pharynx
▻ Planarian Anatomy Ontology Class Overview
▻ Embryonic Molecular Fate Mapping
▻ Description
▻ Figures
▻ In Situ Hybridization Data
▻ Sequences
▻ References
▻ PAGE: Planarian Anatomy Gene Expression
Planarian Anatomy Ontology Class Overview
For more information about the ontology visit PLANA Overview
NAME:
pharynx
DEFINITON:
A plicate and protrusible organ that is the sole point of entry and exit for the Triclad gut. It contains epithelial, muscular, secretory and neuronal cell types.
TERM DEFINITION CITATIONS:
OCLC:16809160
TERM CITATIONS:
Expand publication list
- PMID:16033796
- OCLC:16809160
- PMID:18063757
- PMID:27612384
- PMID:19211673
- PMID:24737865
- PMID:22451003
- PMID:16311336
- PMID:21458439
- PMID:24238224
- PMID:29906446
- PMID:28171748
- PMID:26114597
- PMID:17251262
- PMID:25725068
- PMID:21852957
- PMID:24063805
- PMID:27240733
- PMID:20215344
- PMID:17390146
- PMID:17905225
- PMID:27612382
- PMID:20707997
- PMID:30399335
- PMID:20223763
- PMID:22884275
- PMID:27063937
- PMID:21937596
- https://doi.org/10.1101/279364
- PMID:30471994
- PMID:30237141
- PMID:22125640
- PMID:21747960
- PMID:19174194
- PMID:23297191
- PMID:27122174
- PMID:22339734
- PMID:23123964
- PMID:24922054
- PMID:16890156
- PMID:28126842
- PMID:28287248
- PMID:26062938
- PMID:29291981
- PMID:19852954
- PMID:28245923
- PMID:23250205
- PMID:28495872
- PMID:30729158
- PMID:23405188
- PMID:18786419
- PMID:23079596
- PMID:18063755
- PMID:20967238
- PMID:27163480
- PMID:30282036
- PMID:21356107
- PMID:25017721
- PMID:26525673
- PMID:17942485
- PMID:21295483
- PMID:21806978
- PMID:28686611
- PMID:27034770
- PMID:30383829
- PMID:27501047
- PMID:20422023
- PMID:24704339
- PMID:21179478
- PMID:22411224
- PMID:25356635
- PMID:22371573
- PMID:23318635
- PMID:21282632
- PMID:15866156
- PMID:18456843
- PMID:28072387
- PMID:23629965
- PMID:23954785
- PMID:28434803
- PMID:23652002
- PMID:24173799
- PMID:27074666
- PMID:24131630
- PMID:20511647
- PMID:20865784
- PMID:30194301
- PMID:21894189
- ISBN:9780070316607
- PMID:29674431
- PMID:24120894
- PMID:27441386
- PMID:28461239
- PMID:24040508
- PMID:27150006
- PMID:25558068
- PMID:18287199
- PMID:19048075
- PMID:19766622
- PMID:22543868
- PMID:19247960
- PMID:26457503
- PMID:21664348
- PMID:30962434
- PMID:28292427
- PMID:28893948
- PMID:22439894
- PMID:18202849
- PMID:19933103
- PMID:26711341
- PMID:21828097
- PMID:27551436
- PMID:20599901
- PMID:22385657
- PMID:30485821
- PMID:28807897
- PMID:27654173
- PMID:25956527
- PMID:26459857
- PMID:17670787
- PMID:25254346
- PMID:17376870
TERM ID:
PLANA:0000016
ABOUT THIS TERM:
pharynx
↳is a material entity and organ ↳contained in posterior region of the whole animal and parapharyngeal region
↳existence overlaps Stage 6, Stage 5, juvenile stage, asexual adult, adult hermaphrodite, Stage 8 and Stage 7
↳existence starts during or after Stage 5
↳part of digestive system
→ pharynx progenitor cell and pharynx primordium develops into pharynx
→ pharynx lumen luminal space of pharynx
Expand to see terms that part of pharynx
BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):
Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.
EXPLORE ONTOLOGY GRAPH:
Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.
Embryonic Molecular Fate Mapping
All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource
DESCRIPTION:
foxA1, a pioneer transcription factor required for pharynx maintenance and regeneration during adulthood (Adler et al., 2014; Scimone et al., 2014), may similarly be required for construction of the definitive pharynx during embryogenesis. Development of the definitive pharynx, the single opening of the Smed digestive tract, commenced during S4-S5 with the onset of foxA1 expression in parenchymal cells, many of which were located in the oral hemisphere (Figure 1 – figure supplement 14A). The distribution of foxA1+ cells remained concentrated in and around the developing definitive pharynx rudiment during S6-S8, a pattern reminiscent of that observed in S. polychroa embryos (Martín-Durán et al., 2010), as well as in intact and regenerating Smed asexual adults (Adler et al., 2014; Scimone et al., 2014). The definitive pharynx develops beneath the degenerating temporary embryonic pharynx, and marks the ventral side of the embryos during S6 and thereafter (Martín-Durán and Romero, 2011). foxA1 upregulation during S5-S8 was statistically significant, albeit the adjusted p-values were above the thresholds set for inclusion in the enriched transcript lists presented in Figure 1 – source data 5, Figure 1 – source data 6, Figure 1 – source data 7, Figure 1 – source data 8. meis, a transcription factor coexpressed in foxA1+ neoblasts and expressed within the regenerating pharynx (Scimone et al., 2014), was among the S5 enriched transcripts (Figure 1 – source data 5); its expression trend was similar to foxA1 during embryogenesis (Figure 1 – figure supplement 14B). Two markers exhibiting pharynx-restricted expression in adults, laminin and npp-1 (Adler et al., 2014), were upregulated during S6-S8, after development of the definitive pharynx rudiment was evident (Figure 1 – figure supplement 14B).
FIGURES:
Figure 1 – figure supplement 14: Molecular markers for the definitive pharynx
A: WISH developmental time course using foxA1 riboprobes (blue), S3-S8. foxA1 expression was consistently detected in the embryonic pharynx lumen during S3-S5 (black arrowheads). Anterior: top (S6-S8). Black arrowheads: embryonic pharynx. Red arrowheads: definitive pharynx. O: oral hemisphere. A: aboral hemisphere. D: dorsal. V: ventral. Scale bars: 100 µm.
B: Average RPKM values per embryo for the definitive pharynx markers foxA1, meis, laminin, npp-1 during embryogenesis (Adler et al., 2014; Scimone et al., 2014), Y (yolk), Stage (S) S2-S8.
IN SITU HYBRIDIZATION DATA:
Smed ID Accession Name Alias Expressed during stage(s) Tissue/Pattern Images
SMED30027428 AFJ24799.1 forkhead box A-1 foxA1 Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8 embryonic digestive system, digestive system, pharynx, pharynx progenitor cell, embryonic pharynx 
Click to see image symbols and abbreviations
Abbreviation or symbol Definition
O oral hemisphere
A aboral hemisphere
D dorsal
V ventral
L lateral
black arrowhead embryonic pharynx
red arrowhead definitive pharynx
black arrows primitive gut
yellow arrows primitive ectoderm cells
cyan arrows brain
cyan arrowheads nerve cords
blue arrowheads eye progenitors (trail cells)
purple arrowheads eyes
scale bar 100 µm
SEQUENCES:
smed_20140614 transcript sequences for genes validated by in situ hybridization (above).
>SMED30027428 ID=SMED30027428|Name=forkhead box A-1|organism=Schmidtea mediterranea sexual|type=transcript|length=2149bp
ATCACTTGGTGCTGCTTTTTGCCCCGATAAATCTCTCGGTGCTCCAAAATTTGTGTAAGCGAGCAAAAGATGATTGGGCA
ATTTCTAGCACGTCATTCGGCAACGATGTTTACAAGTTTCTCTGATTGGATGATAAAGTAGAAACTTTCCGAAAATGAAA
CTTCTCCGAACATGCGCATACCGACTGAAAATTAACTCTAAGCCAGCCAATGGAATTGAAGCAAAATTCAAGAGAATATT
AATTGACTTCGCGAATGAACTCAAATTTTCTATTGGCGTATTGTGTGTGCCTCATTGTGAGTGGTTGCGATCGCATCTCA
AATTATTTACACACAAAAAAATAACGCACACAGACATTGAATAGATATATTTGATCAAGTCAATATCACAATGTCAATAT
TAGCTTTTTCTGAAGAAAGAAGACGAACTAGAAGAAAAACAACAACGAAATAGATTCGATAAGGCTACTGAGCGATTTTC
ATAATCTAAATATTATTTTATTATTGATACGGACAAAAATTGGTCTTTTACCAAGTACTACTAGATTGTTGATAAAGAGA
GGTTATTTAGATGCTTGGAAAAAATCCTTATGAAACTGCAATGAGCAACGTGTATTCTCTACCTCCGGGAGGTTCTATTT
ACAATATGAACCCGATGAGTATATCATCAGCTGGCTACAACTCTCAACAAGTATCAACACTATCGTTGAACTTGACCGGA
ATCGGACCTCATTCATTAAGCCCAATGAGTGCAAGCATGTCGGGTATAGCTGCAATGGCCGGTGGAATGAGACAAGGTCT
TGAGTTGGGTCTTGGTAGAAGTGATAGTCCAAGAGATAAAAATTCAATTTCCAATAACAACCGACCATATCAAAGAAGTT
ACACTCATGCCAAGCCTCCATACAGTTATATAAGTTTGATAACAATGGCGATTCAAAATTCTCCAGTAAACATGTGCACT
CTATCGGAGATCTATCAATTCATTATGGATCATTTTCCATACTATCGTCAAAATCAACAGCGATGGCAGAATTCGATTCG
ACATTCTTTGTCCTTCAACGATTGCTTTGTTAAGGTTAGTAGAAGCCCAGAAAAACCAGGTAAAGGCTCATATTGGACCT
TGCATCCTCAATCAGGTAACATGTTTGAAAACGGTTGTTATCTCAGAAGACAAAAGCGATTCAAAGATCCACACAGAGAA
ATCGGCAGACAGAGTCAAAGAGCTGCCACTGGTCCTGGATCAAATGTCACAGAAAACAATCACGACAACGCATCGCAAGA
AGCTAGTGATAACGCAGAAAGTGATACGAAACCCAACATCAAGCAACTTGATTTATCAAGCGATCTCTTAACTAATCAAG
GTCATAATATTAAAAATACTAATCCAACTTCTGTTAGTCAGAGTTGTTCGATGTTTCATCGGAAAAAGGAAAACTGCTCA
CCAGTAGAAATGAAATTGAATAACCAAAACCAACAATCAAACCAGCAAGAACATCCACAAATCCATTACAATCCCAATCA
GCAATTCTACTCAAATCAGCAAAACATTTTCCAACAAAGTTCTCTTGATCATTACAGTCTATTAGCATCCGATGATCCTC
TTGGTCAAGGTATGCACTTGCCACCAGGTGCAAATAGTGTTTTCGGACTTTACGGGGCACATAACTTACCAAACGATGAT
CAAATTTCAGTGTCATTACCATCGATATCCTTATCCGGACATCCGTATGACAATTTATCAACAGCAATGGCATATCAATA
TGAAGCATCTCAACACAATTCTTCATTACTAACGACAAGTAATCCGTTCTCAATAGATCGTTTGATGCATCCAAGACTAG
TCGCTGCAGCGATGGGGGTCAGTCCCCATGATACTCTATACGCAGGAGCTACCGGCCCATCAGTTGATCTAGAACACATG
AAATACTACTCAAACTACAACAATGTGCCTCCTTATTCCTCTGCAATGTCTGACTACTACAAATATGTACAAAATCCTCA
GCCGGGCAACAGCGACATGAGTCTTTGAATTGAGTCCATTGAAGTCTACGGCAGTTTCCTCGAAATTTCACATTCAACCA
GATGTTTATCGCCTAATATAAAGCTGTGTTTTTTTATTTATTTACAATTAAATCTTTGTACAAGAGATC
ADDITIONAL REFERENCES:
Adler, C.E., Seidel, C.W., McKinney, S.A., and Sánchez Alvarado, A. (2014). Selective amputation of the pharynx identifies a FoxA-dependent regeneration program in planaria. Elife 3, e02238.
Martín-Durán, J.M., Amaya, E., and Romero, R. (2010). Germ layer specification and axial patterning in the embryonic development of the freshwater planarian Schmidtea polychroa. Dev Biol 340, 145-158.
Martín-Durán, J.M., and Romero, R. (2011). Evolutionary implications of morphogenesis and molecular patterning of the blind gut in the planarian Schmidtea polychroa. Dev Biol 352, 164-176.
Scimone, M.L., Kravarik, K.M., Lapan, S.W., and Reddien, P.W. (2014). Neoblast specialization in regeneration of the planarian Schmidtea mediterranea. Stem Cell Reports 3, 339-352.
PAGE: Planarian Anatomy Gene Expression
These transcripts were reported as being expressed in pharynx. Click this link to learn more about PAGE.
PAGE Curations: 3229
PLANA Term Reference Transcript Description Gene Models Published Transcript Transcriptome Publication Specimen Lifecycle Evidence pharynx SMED30022468 secreted frizzled-related protein 1 SMESG000075831.1 SMESG000029446.1 EU296635 smed_ncbi_20200123 PMID:24704339
Vogg et al., 2014
pharynx SMED30029487 Smed-NDK SMESG000062038.1 GU592830.1 smed_ncbi_20200123 PMID:24704339
Vogg et al., 2014
pharynx SMED30005045 zinc finger protein A SMESG000022958.1 KF751216.1 smed_ncbi_20200123 PMID:24704339
Vogg et al., 2014
pharynx SMED30027297 winged helix/forkhead transcription factor SMESG000077075.1 KC577557.1 smed_ncbi_20200123 PMID:24704339
Vogg et al., 2014
pharynx SMED30027297 winged helix/forkhead transcription factor SMESG000077075.1 KC577557 smed_ncbi_20200123 PMID:24704339
Vogg et al., 2014
pharynx SMED30031256 wntP-2 SMESG000066476.1 wntP-2 smed_ncbi_20200123 PMID:23318641
Chen et al., 2013
pharynx SMED30027299 PBX SMESG000022232.1 SMESG000001913.1 KC353351.1 smed_ncbi_20200123 PMID:23318641
Chen et al., 2013
pharynx SMED30020359 Smed-NDK-3 SMESG000046244.1 SMESG000046208.1 GU592832.1 smed_ncbi_20200123 PMID:23318641
Chen et al., 2013
pharynx SMED30026602 Wnt2-1 SMESG000002069.1 FJ463753.1 smed_ncbi_20200123 PMID:23318641
Chen et al., 2013
pharynx SMED30012677 Coiled-coil domain-containing protein 51 SMESG000058452.1 Contig1190 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30012677 Coiled-coil domain-containing protein 51 SMESG000058452.1 Contig1190 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30012677 Coiled-coil domain-containing protein 51 SMESG000057519.1 Contig1190 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30012677 Coiled-coil domain-containing protein 51 SMESG000057519.1 Contig1190 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30020784 SMED30020784 SMESG000011782.1 Contig1076 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30023915 Vacuolar-sorting protein SNF8 SMESG000016990.1 Contig1765 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30008091 Serine/threonine-protein kinase PLK SMESG000012131.1 SMESG000012127.1 Contig809 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30008091 Serine/threonine-protein kinase PLK SMESG000027686.1 Contig2364 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30008091 Serine/threonine-protein kinase PLK SMESG000012131.1 SMESG000012127.1 Contig2364 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30008147 SMED30008147 SMESG000053405.1 Contig1766 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30008147 SMED30008147 SMESG000053405.1 Contig1766 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30008147 SMED30008147 SMESG000046314.1 SMESG000028362.1 Contig1766 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30008147 SMED30008147 SMESG000046314.1 SMESG000028362.1 Contig1766 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30004606 Cytochrome P450 2K1-like protein SMESG000020470.1 Contig1680 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30014474 Tumor susceptibility gene 101 protein SMESG000049597.1 Contig5044 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30014474 Tumor susceptibility gene 101 protein SMESG000004871.1 Contig5044 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30016832 SH3 domain-binding protein 5-like SMESG000061052.1 Contig4742 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30016832 SH3 domain-binding protein 5-like SMESG000061052.1 Contig4742 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30016832 SH3 domain-binding protein 5-like SMESG000022856.1 Contig4742 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30016832 SH3 domain-binding protein 5-like SMESG000022856.1 Contig4742 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30023334 Partitioning defective 6 SMESG000066854.1 Contig3688 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30023334 Partitioning defective 6 SMESG000026500.1 Contig3688 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30020872 Myosin IE SMESG000003513.1 Contig59 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30020872 Myosin IE SMESG000068232.1 Contig59 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30016022 SMED30016022 SMESG000053405.1 Contig1766 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30016022 SMED30016022 SMESG000053405.1 Contig1766 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30016022 SMED30016022 SMESG000046314.1 SMESG000028362.1 Contig1766 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30016022 SMED30016022 SMESG000046314.1 SMESG000028362.1 Contig1766 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30019715 Tumor protein p63-regulated gene 1 protein SMESG000038153.1 SMESG000018862.1 Contig1 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30019715 Tumor protein p63-regulated gene 1 protein SMESG000033840.1 Contig1 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30015161 Vacuolar protein sorting-associated protein 45 SMESG000053405.1 Contig1766 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30015161 Vacuolar protein sorting-associated protein 45 SMESG000046314.1 SMESG000028362.1 Contig1766 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30002822 RING-type domain-containing protein SMESG000076385.1 SMESG000076375.1 SMESG000076363.1 SMESG000076223.1 SMESG000076482.1 SMESG000076470.1 SMESG000076410.1 SMESG000076358.1 Contig1645 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30014928 Formin-like protein SMESG000044336.1 Contig1407 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30014928 Formin-like protein SMESG000015063.1 Contig1407 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30033014 Phosphatidylinositol-4,5-bisphosphate 4-phosphatase SMESG000063221.1 Contig1068 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30021127 SMED30021127 SMESG000037626.1 Contig1315 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30021127 SMED30021127 SMESG000037626.1 Contig1315 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30021127 SMED30021127 SMESG000048042.1 Contig1315 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30021127 SMED30021127 SMESG000048042.1 Contig1315 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30015409 cAMP-responsive element modulator SMESG000016695.1 Contig4585 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30015409 cAMP-responsive element modulator SMESG000033655.1 Contig4585 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30003053 1-acyl-sn-glycerol-3-phosphate acyltransferase delta SMESG000081135.1 Contig3433 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30007716 Ankyrin repeat domain 28b SMESG000060640.1 Contig3408 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30007716 Ankyrin repeat domain 28b SMESG000074871.1 Contig3408 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30013976 SMED30013976 SMESG000003513.1 Contig59 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30013976 SMED30013976 SMESG000003513.1 Contig59 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30013976 SMED30013976 SMESG000068232.1 Contig59 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30013976 SMED30013976 SMESG000068232.1 Contig59 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30014138 LIM homeobox 1b SMESG000061052.1 Contig4742 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30014138 LIM homeobox 1b SMESG000022856.1 Contig4742 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30011213 Osteoclast-stimulating factor 1 SMESG000004952.1 Contig516 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30017937 WASP like actin nucleation promoting factor b SMESG000036683.1 Contig4572 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30017937 WASP like actin nucleation promoting factor b SMESG000074788.1 Contig4572 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30021698 14-3-3 protein epsilon SMESG000047644.1 Contig5316 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30033333 SMED30033333 SMESG000004952.1 Contig516 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30022398 C2H2-type domain-containing protein SMESG000032119.1 Contig3970 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30001281 SMED30001281 SMESG000038153.1 SMESG000018862.1 Contig1 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30001281 SMED30001281 SMESG000033840.1 Contig1 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30011780 Si:ch73-222h13.1 SMESG000081135.1 Contig3433 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30011780 Si:ch73-222h13.1 SMESG000081135.1 Contig3433 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30008321 SMED30008321 SMESG000068172.1 Contig3306 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30008321 SMED30008321 SMESG000068172.1 Contig3306 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30008321 SMED30008321 SMESG000025870.1 Contig3306 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30008321 SMED30008321 SMESG000025870.1 Contig3306 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30013865 OFD1 SMESG000046592.1 dd_Smed_v4_13339_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001550 Flagellar outer dynein arm light chain 2 dd_Smed_v4_19018_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30015125 SMED30015125 SMESG000061766.1 dd_Smed_v4_12632_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30015973 myosin-11 SMESG000064787.1 dd_Smed_v4_13489_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30015703 IQ domain-containing protein D SMESG000017912.1 dd_Smed_v4_7079_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30017612 SMED30017612 SMESG000007344.1 dd_Smed_v4_5456_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30010695 coiled-coil domain-containing protein 170 SMESG000048767.1 dd_Smed_v4_7066_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30005442 General transcription factor II-I repeat domain-containing protein 2A dd_Smed_v4_14922_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30000207 SMED30000207 dd_Smed_v4_45021_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30016880 Zinc finger Ran-binding domain-containing protein 2 SMESG000017096.1 dd_Smed_v4_1397_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30011381 HORMA domain-containing protein SMESG000066514.1 dd_Smed_v4_2201_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30019802 SMED30019802 SMESG000017096.1 dd_Smed_v4_1397_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001079 PSDC domain-containing protein SMESG000023831.1 dd_Smed_v4_5455_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30005276 SMED30005276 SMESG000014888.1 dd_Smed_v4_7268_1_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30006326 piggyBac transposable element-derived protein 4-like dd_Smed_v4_14301_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30011189 Arfaptin-2 SMESG000011384.1 dd_Smed_v4_5732_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30015183 Leucine-rich repeat-containing protein 9 SMESG000021671.1 dd_Smed_v4_14851_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30017298 SMED30017298 dd_Smed_v4_17790_0_2 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013459 SMED30013459 dd_Smed_v4_16904_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30002064 Doublecortin domain-containing protein 2 SMESG000040482.1 SMESG000040481.1 SMESG000040480.1 SMESG000038137.1 dd_Smed_v4_6464_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013261 Retrovirus-related Pol polyprotein from transposon dd_Smed_v4_15498_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012385 C2H2-type domain-containing protein dd_Smed_v4_17695_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30018493 Ras and EF-hand domain-containing protein SMESG000028852.1 dd_Smed_v4_12567_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30015588 SMED30015588 SMESG000009089.1 dd_Smed_v4_5692_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30018439 XK-related protein SMESG000080414.1 dd_Smed_v4_2770_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021087 SMED30021087 SMESG000014860.1 dd_Smed_v4_6894_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023104 SMED30023104 dd_Smed_v4_1576_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30020855 Guanine nucleotide-binding protein G(o) subunit alpha SMESG000081490.1 dd_Smed_v4_1635_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30028419 TATA-box-binding protein SMESG000068211.1 dd_Smed_v4_17006_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023491 SMED30023491 dd_Smed_v4_14238_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023859 Serine/threonine protein phosphatase 2A regulatory subunit SMESG000026797.1 dd_Smed_v4_6134_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30026086 MIEAP domain-containing protein SMESG000057251.1 dd_Smed_v4_14351_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023613 SMED30023613 dd_Smed_v4_12778_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021143 Basal body-orientation factor 1 SMESG000078046.1 dd_Smed_v4_9328_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022653 Stromal interaction molecule 1 SMESG000081265.1 dd_Smed_v4_12888_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30029763 histone H1 SMESG000024348.1 SMESG000010800.1 dd_Smed_v4_601_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30030837 cilia- and flagella-associated protein 299 SMESG000052708.1 dd_Smed_v4_11277_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30033785 Cell division cycle and apoptosis regulator protein 1 dd_Smed_v4_1181_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021189 SMED30021189 SMESG000081490.1 dd_Smed_v4_1635_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30026311 SMED30026311 SMESG000030467.1 dd_Smed_v4_15263_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30025849 Centrosome and spindle pole-associated protein 1 SMESG000080361.1 dd_Smed_v4_13453_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30020686 Transmembrane protein 80 SMESG000018777.1 dd_Smed_v4_13318_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30025629 Enkurin domain-containing protein SMESG000020205.1 dd_Smed_v4_12663_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30029902 Protein kinase domain-containing protein SMESG000074943.1 SMESG000074941.1 dd_Smed_v4_6760_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023430 set nuclear proto-oncogene SMESG000031906.1 SMESG000031905.1 dd_Smed_v4_618_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30029492 KN motif and ankyrin repeat domain-containing protein 4 isoform X2 SMESG000059500.1 dd_Smed_v4_7499_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30026877 HORMA domain-containing protein SMESG000066514.1 dd_Smed_v4_2201_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30020913 SMED30020913 SMESG000009078.1 dd_Smed_v4_13484_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30029370 Glucose-6-phosphate isomerase SMESG000067583.1 dd_Smed_v4_1398_1_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30029583 SMED30029583 dd_Smed_v4_1338_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30027086 SMED30027086 dd_10213 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30030699 Ephrin type-A receptor 4-B SMESG000077240.1 dd_Smed_v4_16483_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30034308 Integrase catalytic domain-containing protein dd_Smed_v4_12778_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30032947 cilia- and flagella-associated protein 46 SMESG000014116.1 SMESG000014118.1 dd_Smed_v4_14103_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30029781 SMED30029781 dd_Smed_v4_1213_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30024583 SMED30024583 dd_Smed_v4_215_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30032225 SMED30032225 dd_Smed_v4_16904_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30020537 SMED30020537 SMESG000040594.1 dd_Smed_v4_1676_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30028337 SAP domain-containing protein dd_Smed_v4_1181_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30028343 Cytosolic carboxypeptidase 2 SMESG000006325.1 dd_Smed_v4_13454_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30024648 RRM domain-containing protein dd_Smed_v4_11998_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30015586 TAR DNA-binding protein 43 SMESG000048176.1 dd_Smed_v4_12522_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30014135 ankyrin repeat and MYND domain-containing protein 1-like SMESG000039917.1 dd_Smed_v4_12515_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30017874 PRKCA-binding protein SMESG000013976.1 dd_Smed_v4_11769_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30008623 Phospholipase B-like SMESG000022762.1 dd_Smed_v4_485_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012622 Intraflagellar transport 43 SMESG000067883.1 dd_Smed_v4_5237_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30015672 Gelsolin-like protein SMESG000015928.1 dd_Smed_v4_1215_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30002502 Choline-phosphate cytidylyltransferase SMESG000081359.1 dd_Smed_v4_5385_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001113 FERM domain-containing protein SMESG000048801.1 dd_Smed_v4_5600_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30014094 Kinesin-like protein SMESG000016386.1 dd_Smed_v4_11012_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30008165 Connector enhancer of kinase suppressor of ras 2 SMESG000044449.1 SMESG000044448.1 dd_Smed_v4_4457_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30019494 Ubiquitin-fold modifier-conjugating enzyme 1 SMESG000068795.1 dd_Smed_v4_4590_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30000566 Ropporin-1-like protein SMESG000079804.1 dd_Smed_v4_4888_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30016479 SMED30016479 SMESG000037733.1 dd_Smed_v4_12359_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30011695 Alpha-galactosidase SMESG000009912.1 dd_Smed_v4_606_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30007110 Myosin light chain 1 SMESG000018597.1 dd_Smed_v4_4478_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30000819 Acid sphingomyelinase-like phosphodiesterase SMESG000071517.1 dd_Smed_v4_5377_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30019518 SMED30019518 SMESG000073002.1 SMESG000072984.1 dd_Smed_v4_12680_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30018507 Calcium-transporting ATPase SMESG000038461.1 dd_Smed_v4_4559_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30018507 Calcium-transporting ATPase SMESG000038461.1 dd_Smed_v4_3170_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30011335 Dynein heavy chain 10, axonemal SMESG000051829.1 dd_Smed_v4_12797_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30011335 Dynein heavy chain 10, axonemal SMESG000051829.1 dd_Smed_v4_5169_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30016848 SMED30016848 SMESG000079496.1 dd_Smed_v4_6860_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30000512 cilia- and flagella-associated protein 61 SMESG000059955.1 dd_Smed_v4_4908_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30007780 Collagen alpha-6(VI) chain SMESG000046770.1 dd_Smed_v4_7616_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30011581 AP2-associated protein kinase 1-like Protein SMESG000041938.1 SMESG000041937.1 SMESG000051989.1 dd_Smed_v4_1179_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30014550 Intraflagellar transport protein 43 SMESG000067883.1 dd_Smed_v4_5237_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30005253 EF-hand domain-containing family member C2 SMESG000076759.1 dd_Smed_v4_6035_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30002256 coiled-coil domain-containing protein 81 SMESG000036887.1 dd_Smed_v4_6753_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30009251 coiled-coil domain-containing protein 146 SMESG000006416.1 dd_Smed_v4_6858_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013884 SMED30013884 SMESG000049207.1 SMESG000049205.1 SMESG000049063.1 dd_Smed_v4_11081_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001254 SMED30001254 SMESG000025206.1 dd_Smed_v4_4615_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001147 Ras-like GTP-binding protein YPT1 SMESG000044147.1 dd_Smed_v4_6181_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30005883 Coiled-coil domain containing 81 SMESG000036887.1 dd_Smed_v4_6753_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30007496 C-type lectin domain-containing protein SMESG000016262.1 dd_Smed_v4_5187_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30017615 SMED30017615 SMESG000016882.1 dd_Smed_v4_12216_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30000108 Glycerol-3-phosphate dehydrogenase [NAD( )] SMESG000008767.1 dd_Smed_v4_4661_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30014347 plexin A SMESG000049328.1 SMESG000006542.1 SMESG000006541.1 dd_Smed_v4_11934_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012699 Protein CLP1 homolog SMESG000020165.1 dd_Smed_v4_11378_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30000248 Ras-related protein Rab-11A SMESG000016036.1 dd_Smed_v4_4964_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30030227 flotillin-2 SMESG000059332.1 Contig5500 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30030227 flotillin-2 SMESG000024114.1 Contig5500 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30032408 SMED30032408 SMESG000027686.1 Contig2364 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30032408 SMED30032408 SMESG000012131.1 SMESG000012127.1 Contig2364 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30032354 EOG090X01A3 SMESG000068156.1 SMESG000064685.1 SMESG000043474.1 SMESG000010609.1 SMESG000076470.1 SMESG000073857.1 SMESG000062429.1 SMESG000058575.1 SMESG000053533.1 SMESG000020635.1 SMESG000015751.1 SMESG000005260.1 Contig246 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30032354 EOG090X01A3 SMESG000000175.1 Contig246 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30028347 Engulfment and cell motility 3 SMESG000013936.1 Contig1935 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30028347 Engulfment and cell motility 3 SMESG000039535.1 Contig1935 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30020811 SMED30020811 SMESG000005612.1 Contig594 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30020811 SMED30020811 SMESG000005612.1 Contig594 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30020811 SMED30020811 SMESG000011575.1 Contig594 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30020811 SMED30020811 SMESG000011575.1 Contig594 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30021511 SMED30021511 SMESG000038232.1 Contig5776 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30015310 DUF3421 domain-containing protein SMESG000046710.1 SMESG000046697.1 PL020001000E05 ncbi_smed_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30016397 Transforming acidic coiled-coil-containing protein 3 SMESG000056367.1 PL08003B2C03 ncbi_smed_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30017282 nuclear factor Y complex B2 SMESG000040141.1 KU366700 smed_ncbi_20200123 PMID:27304889
Iyer et al., 2016
pharynx SMED30022468 secreted frizzled-related protein 1 SMESG000075831.1 SMESG000029446.1 ABY85212.1 smed_ncbi_20200123 PMID:20707997
Gurley et al., 2010
pharynx SMED30022468 secreted frizzled-related protein 1 SMESG000075831.1 SMESG000029446.1 EU296635 smed_ncbi_20200123 PMID:20707997
Gurley et al., 2010
pharynx SMED30022929 WntA SMESG000051375.1 ACJ64865.1 smed_ncbi_20200123 PMID:20707997
Gurley et al., 2010
pharynx SMED30022929 WntA SMESG000051375.1 FJ463750.1 smed_ncbi_20200123 PMID:20707997
Gurley et al., 2010
pharynx SMED30022929 WntA SMESG000051375.1 FJ463750 smed_ncbi_20200123 PMID:20707997
Gurley et al., 2010
pharynx SMED30025497 secreted frizzled related protein 2 SMESG000050379.1 ADO51625.1 smed_ncbi_20200123 PMID:20707997
Gurley et al., 2010
pharynx SMED30019722 secreted frizzled related protein 3 SMESG000058717.1 SMED30019722 smed_20140614 PMID:20707997
Gurley et al., 2010
pharynx SMED30019722 secreted frizzled related protein 3 SMESG000058717.1 HM751832.1 smed_ncbi_20200123 PMID:20707997
Gurley et al., 2010
pharynx SMED30016141 lissencephaly-1 SMESG000054739.1 SMESG000035997.1 JQ650355.1 smed_ncbi_20200123 PMID:22411224
Cowles et al., 2012
pharynx SMED30001081 NudC nuclear distribution protein SMESG000036795.1 DN303982.1 ncbi_smed_ests PMID:22411224
Cowles et al., 2012
pharynx SMED30020436 Nuclear distribution protein nudE-like 1 SMESG000016071.1 HO006501.1 ncbi_smed_ests PMID:22411224
Cowles et al., 2012
pharynx SMED30004930 Irregular chiasm C-roughest-like isoform X2 SMESG000077979.1 dd_Smed_v4_12549_0_1 dd_Smed_v4 PMID:27063937
Scimone et al., 2016
pharynx SMED30013316 Polycomb group RING finger protein 1 SMESG000072501.1 dd_Smed_v4_12753_0_1 dd_Smed_v4 PMID:27063937
Scimone et al., 2016
pharynx SMED30001690 SMED30001690 SMESG000069322.1 dd_Smed_v4_12571_0_1 dd_Smed_v4 PMID:27063937
Scimone et al., 2016
pharynx SMED30000553 Epithelial discoidin domain-containing receptor SMESG000069322.1 dd_Smed_v4_12571_0_1 dd_Smed_v4 PMID:27063937
Scimone et al., 2016
pharynx SMED30033884 FERM, RhoGEF and pleckstrin domain-containing protein 1 SMESG000069407.1 dd_Smed_v4_12715_0_1 dd_Smed_v4 PMID:27063937
Scimone et al., 2016
pharynx SMED30025810 SMED30025810 SMESG000019718.1 dd_Smed_v4_2749_0_1 dd_Smed_v4 PMID:27063937
Scimone et al., 2016
pharynx SMED30005718 Guanine nucleotide-binding protein G(I) subunit alpha SMESG000026774.1 Gpas smed_ncbi_20200123 PMID:24992682
Vásquez-Doorman et al., 2014
pharynx SMED30020522 ap2 SMESG000022356.1 JX010470.1 smed_ncbi_20200123 PMID:24992682
Vásquez-Doorman et al., 2014
pharynx SMED30005045 zinc finger protein A SMESG000022958.1 dd_Smed_v4_22585_0_1 dd_Smed_v4 PMID:24992682
Vásquez-Doorman et al., 2014
pharynx SMED30005045 zinc finger protein A SMESG000022958.1 KF751216.1 smed_ncbi_20200123 PMID:24992682
Vásquez-Doorman et al., 2014
pharynx SMED30031425 Homeobox protein Hox-D12 SMESG000003389.1 SMED30031425 smed_20140614 PMID:27034770
Currie et al., 2016
pharynx SMED30024673 SMED30024673 SMESG000067310.1 SmedASXL_065556 SmedAsxl_ww_GCZZ01 PMID:29158443
He et al., 2017
pharynx SMED30022468 secreted frizzled-related protein 1 SMESG000075831.1 SMESG000029446.1 EU296635 smed_ncbi_20200123 PMID:25558068
Reuter et al., 2015
pharynx SMED30029487 Smed-NDK SMESG000062038.1 GU592830.1 smed_ncbi_20200123 PMID:25558068
Reuter et al., 2015
pharynx SMED30022963 anaphase-promoting complex subunit 1 SMESG000010770.1 SMESG000012375.1 tr5_7361 mu_Smed_v1 PMID:25558068
Reuter et al., 2015
pharynx SMED30018250 Telomerase-binding protein EST1A tr5_9369 mu_Smed_v1 PMID:25558068
Reuter et al., 2015
pharynx SMED30013810 Teashirt SMESG000008973.1 KP003815.1 smed_ncbi_20200123 PMID:25558068
Reuter et al., 2015
pharynx SMED30012814 Protein CWC15-like protein SMESG000010770.1 SMESG000012375.1 tr5_7361 mu_Smed_v1 PMID:25558068
Reuter et al., 2015
pharynx SMED30034772 Fibrillar collagen NC1 domain-containing protein SMESG000077977.1 tr5_2051 mu_Smed_v1 PMID:25558068
Reuter et al., 2015
pharynx SMED30016511 SMED30016511 SMESG000072006.1 tr5_6444 mu_Smed_v1 PMID:25558068
Reuter et al., 2015
pharynx SMED30005458 Phosphatidylinositol 4-kinase type 2-beta SMESG000074718.1 tr5_11049 mu_Smed_v1 PMID:25558068
Reuter et al., 2015
pharynx SMED30013810 Teashirt SMESG000008973.1 KP003815.1 smed_ncbi_20200123 PMID:25725068
Owen et al., 2015
pharynx SMED30001404 Dual specificity tyrosine-phosphorylation-regulated kinase 2 SMESG000076586.1 SMESG000076583.1 dd_Smed_v4_12119_1_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30000918 Coiled-coil domain containing 13 SMESG000058204.1 dd_Smed_v4_12055_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30014199 Myosin SMESG000047361.1 dd_Smed_v4_4503_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001362 SMEDWI-3 SMESG000081970.1 dd_Smed_v4_1258_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30002156 TNF receptor associated factor-2 SMESG000065606.1 SMESG000000563.1 SMESG000000559.1 SMESG000000493.1 SMESG000000294.1 dd_Smed_v4_1243_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30014144 Phytanoyl-CoA dioxygenase domain-containing protein 1-like SMESG000023010.1 dd_Smed_v4_1207_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30002139 Vacuole membrane protein 1 SMESG000034612.1 dd_Smed_v4_1156_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001681 SMED30001681 SMESG000049443.1 dd_Smed_v4_1193_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001366 SMED30001366 SMESG000014648.1 dd_Smed_v4_1227_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30005046 Dynein heavy chain, axonemal SMESG000050247.1 SMESG000050248.1 dd_Smed_v4_10191_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30005046 Dynein heavy chain, axonemal SMESG000050247.1 dd_Smed_v4_13135_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30015061 G protein regulated inducer of neurite outgrowth SMESG000062691.1 dd_Smed_v4_10294_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30007001 SMED30007001 SMESG000072162.1 dd_Smed_v4_537_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023483 INX-13 SMESG000043575.1 dd_Smed_v4_11501_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30016546 SMED30016546 SMESG000051921.1 SMESG000051913.1 dd_Smed_v4_1175_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012858 serine/threonine-protein kinase DCLK1 SMESG000078466.1 dd_Smed_v4_13093_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012858 serine/threonine-protein kinase DCLK1 dd_Smed_v4_5129_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30019258 Cytosolic carboxypeptidase 2 SMESG000058240.1 dd_Smed_v4_13450_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013901 SMED30013901 SMESG000019480.1 dd_Smed_v4_12627_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30018865 DUF1619 domain-containing protein SMESG000057489.1 dd_Smed_v4_11225_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30014047 SMED30014047 SMESG000025950.1 dd_Smed_v4_12336_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30020291 Centrosomal protein 104 SMESG000023549.1 dd_Smed_v4_10228_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30020784 SMED30020784 SMESG000011782.1 dd_Smed_v4_10359_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021590 Spectrin beta chain SMESG000081696.1 dd_Smed_v4_1122_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023718 Histone-lysine N-methyltransferase SMESG000081033.1 dd_Smed_v4_10189_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30025688 Protein tilB homolog SMESG000058220.1 dd_Smed_v4_10124_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021807 SMED30021807 SMESG000030582.1 dd_Smed_v4_1124_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022848 Synaptotagmin VIa SMESG000043595.1 dd_Smed_v4_12716_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021977 Beta-1,3-galactosyltransferase 1 SMESG000035184.1 dd_Smed_v4_11741_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021820 Guanylate cyclase SMESG000056411.1 dd_Smed_v4_11767_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023487 Protein LSM14 homolog B-A SMESG000014632.1 dd_Smed_v4_1125_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30004754 RNA-binding protein 8A SMESG000051885.1 dd_Smed_v4_1169_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30008091 Serine/threonine-protein kinase PLK SMESG000012127.1 dd_Smed_v4_1620_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30009052 60S ribosomal protein L18 SMESG000017166.1 dd_Smed_v4_128_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30002882 SMED30002882 SMESG000069367.1 dd_Smed_v4_11838_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30002882 SMED30002882 SMESG000069367.1 dd_Smed_v4_9233_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30007680 serine/threonine-protein kinase DCLK1 SMESG000078466.1 dd_Smed_v4_13093_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30007680 serine/threonine-protein kinase DCLK1 dd_Smed_v4_5129_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30011703 Death domain-containing protein SMESG000040750.1 dd_Smed_v4_11696_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30008769 40S ribosomal protein S10 SMESG000034720.1 dd_Smed_v4_117_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30011715 Splicing factor, arginine/serine-rich 6 SMESG000041210.1 dd_Smed_v4_1177_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30009968 Intraflagellar transport protein 122 homolog SMESG000039305.1 SMESG000039304.1 dd_Smed_v4_11912_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30010620 Histone acetyltransferase SMESG000017094.1 dd_Smed_v4_12274_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30009144 CCDC66 domain-containing protein SMESG000019367.1 dd_Smed_v4_11800_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30009869 fas-binding factor 1 homolog SMESG000037546.1 dd_Smed_v4_12735_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30009869 fas-binding factor 1 homolog SMESG000037546.1 dd_Smed_v4_12422_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30007993 GTP-binding protein SMESG000065983.1 dd_Smed_v4_11291_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012985 Protein FAM188B SMESG000064698.1 dd_Smed_v4_13105_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30011832 Enkurin domain-containing protein SMESG000081414.1 dd_Smed_v4_12339_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30017201 SFI1 SMESG000002829.1 dd_Smed_v4_12484_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013262 SMED30013262 SMESG000060779.1 dd_Smed_v4_11792_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001975 vasohibin-2 SMESG000072424.1 dd_Smed_v4_12833_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30002934 forkhead box J1-like protein 4 SMESG000010030.1 dd_Smed_v4_10152_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30011699 calcium/calmodulin-dependent protein kinase type IV SMESG000042100.1 dd_Smed_v4_10731_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30002822 RING-type domain-containing protein SMESG000076482.1 SMESG000076470.1 SMESG000076469.1 SMESG000076410.1 SMESG000076409.1 SMESG000076408.1 SMESG000076407.1 SMESG000076406.1 SMESG000076390.1 SMESG000076389.1 SMESG000076385.1 SMESG000076375.1 SMESG000076371.1 SMESG000076363.1 SMESG000076358.1 SMESG000076223.1 SMESG000040665.1 dd_Smed_v4_645_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012954 centriolin SMESG000006866.1 dd_Smed_v4_10369_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30010364 SMED30010364 SMESG000056847.1 SMESG000056843.1 SMESG000056838.1 SMESG000044770.1 SMESG000044762.1 SMESG000007140.1 dd_Smed_v4_1137_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30018872 Ig-like domain-containing protein SMESG000042318.1 dd_Smed_v4_11702_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30002374 phytanoyl-CoA dioxygenase domain-containing protein 1 homolog SMESG000077696.1 SMESG000077694.1 dd_Smed_v4_1292_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013692 Small HSP protein SMESG000059879.1 SMESG000059868.1 SMESG000059853.1 dd_Smed_v4_1039_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013054 Protein kinase domain-containing protein SMESG000020466.1 dd_Smed_v4_11366_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013390 Nesprin-1 SMESG000069851.1 dd_Smed_v4_10646_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30014496 Ribosome biogenesis protein NSA2 SMESG000028599.1 dd_Smed_v4_1012_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30000421 TPR_REGION domain-containing protein SMESG000071973.1 dd_Smed_v4_11462_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30016369 SMED30016369 SMESG000022115.1 dd_Smed_v4_12348_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30010674 SPATA6 domain-containing protein SMESG000053714.1 dd_Smed_v4_10543_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001654 SMED30001654 SMESG000012124.1 dd_Smed_v4_11272_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30002162 Glycosyl transferase SMESG000030921.1 dd_Smed_v4_11247_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30009956 SMED30009956 SMESG000022272.1 dd_Smed_v4_10991_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30009956 SMED30009956 SMESG000022273.1 dd_Smed_v4_8344_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30007500 coiled-coil domain-containing protein 170 SMESG000074429.1 dd_Smed_v4_10140_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30016203 SMED30016203 SMESG000030489.1 dd_Smed_v4_11685_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30006859 Peptidyl-prolyl cis-trans isomerase SMESG000059112.1 dd_Smed_v4_10327_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30016654 Intraflagellar transport protein 140 SMESG000001316.1 dd_Smed_v4_11300_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30002712 Dynein heavy chain 3, axonemal SMESG000040511.1 SMESG000040510.1 SMESG000040507.1 dd_Smed_v4_10846_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30010655 SMED30010655 SMESG000028897.1 dd_Smed_v4_12473_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30017260 Pre mRNA processing factor 6 SMESG000011657.1 dd_Smed_v4_1153_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30017587 cilia- and flagella-associated protein 65 SMESG000069031.1 dd_Smed_v4_12428_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30029426 Baculoviral IAP repeat-containing protein 7 SMESG000067789.1 dd_Smed_v4_1187_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30027439 SMED30027439 SMESG000031258.1 dd_Smed_v4_12080_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30031490 SMED30031490 SMESG000017778.1 dd_Smed_v4_10175_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30027291 Death domain-containing protein SMESG000064407.1 dd_Smed_v4_12177_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30030597 Mitogen-activated protein kinase SMESG000033376.1 dd_Smed_v4_11396_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022030 EGR-like protein 1 SMESG000000959.1 dd_Smed_v4_12410_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022030 EGR-like protein 1 SMESG000000960.1 dd_Smed_v4_7731_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023193 Tau tubulin kinase SMESG000026133.1 dd_Smed_v4_12470_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30031582 Innexin SMESG000081749.1 dd_Smed_v4_11302_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30031582 Innexin SMESG000081749.1 dd_Smed_v4_10287_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30025052 histone-lysine N-methyltransferase SETD1B-A SMESG000062286.1 dd_Smed_v4_11834_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30028737 Tubby-like protein SMESG000009644.1 dd_Smed_v4_10462_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30033232 Retinoid isomerohydrolase SMESG000054001.1 dd_Smed_v4_13185_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022225 Bidirectional sugar transporter SWEET SMESG000012540.1 dd_Smed_v4_12308_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30031468 Propionyl-CoA carboxylase alpha chain, mitochondrial SMESG000034830.1 dd_Smed_v4_1247_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30030068 SMED30030068 SMESG000051921.1 SMESG000051913.1 dd_Smed_v4_1175_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30026225 SMED30026225 SMESG000059698.1 dd_Smed_v4_188_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30027035 Pseudouridine synthase SMESG000051935.1 dd_Smed_v4_12745_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30030095 coiled-coil domain-containing protein 87 isoform X1 SMESG000004454.1 dd_Smed_v4_12480_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30027561 SMED30027561 SMESG000072848.1 dd_Smed_v4_11162_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30027269 Ig-like domain-containing protein SMESG000018952.1 SMESG000018951.1 SMESG000018945.1 SMESG000018944.1 dd_Smed_v4_11944_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023484 Methyltransferase-like protein 17 SMESG000058278.1 SMESG000058279.1 dd_Smed_v4_4718_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30026485 SMED30026485 SMESG000078466.1 dd_Smed_v4_13093_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30032498 NPHP8 SMESG000076081.1 dd_Smed_v4_11425_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30032420 SMED30032420 SMESG000050229.1 SMESG000050221.1 dd_Smed_v4_1219_1_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30034138 Coiled-coil domain-containing protein 96 SMESG000050787.1 dd_Smed_v4_11884_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30028228 Centrosomal protein 164 SMESG000054195.1 SMESG000021687.1 dd_Smed_v4_12228_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30035360 Peptidyl-prolyl cis-trans isomerase SMESG000006589.1 dd_Smed_v4_133_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30030030 SMED30030030 SMESG000007276.1 dd_Smed_v4_11992_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30031828 SMED30031828 SMESG000072691.1 dd_Smed_v4_13068_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30007403 Protein phosphatase 1 regulatory subunit 42 SMESG000014888.1 dd_Smed_v4_7268_1_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30002774 SMED30002774 SMESG000017229.1 dd_Smed_v4_613_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30000178 SMED30000178 dd_Smed_v4_13403_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013149 MIEAP domain-containing protein SMESG000019081.1 dd_Smed_v4_6321_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30017314 Dynein regulatory complex subunit 7 SMESG000078850.1 dd_Smed_v4_12588_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30016577 SMED30016577 dd_Smed_v4_10215_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30018829 Insulin like growth factor 2 receptor SMESG000023958.1 SMESG000023953.1 dd_Smed_v4_14729_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30011798 E3 ubiquitin-protein ligase MIB2 SMESG000043477.1 SMESG000010549.1 SMESG000010347.1 SMESG000010327.1 dd_Smed_v4_593_1_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30017080 FHA domain-containing protein SMESG000061238.1 dd_Smed_v4_11335_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30017410 Peptidoglycan-recognition protein SMESG000004536.1 dd_Smed_v4_817_1_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012974 slc25a-27 SMESG000061901.1 dd_Smed_v4_543_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30000691 Eukaryotic initiation factor 4A-III SMESG000078818.1 dd_Smed_v4_737_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30019298 Heterogeneous nuclear ribonucleoprotein L SMESG000005298.1 dd_Smed_v4_1327_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30002680 SMED30002680 dd_Smed_v4_11691_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30011607 SMED30011607 dd_Smed_v4_15559_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30006416 cell division cycle 25-1 SMESG000065054.1 dd_Smed_v4_5520_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30004099 SMED30004099 dd_Smed_v4_15498_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30015480 SMED30015480 SMESG000064024.1 dd_Smed_v4_16354_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30018518 Protein chibby 1 dd_Smed_v4_11618_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30005911 SMED30005911 dd_Smed_v4_12_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30009695 Ras-related protein Ral-A SMESG000017190.1 SMESG000016219.1 dd_Smed_v4_522_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30017794 Coiled-coil domain containing 191 SMESG000064321.1 dd_Smed_v4_8967_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30018740 SMED30018740 dd_Smed_v4_1700_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30017312 Coiled-coil domain-containing protein 189 SMESG000046576.1 dd_Smed_v4_12703_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30011948 F-box/WD repeat-containing protein 10 SMESG000002351.1 SMESG000002342.1 dd_Smed_v4_13271_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012783 SMED30012783 SMESG000064443.1 dd_Smed_v4_16605_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001799 NADH dehydrogenase subunit 5 dd_Smed_v4_258_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001799 NADH dehydrogenase subunit 5 dd_Smed_v4_957_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30005066 Multiple epidermal growth factor domains protein 6 SMESG000002074.1 dd_Smed_v4_5630_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30000702 cytochrome b dd_Smed_v4_344_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012764 SMED30012764 SMESG000059203.1 dd_Smed_v4_5415_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30018900 Intraflagellar transport protein 56 SMESG000031670.1 dd_Smed_v4_12618_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013526 SMED30013526 dd_Smed_v4_11243_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013075 Voltage-dependent anion channel 3 SMESG000000196.1 dd_Smed_v4_738_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001449 Propionyl-CoA carboxylase subunit beta dd_Smed_v4_513_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30008076 Reverse transcriptase domain-containing protein SMESG000008737.1 dd_Smed_v4_540_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30010704 SMED30010704 dd_Smed_v4_14348_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30000682 SMED30000682 dd_Smed_v4_1303_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30015820 Dual specificity tyrosine-phosphorylation-regulated kinase 4 SMESG000042374.1 dd_Smed_v4_12591_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30007555 GCR098 SMESG000016695.1 Contig4585 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30007555 GCR098 SMESG000016695.1 Contig4585 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30007555 GCR098 SMESG000033655.1 Contig4585 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30007555 GCR098 SMESG000033655.1 Contig4585 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30015345 Tropomyosin SMESG000066854.1 Contig3688 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30015345 Tropomyosin SMESG000066854.1 Contig3688 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30015345 Tropomyosin SMESG000026500.1 Contig3688 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30015345 Tropomyosin SMESG000026500.1 Contig3688 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30029557 SMED30029557 SMESG000028899.1 Contig1093 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30029557 SMED30029557 SMESG000071997.1 Contig1093 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30024411 Protein kinase domain-containing protein SMESG000028899.1 Contig1093 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30024411 Protein kinase domain-containing protein SMESG000071997.1 Contig1093 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30032776 SMED30032776 SMESG000063221.1 Contig1068 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30022483 CGG triplet repeat-binding protein 1 SMESG000020470.1 Contig1680 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30022483 CGG triplet repeat-binding protein 1 SMESG000020470.1 Contig1680 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30033476 Zinc finger protein, putative SMESG000068172.1 Contig3306 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30033476 Zinc finger protein, putative SMESG000025870.1 Contig3306 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30031780 Ras-related protein Rab-5A SMESG000065500.1 Contig1027 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30033807 SMED30033807 SMESG000076385.1 SMESG000076375.1 SMESG000076363.1 SMESG000076223.1 SMESG000076482.1 SMESG000076470.1 SMESG000076410.1 SMESG000076358.1 Contig1645 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30030305 Peptidase_M14 domain-containing protein SMESG000037626.1 Contig1315 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30030305 Peptidase_M14 domain-containing protein SMESG000048042.1 Contig1315 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30032067 TRAF-4 SMESG000044336.1 Contig1407 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30032067 TRAF-4 SMESG000015063.1 Contig1407 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30030757 SMED30030757 SMESG000016990.1 Contig1765 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30023739 SMED30023739 SMESG000058452.1 Contig1190 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30023739 SMED30023739 SMESG000057519.1 Contig1190 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30025964 SMED30025964 SMESG000041071.1 Contig2453 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30020100 SMED30020100 SMESG000013936.1 Contig1935 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30020100 SMED30020100 SMESG000013936.1 Contig1935 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30020100 SMED30020100 SMESG000039535.1 Contig1935 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30020100 SMED30020100 SMESG000039535.1 Contig1935 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30029698 Caspase-7 SMESG000053168.1 Contig2992 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30009357 ubiquilin-1 SMESG000045386.1 Contig2009 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30004187 SMED30004187 SMESG000043423.1 Contig1792 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30004187 SMED30004187 SMESG000043423.1 Contig1792 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30004187 SMED30004187 SMESG000072544.1 Contig1792 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30004187 SMED30004187 SMESG000072544.1 Contig1792 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30001294 Phosphatidylinositol-binding clathrin assembly protein SMESG000043423.1 Contig1792 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30001294 Phosphatidylinositol-binding clathrin assembly protein SMESG000072544.1 Contig1792 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30001630 Ras-related C3 botulinum toxin substrate 1 SMESG000005612.1 Contig594 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30001630 Ras-related C3 botulinum toxin substrate 1 SMESG000005612.1 Contig594 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30001630 Ras-related C3 botulinum toxin substrate 1 SMESG000011575.1 Contig594 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30001630 Ras-related C3 botulinum toxin substrate 1 SMESG000011575.1 Contig594 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30005012 SMED30005012 Contig1286 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30002222 SMED30002222 Contig7536 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30002222 SMED30002222 Contig7536 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30017930 SMED30017930 SMESG000049597.1 Contig5044 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30017930 SMED30017930 SMESG000004871.1 Contig5044 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30027682 NAD(P)H-dependent FMN reductase SMESG000060640.1 Contig3408 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30027682 NAD(P)H-dependent FMN reductase SMESG000060640.1 Contig3408 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30027682 NAD(P)H-dependent FMN reductase SMESG000074871.1 Contig3408 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30027682 NAD(P)H-dependent FMN reductase SMESG000074871.1 Contig3408 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30032393 SMED30032393 SMESG000036683.1 Contig4572 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30032393 SMED30032393 SMESG000074788.1 Contig4572 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30022944 SMED30022944 SMESG000049597.1 Contig5044 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30022944 SMED30022944 SMESG000004871.1 Contig5044 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30005336 Phtf-FEM1B_bdg domain-containing protein SMESG000058788.1 Contig2701 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30018122 MADS-box domain-containing protein SMESG000005612.1 Contig594 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30018122 MADS-box domain-containing protein SMESG000011575.1 Contig594 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30014645 HP domain-containing protein SMESG000075965.1 PL04009A1F04 ncbi_smed_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30015706 Twinfilin-1 SMESG000041071.1 Contig2453 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30005434 SMED30005434 SMESG000038889.1 Contig2145 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30013050 SMED30013050 SMESG000000175.1 Contig2068 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30008812 AP complex subunit sigma SMESG000038889.1 Contig2145 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30004652 SMED30004652 SMESG000033527.1 Contig2307 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30017833 SMED30017833 SMESG000053168.1 Contig2992 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30005745 Protein kinase SMESG000079303.1 Contig2289 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30005745 Protein kinase SMESG000017260.1 Contig2289 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30011909 SMED30011909 SMESG000027686.1 Contig2364 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30011909 SMED30011909 SMESG000012131.1 SMESG000012127.1 Contig2364 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30012769 SMED30012769 SMESG000058788.1 Contig2701 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30012769 SMED30012769 SMESG000058788.1 Contig2701 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30015801 SMED30015801 SMESG000079303.1 Contig2289 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30015801 SMED30015801 SMESG000017260.1 Contig2289 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30009175 Transcription elongation factor spt6 SMESG000059332.1 Contig5500 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30009175 Transcription elongation factor spt6 SMESG000059332.1 Contig5500 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30009175 Transcription elongation factor spt6 SMESG000024114.1 Contig5500 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30009175 Transcription elongation factor spt6 SMESG000024114.1 Contig5500 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30019325 Myosin regulatory light chain SMESG000068156.1 SMESG000064685.1 SMESG000043474.1 SMESG000010609.1 SMESG000076470.1 SMESG000073857.1 SMESG000062429.1 SMESG000058575.1 SMESG000053533.1 SMESG000020635.1 SMESG000015751.1 SMESG000005260.1 Contig246 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30019325 Myosin regulatory light chain SMESG000000175.1 Contig246 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30019325 Myosin regulatory light chain SMESG000000175.1 Contig2068 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30001668 SMED30001668 SMESG000033527.1 Contig2307 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30034573 Tubulin beta chain SMESG000047291.1 SMESG000044907.1 SMESG000044888.1 SMESG000035804.1 SMESG000035755.1 SMESG000047284.1 Contig5821 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30011205 SMED30011205 SMESG000056922.1 dd_Smed_v4_11352_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30000038 Ribosome-binding protein 1 SMESG000031975.1 dd_Smed_v4_1111_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30003249 Prohibitin SMESG000038397.1 dd_Smed_v4_1038_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021059 V(D)J recombination-activating protein 1 SMESG000012339.1 dd_Smed_v4_11354_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30027672 Plac8 onzin related protein 1 SMESG000050229.1 SMESG000050221.1 dd_Smed_v4_1219_1_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30005292 Post-GPI attachment to proteins factor 3 SMESG000077193.1 dd_Smed_v4_11282_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30003902 Tetratricopeptide repeat protein 21B SMESG000011579.1 dd_Smed_v4_12056_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30003780 Serine/threonine-protein kinase 36 SMESG000076885.1 dd_Smed_v4_11067_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30009224 early growth response-3 SMESG000000959.1 dd_Smed_v4_12410_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30009224 early growth response-3 SMESG000000959.1 dd_Smed_v4_14711_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30004930 Irregular chiasm C-roughest-like isoform X2 SMESG000077979.1 dd_Smed_v4_12549_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30005345 SMED30005345 SMESG000059907.1 dd_Smed_v4_125_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30006652 dynein heavy chain 6, axonemal SMESG000004477.1 SMESG000004475.1 dd_Smed_v4_10969_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30004097 SMED30004097 SMESG000031258.1 dd_Smed_v4_12080_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30009282 EF-hand calcium binding domain 2 SMESG000049879.1 SMESG000003119.1 dd_Smed_v4_11976_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30003093 SMED30003093 SMESG000056847.1 SMESG000056843.1 SMESG000056838.1 SMESG000044770.1 SMESG000044762.1 SMESG000007140.1 dd_Smed_v4_1137_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30003434 SMED30003434 SMESG000052485.1 dd_Smed_v4_1182_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30007470 Coiled-coil domain-containing protein 180 SMESG000039547.1 dd_Smed_v4_12302_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30005053 SMED30005053 SMESG000072823.1 dd_Smed_v4_11587_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30004559 CULT domain-containing protein SMESG000077110.1 SMESG000077108.1 dd_Smed_v4_11915_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30009231 Transmembrane protein SMESG000002927.1 dd_Smed_v4_12002_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30009231 Transmembrane protein SMESG000002927.1 dd_Smed_v4_16643_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30004648 Dual specificity tyrosine phosphorylation regulated kinase 2 SMESG000076586.1 SMESG000076583.1 dd_Smed_v4_12119_1_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30010029 T-complex-associated-testis-expressed 1 SMESG000023093.1 dd_Smed_v4_12524_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013975 Ras association domain-containing protein 1 SMESG000029652.1 dd_Smed_v4_5323_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30016186 SMED30016186 SMESG000033673.1 dd_Smed_v4_1071_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30016186 SMED30016186 SMESG000033673.1 dd_1071 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30018511 von Willebrand factor A domain-containing protein 3B SMESG000009195.1 dd_Smed_v4_10837_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013935 Eukaryotic translation initiation factor 5B SMESG000012316.1 dd_1274 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30014692 Histone H4 SMESG000036410.1 dd_Smed_v4_506_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30017053 SMED30017053 SMESG000004885.1 dd_Smed_v4_5297_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30015650 FGFR1 oncogene partner SMESG000006505.1 dd_Smed_v4_5371_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30018901 SMED30018901 SMESG000033673.1 dd_Smed_v4_1071_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30018901 SMED30018901 SMESG000033673.1 dd_1071 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013779 Tubulin monoglycylase TTLL3 SMESG000029205.1 dd_Smed_v4_10244_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30015419 SMED30015419 SMESG000021688.1 dd_Smed_v4_11297_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30025095 SMED30025095 SMESG000046852.1 dd_Smed_v4_11398_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30020260 SMED30020260 SMESG000005697.1 dd_Smed_v4_12813_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023857 Calpain 5a SMESG000009459.1 dd_Smed_v4_101944_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021485 SMED30021485 SMESG000059844.1 dd_Smed_v4_1328_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021735 Guanylate cyclase domain-containing protein SMESG000051217.1 dd_Smed_v4_10678_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023085 Non-specific serine/threonine protein kinase SMESG000004478.1 dd_Smed_v4_11674_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30020615 prohibitin-1 SMESG000021272.1 dd_Smed_v4_1089_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021903 SMED30021903 SMESG000040469.1 dd_Smed_v4_10729_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30027392 SMED30027392 SMESG000074013.1 dd_Smed_v4_5067_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30035707 Ras association domain-containing protein SMESG000029652.1 dd_Smed_v4_5323_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30034381 Malate dehydrogenase SMESG000056995.1 dd_Smed_v4_467_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30020941 beta 1,3 galactosyltransferase-1 SMESG000008720.1 dd_Smed_v4_10927_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30027228 Protein FAM166B SMESG000069725.1 dd_Smed_v4_5010_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30029206 ANK_REP_REGION domain-containing protein SMESG000017292.1 dd_Smed_v4_5280_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022914 neurofilament heavy polypeptide isoform X5 SMESG000058734.1 dd_Smed_v4_11421_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30028503 SMED30028503 SMESG000040102.1 dd_Smed_v4_5390_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021613 Nesprin-1 SMESG000077685.1 dd_Smed_v4_10214_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021613 Nesprin-1 SMESG000077685.1 dd_Smed_v4_15904_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30031955 Intraflagellar transport protein 52 SMESG000043987.1 dd_Smed_v4_5043_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30034766 Enolase SMESG000052380.1 dd_Smed_v4_510_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30020829 KH domain-containing protein SMESG000069949.1 dd_Smed_v4_11601_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30024189 60S ribosomal protein L31 SMESG000017099.1 dd_Smed_v4_113_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30030838 slc7a-10 SMESG000025359.1 dd_Smed_v4_4548_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30020398 Kinesin-like protein SMESG000007019.1 dd_Smed_v4_10965_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021838 DUF4709 domain-containing protein SMESG000029222.1 dd_Smed_v4_13431_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022717 SMED30022717 SMESG000005697.1 dd_Smed_v4_12813_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021202 Kunitz-type serine protease inhibitor IX SMESG000012316.1 dd_1274 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30032293 SMED30032293 SMESG000033462.1 dd_554 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30032293 SMED30032293 SMESG000033462.1 dd_Smed_v4_554_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30027092 SMED30027092 SMESG000078236.1 SMESG000032651.1 dd_Smed_v4_4949_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022344 FERM domain containing-1 SMESG000070273.1 dd_Smed_v4_1131_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30031745 Fatty-acid amide hydrolase 1-like SMESG000034791.1 dd_Smed_v4_4966_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30020525 Dynein intermediate chain 2, ciliary SMESG000001839.1 SMESG000001830.1 dd_Smed_v4_4753_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023486 Intraflagellar transport 74 SMESG000074086.1 dd_Smed_v4_12702_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022844 NEPH-3 SMESG000022777.1 dd_Smed_v4_11280_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30020490 SMED30020490 SMESG000030489.1 dd_Smed_v4_11685_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023266 cilia- and flagella-associated protein 43 SMESG000000491.1 dd_Smed_v4_10271_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30005191 Phospholipid scramblase SMESG000050656.1 dd_Smed_v4_6444_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30011615 SMED30011615 SMESG000036524.1 dd_Smed_v4_11034_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30011134 SMED30011134 SMESG000063657.1 dd_Smed_v4_10132_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30019771 Ammonium transporter Rh type B SMESG000048384.1 dd_Smed_v4_1882_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30006633 SMED30006633 SMESG000040042.1 dd_Smed_v4_11386_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30005772 vault protein inter alpha trypsin-1 SMESG000053671.1 SMESG000053669.1 SMESG000053667.1 SMESG000053664.1 SMESG000053657.1 SMESG000053638.1 dd_Smed_v4_1027_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001801 NME/NM23 nucleoside diphosphate kinase 1 SMESG000008082.1 dd_Smed_v4_1096_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30015809 SMED30015809 SMESG000069776.1 dd_Smed_v4_10177_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30016673 Cylindromatosis (turban tumor syndrome), b SMESG000056847.1 SMESG000056843.1 SMESG000056838.1 SMESG000044770.1 SMESG000044762.1 SMESG000007140.1 dd_Smed_v4_1137_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30010702 Serine/threonine-protein kinase B-raf SMESG000064517.1 dd_Smed_v4_13233_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001071 Low density lipoprotein-receptor, class A,domain-containing protein SMESG000037863.1 dd_Smed_v4_12756_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30006515 ZZ-type domain-containing protein SMESG000055420.1 dd_Smed_v4_10173_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30003032 SMED30003032 SMESG000061110.1 dd_Smed_v4_11638_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30010487 Serine/threonine kinase SMESG000054195.1 SMESG000035615.1 dd_Smed_v4_11271_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30008862 Transmembrane protein 17 SMESG000050386.1 dd_Smed_v4_10264_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30014760 Exostosin-1 SMESG000018952.1 SMESG000018951.1 SMESG000018945.1 SMESG000018944.1 dd_Smed_v4_11944_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30004972 SMED30004972 SMESG000007019.1 dd_Smed_v4_10965_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30018893 Enkurin domain-containing protein SMESG000081414.1 dd_Smed_v4_12339_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30004945 slc22a-9 SMESG000025834.1 dd_Smed_v4_11120_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30007143 Nucleolar GTP-binding protein 2 SMESG000026847.1 dd_Smed_v4_1134_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30009887 Macrophage erythroblast attacher SMESG000048410.1 dd_Smed_v4_1168_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30016422 2-oxoisovalerate dehydrogenase subunit alpha SMESG000021412.1 dd_Smed_v4_10732_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30016010 SMED30016010 SMESG000042231.1 dd_Smed_v4_10980_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30017048 cilia- and flagella-associated protein 206 SMESG000021247.1 dd_Smed_v4_11199_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30009014 Alpha/beta hydrolase SMESG000022359.1 dd_Smed_v4_10155_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012981 Cyclic nucleotide gated channel 1 SMESG000036524.1 dd_Smed_v4_11034_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001666 slc18a-1 SMESG000041557.1 SMESG000041534.1 dd_Smed_v4_11917_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30027141 SMED30027141 SMESG000059828.1 dd_Smed_v4_1549_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30024153 SMED30024153 SMESG000035332.1 SMESG000031365.1 SMESG000077214.1 SMESG000075241.1 SMESG000075191.1 dd_Smed_v4_168_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30025791 B box-type domain-containing protein SMESG000078465.1 dd_Smed_v4_11048_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30024986 SMED30024986 SMESG000069890.1 dd_Smed_v4_16311_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30034412 E3 ubiquitin-protein ligase CBL SMESG000056433.1 dd_Smed_v4_6780_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30025181 33 kDa inner dynein arm light chain, axonemal SMESG000067639.1 SMESG000001266.1 dd_Smed_v4_4453_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022249 Clathrin interactor 1 SMESG000032527.1 SMESG000022725.1 dd_Smed_v4_1563_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30029481 SMED30029481 SMESG000079496.1 dd_Smed_v4_6860_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30031875 SMED30031875 SMESG000081251.1 dd_Smed_v4_604_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30035987 Expressed conserved protein SMESG000044572.1 dd_Smed_v4_5021_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30033585 Elongation of very long chain fatty acids protein SMESG000021565.1 dd_Smed_v4_523_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021475 SMED30021475 SMESG000062708.1 dd_Smed_v4_18258_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30031005 A disintegrin and metalloproteinase with thrombospondin motifs 2 SMESG000051172.1 dd_Smed_v4_16551_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30020035 DNA polymerase subunit gamma SMESG000050799.1 dd_Smed_v4_13411_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30025045 SMED30025045 SMESG000069184.1 SMESG000069172.1 dd_Smed_v4_17542_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30027978 Calcyphosin protein SMESG000025859.1 dd_Smed_v4_4512_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30028743 Regulator of G-protein signaling 22 SMESG000069110.1 dd_Smed_v4_11778_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30031142 Protein kinase domain-containing protein SMESG000073002.1 SMESG000072984.1 dd_Smed_v4_12680_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021253 60S ribosomal protein L35 SMESG000035332.1 SMESG000031365.1 SMESG000077214.1 SMESG000075241.1 SMESG000075191.1 dd_Smed_v4_168_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30033909 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 4 SMESG000066601.1 dd_Smed_v4_12354_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30028057 Retinal homeobox protein Rax SMESG000019089.1 dd_Smed_v4_6404_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022246 Coiled-coil domain-containing protein 77 SMESG000045184.1 dd_Smed_v4_4812_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021516 MICOS complex subunit MIC60 SMESG000066687.1 dd_Smed_v4_1605_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30026121 Ectonucleotide pyrophosphatase/phosphodiesterase family member 6 SMESG000040292.1 dd_Smed_v4_1269_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30029152 SMED30029152 SMESG000017036.1 dd_Smed_v4_12630_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30025084 Ankyrin repeat and EF-hand domain-containing protein 1 SMESG000006940.1 SMESG000006938.1 SMESG000006933.1 dd_Smed_v4_12476_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30029302 40S ribosomal protein S16 SMESG000018349.1 SMESG000018333.1 dd_Smed_v4_170_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30028898 BZIP domain-containing protein SMESG000067543.1 dd_Smed_v4_1399_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022806 Calcyphosin protein SMESG000025859.1 dd_Smed_v4_4512_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023411 slc42a-1 SMESG000048384.1 dd_Smed_v4_1882_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30026287 SMED30026287 SMESG000057102.1 dd_Smed_v4_45699_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30025105 Plastin 3 SMESG000081126.1 SMESG000081113.1 dd_Smed_v4_749_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30031188 Casein kinase I SMESG000050144.1 SMESG000050130.1 dd_Smed_v4_16169_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30025542 Leucine-rich repeat-containing protein 71 SMESG000006778.1 dd_Smed_v4_12043_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30020133 SMED30020133 SMESG000023496.1 dd_Smed_v4_21951_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021559 SMED30021559 SMESG000079496.1 dd_Smed_v4_6860_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30028668 Leucine-rich repeat-containing protein 71 SMESG000006778.1 dd_Smed_v4_12043_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30032907 Alpha-galactosidase SMESG000009912.1 dd_Smed_v4_606_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30029555 Serine/arginine-rich splicing factor 4 SMESG000045501.1 dd_Smed_v4_473_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30030891 Sphingolipid delta-4 desaturase SMESG000078629.1 dd_Smed_v4_7414_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30028190 SMED30028190 SMESG000035239.1 SMESG000035240.1 dd_Smed_v4_18162_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021399 Protein kintoun SMESG000052588.1 dd_Smed_v4_14336_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30024527 non-gastric H ,K -ATPase alpha subunit SMESG000041938.1 SMESG000041937.1 SMESG000051989.1 dd_Smed_v4_1179_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30028718 Epsin 2 SMESG000042233.1 dd_Smed_v4_4779_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30024368 chromodomain helicase DNA-binding protein 4 SMESG000068192.1 dd_Smed_v4_2331_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022312 COesterase domain-containing protein SMESG000064723.1 dd_Smed_v4_18958_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30028115 beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase 3 SMESG000026549.1 dd_Smed_v4_10879_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023475 SMED30023475 SMESG000047326.1 dd_Smed_v4_13864_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30025931 SMED30025931 SMESG000066313.1 dd_Smed_v4_2987_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30024309 Isocitrate dehydrogenase [NADP] SMESG000049154.1 dd_Smed_v4_449_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30035642 Granulin b SMESG000029882.1 dd_Smed_v4_442_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30032105 Polypeptide N-acetylgalactosaminyltransferase SMESG000025206.1 dd_Smed_v4_4615_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30028103 SMED30028103 SMESG000081188.1 dd_Smed_v4_11827_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30029399 SMED30029399 SMESG000015116.1 dd_Smed_v4_10874_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30028624 Synaptotagmin, putative SMESG000034832.1 dd_Smed_v4_13224_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021332 Cytochrome c SMESG000045852.1 dd_Smed_v4_464_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30030788 SMED30030788 SMESG000079496.1 dd_Smed_v4_6860_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30026336 Beta-hexosaminidase SMESG000008181.1 dd_Smed_v4_12408_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023155 Thyroid adenoma-associated-like protein SMESG000023235.1 dd_Smed_v4_12325_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30033097 SMED30033097 SMESG000044449.1 SMESG000044448.1 dd_Smed_v4_4457_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022421 RIB43A-like with coiled-coils protein 2 SMESG000037028.1 dd_Smed_v4_4547_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022425 Peroxiredoxin SMESG000002993.1 dd_Smed_v4_1290_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30000144 CAP-Gly domain-containing protein SMESG000000637.1 dd_Smed_v4_16405_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30014015 SMED30014015 SMESG000022082.1 dd_Smed_v4_8317_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30004318 Triadin-like isoform X4 SMESG000025109.1 dd_Smed_v4_22537_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30004318 Triadin-like isoform X4 SMESG000025109.1 dd_Smed_v4_13778_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001257 NADH dehydrogenase [ubiquinone] flavoprotein 1, mitochondrial SMESG000074136.1 dd_Smed_v4_1843_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30003053 1-acyl-sn-glycerol-3-phosphate acyltransferase delta SMESG000056953.1 dd_Smed_v4_5643_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30002742 Dystonin SMESG000043809.1 SMESG000043799.1 dd_Smed_v4_1205_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30000527 SMED30000527 SMESG000034072.1 dd_Smed_v4_7973_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30011384 protein phosphatase 1 regulatory subunit 12C isoform X12 SMESG000010821.1 dd_Smed_v4_8624_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30008650 Beta-hexosaminidase SMESG000008181.1 dd_Smed_v4_12408_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30006235 slc18a-5 SMESG000024277.1 dd_Smed_v4_13278_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30000967 DUF3421 domain-containing protein SMESG000057816.1 dd_Smed_v4_87_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012932 Rapunzel SMESG000037569.1 dd_Smed_v4_811_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30008456 Type I inositol-1,4,5-trisphosphate 5-phosphatase SMESG000074184.1 SMESG000019975.1 dd_Smed_v4_266_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30004285 SMED30004285 SMESG000072376.1 dd_Smed_v4_15802_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30003857 Centrosomal protein of 162 kDa SMESG000027479.1 dd_Smed_v4_9279_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30015974 FAST kinase domain-containing protein 1, mitochondrial SMESG000064523.1 dd_Smed_v4_8917_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30005465 Ras-related protein Rab-11A SMESG000073334.1 dd_Smed_v4_867_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012747 Thioredoxin domain-containing protein 3-like SMESG000043677.1 dd_Smed_v4_8026_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012747 Thioredoxin domain-containing protein 3-like SMESG000043677.1 dd_Smed_v4_8401_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30018730 SOCS box domain-containing protein SMESG000001445.1 SMESG000001437.1 dd_Smed_v4_9937_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30007294 slc5a-3 SMESG000054276.1 SMESG000054266.1 dd_Smed_v4_14173_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30006256 SMED30006256 SMESG000034101.1 dd_Smed_v4_9313_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30006822 SMED30006822 SMESG000043386.1 dd_Smed_v4_15542_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30010881 SMED30010881 SMESG000004195.1 dd_Smed_v4_991_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30004448 Thioredoxin domain-containing protein 3-like SMESG000043677.1 dd_Smed_v4_8026_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30004448 Thioredoxin domain-containing protein 3-like SMESG000043677.1 dd_Smed_v4_8401_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001155 SMED30001155 SMESG000043660.1 dd_Smed_v4_15839_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30003905 Far upstream element-binding protein SMESG000037106.1 dd_Smed_v4_812_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30007561 Protocadherin-h SMESG000034072.1 dd_Smed_v4_7973_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30000972 Leucine-rich repeat-containing protein 71 SMESG000006778.1 dd_Smed_v4_12043_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30015362 SMED30015362 SMESG000043289.1 dd_Smed_v4_80_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30018495 ATPase_AAA_core domain-containing protein SMESG000073596.1 dd_Smed_v4_9568_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30018495 ATPase_AAA_core domain-containing protein SMESG000073596.1 dd_Smed_v4_9484_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30000581 Centlein, centrosomal protein SMESG000000357.1 dd_Smed_v4_9882_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30005231 Polyadenylate-binding protein SMESG000058745.1 dd_Smed_v4_93_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30005553 Thioredoxin domain-containing protein 3-like SMESG000043677.1 dd_Smed_v4_8026_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30005553 Thioredoxin domain-containing protein 3-like SMESG000043677.1 dd_Smed_v4_8401_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30031496 Leucine zipper transcription factor like 1 SMESG000020499.1 dd_Smed_v4_8415_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30025065 SMED30025065 SMESG000054716.1 SMESG000047804.1 SMESG000038532.1 SMESG000038528.1 SMESG000038519.1 SMESG000036102.1 SMESG000036060.1 dd_Smed_v4_9340_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30025065 SMED30025065 SMESG000038532.1 SMESG000038520.1 SMESG000038497.1 SMESG000036112.1 SMESG000036067.1 dd_Smed_v4_5097_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30025065 SMED30025065 SMESG000047804.1 SMESG000038532.1 SMESG000038520.1 SMESG000036112.1 SMESG000036060.1 dd_Smed_v4_4251_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30027937 SMED30027937 SMESG000004925.1 dd_Smed_v4_8053_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022075 Synaptotagmin protein 5 SMESG000074360.1 dd_Smed_v4_4335_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30031141 Tubulin polyglutamylase ttll6 SMESG000075764.1 dd_Smed_v4_8131_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021711 DNA-binding protein SMESG000070983.1 dd_Smed_v4_2102_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30024160 SMED30024160 SMESG000046560.1 SMESG000010944.1 dd_Smed_v4_142_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30035939 Actinin alpha 4 SMESG000074430.1 dd_Smed_v4_7964_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30034859 Tetraspanin SMESG000056555.1 dd_Smed_v4_3116_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30026732 NADH dehydrogenase iron-sulfur protein 8, mitochondrial SMESG000002076.1 dd_Smed_v4_849_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30020664 Potassium voltage-gated channel subfamily A member 2 SMESG000028841.1 dd_Smed_v4_7533_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30029668 Adenylate kinase isoenzyme 5 SMESG000020486.1 SMESG000020480.1 dd_Smed_v4_5119_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021685 Bestrophin homolog SMESG000070057.1 dd_Smed_v4_8073_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021265 2-acylglycerol O-acyltransferase 2 SMESG000052656.1 dd_Smed_v4_6550_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30027540 Cathepsin F SMESG000005279.1 dd_Smed_v4_456_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30020000 RNA binding motif single stranded interacting SMESG000010632.1 dd_Smed_v4_3575_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30008882 Cilia and flagella associated protein 157 SMESG000036345.1 dd_Smed_v4_9862_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30016401 Venom allergen 5 SMESG000005602.1 dd_Smed_v4_1988_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30019874 Calmodulin SMESG000010769.1 dd_Smed_v4_255_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30011084 Epidermal growth factor receptor kinase substrate 8 SMESG000070650.1 dd_Smed_v4_4256_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30015587 Dual specificity protein phosphatase 14 SMESG000037868.1 dd_Smed_v4_7558_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001635 cathepsin B SMESG000048413.1 dd_Smed_v4_81_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30003442 60S ribosomal protein L23 SMESG000023040.1 dd_Smed_v4_242_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30006541 SMED30006541 SMESG000012332.1 SMESG000012317.1 SMESG000058954.1 dd_Smed_v4_246_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30010842 EF-hand domain-containing protein 1 SMESG000078434.1 dd_Smed_v4_2935_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30007246 SMED30007246 SMESG000045656.1 dd_Smed_v4_797_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001479 G_PROTEIN_RECEP_F1_2 domain-containing protein SMESG000029294.1 SMESG000029291.1 dd_Smed_v4_2802_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001479 G_PROTEIN_RECEP_F1_2 domain-containing protein SMESG000029291.1 dd_Smed_v4_6716_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30009782 Outer dense fiber protein 3 SMESG000038718.1 dd_Smed_v4_2658_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012310 SMED30012310 SMESG000028761.1 dd_Smed_v4_5231_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30006683 Pleckstrin homology like domain family B member 2 SMESG000033071.1 dd_Smed_v4_7833_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012572 Leucine--tRNA ligase SMESG000071689.1 dd_Smed_v4_9705_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30018899 Tetraspanin SMESG000078545.1 dd_Smed_v4_354_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30006638 Elongation factor Tu SMESG000068535.1 dd_Smed_v4_818_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30002133 Polyubiquitin SMESG000039444.1 SMESG000014081.1 dd_Smed_v4_34_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30011943 Fibronectin type III and ankyrin repeat domains 1 SMESG000033969.1 dd_Smed_v4_7571_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30018451 Lipopolysaccharide-induced TNF-alpha factor SMESG000020870.1 SMESG000046087.1 SMESG000046084.1 dd_Smed_v4_2768_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30010468 RBR-type E3 ubiquitin transferase SMESG000062644.1 dd_Smed_v4_3281_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012419 Non-specific serine/threonine protein kinase SMESG000069962.1 SMESG000069953.1 SMESG000069952.1 dd_Smed_v4_3244_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012665 FERM domain-containing protein SMESG000062741.1 SMESG000053535.1 SMESG000049374.1 SMESG000033049.1 SMESG000024644.1 SMESG000016667.1 dd_Smed_v4_6227_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30017762 SMED30017762 SMESG000016810.1 dd_Smed_v4_783_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30016458 SMED30016458 SMESG000074522.1 SMESG000074521.1 dd_Smed_v4_1967_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30008553 Phosphoenolpyruvate carboxykinase [GTP] SMESG000062868.1 dd_Smed_v4_196_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30020261 SMED30020261 SMESG000045656.1 dd_Smed_v4_797_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30020269 Myophilin SMESG000081505.1 SMESG000049198.1 SMESG000047694.1 SMESG000035451.1 SMESG000035348.1 dd_Smed_v4_395_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30020160 SMED30020160 SMESG000005587.1 dd_Smed_v4_8117_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30020166 Coiled-coil domain-containing protein SMESG000005080.1 dd_Smed_v4_9816_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30020991 Outer dynein arm protein 1 SMESG000055998.1 SMESG000055997.1 dd_Smed_v4_4191_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012526 slc39a-8 SMESG000009752.1 SMESG000009750.1 dd_Smed_v4_4776_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013233 Expressed conserved protein SMESG000062284.1 dd_Smed_v4_565_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001341 Carbonic anhydrase-related SMESG000054330.1 dd_Smed_v4_10750_1_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30003118 SMED30003118 SMESG000006534.1 dd_Smed_v4_4662_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30014748 Ptk7 SMESG000072430.1 dd_Smed_v4_6999_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30000491 Cornifelin-like A SMESG000023836.1 dd_Smed_v4_1291_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30008195 Non-specific serine/threonine protein kinase SMESG000022413.1 dd_Smed_v4_10848_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30009457 reticulocalbin-1 SMESG000034805.1 dd_Smed_v4_493_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30019273 40S ribosomal protein S3a SMESG000066540.1 SMESG000066537.1 dd_Smed_v4_163_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30018556 Pyruvate kinase SMESG000045839.1 dd_Smed_v4_51910_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30006736 colorectal mutant cancer protein SMESG000002794.1 dd_Smed_v4_5396_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012300 SMED30012300 SMESG000013739.1 dd_Smed_v4_5519_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30015473 Actin cytoplasmic type 5 SMESG000080982.1 SMESG000080969.1 dd_Smed_v4_2624_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30019565 Radial spoke head protein 4-like protein A SMESG000044927.1 dd_Smed_v4_5346_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30006944 slc35e1 SMESG000034003.1 dd_Smed_v4_5304_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012787 MANSC domain-containing protein SMESG000015184.1 dd_Smed_v4_5586_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013676 nesprin-1-like SMESG000016747.1 SMESG000016745.1 dd_Smed_v4_5365_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30014558 SMED30014558 SMESG000023649.1 dd_Smed_v4_184_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013578 MICOS complex subunit MIC10 SMESG000009106.1 dd_Smed_v4_1150_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012757 Tektin-4 SMESG000068903.1 dd_Smed_v4_4872_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30008534 cGMP-dependent protein kinase SMESG000052811.1 dd_Smed_v4_5704_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30008242 SMED30008242 SMESG000068886.1 dd_Smed_v4_12913_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30016078 Actin, cytoplasmic SMESG000012332.1 SMESG000012317.1 SMESG000058954.1 dd_Smed_v4_246_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30016078 Actin, cytoplasmic SMESG000012332.1 SMESG000012317.1 dd_Smed_v4_285_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30010320 Radial spoke head 10-like protein B2 SMESG000039156.1 SMESG000039153.1 dd_Smed_v4_12762_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012638 DUF4200 domain-containing protein SMESG000028991.1 dd_Smed_v4_11371_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013787 SMED30013787 SMESG000017258.1 dd_Smed_v4_5255_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012136 radial spoke head protein 9 homolog SMESG000046857.1 dd_Smed_v4_4707_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30019139 Calmodulin SMESG000010244.1 dd_Smed_v4_10239_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013563 Serine/threonine-protein kinase 10 SMESG000064983.1 dd_Smed_v4_5720_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30017333 centrosomal protein of 83 kDa-like SMESG000033227.1 SMESG000033225.1 dd_Smed_v4_12969_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30007543 nesprin-1-like SMESG000016747.1 SMESG000016745.1 dd_Smed_v4_5365_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30011453 Facilitated trehalose transporter Tret1 SMESG000063382.1 dd_Smed_v4_11168_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30019328 Armadillo repeat-containing protein 2 SMESG000077074.1 dd_Smed_v4_12684_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30014544 Dynein light chain SMESG000067731.1 dd_Smed_v4_11037_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001672 NADH dehydrogenase [ubiquinone] iron-sulfur protein 7, mitochondrial SMESG000035542.1 dd_Smed_v4_4432_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30033594 Microtubule-associated protein 1A SMESG000014298.1 dd_Smed_v4_1301_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30033594 Microtubule-associated protein 1A SMESG000014298.1 dd_Smed_v4_3654_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30027378 60S ribosomal protein L3 SMESG000022732.1 dd_Smed_v4_127_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023413 40S ribosomal protein S25 SMESG000059049.1 dd_Smed_v4_134_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30026551 Ankyrin and armadillo repeat-containing protein SMESG000058465.1 dd_Smed_v4_13064_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30028267 SMED30028267 SMESG000048027.1 dd_Smed_v4_4822_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30031345 Pyruvate dehydrogenase E1 component subunit alpha SMESG000073271.1 dd_Smed_v4_1310_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023062 bruno-like SMESG000021009.1 dd_Smed_v4_2592_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30020821 SMED30020821 SMESG000014298.1 dd_Smed_v4_1301_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30033411 Dynein light chain SMESG000041239.1 dd_Smed_v4_3149_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30034202 SMED30034202 SMESG000077061.1 dd_Smed_v4_1917_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30027280 60S acidic ribosomal protein P0 SMESG000079482.1 dd_Smed_v4_161_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30020948 SMED30020948 SMESG000024857.1 dd_Smed_v4_409_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023766 SMED30023766 SMESG000073811.1 dd_Smed_v4_116_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30014820 Centrosomal protein of 135 kDa (Cep135 protein) (Centrosomal protein 4), putative SMESG000052451.1 dd_Smed_v4_11072_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30025982 RING finger protein 32 SMESG000057989.1 dd_Smed_v4_12150_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023017 SMED30023017 SMESG000065348.1 dd_1320 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023017 SMED30023017 SMESG000065348.1 dd_Smed_v4_1320_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30026061 SMED30026061 SMESG000076482.1 SMESG000076409.1 SMESG000076405.1 SMESG000076390.1 SMESG000076375.1 SMESG000076364.1 SMESG000076223.1 SMESG000040665.1 SMESG000019753.1 dd_Smed_v4_1097_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30020334 Leucine-rich repeat-containing protein 57 SMESG000037709.1 dd_Smed_v4_17742_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30025664 TSNAXIP1_N domain-containing protein SMESG000060720.1 dd_Smed_v4_13434_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023050 Aldehyde dehydrogenase, mitochondrial SMESG000016195.1 dd_Smed_v4_1339_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021821 Transient receptor potential cation channel subfamily M member SMESG000078720.1 dd_Smed_v4_17981_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022178 SMED30022178 SMESG000057910.1 dd_Smed_v4_1090_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30028626 C2H2-type domain-containing protein SMESG000019280.1 SMESG000019279.1 dd_Smed_v4_10324_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30030586 slc10a-2 SMESG000064833.1 dd_Smed_v4_10199_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022362 Synaptotagmin-2 SMESG000011583.1 dd_Smed_v4_12772_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30029698 Caspase-7 SMESG000053168.1 dd_Smed_v4_1167_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022414 SMED30022414 SMESG000076482.1 SMESG000076409.1 SMESG000076405.1 SMESG000076390.1 SMESG000076375.1 SMESG000076364.1 SMESG000076223.1 SMESG000040665.1 SMESG000019753.1 dd_Smed_v4_1097_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022414 SMED30022414 SMESG000076482.1 SMESG000076470.1 SMESG000076469.1 SMESG000076410.1 SMESG000076409.1 SMESG000076408.1 SMESG000076407.1 SMESG000076406.1 SMESG000076390.1 SMESG000076389.1 SMESG000076385.1 SMESG000076375.1 SMESG000076371.1 SMESG000076363.1 SMESG000076358.1 SMESG000076223.1 SMESG000040665.1 dd_Smed_v4_645_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30027596 RNA-binding protein pno1 SMESG000015341.1 dd_Smed_v4_1077_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30020814 SMED30020814 SMESG000076482.1 SMESG000076409.1 SMESG000076405.1 SMESG000076390.1 SMESG000076375.1 SMESG000076364.1 SMESG000076223.1 SMESG000040665.1 SMESG000019753.1 dd_Smed_v4_1097_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30027019 Innexin SMESG000030971.1 SMESG000030964.1 dd_Smed_v4_10061_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30026646 Dynein light chain SMESG000009941.1 dd_Smed_v4_107_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30031722 ANK_REP_REGION domain-containing protein SMESG000022931.1 dd_Smed_v4_11187_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30027644 cAMP-dependent protein kinase regulatory subunit SMESG000003135.1 dd_Smed_v4_14355_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001515 Annexin SMESG000042839.1 dd_Smed_v4_1104_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30006413 SMED30006413 SMESG000069778.1 dd_Smed_v4_18416_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001112 SMED30001112 SMESG000061228.1 dd_Smed_v4_13515_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001112 SMED30001112 SMESG000061228.1 dd_Smed_v4_8351_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30007588 SMED30007588 SMESG000034112.1 dd_Smed_v4_10100_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30010188 Ankyrin repeat-containing domain protein SMESG000011193.1 dd_Smed_v4_13251_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30007867 Otoferlin SMESG000010400.1 dd_Smed_v4_14162_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30007867 Otoferlin SMESG000010400.1 dd_Smed_v4_13850_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30000840 Coiled-coil domain-containing protein 42-like protein SMESG000046807.1 dd_Smed_v4_12378_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30007557 DUF4515 domain-containing protein SMESG000013289.1 dd_Smed_v4_13384_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30011250 Granulin precursor SMESG000029882.1 dd_Smed_v4_442_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30008113 nicolin-1 SMESG000079687.1 SMESG000054751.1 dd_Smed_v4_11961_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30002592 NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 3 SMESG000016331.1 dd_Smed_v4_1078_1_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30007188 Calmodulin SMESG000078272.1 dd_Smed_v4_11942_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30008915 SMED30008915 SMESG000002588.1 dd_Smed_v4_10456_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013319 Long-chain-fatty-acid--CoA ligase ACSBG2 SMESG000027204.1 dd_Smed_v4_1026_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30007587 serine/threonine/tyrosine-interacting-like protein 1 SMESG000070767.1 dd_Smed_v4_11358_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30004871 Mitogen-activated protein kinase SMESG000023035.1 SMESG000023025.1 dd_Smed_v4_10933_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30005771 SMED30005771 SMESG000042003.1 dd_Smed_v4_12482_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30009071 SMED30009071 SMESG000017123.1 dd_Smed_v4_10551_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30010231 SMED30010231 SMESG000015116.1 dd_Smed_v4_10874_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30009981 Ras-related protein SMESG000044147.1 dd_Smed_v4_6181_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001031 TRAF3-interacting protein 1 SMESG000006345.1 dd_Smed_v4_10562_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30005802 SMED30005802 SMESG000072483.1 dd_Smed_v4_5611_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30007503 SMED30007503 SMESG000039907.1 dd_Smed_v4_13316_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30000745 SMED30000745 SMESG000027028.1 dd_Smed_v4_14847_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30007804 Immunoglobulin-like domain-containing protein SMESG000010356.1 dd_Smed_v4_1827_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30008636 SMED30008636 SMESG000016848.1 dd_Smed_v4_14631_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30002886 SMED30002886 SMESG000017779.1 dd_Smed_v4_11049_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001176 SMED30001176 SMESG000020646.1 dd_Smed_v4_10759_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30007718 Flotillin-1 SMESG000063612.1 dd_Smed_v4_1887_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30002489 Apical junction component 1 homolog SMESG000037093.1 dd_Smed_v4_11689_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30003228 Dach-1 SMESG000005090.1 dd_Smed_v4_5823_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001414 UPF0728 protein C10orf53 homolog SMESG000073355.1 dd_Smed_v4_10501_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30026934 SMED30026934 SMESG000050824.1 dd_Smed_v4_12162_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022522 Centrin-3 SMESG000016538.1 dd_Smed_v4_11582_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30005863 DUF3421 domain-containing protein SMESG000074396.1 SMESG000074378.1 dd_Smed_v4_11_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30004937 Elongation factor 2 SMESG000042430.1 dd_Smed_v4_186_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30008325 Fatty acid synthase SMESG000020850.1 dd_Smed_v4_10967_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30005988 60S ribosomal protein L24 SMESG000007869.1 SMESG000007858.1 SMESG000007847.1 dd_Smed_v4_172_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30007853 Family with sequence similarity 49 member A SMESG000040316.1 dd_Smed_v4_1856_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30006368 Piezo-type mechanosensitive ion channel component SMESG000080326.1 SMESG000080325.1 dd_Smed_v4_18354_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30007371 nuclear mitotic apparatus protein 1 isoform X2 SMESG000071994.1 dd_Smed_v4_10823_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30008461 nuclear mitotic apparatus protein 1 isoform X2 SMESG000071994.1 dd_Smed_v4_10823_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30005820 SMED30005820 SMESG000080577.1 dd_Smed_v4_19517_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30006074 SMED30006074 SMESG000019341.1 dd_Smed_v4_177_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30008349 Histone-lysine N-methyltransferase SETMAR SMESG000017253.1 SMESG000015137.1 dd_Smed_v4_1612_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30004484 60S ribosomal protein L8 SMESG000017087.1 dd_Smed_v4_108_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30018756 SMED30018756 dd_Smed_v4_6916_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30004312 Parvo_coat_N domain-containing protein dd_Smed_v4_91560_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30016918 UPF0466 protein-like dd_Smed_v4_5792_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30004403 GCR079 SMESG000014330.1 dd_Smed_v4_11910_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001925 SMED30001925 dd_4476 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001925 SMED30001925 dd_Smed_v4_4476_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30008373 SMED30008373 dd_Smed_v4_6046_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013141 Pleckstrin homology domain-containing family F member 2-like protein dd_Smed_v4_2374_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30019959 NADH dehydrogenase subunit 4 dd_Smed_v4_344_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30019959 NADH dehydrogenase subunit 4 dd_Smed_v4_292_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30008902 inositol phosphoceramide mannosyltransferase 2-like SMESG000059812.1 SMESG000045480.1 SMESG000045292.1 SMESG000045267.1 SMESG000037990.1 dd_Smed_v4_2174_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30011303 Syndecan binding protein (Syntenin) dd_Smed_v4_387_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30016080 Deoxyhypusine hydroxylase SMESG000051726.1 SMESG000051721.1 dd_Smed_v4_703_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012451 SMED30012451 dd_Smed_v4_215_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013131 protein PLANT CADMIUM RESISTANCE 2-like dd_Smed_v4_4778_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30015411 GLTP domain-containing protein dd_Smed_v4_2621_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012212 NADH dehydrogenase subunit 1 dd_Smed_v4_258_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30009030 Selenoprotein W dd_Smed_v4_572_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30010253 NADH dehydrogenase subunit 6 dd_Smed_v4_957_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30010134 SMED30010134 dd_Smed_v4_34037_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013571 NADH dehydrogenase subunit 4L dd_Smed_v4_344_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30008418 SMED30008418 SMESG000027863.1 dd_Smed_v4_16528_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30005542 SMED30005542 dd_Smed_v4_23179_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30002689 SMED30002689 dd_Smed_v4_680_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30004402 Dimer_Tnp_hAT domain-containing protein dd_Smed_v4_14487_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30018956 SMED30018956 dd_Smed_v4_2990_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30006480 SMED30006480 dd_Smed_v4_479_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30005334 SMED30005334 dd_Smed_v4_344_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30016430 SMED30016430 dd_Smed_v4_275_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30009793 Dach-2 SMESG000033540.1 dd_Smed_v4_11289_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30019364 Si:ch211-193l2.10 SMESG000062713.1 dd_Smed_v4_3203_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30007142 Sperm surface protein Sp17 SMESG000046919.1 dd_Smed_v4_4783_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30007142 Sperm surface protein Sp17 SMESG000046919.1 dd_Smed_v4_2279_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30006792 Argonaute 1 SMESG000050993.1 SMESG000050994.1 dd_Smed_v4_1194_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30027687 RRM domain-containing protein SMESG000038824.1 dd_Smed_v4_3002_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021641 SMED30021641 SMESG000040565.1 dd_Smed_v4_4660_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021589 Agrin, putative SMESG000028865.1 SMESG000028859.1 dd_Smed_v4_3649_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30034888 Dynein heavy chain 5, axonemal SMESG000049144.1 dd_Smed_v4_4569_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021687 glycogen synthase kinase 3 SMESG000023764.1 dd_Smed_v4_4762_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30029024 Protein F37C4.5 SMESG000064758.1 dd_Smed_v4_5168_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30034831 SMED30034831 SMESG000064758.1 dd_Smed_v4_5168_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30031912 SMED30031912 SMESG000003404.1 dd_Smed_v4_2094_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30026227 SMED30026227 SMESG000055174.1 SMESG000055172.1 dd_Smed_v4_10518_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022043 Protein odd-skipped-related 2 SMESG000032229.1 dd_Smed_v4_10039_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30026136 Nad dependent epimerase dehydratase SMESG000035068.1 dd_Smed_v4_3452_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30024475 Si:ch211-106h4.9 SMESG000026729.1 dd_Smed_v4_3756_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30031065 Tetraspanin SMESG000050726.1 dd_Smed_v4_5209_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30034862 SMED30034862 SMESG000049533.1 dd_Smed_v4_3835_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30034697 Testis-specific Y-encoded-like protein 1 SMESG000027817.1 SMESG000027807.1 dd_Smed_v4_393_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30025910 Microtubule-associated protein futsch SMESG000044270.1 SMESG000030021.1 SMESG000025422.1 dd_Smed_v4_1999_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30026539 10 kDa heat shock protein, mitochondrial SMESG000000556.1 dd_Smed_v4_421_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30030542 Dynein light chain SMESG000003543.1 dd_Smed_v4_310_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30031471 SMED30031471 SMESG000050535.1 SMESG000050533.1 dd_Smed_v4_5107_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30029711 SMED30029711 SMESG000039804.1 dd_Smed_v4_5259_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30029711 SMED30029711 SMESG000039803.1 dd_Smed_v4_3788_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30028659 Cilia-and flagella-associated protein 100 SMESG000033127.1 dd_Smed_v4_6518_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021386 Y box protein-1 SMESG000058066.1 dd_Smed_v4_52_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30033453 Dimer_Tnp_hAT domain-containing protein SMESG000001790.1 dd_Smed_v4_212_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30033389 SMED30033389 SMESG000079563.1 SMESG000052448.1 dd_Smed_v4_3113_1_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30033302 RNA-binding protein MEX3B SMESG000044270.1 SMESG000030021.1 SMESG000025422.1 dd_Smed_v4_1999_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30026135 SMED30026135 SMESG000016933.1 dd_Smed_v4_2807_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30030766 Y box protein-1 SMESG000058066.1 dd_Smed_v4_52_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30026808 EF-hand domain-containing protein SMESG000081370.1 dd_Smed_v4_446_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30029820 E3 ubiquitin-protein ligase MYLIP SMESG000074789.1 SMESG000054150.1 dd_Smed_v4_2867_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30029771 SMED30029771 SMESG000075916.1 dd_Smed_v4_2326_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30033752 Tyrosine-protein kinase SMESG000059352.1 SMESG000059351.1 dd_Smed_v4_420_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30034016 Sperm surface protein Sp17 SMESG000046919.1 dd_Smed_v4_4783_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30029741 SMED30029741 SMESG000056346.1 dd_Smed_v4_2250_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30030659 Fer-1-related SMESG000070967.1 dd_Smed_v4_4648_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012240 E3 ubiquitin-protein ligase RNF170 SMESG000068288.1 SMESG000068286.1 dd_Smed_v4_802_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30018770 SMED30018770 SMESG000072454.1 dd_Smed_v4_1949_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30008772 Golgi-associated plant pathogenesis-related protein 1 SMESG000035954.1 dd_Smed_v4_27440_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013198 SMED30013198 SMESG000057605.1 dd_Smed_v4_24714_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012160 SMED30012160 SMESG000069851.1 dd_9493 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012160 SMED30012160 SMESG000069851.1 dd_Smed_v4_9493_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30008609 SMED30008609 SMESG000059918.1 SMESG000052306.1 dd_Smed_v4_12223_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013300 Mitochondrial ATP synthase subunit 9 SMESG000078181.1 dd_Smed_v4_23_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30014360 Choline dehydrogenase SMESG000055690.1 SMESG000055689.1 SMESG000055687.1 dd_Smed_v4_1744_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30005665 SMED30005665 SMESG000074689.1 dd_Smed_v4_2429_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012386 Alpha-1,4 glucan phosphorylase SMESG000061417.1 dd_Smed_v4_1532_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012926 SMED30012926 SMESG000059195.1 SMESG000059194.1 SMESG000059193.1 dd_Smed_v4_1940_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30000134 60S ribosomal protein L4 SMESG000009479.1 dd_Smed_v4_211_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30016015 Cilia and flagella associated protein 157 SMESG000020913.1 dd_Smed_v4_11523_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30003011 NPHP1 SMESG000061008.1 dd_Smed_v4_9990_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30010326 Tetraspanin SMESG000078589.1 dd_Smed_v4_2698_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001043 SMED30001043 SMESG000036225.1 dd_Smed_v4_372_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30000771 SMED30000771 SMESG000059918.1 SMESG000052306.1 SMESG000022407.1 dd_Smed_v4_474_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30000771 SMED30000771 SMESG000059918.1 SMESG000052306.1 SMESG000022407.1 dd_Smed_v4_1996_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013808 fos-1 SMESG000003328.1 dd_Smed_v4_2789_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001380 Zinc finger FYVE domain-containing protein SMESG000014968.1 dd_Smed_v4_4344_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30003292 SMED30003292 SMESG000066258.1 dd_Smed_v4_19593_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30006397 Cyclic nucleotide-binding domain-containing protein SMESG000040419.1 SMESG000040416.1 SMESG000005563.1 dd_Smed_v4_19613_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30004562 Placenta-specific gene 8 protein SMESG000050175.1 dd_Smed_v4_20106_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30003507 Adenylate kinase 9 SMESG000043841.1 dd_Smed_v4_9617_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001359 SMED30001359 SMESG000059918.1 SMESG000052306.1 SMESG000022407.1 dd_Smed_v4_1996_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30016746 SMED30016746 SMESG000060159.1 dd_Smed_v4_2729_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001490 ADF-H domain-containing protein SMESG000080129.1 dd_Smed_v4_260_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001290 semaphorin 5-3 SMESG000033853.1 dd_Smed_v4_9914_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30014469 DUF862 domain-containing protein SMESG000007684.1 dd_Smed_v4_1938_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30018297 Dynein light chain SMESG000019341.1 dd_Smed_v4_177_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013371 40S ribosomal protein S26 SMESG000049997.1 SMESG000005227.1 dd_Smed_v4_222_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001172 Elongation factor 1-beta SMESG000026862.1 dd_Smed_v4_206_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30016252 Saposin SMESG000074184.1 SMESG000019975.1 dd_Smed_v4_266_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30007654 SMED30007654 SMESG000060598.1 SMESG000046845.1 dd_Smed_v4_20799_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30000817 IPPc domain-containing protein SMESG000026603.1 dd_Smed_v4_3627_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30010357 SMED30010357 SMESG000002236.1 dd_Smed_v4_17805_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001248 SMED30001248 SMESG000013596.1 dd_Smed_v4_6322_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30011755 SMED30011755 SMESG000074184.1 SMESG000019975.1 dd_Smed_v4_266_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30003036 SMED30003036 SMESG000076482.1 SMESG000076470.1 SMESG000076469.1 SMESG000076410.1 SMESG000076409.1 SMESG000076408.1 SMESG000076407.1 SMESG000076406.1 SMESG000076390.1 SMESG000076389.1 SMESG000076385.1 SMESG000076375.1 SMESG000076371.1 SMESG000076363.1 SMESG000076358.1 SMESG000076223.1 SMESG000040665.1 dd_Smed_v4_645_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30025510 UHRF1-binding protein 1-like SMESG000044305.1 dd_Smed_v4_11401_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30020215 Annexin SMESG000030132.1 dd_Smed_v4_1735_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30034247 SMED30034247 SMESG000005178.1 dd_Smed_v4_10371_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30024984 LisH domain-containing protein ARMC9 SMESG000049428.1 dd_Smed_v4_10926_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30032706 SMED30032706 SMESG000026670.1 dd_Smed_v4_14959_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30020977 SMED30020977 SMESG000069851.1 dd_9493 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30020977 SMED30020977 SMESG000069851.1 dd_Smed_v4_9493_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022193 SMED30022193 SMESG000069851.1 dd_9493 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022193 SMED30022193 SMESG000069851.1 dd_Smed_v4_9493_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30032042 SMED30032042 SMESG000065355.1 SMESG000065350.1 SMESG000065349.1 dd_531 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30032042 SMED30032042 SMESG000065355.1 SMESG000065350.1 SMESG000065349.1 dd_Smed_v4_531_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30034618 von Willebrand factor A domain-containing protein 3A SMESG000022334.1 SMESG000022332.1 dd_Smed_v4_10972_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30036004 SMED30036004 SMESG000015790.1 dd_Smed_v4_10265_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30032668 Axonemal dynein light chain domain containing 1 SMESG000011832.1 dd_Smed_v4_16309_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30033164 Heat shock 70 kDa protein SMESG000041117.1 dd_Smed_v4_1378_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30030168 Latent transforming growth factor beta binding protein 3 SMESG000008188.1 dd_Smed_v4_1886_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30029970 Rab-GAP TBC domain-containing protein SMESG000063156.1 dd_Smed_v4_15291_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30034523 SMED30034523 SMESG000009543.1 dd_Smed_v4_12682_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30034323 Ras family protein SMESG000053083.1 dd_Smed_v4_11357_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30035576 Leucine-rich repeat-containing protein 56 SMESG000036659.1 dd_Smed_v4_10834_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30034953 SMED30034953 SMESG000065075.1 dd_Smed_v4_102_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30025647 Ig-like domain-containing protein SMESG000079961.1 dd_Smed_v4_12974_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30034376 slc6a-5 SMESG000042091.1 dd_Smed_v4_4290_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30032666 Spermatogenesis associated 7 SMESG000056890.1 dd_Smed_v4_8977_0_1 dd_Smed_v4
↳contained in posterior region of the whole animal and parapharyngeal region
↳existence overlaps Stage 6, Stage 5, juvenile stage, asexual adult, adult hermaphrodite, Stage 8 and Stage 7
↳existence starts during or after Stage 5
↳part of digestive system
→ pharynx progenitor cell and pharynx primordium develops into pharynx
→ pharynx lumen luminal space of pharynx
Expand to see terms that part of pharynx
BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):
Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.
EXPLORE ONTOLOGY GRAPH:
Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.
Embryonic Molecular Fate Mapping
All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource
DESCRIPTION:
foxA1, a pioneer transcription factor required for pharynx maintenance and regeneration during adulthood (Adler et al., 2014; Scimone et al., 2014), may similarly be required for construction of the definitive pharynx during embryogenesis. Development of the definitive pharynx, the single opening of the Smed digestive tract, commenced during S4-S5 with the onset of foxA1 expression in parenchymal cells, many of which were located in the oral hemisphere (Figure 1 – figure supplement 14A). The distribution of foxA1+ cells remained concentrated in and around the developing definitive pharynx rudiment during S6-S8, a pattern reminiscent of that observed in S. polychroa embryos (Martín-Durán et al., 2010), as well as in intact and regenerating Smed asexual adults (Adler et al., 2014; Scimone et al., 2014). The definitive pharynx develops beneath the degenerating temporary embryonic pharynx, and marks the ventral side of the embryos during S6 and thereafter (Martín-Durán and Romero, 2011). foxA1 upregulation during S5-S8 was statistically significant, albeit the adjusted p-values were above the thresholds set for inclusion in the enriched transcript lists presented in Figure 1 – source data 5, Figure 1 – source data 6, Figure 1 – source data 7, Figure 1 – source data 8. meis, a transcription factor coexpressed in foxA1+ neoblasts and expressed within the regenerating pharynx (Scimone et al., 2014), was among the S5 enriched transcripts (Figure 1 – source data 5); its expression trend was similar to foxA1 during embryogenesis (Figure 1 – figure supplement 14B). Two markers exhibiting pharynx-restricted expression in adults, laminin and npp-1 (Adler et al., 2014), were upregulated during S6-S8, after development of the definitive pharynx rudiment was evident (Figure 1 – figure supplement 14B).
FIGURES:

Figure 1 – figure supplement 14: Molecular markers for the definitive pharynx
A: WISH developmental time course using foxA1 riboprobes (blue), S3-S8. foxA1 expression was consistently detected in the embryonic pharynx lumen during S3-S5 (black arrowheads). Anterior: top (S6-S8). Black arrowheads: embryonic pharynx. Red arrowheads: definitive pharynx. O: oral hemisphere. A: aboral hemisphere. D: dorsal. V: ventral. Scale bars: 100 µm.
B: Average RPKM values per embryo for the definitive pharynx markers foxA1, meis, laminin, npp-1 during embryogenesis (Adler et al., 2014; Scimone et al., 2014), Y (yolk), Stage (S) S2-S8.
IN SITU HYBRIDIZATION DATA:
Smed ID | Accession | Name | Alias | Expressed during stage(s) | Tissue/Pattern | Images |
---|---|---|---|---|---|---|
SMED30027428 | AFJ24799.1 | forkhead box A-1 | foxA1 | Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8 | embryonic digestive system, digestive system, pharynx, pharynx progenitor cell, embryonic pharynx | ![]() |
Click to see image symbols and abbreviations
Abbreviation or symbol | Definition |
---|---|
O | oral hemisphere |
A | aboral hemisphere |
D | dorsal |
V | ventral |
L | lateral |
black arrowhead | embryonic pharynx |
red arrowhead | definitive pharynx |
black arrows | primitive gut |
yellow arrows | primitive ectoderm cells |
cyan arrows | brain |
cyan arrowheads | nerve cords |
blue arrowheads | eye progenitors (trail cells) |
purple arrowheads | eyes |
scale bar | 100 µm |
SEQUENCES:
smed_20140614 transcript sequences for genes validated by in situ hybridization (above).
>SMED30027428 ID=SMED30027428|Name=forkhead box A-1|organism=Schmidtea mediterranea sexual|type=transcript|length=2149bp
ATCACTTGGTGCTGCTTTTTGCCCCGATAAATCTCTCGGTGCTCCAAAATTTGTGTAAGCGAGCAAAAGATGATTGGGCA
ATTTCTAGCACGTCATTCGGCAACGATGTTTACAAGTTTCTCTGATTGGATGATAAAGTAGAAACTTTCCGAAAATGAAA
CTTCTCCGAACATGCGCATACCGACTGAAAATTAACTCTAAGCCAGCCAATGGAATTGAAGCAAAATTCAAGAGAATATT
AATTGACTTCGCGAATGAACTCAAATTTTCTATTGGCGTATTGTGTGTGCCTCATTGTGAGTGGTTGCGATCGCATCTCA
AATTATTTACACACAAAAAAATAACGCACACAGACATTGAATAGATATATTTGATCAAGTCAATATCACAATGTCAATAT
TAGCTTTTTCTGAAGAAAGAAGACGAACTAGAAGAAAAACAACAACGAAATAGATTCGATAAGGCTACTGAGCGATTTTC
ATAATCTAAATATTATTTTATTATTGATACGGACAAAAATTGGTCTTTTACCAAGTACTACTAGATTGTTGATAAAGAGA
GGTTATTTAGATGCTTGGAAAAAATCCTTATGAAACTGCAATGAGCAACGTGTATTCTCTACCTCCGGGAGGTTCTATTT
ACAATATGAACCCGATGAGTATATCATCAGCTGGCTACAACTCTCAACAAGTATCAACACTATCGTTGAACTTGACCGGA
ATCGGACCTCATTCATTAAGCCCAATGAGTGCAAGCATGTCGGGTATAGCTGCAATGGCCGGTGGAATGAGACAAGGTCT
TGAGTTGGGTCTTGGTAGAAGTGATAGTCCAAGAGATAAAAATTCAATTTCCAATAACAACCGACCATATCAAAGAAGTT
ACACTCATGCCAAGCCTCCATACAGTTATATAAGTTTGATAACAATGGCGATTCAAAATTCTCCAGTAAACATGTGCACT
CTATCGGAGATCTATCAATTCATTATGGATCATTTTCCATACTATCGTCAAAATCAACAGCGATGGCAGAATTCGATTCG
ACATTCTTTGTCCTTCAACGATTGCTTTGTTAAGGTTAGTAGAAGCCCAGAAAAACCAGGTAAAGGCTCATATTGGACCT
TGCATCCTCAATCAGGTAACATGTTTGAAAACGGTTGTTATCTCAGAAGACAAAAGCGATTCAAAGATCCACACAGAGAA
ATCGGCAGACAGAGTCAAAGAGCTGCCACTGGTCCTGGATCAAATGTCACAGAAAACAATCACGACAACGCATCGCAAGA
AGCTAGTGATAACGCAGAAAGTGATACGAAACCCAACATCAAGCAACTTGATTTATCAAGCGATCTCTTAACTAATCAAG
GTCATAATATTAAAAATACTAATCCAACTTCTGTTAGTCAGAGTTGTTCGATGTTTCATCGGAAAAAGGAAAACTGCTCA
CCAGTAGAAATGAAATTGAATAACCAAAACCAACAATCAAACCAGCAAGAACATCCACAAATCCATTACAATCCCAATCA
GCAATTCTACTCAAATCAGCAAAACATTTTCCAACAAAGTTCTCTTGATCATTACAGTCTATTAGCATCCGATGATCCTC
TTGGTCAAGGTATGCACTTGCCACCAGGTGCAAATAGTGTTTTCGGACTTTACGGGGCACATAACTTACCAAACGATGAT
CAAATTTCAGTGTCATTACCATCGATATCCTTATCCGGACATCCGTATGACAATTTATCAACAGCAATGGCATATCAATA
TGAAGCATCTCAACACAATTCTTCATTACTAACGACAAGTAATCCGTTCTCAATAGATCGTTTGATGCATCCAAGACTAG
TCGCTGCAGCGATGGGGGTCAGTCCCCATGATACTCTATACGCAGGAGCTACCGGCCCATCAGTTGATCTAGAACACATG
AAATACTACTCAAACTACAACAATGTGCCTCCTTATTCCTCTGCAATGTCTGACTACTACAAATATGTACAAAATCCTCA
GCCGGGCAACAGCGACATGAGTCTTTGAATTGAGTCCATTGAAGTCTACGGCAGTTTCCTCGAAATTTCACATTCAACCA
GATGTTTATCGCCTAATATAAAGCTGTGTTTTTTTATTTATTTACAATTAAATCTTTGTACAAGAGATC
ADDITIONAL REFERENCES:
Adler, C.E., Seidel, C.W., McKinney, S.A., and Sánchez Alvarado, A. (2014). Selective amputation of the pharynx identifies a FoxA-dependent regeneration program in planaria. Elife 3, e02238.
Martín-Durán, J.M., Amaya, E., and Romero, R. (2010). Germ layer specification and axial patterning in the embryonic development of the freshwater planarian Schmidtea polychroa. Dev Biol 340, 145-158.
Martín-Durán, J.M., and Romero, R. (2011). Evolutionary implications of morphogenesis and molecular patterning of the blind gut in the planarian Schmidtea polychroa. Dev Biol 352, 164-176.
Scimone, M.L., Kravarik, K.M., Lapan, S.W., and Reddien, P.W. (2014). Neoblast specialization in regeneration of the planarian Schmidtea mediterranea. Stem Cell Reports 3, 339-352.
PAGE: Planarian Anatomy Gene Expression
These transcripts were reported as being expressed in pharynx. Click this link to learn more about PAGE.
PAGE Curations: 3229
PLANA Term | Reference Transcript | Description | Gene Models | Published Transcript | Transcriptome | Publication | Specimen | Lifecycle | Evidence |
---|---|---|---|---|---|---|---|---|---|
pharynx | SMED30022468 | secreted frizzled-related protein 1 | SMESG000075831.1 SMESG000029446.1 | EU296635 | smed_ncbi_20200123 | PMID:24704339 Vogg et al., 2014 | ![]() | ![]() | ![]() |
pharynx | SMED30029487 | Smed-NDK | SMESG000062038.1 | GU592830.1 | smed_ncbi_20200123 | PMID:24704339 Vogg et al., 2014 | ![]() | ![]() | ![]() |
pharynx | SMED30005045 | zinc finger protein A | SMESG000022958.1 | KF751216.1 | smed_ncbi_20200123 | PMID:24704339 Vogg et al., 2014 | ![]() | ![]() | ![]() |
pharynx | SMED30027297 | winged helix/forkhead transcription factor | SMESG000077075.1 | KC577557.1 | smed_ncbi_20200123 | PMID:24704339 Vogg et al., 2014 | ![]() | ![]() | ![]() |
pharynx | SMED30027297 | winged helix/forkhead transcription factor | SMESG000077075.1 | KC577557 | smed_ncbi_20200123 | PMID:24704339 Vogg et al., 2014 | ![]() | ![]() | ![]() |
pharynx | SMED30031256 | wntP-2 | SMESG000066476.1 | wntP-2 | smed_ncbi_20200123 | PMID:23318641 Chen et al., 2013 | ![]() | ![]() | ![]() |
pharynx | SMED30027299 | PBX | SMESG000022232.1 SMESG000001913.1 | KC353351.1 | smed_ncbi_20200123 | PMID:23318641 Chen et al., 2013 | ![]() | ![]() | ![]() |
pharynx | SMED30020359 | Smed-NDK-3 | SMESG000046244.1 SMESG000046208.1 | GU592832.1 | smed_ncbi_20200123 | PMID:23318641 Chen et al., 2013 | ![]() | ![]() | ![]() |
pharynx | SMED30026602 | Wnt2-1 | SMESG000002069.1 | FJ463753.1 | smed_ncbi_20200123 | PMID:23318641 Chen et al., 2013 | ![]() | ![]() | ![]() |
pharynx | SMED30012677 | Coiled-coil domain-containing protein 51 | SMESG000058452.1 | Contig1190 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30012677 | Coiled-coil domain-containing protein 51 | SMESG000058452.1 | Contig1190 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30012677 | Coiled-coil domain-containing protein 51 | SMESG000057519.1 | Contig1190 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30012677 | Coiled-coil domain-containing protein 51 | SMESG000057519.1 | Contig1190 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30020784 | SMED30020784 | SMESG000011782.1 | Contig1076 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30023915 | Vacuolar-sorting protein SNF8 | SMESG000016990.1 | Contig1765 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30008091 | Serine/threonine-protein kinase PLK | SMESG000012131.1 SMESG000012127.1 | Contig809 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30008091 | Serine/threonine-protein kinase PLK | SMESG000027686.1 | Contig2364 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30008091 | Serine/threonine-protein kinase PLK | SMESG000012131.1 SMESG000012127.1 | Contig2364 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30008147 | SMED30008147 | SMESG000053405.1 | Contig1766 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30008147 | SMED30008147 | SMESG000053405.1 | Contig1766 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30008147 | SMED30008147 | SMESG000046314.1 SMESG000028362.1 | Contig1766 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30008147 | SMED30008147 | SMESG000046314.1 SMESG000028362.1 | Contig1766 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30004606 | Cytochrome P450 2K1-like protein | SMESG000020470.1 | Contig1680 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30014474 | Tumor susceptibility gene 101 protein | SMESG000049597.1 | Contig5044 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30014474 | Tumor susceptibility gene 101 protein | SMESG000004871.1 | Contig5044 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30016832 | SH3 domain-binding protein 5-like | SMESG000061052.1 | Contig4742 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30016832 | SH3 domain-binding protein 5-like | SMESG000061052.1 | Contig4742 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30016832 | SH3 domain-binding protein 5-like | SMESG000022856.1 | Contig4742 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30016832 | SH3 domain-binding protein 5-like | SMESG000022856.1 | Contig4742 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30023334 | Partitioning defective 6 | SMESG000066854.1 | Contig3688 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30023334 | Partitioning defective 6 | SMESG000026500.1 | Contig3688 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30020872 | Myosin IE | SMESG000003513.1 | Contig59 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30020872 | Myosin IE | SMESG000068232.1 | Contig59 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30016022 | SMED30016022 | SMESG000053405.1 | Contig1766 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30016022 | SMED30016022 | SMESG000053405.1 | Contig1766 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30016022 | SMED30016022 | SMESG000046314.1 SMESG000028362.1 | Contig1766 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30016022 | SMED30016022 | SMESG000046314.1 SMESG000028362.1 | Contig1766 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30019715 | Tumor protein p63-regulated gene 1 protein | SMESG000038153.1 SMESG000018862.1 | Contig1 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30019715 | Tumor protein p63-regulated gene 1 protein | SMESG000033840.1 | Contig1 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30015161 | Vacuolar protein sorting-associated protein 45 | SMESG000053405.1 | Contig1766 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30015161 | Vacuolar protein sorting-associated protein 45 | SMESG000046314.1 SMESG000028362.1 | Contig1766 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30002822 | RING-type domain-containing protein | SMESG000076385.1 SMESG000076375.1 SMESG000076363.1 SMESG000076223.1 SMESG000076482.1 SMESG000076470.1 SMESG000076410.1 SMESG000076358.1 | Contig1645 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30014928 | Formin-like protein | SMESG000044336.1 | Contig1407 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30014928 | Formin-like protein | SMESG000015063.1 | Contig1407 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30033014 | Phosphatidylinositol-4,5-bisphosphate 4-phosphatase | SMESG000063221.1 | Contig1068 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30021127 | SMED30021127 | SMESG000037626.1 | Contig1315 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30021127 | SMED30021127 | SMESG000037626.1 | Contig1315 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30021127 | SMED30021127 | SMESG000048042.1 | Contig1315 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30021127 | SMED30021127 | SMESG000048042.1 | Contig1315 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30015409 | cAMP-responsive element modulator | SMESG000016695.1 | Contig4585 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30015409 | cAMP-responsive element modulator | SMESG000033655.1 | Contig4585 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30003053 | 1-acyl-sn-glycerol-3-phosphate acyltransferase delta | SMESG000081135.1 | Contig3433 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30007716 | Ankyrin repeat domain 28b | SMESG000060640.1 | Contig3408 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30007716 | Ankyrin repeat domain 28b | SMESG000074871.1 | Contig3408 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30013976 | SMED30013976 | SMESG000003513.1 | Contig59 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30013976 | SMED30013976 | SMESG000003513.1 | Contig59 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30013976 | SMED30013976 | SMESG000068232.1 | Contig59 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30013976 | SMED30013976 | SMESG000068232.1 | Contig59 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30014138 | LIM homeobox 1b | SMESG000061052.1 | Contig4742 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30014138 | LIM homeobox 1b | SMESG000022856.1 | Contig4742 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30011213 | Osteoclast-stimulating factor 1 | SMESG000004952.1 | Contig516 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30017937 | WASP like actin nucleation promoting factor b | SMESG000036683.1 | Contig4572 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30017937 | WASP like actin nucleation promoting factor b | SMESG000074788.1 | Contig4572 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30021698 | 14-3-3 protein epsilon | SMESG000047644.1 | Contig5316 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30033333 | SMED30033333 | SMESG000004952.1 | Contig516 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30022398 | C2H2-type domain-containing protein | SMESG000032119.1 | Contig3970 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30001281 | SMED30001281 | SMESG000038153.1 SMESG000018862.1 | Contig1 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30001281 | SMED30001281 | SMESG000033840.1 | Contig1 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30011780 | Si:ch73-222h13.1 | SMESG000081135.1 | Contig3433 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30011780 | Si:ch73-222h13.1 | SMESG000081135.1 | Contig3433 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30008321 | SMED30008321 | SMESG000068172.1 | Contig3306 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30008321 | SMED30008321 | SMESG000068172.1 | Contig3306 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30008321 | SMED30008321 | SMESG000025870.1 | Contig3306 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30008321 | SMED30008321 | SMESG000025870.1 | Contig3306 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30013865 | OFD1 | SMESG000046592.1 | dd_Smed_v4_13339_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001550 | Flagellar outer dynein arm light chain 2 | dd_Smed_v4_19018_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30015125 | SMED30015125 | SMESG000061766.1 | dd_Smed_v4_12632_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30015973 | myosin-11 | SMESG000064787.1 | dd_Smed_v4_13489_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30015703 | IQ domain-containing protein D | SMESG000017912.1 | dd_Smed_v4_7079_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30017612 | SMED30017612 | SMESG000007344.1 | dd_Smed_v4_5456_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30010695 | coiled-coil domain-containing protein 170 | SMESG000048767.1 | dd_Smed_v4_7066_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30005442 | General transcription factor II-I repeat domain-containing protein 2A | dd_Smed_v4_14922_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30000207 | SMED30000207 | dd_Smed_v4_45021_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30016880 | Zinc finger Ran-binding domain-containing protein 2 | SMESG000017096.1 | dd_Smed_v4_1397_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30011381 | HORMA domain-containing protein | SMESG000066514.1 | dd_Smed_v4_2201_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30019802 | SMED30019802 | SMESG000017096.1 | dd_Smed_v4_1397_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001079 | PSDC domain-containing protein | SMESG000023831.1 | dd_Smed_v4_5455_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30005276 | SMED30005276 | SMESG000014888.1 | dd_Smed_v4_7268_1_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30006326 | piggyBac transposable element-derived protein 4-like | dd_Smed_v4_14301_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30011189 | Arfaptin-2 | SMESG000011384.1 | dd_Smed_v4_5732_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30015183 | Leucine-rich repeat-containing protein 9 | SMESG000021671.1 | dd_Smed_v4_14851_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30017298 | SMED30017298 | dd_Smed_v4_17790_0_2 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30013459 | SMED30013459 | dd_Smed_v4_16904_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30002064 | Doublecortin domain-containing protein 2 | SMESG000040482.1 SMESG000040481.1 SMESG000040480.1 SMESG000038137.1 | dd_Smed_v4_6464_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30013261 | Retrovirus-related Pol polyprotein from transposon | dd_Smed_v4_15498_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30012385 | C2H2-type domain-containing protein | dd_Smed_v4_17695_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30018493 | Ras and EF-hand domain-containing protein | SMESG000028852.1 | dd_Smed_v4_12567_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30015588 | SMED30015588 | SMESG000009089.1 | dd_Smed_v4_5692_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30018439 | XK-related protein | SMESG000080414.1 | dd_Smed_v4_2770_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021087 | SMED30021087 | SMESG000014860.1 | dd_Smed_v4_6894_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30023104 | SMED30023104 | dd_Smed_v4_1576_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30020855 | Guanine nucleotide-binding protein G(o) subunit alpha | SMESG000081490.1 | dd_Smed_v4_1635_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30028419 | TATA-box-binding protein | SMESG000068211.1 | dd_Smed_v4_17006_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30023491 | SMED30023491 | dd_Smed_v4_14238_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30023859 | Serine/threonine protein phosphatase 2A regulatory subunit | SMESG000026797.1 | dd_Smed_v4_6134_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30026086 | MIEAP domain-containing protein | SMESG000057251.1 | dd_Smed_v4_14351_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30023613 | SMED30023613 | dd_Smed_v4_12778_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30021143 | Basal body-orientation factor 1 | SMESG000078046.1 | dd_Smed_v4_9328_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022653 | Stromal interaction molecule 1 | SMESG000081265.1 | dd_Smed_v4_12888_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30029763 | histone H1 | SMESG000024348.1 SMESG000010800.1 | dd_Smed_v4_601_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30030837 | cilia- and flagella-associated protein 299 | SMESG000052708.1 | dd_Smed_v4_11277_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30033785 | Cell division cycle and apoptosis regulator protein 1 | dd_Smed_v4_1181_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30021189 | SMED30021189 | SMESG000081490.1 | dd_Smed_v4_1635_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30026311 | SMED30026311 | SMESG000030467.1 | dd_Smed_v4_15263_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30025849 | Centrosome and spindle pole-associated protein 1 | SMESG000080361.1 | dd_Smed_v4_13453_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30020686 | Transmembrane protein 80 | SMESG000018777.1 | dd_Smed_v4_13318_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30025629 | Enkurin domain-containing protein | SMESG000020205.1 | dd_Smed_v4_12663_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30029902 | Protein kinase domain-containing protein | SMESG000074943.1 SMESG000074941.1 | dd_Smed_v4_6760_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30023430 | set nuclear proto-oncogene | SMESG000031906.1 SMESG000031905.1 | dd_Smed_v4_618_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30029492 | KN motif and ankyrin repeat domain-containing protein 4 isoform X2 | SMESG000059500.1 | dd_Smed_v4_7499_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30026877 | HORMA domain-containing protein | SMESG000066514.1 | dd_Smed_v4_2201_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30020913 | SMED30020913 | SMESG000009078.1 | dd_Smed_v4_13484_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30029370 | Glucose-6-phosphate isomerase | SMESG000067583.1 | dd_Smed_v4_1398_1_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30029583 | SMED30029583 | dd_Smed_v4_1338_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30027086 | SMED30027086 | dd_10213 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30030699 | Ephrin type-A receptor 4-B | SMESG000077240.1 | dd_Smed_v4_16483_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30034308 | Integrase catalytic domain-containing protein | dd_Smed_v4_12778_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30032947 | cilia- and flagella-associated protein 46 | SMESG000014116.1 SMESG000014118.1 | dd_Smed_v4_14103_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30029781 | SMED30029781 | dd_Smed_v4_1213_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30024583 | SMED30024583 | dd_Smed_v4_215_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30032225 | SMED30032225 | dd_Smed_v4_16904_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30020537 | SMED30020537 | SMESG000040594.1 | dd_Smed_v4_1676_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30028337 | SAP domain-containing protein | dd_Smed_v4_1181_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30028343 | Cytosolic carboxypeptidase 2 | SMESG000006325.1 | dd_Smed_v4_13454_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30024648 | RRM domain-containing protein | dd_Smed_v4_11998_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30015586 | TAR DNA-binding protein 43 | SMESG000048176.1 | dd_Smed_v4_12522_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30014135 | ankyrin repeat and MYND domain-containing protein 1-like | SMESG000039917.1 | dd_Smed_v4_12515_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30017874 | PRKCA-binding protein | SMESG000013976.1 | dd_Smed_v4_11769_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30008623 | Phospholipase B-like | SMESG000022762.1 | dd_Smed_v4_485_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30012622 | Intraflagellar transport 43 | SMESG000067883.1 | dd_Smed_v4_5237_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30015672 | Gelsolin-like protein | SMESG000015928.1 | dd_Smed_v4_1215_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30002502 | Choline-phosphate cytidylyltransferase | SMESG000081359.1 | dd_Smed_v4_5385_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001113 | FERM domain-containing protein | SMESG000048801.1 | dd_Smed_v4_5600_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30014094 | Kinesin-like protein | SMESG000016386.1 | dd_Smed_v4_11012_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30008165 | Connector enhancer of kinase suppressor of ras 2 | SMESG000044449.1 SMESG000044448.1 | dd_Smed_v4_4457_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30019494 | Ubiquitin-fold modifier-conjugating enzyme 1 | SMESG000068795.1 | dd_Smed_v4_4590_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30000566 | Ropporin-1-like protein | SMESG000079804.1 | dd_Smed_v4_4888_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30016479 | SMED30016479 | SMESG000037733.1 | dd_Smed_v4_12359_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30011695 | Alpha-galactosidase | SMESG000009912.1 | dd_Smed_v4_606_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30007110 | Myosin light chain 1 | SMESG000018597.1 | dd_Smed_v4_4478_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30000819 | Acid sphingomyelinase-like phosphodiesterase | SMESG000071517.1 | dd_Smed_v4_5377_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30019518 | SMED30019518 | SMESG000073002.1 SMESG000072984.1 | dd_Smed_v4_12680_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30018507 | Calcium-transporting ATPase | SMESG000038461.1 | dd_Smed_v4_4559_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30018507 | Calcium-transporting ATPase | SMESG000038461.1 | dd_Smed_v4_3170_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30011335 | Dynein heavy chain 10, axonemal | SMESG000051829.1 | dd_Smed_v4_12797_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30011335 | Dynein heavy chain 10, axonemal | SMESG000051829.1 | dd_Smed_v4_5169_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30016848 | SMED30016848 | SMESG000079496.1 | dd_Smed_v4_6860_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30000512 | cilia- and flagella-associated protein 61 | SMESG000059955.1 | dd_Smed_v4_4908_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30007780 | Collagen alpha-6(VI) chain | SMESG000046770.1 | dd_Smed_v4_7616_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30011581 | AP2-associated protein kinase 1-like Protein | SMESG000041938.1 SMESG000041937.1 SMESG000051989.1 | dd_Smed_v4_1179_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30014550 | Intraflagellar transport protein 43 | SMESG000067883.1 | dd_Smed_v4_5237_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30005253 | EF-hand domain-containing family member C2 | SMESG000076759.1 | dd_Smed_v4_6035_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30002256 | coiled-coil domain-containing protein 81 | SMESG000036887.1 | dd_Smed_v4_6753_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30009251 | coiled-coil domain-containing protein 146 | SMESG000006416.1 | dd_Smed_v4_6858_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30013884 | SMED30013884 | SMESG000049207.1 SMESG000049205.1 SMESG000049063.1 | dd_Smed_v4_11081_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001254 | SMED30001254 | SMESG000025206.1 | dd_Smed_v4_4615_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001147 | Ras-like GTP-binding protein YPT1 | SMESG000044147.1 | dd_Smed_v4_6181_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30005883 | Coiled-coil domain containing 81 | SMESG000036887.1 | dd_Smed_v4_6753_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30007496 | C-type lectin domain-containing protein | SMESG000016262.1 | dd_Smed_v4_5187_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30017615 | SMED30017615 | SMESG000016882.1 | dd_Smed_v4_12216_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30000108 | Glycerol-3-phosphate dehydrogenase [NAD( )] | SMESG000008767.1 | dd_Smed_v4_4661_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30014347 | plexin A | SMESG000049328.1 SMESG000006542.1 SMESG000006541.1 | dd_Smed_v4_11934_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30012699 | Protein CLP1 homolog | SMESG000020165.1 | dd_Smed_v4_11378_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30000248 | Ras-related protein Rab-11A | SMESG000016036.1 | dd_Smed_v4_4964_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30030227 | flotillin-2 | SMESG000059332.1 | Contig5500 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30030227 | flotillin-2 | SMESG000024114.1 | Contig5500 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30032408 | SMED30032408 | SMESG000027686.1 | Contig2364 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30032408 | SMED30032408 | SMESG000012131.1 SMESG000012127.1 | Contig2364 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30032354 | EOG090X01A3 | SMESG000068156.1 SMESG000064685.1 SMESG000043474.1 SMESG000010609.1 SMESG000076470.1 SMESG000073857.1 SMESG000062429.1 SMESG000058575.1 SMESG000053533.1 SMESG000020635.1 SMESG000015751.1 SMESG000005260.1 | Contig246 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30032354 | EOG090X01A3 | SMESG000000175.1 | Contig246 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30028347 | Engulfment and cell motility 3 | SMESG000013936.1 | Contig1935 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30028347 | Engulfment and cell motility 3 | SMESG000039535.1 | Contig1935 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30020811 | SMED30020811 | SMESG000005612.1 | Contig594 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30020811 | SMED30020811 | SMESG000005612.1 | Contig594 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30020811 | SMED30020811 | SMESG000011575.1 | Contig594 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30020811 | SMED30020811 | SMESG000011575.1 | Contig594 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30021511 | SMED30021511 | SMESG000038232.1 | Contig5776 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30015310 | DUF3421 domain-containing protein | SMESG000046710.1 SMESG000046697.1 | PL020001000E05 | ncbi_smed_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30016397 | Transforming acidic coiled-coil-containing protein 3 | SMESG000056367.1 | PL08003B2C03 | ncbi_smed_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30017282 | nuclear factor Y complex B2 | SMESG000040141.1 | KU366700 | smed_ncbi_20200123 | PMID:27304889 Iyer et al., 2016 | ![]() | ![]() | ![]() |
pharynx | SMED30022468 | secreted frizzled-related protein 1 | SMESG000075831.1 SMESG000029446.1 | ABY85212.1 | smed_ncbi_20200123 | PMID:20707997 Gurley et al., 2010 | ![]() | ![]() | ![]() |
pharynx | SMED30022468 | secreted frizzled-related protein 1 | SMESG000075831.1 SMESG000029446.1 | EU296635 | smed_ncbi_20200123 | PMID:20707997 Gurley et al., 2010 | ![]() | ![]() | ![]() |
pharynx | SMED30022929 | WntA | SMESG000051375.1 | ACJ64865.1 | smed_ncbi_20200123 | PMID:20707997 Gurley et al., 2010 | ![]() | ![]() | ![]() |
pharynx | SMED30022929 | WntA | SMESG000051375.1 | FJ463750.1 | smed_ncbi_20200123 | PMID:20707997 Gurley et al., 2010 | ![]() | ![]() | ![]() |
pharynx | SMED30022929 | WntA | SMESG000051375.1 | FJ463750 | smed_ncbi_20200123 | PMID:20707997 Gurley et al., 2010 | ![]() | ![]() | ![]() |
pharynx | SMED30025497 | secreted frizzled related protein 2 | SMESG000050379.1 | ADO51625.1 | smed_ncbi_20200123 | PMID:20707997 Gurley et al., 2010 | ![]() | ![]() | ![]() |
pharynx | SMED30019722 | secreted frizzled related protein 3 | SMESG000058717.1 | SMED30019722 | smed_20140614 | PMID:20707997 Gurley et al., 2010 | ![]() | ![]() | ![]() |
pharynx | SMED30019722 | secreted frizzled related protein 3 | SMESG000058717.1 | HM751832.1 | smed_ncbi_20200123 | PMID:20707997 Gurley et al., 2010 | ![]() | ![]() | ![]() |
pharynx | SMED30016141 | lissencephaly-1 | SMESG000054739.1 SMESG000035997.1 | JQ650355.1 | smed_ncbi_20200123 | PMID:22411224 Cowles et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30001081 | NudC nuclear distribution protein | SMESG000036795.1 | DN303982.1 | ncbi_smed_ests | PMID:22411224 Cowles et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30020436 | Nuclear distribution protein nudE-like 1 | SMESG000016071.1 | HO006501.1 | ncbi_smed_ests | PMID:22411224 Cowles et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30004930 | Irregular chiasm C-roughest-like isoform X2 | SMESG000077979.1 | dd_Smed_v4_12549_0_1 | dd_Smed_v4 | PMID:27063937 Scimone et al., 2016 | ![]() | ![]() | ![]() |
pharynx | SMED30013316 | Polycomb group RING finger protein 1 | SMESG000072501.1 | dd_Smed_v4_12753_0_1 | dd_Smed_v4 | PMID:27063937 Scimone et al., 2016 | ![]() | ![]() | ![]() |
pharynx | SMED30001690 | SMED30001690 | SMESG000069322.1 | dd_Smed_v4_12571_0_1 | dd_Smed_v4 | PMID:27063937 Scimone et al., 2016 | ![]() | ![]() | ![]() |
pharynx | SMED30000553 | Epithelial discoidin domain-containing receptor | SMESG000069322.1 | dd_Smed_v4_12571_0_1 | dd_Smed_v4 | PMID:27063937 Scimone et al., 2016 | ![]() | ![]() | ![]() |
pharynx | SMED30033884 | FERM, RhoGEF and pleckstrin domain-containing protein 1 | SMESG000069407.1 | dd_Smed_v4_12715_0_1 | dd_Smed_v4 | PMID:27063937 Scimone et al., 2016 | ![]() | ![]() | ![]() |
pharynx | SMED30025810 | SMED30025810 | SMESG000019718.1 | dd_Smed_v4_2749_0_1 | dd_Smed_v4 | PMID:27063937 Scimone et al., 2016 | ![]() | ![]() | ![]() |
pharynx | SMED30005718 | Guanine nucleotide-binding protein G(I) subunit alpha | SMESG000026774.1 | Gpas | smed_ncbi_20200123 | PMID:24992682 Vásquez-Doorman et al., 2014 | ![]() | ![]() | ![]() |
pharynx | SMED30020522 | ap2 | SMESG000022356.1 | JX010470.1 | smed_ncbi_20200123 | PMID:24992682 Vásquez-Doorman et al., 2014 | ![]() | ![]() | ![]() |
pharynx | SMED30005045 | zinc finger protein A | SMESG000022958.1 | dd_Smed_v4_22585_0_1 | dd_Smed_v4 | PMID:24992682 Vásquez-Doorman et al., 2014 | ![]() | ![]() | ![]() |
pharynx | SMED30005045 | zinc finger protein A | SMESG000022958.1 | KF751216.1 | smed_ncbi_20200123 | PMID:24992682 Vásquez-Doorman et al., 2014 | ![]() | ![]() | ![]() |
pharynx | SMED30031425 | Homeobox protein Hox-D12 | SMESG000003389.1 | SMED30031425 | smed_20140614 | PMID:27034770 Currie et al., 2016 | ![]() | ![]() | ![]() |
pharynx | SMED30024673 | SMED30024673 | SMESG000067310.1 | SmedASXL_065556 | SmedAsxl_ww_GCZZ01 | PMID:29158443 He et al., 2017 | ![]() | ![]() | ![]() |
pharynx | SMED30022468 | secreted frizzled-related protein 1 | SMESG000075831.1 SMESG000029446.1 | EU296635 | smed_ncbi_20200123 | PMID:25558068 Reuter et al., 2015 | ![]() | ![]() | ![]() |
pharynx | SMED30029487 | Smed-NDK | SMESG000062038.1 | GU592830.1 | smed_ncbi_20200123 | PMID:25558068 Reuter et al., 2015 | ![]() | ![]() | ![]() |
pharynx | SMED30022963 | anaphase-promoting complex subunit 1 | SMESG000010770.1 SMESG000012375.1 | tr5_7361 | mu_Smed_v1 | PMID:25558068 Reuter et al., 2015 | ![]() | ![]() | ![]() |
pharynx | SMED30018250 | Telomerase-binding protein EST1A | tr5_9369 | mu_Smed_v1 | PMID:25558068 Reuter et al., 2015 | ![]() | ![]() | ![]() | |
pharynx | SMED30013810 | Teashirt | SMESG000008973.1 | KP003815.1 | smed_ncbi_20200123 | PMID:25558068 Reuter et al., 2015 | ![]() | ![]() | ![]() |
pharynx | SMED30012814 | Protein CWC15-like protein | SMESG000010770.1 SMESG000012375.1 | tr5_7361 | mu_Smed_v1 | PMID:25558068 Reuter et al., 2015 | ![]() | ![]() | ![]() |
pharynx | SMED30034772 | Fibrillar collagen NC1 domain-containing protein | SMESG000077977.1 | tr5_2051 | mu_Smed_v1 | PMID:25558068 Reuter et al., 2015 | ![]() | ![]() | ![]() |
pharynx | SMED30016511 | SMED30016511 | SMESG000072006.1 | tr5_6444 | mu_Smed_v1 | PMID:25558068 Reuter et al., 2015 | ![]() | ![]() | ![]() |
pharynx | SMED30005458 | Phosphatidylinositol 4-kinase type 2-beta | SMESG000074718.1 | tr5_11049 | mu_Smed_v1 | PMID:25558068 Reuter et al., 2015 | ![]() | ![]() | ![]() |
pharynx | SMED30013810 | Teashirt | SMESG000008973.1 | KP003815.1 | smed_ncbi_20200123 | PMID:25725068 Owen et al., 2015 | ![]() | ![]() | ![]() |
pharynx | SMED30001404 | Dual specificity tyrosine-phosphorylation-regulated kinase 2 | SMESG000076586.1 SMESG000076583.1 | dd_Smed_v4_12119_1_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30000918 | Coiled-coil domain containing 13 | SMESG000058204.1 | dd_Smed_v4_12055_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30014199 | Myosin | SMESG000047361.1 | dd_Smed_v4_4503_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001362 | SMEDWI-3 | SMESG000081970.1 | dd_Smed_v4_1258_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30002156 | TNF receptor associated factor-2 | SMESG000065606.1 SMESG000000563.1 SMESG000000559.1 SMESG000000493.1 SMESG000000294.1 | dd_Smed_v4_1243_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30014144 | Phytanoyl-CoA dioxygenase domain-containing protein 1-like | SMESG000023010.1 | dd_Smed_v4_1207_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30002139 | Vacuole membrane protein 1 | SMESG000034612.1 | dd_Smed_v4_1156_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001681 | SMED30001681 | SMESG000049443.1 | dd_Smed_v4_1193_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001366 | SMED30001366 | SMESG000014648.1 | dd_Smed_v4_1227_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30005046 | Dynein heavy chain, axonemal | SMESG000050247.1 SMESG000050248.1 | dd_Smed_v4_10191_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30005046 | Dynein heavy chain, axonemal | SMESG000050247.1 | dd_Smed_v4_13135_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30015061 | G protein regulated inducer of neurite outgrowth | SMESG000062691.1 | dd_Smed_v4_10294_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30007001 | SMED30007001 | SMESG000072162.1 | dd_Smed_v4_537_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30023483 | INX-13 | SMESG000043575.1 | dd_Smed_v4_11501_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30016546 | SMED30016546 | SMESG000051921.1 SMESG000051913.1 | dd_Smed_v4_1175_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30012858 | serine/threonine-protein kinase DCLK1 | SMESG000078466.1 | dd_Smed_v4_13093_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30012858 | serine/threonine-protein kinase DCLK1 | dd_Smed_v4_5129_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30019258 | Cytosolic carboxypeptidase 2 | SMESG000058240.1 | dd_Smed_v4_13450_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30013901 | SMED30013901 | SMESG000019480.1 | dd_Smed_v4_12627_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30018865 | DUF1619 domain-containing protein | SMESG000057489.1 | dd_Smed_v4_11225_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30014047 | SMED30014047 | SMESG000025950.1 | dd_Smed_v4_12336_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30020291 | Centrosomal protein 104 | SMESG000023549.1 | dd_Smed_v4_10228_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30020784 | SMED30020784 | SMESG000011782.1 | dd_Smed_v4_10359_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021590 | Spectrin beta chain | SMESG000081696.1 | dd_Smed_v4_1122_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30023718 | Histone-lysine N-methyltransferase | SMESG000081033.1 | dd_Smed_v4_10189_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30025688 | Protein tilB homolog | SMESG000058220.1 | dd_Smed_v4_10124_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021807 | SMED30021807 | SMESG000030582.1 | dd_Smed_v4_1124_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022848 | Synaptotagmin VIa | SMESG000043595.1 | dd_Smed_v4_12716_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021977 | Beta-1,3-galactosyltransferase 1 | SMESG000035184.1 | dd_Smed_v4_11741_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021820 | Guanylate cyclase | SMESG000056411.1 | dd_Smed_v4_11767_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30023487 | Protein LSM14 homolog B-A | SMESG000014632.1 | dd_Smed_v4_1125_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30004754 | RNA-binding protein 8A | SMESG000051885.1 | dd_Smed_v4_1169_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30008091 | Serine/threonine-protein kinase PLK | SMESG000012127.1 | dd_Smed_v4_1620_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30009052 | 60S ribosomal protein L18 | SMESG000017166.1 | dd_Smed_v4_128_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30002882 | SMED30002882 | SMESG000069367.1 | dd_Smed_v4_11838_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30002882 | SMED30002882 | SMESG000069367.1 | dd_Smed_v4_9233_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30007680 | serine/threonine-protein kinase DCLK1 | SMESG000078466.1 | dd_Smed_v4_13093_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30007680 | serine/threonine-protein kinase DCLK1 | dd_Smed_v4_5129_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30011703 | Death domain-containing protein | SMESG000040750.1 | dd_Smed_v4_11696_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30008769 | 40S ribosomal protein S10 | SMESG000034720.1 | dd_Smed_v4_117_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30011715 | Splicing factor, arginine/serine-rich 6 | SMESG000041210.1 | dd_Smed_v4_1177_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30009968 | Intraflagellar transport protein 122 homolog | SMESG000039305.1 SMESG000039304.1 | dd_Smed_v4_11912_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30010620 | Histone acetyltransferase | SMESG000017094.1 | dd_Smed_v4_12274_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30009144 | CCDC66 domain-containing protein | SMESG000019367.1 | dd_Smed_v4_11800_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30009869 | fas-binding factor 1 homolog | SMESG000037546.1 | dd_Smed_v4_12735_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30009869 | fas-binding factor 1 homolog | SMESG000037546.1 | dd_Smed_v4_12422_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30007993 | GTP-binding protein | SMESG000065983.1 | dd_Smed_v4_11291_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30012985 | Protein FAM188B | SMESG000064698.1 | dd_Smed_v4_13105_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30011832 | Enkurin domain-containing protein | SMESG000081414.1 | dd_Smed_v4_12339_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30017201 | SFI1 | SMESG000002829.1 | dd_Smed_v4_12484_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30013262 | SMED30013262 | SMESG000060779.1 | dd_Smed_v4_11792_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001975 | vasohibin-2 | SMESG000072424.1 | dd_Smed_v4_12833_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30002934 | forkhead box J1-like protein 4 | SMESG000010030.1 | dd_Smed_v4_10152_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30011699 | calcium/calmodulin-dependent protein kinase type IV | SMESG000042100.1 | dd_Smed_v4_10731_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30002822 | RING-type domain-containing protein | SMESG000076482.1 SMESG000076470.1 SMESG000076469.1 SMESG000076410.1 SMESG000076409.1 SMESG000076408.1 SMESG000076407.1 SMESG000076406.1 SMESG000076390.1 SMESG000076389.1 SMESG000076385.1 SMESG000076375.1 SMESG000076371.1 SMESG000076363.1 SMESG000076358.1 SMESG000076223.1 SMESG000040665.1 | dd_Smed_v4_645_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30012954 | centriolin | SMESG000006866.1 | dd_Smed_v4_10369_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30010364 | SMED30010364 | SMESG000056847.1 SMESG000056843.1 SMESG000056838.1 SMESG000044770.1 SMESG000044762.1 SMESG000007140.1 | dd_Smed_v4_1137_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30018872 | Ig-like domain-containing protein | SMESG000042318.1 | dd_Smed_v4_11702_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30002374 | phytanoyl-CoA dioxygenase domain-containing protein 1 homolog | SMESG000077696.1 SMESG000077694.1 | dd_Smed_v4_1292_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30013692 | Small HSP protein | SMESG000059879.1 SMESG000059868.1 SMESG000059853.1 | dd_Smed_v4_1039_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30013054 | Protein kinase domain-containing protein | SMESG000020466.1 | dd_Smed_v4_11366_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30013390 | Nesprin-1 | SMESG000069851.1 | dd_Smed_v4_10646_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30014496 | Ribosome biogenesis protein NSA2 | SMESG000028599.1 | dd_Smed_v4_1012_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30000421 | TPR_REGION domain-containing protein | SMESG000071973.1 | dd_Smed_v4_11462_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30016369 | SMED30016369 | SMESG000022115.1 | dd_Smed_v4_12348_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30010674 | SPATA6 domain-containing protein | SMESG000053714.1 | dd_Smed_v4_10543_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001654 | SMED30001654 | SMESG000012124.1 | dd_Smed_v4_11272_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30002162 | Glycosyl transferase | SMESG000030921.1 | dd_Smed_v4_11247_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30009956 | SMED30009956 | SMESG000022272.1 | dd_Smed_v4_10991_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30009956 | SMED30009956 | SMESG000022273.1 | dd_Smed_v4_8344_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30007500 | coiled-coil domain-containing protein 170 | SMESG000074429.1 | dd_Smed_v4_10140_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30016203 | SMED30016203 | SMESG000030489.1 | dd_Smed_v4_11685_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30006859 | Peptidyl-prolyl cis-trans isomerase | SMESG000059112.1 | dd_Smed_v4_10327_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30016654 | Intraflagellar transport protein 140 | SMESG000001316.1 | dd_Smed_v4_11300_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30002712 | Dynein heavy chain 3, axonemal | SMESG000040511.1 SMESG000040510.1 SMESG000040507.1 | dd_Smed_v4_10846_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30010655 | SMED30010655 | SMESG000028897.1 | dd_Smed_v4_12473_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30017260 | Pre mRNA processing factor 6 | SMESG000011657.1 | dd_Smed_v4_1153_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30017587 | cilia- and flagella-associated protein 65 | SMESG000069031.1 | dd_Smed_v4_12428_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30029426 | Baculoviral IAP repeat-containing protein 7 | SMESG000067789.1 | dd_Smed_v4_1187_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30027439 | SMED30027439 | SMESG000031258.1 | dd_Smed_v4_12080_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30031490 | SMED30031490 | SMESG000017778.1 | dd_Smed_v4_10175_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30027291 | Death domain-containing protein | SMESG000064407.1 | dd_Smed_v4_12177_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30030597 | Mitogen-activated protein kinase | SMESG000033376.1 | dd_Smed_v4_11396_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022030 | EGR-like protein 1 | SMESG000000959.1 | dd_Smed_v4_12410_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022030 | EGR-like protein 1 | SMESG000000960.1 | dd_Smed_v4_7731_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30023193 | Tau tubulin kinase | SMESG000026133.1 | dd_Smed_v4_12470_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30031582 | Innexin | SMESG000081749.1 | dd_Smed_v4_11302_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30031582 | Innexin | SMESG000081749.1 | dd_Smed_v4_10287_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30025052 | histone-lysine N-methyltransferase SETD1B-A | SMESG000062286.1 | dd_Smed_v4_11834_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30028737 | Tubby-like protein | SMESG000009644.1 | dd_Smed_v4_10462_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30033232 | Retinoid isomerohydrolase | SMESG000054001.1 | dd_Smed_v4_13185_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022225 | Bidirectional sugar transporter SWEET | SMESG000012540.1 | dd_Smed_v4_12308_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30031468 | Propionyl-CoA carboxylase alpha chain, mitochondrial | SMESG000034830.1 | dd_Smed_v4_1247_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30030068 | SMED30030068 | SMESG000051921.1 SMESG000051913.1 | dd_Smed_v4_1175_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30026225 | SMED30026225 | SMESG000059698.1 | dd_Smed_v4_188_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30027035 | Pseudouridine synthase | SMESG000051935.1 | dd_Smed_v4_12745_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30030095 | coiled-coil domain-containing protein 87 isoform X1 | SMESG000004454.1 | dd_Smed_v4_12480_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30027561 | SMED30027561 | SMESG000072848.1 | dd_Smed_v4_11162_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30027269 | Ig-like domain-containing protein | SMESG000018952.1 SMESG000018951.1 SMESG000018945.1 SMESG000018944.1 | dd_Smed_v4_11944_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30023484 | Methyltransferase-like protein 17 | SMESG000058278.1 SMESG000058279.1 | dd_Smed_v4_4718_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30026485 | SMED30026485 | SMESG000078466.1 | dd_Smed_v4_13093_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30032498 | NPHP8 | SMESG000076081.1 | dd_Smed_v4_11425_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30032420 | SMED30032420 | SMESG000050229.1 SMESG000050221.1 | dd_Smed_v4_1219_1_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30034138 | Coiled-coil domain-containing protein 96 | SMESG000050787.1 | dd_Smed_v4_11884_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30028228 | Centrosomal protein 164 | SMESG000054195.1 SMESG000021687.1 | dd_Smed_v4_12228_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30035360 | Peptidyl-prolyl cis-trans isomerase | SMESG000006589.1 | dd_Smed_v4_133_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30030030 | SMED30030030 | SMESG000007276.1 | dd_Smed_v4_11992_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30031828 | SMED30031828 | SMESG000072691.1 | dd_Smed_v4_13068_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30007403 | Protein phosphatase 1 regulatory subunit 42 | SMESG000014888.1 | dd_Smed_v4_7268_1_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30002774 | SMED30002774 | SMESG000017229.1 | dd_Smed_v4_613_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30000178 | SMED30000178 | dd_Smed_v4_13403_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30013149 | MIEAP domain-containing protein | SMESG000019081.1 | dd_Smed_v4_6321_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30017314 | Dynein regulatory complex subunit 7 | SMESG000078850.1 | dd_Smed_v4_12588_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30016577 | SMED30016577 | dd_Smed_v4_10215_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30018829 | Insulin like growth factor 2 receptor | SMESG000023958.1 SMESG000023953.1 | dd_Smed_v4_14729_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30011798 | E3 ubiquitin-protein ligase MIB2 | SMESG000043477.1 SMESG000010549.1 SMESG000010347.1 SMESG000010327.1 | dd_Smed_v4_593_1_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30017080 | FHA domain-containing protein | SMESG000061238.1 | dd_Smed_v4_11335_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30017410 | Peptidoglycan-recognition protein | SMESG000004536.1 | dd_Smed_v4_817_1_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30012974 | slc25a-27 | SMESG000061901.1 | dd_Smed_v4_543_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30000691 | Eukaryotic initiation factor 4A-III | SMESG000078818.1 | dd_Smed_v4_737_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30019298 | Heterogeneous nuclear ribonucleoprotein L | SMESG000005298.1 | dd_Smed_v4_1327_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30002680 | SMED30002680 | dd_Smed_v4_11691_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30011607 | SMED30011607 | dd_Smed_v4_15559_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30006416 | cell division cycle 25-1 | SMESG000065054.1 | dd_Smed_v4_5520_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30004099 | SMED30004099 | dd_Smed_v4_15498_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30015480 | SMED30015480 | SMESG000064024.1 | dd_Smed_v4_16354_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30018518 | Protein chibby 1 | dd_Smed_v4_11618_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30005911 | SMED30005911 | dd_Smed_v4_12_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30009695 | Ras-related protein Ral-A | SMESG000017190.1 SMESG000016219.1 | dd_Smed_v4_522_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30017794 | Coiled-coil domain containing 191 | SMESG000064321.1 | dd_Smed_v4_8967_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30018740 | SMED30018740 | dd_Smed_v4_1700_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30017312 | Coiled-coil domain-containing protein 189 | SMESG000046576.1 | dd_Smed_v4_12703_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30011948 | F-box/WD repeat-containing protein 10 | SMESG000002351.1 SMESG000002342.1 | dd_Smed_v4_13271_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30012783 | SMED30012783 | SMESG000064443.1 | dd_Smed_v4_16605_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001799 | NADH dehydrogenase subunit 5 | dd_Smed_v4_258_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30001799 | NADH dehydrogenase subunit 5 | dd_Smed_v4_957_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30005066 | Multiple epidermal growth factor domains protein 6 | SMESG000002074.1 | dd_Smed_v4_5630_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30000702 | cytochrome b | dd_Smed_v4_344_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30012764 | SMED30012764 | SMESG000059203.1 | dd_Smed_v4_5415_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30018900 | Intraflagellar transport protein 56 | SMESG000031670.1 | dd_Smed_v4_12618_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30013526 | SMED30013526 | dd_Smed_v4_11243_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30013075 | Voltage-dependent anion channel 3 | SMESG000000196.1 | dd_Smed_v4_738_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001449 | Propionyl-CoA carboxylase subunit beta | dd_Smed_v4_513_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30008076 | Reverse transcriptase domain-containing protein | SMESG000008737.1 | dd_Smed_v4_540_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30010704 | SMED30010704 | dd_Smed_v4_14348_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30000682 | SMED30000682 | dd_Smed_v4_1303_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30015820 | Dual specificity tyrosine-phosphorylation-regulated kinase 4 | SMESG000042374.1 | dd_Smed_v4_12591_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30007555 | GCR098 | SMESG000016695.1 | Contig4585 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30007555 | GCR098 | SMESG000016695.1 | Contig4585 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30007555 | GCR098 | SMESG000033655.1 | Contig4585 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30007555 | GCR098 | SMESG000033655.1 | Contig4585 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30015345 | Tropomyosin | SMESG000066854.1 | Contig3688 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30015345 | Tropomyosin | SMESG000066854.1 | Contig3688 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30015345 | Tropomyosin | SMESG000026500.1 | Contig3688 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30015345 | Tropomyosin | SMESG000026500.1 | Contig3688 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30029557 | SMED30029557 | SMESG000028899.1 | Contig1093 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30029557 | SMED30029557 | SMESG000071997.1 | Contig1093 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30024411 | Protein kinase domain-containing protein | SMESG000028899.1 | Contig1093 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30024411 | Protein kinase domain-containing protein | SMESG000071997.1 | Contig1093 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30032776 | SMED30032776 | SMESG000063221.1 | Contig1068 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30022483 | CGG triplet repeat-binding protein 1 | SMESG000020470.1 | Contig1680 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30022483 | CGG triplet repeat-binding protein 1 | SMESG000020470.1 | Contig1680 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30033476 | Zinc finger protein, putative | SMESG000068172.1 | Contig3306 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30033476 | Zinc finger protein, putative | SMESG000025870.1 | Contig3306 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30031780 | Ras-related protein Rab-5A | SMESG000065500.1 | Contig1027 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30033807 | SMED30033807 | SMESG000076385.1 SMESG000076375.1 SMESG000076363.1 SMESG000076223.1 SMESG000076482.1 SMESG000076470.1 SMESG000076410.1 SMESG000076358.1 | Contig1645 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30030305 | Peptidase_M14 domain-containing protein | SMESG000037626.1 | Contig1315 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30030305 | Peptidase_M14 domain-containing protein | SMESG000048042.1 | Contig1315 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30032067 | TRAF-4 | SMESG000044336.1 | Contig1407 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30032067 | TRAF-4 | SMESG000015063.1 | Contig1407 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30030757 | SMED30030757 | SMESG000016990.1 | Contig1765 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30023739 | SMED30023739 | SMESG000058452.1 | Contig1190 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30023739 | SMED30023739 | SMESG000057519.1 | Contig1190 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30025964 | SMED30025964 | SMESG000041071.1 | Contig2453 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30020100 | SMED30020100 | SMESG000013936.1 | Contig1935 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30020100 | SMED30020100 | SMESG000013936.1 | Contig1935 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30020100 | SMED30020100 | SMESG000039535.1 | Contig1935 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30020100 | SMED30020100 | SMESG000039535.1 | Contig1935 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30029698 | Caspase-7 | SMESG000053168.1 | Contig2992 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30009357 | ubiquilin-1 | SMESG000045386.1 | Contig2009 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30004187 | SMED30004187 | SMESG000043423.1 | Contig1792 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30004187 | SMED30004187 | SMESG000043423.1 | Contig1792 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30004187 | SMED30004187 | SMESG000072544.1 | Contig1792 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30004187 | SMED30004187 | SMESG000072544.1 | Contig1792 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30001294 | Phosphatidylinositol-binding clathrin assembly protein | SMESG000043423.1 | Contig1792 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30001294 | Phosphatidylinositol-binding clathrin assembly protein | SMESG000072544.1 | Contig1792 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30001630 | Ras-related C3 botulinum toxin substrate 1 | SMESG000005612.1 | Contig594 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30001630 | Ras-related C3 botulinum toxin substrate 1 | SMESG000005612.1 | Contig594 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30001630 | Ras-related C3 botulinum toxin substrate 1 | SMESG000011575.1 | Contig594 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30001630 | Ras-related C3 botulinum toxin substrate 1 | SMESG000011575.1 | Contig594 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30005012 | SMED30005012 | Contig1286 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() | |
pharynx | SMED30002222 | SMED30002222 | Contig7536 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() | |
pharynx | SMED30002222 | SMED30002222 | Contig7536 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() | |
pharynx | SMED30017930 | SMED30017930 | SMESG000049597.1 | Contig5044 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30017930 | SMED30017930 | SMESG000004871.1 | Contig5044 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30027682 | NAD(P)H-dependent FMN reductase | SMESG000060640.1 | Contig3408 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30027682 | NAD(P)H-dependent FMN reductase | SMESG000060640.1 | Contig3408 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30027682 | NAD(P)H-dependent FMN reductase | SMESG000074871.1 | Contig3408 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30027682 | NAD(P)H-dependent FMN reductase | SMESG000074871.1 | Contig3408 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30032393 | SMED30032393 | SMESG000036683.1 | Contig4572 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30032393 | SMED30032393 | SMESG000074788.1 | Contig4572 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30022944 | SMED30022944 | SMESG000049597.1 | Contig5044 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30022944 | SMED30022944 | SMESG000004871.1 | Contig5044 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30005336 | Phtf-FEM1B_bdg domain-containing protein | SMESG000058788.1 | Contig2701 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30018122 | MADS-box domain-containing protein | SMESG000005612.1 | Contig594 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30018122 | MADS-box domain-containing protein | SMESG000011575.1 | Contig594 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30014645 | HP domain-containing protein | SMESG000075965.1 | PL04009A1F04 | ncbi_smed_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30015706 | Twinfilin-1 | SMESG000041071.1 | Contig2453 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30005434 | SMED30005434 | SMESG000038889.1 | Contig2145 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30013050 | SMED30013050 | SMESG000000175.1 | Contig2068 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30008812 | AP complex subunit sigma | SMESG000038889.1 | Contig2145 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30004652 | SMED30004652 | SMESG000033527.1 | Contig2307 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30017833 | SMED30017833 | SMESG000053168.1 | Contig2992 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30005745 | Protein kinase | SMESG000079303.1 | Contig2289 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30005745 | Protein kinase | SMESG000017260.1 | Contig2289 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30011909 | SMED30011909 | SMESG000027686.1 | Contig2364 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30011909 | SMED30011909 | SMESG000012131.1 SMESG000012127.1 | Contig2364 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30012769 | SMED30012769 | SMESG000058788.1 | Contig2701 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30012769 | SMED30012769 | SMESG000058788.1 | Contig2701 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30015801 | SMED30015801 | SMESG000079303.1 | Contig2289 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30015801 | SMED30015801 | SMESG000017260.1 | Contig2289 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30009175 | Transcription elongation factor spt6 | SMESG000059332.1 | Contig5500 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30009175 | Transcription elongation factor spt6 | SMESG000059332.1 | Contig5500 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30009175 | Transcription elongation factor spt6 | SMESG000024114.1 | Contig5500 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30009175 | Transcription elongation factor spt6 | SMESG000024114.1 | Contig5500 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30019325 | Myosin regulatory light chain | SMESG000068156.1 SMESG000064685.1 SMESG000043474.1 SMESG000010609.1 SMESG000076470.1 SMESG000073857.1 SMESG000062429.1 SMESG000058575.1 SMESG000053533.1 SMESG000020635.1 SMESG000015751.1 SMESG000005260.1 | Contig246 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30019325 | Myosin regulatory light chain | SMESG000000175.1 | Contig246 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30019325 | Myosin regulatory light chain | SMESG000000175.1 | Contig2068 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30001668 | SMED30001668 | SMESG000033527.1 | Contig2307 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30034573 | Tubulin beta chain | SMESG000047291.1 SMESG000044907.1 SMESG000044888.1 SMESG000035804.1 SMESG000035755.1 SMESG000047284.1 | Contig5821 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30011205 | SMED30011205 | SMESG000056922.1 | dd_Smed_v4_11352_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30000038 | Ribosome-binding protein 1 | SMESG000031975.1 | dd_Smed_v4_1111_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30003249 | Prohibitin | SMESG000038397.1 | dd_Smed_v4_1038_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021059 | V(D)J recombination-activating protein 1 | SMESG000012339.1 | dd_Smed_v4_11354_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30027672 | Plac8 onzin related protein 1 | SMESG000050229.1 SMESG000050221.1 | dd_Smed_v4_1219_1_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30005292 | Post-GPI attachment to proteins factor 3 | SMESG000077193.1 | dd_Smed_v4_11282_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30003902 | Tetratricopeptide repeat protein 21B | SMESG000011579.1 | dd_Smed_v4_12056_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30003780 | Serine/threonine-protein kinase 36 | SMESG000076885.1 | dd_Smed_v4_11067_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30009224 | early growth response-3 | SMESG000000959.1 | dd_Smed_v4_12410_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30009224 | early growth response-3 | SMESG000000959.1 | dd_Smed_v4_14711_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30004930 | Irregular chiasm C-roughest-like isoform X2 | SMESG000077979.1 | dd_Smed_v4_12549_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30005345 | SMED30005345 | SMESG000059907.1 | dd_Smed_v4_125_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30006652 | dynein heavy chain 6, axonemal | SMESG000004477.1 SMESG000004475.1 | dd_Smed_v4_10969_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30004097 | SMED30004097 | SMESG000031258.1 | dd_Smed_v4_12080_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30009282 | EF-hand calcium binding domain 2 | SMESG000049879.1 SMESG000003119.1 | dd_Smed_v4_11976_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30003093 | SMED30003093 | SMESG000056847.1 SMESG000056843.1 SMESG000056838.1 SMESG000044770.1 SMESG000044762.1 SMESG000007140.1 | dd_Smed_v4_1137_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30003434 | SMED30003434 | SMESG000052485.1 | dd_Smed_v4_1182_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30007470 | Coiled-coil domain-containing protein 180 | SMESG000039547.1 | dd_Smed_v4_12302_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30005053 | SMED30005053 | SMESG000072823.1 | dd_Smed_v4_11587_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30004559 | CULT domain-containing protein | SMESG000077110.1 SMESG000077108.1 | dd_Smed_v4_11915_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30009231 | Transmembrane protein | SMESG000002927.1 | dd_Smed_v4_12002_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30009231 | Transmembrane protein | SMESG000002927.1 | dd_Smed_v4_16643_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30004648 | Dual specificity tyrosine phosphorylation regulated kinase 2 | SMESG000076586.1 SMESG000076583.1 | dd_Smed_v4_12119_1_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30010029 | T-complex-associated-testis-expressed 1 | SMESG000023093.1 | dd_Smed_v4_12524_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30013975 | Ras association domain-containing protein 1 | SMESG000029652.1 | dd_Smed_v4_5323_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30016186 | SMED30016186 | SMESG000033673.1 | dd_Smed_v4_1071_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30016186 | SMED30016186 | SMESG000033673.1 | dd_1071 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30018511 | von Willebrand factor A domain-containing protein 3B | SMESG000009195.1 | dd_Smed_v4_10837_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30013935 | Eukaryotic translation initiation factor 5B | SMESG000012316.1 | dd_1274 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30014692 | Histone H4 | SMESG000036410.1 | dd_Smed_v4_506_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30017053 | SMED30017053 | SMESG000004885.1 | dd_Smed_v4_5297_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30015650 | FGFR1 oncogene partner | SMESG000006505.1 | dd_Smed_v4_5371_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30018901 | SMED30018901 | SMESG000033673.1 | dd_Smed_v4_1071_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30018901 | SMED30018901 | SMESG000033673.1 | dd_1071 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30013779 | Tubulin monoglycylase TTLL3 | SMESG000029205.1 | dd_Smed_v4_10244_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30015419 | SMED30015419 | SMESG000021688.1 | dd_Smed_v4_11297_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30025095 | SMED30025095 | SMESG000046852.1 | dd_Smed_v4_11398_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30020260 | SMED30020260 | SMESG000005697.1 | dd_Smed_v4_12813_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30023857 | Calpain 5a | SMESG000009459.1 | dd_Smed_v4_101944_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021485 | SMED30021485 | SMESG000059844.1 | dd_Smed_v4_1328_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021735 | Guanylate cyclase domain-containing protein | SMESG000051217.1 | dd_Smed_v4_10678_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30023085 | Non-specific serine/threonine protein kinase | SMESG000004478.1 | dd_Smed_v4_11674_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30020615 | prohibitin-1 | SMESG000021272.1 | dd_Smed_v4_1089_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021903 | SMED30021903 | SMESG000040469.1 | dd_Smed_v4_10729_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30027392 | SMED30027392 | SMESG000074013.1 | dd_Smed_v4_5067_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30035707 | Ras association domain-containing protein | SMESG000029652.1 | dd_Smed_v4_5323_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30034381 | Malate dehydrogenase | SMESG000056995.1 | dd_Smed_v4_467_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30020941 | beta 1,3 galactosyltransferase-1 | SMESG000008720.1 | dd_Smed_v4_10927_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30027228 | Protein FAM166B | SMESG000069725.1 | dd_Smed_v4_5010_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30029206 | ANK_REP_REGION domain-containing protein | SMESG000017292.1 | dd_Smed_v4_5280_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022914 | neurofilament heavy polypeptide isoform X5 | SMESG000058734.1 | dd_Smed_v4_11421_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30028503 | SMED30028503 | SMESG000040102.1 | dd_Smed_v4_5390_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021613 | Nesprin-1 | SMESG000077685.1 | dd_Smed_v4_10214_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021613 | Nesprin-1 | SMESG000077685.1 | dd_Smed_v4_15904_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30031955 | Intraflagellar transport protein 52 | SMESG000043987.1 | dd_Smed_v4_5043_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30034766 | Enolase | SMESG000052380.1 | dd_Smed_v4_510_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30020829 | KH domain-containing protein | SMESG000069949.1 | dd_Smed_v4_11601_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30024189 | 60S ribosomal protein L31 | SMESG000017099.1 | dd_Smed_v4_113_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30030838 | slc7a-10 | SMESG000025359.1 | dd_Smed_v4_4548_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30020398 | Kinesin-like protein | SMESG000007019.1 | dd_Smed_v4_10965_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021838 | DUF4709 domain-containing protein | SMESG000029222.1 | dd_Smed_v4_13431_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022717 | SMED30022717 | SMESG000005697.1 | dd_Smed_v4_12813_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021202 | Kunitz-type serine protease inhibitor IX | SMESG000012316.1 | dd_1274 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30032293 | SMED30032293 | SMESG000033462.1 | dd_554 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30032293 | SMED30032293 | SMESG000033462.1 | dd_Smed_v4_554_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30027092 | SMED30027092 | SMESG000078236.1 SMESG000032651.1 | dd_Smed_v4_4949_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022344 | FERM domain containing-1 | SMESG000070273.1 | dd_Smed_v4_1131_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30031745 | Fatty-acid amide hydrolase 1-like | SMESG000034791.1 | dd_Smed_v4_4966_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30020525 | Dynein intermediate chain 2, ciliary | SMESG000001839.1 SMESG000001830.1 | dd_Smed_v4_4753_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30023486 | Intraflagellar transport 74 | SMESG000074086.1 | dd_Smed_v4_12702_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022844 | NEPH-3 | SMESG000022777.1 | dd_Smed_v4_11280_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30020490 | SMED30020490 | SMESG000030489.1 | dd_Smed_v4_11685_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30023266 | cilia- and flagella-associated protein 43 | SMESG000000491.1 | dd_Smed_v4_10271_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30005191 | Phospholipid scramblase | SMESG000050656.1 | dd_Smed_v4_6444_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30011615 | SMED30011615 | SMESG000036524.1 | dd_Smed_v4_11034_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30011134 | SMED30011134 | SMESG000063657.1 | dd_Smed_v4_10132_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30019771 | Ammonium transporter Rh type B | SMESG000048384.1 | dd_Smed_v4_1882_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30006633 | SMED30006633 | SMESG000040042.1 | dd_Smed_v4_11386_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30005772 | vault protein inter alpha trypsin-1 | SMESG000053671.1 SMESG000053669.1 SMESG000053667.1 SMESG000053664.1 SMESG000053657.1 SMESG000053638.1 | dd_Smed_v4_1027_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001801 | NME/NM23 nucleoside diphosphate kinase 1 | SMESG000008082.1 | dd_Smed_v4_1096_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30015809 | SMED30015809 | SMESG000069776.1 | dd_Smed_v4_10177_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30016673 | Cylindromatosis (turban tumor syndrome), b | SMESG000056847.1 SMESG000056843.1 SMESG000056838.1 SMESG000044770.1 SMESG000044762.1 SMESG000007140.1 | dd_Smed_v4_1137_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30010702 | Serine/threonine-protein kinase B-raf | SMESG000064517.1 | dd_Smed_v4_13233_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001071 | Low density lipoprotein-receptor, class A,domain-containing protein | SMESG000037863.1 | dd_Smed_v4_12756_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30006515 | ZZ-type domain-containing protein | SMESG000055420.1 | dd_Smed_v4_10173_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30003032 | SMED30003032 | SMESG000061110.1 | dd_Smed_v4_11638_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30010487 | Serine/threonine kinase | SMESG000054195.1 SMESG000035615.1 | dd_Smed_v4_11271_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30008862 | Transmembrane protein 17 | SMESG000050386.1 | dd_Smed_v4_10264_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30014760 | Exostosin-1 | SMESG000018952.1 SMESG000018951.1 SMESG000018945.1 SMESG000018944.1 | dd_Smed_v4_11944_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30004972 | SMED30004972 | SMESG000007019.1 | dd_Smed_v4_10965_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30018893 | Enkurin domain-containing protein | SMESG000081414.1 | dd_Smed_v4_12339_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30004945 | slc22a-9 | SMESG000025834.1 | dd_Smed_v4_11120_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30007143 | Nucleolar GTP-binding protein 2 | SMESG000026847.1 | dd_Smed_v4_1134_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30009887 | Macrophage erythroblast attacher | SMESG000048410.1 | dd_Smed_v4_1168_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30016422 | 2-oxoisovalerate dehydrogenase subunit alpha | SMESG000021412.1 | dd_Smed_v4_10732_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30016010 | SMED30016010 | SMESG000042231.1 | dd_Smed_v4_10980_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30017048 | cilia- and flagella-associated protein 206 | SMESG000021247.1 | dd_Smed_v4_11199_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30009014 | Alpha/beta hydrolase | SMESG000022359.1 | dd_Smed_v4_10155_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30012981 | Cyclic nucleotide gated channel 1 | SMESG000036524.1 | dd_Smed_v4_11034_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001666 | slc18a-1 | SMESG000041557.1 SMESG000041534.1 | dd_Smed_v4_11917_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30027141 | SMED30027141 | SMESG000059828.1 | dd_Smed_v4_1549_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30024153 | SMED30024153 | SMESG000035332.1 SMESG000031365.1 SMESG000077214.1 SMESG000075241.1 SMESG000075191.1 | dd_Smed_v4_168_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30025791 | B box-type domain-containing protein | SMESG000078465.1 | dd_Smed_v4_11048_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30024986 | SMED30024986 | SMESG000069890.1 | dd_Smed_v4_16311_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30034412 | E3 ubiquitin-protein ligase CBL | SMESG000056433.1 | dd_Smed_v4_6780_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30025181 | 33 kDa inner dynein arm light chain, axonemal | SMESG000067639.1 SMESG000001266.1 | dd_Smed_v4_4453_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022249 | Clathrin interactor 1 | SMESG000032527.1 SMESG000022725.1 | dd_Smed_v4_1563_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30029481 | SMED30029481 | SMESG000079496.1 | dd_Smed_v4_6860_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30031875 | SMED30031875 | SMESG000081251.1 | dd_Smed_v4_604_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30035987 | Expressed conserved protein | SMESG000044572.1 | dd_Smed_v4_5021_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30033585 | Elongation of very long chain fatty acids protein | SMESG000021565.1 | dd_Smed_v4_523_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021475 | SMED30021475 | SMESG000062708.1 | dd_Smed_v4_18258_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30031005 | A disintegrin and metalloproteinase with thrombospondin motifs 2 | SMESG000051172.1 | dd_Smed_v4_16551_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30020035 | DNA polymerase subunit gamma | SMESG000050799.1 | dd_Smed_v4_13411_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30025045 | SMED30025045 | SMESG000069184.1 SMESG000069172.1 | dd_Smed_v4_17542_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30027978 | Calcyphosin protein | SMESG000025859.1 | dd_Smed_v4_4512_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30028743 | Regulator of G-protein signaling 22 | SMESG000069110.1 | dd_Smed_v4_11778_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30031142 | Protein kinase domain-containing protein | SMESG000073002.1 SMESG000072984.1 | dd_Smed_v4_12680_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021253 | 60S ribosomal protein L35 | SMESG000035332.1 SMESG000031365.1 SMESG000077214.1 SMESG000075241.1 SMESG000075191.1 | dd_Smed_v4_168_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30033909 | UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 4 | SMESG000066601.1 | dd_Smed_v4_12354_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30028057 | Retinal homeobox protein Rax | SMESG000019089.1 | dd_Smed_v4_6404_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022246 | Coiled-coil domain-containing protein 77 | SMESG000045184.1 | dd_Smed_v4_4812_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021516 | MICOS complex subunit MIC60 | SMESG000066687.1 | dd_Smed_v4_1605_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30026121 | Ectonucleotide pyrophosphatase/phosphodiesterase family member 6 | SMESG000040292.1 | dd_Smed_v4_1269_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30029152 | SMED30029152 | SMESG000017036.1 | dd_Smed_v4_12630_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30025084 | Ankyrin repeat and EF-hand domain-containing protein 1 | SMESG000006940.1 SMESG000006938.1 SMESG000006933.1 | dd_Smed_v4_12476_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30029302 | 40S ribosomal protein S16 | SMESG000018349.1 SMESG000018333.1 | dd_Smed_v4_170_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30028898 | BZIP domain-containing protein | SMESG000067543.1 | dd_Smed_v4_1399_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022806 | Calcyphosin protein | SMESG000025859.1 | dd_Smed_v4_4512_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30023411 | slc42a-1 | SMESG000048384.1 | dd_Smed_v4_1882_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30026287 | SMED30026287 | SMESG000057102.1 | dd_Smed_v4_45699_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30025105 | Plastin 3 | SMESG000081126.1 SMESG000081113.1 | dd_Smed_v4_749_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30031188 | Casein kinase I | SMESG000050144.1 SMESG000050130.1 | dd_Smed_v4_16169_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30025542 | Leucine-rich repeat-containing protein 71 | SMESG000006778.1 | dd_Smed_v4_12043_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30020133 | SMED30020133 | SMESG000023496.1 | dd_Smed_v4_21951_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021559 | SMED30021559 | SMESG000079496.1 | dd_Smed_v4_6860_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30028668 | Leucine-rich repeat-containing protein 71 | SMESG000006778.1 | dd_Smed_v4_12043_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30032907 | Alpha-galactosidase | SMESG000009912.1 | dd_Smed_v4_606_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30029555 | Serine/arginine-rich splicing factor 4 | SMESG000045501.1 | dd_Smed_v4_473_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30030891 | Sphingolipid delta-4 desaturase | SMESG000078629.1 | dd_Smed_v4_7414_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30028190 | SMED30028190 | SMESG000035239.1 SMESG000035240.1 | dd_Smed_v4_18162_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021399 | Protein kintoun | SMESG000052588.1 | dd_Smed_v4_14336_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30024527 | non-gastric H ,K -ATPase alpha subunit | SMESG000041938.1 SMESG000041937.1 SMESG000051989.1 | dd_Smed_v4_1179_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30028718 | Epsin 2 | SMESG000042233.1 | dd_Smed_v4_4779_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30024368 | chromodomain helicase DNA-binding protein 4 | SMESG000068192.1 | dd_Smed_v4_2331_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022312 | COesterase domain-containing protein | SMESG000064723.1 | dd_Smed_v4_18958_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30028115 | beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase 3 | SMESG000026549.1 | dd_Smed_v4_10879_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30023475 | SMED30023475 | SMESG000047326.1 | dd_Smed_v4_13864_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30025931 | SMED30025931 | SMESG000066313.1 | dd_Smed_v4_2987_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30024309 | Isocitrate dehydrogenase [NADP] | SMESG000049154.1 | dd_Smed_v4_449_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30035642 | Granulin b | SMESG000029882.1 | dd_Smed_v4_442_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30032105 | Polypeptide N-acetylgalactosaminyltransferase | SMESG000025206.1 | dd_Smed_v4_4615_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30028103 | SMED30028103 | SMESG000081188.1 | dd_Smed_v4_11827_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30029399 | SMED30029399 | SMESG000015116.1 | dd_Smed_v4_10874_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30028624 | Synaptotagmin, putative | SMESG000034832.1 | dd_Smed_v4_13224_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021332 | Cytochrome c | SMESG000045852.1 | dd_Smed_v4_464_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30030788 | SMED30030788 | SMESG000079496.1 | dd_Smed_v4_6860_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30026336 | Beta-hexosaminidase | SMESG000008181.1 | dd_Smed_v4_12408_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30023155 | Thyroid adenoma-associated-like protein | SMESG000023235.1 | dd_Smed_v4_12325_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30033097 | SMED30033097 | SMESG000044449.1 SMESG000044448.1 | dd_Smed_v4_4457_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022421 | RIB43A-like with coiled-coils protein 2 | SMESG000037028.1 | dd_Smed_v4_4547_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022425 | Peroxiredoxin | SMESG000002993.1 | dd_Smed_v4_1290_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30000144 | CAP-Gly domain-containing protein | SMESG000000637.1 | dd_Smed_v4_16405_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30014015 | SMED30014015 | SMESG000022082.1 | dd_Smed_v4_8317_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30004318 | Triadin-like isoform X4 | SMESG000025109.1 | dd_Smed_v4_22537_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30004318 | Triadin-like isoform X4 | SMESG000025109.1 | dd_Smed_v4_13778_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001257 | NADH dehydrogenase [ubiquinone] flavoprotein 1, mitochondrial | SMESG000074136.1 | dd_Smed_v4_1843_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30003053 | 1-acyl-sn-glycerol-3-phosphate acyltransferase delta | SMESG000056953.1 | dd_Smed_v4_5643_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30002742 | Dystonin | SMESG000043809.1 SMESG000043799.1 | dd_Smed_v4_1205_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30000527 | SMED30000527 | SMESG000034072.1 | dd_Smed_v4_7973_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30011384 | protein phosphatase 1 regulatory subunit 12C isoform X12 | SMESG000010821.1 | dd_Smed_v4_8624_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30008650 | Beta-hexosaminidase | SMESG000008181.1 | dd_Smed_v4_12408_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30006235 | slc18a-5 | SMESG000024277.1 | dd_Smed_v4_13278_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30000967 | DUF3421 domain-containing protein | SMESG000057816.1 | dd_Smed_v4_87_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30012932 | Rapunzel | SMESG000037569.1 | dd_Smed_v4_811_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30008456 | Type I inositol-1,4,5-trisphosphate 5-phosphatase | SMESG000074184.1 SMESG000019975.1 | dd_Smed_v4_266_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30004285 | SMED30004285 | SMESG000072376.1 | dd_Smed_v4_15802_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30003857 | Centrosomal protein of 162 kDa | SMESG000027479.1 | dd_Smed_v4_9279_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30015974 | FAST kinase domain-containing protein 1, mitochondrial | SMESG000064523.1 | dd_Smed_v4_8917_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30005465 | Ras-related protein Rab-11A | SMESG000073334.1 | dd_Smed_v4_867_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30012747 | Thioredoxin domain-containing protein 3-like | SMESG000043677.1 | dd_Smed_v4_8026_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30012747 | Thioredoxin domain-containing protein 3-like | SMESG000043677.1 | dd_Smed_v4_8401_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30018730 | SOCS box domain-containing protein | SMESG000001445.1 SMESG000001437.1 | dd_Smed_v4_9937_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30007294 | slc5a-3 | SMESG000054276.1 SMESG000054266.1 | dd_Smed_v4_14173_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30006256 | SMED30006256 | SMESG000034101.1 | dd_Smed_v4_9313_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30006822 | SMED30006822 | SMESG000043386.1 | dd_Smed_v4_15542_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30010881 | SMED30010881 | SMESG000004195.1 | dd_Smed_v4_991_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30004448 | Thioredoxin domain-containing protein 3-like | SMESG000043677.1 | dd_Smed_v4_8026_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30004448 | Thioredoxin domain-containing protein 3-like | SMESG000043677.1 | dd_Smed_v4_8401_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001155 | SMED30001155 | SMESG000043660.1 | dd_Smed_v4_15839_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30003905 | Far upstream element-binding protein | SMESG000037106.1 | dd_Smed_v4_812_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30007561 | Protocadherin-h | SMESG000034072.1 | dd_Smed_v4_7973_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30000972 | Leucine-rich repeat-containing protein 71 | SMESG000006778.1 | dd_Smed_v4_12043_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30015362 | SMED30015362 | SMESG000043289.1 | dd_Smed_v4_80_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30018495 | ATPase_AAA_core domain-containing protein | SMESG000073596.1 | dd_Smed_v4_9568_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30018495 | ATPase_AAA_core domain-containing protein | SMESG000073596.1 | dd_Smed_v4_9484_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30000581 | Centlein, centrosomal protein | SMESG000000357.1 | dd_Smed_v4_9882_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30005231 | Polyadenylate-binding protein | SMESG000058745.1 | dd_Smed_v4_93_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30005553 | Thioredoxin domain-containing protein 3-like | SMESG000043677.1 | dd_Smed_v4_8026_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30005553 | Thioredoxin domain-containing protein 3-like | SMESG000043677.1 | dd_Smed_v4_8401_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30031496 | Leucine zipper transcription factor like 1 | SMESG000020499.1 | dd_Smed_v4_8415_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30025065 | SMED30025065 | SMESG000054716.1 SMESG000047804.1 SMESG000038532.1 SMESG000038528.1 SMESG000038519.1 SMESG000036102.1 SMESG000036060.1 | dd_Smed_v4_9340_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30025065 | SMED30025065 | SMESG000038532.1 SMESG000038520.1 SMESG000038497.1 SMESG000036112.1 SMESG000036067.1 | dd_Smed_v4_5097_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30025065 | SMED30025065 | SMESG000047804.1 SMESG000038532.1 SMESG000038520.1 SMESG000036112.1 SMESG000036060.1 | dd_Smed_v4_4251_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30027937 | SMED30027937 | SMESG000004925.1 | dd_Smed_v4_8053_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022075 | Synaptotagmin protein 5 | SMESG000074360.1 | dd_Smed_v4_4335_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30031141 | Tubulin polyglutamylase ttll6 | SMESG000075764.1 | dd_Smed_v4_8131_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021711 | DNA-binding protein | SMESG000070983.1 | dd_Smed_v4_2102_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30024160 | SMED30024160 | SMESG000046560.1 SMESG000010944.1 | dd_Smed_v4_142_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30035939 | Actinin alpha 4 | SMESG000074430.1 | dd_Smed_v4_7964_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30034859 | Tetraspanin | SMESG000056555.1 | dd_Smed_v4_3116_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30026732 | NADH dehydrogenase iron-sulfur protein 8, mitochondrial | SMESG000002076.1 | dd_Smed_v4_849_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30020664 | Potassium voltage-gated channel subfamily A member 2 | SMESG000028841.1 | dd_Smed_v4_7533_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30029668 | Adenylate kinase isoenzyme 5 | SMESG000020486.1 SMESG000020480.1 | dd_Smed_v4_5119_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021685 | Bestrophin homolog | SMESG000070057.1 | dd_Smed_v4_8073_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021265 | 2-acylglycerol O-acyltransferase 2 | SMESG000052656.1 | dd_Smed_v4_6550_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30027540 | Cathepsin F | SMESG000005279.1 | dd_Smed_v4_456_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30020000 | RNA binding motif single stranded interacting | SMESG000010632.1 | dd_Smed_v4_3575_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30008882 | Cilia and flagella associated protein 157 | SMESG000036345.1 | dd_Smed_v4_9862_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30016401 | Venom allergen 5 | SMESG000005602.1 | dd_Smed_v4_1988_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30019874 | Calmodulin | SMESG000010769.1 | dd_Smed_v4_255_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30011084 | Epidermal growth factor receptor kinase substrate 8 | SMESG000070650.1 | dd_Smed_v4_4256_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30015587 | Dual specificity protein phosphatase 14 | SMESG000037868.1 | dd_Smed_v4_7558_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001635 | cathepsin B | SMESG000048413.1 | dd_Smed_v4_81_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30003442 | 60S ribosomal protein L23 | SMESG000023040.1 | dd_Smed_v4_242_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30006541 | SMED30006541 | SMESG000012332.1 SMESG000012317.1 SMESG000058954.1 | dd_Smed_v4_246_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30010842 | EF-hand domain-containing protein 1 | SMESG000078434.1 | dd_Smed_v4_2935_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30007246 | SMED30007246 | SMESG000045656.1 | dd_Smed_v4_797_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001479 | G_PROTEIN_RECEP_F1_2 domain-containing protein | SMESG000029294.1 SMESG000029291.1 | dd_Smed_v4_2802_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001479 | G_PROTEIN_RECEP_F1_2 domain-containing protein | SMESG000029291.1 | dd_Smed_v4_6716_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30009782 | Outer dense fiber protein 3 | SMESG000038718.1 | dd_Smed_v4_2658_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30012310 | SMED30012310 | SMESG000028761.1 | dd_Smed_v4_5231_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30006683 | Pleckstrin homology like domain family B member 2 | SMESG000033071.1 | dd_Smed_v4_7833_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30012572 | Leucine--tRNA ligase | SMESG000071689.1 | dd_Smed_v4_9705_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30018899 | Tetraspanin | SMESG000078545.1 | dd_Smed_v4_354_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30006638 | Elongation factor Tu | SMESG000068535.1 | dd_Smed_v4_818_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30002133 | Polyubiquitin | SMESG000039444.1 SMESG000014081.1 | dd_Smed_v4_34_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30011943 | Fibronectin type III and ankyrin repeat domains 1 | SMESG000033969.1 | dd_Smed_v4_7571_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30018451 | Lipopolysaccharide-induced TNF-alpha factor | SMESG000020870.1 SMESG000046087.1 SMESG000046084.1 | dd_Smed_v4_2768_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30010468 | RBR-type E3 ubiquitin transferase | SMESG000062644.1 | dd_Smed_v4_3281_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30012419 | Non-specific serine/threonine protein kinase | SMESG000069962.1 SMESG000069953.1 SMESG000069952.1 | dd_Smed_v4_3244_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30012665 | FERM domain-containing protein | SMESG000062741.1 SMESG000053535.1 SMESG000049374.1 SMESG000033049.1 SMESG000024644.1 SMESG000016667.1 | dd_Smed_v4_6227_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30017762 | SMED30017762 | SMESG000016810.1 | dd_Smed_v4_783_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30016458 | SMED30016458 | SMESG000074522.1 SMESG000074521.1 | dd_Smed_v4_1967_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30008553 | Phosphoenolpyruvate carboxykinase [GTP] | SMESG000062868.1 | dd_Smed_v4_196_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30020261 | SMED30020261 | SMESG000045656.1 | dd_Smed_v4_797_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30020269 | Myophilin | SMESG000081505.1 SMESG000049198.1 SMESG000047694.1 SMESG000035451.1 SMESG000035348.1 | dd_Smed_v4_395_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30020160 | SMED30020160 | SMESG000005587.1 | dd_Smed_v4_8117_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30020166 | Coiled-coil domain-containing protein | SMESG000005080.1 | dd_Smed_v4_9816_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30020991 | Outer dynein arm protein 1 | SMESG000055998.1 SMESG000055997.1 | dd_Smed_v4_4191_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30012526 | slc39a-8 | SMESG000009752.1 SMESG000009750.1 | dd_Smed_v4_4776_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30013233 | Expressed conserved protein | SMESG000062284.1 | dd_Smed_v4_565_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001341 | Carbonic anhydrase-related | SMESG000054330.1 | dd_Smed_v4_10750_1_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30003118 | SMED30003118 | SMESG000006534.1 | dd_Smed_v4_4662_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30014748 | Ptk7 | SMESG000072430.1 | dd_Smed_v4_6999_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30000491 | Cornifelin-like A | SMESG000023836.1 | dd_Smed_v4_1291_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30008195 | Non-specific serine/threonine protein kinase | SMESG000022413.1 | dd_Smed_v4_10848_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30009457 | reticulocalbin-1 | SMESG000034805.1 | dd_Smed_v4_493_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30019273 | 40S ribosomal protein S3a | SMESG000066540.1 SMESG000066537.1 | dd_Smed_v4_163_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30018556 | Pyruvate kinase | SMESG000045839.1 | dd_Smed_v4_51910_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30006736 | colorectal mutant cancer protein | SMESG000002794.1 | dd_Smed_v4_5396_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30012300 | SMED30012300 | SMESG000013739.1 | dd_Smed_v4_5519_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30015473 | Actin cytoplasmic type 5 | SMESG000080982.1 SMESG000080969.1 | dd_Smed_v4_2624_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30019565 | Radial spoke head protein 4-like protein A | SMESG000044927.1 | dd_Smed_v4_5346_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30006944 | slc35e1 | SMESG000034003.1 | dd_Smed_v4_5304_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30012787 | MANSC domain-containing protein | SMESG000015184.1 | dd_Smed_v4_5586_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30013676 | nesprin-1-like | SMESG000016747.1 SMESG000016745.1 | dd_Smed_v4_5365_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30014558 | SMED30014558 | SMESG000023649.1 | dd_Smed_v4_184_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30013578 | MICOS complex subunit MIC10 | SMESG000009106.1 | dd_Smed_v4_1150_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30012757 | Tektin-4 | SMESG000068903.1 | dd_Smed_v4_4872_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30008534 | cGMP-dependent protein kinase | SMESG000052811.1 | dd_Smed_v4_5704_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30008242 | SMED30008242 | SMESG000068886.1 | dd_Smed_v4_12913_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30016078 | Actin, cytoplasmic | SMESG000012332.1 SMESG000012317.1 SMESG000058954.1 | dd_Smed_v4_246_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30016078 | Actin, cytoplasmic | SMESG000012332.1 SMESG000012317.1 | dd_Smed_v4_285_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30010320 | Radial spoke head 10-like protein B2 | SMESG000039156.1 SMESG000039153.1 | dd_Smed_v4_12762_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30012638 | DUF4200 domain-containing protein | SMESG000028991.1 | dd_Smed_v4_11371_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30013787 | SMED30013787 | SMESG000017258.1 | dd_Smed_v4_5255_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30012136 | radial spoke head protein 9 homolog | SMESG000046857.1 | dd_Smed_v4_4707_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30019139 | Calmodulin | SMESG000010244.1 | dd_Smed_v4_10239_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30013563 | Serine/threonine-protein kinase 10 | SMESG000064983.1 | dd_Smed_v4_5720_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30017333 | centrosomal protein of 83 kDa-like | SMESG000033227.1 SMESG000033225.1 | dd_Smed_v4_12969_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30007543 | nesprin-1-like | SMESG000016747.1 SMESG000016745.1 | dd_Smed_v4_5365_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30011453 | Facilitated trehalose transporter Tret1 | SMESG000063382.1 | dd_Smed_v4_11168_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30019328 | Armadillo repeat-containing protein 2 | SMESG000077074.1 | dd_Smed_v4_12684_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30014544 | Dynein light chain | SMESG000067731.1 | dd_Smed_v4_11037_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001672 | NADH dehydrogenase [ubiquinone] iron-sulfur protein 7, mitochondrial | SMESG000035542.1 | dd_Smed_v4_4432_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30033594 | Microtubule-associated protein 1A | SMESG000014298.1 | dd_Smed_v4_1301_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30033594 | Microtubule-associated protein 1A | SMESG000014298.1 | dd_Smed_v4_3654_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30027378 | 60S ribosomal protein L3 | SMESG000022732.1 | dd_Smed_v4_127_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30023413 | 40S ribosomal protein S25 | SMESG000059049.1 | dd_Smed_v4_134_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30026551 | Ankyrin and armadillo repeat-containing protein | SMESG000058465.1 | dd_Smed_v4_13064_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30028267 | SMED30028267 | SMESG000048027.1 | dd_Smed_v4_4822_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30031345 | Pyruvate dehydrogenase E1 component subunit alpha | SMESG000073271.1 | dd_Smed_v4_1310_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30023062 | bruno-like | SMESG000021009.1 | dd_Smed_v4_2592_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30020821 | SMED30020821 | SMESG000014298.1 | dd_Smed_v4_1301_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30033411 | Dynein light chain | SMESG000041239.1 | dd_Smed_v4_3149_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30034202 | SMED30034202 | SMESG000077061.1 | dd_Smed_v4_1917_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30027280 | 60S acidic ribosomal protein P0 | SMESG000079482.1 | dd_Smed_v4_161_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30020948 | SMED30020948 | SMESG000024857.1 | dd_Smed_v4_409_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30023766 | SMED30023766 | SMESG000073811.1 | dd_Smed_v4_116_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30014820 | Centrosomal protein of 135 kDa (Cep135 protein) (Centrosomal protein 4), putative | SMESG000052451.1 | dd_Smed_v4_11072_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30025982 | RING finger protein 32 | SMESG000057989.1 | dd_Smed_v4_12150_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30023017 | SMED30023017 | SMESG000065348.1 | dd_1320 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30023017 | SMED30023017 | SMESG000065348.1 | dd_Smed_v4_1320_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30026061 | SMED30026061 | SMESG000076482.1 SMESG000076409.1 SMESG000076405.1 SMESG000076390.1 SMESG000076375.1 SMESG000076364.1 SMESG000076223.1 SMESG000040665.1 SMESG000019753.1 | dd_Smed_v4_1097_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30020334 | Leucine-rich repeat-containing protein 57 | SMESG000037709.1 | dd_Smed_v4_17742_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30025664 | TSNAXIP1_N domain-containing protein | SMESG000060720.1 | dd_Smed_v4_13434_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30023050 | Aldehyde dehydrogenase, mitochondrial | SMESG000016195.1 | dd_Smed_v4_1339_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021821 | Transient receptor potential cation channel subfamily M member | SMESG000078720.1 | dd_Smed_v4_17981_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022178 | SMED30022178 | SMESG000057910.1 | dd_Smed_v4_1090_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30028626 | C2H2-type domain-containing protein | SMESG000019280.1 SMESG000019279.1 | dd_Smed_v4_10324_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30030586 | slc10a-2 | SMESG000064833.1 | dd_Smed_v4_10199_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022362 | Synaptotagmin-2 | SMESG000011583.1 | dd_Smed_v4_12772_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30029698 | Caspase-7 | SMESG000053168.1 | dd_Smed_v4_1167_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022414 | SMED30022414 | SMESG000076482.1 SMESG000076409.1 SMESG000076405.1 SMESG000076390.1 SMESG000076375.1 SMESG000076364.1 SMESG000076223.1 SMESG000040665.1 SMESG000019753.1 | dd_Smed_v4_1097_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022414 | SMED30022414 | SMESG000076482.1 SMESG000076470.1 SMESG000076469.1 SMESG000076410.1 SMESG000076409.1 SMESG000076408.1 SMESG000076407.1 SMESG000076406.1 SMESG000076390.1 SMESG000076389.1 SMESG000076385.1 SMESG000076375.1 SMESG000076371.1 SMESG000076363.1 SMESG000076358.1 SMESG000076223.1 SMESG000040665.1 | dd_Smed_v4_645_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30027596 | RNA-binding protein pno1 | SMESG000015341.1 | dd_Smed_v4_1077_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30020814 | SMED30020814 | SMESG000076482.1 SMESG000076409.1 SMESG000076405.1 SMESG000076390.1 SMESG000076375.1 SMESG000076364.1 SMESG000076223.1 SMESG000040665.1 SMESG000019753.1 | dd_Smed_v4_1097_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30027019 | Innexin | SMESG000030971.1 SMESG000030964.1 | dd_Smed_v4_10061_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30026646 | Dynein light chain | SMESG000009941.1 | dd_Smed_v4_107_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30031722 | ANK_REP_REGION domain-containing protein | SMESG000022931.1 | dd_Smed_v4_11187_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30027644 | cAMP-dependent protein kinase regulatory subunit | SMESG000003135.1 | dd_Smed_v4_14355_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001515 | Annexin | SMESG000042839.1 | dd_Smed_v4_1104_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30006413 | SMED30006413 | SMESG000069778.1 | dd_Smed_v4_18416_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001112 | SMED30001112 | SMESG000061228.1 | dd_Smed_v4_13515_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001112 | SMED30001112 | SMESG000061228.1 | dd_Smed_v4_8351_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30007588 | SMED30007588 | SMESG000034112.1 | dd_Smed_v4_10100_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30010188 | Ankyrin repeat-containing domain protein | SMESG000011193.1 | dd_Smed_v4_13251_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30007867 | Otoferlin | SMESG000010400.1 | dd_Smed_v4_14162_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30007867 | Otoferlin | SMESG000010400.1 | dd_Smed_v4_13850_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30000840 | Coiled-coil domain-containing protein 42-like protein | SMESG000046807.1 | dd_Smed_v4_12378_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30007557 | DUF4515 domain-containing protein | SMESG000013289.1 | dd_Smed_v4_13384_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30011250 | Granulin precursor | SMESG000029882.1 | dd_Smed_v4_442_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30008113 | nicolin-1 | SMESG000079687.1 SMESG000054751.1 | dd_Smed_v4_11961_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30002592 | NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 3 | SMESG000016331.1 | dd_Smed_v4_1078_1_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30007188 | Calmodulin | SMESG000078272.1 | dd_Smed_v4_11942_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30008915 | SMED30008915 | SMESG000002588.1 | dd_Smed_v4_10456_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30013319 | Long-chain-fatty-acid--CoA ligase ACSBG2 | SMESG000027204.1 | dd_Smed_v4_1026_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30007587 | serine/threonine/tyrosine-interacting-like protein 1 | SMESG000070767.1 | dd_Smed_v4_11358_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30004871 | Mitogen-activated protein kinase | SMESG000023035.1 SMESG000023025.1 | dd_Smed_v4_10933_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30005771 | SMED30005771 | SMESG000042003.1 | dd_Smed_v4_12482_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30009071 | SMED30009071 | SMESG000017123.1 | dd_Smed_v4_10551_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30010231 | SMED30010231 | SMESG000015116.1 | dd_Smed_v4_10874_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30009981 | Ras-related protein | SMESG000044147.1 | dd_Smed_v4_6181_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001031 | TRAF3-interacting protein 1 | SMESG000006345.1 | dd_Smed_v4_10562_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30005802 | SMED30005802 | SMESG000072483.1 | dd_Smed_v4_5611_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30007503 | SMED30007503 | SMESG000039907.1 | dd_Smed_v4_13316_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30000745 | SMED30000745 | SMESG000027028.1 | dd_Smed_v4_14847_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30007804 | Immunoglobulin-like domain-containing protein | SMESG000010356.1 | dd_Smed_v4_1827_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30008636 | SMED30008636 | SMESG000016848.1 | dd_Smed_v4_14631_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30002886 | SMED30002886 | SMESG000017779.1 | dd_Smed_v4_11049_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001176 | SMED30001176 | SMESG000020646.1 | dd_Smed_v4_10759_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30007718 | Flotillin-1 | SMESG000063612.1 | dd_Smed_v4_1887_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30002489 | Apical junction component 1 homolog | SMESG000037093.1 | dd_Smed_v4_11689_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30003228 | Dach-1 | SMESG000005090.1 | dd_Smed_v4_5823_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001414 | UPF0728 protein C10orf53 homolog | SMESG000073355.1 | dd_Smed_v4_10501_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30026934 | SMED30026934 | SMESG000050824.1 | dd_Smed_v4_12162_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022522 | Centrin-3 | SMESG000016538.1 | dd_Smed_v4_11582_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30005863 | DUF3421 domain-containing protein | SMESG000074396.1 SMESG000074378.1 | dd_Smed_v4_11_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30004937 | Elongation factor 2 | SMESG000042430.1 | dd_Smed_v4_186_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30008325 | Fatty acid synthase | SMESG000020850.1 | dd_Smed_v4_10967_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30005988 | 60S ribosomal protein L24 | SMESG000007869.1 SMESG000007858.1 SMESG000007847.1 | dd_Smed_v4_172_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30007853 | Family with sequence similarity 49 member A | SMESG000040316.1 | dd_Smed_v4_1856_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30006368 | Piezo-type mechanosensitive ion channel component | SMESG000080326.1 SMESG000080325.1 | dd_Smed_v4_18354_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30007371 | nuclear mitotic apparatus protein 1 isoform X2 | SMESG000071994.1 | dd_Smed_v4_10823_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30008461 | nuclear mitotic apparatus protein 1 isoform X2 | SMESG000071994.1 | dd_Smed_v4_10823_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30005820 | SMED30005820 | SMESG000080577.1 | dd_Smed_v4_19517_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30006074 | SMED30006074 | SMESG000019341.1 | dd_Smed_v4_177_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30008349 | Histone-lysine N-methyltransferase SETMAR | SMESG000017253.1 SMESG000015137.1 | dd_Smed_v4_1612_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30004484 | 60S ribosomal protein L8 | SMESG000017087.1 | dd_Smed_v4_108_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30018756 | SMED30018756 | dd_Smed_v4_6916_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30004312 | Parvo_coat_N domain-containing protein | dd_Smed_v4_91560_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30016918 | UPF0466 protein-like | dd_Smed_v4_5792_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30004403 | GCR079 | SMESG000014330.1 | dd_Smed_v4_11910_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001925 | SMED30001925 | dd_4476 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30001925 | SMED30001925 | dd_Smed_v4_4476_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30008373 | SMED30008373 | dd_Smed_v4_6046_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30013141 | Pleckstrin homology domain-containing family F member 2-like protein | dd_Smed_v4_2374_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30019959 | NADH dehydrogenase subunit 4 | dd_Smed_v4_344_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30019959 | NADH dehydrogenase subunit 4 | dd_Smed_v4_292_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30008902 | inositol phosphoceramide mannosyltransferase 2-like | SMESG000059812.1 SMESG000045480.1 SMESG000045292.1 SMESG000045267.1 SMESG000037990.1 | dd_Smed_v4_2174_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30011303 | Syndecan binding protein (Syntenin) | dd_Smed_v4_387_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30016080 | Deoxyhypusine hydroxylase | SMESG000051726.1 SMESG000051721.1 | dd_Smed_v4_703_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30012451 | SMED30012451 | dd_Smed_v4_215_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30013131 | protein PLANT CADMIUM RESISTANCE 2-like | dd_Smed_v4_4778_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30015411 | GLTP domain-containing protein | dd_Smed_v4_2621_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30012212 | NADH dehydrogenase subunit 1 | dd_Smed_v4_258_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30009030 | Selenoprotein W | dd_Smed_v4_572_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30010253 | NADH dehydrogenase subunit 6 | dd_Smed_v4_957_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30010134 | SMED30010134 | dd_Smed_v4_34037_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30013571 | NADH dehydrogenase subunit 4L | dd_Smed_v4_344_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30008418 | SMED30008418 | SMESG000027863.1 | dd_Smed_v4_16528_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30005542 | SMED30005542 | dd_Smed_v4_23179_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30002689 | SMED30002689 | dd_Smed_v4_680_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30004402 | Dimer_Tnp_hAT domain-containing protein | dd_Smed_v4_14487_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30018956 | SMED30018956 | dd_Smed_v4_2990_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30006480 | SMED30006480 | dd_Smed_v4_479_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30005334 | SMED30005334 | dd_Smed_v4_344_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30016430 | SMED30016430 | dd_Smed_v4_275_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30009793 | Dach-2 | SMESG000033540.1 | dd_Smed_v4_11289_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30019364 | Si:ch211-193l2.10 | SMESG000062713.1 | dd_Smed_v4_3203_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30007142 | Sperm surface protein Sp17 | SMESG000046919.1 | dd_Smed_v4_4783_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30007142 | Sperm surface protein Sp17 | SMESG000046919.1 | dd_Smed_v4_2279_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30006792 | Argonaute 1 | SMESG000050993.1 SMESG000050994.1 | dd_Smed_v4_1194_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30027687 | RRM domain-containing protein | SMESG000038824.1 | dd_Smed_v4_3002_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021641 | SMED30021641 | SMESG000040565.1 | dd_Smed_v4_4660_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021589 | Agrin, putative | SMESG000028865.1 SMESG000028859.1 | dd_Smed_v4_3649_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30034888 | Dynein heavy chain 5, axonemal | SMESG000049144.1 | dd_Smed_v4_4569_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021687 | glycogen synthase kinase 3 | SMESG000023764.1 | dd_Smed_v4_4762_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30029024 | Protein F37C4.5 | SMESG000064758.1 | dd_Smed_v4_5168_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30034831 | SMED30034831 | SMESG000064758.1 | dd_Smed_v4_5168_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30031912 | SMED30031912 | SMESG000003404.1 | dd_Smed_v4_2094_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30026227 | SMED30026227 | SMESG000055174.1 SMESG000055172.1 | dd_Smed_v4_10518_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022043 | Protein odd-skipped-related 2 | SMESG000032229.1 | dd_Smed_v4_10039_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30026136 | Nad dependent epimerase dehydratase | SMESG000035068.1 | dd_Smed_v4_3452_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30024475 | Si:ch211-106h4.9 | SMESG000026729.1 | dd_Smed_v4_3756_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30031065 | Tetraspanin | SMESG000050726.1 | dd_Smed_v4_5209_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30034862 | SMED30034862 | SMESG000049533.1 | dd_Smed_v4_3835_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30034697 | Testis-specific Y-encoded-like protein 1 | SMESG000027817.1 SMESG000027807.1 | dd_Smed_v4_393_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30025910 | Microtubule-associated protein futsch | SMESG000044270.1 SMESG000030021.1 SMESG000025422.1 | dd_Smed_v4_1999_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30026539 | 10 kDa heat shock protein, mitochondrial | SMESG000000556.1 | dd_Smed_v4_421_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30030542 | Dynein light chain | SMESG000003543.1 | dd_Smed_v4_310_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30031471 | SMED30031471 | SMESG000050535.1 SMESG000050533.1 | dd_Smed_v4_5107_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30029711 | SMED30029711 | SMESG000039804.1 | dd_Smed_v4_5259_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30029711 | SMED30029711 | SMESG000039803.1 | dd_Smed_v4_3788_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30028659 | Cilia-and flagella-associated protein 100 | SMESG000033127.1 | dd_Smed_v4_6518_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021386 | Y box protein-1 | SMESG000058066.1 | dd_Smed_v4_52_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30033453 | Dimer_Tnp_hAT domain-containing protein | SMESG000001790.1 | dd_Smed_v4_212_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30033389 | SMED30033389 | SMESG000079563.1 SMESG000052448.1 | dd_Smed_v4_3113_1_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30033302 | RNA-binding protein MEX3B | SMESG000044270.1 SMESG000030021.1 SMESG000025422.1 | dd_Smed_v4_1999_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30026135 | SMED30026135 | SMESG000016933.1 | dd_Smed_v4_2807_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30030766 | Y box protein-1 | SMESG000058066.1 | dd_Smed_v4_52_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30026808 | EF-hand domain-containing protein | SMESG000081370.1 | dd_Smed_v4_446_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30029820 | E3 ubiquitin-protein ligase MYLIP | SMESG000074789.1 SMESG000054150.1 | dd_Smed_v4_2867_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30029771 | SMED30029771 | SMESG000075916.1 | dd_Smed_v4_2326_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30033752 | Tyrosine-protein kinase | SMESG000059352.1 SMESG000059351.1 | dd_Smed_v4_420_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30034016 | Sperm surface protein Sp17 | SMESG000046919.1 | dd_Smed_v4_4783_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30029741 | SMED30029741 | SMESG000056346.1 | dd_Smed_v4_2250_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30030659 | Fer-1-related | SMESG000070967.1 | dd_Smed_v4_4648_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30012240 | E3 ubiquitin-protein ligase RNF170 | SMESG000068288.1 SMESG000068286.1 | dd_Smed_v4_802_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30018770 | SMED30018770 | SMESG000072454.1 | dd_Smed_v4_1949_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30008772 | Golgi-associated plant pathogenesis-related protein 1 | SMESG000035954.1 | dd_Smed_v4_27440_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30013198 | SMED30013198 | SMESG000057605.1 | dd_Smed_v4_24714_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30012160 | SMED30012160 | SMESG000069851.1 | dd_9493 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30012160 | SMED30012160 | SMESG000069851.1 | dd_Smed_v4_9493_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30008609 | SMED30008609 | SMESG000059918.1 SMESG000052306.1 | dd_Smed_v4_12223_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30013300 | Mitochondrial ATP synthase subunit 9 | SMESG000078181.1 | dd_Smed_v4_23_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30014360 | Choline dehydrogenase | SMESG000055690.1 SMESG000055689.1 SMESG000055687.1 | dd_Smed_v4_1744_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30005665 | SMED30005665 | SMESG000074689.1 | dd_Smed_v4_2429_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30012386 | Alpha-1,4 glucan phosphorylase | SMESG000061417.1 | dd_Smed_v4_1532_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30012926 | SMED30012926 | SMESG000059195.1 SMESG000059194.1 SMESG000059193.1 | dd_Smed_v4_1940_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30000134 | 60S ribosomal protein L4 | SMESG000009479.1 | dd_Smed_v4_211_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30016015 | Cilia and flagella associated protein 157 | SMESG000020913.1 | dd_Smed_v4_11523_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30003011 | NPHP1 | SMESG000061008.1 | dd_Smed_v4_9990_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30010326 | Tetraspanin | SMESG000078589.1 | dd_Smed_v4_2698_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001043 | SMED30001043 | SMESG000036225.1 | dd_Smed_v4_372_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30000771 | SMED30000771 | SMESG000059918.1 SMESG000052306.1 SMESG000022407.1 | dd_Smed_v4_474_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30000771 | SMED30000771 | SMESG000059918.1 SMESG000052306.1 SMESG000022407.1 | dd_Smed_v4_1996_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30013808 | fos-1 | SMESG000003328.1 | dd_Smed_v4_2789_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001380 | Zinc finger FYVE domain-containing protein | SMESG000014968.1 | dd_Smed_v4_4344_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30003292 | SMED30003292 | SMESG000066258.1 | dd_Smed_v4_19593_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30006397 | Cyclic nucleotide-binding domain-containing protein | SMESG000040419.1 SMESG000040416.1 SMESG000005563.1 | dd_Smed_v4_19613_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30004562 | Placenta-specific gene 8 protein | SMESG000050175.1 | dd_Smed_v4_20106_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30003507 | Adenylate kinase 9 | SMESG000043841.1 | dd_Smed_v4_9617_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001359 | SMED30001359 | SMESG000059918.1 SMESG000052306.1 SMESG000022407.1 | dd_Smed_v4_1996_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30016746 | SMED30016746 | SMESG000060159.1 | dd_Smed_v4_2729_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001490 | ADF-H domain-containing protein | SMESG000080129.1 | dd_Smed_v4_260_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001290 | semaphorin 5-3 | SMESG000033853.1 | dd_Smed_v4_9914_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30014469 | DUF862 domain-containing protein | SMESG000007684.1 | dd_Smed_v4_1938_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30018297 | Dynein light chain | SMESG000019341.1 | dd_Smed_v4_177_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30013371 | 40S ribosomal protein S26 | SMESG000049997.1 SMESG000005227.1 | dd_Smed_v4_222_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001172 | Elongation factor 1-beta | SMESG000026862.1 | dd_Smed_v4_206_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30016252 | Saposin | SMESG000074184.1 SMESG000019975.1 | dd_Smed_v4_266_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30007654 | SMED30007654 | SMESG000060598.1 SMESG000046845.1 | dd_Smed_v4_20799_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30000817 | IPPc domain-containing protein | SMESG000026603.1 | dd_Smed_v4_3627_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30010357 | SMED30010357 | SMESG000002236.1 | dd_Smed_v4_17805_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001248 | SMED30001248 | SMESG000013596.1 | dd_Smed_v4_6322_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30011755 | SMED30011755 | SMESG000074184.1 SMESG000019975.1 | dd_Smed_v4_266_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30003036 | SMED30003036 | SMESG000076482.1 SMESG000076470.1 SMESG000076469.1 SMESG000076410.1 SMESG000076409.1 SMESG000076408.1 SMESG000076407.1 SMESG000076406.1 SMESG000076390.1 SMESG000076389.1 SMESG000076385.1 SMESG000076375.1 SMESG000076371.1 SMESG000076363.1 SMESG000076358.1 SMESG000076223.1 SMESG000040665.1 | dd_Smed_v4_645_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30025510 | UHRF1-binding protein 1-like | SMESG000044305.1 | dd_Smed_v4_11401_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30020215 | Annexin | SMESG000030132.1 | dd_Smed_v4_1735_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30034247 | SMED30034247 | SMESG000005178.1 | dd_Smed_v4_10371_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30024984 | LisH domain-containing protein ARMC9 | SMESG000049428.1 | dd_Smed_v4_10926_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30032706 | SMED30032706 | SMESG000026670.1 | dd_Smed_v4_14959_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30020977 | SMED30020977 | SMESG000069851.1 | dd_9493 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30020977 | SMED30020977 | SMESG000069851.1 | dd_Smed_v4_9493_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022193 | SMED30022193 | SMESG000069851.1 | dd_9493 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022193 | SMED30022193 | SMESG000069851.1 | dd_Smed_v4_9493_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30032042 | SMED30032042 | SMESG000065355.1 SMESG000065350.1 SMESG000065349.1 | dd_531 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30032042 | SMED30032042 | SMESG000065355.1 SMESG000065350.1 SMESG000065349.1 | dd_Smed_v4_531_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30034618 | von Willebrand factor A domain-containing protein 3A | SMESG000022334.1 SMESG000022332.1 | dd_Smed_v4_10972_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30036004 | SMED30036004 | SMESG000015790.1 | dd_Smed_v4_10265_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30032668 | Axonemal dynein light chain domain containing 1 | SMESG000011832.1 | dd_Smed_v4_16309_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30033164 | Heat shock 70 kDa protein | SMESG000041117.1 | dd_Smed_v4_1378_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30030168 | Latent transforming growth factor beta binding protein 3 | SMESG000008188.1 | dd_Smed_v4_1886_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30029970 | Rab-GAP TBC domain-containing protein | SMESG000063156.1 | dd_Smed_v4_15291_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30034523 | SMED30034523 | SMESG000009543.1 | dd_Smed_v4_12682_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30034323 | Ras family protein | SMESG000053083.1 | dd_Smed_v4_11357_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30035576 | Leucine-rich repeat-containing protein 56 | SMESG000036659.1 | dd_Smed_v4_10834_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30034953 | SMED30034953 | SMESG000065075.1 | dd_Smed_v4_102_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30025647 | Ig-like domain-containing protein | SMESG000079961.1 | dd_Smed_v4_12974_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30034376 | slc6a-5 | SMESG000042091.1 | dd_Smed_v4_4290_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30032666 | Spermatogenesis associated 7 | SMESG000056890.1 | dd_Smed_v4_8977_0_1 | dd_Smed_v4 |