pharynx

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ Description

  ▻ Figures

  ▻ In Situ Hybridization Data

  ▻ Sequences

  ▻ References




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  pharynx


DEFINITON:

  A plicate and protrusible organ that is the sole point of entry and exit for the Triclad gut. It contains epithelial, muscular, secretory and neuronal cell types.


TERM DEFINITION CITATIONS:

  OCLC:16809160


TERM CITATIONS:

Expand publication list


TERM ID:

  PLANA:0000016


ABOUT THIS TERM:

pharynx

  ↳is a material entity and organ

  ↳contained in posterior region of the whole animal and parapharyngeal region

  ↳existence overlaps Stage 6, juvenile, Stage 5, asexual adult, adult hermaphrodite, Stage 8 and Stage 7

  ↳existence starts during or after Stage 5

  ↳part of digestive system


  → pharynx progenitor cell and pharynx primordium develops into pharynx




BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


DESCRIPTION:   

foxA1, a pioneer transcription factor required for pharynx maintenance and regeneration during adulthood (Adler et al., 2014; Scimone et al., 2014), may similarly be required for construction of the definitive pharynx during embryogenesis. Development of the definitive pharynx, the single opening of the Smed digestive tract, commenced during S4-S5 with the onset of foxA1 expression in parenchymal cells, many of which were located in the oral hemisphere (Figure 1 – figure supplement 14A). The distribution of foxA1+ cells remained concentrated in and around the developing definitive pharynx rudiment during S6-S8, a pattern reminiscent of that observed in S. polychroa embryos (Martín-Durán et al., 2010), as well as in intact and regenerating Smed asexual adults (Adler et al., 2014; Scimone et al., 2014). The definitive pharynx develops beneath the degenerating temporary embryonic pharynx, and marks the ventral side of the embryos during S6 and thereafter (Martín-Durán and Romero, 2011). foxA1 upregulation during S5-S8 was statistically significant, albeit the adjusted p-values were above the thresholds set for inclusion in the enriched transcript lists presented in Figure 1 – source data 5, Figure 1 – source data 6, Figure 1 – source data 7, Figure 1 – source data 8. meis, a transcription factor coexpressed in foxA1+ neoblasts and expressed within the regenerating pharynx (Scimone et al., 2014), was among the S5 enriched transcripts (Figure 1 – source data 5); its expression trend was similar to foxA1 during embryogenesis (Figure 1 – figure supplement 14B). Two markers exhibiting pharynx-restricted expression in adults, laminin and npp-1 (Adler et al., 2014), were upregulated during S6-S8, after development of the definitive pharynx rudiment was evident (Figure 1 – figure supplement 14B).


 

back to top


FIGURES:


Figure 1 – figure supplement 14: Molecular markers for the definitive pharynx

A: WISH developmental time course using foxA1 riboprobes (blue), S3-S8.  foxA1 expression was consistently detected in the embryonic pharynx lumen during S3-S5 (black arrowheads). Anterior: top (S6-S8). Black arrowheads: embryonic pharynx. Red arrowheads: definitive pharynx. O: oral hemisphere. A: aboral hemisphere. D: dorsal. V: ventral. Scale bars: 100 µm.

B: Average RPKM values per embryo for the definitive pharynx markers foxA1, meis, laminin, npp-1 during embryogenesis (Adler et al., 2014; Scimone et al., 2014), Y (yolk), Stage (S) S2-S8. 

 

 

back to top


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30027428AFJ24799.1forkhead box A-1foxA1Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, digestive system, pharynx, pharynx progenitor cell, embryonic pharynx
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30027428 ID=SMED30027428|Name=forkhead box A-1|organism=Schmidtea mediterranea sexual|type=transcript|length=2149bp
ATCACTTGGTGCTGCTTTTTGCCCCGATAAATCTCTCGGTGCTCCAAAATTTGTGTAAGCGAGCAAAAGATGATTGGGCA
ATTTCTAGCACGTCATTCGGCAACGATGTTTACAAGTTTCTCTGATTGGATGATAAAGTAGAAACTTTCCGAAAATGAAA
CTTCTCCGAACATGCGCATACCGACTGAAAATTAACTCTAAGCCAGCCAATGGAATTGAAGCAAAATTCAAGAGAATATT
AATTGACTTCGCGAATGAACTCAAATTTTCTATTGGCGTATTGTGTGTGCCTCATTGTGAGTGGTTGCGATCGCATCTCA
AATTATTTACACACAAAAAAATAACGCACACAGACATTGAATAGATATATTTGATCAAGTCAATATCACAATGTCAATAT
TAGCTTTTTCTGAAGAAAGAAGACGAACTAGAAGAAAAACAACAACGAAATAGATTCGATAAGGCTACTGAGCGATTTTC
ATAATCTAAATATTATTTTATTATTGATACGGACAAAAATTGGTCTTTTACCAAGTACTACTAGATTGTTGATAAAGAGA
GGTTATTTAGATGCTTGGAAAAAATCCTTATGAAACTGCAATGAGCAACGTGTATTCTCTACCTCCGGGAGGTTCTATTT
ACAATATGAACCCGATGAGTATATCATCAGCTGGCTACAACTCTCAACAAGTATCAACACTATCGTTGAACTTGACCGGA
ATCGGACCTCATTCATTAAGCCCAATGAGTGCAAGCATGTCGGGTATAGCTGCAATGGCCGGTGGAATGAGACAAGGTCT
TGAGTTGGGTCTTGGTAGAAGTGATAGTCCAAGAGATAAAAATTCAATTTCCAATAACAACCGACCATATCAAAGAAGTT
ACACTCATGCCAAGCCTCCATACAGTTATATAAGTTTGATAACAATGGCGATTCAAAATTCTCCAGTAAACATGTGCACT
CTATCGGAGATCTATCAATTCATTATGGATCATTTTCCATACTATCGTCAAAATCAACAGCGATGGCAGAATTCGATTCG
ACATTCTTTGTCCTTCAACGATTGCTTTGTTAAGGTTAGTAGAAGCCCAGAAAAACCAGGTAAAGGCTCATATTGGACCT
TGCATCCTCAATCAGGTAACATGTTTGAAAACGGTTGTTATCTCAGAAGACAAAAGCGATTCAAAGATCCACACAGAGAA
ATCGGCAGACAGAGTCAAAGAGCTGCCACTGGTCCTGGATCAAATGTCACAGAAAACAATCACGACAACGCATCGCAAGA
AGCTAGTGATAACGCAGAAAGTGATACGAAACCCAACATCAAGCAACTTGATTTATCAAGCGATCTCTTAACTAATCAAG
GTCATAATATTAAAAATACTAATCCAACTTCTGTTAGTCAGAGTTGTTCGATGTTTCATCGGAAAAAGGAAAACTGCTCA
CCAGTAGAAATGAAATTGAATAACCAAAACCAACAATCAAACCAGCAAGAACATCCACAAATCCATTACAATCCCAATCA
GCAATTCTACTCAAATCAGCAAAACATTTTCCAACAAAGTTCTCTTGATCATTACAGTCTATTAGCATCCGATGATCCTC
TTGGTCAAGGTATGCACTTGCCACCAGGTGCAAATAGTGTTTTCGGACTTTACGGGGCACATAACTTACCAAACGATGAT
CAAATTTCAGTGTCATTACCATCGATATCCTTATCCGGACATCCGTATGACAATTTATCAACAGCAATGGCATATCAATA
TGAAGCATCTCAACACAATTCTTCATTACTAACGACAAGTAATCCGTTCTCAATAGATCGTTTGATGCATCCAAGACTAG
TCGCTGCAGCGATGGGGGTCAGTCCCCATGATACTCTATACGCAGGAGCTACCGGCCCATCAGTTGATCTAGAACACATG
AAATACTACTCAAACTACAACAATGTGCCTCCTTATTCCTCTGCAATGTCTGACTACTACAAATATGTACAAAATCCTCA
GCCGGGCAACAGCGACATGAGTCTTTGAATTGAGTCCATTGAAGTCTACGGCAGTTTCCTCGAAATTTCACATTCAACCA
GATGTTTATCGCCTAATATAAAGCTGTGTTTTTTTATTTATTTACAATTAAATCTTTGTACAAGAGATC

 

back to top


ADDITIONAL REFERENCES:


Adler, C.E., Seidel, C.W., McKinney, S.A., and Sánchez Alvarado, A. (2014). Selective amputation of the pharynx identifies a FoxA-dependent regeneration program in planaria. Elife 3, e02238.

Martín-Durán, J.M., Amaya, E., and Romero, R. (2010). Germ layer specification and axial patterning in the embryonic development of the freshwater planarian Schmidtea polychroa. Dev Biol 340, 145-158.

Martín-Durán, J.M., and Romero, R. (2011). Evolutionary implications of morphogenesis and molecular patterning of the blind gut in the planarian Schmidtea polychroa. Dev Biol 352, 164-176.

Scimone, M.L., Kravarik, K.M., Lapan, S.W., and Reddien, P.W. (2014). Neoblast specialization in regeneration of the planarian Schmidtea mediterranea. Stem Cell Reports 3, 339-352.

 

back to top