011075SMESG000027616.1 dd_Smed_v4_6146_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010437Copper homeostasis protein CutCSMESG000016228.1 dd_Smed_v4_7302_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017953SMED30017953SMESG000011944.1 dd_Smed_v4_3820_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000048testis-expressed protein 43SMESG000012601.1 dd_Smed_v4_9820_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004395DENN domain-containing protein 11SMESG000068092.1 dd_Smed_v4_8805_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018560SMED30018560SMESG000004196.1 dd_Smed_v4_1162_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035813SMED30035813SMESG000004300.1 dd_Smed_v4_7960_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30024316RibokinaseSMESG000024727.1 dd_Smed_v4_3352_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032668Axonemal dynein light chain domain containing 1SMESG000011832.1 dd_Smed_v4_16309_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027392SMED30027392SMESG000074013.1 dd_Smed_v4_5067_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027593Protein polyglycylase TTLL10SMESG000042729.1 SMESG000042734.1 dd_Smed_v4_14858_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030054SMED30030054SMESG000031900.1 dd_Smed_v4_13724_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029489Serine/threonine-protein kinaseSMESG000041899.1 SMESG000031064.1 dd_Smed_v4_8347_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021059V(D)J recombination-activating protein 1SMESG000012339.1 dd_Smed_v4_11354_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30024475Si:ch211-106h4.9SMESG000026729.1 dd_Smed_v4_3756_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30024572SMED30024572SMESG000022691.1 SMESG000022690.1 dd_Smed_v4_2130_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025711G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000050757.1 dd_Smed_v4_23525_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021042Phosphoenolpyruvate synthaseSMESG000026514.1 dd_Smed_v4_2604_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30024579SJCHGC07397 proteinSMESG000050581.1 dd_Smed_v4_10396_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020913SMED30020913SMESG000009078.1 dd_Smed_v4_13484_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020133SMED30020133SMESG000023496.1 dd_Smed_v4_21951_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034315Adenylyl cyclase-associated proteinSMESG000032321.1 dd_Smed_v4_727_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033644titin homologSMESG000002539.1 dd_Smed_v4_8111_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030342RNA-binding protein 25SMESG000074815.1 dd_Smed_v4_7685_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021431TTF-type domain-containing proteinSMESG000080622.1 SMESG000068757.1 SMESG000055125.1 SMESG000038294.1 SMESG000032747.1 SMESG000023322.1 dd_Smed_v4_3830_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025062G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000018450.1 dd_Smed_v4_1699_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021404ALMS_motif domain-containing proteinSMESG000077136.1 dd_Smed_v4_5064_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021404ALMS_motif domain-containing proteinSMESG000077136.1 dd_Smed_v4_10880_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028115beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase 3SMESG000026549.1 dd_Smed_v4_10879_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029517SMED30029517SMESG000071450.1 dd_Smed_v4_3079_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025553Cell polarity proteinSMESG000027800.1 dd_Smed_v4_4789_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021837piggyBac transposable element-derived protein 4-likeSMESG000080622.1 SMESG000068757.1 SMESG000055125.1 SMESG000038294.1 SMESG000032747.1 SMESG000023322.1 dd_Smed_v4_3830_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031722ANK_REP_REGION domain-containing proteinSMESG000022931.1 dd_Smed_v4_11187_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029350Serine incorporator 3SMESG000020805.1 dd_Smed_v4_1130_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022844NEPH-3SMESG000022777.1 dd_Smed_v4_11280_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029802MKS transition zone complex subunit 1SMESG000058562.1 dd_Smed_v4_14053_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED300212652-acylglycerol O-acyltransferase 2SMESG000052656.1 dd_Smed_v4_6550_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017846Serpin family proteinSMESG000032448.1 SMESG000032440.1 SMESG000032430.1 dd_Smed_v4_1741_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000158Dipeptidyl peptidase 3SMESG000079740.1 dd_Smed_v4_1031_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010632E3 ubiquitin-protein ligase RGLG4SMESG000076482.1 SMESG000076409.1 SMESG000076405.1 SMESG000076390.1 SMESG000076375.1 SMESG000076364.1 SMESG000076223.1 SMESG000040665.1 SMESG000019753.1 dd_Smed_v4_1097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009224early growth response-3SMESG000000959.1 dd_Smed_v4_12410_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009224early growth response-3SMESG000000959.1 dd_Smed_v4_14711_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007107SMED30007107SMESG000050890.1 dd_Smed_v4_1847_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009436SMED30009436SMESG000077535.1 dd_Smed_v4_18415_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014199MyosinSMESG000047361.1 dd_Smed_v4_4503_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016673Cylindromatosis (turban tumor syndrome), bSMESG000056847.1 SMESG000056843.1 SMESG000056838.1 SMESG000044770.1 SMESG000044762.1 SMESG000007140.1 dd_Smed_v4_1137_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008650Beta-hexosaminidaseSMESG000008181.1 dd_Smed_v4_12408_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010024SMED30010024SMESG000038072.1 dd_Smed_v4_13847_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009121Galectin domain-containing proteinSMESG000022399.1 dd_Smed_v4_10749_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007557DUF4515 domain-containing proteinSMESG000013289.1 dd_Smed_v4_13384_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008113nicolin-1SMESG000079687.1 SMESG000054751.1 dd_Smed_v4_11961_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016116Sodium/hydrogen exchangerSMESG000006858.1 dd_Smed_v4_19237_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011238Kinesin-like proteinSMESG000035453.1 dd_Smed_v4_13424_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011238Kinesin-like proteinSMESG000035453.1 dd_Smed_v4_10765_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017048cilia- and flagella-associated protein 206SMESG000021247.1 dd_Smed_v4_11199_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007853Family with sequence similarity 49 member ASMESG000040316.1 dd_Smed_v4_1856_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009913Beta-ureidopropionaseSMESG000060425.1 dd_Smed_v4_1584_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019518SMED30019518SMESG000073002.1 SMESG000072984.1 dd_Smed_v4_12680_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010322SMED30010322SMESG000006336.1 dd_Smed_v4_11671_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006971SMED30006971SMESG000030739.1 dd_Smed_v4_14664_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013159LimbinSMESG000017303.1 dd_Smed_v4_10777_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006822SMED30006822SMESG000043386.1 dd_Smed_v4_15542_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011699calcium/calmodulin-dependent protein kinase type IVSMESG000042100.1 dd_Smed_v4_10731_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013865OFD1SMESG000046592.1 dd_Smed_v4_13339_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013884SMED30013884SMESG000049207.1 SMESG000049205.1 SMESG000049063.1 dd_Smed_v4_11081_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000647Cell wall integrity and stress response component 1SMESG000035037.1 SMESG000035036.1 dd_Smed_v4_6380_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006714SMED30006714SMESG000001790.1 dd_Smed_v4_212_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002166SMED30002166SMESG000058880.1 SMESG000039065.1 dd_Smed_v4_4225_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009521Zinc finger BED domain-containing protein 5SMESG000002129.1 dd_Smed_v4_13531_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000745SMED30000745SMESG000027028.1 dd_Smed_v4_14847_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012638DUF4200 domain-containing proteinSMESG000028991.1 dd_Smed_v4_11371_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010674SPATA6 domain-containing proteinSMESG000053714.1 dd_Smed_v4_10543_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001779SMED30001779SMESG000012423.1 dd_Smed_v4_5949_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017021PhosphodiesteraseSMESG000044149.1 dd_Smed_v4_15950_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005874SMED30005874SMESG000014715.1 dd_Smed_v4_2213_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019139CalmodulinSMESG000010244.1 dd_Smed_v4_10239_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015061G protein regulated inducer of neurite outgrowthSMESG000062691.1 dd_Smed_v4_10294_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017214SMED30017214SMESG000068350.1 dd_Smed_v4_18752_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003228Dach-1SMESG000005090.1 dd_Smed_v4_5823_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009090Mushroom body large-type Kenyon-related proteinSMESG000070784.1 dd_Smed_v4_17498_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019942Roc domain-containing proteinSMESG000038728.1 dd_Smed_v4_11334_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014919KIF3A-like proteinSMESG000075065.1 dd_Smed_v4_4343_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008856SMED30008856SMESG000025888.1 dd_Smed_v4_1422_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019453Asparagine rich antigenSMESG000022424.1 dd_Smed_v4_10530_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000248Ras-related protein Rab-11ASMESG000016036.1 dd_Smed_v4_4964_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005211cilia- and flagella-associated protein 47SMESG000060264.1 dd_Smed_v4_8294_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010655SMED30010655SMESG000028897.1 dd_Smed_v4_12473_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026934SMED30026934SMESG000050824.1 dd_Smed_v4_12162_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30024198protocadherin-9SMESG000023091.1 dd_Smed_v4_21207_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020855Guanine nucleotide-binding protein G(o) subunit alphaSMESG000081490.1 dd_Smed_v4_1635_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30024986SMED30024986SMESG000069890.1 dd_Smed_v4_16311_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025195SMED30025195SMESG000001693.1 dd_Smed_v4_10480_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30024984LisH domain-containing protein ARMC9SMESG000049428.1 dd_Smed_v4_10926_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026061SMED30026061SMESG000076482.1 SMESG000076409.1 SMESG000076405.1 SMESG000076390.1 SMESG000076375.1 SMESG000076364.1 SMESG000076223.1 SMESG000040665.1 SMESG000019753.1 dd_Smed_v4_1097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025153SMED30025153SMESG000029777.1 dd_Smed_v4_13914_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023857Calpain 5aSMESG000009459.1 dd_Smed_v4_101944_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027940cAMP-dependent protein kinase type I-alpha regulatory subunitSMESG000078298.1 dd_Smed_v4_15589_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021615Conserved uncharacterized CXorf65-related proteinSMESG000033459.1 dd_Smed_v4_15167_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023050Aldehyde dehydrogenase, mitochondrialSMESG000016195.1 dd_Smed_v4_1339_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030597Mitogen-activated protein kinaseSMESG000033376.1 dd_Smed_v4_11396_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023193Tau tubulin kinaseSMESG000026133.1 dd_Smed_v4_12470_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031582InnexinSMESG000081749.1 dd_Smed_v4_11302_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031582InnexinSMESG000081749.1 dd_Smed_v4_10287_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030837cilia- and flagella-associated protein 299SMESG000052708.1 dd_Smed_v4_11277_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025084Ankyrin repeat and EF-hand domain-containing protein 1SMESG000006940.1 SMESG000006938.1 SMESG000006933.1 dd_Smed_v4_12476_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021189SMED30021189SMESG000081490.1 dd_Smed_v4_1635_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015004SMED30015004SMESG000042350.1 dd_Smed_v4_13840_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010500Fibronectin type III domain proteinSMESG000033545.1 dd_Smed_v4_15017_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013107Glyceraldehyde-3-phosphate dehydrogenaseSMESG000052353.1 dd_Smed_v4_78_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001654SMED30001654SMESG000012124.1 dd_Smed_v4_11272_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002162Glycosyl transferaseSMESG000030921.1 dd_Smed_v4_11247_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011963SMED30011963SMESG000032294.1 dd_Smed_v4_1381_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019169Neuronal acetylcholine receptor subunit alpha-6SMESG000013975.1 dd_Smed_v4_2273_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007755LIM and SH3 domain protein 1SMESG000002154.1 dd_Smed_v4_1218_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019717inositol phosphoceramide mannosyltransferase 2-likeSMESG000059812.1 SMESG000045480.1 SMESG000045292.1 SMESG000045267.1 SMESG000037990.1 dd_Smed_v4_2174_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010502SMED30010502SMESG000051310.1 dd_Smed_v4_15505_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007993GTP-binding proteinSMESG000065983.1 dd_Smed_v4_11291_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011096Centrosomal protein 131SMESG000051138.1 dd_Smed_v4_13976_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027478SMED30027478SMESG000081245.1 dd_Smed_v4_3287_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028890Bravo_FIGEY domain-containing proteinSMESG000065363.1 SMESG000043141.1 dd_Smed_v4_1294_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031260SMED30031260SMESG000013211.1 dd_Smed_v4_2357_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031407Coiled-coil-helix-coiled-coil-helix domain-containing protein 10 mitochondrialSMESG000003969.1 dd_Smed_v4_225_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031777Peptidoglycan-recognition proteinSMESG000020172.1 dd_Smed_v4_13624_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020334Leucine-rich repeat-containing protein 57SMESG000037709.1 dd_Smed_v4_17742_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021019CYTOSOL_AP domain-containing proteinSMESG000037599.1 dd_Smed_v4_181_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023043SMED30023043SMESG000019067.1 dd_Smed_v4_13671_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020321Cilia and flagella associated protein 126SMESG000048804.1 dd_Smed_v4_2157_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020035DNA polymerase subunit gammaSMESG000050799.1 dd_Smed_v4_13411_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026669WD repeat and SOCS box-containing 1SMESG000032294.1 dd_Smed_v4_1381_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031282cAMP-dependent protein kinase regulatory subunitSMESG000078515.1 dd_Smed_v4_13623_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025664TSNAXIP1_N domain-containing proteinSMESG000060720.1 dd_Smed_v4_13434_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032005SIAH-type domain-containing proteinSMESG000042443.1 dd_Smed_v4_13836_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026121Ectonucleotide pyrophosphatase/phosphodiesterase family member 6SMESG000040292.1 dd_Smed_v4_1269_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035448Kinesin motor domain proteinSMESG000075721.1 dd_Smed_v4_11799_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022057SJCHGC08494 proteinSMESG000027083.1 dd_Smed_v4_2196_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025052histone-lysine N-methyltransferase SETD1B-ASMESG000062286.1 dd_Smed_v4_11834_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029349AdenosylhomocysteinaseSMESG000029405.1 dd_Smed_v4_3408_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022914neurofilament heavy polypeptide isoform X5SMESG000058734.1 dd_Smed_v4_11421_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021206Calcineurin B homologous protein 1SMESG000018297.1 dd_Smed_v4_1504_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031188Casein kinase ISMESG000050144.1 SMESG000050130.1 dd_Smed_v4_16169_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031189G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000063918.1 dd_Smed_v4_19017_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028017SMED30028017SMESG000081058.1 dd_Smed_v4_1803_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025910Microtubule-associated protein futschSMESG000044270.1 SMESG000030021.1 SMESG000025422.1 dd_Smed_v4_1999_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026225SMED30026225SMESG000059698.1 dd_Smed_v4_188_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035260SMED30035260SMESG000035564.1 dd_Smed_v4_12208_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030095coiled-coil domain-containing protein 87 isoform X1SMESG000004454.1 dd_Smed_v4_12480_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021399Protein kintounSMESG000052588.1 dd_Smed_v4_14336_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022362Synaptotagmin-2SMESG000011583.1 dd_Smed_v4_12772_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029139Ubiquitin-conjugating enzyme E2 L3SMESG000069968.1 SMESG000069969.1 dd_Smed_v4_180_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035592E3 ubiquitin-protein ligase mind-bombSMESG000031930.1 dd_Smed_v4_1317_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033302RNA-binding protein MEX3BSMESG000044270.1 SMESG000030021.1 SMESG000025422.1 dd_Smed_v4_1999_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025141SMED30025141SMESG000076211.1 SMESG000047610.1 dd_Smed_v4_2124_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021122Tyrosine--tRNA ligaseSMESG000055897.1 SMESG000019862.1 dd_Smed_v4_1795_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025608X1.A.G7.1SMESG000046817.1 SMESG000046814.1 dd_Smed_v4_1507_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30024854SMED30024854SMESG000013975.1 dd_Smed_v4_2273_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023486Intraflagellar transport 74SMESG000074086.1 dd_Smed_v4_12702_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029771SMED30029771SMESG000075916.1 dd_Smed_v4_2326_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022167SMED30022167SMESG000031417.1 dd_Smed_v4_11958_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033245InnexinSMESG000061679.1 dd_Smed_v4_8390_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008508SMED30008508SMESG000055230.1 SMESG000044487.1 dd_Smed_v4_921_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005821SMED30005821SMESG000009284.1 dd_Smed_v4_3178_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019342SH3 and multiple ankyrin repeat domains proteinSMESG000014775.1 dd_Smed_v4_7862_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013198SMED30013198SMESG000057605.1 dd_Smed_v4_24714_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010068Formin-like protein 15SMESG000035694.1 SMESG000035692.1 dd_Smed_v4_8222_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014439Luc7-like protein 3SMESG000063148.1 dd_Smed_v4_5427_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007246SMED30007246SMESG000045656.1 dd_Smed_v4_797_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011695Alpha-galactosidaseSMESG000009912.1 dd_Smed_v4_606_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000165Formin-like protein 15SMESG000035694.1 SMESG000035692.1 dd_Smed_v4_8222_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002176Sterile alpha motif domain containing 4ASMESG000038073.1 dd_Smed_v4_6923_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004581Dual specificity protein phosphatase 10SMESG000030100.1 dd_Smed_v4_3551_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011898Protein F37C4.5SMESG000008044.1 dd_Smed_v4_9190_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001479G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000029291.1 dd_Smed_v4_6716_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001479G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000029294.1 SMESG000029291.1 dd_Smed_v4_2802_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008579ST13 Hsp70 interacting proteinSMESG000071677.1 SMESG000069228.1 SMESG000017570.1 SMESG000017358.1 SMESG000017347.1 SMESG000013728.1 SMESG000001430.1 dd_Smed_v4_668_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010881SMED30010881SMESG000004195.1 dd_Smed_v4_991_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008534cGMP-dependent protein kinaseSMESG000052811.1 dd_Smed_v4_5704_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001828dynein assembly factor 3, axonemalSMESG000017259.1 dd_Smed_v4_6686_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3000928360S ribosomal protein L18aSMESG000060163.1 dd_Smed_v4_437_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014640Small heat shock protein p36SMESG000028601.1 dd_Smed_v4_6399_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005163SMED30005163SMESG000043675.1 dd_Smed_v4_28780_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013779Tubulin monoglycylase TTLL3SMESG000029205.1 dd_Smed_v4_10244_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018185SMED30018185SMESG000003780.1 dd_Smed_v4_9295_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007718Flotillin-1SMESG000063612.1 dd_Smed_v4_1887_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010203C2H2-type domain-containing proteinSMESG000067728.1 dd_Smed_v4_1455_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017620SMED30017620SMESG000068887.1 dd_Smed_v4_31113_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009566SMED30009566SMESG000015985.1 dd_Smed_v4_4240_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035836Procollagen galactosyltransferase 1SMESG000064760.1 dd_Smed_v4_11681_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034247SMED30034247SMESG000005178.1 dd_Smed_v4_10371_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026551Ankyrin and armadillo repeat-containing proteinSMESG000058465.1 dd_Smed_v4_13064_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022089heterogeneous nuclear ribonucleoprotein KSMESG000033971.1 dd_Smed_v4_1569_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020261SMED30020261SMESG000045656.1 dd_Smed_v4_797_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021637Adenosine monophosphate-protein transferase FICDSMESG000007402.1 dd_Smed_v4_11524_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035412SMED30035412SMESG000077193.1 dd_Smed_v4_11282_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029911Pre-mRNA-processing factor 40SMESG000044274.1 dd_Smed_v4_1909_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029970Rab-GAP TBC domain-containing proteinSMESG000063156.1 dd_Smed_v4_15291_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028353Dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit DAD1SMESG000050730.1 dd_Smed_v4_2109_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027733NAD-dependent protein deacetylaseSMESG000079800.1 dd_Smed_v4_21545_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033487cilia- and flagella-associated protein 70SMESG000009189.1 dd_Smed_v4_10893_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029370Glucose-6-phosphate isomeraseSMESG000067583.1 dd_Smed_v4_1398_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026256vault protein inter alpha trypsin-1SMESG000053671.1 SMESG000053669.1 SMESG000053667.1 SMESG000053664.1 SMESG000053657.1 SMESG000053638.1 dd_Smed_v4_1027_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028190SMED30028190SMESG000035239.1 SMESG000035240.1 dd_Smed_v4_18162_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031362SMED30031362SMESG000033673.1 dd_1071dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
pharynxSMED30026646Dynein light chainSMESG000009941.1 dd_Smed_v4_107_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030795Vault protein inter alpha trypsin-1SMESG000053671.1 SMESG000053669.1 SMESG000053667.1 SMESG000053664.1 SMESG000053657.1 SMESG000053638.1 dd_Smed_v4_1027_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021711DNA-binding proteinSMESG000070983.1 dd_Smed_v4_2102_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007403Protein phosphatase 1 regulatory subunit 42SMESG000014888.1 dd_Smed_v4_7268_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032531SMED30032531SMESG000024850.1 dd_Smed_v4_9209_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021194Calcitonin-like receptorSMESG000080399.1 dd_Smed_v4_7328_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031988UPF0602 protein C4orf47 homologSMESG000078789.1 dd_Smed_v4_8186_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029780EGR-like protein 1SMESG000000960.1 dd_Smed_v4_7731_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022840SMED30022840SMESG000025410.1 dd_Smed_v4_777_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032970Alpha-int-3SMESG000034289.1 dd_Smed_v4_8943_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029077Macrophage-expressed gene 1 proteinSMESG000044681.1 dd_Smed_v4_983_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029379Gamma-aminobutyric acid receptor-associated protein-like 2SMESG000033716.1 dd_Smed_v4_1441_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035908Serine-rich adhesin for platelets (Staphylococcus aureus surface protein A)SMESG000025158.1 dd_Smed_v4_3220_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032042SMED30032042SMESG000065355.1 SMESG000065350.1 SMESG000065349.1 dd_531dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
pharynxSMED30032042SMED30032042SMESG000065355.1 SMESG000065350.1 SMESG000065349.1 dd_Smed_v4_531_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030637SMED30030637SMESG000056889.1 dd_Smed_v4_4060_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021143Basal body-orientation factor 1SMESG000078046.1 dd_Smed_v4_9328_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034381Malate dehydrogenaseSMESG000056995.1 dd_Smed_v4_467_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035681Intraflagellar transport protein 88SMESG000039906.1 dd_Smed_v4_5484_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029902Protein kinase domain-containing proteinSMESG000074943.1 SMESG000074941.1 dd_Smed_v4_6760_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033998SMED30033998SMESG000066201.1 SMESG000053557.1 SMESG000040504.1 dd_Smed_v4_8274_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027228Protein FAM166BSMESG000069725.1 dd_Smed_v4_5010_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030079SMED30030079SMESG000042010.1 dd_Smed_v4_8745_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028503SMED30028503SMESG000040102.1 dd_Smed_v4_5390_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030287Serine/threonine-protein phosphataseSMESG000064848.1 dd_Smed_v4_2045_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020039B9 domain-containing protein 1SMESG000017059.1 dd_Smed_v4_5678_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022055SMED30022055SMESG000039579.1 dd_Smed_v4_32066_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030286Tctex1 domain containing 2SMESG000027829.1 dd_Smed_v4_7666_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035231SMED30035231SMESG000066861.1 SMESG000059630.1 SMESG000066862.1 dd_Smed_v4_6647_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020150SMED30020150SMESG000007340.1 dd_Smed_v4_6334_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034139Receptor-type tyrosine-protein phosphatase betaSMESG000005260.1 dd_Smed_v4_5733_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032161SMED30032161SMESG000076606.1 dd_Smed_v4_8156_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031141Tubulin polyglutamylase ttll6SMESG000075764.1 dd_Smed_v4_8131_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021145SMED30021145SMESG000023086.1 dd_Smed_v4_6287_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027818Si:ch211-163l21.7SMESG000026490.1 dd_Smed_v4_3833_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028417Bardet-Biedl syndrome 1 protein homologSMESG000009880.1 dd_Smed_v4_7298_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021882Disks large homolog 1SMESG000045568.1 dd_Smed_v4_8293_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023210PhosphodiesteraseSMESG000034055.1 SMESG000034048.1 dd_Smed_v4_9276_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020852Protein phosphatase 1 regulatory inhibitor subunit 16B-like ProteinSMESG000072724.1 dd_Smed_v4_5861_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006149protein pitchforkSMESG000045346.1 dd_Smed_v4_5490_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017204SMED30017204SMESG000019898.1 dd_Smed_v4_4953_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014044SMED30014044SMESG000079607.1 SMESG000072955.1 SMESG000049847.1 SMESG000049844.1 SMESG000049832.1 SMESG000049812.1 SMESG000049806.1 SMESG000049805.1 SMESG000049772.1 SMESG000049767.1 SMESG000049756.1 SMESG000049745.1 SMESG000049740.1 SMESG000049739.1 SMESG000049695.1 SMESG000049688.1 SMESG000049683.1 SMESG000049676.1 SMESG000049665.1 SMESG000049663.1 SMESG000049647.1 SMESG000049621.1 SMESG000049614.1 SMESG000049601.1 SMESG000049567.1 SMESG000049548.1 SMESG000040301.1 SMESG000040257.1 SMESG000032755.1 SMESG000032715.1 SMESG000022696.1 SMESG000022691.1 SMESG000022676.1 SMESG000022665.1 SMESG000022640.1 SMESG000022619.1 SMESG000022612.1 dd_Smed_v4_490_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004253HexosyltransferaseSMESG000042545.1 dd_Smed_v4_6589_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012966SMED30012966SMESG000079607.1 SMESG000072955.1 SMESG000049847.1 SMESG000049844.1 SMESG000049832.1 SMESG000049812.1 SMESG000049806.1 SMESG000049805.1 SMESG000049772.1 SMESG000049767.1 SMESG000049756.1 SMESG000049745.1 SMESG000049740.1 SMESG000049739.1 SMESG000049695.1 SMESG000049688.1 SMESG000049683.1 SMESG000049676.1 SMESG000049665.1 SMESG000049663.1 SMESG000049647.1 SMESG000049621.1 SMESG000049614.1 SMESG000049601.1 SMESG000049567.1 SMESG000049548.1 SMESG000040301.1 SMESG000040257.1 SMESG000032755.1 SMESG000032715.1 SMESG000022696.1 SMESG000022691.1 SMESG000022676.1 SMESG000022665.1 SMESG000022640.1 SMESG000022619.1 SMESG000022612.1 dd_Smed_v4_490_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002656Unconventional myosin-XVSMESG000061386.1 dd_Smed_v4_7193_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008609SMED30008609SMESG000059918.1 SMESG000052306.1 dd_Smed_v4_12223_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012843SMED30012843SMESG000032321.1 dd_Smed_v4_727_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002038Calsyntenin 1SMESG000002834.1 SMESG000002830.1 dd_Smed_v4_1518_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011690Heterogeneous nuclear ribonucleoprotein A2SMESG000050993.1 SMESG000050994.1 dd_Smed_v4_1194_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001362SMEDWI-3SMESG000081970.1 dd_Smed_v4_1258_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007588SMED30007588SMESG000034112.1 dd_Smed_v4_10100_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006515ZZ-type domain-containing proteinSMESG000055420.1 dd_Smed_v4_10173_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010668MAGUK p55 subfamily member 5SMESG000017294.1 dd_Smed_v4_6790_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004945slc22a-9SMESG000025834.1 dd_Smed_v4_11120_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010380SJCHGC04139 proteinSMESG000022419.1 dd_Smed_v4_4617_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007060LIM zinc-binding domain-containing proteinSMESG000040062.1 dd_Smed_v4_1625_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005955SMED30005955SMESG000029728.1 dd_Smed_v4_28658_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010775SMED30010775SMESG000062858.1 dd_Smed_v4_10948_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000006Potassium voltage gated channel subfamily HSMESG000050992.1 dd_Smed_v4_14863_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019258Cytosolic carboxypeptidase 2SMESG000058240.1 dd_Smed_v4_13450_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005066Multiple epidermal growth factor domains protein 6SMESG000002074.1 dd_Smed_v4_5630_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002772LipaseSMESG000044132.1 dd_Smed_v4_11504_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3001422860S ribosomal protein L6SMESG000050581.1 dd_Smed_v4_10396_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018731MORN repeat-containing protein 5SMESG000023247.1 dd_Smed_v4_7020_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007780Collagen alpha-6(VI) chainSMESG000046770.1 dd_Smed_v4_7616_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018865DUF1619 domain-containing proteinSMESG000057489.1 dd_Smed_v4_11225_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003873nuclear factor Y subunit BSMESG000017262.1 dd_Smed_v4_5828_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006397Cyclic nucleotide-binding domain-containing proteinSMESG000040419.1 SMESG000040416.1 SMESG000005563.1 dd_Smed_v4_19613_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009173Glutamate receptor-interacting protein 2SMESG000031603.1 dd_Smed_v4_3080_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017667SMED30017667SMESG000044691.1 SMESG000022166.1 dd_Smed_v4_10233_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017369Disabled 2-interacting proteinSMESG000043888.1 dd_Smed_v4_3238_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004224Sodium/hydrogen exchanger 11SMESG000052479.1 dd_Smed_v4_10212_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019261SMED30019261SMESG000022691.1 SMESG000022690.1 dd_Smed_v4_2130_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000146GLI-3SMESG000078300.1 dd_Smed_v4_17566_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017231NEPH-3SMESG000022777.1 dd_Smed_v4_11280_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010320Radial spoke head 10-like protein B2SMESG000039156.1 SMESG000039153.1 dd_Smed_v4_12762_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004553SMED30004553SMESG000023121.1 dd_Smed_v4_6718_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017399Transmembrane protein 81SMESG000026648.1 dd_Smed_v4_10248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012419Non-specific serine/threonine protein kinaseSMESG000069962.1 SMESG000069953.1 SMESG000069952.1 dd_Smed_v4_3244_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002886SMED30002886SMESG000017779.1 dd_Smed_v4_11049_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006334TBC1 domain family member 12SMESG000071846.1 SMESG000020373.1 dd_Smed_v4_7827_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019315SMED30019315SMESG000022726.1 dd_Smed_v4_2668_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013768SMED30013768SMESG000056915.1 dd_Smed_v4_3761_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011060SMED30011060SMESG000018625.1 dd_Smed_v4_7135_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016603Polyubiquitin-BSMESG000063727.1 SMESG000063594.1 dd_Smed_v4_15619_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018972ANK_REP_REGION domain-containing proteinSMESG000022931.1 dd_Smed_v4_11187_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011294Protein kinase domain-containing proteinSMESG000041899.1 SMESG000031064.1 dd_Smed_v4_8347_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019223Protein FAM47ESMESG000026097.1 dd_Smed_v4_10346_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002064Doublecortin domain-containing protein 2SMESG000040482.1 SMESG000040481.1 SMESG000040480.1 SMESG000038137.1 dd_Smed_v4_6464_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004756Small nuclear ribonucleoprotein Sm D2SMESG000032344.1 dd_Smed_v4_2994_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017542SMED30017542SMESG000033620.1 dd_Smed_v4_22810_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006792Argonaute 1SMESG000050993.1 SMESG000050994.1 dd_Smed_v4_1194_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011285DNA polymerase subunit gamma-1SMESG000077612.1 SMESG000050769.1 dd_Smed_v4_5734_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033594Microtubule-associated protein 1ASMESG000014298.1 dd_Smed_v4_1301_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033594Microtubule-associated protein 1ASMESG000014298.1 dd_Smed_v4_3654_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029624Heterogeneous nuclear ribonucleoprotein KSMESG000064674.1 dd_Smed_v4_1998_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032342Hsc70-interacting proteinSMESG000040419.1 SMESG000040416.1 SMESG000005563.1 dd_Smed_v4_19613_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031485Lipoxygenase homology domain-containing protein 1SMESG000001054.1 dd_Smed_v4_10315_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030924Protein tilB-likeSMESG000009895.1 dd_Smed_v4_14797_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031345Pyruvate dehydrogenase E1 component subunit alphaSMESG000073271.1 dd_Smed_v4_1310_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021146SERPIN domain-containing proteinSMESG000054563.1 dd_Smed_v4_3824_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025004Magnesium-dependent phosphatase 1SMESG000025378.1 dd_Smed_v4_1958_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023859Serine/threonine protein phosphatase 2A regulatory subunitSMESG000026797.1 dd_Smed_v4_6134_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020821SMED30020821SMESG000014298.1 dd_Smed_v4_1301_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028938Protein disulfide-isomerase A6SMESG000023147.1 dd_Smed_v4_250_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022575pescadillo-1SMESG000032689.1 dd_Smed_v4_900_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30024611Terminal nucleotidyltransferase 5CSMESG000079542.1 dd_Smed_v4_78314_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032159Oxysterol-binding proteinSMESG000046022.1 dd_Smed_v4_5423_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021030slc25a-7SMESG000074820.1 dd_Smed_v4_8013_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022325SMED30022325SMESG000022410.1 SMESG000022409.1 dd_Smed_v4_1683_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030984MFS domain-containing proteinSMESG000069674.1 dd_Smed_v4_4285_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006062SMED30006062SMESG000017127.1 dd_Smed_v4_8536_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005698SMED30005698SMESG000052123.1 dd_Smed_v4_2845_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005770Cell number regulator 7SMESG000060415.1 dd_Smed_v4_743_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002228Ig-like domain-containing proteinSMESG000024613.1 dd_Smed_v4_7050_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011134SMED30011134SMESG000063657.1 dd_Smed_v4_10132_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007704ActinSMESG000051672.1 SMESG000051670.1 dd_Smed_v4_3_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013825Acyl-coenzyme A thioesterase 13SMESG000063995.1 dd_Smed_v4_4659_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010487Serine/threonine kinaseSMESG000054195.1 SMESG000035615.1 dd_Smed_v4_11271_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006235slc18a-5SMESG000024277.1 dd_Smed_v4_13278_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006820cilia- and flagella-associated protein 57SMESG000072029.1 dd_Smed_v4_3323_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED300051503' histone mRNA exonuclease 1SMESG000058668.1 dd_Smed_v4_1266_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003887c-Myc-binding proteinSMESG000001466.1 dd_Smed_v4_891_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013077SMED30013077SMESG000076350.1 dd_Smed_v4_7379_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013212Histone H2ASMESG000015784.1 dd_Smed_v4_469_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016196SMED30016196SMESG000059283.1 dd_Smed_v4_62_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014257Oxysterol-binding proteinSMESG000008795.1 dd_Smed_v4_4931_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009735Bardet-Biedl syndrome 5 protein homologSMESG000052420.1 dd_Smed_v4_8523_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006416cell division cycle 25-1SMESG000065054.1 dd_Smed_v4_5520_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007379YTH domain-containing family protein 2SMESG000008619.1 dd_Smed_v4_7891_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014810Endophilin-A3SMESG000061276.1 dd_Smed_v4_7468_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005459SMED30005459SMESG000014884.1 dd_Smed_v4_2661_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016302NADH-ubiquinone oxidoreductase 75 kDa subunit, mitochondrialSMESG000081864.1 dd_Smed_v4_2402_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009695Ras-related protein Ral-ASMESG000017190.1 SMESG000016219.1 dd_Smed_v4_522_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012300SMED30012300SMESG000013739.1 dd_Smed_v4_5519_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009045EF-hand calcium binding domain 1SMESG000017974.1 dd_Smed_v4_5488_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002013SMED30002013SMESG000060484.1 dd_Smed_v4_6979_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013840Tektin-2SMESG000065255.1 SMESG000050057.1 dd_Smed_v4_2339_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001242Mitogen-activated protein kinase kinase kinase 1aSMESG000017260.1 dd_Smed_v4_4322_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006315SMED30006315SMESG000004983.1 dd_Smed_v4_20679_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016238Kinesin-like proteinSMESG000071604.1 dd_Smed_v4_12639_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011700Calcium-binding protein ASMESG000052083.1 SMESG000048475.1 dd_Smed_v4_605_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010457cell division cycle and apoptosis regulator protein 1SMESG000052430.1 dd_Smed_v4_1608_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007385SMED30007385SMESG000003089.1 dd_Smed_v4_780_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016848SMED30016848SMESG000079496.1 dd_Smed_v4_6860_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006051SMED30006051SMESG000010439.1 dd_Smed_v4_13617_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000126Centrosomal protein 95SMESG000002923.1 dd_Smed_v4_8515_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013075Voltage-dependent anion channel 3SMESG000000196.1 dd_Smed_v4_738_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004208AAEL003283-PASMESG000004656.1 dd_Smed_v4_8909_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3001096960S ribosomal protein L6SMESG000019835.1 dd_Smed_v4_839_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016446Root phototropism protein 2SMESG000067415.1 dd_Smed_v4_8081_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007546SMED30007546SMESG000015060.1 dd_Smed_v4_3222_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010410SMED30010410SMESG000021757.1 dd_Smed_v4_8797_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010277SMED30010277SMESG000000133.1 dd_Smed_v4_8640_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000605UPF0193 protein EVG1SMESG000056865.1 dd_Smed_v4_9772_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008973SMED30008973SMESG000017122.1 dd_Smed_v4_13867_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020375PHD finger-like domain-containing protein 5ASMESG000029843.1 dd_Smed_v4_2656_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023471Myosin, light chain kinase aSMESG000081274.1 dd_Smed_v4_3482_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031736SMED30031736SMESG000019122.1 dd_Smed_v4_8185_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029360Low density lipoprotein receptor class A cysteine richSMESG000073751.1 dd_Smed_v4_2114_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030925SMED30030925SMESG000038398.1 dd_Smed_v4_4195_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029668Adenylate kinase isoenzyme 5SMESG000020486.1 SMESG000020480.1 dd_Smed_v4_5119_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035215G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000023842.1 dd_Smed_v4_32_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034802Small nuclear ribonucleoprotein Sm D3SMESG000010007.1 dd_Smed_v4_562_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025746SMED30025746SMESG000043367.1 dd_Smed_v4_7030_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029741SMED30029741SMESG000056346.1 dd_Smed_v4_2250_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013257Tektin-2SMESG000026446.1 SMESG000026445.1 SMESG000026429.1 dd_Smed_v4_2694_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010123Sodium/potassium-transporting ATPase subunit beta-1SMESG000064593.1 dd_Smed_v4_2210_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004178SMED30004178SMESG000025475.1 dd_Smed_v4_2550_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006119X-box-binding protein 1SMESG000048111.1 dd_Smed_v4_415_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018829Insulin like growth factor 2 receptorSMESG000023958.1 SMESG000023953.1 dd_Smed_v4_14729_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006633SMED30006633SMESG000040042.1 dd_Smed_v4_11386_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001916IRS-type PTB domain-containing proteinSMESG000027222.1 dd_Smed_v4_9490_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002944GGACT domain-containing proteinSMESG000081395.1 dd_Smed_v4_8685_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3000024060S ribosomal protein L10aSMESG000027088.1 dd_Smed_v4_350_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009457reticulocalbin-1SMESG000034805.1 dd_Smed_v4_493_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002502Choline-phosphate cytidylyltransferaseSMESG000081359.1 dd_Smed_v4_5385_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017114Elongation factor 1-gammaSMESG000018714.1 dd_Smed_v4_308_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED300164222-oxoisovalerate dehydrogenase subunit alphaSMESG000021412.1 dd_Smed_v4_10732_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012631Phospholipid-transporting ATPaseSMESG000011472.1 dd_Smed_v4_10737_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019668Proactivator polypeptideSMESG000042333.1 dd_Smed_v4_241_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018944SMED30018944SMESG000028183.1 dd_Smed_v4_592_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3001616360S ribosomal protein L27aSMESG000034631.1 dd_Smed_v4_155_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3000109640S ribosomal protein S23SMESG000017264.1 dd_Smed_v4_290_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015252Mitochondrial inner membrane protein OXA1LSMESG000039158.1 dd_Smed_v4_4072_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3000876940S ribosomal protein S10SMESG000034720.1 dd_Smed_v4_117_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005190SMED30005190SMESG000041069.1 dd_Smed_v4_237_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000270Histone H3SMESG000049112.1 SMESG000049109.1 dd_Smed_v4_532_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010027SMED30010027SMESG000015329.1 dd_Smed_v4_5101_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001490ADF-H domain-containing proteinSMESG000080129.1 dd_Smed_v4_260_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010941dnaJ homolog subfamily B member 13SMESG000076708.1 dd_Smed_v4_4820_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3001337140S ribosomal protein S26SMESG000049997.1 SMESG000005227.1 dd_Smed_v4_222_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3001238340S ribosomal protein SASMESG000071180.1 dd_Smed_v4_171_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004469Splicing factor 3B subunit 1SMESG000025534.1 dd_Smed_v4_2797_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007498Ribosomal protein L19SMESG000057653.1 dd_Smed_v4_228_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013315SMED30013315SMESG000022425.1 dd_Smed_v4_3843_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000565Dynein heavy chainSMESG000065732.1 dd_Smed_v4_6941_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006391SMED30006391SMESG000026399.1 dd_Smed_v4_110_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3000270360S ribosomal protein L23aSMESG000074545.1 dd_Smed_v4_281_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010637Nucleolar RNA helicase II/Gu proteinSMESG000065959.1 dd_Smed_v4_283_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013396perilipin-2 isoform X1SMESG000075481.1 dd_Smed_v4_154_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002537Y box protein-1SMESG000058013.1 dd_Smed_v4_35_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006353SMED30006353SMESG000004009.1 dd_Smed_v4_7680_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011205SMED30011205SMESG000056922.1 dd_Smed_v4_11352_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009623SMED30009623SMESG000047804.1 SMESG000038532.1 SMESG000038520.1 SMESG000036112.1 SMESG000036060.1 dd_Smed_v4_4251_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001875Dynein light chain roadblockSMESG000072361.1 dd_Smed_v4_1126_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027141SMED30027141SMESG000059828.1 dd_Smed_v4_1549_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025791B box-type domain-containing proteinSMESG000078465.1 dd_Smed_v4_11048_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025604Sortilin-related receptorSMESG000043036.1 SMESG000043031.1 SMESG000040338.1 SMESG000040332.1 dd_Smed_v4_8864_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033015SMED30033015SMESG000049533.1 dd_Smed_v4_2058_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031646SMED30031646SMESG000010156.1 dd_Smed_v4_105_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027150Pleckstrin homology and RhoGEF domain containing G5SMESG000052365.1 dd_Smed_v4_14038_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025095SMED30025095SMESG000046852.1 dd_Smed_v4_11398_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3002420240S ribosomal protein S14SMESG000036550.1 dd_Smed_v4_139_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022331Translocon-associated protein, gamma subunitSMESG000066628.1 dd_Smed_v4_1265_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030499Chromosome X CXorf58 homologSMESG000061012.1 dd_Smed_v4_8151_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035599meisSMESG000006530.1 dd_Smed_v4_15951_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3002669640S ribosomal protein S19SMESG000023987.1 SMESG000009719.1 dd_Smed_v4_202_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3002728060S acidic ribosomal protein P0SMESG000079482.1 dd_Smed_v4_161_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034212SMED30034212SMESG000023080.1 dd_Smed_v4_8763_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031912SMED30031912SMESG000003404.1 dd_Smed_v4_2094_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020615prohibitin-1SMESG000021272.1 dd_Smed_v4_1089_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028787TNF receptor-associated factorSMESG000015087.1 dd_Smed_v4_2354_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020070High mobility group protein B1SMESG000034017.1 dd_Smed_v4_1095_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027914SMED30027914SMESG000040016.1 SMESG000040019.1 dd_Smed_v4_22578_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025883Forkhead associated phosphopeptide binding domain 1SMESG000071072.1 dd_Smed_v4_14350_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026877HORMA domain-containing proteinSMESG000066514.1 dd_Smed_v4_2201_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025898SMED30025898SMESG000051187.1 dd_Smed_v4_16909_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020503SMED30020503SMESG000005001.1 dd_Smed_v4_45152_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028496Protein disulfide-isomeraseSMESG000001159.1 dd_Smed_v4_1893_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3002317260s ribosomal protein L14SMESG000022343.1 dd_Smed_v4_167_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026887Myosin light chain proteinSMESG000075512.1 dd_Smed_v4_223_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022778SMED30022778SMESG000079288.1 SMESG000017831.1 dd_Smed_v4_15746_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021753SMED30021753SMESG000043533.1 dd_Smed_v4_12718_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020109R3H domain containing-likeSMESG000044056.1 dd_Smed_v4_11014_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026949SMED30026949SMESG000047804.1 SMESG000038532.1 SMESG000038520.1 SMESG000036112.1 SMESG000036060.1 dd_Smed_v4_4251_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025747SMED30025747SMESG000049533.1 dd_Smed_v4_2058_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021977Beta-1,3-galactosyltransferase 1SMESG000035184.1 dd_Smed_v4_11741_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031429SMED30031429SMESG000038604.1 dd_Smed_v4_1973_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027092SMED30027092SMESG000078236.1 SMESG000032651.1 dd_Smed_v4_4949_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031309nuclear protein MDM1-like isoform X1SMESG000058479.1 dd_Smed_v4_10635_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023112SMED30023112SMESG000047804.1 SMESG000038532.1 SMESG000038520.1 SMESG000036112.1 SMESG000036060.1 dd_Smed_v4_4251_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30024629inositol 1,4,5-trisphosphate receptor type 3 isoform X13SMESG000060659.1 SMESG000060658.1 SMESG000060657.1 dd_Smed_v4_13538_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021820Guanylate cyclaseSMESG000056411.1 dd_Smed_v4_11767_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005292Post-GPI attachment to proteins factor 3SMESG000077193.1 dd_Smed_v4_11282_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018252Cathepsin L2SMESG000049723.1 dd_Smed_v4_48_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012881BLUF domain-containing proteinSMESG000015580.1 dd_Smed_v4_11000_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005772vault protein inter alpha trypsin-1SMESG000053671.1 SMESG000053669.1 SMESG000053667.1 SMESG000053664.1 SMESG000053657.1 SMESG000053638.1 dd_Smed_v4_1027_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003716Glucose-6-phosphate isomeraseSMESG000067583.1 dd_Smed_v4_1398_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018511von Willebrand factor A domain-containing protein 3BSMESG000009195.1 dd_Smed_v4_10837_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003032SMED30003032SMESG000061110.1 dd_Smed_v4_11638_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019298Heterogeneous nuclear ribonucleoprotein LSMESG000005298.1 dd_Smed_v4_1327_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018534Muscleblind-like proteinSMESG000067960.1 SMESG000079855.1 SMESG000037170.1 dd_Smed_v4_2838_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006279SMED30006279SMESG000024330.1 dd_Smed_v4_15812_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003249ProhibitinSMESG000038397.1 dd_Smed_v4_1038_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013027SMED30013027SMESG000076350.1 dd_Smed_v4_7379_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022468secreted frizzled-related protein 1SMESG000075831.1 SMESG000029446.1 EU296635smed_ncbi_20200123PMID:24704339
Vogg et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30029487Smed-NDKSMESG000062038.1 GU592830.1smed_ncbi_20200123PMID:24704339
Vogg et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30005045zinc finger protein ASMESG000022958.1 KF751216.1smed_ncbi_20200123PMID:24704339
Vogg et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30027297winged helix/forkhead transcription factorSMESG000077075.1 KC577557smed_ncbi_20200123PMID:24704339
Vogg et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30027297winged helix/forkhead transcription factorSMESG000077075.1 KC577557.1smed_ncbi_20200123PMID:24704339
Vogg et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30026602Wnt2-1SMESG000002069.1 FJ463753.1smed_ncbi_20200123PMID:23318641
Chen et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30020359Smed-NDK-3SMESG000046244.1 SMESG000046208.1 GU592832.1smed_ncbi_20200123PMID:23318641
Chen et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30027299PBXSMESG000022232.1 SMESG000001913.1 KC353351.1smed_ncbi_20200123PMID:23318641
Chen et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30031256wntP-2SMESG000066476.1 wntP-2smed_ncbi_20200123PMID:23318641
Chen et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30007555GCR098SMESG000016695.1 Contig4585newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30007555GCR098SMESG000016695.1 Contig4585uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30007555GCR098SMESG000033655.1 Contig4585newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30007555GCR098SMESG000033655.1 Contig4585uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30001630Ras-related C3 botulinum toxin substrate 1SMESG000005612.1 Contig594newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30001630Ras-related C3 botulinum toxin substrate 1SMESG000005612.1 Contig594uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30001630Ras-related C3 botulinum toxin substrate 1SMESG000011575.1 Contig594newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30001630Ras-related C3 botulinum toxin substrate 1SMESG000011575.1 Contig594uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30015345TropomyosinSMESG000066854.1 Contig3688newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30015345TropomyosinSMESG000066854.1 Contig3688uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30015345TropomyosinSMESG000026500.1 Contig3688newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30015345TropomyosinSMESG000026500.1 Contig3688uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30033476Zinc finger protein, putativeSMESG000068172.1 Contig3306GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30033476Zinc finger protein, putativeSMESG000025870.1 Contig3306GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30015409cAMP-responsive element modulatorSMESG000016695.1 Contig4585GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30015409cAMP-responsive element modulatorSMESG000033655.1 Contig4585GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30014474Tumor susceptibility gene 101 proteinSMESG000049597.1 Contig5044GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30014474Tumor susceptibility gene 101 proteinSMESG000004871.1 Contig5044GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30008091Serine/threonine-protein kinase PLKSMESG000012131.1 SMESG000012127.1 Contig809GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30008091Serine/threonine-protein kinase PLKSMESG000027686.1 Contig2364GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30008091Serine/threonine-protein kinase PLKSMESG000012131.1 SMESG000012127.1 Contig2364GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30018122MADS-box domain-containing proteinSMESG000005612.1 Contig594GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30018122MADS-box domain-containing proteinSMESG000011575.1 Contig594GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30008321SMED30008321SMESG000068172.1 Contig3306newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30008321SMED30008321SMESG000068172.1 Contig3306uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30008321SMED30008321SMESG000025870.1 Contig3306newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30008321SMED30008321SMESG000025870.1 Contig3306uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30011213Osteoclast-stimulating factor 1SMESG000004952.1 Contig516GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30017937WASP like actin nucleation promoting factor bSMESG000036683.1 Contig4572GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30017937WASP like actin nucleation promoting factor bSMESG000074788.1 Contig4572GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30025964SMED30025964SMESG000041071.1 Contig2453newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30023334Partitioning defective 6SMESG000066854.1 Contig3688GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30023334Partitioning defective 6SMESG000026500.1 Contig3688GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30033333SMED30033333SMESG000004952.1 Contig516newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30020100SMED30020100SMESG000013936.1 Contig1935newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30020100SMED30020100SMESG000013936.1 Contig1935uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30020100SMED30020100SMESG000039535.1 Contig1935newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30020100SMED30020100SMESG000039535.1 Contig1935uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30020811SMED30020811SMESG000005612.1 Contig594newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30020811SMED30020811SMESG000005612.1 Contig594uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30020811SMED30020811SMESG000011575.1 Contig594newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30020811SMED30020811SMESG000011575.1 Contig594uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30005336Phtf-FEM1B_bdg domain-containing proteinSMESG000058788.1 Contig2701GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30015706Twinfilin-1SMESG000041071.1 Contig2453GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30017930SMED30017930SMESG000049597.1 Contig5044newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30017930SMED30017930SMESG000004871.1 Contig5044newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30008812AP complex subunit sigmaSMESG000038889.1 Contig2145GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30009175Transcription elongation factor spt6SMESG000059332.1 Contig5500newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30009175Transcription elongation factor spt6SMESG000059332.1 Contig5500uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30009175Transcription elongation factor spt6SMESG000024114.1 Contig5500newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30009175Transcription elongation factor spt6SMESG000024114.1 Contig5500uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30019325Myosin regulatory light chainSMESG000068156.1 SMESG000064685.1 SMESG000043474.1 SMESG000010609.1 SMESG000076470.1 SMESG000073857.1 SMESG000062429.1 SMESG000058575.1 SMESG000053533.1 SMESG000020635.1 SMESG000015751.1 SMESG000005260.1 Contig246GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30019325Myosin regulatory light chainSMESG000000175.1 Contig246GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30019325Myosin regulatory light chainSMESG000000175.1 Contig2068GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30030227flotillin-2SMESG000059332.1 Contig5500GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30030227flotillin-2SMESG000024114.1 Contig5500GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30032354EOG090X01A3SMESG000068156.1 SMESG000064685.1 SMESG000043474.1 SMESG000010609.1 SMESG000076470.1 SMESG000073857.1 SMESG000062429.1 SMESG000058575.1 SMESG000053533.1 SMESG000020635.1 SMESG000015751.1 SMESG000005260.1 Contig246newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30032354EOG090X01A3SMESG000000175.1 Contig246newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30028347Engulfment and cell motility 3SMESG000013936.1 Contig1935GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30028347Engulfment and cell motility 3SMESG000039535.1 Contig1935GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30032393SMED30032393SMESG000036683.1 Contig4572newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30032393SMED30032393SMESG000074788.1 Contig4572newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30022944SMED30022944SMESG000049597.1 Contig5044newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30022944SMED30022944SMESG000004871.1 Contig5044newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30019715Tumor protein p63-regulated gene 1 proteinSMESG000038153.1 SMESG000018862.1 Contig1GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30019715Tumor protein p63-regulated gene 1 proteinSMESG000033840.1 Contig1GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30004187SMED30004187SMESG000043423.1 Contig1792newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30004187SMED30004187SMESG000043423.1 Contig1792uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30030892Intraflagellar transport protein 172SMESG000028841.1 dd_Smed_v4_7533_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020883SMED30020883SMESG000071322.1 dd_Smed_v4_5453_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020666Glutamine-rich protein 2SMESG000081231.1 dd_Smed_v4_6048_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034096Peptidoglycan recognition protein-1SMESG000081052.1 SMESG000028122.1 dd_Smed_v4_6162_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022545Protein kinase domain-containing proteinSMESG000057044.1 dd_Smed_v4_9098_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017874PRKCA-binding proteinSMESG000013976.1 dd_Smed_v4_11769_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013041SMED30013041SMESG000049878.1 dd_Smed_v4_4914_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008903ProfilinSMESG000020082.1 SMESG000020071.1 dd_Smed_v4_2107_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015809SMED30015809SMESG000069776.1 dd_Smed_v4_10177_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010702Serine/threonine-protein kinase B-rafSMESG000064517.1 dd_Smed_v4_13233_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008522Fatty acid-binding proteinSMESG000015143.1 dd_Smed_v4_271_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015453Poly [ADP-ribose] polymeraseSMESG000011115.1 dd_Smed_v4_2611_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009787Laminin subunit alpha-2SMESG000056016.1 SMESG000056013.1 dd_Smed_v4_7924_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002156TNF receptor associated factor-2SMESG000065606.1 SMESG000000563.1 SMESG000000559.1 SMESG000000493.1 SMESG000000294.1 dd_Smed_v4_1243_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013312CalpainSMESG000062904.1 SMESG000062902.1 dd_Smed_v4_1971_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011027Dynein axonemal assembly factor 4SMESG000052823.1 dd_Smed_v4_12396_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002718Family with sequence similarity 227 member BSMESG000052176.1 SMESG000046302.1 dd_Smed_v4_15102_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015310DUF3421 domain-containing proteinSMESG000046710.1 SMESG000046697.1 dd_Smed_v4_54_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003011NPHP1SMESG000061008.1 dd_Smed_v4_9990_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018507Calcium-transporting ATPaseSMESG000038461.1 dd_Smed_v4_4559_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018507Calcium-transporting ATPaseSMESG000038461.1 dd_Smed_v4_3170_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003343Peptidyl-prolyl cis-trans isomeraseSMESG000038766.1 dd_Smed_v4_686_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009430Fructose-bisphosphate aldolaseSMESG000006056.1 dd_Smed_v4_591_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015584Nesprin-1SMESG000016745.1 dd_Smed_v4_16850_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011715Splicing factor, arginine/serine-rich 6SMESG000041210.1 dd_Smed_v4_1177_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011581AP2-associated protein kinase 1-like Protein