pharynx

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ Description

  ▻ Figures

  ▻ In Situ Hybridization Data

  ▻ Sequences

  ▻ References

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  pharynx


DEFINITON:

  A plicate and protrusible organ that is the sole point of entry and exit for the Triclad gut. It contains epithelial, muscular, secretory and neuronal cell types.


TERM DEFINITION CITATIONS:

  OCLC:16809160


TERM CITATIONS:

Expand publication list


TERM ID:

  PLANA:0000016


ABOUT THIS TERM:

pharynx

  ↳is a material entity and organ

  ↳contained in posterior region of the whole animal and parapharyngeal region

  ↳existence overlaps Stage 6, juvenile, Stage 5, asexual adult, adult hermaphrodite, Stage 8 and Stage 7

  ↳existence starts during or after Stage 5

  ↳part of digestive system


  → pharynx progenitor cell and pharynx primordium develops into pharynx


Expand to see terms that part of pharynx


BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


DESCRIPTION:   

foxA1, a pioneer transcription factor required for pharynx maintenance and regeneration during adulthood (Adler et al., 2014; Scimone et al., 2014), may similarly be required for construction of the definitive pharynx during embryogenesis. Development of the definitive pharynx, the single opening of the Smed digestive tract, commenced during S4-S5 with the onset of foxA1 expression in parenchymal cells, many of which were located in the oral hemisphere (Figure 1 – figure supplement 14A). The distribution of foxA1+ cells remained concentrated in and around the developing definitive pharynx rudiment during S6-S8, a pattern reminiscent of that observed in S. polychroa embryos (Martín-Durán et al., 2010), as well as in intact and regenerating Smed asexual adults (Adler et al., 2014; Scimone et al., 2014). The definitive pharynx develops beneath the degenerating temporary embryonic pharynx, and marks the ventral side of the embryos during S6 and thereafter (Martín-Durán and Romero, 2011). foxA1 upregulation during S5-S8 was statistically significant, albeit the adjusted p-values were above the thresholds set for inclusion in the enriched transcript lists presented in Figure 1 – source data 5, Figure 1 – source data 6, Figure 1 – source data 7, Figure 1 – source data 8. meis, a transcription factor coexpressed in foxA1+ neoblasts and expressed within the regenerating pharynx (Scimone et al., 2014), was among the S5 enriched transcripts (Figure 1 – source data 5); its expression trend was similar to foxA1 during embryogenesis (Figure 1 – figure supplement 14B). Two markers exhibiting pharynx-restricted expression in adults, laminin and npp-1 (Adler et al., 2014), were upregulated during S6-S8, after development of the definitive pharynx rudiment was evident (Figure 1 – figure supplement 14B).


 

back to top


FIGURES:


Figure 1 – figure supplement 14: Molecular markers for the definitive pharynx

A: WISH developmental time course using foxA1 riboprobes (blue), S3-S8.  foxA1 expression was consistently detected in the embryonic pharynx lumen during S3-S5 (black arrowheads). Anterior: top (S6-S8). Black arrowheads: embryonic pharynx. Red arrowheads: definitive pharynx. O: oral hemisphere. A: aboral hemisphere. D: dorsal. V: ventral. Scale bars: 100 µm.

B: Average RPKM values per embryo for the definitive pharynx markers foxA1, meis, laminin, npp-1 during embryogenesis (Adler et al., 2014; Scimone et al., 2014), Y (yolk), Stage (S) S2-S8. 

 

 

back to top


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30027428AFJ24799.1forkhead box A-1foxA1Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, digestive system, pharynx, pharynx progenitor cell, embryonic pharynx
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30027428 ID=SMED30027428|Name=forkhead box A-1|organism=Schmidtea mediterranea sexual|type=transcript|length=2149bp
ATCACTTGGTGCTGCTTTTTGCCCCGATAAATCTCTCGGTGCTCCAAAATTTGTGTAAGCGAGCAAAAGATGATTGGGCA
ATTTCTAGCACGTCATTCGGCAACGATGTTTACAAGTTTCTCTGATTGGATGATAAAGTAGAAACTTTCCGAAAATGAAA
CTTCTCCGAACATGCGCATACCGACTGAAAATTAACTCTAAGCCAGCCAATGGAATTGAAGCAAAATTCAAGAGAATATT
AATTGACTTCGCGAATGAACTCAAATTTTCTATTGGCGTATTGTGTGTGCCTCATTGTGAGTGGTTGCGATCGCATCTCA
AATTATTTACACACAAAAAAATAACGCACACAGACATTGAATAGATATATTTGATCAAGTCAATATCACAATGTCAATAT
TAGCTTTTTCTGAAGAAAGAAGACGAACTAGAAGAAAAACAACAACGAAATAGATTCGATAAGGCTACTGAGCGATTTTC
ATAATCTAAATATTATTTTATTATTGATACGGACAAAAATTGGTCTTTTACCAAGTACTACTAGATTGTTGATAAAGAGA
GGTTATTTAGATGCTTGGAAAAAATCCTTATGAAACTGCAATGAGCAACGTGTATTCTCTACCTCCGGGAGGTTCTATTT
ACAATATGAACCCGATGAGTATATCATCAGCTGGCTACAACTCTCAACAAGTATCAACACTATCGTTGAACTTGACCGGA
ATCGGACCTCATTCATTAAGCCCAATGAGTGCAAGCATGTCGGGTATAGCTGCAATGGCCGGTGGAATGAGACAAGGTCT
TGAGTTGGGTCTTGGTAGAAGTGATAGTCCAAGAGATAAAAATTCAATTTCCAATAACAACCGACCATATCAAAGAAGTT
ACACTCATGCCAAGCCTCCATACAGTTATATAAGTTTGATAACAATGGCGATTCAAAATTCTCCAGTAAACATGTGCACT
CTATCGGAGATCTATCAATTCATTATGGATCATTTTCCATACTATCGTCAAAATCAACAGCGATGGCAGAATTCGATTCG
ACATTCTTTGTCCTTCAACGATTGCTTTGTTAAGGTTAGTAGAAGCCCAGAAAAACCAGGTAAAGGCTCATATTGGACCT
TGCATCCTCAATCAGGTAACATGTTTGAAAACGGTTGTTATCTCAGAAGACAAAAGCGATTCAAAGATCCACACAGAGAA
ATCGGCAGACAGAGTCAAAGAGCTGCCACTGGTCCTGGATCAAATGTCACAGAAAACAATCACGACAACGCATCGCAAGA
AGCTAGTGATAACGCAGAAAGTGATACGAAACCCAACATCAAGCAACTTGATTTATCAAGCGATCTCTTAACTAATCAAG
GTCATAATATTAAAAATACTAATCCAACTTCTGTTAGTCAGAGTTGTTCGATGTTTCATCGGAAAAAGGAAAACTGCTCA
CCAGTAGAAATGAAATTGAATAACCAAAACCAACAATCAAACCAGCAAGAACATCCACAAATCCATTACAATCCCAATCA
GCAATTCTACTCAAATCAGCAAAACATTTTCCAACAAAGTTCTCTTGATCATTACAGTCTATTAGCATCCGATGATCCTC
TTGGTCAAGGTATGCACTTGCCACCAGGTGCAAATAGTGTTTTCGGACTTTACGGGGCACATAACTTACCAAACGATGAT
CAAATTTCAGTGTCATTACCATCGATATCCTTATCCGGACATCCGTATGACAATTTATCAACAGCAATGGCATATCAATA
TGAAGCATCTCAACACAATTCTTCATTACTAACGACAAGTAATCCGTTCTCAATAGATCGTTTGATGCATCCAAGACTAG
TCGCTGCAGCGATGGGGGTCAGTCCCCATGATACTCTATACGCAGGAGCTACCGGCCCATCAGTTGATCTAGAACACATG
AAATACTACTCAAACTACAACAATGTGCCTCCTTATTCCTCTGCAATGTCTGACTACTACAAATATGTACAAAATCCTCA
GCCGGGCAACAGCGACATGAGTCTTTGAATTGAGTCCATTGAAGTCTACGGCAGTTTCCTCGAAATTTCACATTCAACCA
GATGTTTATCGCCTAATATAAAGCTGTGTTTTTTTATTTATTTACAATTAAATCTTTGTACAAGAGATC

 

back to top


ADDITIONAL REFERENCES:


Adler, C.E., Seidel, C.W., McKinney, S.A., and Sánchez Alvarado, A. (2014). Selective amputation of the pharynx identifies a FoxA-dependent regeneration program in planaria. Elife 3, e02238.

Martín-Durán, J.M., Amaya, E., and Romero, R. (2010). Germ layer specification and axial patterning in the embryonic development of the freshwater planarian Schmidtea polychroa. Dev Biol 340, 145-158.

Martín-Durán, J.M., and Romero, R. (2011). Evolutionary implications of morphogenesis and molecular patterning of the blind gut in the planarian Schmidtea polychroa. Dev Biol 352, 164-176.

Scimone, M.L., Kravarik, K.M., Lapan, S.W., and Reddien, P.W. (2014). Neoblast specialization in regeneration of the planarian Schmidtea mediterranea. Stem Cell Reports 3, 339-352.

 

back to top



PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in pharynx. Click this link to learn more about PAGE.


PAGE Curations: 3199


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
pharynxSMED30035090SMED30035090SMESG000005437.1 dd_Smed_v4_10052_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034953SMED30034953SMESG000065075.1 dd_Smed_v4_102_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026513SMED30026513SMESG000005268.1 dd_Smed_v4_1537_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035470SMED30035470SMESG000076482.1 SMESG000076409.1 SMESG000076405.1 SMESG000076390.1 SMESG000076375.1 SMESG000076364.1 SMESG000076223.1 SMESG000040665.1 SMESG000019753.1 dd_Smed_v4_1097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035924SMED30035924SMESG000043662.1 dd_Smed_v4_11896_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029927SMED30029927SMESG000052080.1 dd_Smed_v4_14074_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027269Ig-like domain-containing proteinSMESG000018952.1 SMESG000018951.1 SMESG000018945.1 SMESG000018944.1 dd_Smed_v4_11944_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020398Kinesin-like proteinSMESG000007019.1 dd_Smed_v4_10965_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035769Four and a half LIM domains proteinSMESG000023063.1 dd_Smed_v4_1251_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025062G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000018450.1 dd_Smed_v4_1699_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028115beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase 3SMESG000026549.1 dd_Smed_v4_10879_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025696Carbonic anhydraseSMESG000035022.1 dd_Smed_v4_10041_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033407C2H2-type domain-containing proteinSMESG000059040.1 dd_Smed_v4_9365_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035230SMED30035230SMESG000060309.1 dd_Smed_v4_12186_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027076FAD-binding PCMH-type domain-containing proteinSMESG000066568.1 dd_Smed_v4_10292_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027628SMED30027628SMESG000077696.1 SMESG000077694.1 dd_Smed_v4_1292_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028103SMED30028103SMESG000081188.1 dd_Smed_v4_11827_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031828SMED30031828SMESG000072691.1 dd_Smed_v4_13068_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022997ELMO domain containing 3SMESG000008416.1 dd_Smed_v4_13608_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028624Synaptotagmin, putativeSMESG000034832.1 dd_Smed_v4_13224_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027644cAMP-dependent protein kinase regulatory subunitSMESG000003135.1 dd_Smed_v4_14355_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026336Beta-hexosaminidaseSMESG000008181.1 dd_Smed_v4_12408_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023487Protein LSM14 homolog B-ASMESG000014632.1 dd_Smed_v4_1125_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011708Neural cell adhesion molecule 1SMESG000077686.1 dd_Smed_v4_3768_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED300030531-acyl-sn-glycerol-3-phosphate acyltransferase deltaSMESG000056953.1 dd_Smed_v4_5643_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018300slc42a-2SMESG000005978.1 dd_Smed_v4_2323_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012160SMED30012160SMESG000069851.1 dd_9493dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
pharynxSMED30012160SMED30012160SMESG000069851.1 dd_Smed_v4_9493_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009712epidermal growth factor receptor 1SMESG000070834.1 dd_Smed_v4_8641_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013840Tektin-2SMESG000065255.1 SMESG000050057.1 dd_Smed_v4_2339_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006764Phosphatidylinositol 3-kinase regulatory subunit alphaSMESG000078199.1 dd_Smed_v4_4794_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007110Myosin light chain 1SMESG000018597.1 dd_Smed_v4_4478_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001511SMED30001511SMESG000029772.1 dd_Smed_v4_16888_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001681SMED30001681SMESG000049443.1 dd_Smed_v4_1193_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000837Histone H4SMESG000048698.1 SMESG000004193.1 dd_Smed_v4_16283_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000745SMED30000745SMESG000027028.1 dd_Smed_v4_14847_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004876Nuclear receptor subfamily 4 group ASMESG000063104.1 dd_Smed_v4_12229_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016546SMED30016546SMESG000051921.1 SMESG000051913.1 dd_Smed_v4_1175_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011780Si:ch73-222h13.1SMESG000081135.1 dd_Smed_v4_12752_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008862Transmembrane protein 17SMESG000050386.1 dd_Smed_v4_10264_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008325Fatty acid synthaseSMESG000020850.1 dd_Smed_v4_10967_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006481WD repeat-containing protein 49SMESG000041940.1 dd_Smed_v4_13248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006985WD repeat-containing protein 49SMESG000041940.1 dd_Smed_v4_13248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009793Dach-2SMESG000033540.1 dd_Smed_v4_11289_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009463WD repeat-containing protein 49SMESG000041940.1 dd_Smed_v4_13248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000771SMED30000771SMESG000059918.1 SMESG000052306.1 SMESG000022407.1 dd_Smed_v4_1996_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000771SMED30000771SMESG000059918.1 SMESG000052306.1 SMESG000022407.1 dd_Smed_v4_474_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000419bok-1SMESG000021216.1 dd_Smed_v4_18390_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017846Serpin family proteinSMESG000032448.1 SMESG000032440.1 SMESG000032430.1 dd_Smed_v4_1741_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013060Transcription factor IIIB 90 kDa subunitSMESG000049775.1 dd_Smed_v4_1437_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006006SMED30006006SMESG000007018.1 SMESG000007017.1 dd_Smed_v4_1969_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001801NME/NM23 nucleoside diphosphate kinase 1SMESG000008082.1 dd_Smed_v4_1096_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013087SMED30013087SMESG000023252.1 dd_Smed_v4_18917_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004972SMED30004972SMESG000007019.1 dd_Smed_v4_10965_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004930Irregular chiasm C-roughest-like isoform X2SMESG000077979.1 dd_Smed_v4_12549_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008907SMED30008907SMESG000017261.1 dd_Smed_v4_2030_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005863DUF3421 domain-containing proteinSMESG000074396.1 SMESG000074378.1 dd_Smed_v4_11_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004117Peptidyl-prolyl cis-trans isomeraseSMESG000070665.1 dd_Smed_v4_2064_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013312CalpainSMESG000062904.1 SMESG000062902.1 dd_Smed_v4_1971_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009218Receptor expression-enhancing proteinSMESG000036637.1 dd_Smed_v4_1995_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008456Type I inositol-1,4,5-trisphosphate 5-phosphataseSMESG000074184.1 SMESG000019975.1 dd_Smed_v4_266_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010024SMED30010024SMESG000038072.1 dd_Smed_v4_13847_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016116Sodium/hydrogen exchangerSMESG000006858.1 dd_Smed_v4_19237_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012344SMED30012344SMESG000017261.1 dd_Smed_v4_2030_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012858serine/threonine-protein kinase DCLK1SMESG000078466.1 dd_Smed_v4_13093_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012858serine/threonine-protein kinase DCLK1 dd_Smed_v4_5129_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013319Long-chain-fatty-acid--CoA ligase ACSBG2SMESG000027204.1 dd_Smed_v4_1026_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015020E3 ubiquitin-protein ligase XIAPSMESG000031958.1 dd_Smed_v4_2104_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006315SMED30006315SMESG000004983.1 dd_Smed_v4_20679_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010766C2 domain-containing protein 3SMESG000025571.1 dd_Smed_v4_13019_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003991SMED30003991SMESG000053279.1 dd_Smed_v4_13268_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012991endoglycoceramidaseSMESG000030369.1 SMESG000030357.1 SMESG000030353.1 dd_Smed_v4_1570_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011896Golgi-associated plant pathogenesis-related protein 1SMESG000005601.1 dd_Smed_v4_15638_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018900Intraflagellar transport protein 56SMESG000031670.1 dd_Smed_v4_12618_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014981Gelsolin-like proteinSMESG000015924.1 dd_Smed_v4_1673_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006189SMED30006189SMESG000001434.1 dd_Smed_v4_16150_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025535TNF receptor associated factor-2SMESG000049688.1 SMESG000049683.1 SMESG000049676.1 SMESG000049663.1 SMESG000049649.1 SMESG000049621.1 SMESG000049614.1 SMESG000049603.1 SMESG000049567.1 SMESG000008530.1 SMESG000008521.1 dd_Smed_v4_2003_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020257DUF3421 domain-containing proteinSMESG000046742.1 dd_Smed_v4_1040_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021485SMED30021485SMESG000059844.1 dd_Smed_v4_1328_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027940cAMP-dependent protein kinase type I-alpha regulatory subunitSMESG000078298.1 dd_Smed_v4_15589_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021615Conserved uncharacterized CXorf65-related proteinSMESG000033459.1 dd_Smed_v4_15167_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023050Aldehyde dehydrogenase, mitochondrialSMESG000016195.1 dd_Smed_v4_1339_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023193Tau tubulin kinaseSMESG000026133.1 dd_Smed_v4_12470_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027376SMED30027376SMESG000007018.1 SMESG000007017.1 dd_Smed_v4_1969_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027376SMED30027376SMESG000007017.1 dd_Smed_v4_7377_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025753SMED30025753SMESG000016791.1 dd_Smed_v4_10_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025084Ankyrin repeat and EF-hand domain-containing protein 1SMESG000006940.1 SMESG000006938.1 SMESG000006933.1 dd_Smed_v4_12476_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028898BZIP domain-containing proteinSMESG000067543.1 dd_Smed_v4_1399_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020686Transmembrane protein 80SMESG000018777.1 dd_Smed_v4_13318_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031491Armadillo repeat containing 4SMESG000057827.1 dd_Smed_v4_5065_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030168Latent transforming growth factor beta binding protein 3SMESG000008188.1 dd_Smed_v4_1886_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025688Protein tilB homologSMESG000058220.1 dd_Smed_v4_10124_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023540Serine/threonine-protein phosphatase 2B catalytic subunitSMESG000064848.1 dd_Smed_v4_2045_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029361KIF3B-like proteinSMESG000020245.1 dd_Smed_v4_9308_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029361KIF3B-like proteinSMESG000075065.1 dd_Smed_v4_4343_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026977SMED30026977SMESG000004247.1 dd_Smed_v4_19980_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021807SMED30021807SMESG000030582.1 dd_Smed_v4_1124_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022848Synaptotagmin VIaSMESG000043595.1 dd_Smed_v4_12716_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021940SMED30021940SMESG000017261.1 dd_Smed_v4_2030_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30024396Centrosomal protein 295SMESG000023095.1 dd_Smed_v4_11068_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30024396Centrosomal protein 295SMESG000023095.1 dd_Smed_v4_17079_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023196Glycosyl hydrolase family 25SMESG000049688.1 SMESG000049683.1 SMESG000049676.1 SMESG000049663.1 SMESG000049649.1 SMESG000049621.1 SMESG000049614.1 SMESG000049603.1 SMESG000049567.1 SMESG000008530.1 SMESG000008521.1 dd_Smed_v4_2003_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027035Pseudouridine synthaseSMESG000051935.1 dd_Smed_v4_12745_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031919F-box only protein 16SMESG000017118.1 dd_Smed_v4_12714_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030287Serine/threonine-protein phosphataseSMESG000064848.1 dd_Smed_v4_2045_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026699Zinc finger protein 474SMESG000009204.1 dd_Smed_v4_14765_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026702SMED30026702SMESG000038479.1 SMESG000038478.1 dd_Smed_v4_1931_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021479SMED30021479SMESG000017261.1 dd_Smed_v4_2030_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026485SMED30026485SMESG000078466.1 dd_Smed_v4_13093_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022312COesterase domain-containing proteinSMESG000064723.1 dd_Smed_v4_18958_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025310SMED30025310SMESG000050440.1 dd_Smed_v4_1552_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032272FMN_red domain-containing proteinSMESG000023871.1 dd_Smed_v4_1834_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021977Beta-1,3-galactosyltransferase 1SMESG000035184.1 dd_Smed_v4_11741_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022414SMED30022414SMESG000076482.1 SMESG000076409.1 SMESG000076405.1 SMESG000076390.1 SMESG000076375.1 SMESG000076364.1 SMESG000076223.1 SMESG000040665.1 SMESG000019753.1 dd_Smed_v4_1097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022414SMED30022414SMESG000076482.1 SMESG000076470.1 SMESG000076469.1 SMESG000076410.1 SMESG000076409.1 SMESG000076408.1 SMESG000076407.1 SMESG000076406.1 SMESG000076390.1 SMESG000076389.1 SMESG000076385.1 SMESG000076375.1 SMESG000076371.1 SMESG000076363.1 SMESG000076358.1 SMESG000076223.1 SMESG000040665.1 dd_Smed_v4_645_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020814SMED30020814SMESG000076482.1 SMESG000076409.1 SMESG000076405.1 SMESG000076390.1 SMESG000076375.1 SMESG000076364.1 SMESG000076223.1 SMESG000040665.1 SMESG000019753.1 dd_Smed_v4_1097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022344FERM domain containing-1SMESG000070273.1 dd_Smed_v4_1131_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031190SMED30031190SMESG000021216.1 dd_Smed_v4_18390_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020537SMED30020537SMESG000040594.1 dd_Smed_v4_1676_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30024952Coiled-coil domain containing 60SMESG000038986.1 dd_Smed_v4_14286_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028489START domain-containing proteinSMESG000028630.1 dd_Smed_v4_3237_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028489START domain-containing proteinSMESG000078713.1 SMESG000060505.1 SMESG000055485.1 SMESG000051367.1 SMESG000073216.1 SMESG000045326.1 SMESG000032032.1 SMESG000021912.1 SMESG000017091.1 dd_Smed_v4_12660_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027707S-adenosylmethionine synthaseSMESG000027587.1 dd_Smed_v4_1580_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020490SMED30020490SMESG000030489.1 dd_Smed_v4_11685_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028343Cytosolic carboxypeptidase 2SMESG000006325.1 dd_Smed_v4_13454_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031879Protein kinase domain-containing proteinSMESG000043386.1 dd_Smed_v4_15542_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001515AnnexinSMESG000042839.1 dd_Smed_v4_1104_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004498SMED30004498SMESG000035916.1 dd_Smed_v4_13051_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005191Phospholipid scramblaseSMESG000050656.1 dd_Smed_v4_6444_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010910POU domain proteinSMESG000058834.1 dd_Smed_v4_13010_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008091Serine/threonine-protein kinase PLKSMESG000012127.1 dd_Smed_v4_1620_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001404Dual specificity tyrosine-phosphorylation-regulated kinase 2SMESG000076586.1 SMESG000076583.1 dd_Smed_v4_12119_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003780Serine/threonine-protein kinase 36SMESG000076885.1 dd_Smed_v4_11067_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010632E3 ubiquitin-protein ligase RGLG4SMESG000076482.1 SMESG000076409.1 SMESG000076405.1 SMESG000076390.1 SMESG000076375.1 SMESG000076364.1 SMESG000076223.1 SMESG000040665.1 SMESG000019753.1 dd_Smed_v4_1097_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002023ANK_REP_REGION domain-containing proteinSMESG000020576.1 dd_Smed_v4_13360_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008280Class E vacuolar protein-sorting machinery protein HSE1SMESG000077597.1 dd_Smed_v4_4190_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009436SMED30009436SMESG000077535.1 dd_Smed_v4_18415_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008609SMED30008609SMESG000059918.1 SMESG000052306.1 dd_Smed_v4_12223_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001071Low density lipoprotein-receptor, class A,domain-containing proteinSMESG000037863.1 dd_Smed_v4_12756_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006515ZZ-type domain-containing proteinSMESG000055420.1 dd_Smed_v4_10173_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014760Exostosin-1SMESG000018952.1 SMESG000018951.1 SMESG000018945.1 SMESG000018944.1 dd_Smed_v4_11944_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000014slc20a-1SMESG000012546.1 dd_Smed_v4_1270_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004945slc22a-9SMESG000025834.1 dd_Smed_v4_11120_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007867OtoferlinSMESG000010400.1 dd_Smed_v4_14162_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007867OtoferlinSMESG000010400.1 dd_Smed_v4_13850_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007557DUF4515 domain-containing proteinSMESG000013289.1 dd_Smed_v4_13384_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005064Homeobox domain-containing proteinSMESG000074896.1 dd_Smed_v4_18719_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002882SMED30002882SMESG000069367.1 dd_Smed_v4_11838_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002882SMED30002882SMESG000069367.1 dd_Smed_v4_9233_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011238Kinesin-like proteinSMESG000035453.1 dd_Smed_v4_13424_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011238Kinesin-like proteinSMESG000035453.1 dd_Smed_v4_10765_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015069ANK_REP_REGION domain-containing proteinSMESG000063648.1 dd_Smed_v4_10764_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004582SMED30004582SMESG000035916.1 dd_Smed_v4_13051_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007680serine/threonine-protein kinase DCLK1SMESG000078466.1 dd_Smed_v4_13093_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007680serine/threonine-protein kinase DCLK1 dd_Smed_v4_5129_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010940TetraspaninSMESG000021642.1 dd_Smed_v4_1257_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010372SMED30010372SMESG000079705.1 dd_Smed_v4_12668_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005093NPHP5SMESG000005436.1 dd_Smed_v4_11329_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001920SMED30001920SMESG000013429.1 dd_Smed_v4_21056_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006822SMED30006822SMESG000043386.1 dd_Smed_v4_15542_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004562Placenta-specific gene 8 proteinSMESG000050175.1 dd_Smed_v4_20106_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005771SMED30005771SMESG000042003.1 dd_Smed_v4_12482_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001359SMED30001359SMESG000059918.1 SMESG000052306.1 SMESG000022407.1 dd_Smed_v4_1996_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003047Nalp (Nacht leucine rich repeat and pyrin domain containing)SMESG000047177.1 SMESG000045615.1 dd_Smed_v4_16437_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011699calcium/calmodulin-dependent protein kinase type IVSMESG000042100.1 dd_Smed_v4_10731_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012954centriolinSMESG000006866.1 dd_Smed_v4_10369_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013578MICOS complex subunit MIC10SMESG000009106.1 dd_Smed_v4_1150_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013865OFD1SMESG000046592.1 dd_Smed_v4_13339_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002655Ig-like domain-containing proteinSMESG000079770.1 dd_Smed_v4_1914_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000535CEP72SMESG000043538.1 dd_Smed_v4_12835_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013884SMED30013884SMESG000049207.1 SMESG000049205.1 SMESG000049063.1 dd_Smed_v4_11081_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009277Polyamine-modulated factor 1-binding protein 1SMESG000048877.1 dd_Smed_v4_3146_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008242SMED30008242SMESG000068886.1 dd_Smed_v4_12913_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002166SMED30002166SMESG000058880.1 SMESG000039065.1 dd_Smed_v4_4225_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010674SPATA6 domain-containing proteinSMESG000053714.1 dd_Smed_v4_10543_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002886SMED30002886SMESG000017779.1 dd_Smed_v4_11049_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026544Mucin-19-like isoform X3SMESG000001496.1 SMESG000001495.1 dd_Smed_v4_14943_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020941beta 1,3 galactosyltransferase-1SMESG000008720.1 dd_Smed_v4_10927_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED300279683'-phosphoadenosine 5'-phosphosulfate synthaseSMESG000077893.1 dd_Smed_v4_2536_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023729Cold shock domain proteinSMESG000073546.1 dd_Smed_v4_392_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022225Bidirectional sugar transporter SWEETSMESG000012540.1 dd_Smed_v4_12308_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035963SMED30035963SMESG000071278.1 dd_Smed_v4_1649_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026101Reticulocalbin-1SMESG000077405.1 dd_Smed_v4_5905_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026256vault protein inter alpha trypsin-1SMESG000053671.1 SMESG000053669.1 SMESG000053667.1 SMESG000053664.1 SMESG000053657.1 SMESG000053638.1 dd_Smed_v4_1027_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021386Y box protein-1SMESG000058066.1 dd_Smed_v4_52_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030699Ephrin type-A receptor 4-BSMESG000077240.1 dd_Smed_v4_16483_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029603SMED30029603SMESG000071278.1 dd_Smed_v4_1649_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034709DNA polymerase etaSMESG000019761.1 SMESG000010350.1 SMESG000010346.1 dd_Smed_v4_6500_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031405SMED30031405SMESG000051910.1 SMESG000051904.1 dd_Smed_v4_298_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031405SMED30031405SMESG000051911.1 dd_Smed_v4_5276_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026135SMED30026135SMESG000016933.1 dd_Smed_v4_2807_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030766Y box protein-1SMESG000058066.1 dd_Smed_v4_52_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035642Granulin bSMESG000029882.1 dd_Smed_v4_442_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033467SMED30033467SMESG000019977.1 dd_Smed_v4_284_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030795Vault protein inter alpha trypsin-1SMESG000053671.1 SMESG000053669.1 SMESG000053667.1 SMESG000053664.1 SMESG000053657.1 SMESG000053638.1 dd_Smed_v4_1027_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033541SMED30033541SMESG000061837.1 dd_Smed_v4_14985_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034775Ras-associating domain-containing proteinSMESG000002146.1 dd_Smed_v4_3216_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031219deleted in lung and esophageal cancer protein 1SMESG000079694.1 dd_Smed_v4_10833_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035194DnaJ-like subfamily C member 27SMESG000071551.1 dd_Smed_v4_11963_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031947Long-chain-fatty-acid--CoA ligase ACSBG2SMESG000027217.1 dd_Smed_v4_2414_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029802MKS transition zone complex subunit 1SMESG000058562.1 dd_Smed_v4_14053_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027407SERPINE1 mRNA binding protein 1aSMESG000008791.1 dd_Smed_v4_697_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029899slc25a-30SMESG000044697.1 SMESG000022161.1 dd_Smed_v4_50_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025152cilia- and flagella-associated protein 91SMESG000056200.1 dd_Smed_v4_10405_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025152cilia- and flagella-associated protein 91SMESG000056200.1 dd_Smed_v4_9724_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033196SMED30033196SMESG000051944.1 dd_Smed_v4_14960_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035373histone deacetylase 1SMESG000060876.1 dd_Smed_v4_695_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012075SMED30012075SMESG000059352.1 SMESG000059351.1 dd_Smed_v4_420_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006438EF-hand domain-containing family member BSMESG000077905.1 dd_Smed_v4_11909_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019921SMED30019921SMESG000058949.1 dd_Smed_v4_10877_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017314Dynein regulatory complex subunit 7SMESG000078850.1 dd_Smed_v4_12588_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3000170160S ribosomal protein L7aSMESG000020535.1 dd_Smed_v4_296_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015457SMED30015457SMESG000022017.1 dd_Smed_v4_9360_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018770SMED30018770SMESG000072454.1 dd_Smed_v4_1949_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009026ATP-dependent RNA helicase DDX3XSMESG000046974.1 SMESG000046953.1 dd_Smed_v4_799_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002038Calsyntenin 1SMESG000002834.1 SMESG000002830.1 dd_Smed_v4_1518_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017135Dual specificity mitogen-activated protein kinase kinase 6SMESG000017824.1 dd_Smed_v4_1568_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004875EF-hand calcium-binding domain-containing protein 6SMESG000058629.1 dd_Smed_v4_20435_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000639Microtubule-actin cross-linking factor 1-like isoform X28SMESG000017517.1 SMESG000017520.1 SMESG000017519.1 dd_Smed_v4_6577_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004551G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000016965.1 dd_Smed_v4_19397_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001185Transmembrane protein 231SMESG000032658.1 dd_Smed_v4_16131_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017953SMED30017953SMESG000011944.1 dd_Smed_v4_3820_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014094Kinesin-like proteinSMESG000016386.1 dd_Smed_v4_11012_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012960CalmodulinSMESG000003548.1 dd_Smed_v4_10083_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015974FAST kinase domain-containing protein 1, mitochondrialSMESG000064523.1 dd_Smed_v4_8917_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009887Macrophage erythroblast attacherSMESG000048410.1 dd_Smed_v4_1168_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011027Dynein axonemal assembly factor 4SMESG000052823.1 dd_Smed_v4_12396_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012926SMED30012926SMESG000059195.1 SMESG000059194.1 SMESG000059193.1 dd_Smed_v4_1940_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016010SMED30016010SMESG000042231.1 dd_Smed_v4_10980_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019565Radial spoke head protein 4-like protein ASMESG000044927.1 dd_Smed_v4_5346_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005045zinc finger protein ASMESG000022958.1 KF751216.1smed_ncbi_20200123PMID:24704339
Vogg et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30022468secreted frizzled-related protein 1SMESG000075831.1 SMESG000029446.1 EU296635smed_ncbi_20200123PMID:24704339
Vogg et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30027297winged helix/forkhead transcription factorSMESG000077075.1 KC577557.1smed_ncbi_20200123PMID:24704339
Vogg et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30027297winged helix/forkhead transcription factorSMESG000077075.1 KC577557smed_ncbi_20200123PMID:24704339
Vogg et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30029487Smed-NDKSMESG000062038.1 GU592830.1smed_ncbi_20200123PMID:24704339
Vogg et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30027299PBXSMESG000022232.1 SMESG000001913.1 KC353351.1smed_ncbi_20200123PMID:23318641
Chen et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30031256wntP-2SMESG000066476.1 wntP-2smed_ncbi_20200123PMID:23318641
Chen et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30026602Wnt2-1SMESG000002069.1 FJ463753.1smed_ncbi_20200123PMID:23318641
Chen et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30020359Smed-NDK-3SMESG000046244.1 SMESG000046208.1 GU592832.1smed_ncbi_20200123PMID:23318641
Chen et al., 2013
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30001630Ras-related C3 botulinum toxin substrate 1SMESG000005612.1 Contig594newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30001630Ras-related C3 botulinum toxin substrate 1SMESG000005612.1 Contig594uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30001630Ras-related C3 botulinum toxin substrate 1SMESG000011575.1 Contig594newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30001630Ras-related C3 botulinum toxin substrate 1SMESG000011575.1 Contig594uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30015345TropomyosinSMESG000066854.1 Contig3688newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30015345TropomyosinSMESG000066854.1 Contig3688uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30015345TropomyosinSMESG000026500.1 Contig3688newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30015345TropomyosinSMESG000026500.1 Contig3688uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30009357ubiquilin-1SMESG000045386.1 Contig2009GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30008321SMED30008321SMESG000068172.1 Contig3306newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30008321SMED30008321SMESG000068172.1 Contig3306uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30008321SMED30008321SMESG000025870.1 Contig3306newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30008321SMED30008321SMESG000025870.1 Contig3306uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30004606Cytochrome P450 2K1-like proteinSMESG000020470.1 Contig1680GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30033476Zinc finger protein, putativeSMESG000068172.1 Contig3306GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30033476Zinc finger protein, putativeSMESG000025870.1 Contig3306GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30014474Tumor susceptibility gene 101 proteinSMESG000049597.1 Contig5044GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30014474Tumor susceptibility gene 101 proteinSMESG000004871.1 Contig5044GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30016832SH3 domain-binding protein 5-likeSMESG000061052.1 Contig4742newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30016832SH3 domain-binding protein 5-likeSMESG000061052.1 Contig4742uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30016832SH3 domain-binding protein 5-likeSMESG000022856.1 Contig4742newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30016832SH3 domain-binding protein 5-likeSMESG000022856.1 Contig4742uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30011780Si:ch73-222h13.1SMESG000081135.1 Contig3433newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30011780Si:ch73-222h13.1SMESG000081135.1 Contig3433uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30008147SMED30008147SMESG000053405.1 Contig1766newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30008147SMED30008147SMESG000053405.1 Contig1766uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30008147SMED30008147SMESG000046314.1 SMESG000028362.1 Contig1766newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30008147SMED30008147SMESG000046314.1 SMESG000028362.1 Contig1766uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30007555GCR098SMESG000016695.1 Contig4585newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30007555GCR098SMESG000016695.1 Contig4585uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30007555GCR098SMESG000033655.1 Contig4585newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30007555GCR098SMESG000033655.1 Contig4585uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30011213Osteoclast-stimulating factor 1SMESG000004952.1 Contig516GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30001294Phosphatidylinositol-binding clathrin assembly proteinSMESG000043423.1 Contig1792GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30001294Phosphatidylinositol-binding clathrin assembly proteinSMESG000072544.1 Contig1792GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30001281SMED30001281SMESG000038153.1 SMESG000018862.1 Contig1newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30001281SMED30001281SMESG000033840.1 Contig1newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30005434SMED30005434SMESG000038889.1 Contig2145newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30012677Coiled-coil domain-containing protein 51SMESG000058452.1 Contig1190newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30012677Coiled-coil domain-containing protein 51SMESG000058452.1 Contig1190uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30012677Coiled-coil domain-containing protein 51SMESG000057519.1 Contig1190newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30012677Coiled-coil domain-containing protein 51SMESG000057519.1 Contig1190uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30013050SMED30013050SMESG000000175.1 Contig2068newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30017930SMED30017930SMESG000049597.1 Contig5044newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30017930SMED30017930SMESG000004871.1 Contig5044newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30004652SMED30004652SMESG000033527.1 Contig2307newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30017833SMED30017833SMESG000053168.1 Contig2992newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30013976SMED30013976SMESG000003513.1 Contig59newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30013976SMED30013976SMESG000003513.1 Contig59uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30013976SMED30013976SMESG000068232.1 Contig59newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30013976SMED30013976SMESG000068232.1 Contig59uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30012769SMED30012769SMESG000058788.1 Contig2701newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30012769SMED30012769SMESG000058788.1 Contig2701uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30009175Transcription elongation factor spt6SMESG000059332.1 Contig5500newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30009175Transcription elongation factor spt6SMESG000059332.1 Contig5500uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30009175Transcription elongation factor spt6SMESG000024114.1 Contig5500newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30009175Transcription elongation factor spt6SMESG000024114.1 Contig5500uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30034573Tubulin beta chainSMESG000047291.1 SMESG000044907.1 SMESG000044888.1 SMESG000035804.1 SMESG000035755.1 SMESG000047284.1 Contig5821GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30022483CGG triplet repeat-binding protein 1SMESG000020470.1 Contig1680newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30022483CGG triplet repeat-binding protein 1SMESG000020470.1 Contig1680uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30032408SMED30032408SMESG000027686.1 Contig2364newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30032408SMED30032408SMESG000012131.1 SMESG000012127.1 Contig2364newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30028347Engulfment and cell motility 3SMESG000013936.1 Contig1935GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30028347Engulfment and cell motility 3SMESG000039535.1 Contig1935GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30032393SMED30032393SMESG000036683.1 Contig4572newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30032393SMED30032393SMESG000074788.1 Contig4572newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30022944SMED30022944SMESG000049597.1 Contig5044newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30010239SMED30010239SMESG000023005.1 dd_Smed_v4_1571_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004725SMED30004725SMESG000023005.1 dd_Smed_v4_1571_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007500coiled-coil domain-containing protein 170SMESG000074429.1 dd_Smed_v4_10140_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009090Mushroom body large-type Kenyon-related proteinSMESG000070784.1 dd_Smed_v4_17498_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004648Dual specificity tyrosine phosphorylation regulated kinase 2SMESG000076586.1 SMESG000076583.1 dd_Smed_v4_12119_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008856SMED30008856SMESG000025888.1 dd_Smed_v4_1422_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005211cilia- and flagella-associated protein 47SMESG000060264.1 dd_Smed_v4_8294_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010655SMED30010655SMESG000028897.1 dd_Smed_v4_12473_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015419SMED30015419SMESG000021688.1 dd_Smed_v4_11297_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005421CAP-Gly domain-containing proteinSMESG000006189.1 dd_Smed_v4_14698_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005421CAP-Gly domain-containing proteinSMESG000006189.1 dd_Smed_v4_12985_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026934SMED30026934SMESG000050824.1 dd_Smed_v4_12162_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030924Protein tilB-likeSMESG000009895.1 dd_Smed_v4_14797_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021167SMED30021167SMESG000035386.1 dd_Smed_v4_10651_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031175SMED30031175SMESG000064100.1 SMESG000064099.1 dd_Smed_v4_14322_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026337AnkyrinSMESG000000606.1 dd_Smed_v4_2072_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020508SMED30020508SMESG000021243.1 dd_Smed_v4_12661_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025849Centrosome and spindle pole-associated protein 1SMESG000080361.1 dd_Smed_v4_13453_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022914neurofilament heavy polypeptide isoform X5SMESG000058734.1 dd_Smed_v4_11421_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021613Nesprin-1SMESG000077685.1 dd_Smed_v4_15904_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021613Nesprin-1SMESG000077685.1 dd_Smed_v4_10214_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020318WD repeat-containing protein 49SMESG000041940.1 dd_Smed_v4_13248_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022163Tubulin polyglutamylase TTLL7SMESG000055128.1 dd_Smed_v4_13600_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031962Frizzled receptorSMESG000053774.1 dd_Smed_v4_17168_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022362Synaptotagmin-2SMESG000011583.1 dd_Smed_v4_12772_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021404ALMS_motif domain-containing proteinSMESG000077136.1 dd_Smed_v4_10880_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021404ALMS_motif domain-containing proteinSMESG000077136.1 dd_Smed_v4_5064_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025623SMED30025623SMESG000065670.1 dd_Smed_v4_10718_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032947cilia- and flagella-associated protein 46SMESG000014116.1 SMESG000014118.1 dd_Smed_v4_14103_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025972Fzd-5/8-2SMESG000053774.1 dd_Smed_v4_17168_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022681Dynein heavy chain 7 axonemalSMESG000012956.1 dd_Smed_v4_13792_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022681Dynein heavy chain 7 axonemalSMESG000012956.1 dd_Smed_v4_5350_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022121SMED30022121SMESG000042798.1 dd_Smed_v4_2204_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021820Guanylate cyclaseSMESG000056411.1 dd_Smed_v4_11767_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029741SMED30029741SMESG000056346.1 dd_Smed_v4_2250_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017410Peptidoglycan-recognition proteinSMESG000004536.1 dd_Smed_v4_817_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000491Cornifelin-like ASMESG000023836.1 dd_Smed_v4_1291_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED300051503' histone mRNA exonuclease 1SMESG000058668.1 dd_Smed_v4_1266_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016080Deoxyhypusine hydroxylaseSMESG000051726.1 SMESG000051721.1 dd_Smed_v4_703_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019729Bestrophin homologSMESG000070057.1 dd_Smed_v4_8073_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018556Pyruvate kinaseSMESG000045839.1 dd_Smed_v4_51910_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017794Coiled-coil domain containing 191SMESG000064321.1 dd_Smed_v4_8967_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004871Mitogen-activated protein kinaseSMESG000023035.1 SMESG000023025.1 dd_Smed_v4_10933_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001155SMED30001155SMESG000043660.1 dd_Smed_v4_15839_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017387von Willebrand factor A domain containing 3BSMESG000047774.1 dd_Smed_v4_9363_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017612SMED30017612SMESG000007344.1 dd_Smed_v4_5456_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012665FERM domain-containing proteinSMESG000062741.1 SMESG000053535.1 SMESG000049374.1 SMESG000033049.1 SMESG000024644.1 SMESG000016667.1 dd_Smed_v4_6227_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013441WD repeat domain 78SMESG000047563.1 dd_Smed_v4_8721_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021641SMED30021641SMESG000040565.1 dd_Smed_v4_4660_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032610WD_REPEATS_REGION domain-containing proteinSMESG000060483.1 dd_Smed_v4_8615_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032692Histone H3SMESG000074938.1 SMESG000074937.1 dd_Smed_v4_9531_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034249SMED30034249SMESG000042496.1 dd_Smed_v4_8345_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027062NIPA-like protein 2SMESG000039144.1 dd_Smed_v4_7517_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023889SMED30023889SMESG000055805.1 dd_Smed_v4_857_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029024Protein F37C4.5SMESG000064758.1 dd_Smed_v4_5168_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033411Dynein light chainSMESG000041239.1 dd_Smed_v4_3149_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034831SMED30034831SMESG000064758.1 dd_Smed_v4_5168_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033139TNF receptor-associated factorSMESG000079607.1 SMESG000072955.1 SMESG000049847.1 SMESG000049844.1 SMESG000049832.1 SMESG000049812.1 SMESG000049806.1 SMESG000049805.1 SMESG000049772.1 SMESG000049767.1 SMESG000049756.1 SMESG000049745.1 SMESG000049740.1 SMESG000049739.1 SMESG000049695.1 SMESG000049688.1 SMESG000049683.1 SMESG000049676.1 SMESG000049665.1 SMESG000049663.1 SMESG000049647.1 SMESG000049621.1 SMESG000049614.1 SMESG000049601.1 SMESG000049567.1 SMESG000049548.1 SMESG000040301.1 SMESG000040257.1 SMESG000032755.1 SMESG000032715.1 SMESG000022696.1 SMESG000022691.1 SMESG000022676.1 SMESG000022665.1 SMESG000022640.1 SMESG000022619.1 SMESG000022612.1 dd_Smed_v4_490_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021143Basal body-orientation factor 1SMESG000078046.1 dd_Smed_v4_9328_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026782Cilia-and flagella-associated protein 58SMESG000061980.1 dd_Smed_v4_5727_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034470PDZ ring finger protein 4SMESG000021620.1 dd_Smed_v4_5781_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020205Si:dkey-90a13.10SMESG000035648.1 dd_Smed_v4_5452_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032389slc24a-1SMESG000010390.1 dd_Smed_v4_5868_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029492KN motif and ankyrin repeat domain-containing protein 4 isoform X2SMESG000059500.1 dd_Smed_v4_7499_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031571Testis-specific expressed protein 55SMESG000033391.1 dd_Smed_v4_5969_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028503SMED30028503SMESG000040102.1 dd_Smed_v4_5390_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026803X1.D.D8.3SMESG000053883.1 dd_Smed_v4_8540_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020643Chromosome 11 open reading frame 58SMESG000030362.1 dd_Smed_v4_6127_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032094RIIa domain-containing protein 1SMESG000079320.1 dd_Smed_v4_4716_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023882Rootletin-2SMESG000081227.1 dd_Smed_v4_6573_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028223Stabilizer of axonemal microtubules 1SMESG000042230.1 dd_Smed_v4_5551_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033791cilia- and flagella-associated protein 161SMESG000028972.1 dd_Smed_v4_8229_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035683V-type proton ATPase subunit aSMESG000044136.1 SMESG000037609.1 dd_Smed_v4_833_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30024248SMED30024248SMESG000055844.1 dd_Smed_v4_6835_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027213Solute carrier family 49 member 3SMESG000032659.1 dd_Smed_v4_5238_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034139Receptor-type tyrosine-protein phosphatase betaSMESG000005260.1 dd_Smed_v4_5733_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030642Cytochrome P450 2C3SMESG000023530.1 SMESG000023528.1 dd_Smed_v4_7874_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020168c-Jun N-terminal kinasesSMESG000043618.1 dd_Smed_v4_5924_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035226AnnexinSMESG000023108.1 dd_Smed_v4_5798_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015310DUF3421 domain-containing proteinSMESG000046710.1 SMESG000046697.1 dd_Smed_v4_54_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005322SMED30005322SMESG000078208.1 dd_2727dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
pharynxSMED30029624Heterogeneous nuclear ribonucleoprotein KSMESG000064674.1 dd_Smed_v4_1998_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029394Dopamine receptor proteinSMESG000063119.1 dd_Smed_v4_21196_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025473mxi-2 proteinSMESG000060394.1 dd_Smed_v4_4048_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027683Golgi phosphoprotein 3SMESG000073543.1 SMESG000073542.1 dd_Smed_v4_1770_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025195SMED30025195SMESG000001693.1 dd_Smed_v4_10480_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023022Protein transport protein Sec24CSMESG000060905.1 dd_Smed_v4_1764_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032042SMED30032042SMESG000065355.1 SMESG000065350.1 SMESG000065349.1 dd_531dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
pharynxSMED30032042SMED30032042SMESG000065355.1 SMESG000065350.1 SMESG000065349.1 dd_Smed_v4_531_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023857Calpain 5aSMESG000009459.1 dd_Smed_v4_101944_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030597Mitogen-activated protein kinaseSMESG000033376.1 dd_Smed_v4_11396_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022030EGR-like protein 1SMESG000000959.1 dd_Smed_v4_12410_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022030EGR-like protein 1SMESG000000960.1 dd_Smed_v4_7731_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031582InnexinSMESG000081749.1 dd_Smed_v4_10287_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031582InnexinSMESG000081749.1 dd_Smed_v4_11302_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030837cilia- and flagella-associated protein 299SMESG000052708.1 dd_Smed_v4_11277_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029206ANK_REP_REGION domain-containing proteinSMESG000017292.1 dd_Smed_v4_5280_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031468Propionyl-CoA carboxylase alpha chain, mitochondrialSMESG000034830.1 dd_Smed_v4_1247_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034323Ras family proteinSMESG000053083.1 dd_Smed_v4_11357_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030504Iroquois-class homeodomain protein IRX-4SMESG000026100.1 dd_Smed_v4_17352_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019325Myosin regulatory light chainSMESG000000175.1 Contig2068GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30001668SMED30001668SMESG000033527.1 Contig2307GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30021511SMED30021511SMESG000038232.1 Contig5776GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED3002169814-3-3 protein epsilonSMESG000047644.1 Contig5316GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30030227flotillin-2SMESG000059332.1 Contig5500GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30030227flotillin-2SMESG000024114.1 Contig5500GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30033333SMED30033333SMESG000004952.1 Contig516newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30022398C2H2-type domain-containing proteinSMESG000032119.1 Contig3970GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30029698Caspase-7SMESG000053168.1 Contig2992GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30020811SMED30020811SMESG000005612.1 Contig594newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30020811SMED30020811SMESG000005612.1 Contig594uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30020811SMED30020811SMESG000011575.1 Contig594newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30020811SMED30020811SMESG000011575.1 Contig594uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30005012SMED30005012 Contig1286newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30002222SMED30002222 Contig7536newmark_estsPMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30002222SMED30002222 Contig7536uc_Smed_v2PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30017282nuclear factor Y complex B2SMESG000040141.1 KU366700smed_ncbi_20200123PMID:27304889
Iyer et al., 2016
whole organism adult hermaphrodite colorimetric in situ hybridization evidence
pharynxSMED30025497secreted frizzled related protein 2SMESG000050379.1 ADO51625.1smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30022468secreted frizzled-related protein 1SMESG000075831.1 SMESG000029446.1 EU296635smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30022468secreted frizzled-related protein 1SMESG000075831.1 SMESG000029446.1 ABY85212.1smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30019722secreted frizzled related protein 3SMESG000058717.1 HM751832.1smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30022929WntASMESG000051375.1 FJ463750.1smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30022929WntASMESG000051375.1 FJ463750smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30022929WntASMESG000051375.1 ACJ64865.1smed_ncbi_20200123PMID:20707997
Gurley et al., 2010
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30001081NudC nuclear distribution proteinSMESG000036795.1 DN303982.1ncbi_smed_estsPMID:22411224
Cowles et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30020436Nuclear distribution protein nudE-like 1SMESG000016071.1 HO006501.1ncbi_smed_estsPMID:22411224
Cowles et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30016141lissencephaly-1SMESG000054739.1 SMESG000035997.1 JQ650355.1smed_ncbi_20200123PMID:22411224
Cowles et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30004930Irregular chiasm C-roughest-like isoform X2SMESG000077979.1 dd_Smed_v4_12549_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30001690SMED30001690SMESG000069322.1 dd_Smed_v4_12571_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30000553Epithelial discoidin domain-containing receptorSMESG000069322.1 dd_Smed_v4_12571_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30013316Polycomb group RING finger protein 1SMESG000072501.1 dd_Smed_v4_12753_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30033884FERM, RhoGEF and pleckstrin domain-containing protein 1SMESG000069407.1 dd_Smed_v4_12715_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30025810SMED30025810SMESG000019718.1 dd_Smed_v4_2749_0_1dd_Smed_v4PMID:27063937
Scimone et al., 2016
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30005045zinc finger protein ASMESG000022958.1 KF751216.1smed_ncbi_20200123PMID:24992682
Vásquez-Doorman et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30005045zinc finger protein ASMESG000022958.1 dd_Smed_v4_22585_0_1dd_Smed_v4PMID:24992682
Vásquez-Doorman et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30005718Guanine nucleotide-binding protein G(I) subunit alphaSMESG000026774.1 Gpassmed_ncbi_20200123PMID:24992682
Vásquez-Doorman et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30020522ap2SMESG000022356.1 JX010470.1smed_ncbi_20200123PMID:24992682
Vásquez-Doorman et al., 2014
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30031425Homeobox protein Hox-D12SMESG000003389.1 SMED30031425smed_20140614PMID:27034770
Currie et al., 2016
whole organism asexual adult fluorescence in situ hybridization evidence
pharynxSMED30024673SMED30024673SMESG000067310.1 SmedASXL_065556SmedAsxl_ww_GCZZ01PMID:29158443
He et al., 2017
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30005458Phosphatidylinositol 4-kinase type 2-betaSMESG000074718.1 tr5_11049mu_Smed_v1PMID:25558068
Reuter et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30013810TeashirtSMESG000008973.1 KP003815.1smed_ncbi_20200123PMID:25558068
Reuter et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
pharynxSMED30022468secreted frizzled-related protein 1SMESG000075831.1 SMESG000029446.1 EU296635smed_ncbi_20200123PMID:25558068
Reuter et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30029487Smed-NDKSMESG000062038.1 GU592830.1smed_ncbi_20200123PMID:25558068
Reuter et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30022963anaphase-promoting complex subunit 1SMESG000010770.1 SMESG000012375.1 tr5_7361mu_Smed_v1PMID:25558068
Reuter et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30018250Telomerase-binding protein EST1A tr5_9369mu_Smed_v1PMID:25558068
Reuter et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30016511SMED30016511SMESG000072006.1 tr5_6444mu_Smed_v1PMID:25558068
Reuter et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30012814Protein CWC15-like proteinSMESG000010770.1 SMESG000012375.1 tr5_7361mu_Smed_v1PMID:25558068
Reuter et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30034772Fibrillar collagen NC1 domain-containing proteinSMESG000077977.1 tr5_2051mu_Smed_v1PMID:25558068
Reuter et al., 2015
whole organism asexual adult colorimetric in situ hybridization evidence
pharynxSMED30013810TeashirtSMESG000008973.1 KP003815.1smed_ncbi_20200123PMID:25725068
Owen et al., 2015
whole organism asexual adult fluorescence in situ hybridization evidence
pharynxSMED30000144CAP-Gly domain-containing proteinSMESG000000637.1 dd_Smed_v4_16405_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019774SMED30019774SMESG000065670.1 dd_Smed_v4_10718_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002162Glycosyl transferaseSMESG000030921.1 dd_Smed_v4_11247_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003458Ras-related protein Rab-27BSMESG000077907.1 dd_Smed_v4_10266_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004112Dynein heavy chain 5, axonemalSMESG000012967.1 dd_Smed_v4_17773_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004112Dynein heavy chain 5, axonemalSMESG000012967.1 dd_Smed_v4_4113_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001414UPF0728 protein C10orf53 homologSMESG000073355.1 dd_Smed_v4_10501_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027428forkhead box A-1SMESG000065670.1 dd_Smed_v4_10718_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021960AminopeptidaseSMESG000067986.1 dd_Smed_v4_2224_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004318Triadin-like isoform X4SMESG000025109.1 dd_Smed_v4_13778_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004318Triadin-like isoform X4SMESG000025109.1 dd_Smed_v4_22537_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015511X-ray radiation resistance-associated protein 1SMESG000019618.1 dd_Smed_v4_13519_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002734echinoderm microtubule-associated protein-like 2 isoform X1SMESG000038072.1 dd_Smed_v4_21299_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005046Dynein heavy chain, axonemalSMESG000050247.1 dd_Smed_v4_13135_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005046Dynein heavy chain, axonemalSMESG000050247.1 SMESG000050248.1 dd_Smed_v4_10191_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005413SMED30005413SMESG000017261.1 dd_Smed_v4_2030_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000158Dipeptidyl peptidase 3SMESG000079740.1 dd_Smed_v4_1031_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000918Coiled-coil domain containing 13SMESG000058204.1 dd_Smed_v4_12055_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004908L1-like cell adhesion moleculeSMESG000025433.1 dd_Smed_v4_1916_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003093SMED30003093SMESG000056847.1 SMESG000056843.1 SMESG000056838.1 SMESG000044770.1 SMESG000044762.1 SMESG000007140.1 dd_Smed_v4_1137_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011695Alpha-galactosidaseSMESG000009912.1 dd_Smed_v4_606_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010565SMED30010565SMESG000068609.1 dd_Smed_v4_34185_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001470wntP-3SMESG000067888.1 dd_Smed_v4_14865_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017053SMED30017053SMESG000004885.1 dd_Smed_v4_5297_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018507Calcium-transporting ATPaseSMESG000038461.1 dd_Smed_v4_3170_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018507Calcium-transporting ATPaseSMESG000038461.1 dd_Smed_v4_4559_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008476LRRC50SMESG000004118.1 SMESG000004112.1 dd_Smed_v4_9766_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009450TIR domain-containing proteinSMESG000008937.1 dd_Smed_v4_9242_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3000876940S ribosomal protein S10SMESG000034720.1 dd_Smed_v4_117_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007385SMED30007385SMESG000003089.1 dd_Smed_v4_780_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001818TNF receptor associated factor 3SMESG000026104.1 dd_Smed_v4_9703_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013157KHD-1SMESG000070471.1 dd_Smed_v4_294_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015160SMED30015160SMESG000016267.1 SMESG000058374.1 dd_Smed_v4_3391_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3001198260S ribosomal protein L17SMESG000009564.1 dd_Smed_v4_95_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006397Cyclic nucleotide-binding domain-containing proteinSMESG000040419.1 SMESG000040416.1 SMESG000005563.1 dd_Smed_v4_19613_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008579ST13 Hsp70 interacting proteinSMESG000071677.1 SMESG000069228.1 SMESG000017570.1 SMESG000017358.1 SMESG000017347.1 SMESG000013728.1 SMESG000001430.1 dd_Smed_v4_668_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003997SMED30003997SMESG000059318.1 SMESG000059304.1 dd_Smed_v4_483_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013379IQ motif containing GSMESG000075453.1 dd_Smed_v4_7221_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001031TRAF3-interacting protein 1SMESG000006345.1 dd_Smed_v4_10562_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000794Luc7-like protein 3SMESG000041410.1 dd_Smed_v4_1899_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004519Novel proteinSMESG000039682.1 dd_Smed_v4_2676_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012826SMED30012826SMESG000017012.1 SMESG000017011.1 dd_Smed_v4_309_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010468RBR-type E3 ubiquitin transferaseSMESG000062644.1 dd_Smed_v4_3281_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004518Dynein assembly factor with WDR repeat domains 1SMESG000008529.1 SMESG000008519.1 dd_Smed_v4_4782_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009956SMED30009956SMESG000022272.1 dd_Smed_v4_10991_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009956SMED30009956SMESG000022273.1 dd_Smed_v4_8344_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011431SMED30011431SMESG000063184.1 dd_Smed_v4_2217_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005231Polyadenylate-binding proteinSMESG000058745.1 dd_Smed_v4_93_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018972ANK_REP_REGION domain-containing proteinSMESG000022931.1 dd_Smed_v4_11187_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3000665560S ribosomal protein L32SMESG000060036.1 dd_Smed_v4_149_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009941Peptidylprolyl isomeraseSMESG000028286.1 SMESG000004790.1 dd_Smed_v4_672_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007406SMEDWI-1SMESG000036375.1 dd_Smed_v4_659_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005171SMED30005171SMESG000024345.1 dd_Smed_v4_629_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017795SJCHGC08351 proteinSMESG000005753.1 dd_Smed_v4_8141_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000411Dynamin-1SMESG000021502.1 dd_Smed_v4_2160_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004840Coiled-coil domain containing 88AaSMESG000012304.1 dd_Smed_v4_3591_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017260Pre mRNA processing factor 6SMESG000011657.1 dd_Smed_v4_1153_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007343Tud-1SMESG000043684.1 dd_Smed_v4_3741_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014544Dynein light chainSMESG000067731.1 dd_Smed_v4_11037_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033594Microtubule-associated protein 1ASMESG000014298.1 dd_Smed_v4_3654_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033594Microtubule-associated protein 1ASMESG000014298.1 dd_Smed_v4_1301_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023008HSP27SMESG000030472.1 dd_Smed_v4_2189_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026658SMED30026658SMESG000008925.1 dd_Smed_v4_376_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032342Hsc70-interacting proteinSMESG000040419.1 SMESG000040416.1 SMESG000005563.1 dd_Smed_v4_19613_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028591Protein kinaseSMESG000030545.1 dd_Smed_v4_11177_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031216Oxysterol-binding proteinSMESG000023068.1 dd_Smed_v4_3268_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031646SMED30031646SMESG000010156.1 dd_Smed_v4_105_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035904PROG-1SMESG000024882.1 SMESG000024707.1 dd_Smed_v4_332_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021903SMED30021903SMESG000040469.1 dd_Smed_v4_10729_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020195rab-like protein 2ASMESG000031968.1 dd_Smed_v4_9251_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016922Parkin coregulated proteinSMESG000000577.1 dd_Smed_v4_3899_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009268SMED30009268SMESG000065344.1 dd_Smed_v4_3354_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3000109640S ribosomal protein S23SMESG000017264.1 dd_Smed_v4_290_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001933Heterogeneous nuclear ribonucleoproteinSMESG000055008.1 dd_Smed_v4_2383_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002344Bax inhibitor-1 proteinSMESG000038559.1 dd_Smed_v4_319_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018542slc4a-1SMESG000024335.1 dd_Smed_v4_3003_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008950SMED30008950SMESG000071333.1 dd_Smed_v4_3647_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010966Core 1 udp-galactose:n-acetylgalactosamine-alpha-r beta 1,3-galactosyltransferase, putativeSMESG000061089.1 dd_Smed_v4_2796_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010890Y box binding protein 1SMESG000008704.1 dd_Smed_v4_347_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007742Protein transport protein Sec61 subunit alphaSMESG000003007.1 dd_Smed_v4_282_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013768SMED30013768SMESG000056915.1 dd_Smed_v4_3761_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014184Tumor necrosis factor alpha-induced protein 8-like proteinSMESG000002914.1 dd_Smed_v4_2386_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016899Transcription factor ETV6SMESG000035130.1 dd_Smed_v4_5087_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED300163635'-nucleotidase proteinSMESG000032250.1 dd_Smed_v4_3474_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000248Ras-related protein Rab-11ASMESG000016036.1 dd_Smed_v4_4964_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009834TNF receptor-associated factorSMESG000047296.1 dd_Smed_v4_2916_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017714Basement membrane-specific heparan sulfate proteoglycan core proteinSMESG000075928.1 dd_8356dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
pharynxSMED30021112Metallophos domain-containing proteinSMESG000036416.1 dd_Smed_v4_4496_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020977SMED30020977SMESG000069851.1 dd_9493dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
pharynxSMED30020977SMED30020977SMESG000069851.1 dd_Smed_v4_9493_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022193SMED30022193SMESG000069851.1 dd_9493dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
pharynxSMED30022193SMED30022193SMESG000069851.1 dd_Smed_v4_9493_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030159SMED30030159SMESG000000606.1 dd_Smed_v4_2072_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031654SMED30031654SMESG000064362.1 dd_Smed_v4_3795_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030068SMED30030068SMESG000051921.1 SMESG000051913.1 dd_Smed_v4_1175_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020714slc7a-4SMESG000017104.1 dd_Smed_v4_4211_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027451PMP-22/EMP/MP20/Claudin tight junctionSMESG000029752.1 dd_Smed_v4_2731_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034635Tubulin tyrosine ligase-like family, member 7SMESG000055128.1 dd_Smed_v4_13600_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029698Caspase-7SMESG000053168.1 dd_Smed_v4_1167_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020617Endophilin-B1SMESG000013676.1 dd_Smed_v4_4055_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029820E3 ubiquitin-protein ligase MYLIPSMESG000074789.1 SMESG000054150.1 dd_Smed_v4_2867_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028417Bardet-Biedl syndrome 1 protein homologSMESG000009880.1 dd_Smed_v4_7298_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008508SMED30008508SMESG000055230.1 SMESG000044487.1 dd_Smed_v4_921_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001251G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000012748.1 dd_Smed_v4_15409_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003902Tetratricopeptide repeat protein 21BSMESG000011579.1 dd_Smed_v4_12056_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019526Membrane protein insertase YidCSMESG000039158.1 dd_Smed_v4_4072_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001754G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000077893.1 dd_Smed_v4_2536_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008623Phospholipase B-likeSMESG000022762.1 dd_Smed_v4_485_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005772vault protein inter alpha trypsin-1SMESG000053671.1 SMESG000053669.1 SMESG000053667.1 SMESG000053664.1 SMESG000053657.1 SMESG000053638.1 dd_Smed_v4_1027_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003044ReticulocalbinSMESG000077405.1 dd_Smed_v4_5905_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008522Fatty acid-binding proteinSMESG000015143.1 dd_Smed_v4_271_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000967DUF3421 domain-containing proteinSMESG000057816.1 dd_Smed_v4_87_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018893Enkurin domain-containing proteinSMESG000081414.1 dd_Smed_v4_12339_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003469FerritinSMESG000068032.1 SMESG000068030.1 SMESG000068027.1 dd_Smed_v4_1033_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016498SMED30016498SMESG000018390.1 dd_Smed_v4_42506_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016950DystrophinSMESG000020523.1 dd_Smed_v4_5325_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000126Centrosomal protein 95SMESG000002923.1 dd_Smed_v4_8515_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004208AAEL003283-PASMESG000004656.1 dd_Smed_v4_8909_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013845Phosphoglucomutase-1SMESG000046578.1 dd_Smed_v4_3503_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009642Neural-cadherinSMESG000045006.1 dd_Smed_v4_9254_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008112Mitogen-activated protein kinaseSMESG000081061.1 dd_Smed_v4_6769_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007279Neurocalcin-deltaSMESG000068889.1 dd_Smed_v4_2568_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006402Progesterone immunomodulatory binding factor 1SMESG000046936.1 dd_Smed_v4_13444_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011483Inositol phosphoceramide mannosyltransferase 3SMESG000054567.1 SMESG000052627.1 dd_Smed_v4_7523_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005053SMED30005053SMESG000072823.1 dd_Smed_v4_11587_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005213Band 4.1-like protein 5SMESG000007133.1 dd_Smed_v4_4114_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002606Cilia-and flagella-associated protein 74SMESG000043377.1 dd_Smed_v4_18628_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007744SMED-SMAD6/7-1SMESG000002697.1 dd_Smed_v4_9186_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004469Splicing factor 3B subunit 1SMESG000025534.1 dd_Smed_v4_2797_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014612SMED30014612SMESG000047053.1 dd_Smed_v4_7303_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000065SMED30000065SMESG000049103.1 dd_Smed_v4_397_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004886Hsp70-Hsp90 organizing protein 1SMESG000033618.1 dd_Smed_v4_14717_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007568NADH-ubiquinone oxidoreductase 75 kDa subunit, mitochondrialSMESG000081864.1 dd_Smed_v4_2402_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001575EF-hand calcium-binding domain-containing protein 6SMESG000009107.1 dd_Smed_v4_7631_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009566SMED30009566SMESG000015985.1 dd_Smed_v4_4240_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001197SMED30001197SMESG000004996.1 dd_Smed_v4_4124_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032324SMED30032324SMESG000079516.1 dd_Smed_v4_8794_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032031HDNR domain-containing proteinSMESG000008952.1 dd_Smed_v4_6279_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031423ATP synthase subunitSMESG000021514.1 dd_Smed_v4_428_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026578Peptidoglycan-recognition proteinSMESG000068025.1 dd_Smed_v4_1523_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034412E3 ubiquitin-protein ligase CBLSMESG000056433.1 dd_Smed_v4_6780_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032910Protein ANKUB1SMESG000033543.1 dd_Smed_v4_9027_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029780EGR-like protein 1SMESG000000960.1 dd_Smed_v4_7731_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035317Phosphoglycerate kinaseSMESG000039090.1 dd_Smed_v4_972_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031389CalnexinSMESG000016275.1 dd_Smed_v4_632_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021731Multidrug resistance protein 1-like proteinSMESG000004996.1 dd_Smed_v4_4124_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022331Translocon-associated protein, gamma subunitSMESG000066628.1 dd_Smed_v4_1265_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021063SMED30021063SMESG000025889.1 dd_Smed_v4_17_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022020Phospholipid scramblaseSMESG000016647.1 dd_Smed_v4_13534_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021516MICOS complex subunit MIC60SMESG000066687.1 dd_Smed_v4_1605_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035707Ras association domain-containing proteinSMESG000029652.1 dd_Smed_v4_5323_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034342HDNR domain-containing proteinSMESG000008952.1 dd_Smed_v4_6279_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032602Neural proliferation differentiation and control protein 1SMESG000012605.1 dd_Smed_v4_6930_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032523SMED30032523SMESG000042167.1 dd_Smed_v4_8527_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035078Inositol phosphoceramide mannosyltransferase 3SMESG000005599.1 dd_Smed_v4_6819_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032051serine/arginine repetitive matrix protein 1 isoform X3SMESG000018884.1 dd_Smed_v4_9404_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034361Glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase 1SMESG000045412.1 dd_Smed_v4_4310_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033750Protein kinaseSMESG000070879.1 SMESG000070880.1 dd_Smed_v4_3195_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029865Reverse transcriptaseSMESG000079542.1 dd_Smed_v4_78314_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032916SMED30032916SMESG000060752.1 dd_Smed_v4_38544_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035360Peptidyl-prolyl cis-trans isomeraseSMESG000006589.1 dd_Smed_v4_133_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028938Protein disulfide-isomerase A6SMESG000023147.1 dd_Smed_v4_250_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035074SMED30035074SMESG000068982.1 dd_Smed_v4_1190_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30024611Terminal nucleotidyltransferase 5CSMESG000079542.1 dd_Smed_v4_78314_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032159Oxysterol-binding proteinSMESG000046022.1 dd_Smed_v4_5423_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028261InnexinSMESG000030970.1 dd_Smed_v4_6798_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023621Transmembrane protein 131SMESG000028913.1 dd_Smed_v4_6371_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030788SMED30030788SMESG000079496.1 dd_Smed_v4_6860_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018829Insulin like growth factor 2 receptorSMESG000023958.1 SMESG000023953.1 dd_Smed_v4_14729_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013424WD repeat domain 60SMESG000040271.1 dd_Smed_v4_10032_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014199MyosinSMESG000047361.1 dd_Smed_v4_4503_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001916IRS-type PTB domain-containing proteinSMESG000027222.1 dd_Smed_v4_9490_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005748HNF4SMESG000014588.1 dd_Smed_v4_1694_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010487Serine/threonine kinaseSMESG000054195.1 SMESG000035615.1 dd_Smed_v4_11271_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000691Eukaryotic initiation factor 4A-IIISMESG000078818.1 dd_Smed_v4_737_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006235slc18a-5SMESG000024277.1 dd_Smed_v4_13278_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008698WSC domain-containing proteinSMESG000074503.1 dd_Smed_v4_21823_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009119Ankyrin-2SMESG000058557.1 dd_Smed_v4_1432_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016941Cytospin-ASMESG000002849.1 dd_Smed_v4_14690_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010188Ankyrin repeat-containing domain proteinSMESG000011193.1 dd_Smed_v4_13251_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000708Dynein heavy chain 5, axonemalSMESG000049144.1 dd_Smed_v4_4569_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018534Muscleblind-like proteinSMESG000067960.1 SMESG000079855.1 SMESG000037170.1 dd_Smed_v4_2838_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000090SMED30000090SMESG000051911.1 dd_Smed_v4_5276_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018656SMED30018656SMESG000056208.1 dd_Smed_v4_16921_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012379SMED30012379SMESG000058557.1 dd_Smed_v4_1432_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005345SMED30005345SMESG000059907.1 dd_Smed_v4_125_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007294slc5a-3SMESG000054276.1 SMESG000054266.1 dd_Smed_v4_14173_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009913Beta-ureidopropionaseSMESG000060425.1 dd_Smed_v4_1584_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016238Kinesin-like proteinSMESG000071604.1 dd_Smed_v4_12639_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012107Zinc finger MYND domain-containing protein 12SMESG000023516.1 dd_Smed_v4_10079_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006971SMED30006971SMESG000030739.1 dd_Smed_v4_14664_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008273SMED30008273SMESG000009199.1 dd_Smed_v4_15003_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010124protein arginine methyltransferase 1-like proteinSMESG000038804.1 dd_Smed_v4_1755_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001347SMED30001347SMESG000053274.1 dd_Smed_v4_6857_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003292SMED30003292SMESG000066258.1 dd_Smed_v4_19593_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015980SPATA1_C domain-containing proteinSMESG000004654.1 dd_Smed_v4_15381_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001793UDP-N-acetylglucosamine--peptide N-acetylglucosaminyltransferase subunitSMESG000002813.1 dd_Smed_v4_2939_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010704SMED30010704 dd_Smed_v4_14348_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017079LRRCC1SMESG000016752.1 dd_Smed_v4_10086_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007534Protein LLP homologSMESG000010838.1 dd_Smed_v4_5414_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015820Dual specificity tyrosine-phosphorylation-regulated kinase 4SMESG000042374.1 dd_Smed_v4_12591_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014469DUF862 domain-containing proteinSMESG000007684.1 dd_Smed_v4_1938_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018297Dynein light chainSMESG000019341.1 dd_Smed_v4_177_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013350HPHLAWLY domain-containing proteinSMESG000034214.1 SMESG000030723.1 SMESG000030612.1 SMESG000030179.1 dd_Smed_v4_10891_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013054Protein kinase domain-containing proteinSMESG000020466.1 dd_Smed_v4_11366_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013080G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000001813.1 dd_Smed_v4_19933_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000212Vacuolar protein sorting-associated protein 26BSMESG000026617.1 dd_Smed_v4_912_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006074SMED30006074SMESG000019341.1 dd_Smed_v4_177_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002988Bestrophin homologSMESG000030927.1 dd_Smed_v4_14800_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008636SMED30008636SMESG000016848.1 dd_Smed_v4_14631_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012889Family S33 non-peptidase homologue (S33 family)SMESG000021236.1 dd_Smed_v4_1414_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018838SMED30018838 dd_Smed_v4_17031_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013241SMED30013241SMESG000007775.1 dd_Smed_v4_137_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016156Alpha-1-antiproteinase 2SMESG000078713.1 SMESG000078711.1 SMESG000078710.1 dd_Smed_v4_1853_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013835SMED30013835SMESG000061090.1 dd_Smed_v4_1300_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014347plexin ASMESG000049328.1 SMESG000006542.1 SMESG000006541.1 dd_Smed_v4_11934_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001296Actin-related protein 2SMESG000019700.1 dd_Smed_v4_623_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003228Dach-1SMESG000005090.1 dd_Smed_v4_5823_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006326piggyBac transposable element-derived protein 4-like dd_Smed_v4_14301_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002414Delta-like proteinSMESG000022173.1 dd_Smed_v4_13823_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007755LIM and SH3 domain protein 1SMESG000002154.1 dd_Smed_v4_1218_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013396perilipin-2 isoform X1SMESG000075481.1 dd_Smed_v4_154_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019487PhosphodiesteraseSMESG000054903.1 SMESG000054901.1 SMESG000054878.1 SMESG000044092.1 dd_Smed_v4_10593_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031277SMED30031277SMESG000040958.1 dd_Smed_v4_22156_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30024986SMED30024986SMESG000069890.1 dd_Smed_v4_16311_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032906SMED30032906SMESG000022399.1 dd_Smed_v4_8295_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026449Kinase-like domain-containing proteinSMESG000074921.1 SMESG000074915.1 dd_Smed_v4_1634_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026131SMED30026131SMESG000027311.1 dd_Smed_v4_1401_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027150Pleckstrin homology and RhoGEF domain containing G5SMESG000052365.1 dd_Smed_v4_14038_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025153SMED30025153SMESG000029777.1 dd_Smed_v4_13914_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035599meisSMESG000006530.1 dd_Smed_v4_15951_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033909UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 4SMESG000066601.1 dd_Smed_v4_12354_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030425Ubiquitin carboxyl-terminal hydrolase 7SMESG000050890.1 dd_Smed_v4_1847_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025883Forkhead associated phosphopeptide binding domain 1SMESG000071072.1 dd_Smed_v4_14350_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027186SMED30027186SMESG000022949.1 dd_Smed_v4_14572_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021916SMED30021916SMESG000001722.1 dd_Smed_v4_19988_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028905Chaperone protein DnaJSMESG000036198.1 dd_Smed_v4_24393_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027542CRAL-TRIO domain-containing proteinSMESG000019717.1 dd_Smed_v4_1619_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025898SMED30025898SMESG000051187.1 dd_Smed_v4_16909_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034034SMED30034034SMESG000059880.1 dd_Smed_v4_20480_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023228SMED30023228SMESG000058720.1 dd_Smed_v4_7931_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022778SMED30022778SMESG000079288.1 SMESG000017831.1 dd_Smed_v4_15746_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021753SMED30021753SMESG000043533.1 dd_Smed_v4_12718_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028626C2H2-type domain-containing proteinSMESG000019280.1 SMESG000019279.1 dd_Smed_v4_10324_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023484Methyltransferase-like protein 17SMESG000058278.1 SMESG000058279.1 dd_Smed_v4_4718_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027672Plac8 onzin related protein 1SMESG000050229.1 SMESG000050221.1 dd_Smed_v4_1219_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035592E3 ubiquitin-protein ligase mind-bombSMESG000031930.1 dd_Smed_v4_1317_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029180Poly(A) polymeraseSMESG000072012.1 dd_Smed_v4_3033_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30024121TetraspaninSMESG000023248.1 dd_Smed_v4_1808_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025527coiled-coil domain-containing protein 105SMESG000077974.1 dd_Smed_v4_14773_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30024629inositol 1,4,5-trisphosphate receptor type 3 isoform X13SMESG000060659.1 SMESG000060658.1 SMESG000060657.1 dd_Smed_v4_13538_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029809UBX domain-containing protein 11-likeSMESG000021828.1 SMESG000021820.1 dd_Smed_v4_14940_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017204SMED30017204SMESG000019898.1 dd_Smed_v4_4953_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017663Fer-1-relatedSMESG000070967.1 dd_Smed_v4_4648_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018802SMED30018802SMESG000030480.1 dd_Smed_v4_2310_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008534cGMP-dependent protein kinaseSMESG000052811.1 dd_Smed_v4_5704_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017369Disabled 2-interacting proteinSMESG000043888.1 dd_Smed_v4_3238_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014640Small heat shock protein p36SMESG000028601.1 dd_Smed_v4_6399_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007072Methylmalonyl-CoA epimeraseSMESG000021684.1 dd_Smed_v4_3348_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019320Stromal interaction molecule 2SMESG000052167.1 SMESG000045892.1 SMESG000045881.1 dd_Smed_v4_7756_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011285DNA polymerase subunit gamma-1SMESG000077612.1 SMESG000050769.1 dd_Smed_v4_5734_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022038slc47a-5SMESG000077134.1 dd_Smed_v4_9513_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026601Dynein heavy chain axonemalSMESG000033128.1 dd_Smed_v4_7062_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035908Serine-rich adhesin for platelets (Staphylococcus aureus surface protein A)SMESG000025158.1 dd_Smed_v4_3220_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031687TNF receptor-associated factorSMESG000014725.1 SMESG000014724.1 SMESG000014706.1 SMESG000014702.1 SMESG000014700.1 dd_Smed_v4_4420_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023859Serine/threonine protein phosphatase 2A regulatory subunitSMESG000026797.1 dd_Smed_v4_6134_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033292DUF3421 domain-containing proteinSMESG000029913.1 dd_Smed_v4_30758_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30024316RibokinaseSMESG000024727.1 dd_Smed_v4_3352_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014923ADP-ribosylation factorSMESG000052763.1 dd_Smed_v4_2013_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010364SMED30010364SMESG000056847.1 SMESG000056843.1 SMESG000056838.1 SMESG000044770.1 SMESG000044762.1 SMESG000007140.1 dd_Smed_v4_1137_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011604Long-chain-fatty-acid--CoA ligaseSMESG000081754.1 dd_Smed_v4_2153_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002374phytanoyl-CoA dioxygenase domain-containing protein 1 homologSMESG000077696.1 SMESG000077694.1 dd_Smed_v4_1292_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013692Small HSP proteinSMESG000059879.1 SMESG000059868.1 SMESG000059853.1 dd_Smed_v4_1039_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015973myosin-11SMESG000064787.1 dd_Smed_v4_13489_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000146GLI-3SMESG000078300.1 dd_Smed_v4_17566_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3000412414-3-3 protein beta/alphaSMESG000055903.1 dd_Smed_v4_138_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008349Histone-lysine N-methyltransferase SETMARSMESG000017253.1 SMESG000015137.1 dd_Smed_v4_1612_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015660SMED30015660SMESG000018225.1 SMESG000017035.1 dd_Smed_v4_1426_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015061G protein regulated inducer of neurite outgrowthSMESG000062691.1 dd_Smed_v4_10294_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014685SMED30014685SMESG000036334.1 dd_Smed_v4_13648_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011453Facilitated trehalose transporter Tret1SMESG000063382.1 dd_Smed_v4_11168_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010461Dynamin-binding proteinSMESG000001434.1 dd_Smed_v4_16150_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020855Guanine nucleotide-binding protein G(o) subunit alphaSMESG000081490.1 dd_Smed_v4_1635_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022574START domain-containing proteinSMESG000046413.1 SMESG000037645.1 dd_Smed_v4_3734_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026112Sorting nexin-27SMESG000081127.1 dd_Smed_v4_2513_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029097Neuropeptide-1SMESG000024498.1 dd_Smed_v4_2575_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
pharynxSMED30031809SMED30031809SMESG000003238.1 dd_Smed_v4_24918_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025076SMED30025076SMESG000010166.1 dd_Smed_v4_2518_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023111RBR-type E3 ubiquitin transferaseSMESG000054560.1 dd_Smed_v4_4845_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026227SMED30026227SMESG000055174.1 SMESG000055172.1 dd_Smed_v4_10518_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021189SMED30021189SMESG000081490.1 dd_Smed_v4_1635_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027354Myeloid leukemia factor 1SMESG000025667.1 dd_Smed_v4_4787_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035681Intraflagellar transport protein 88SMESG000039906.1 dd_Smed_v4_5484_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3002338613 kDa deflagellation-inducible proteinSMESG000050233.1 dd_Smed_v4_3576_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034110Dynein intermediate chain 3, ciliarySMESG000075110.1 dd_Smed_v4_2644_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021505Serpin B6SMESG000032448.1 SMESG000032440.1 SMESG000032430.1 dd_Smed_v4_1741_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029561SMED30029561SMESG000041756.1 dd_Smed_v4_3569_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030724Protein numbSMESG000016237.1 SMESG000033358.1 dd_Smed_v4_507_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020574Dynein heavy chain axonemalSMESG000017294.1 dd_Smed_v4_6790_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021838DUF4709 domain-containing proteinSMESG000029222.1 dd_Smed_v4_13431_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026811DUF3421 domain-containing proteinSMESG000074377.1 dd_Smed_v4_766_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034376slc6a-5SMESG000042091.1 dd_Smed_v4_4290_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032448Expressed conserved proteinSMESG000064362.1 dd_Smed_v4_3795_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014044SMED30014044SMESG000079607.1 SMESG000072955.1 SMESG000049847.1 SMESG000049844.1 SMESG000049832.1 SMESG000049812.1 SMESG000049806.1 SMESG000049805.1 SMESG000049772.1 SMESG000049767.1 SMESG000049756.1 SMESG000049745.1 SMESG000049740.1 SMESG000049739.1 SMESG000049695.1 SMESG000049688.1 SMESG000049683.1 SMESG000049676.1 SMESG000049665.1 SMESG000049663.1 SMESG000049647.1 SMESG000049621.1 SMESG000049614.1 SMESG000049601.1 SMESG000049567.1 SMESG000049548.1 SMESG000040301.1 SMESG000040257.1 SMESG000032755.1 SMESG000032715.1 SMESG000022696.1 SMESG000022691.1 SMESG000022676.1 SMESG000022665.1 SMESG000022640.1 SMESG000022619.1 SMESG000022612.1 dd_Smed_v4_490_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008334SMED30008334SMESG000068935.1 dd_Smed_v4_357_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED300050684-coumarate--CoA ligase 2SMESG000064101.1 dd_Smed_v4_6511_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012966SMED30012966SMESG000079607.1 SMESG000072955.1 SMESG000049847.1 SMESG000049844.1 SMESG000049832.1 SMESG000049812.1 SMESG000049806.1 SMESG000049805.1 SMESG000049772.1 SMESG000049767.1 SMESG000049756.1 SMESG000049745.1 SMESG000049740.1 SMESG000049739.1 SMESG000049695.1 SMESG000049688.1 SMESG000049683.1 SMESG000049676.1 SMESG000049665.1 SMESG000049663.1 SMESG000049647.1 SMESG000049621.1 SMESG000049614.1 SMESG000049601.1 SMESG000049567.1 SMESG000049548.1 SMESG000040301.1 SMESG000040257.1 SMESG000032755.1 SMESG000032715.1 SMESG000022696.1 SMESG000022691.1 SMESG000022676.1 SMESG000022665.1 SMESG000022640.1 SMESG000022619.1 SMESG000022612.1 dd_Smed_v4_490_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033291SMED30033291SMESG000030545.1 dd_Smed_v4_11177_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028420Nucleotide-binding oligomerization domain-containing protein 2SMESG000018415.1 dd_Smed_v4_10594_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30024538Beta-amyloid-like proteinSMESG000025222.1 SMESG000025214.1 SMESG000025213.1 dd_Smed_v4_2561_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022622Centrosomal protein 350SMESG000033533.1 dd_Smed_v4_5967_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031837SMED30031837SMESG000054635.1 SMESG000054602.1 SMESG000052914.1 dd_Smed_v4_2185_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030643Methylmalonic aciduria and homocystinuria type D-like protein, mitochondrialSMESG000030431.1 dd_Smed_v4_2046_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028401InnexinSMESG000056430.1 dd_Smed_v4_734_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035315Endothelin-converting enzyme 1SMESG000025056.1 dd_Smed_v4_8276_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034720Smed-NDK-4SMESG000009032.1 dd_Smed_v4_12674_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033487cilia- and flagella-associated protein 70SMESG000009189.1 dd_Smed_v4_10893_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028496Protein disulfide-isomeraseSMESG000001159.1 dd_Smed_v4_1893_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030662SMED30030662SMESG000024141.1 dd_Smed_v4_2719_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022184Protein transport protein Sec61 subunit betaSMESG000050010.1 SMESG000013437.1 dd_Smed_v4_418_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027561SMED30027561SMESG000072848.1 dd_Smed_v4_11162_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED300219226-phosphogluconate dehydrogenase, decarboxylatingSMESG000005726.1 SMESG000005724.1 SMESG000005722.1 dd_Smed_v4_8829_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030586slc10a-2SMESG000064833.1 dd_Smed_v4_10199_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021222Meiosis specific nuclear structural 1SMESG000036318.1 dd_Smed_v4_4463_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026527Serine palmitoyltransferase 2SMESG000011189.1 dd_Smed_v4_4337_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032797DnaJ homolog subfamily A member 1SMESG000012107.1 dd_Smed_v4_147_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027596RNA-binding protein pno1SMESG000015341.1 dd_Smed_v4_1077_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032105Polypeptide N-acetylgalactosaminyltransferaseSMESG000025206.1 dd_Smed_v4_4615_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033335SMED30033335SMESG000002226.1 dd_Smed_v4_10738_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30024160SMED30024160SMESG000046560.1 SMESG000010944.1 dd_Smed_v4_142_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032624cilia- and flagella-associated protein 53SMESG000004919.1 dd_Smed_v4_3219_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032624cilia- and flagella-associated protein 53SMESG000004919.1 dd_3219dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult fluorescence in situ hybridization evidence
pharynxSMED30035939Actinin alpha 4SMESG000074430.1 dd_Smed_v4_7964_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30031722ANK_REP_REGION domain-containing proteinSMESG000022931.1 dd_Smed_v4_11187_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025171SMED30025171SMESG000014769.1 dd_Smed_v4_1952_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30024236InnexinSMESG000056430.1 dd_Smed_v4_734_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022425PeroxiredoxinSMESG000002993.1 dd_Smed_v4_1290_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027540Cathepsin FSMESG000005279.1 dd_Smed_v4_456_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005280SMED30005280SMESG000077104.1 dd_Smed_v4_4063_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012229Cilia- and flagella-associated protein 20SMESG000081781.1 dd_Smed_v4_3751_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010123Sodium/potassium-transporting ATPase subunit beta-1SMESG000064593.1 dd_Smed_v4_2210_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004178SMED30004178SMESG000025475.1 dd_Smed_v4_2550_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000831Golgi-associated plant pathogenesis protein 1SMESG000036937.1 dd_Smed_v4_2081_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010702Serine/threonine-protein kinase B-rafSMESG000064517.1 dd_Smed_v4_13233_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003716Glucose-6-phosphate isomeraseSMESG000067583.1 dd_Smed_v4_1398_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013139SMED30013139SMESG000059266.1 SMESG000059254.1 dd_Smed_v4_301_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013300Mitochondrial ATP synthase subunit 9SMESG000078181.1 dd_Smed_v4_23_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015587Dual specificity protein phosphatase 14SMESG000037868.1 dd_Smed_v4_7558_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005629Protein kinase domain-containing proteinSMESG000078509.1 SMESG000078507.1 dd_Smed_v4_4259_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016810ER lumen protein-retaining receptorSMESG000073757.1 dd_Smed_v4_3954_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009735Bardet-Biedl syndrome 5 protein homologSMESG000052420.1 dd_Smed_v4_8523_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001113FERM domain-containing proteinSMESG000048801.1 dd_Smed_v4_5600_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007024G_PROTEIN_RECEP_F1_2 domain-containing proteinSMESG000078415.1 dd_Smed_v4_24316_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004395DENN domain-containing protein 11SMESG000068092.1 dd_Smed_v4_8805_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30016302NADH-ubiquinone oxidoreductase 75 kDa subunit, mitochondrialSMESG000081864.1 dd_Smed_v4_2402_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007246SMED30007246SMESG000045656.1 dd_Smed_v4_797_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014791adenylate kinase 8-likeSMESG000027219.1 dd_Smed_v4_7317_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000732Leucine-rich repeat-containing protein 45SMESG000060194.1 dd_Smed_v4_9495_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006368Piezo-type mechanosensitive ion channel componentSMESG000080326.1 SMESG000080325.1 dd_Smed_v4_18354_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000305CDGSH iron-sulfur domain-containing proteinSMESG000056141.1 dd_Smed_v4_2098_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002176Sterile alpha motif domain containing 4ASMESG000038073.1 dd_Smed_v4_6923_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017430Protein disulfide-isomeraseSMESG000023147.1 dd_Smed_v4_250_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009282EF-hand calcium binding domain 2SMESG000049879.1 SMESG000003119.1 dd_Smed_v4_11976_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023155Thyroid adenoma-associated-like proteinSMESG000023235.1 dd_Smed_v4_12325_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022035Dihydroorotate dehydrogenase (Quinone), mitochondrialSMESG000065729.1 dd_Smed_v4_4266_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023266cilia- and flagella-associated protein 43SMESG000000491.1 dd_Smed_v4_10271_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034141Leucine-rich repeat-containing protein 27SMESG000073140.1 dd_Smed_v4_13740_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010853slc25a-21SMESG000073400.1 dd_Smed_v4_13134_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013041SMED30013041SMESG000049878.1 dd_Smed_v4_4914_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019452Ceramide glucosyltransferaseSMESG000070132.1 dd_Smed_v4_7543_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011111coiled-coil domain-containing protein 170SMESG000051384.1 dd_Smed_v4_7992_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011075SMED30011075SMESG000027616.1 dd_Smed_v4_6146_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007704ActinSMESG000051672.1 SMESG000051670.1 dd_Smed_v4_3_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006437HTH CENPB-type domain-containing proteinSMESG000078713.1 SMESG000060505.1 SMESG000055485.1 SMESG000051367.1 SMESG000073216.1 SMESG000045326.1 SMESG000032032.1 SMESG000021912.1 SMESG000017091.1 dd_Smed_v4_12660_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015887DUF4550 domain-containing proteinSMESG000000883.1 dd_Smed_v4_10058_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008902inositol phosphoceramide mannosyltransferase 2-likeSMESG000059812.1 SMESG000045480.1 SMESG000045292.1 SMESG000045267.1 SMESG000037990.1 dd_Smed_v4_2174_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012622Intraflagellar transport 43SMESG000067883.1 dd_Smed_v4_5237_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001929F-box domain-containing proteinSMESG000077869.1 dd_Smed_v4_14890_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015825inositol phosphoceramide mannosyltransferase 2-likeSMESG000059812.1 SMESG000045480.1 SMESG000045292.1 SMESG000045267.1 SMESG000037990.1 dd_Smed_v4_2174_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3000905260S ribosomal protein L18SMESG000017166.1 dd_Smed_v4_128_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000977PhosphomannomutaseSMESG000079671.1 SMESG000079384.1 dd_Smed_v4_1964_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3000344260S ribosomal protein L23SMESG000023040.1 dd_Smed_v4_242_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007143Nucleolar GTP-binding protein 2SMESG000026847.1 dd_Smed_v4_1134_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30003249ProhibitinSMESG000038397.1 dd_Smed_v4_1038_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017114Elongation factor 1-gammaSMESG000018714.1 dd_Smed_v4_308_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006736colorectal mutant cancer proteinSMESG000002794.1 dd_Smed_v4_5396_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018834SMED30018834SMESG000010762.1 dd_Smed_v4_3061_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000566Ropporin-1-like proteinSMESG000079804.1 dd_Smed_v4_4888_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007517IQ domain-containing protein E-likeSMESG000013899.1 SMESG000013896.1 dd_Smed_v4_7345_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3001361360S ribosomal protein L26SMESG000066644.1 dd_Smed_v4_235_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011335Dynein heavy chain 10, axonemalSMESG000051829.1 dd_Smed_v4_12797_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011335Dynein heavy chain 10, axonemalSMESG000051829.1 dd_Smed_v4_5169_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017976HTH CENPB-type domain-containing proteinSMESG000078713.1 SMESG000060505.1 SMESG000055485.1 SMESG000051367.1 SMESG000073216.1 SMESG000045326.1 SMESG000032032.1 SMESG000021912.1 SMESG000017091.1 dd_Smed_v4_12660_2_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009611Str_synth domain-containing proteinSMESG000052600.1 dd_Smed_v4_1480_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007124EF-hand domain-containing proteinSMESG000062171.1 dd_Smed_v4_3568_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30006256SMED30006256SMESG000034101.1 dd_Smed_v4_9313_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000512cilia- and flagella-associated protein 61SMESG000059955.1 dd_Smed_v4_4908_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002139Vacuole membrane protein 1SMESG000034612.1 dd_Smed_v4_1156_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014550Intraflagellar transport protein 43SMESG000067883.1 dd_Smed_v4_5237_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3000898760S ribosomal protein L13-like proteinSMESG000036992.1 dd_Smed_v4_145_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005537TIGR00341 family proteinSMESG000062412.1 dd_Smed_v4_9934_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014131RPTOR independent companion of MTOR, complex 2 aSMESG000024212.1 SMESG000033570.1 dd_Smed_v4_9324_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30008671PhosphodiesteraseSMESG000021196.1 dd_Smed_v4_8589_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001056AcetylCoA_hyd_C domain-containing proteinSMESG000063866.1 dd_Smed_v4_1775_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005449SMED30005449SMESG000014251.1 dd_Smed_v4_9793_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004363cAMP-dependent protein kinase catalytic subunit alphaSMESG000063155.1 dd_Smed_v4_5162_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002133PolyubiquitinSMESG000039444.1 SMESG000014081.1 dd_Smed_v4_34_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007804Immunoglobulin-like domain-containing proteinSMESG000010356.1 dd_Smed_v4_1827_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30005428CIP29SMESG000073815.1 dd_Smed_v4_2297_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013787SMED30013787SMESG000017258.1 dd_Smed_v4_5255_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30010500Fibronectin type III domain proteinSMESG000033545.1 dd_Smed_v4_15017_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001495Ribosomal protein L15SMESG000056940.1 dd_Smed_v4_193_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000817IPPc domain-containing proteinSMESG000026603.1 dd_Smed_v4_3627_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30014233SMED30014233SMESG000045992.1 dd_Smed_v4_6974_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007498Ribosomal protein L19SMESG000057653.1 dd_Smed_v4_228_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30000289SMED30000289SMESG000076644.1 SMESG000076643.1 dd_Smed_v4_227_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3001360660S ribosomal protein L7SMESG000022296.1 dd_Smed_v4_276_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013315SMED30013315SMESG000022425.1 dd_Smed_v4_3843_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3001990360S ribosomal protein L13aSMESG000041483.1 dd_Smed_v4_287_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009873SMED30009873SMESG000016812.1 SMESG000016788.1 SMESG000016785.1 SMESG000016784.1 SMESG000016778.1 SMESG000016777.1 SMESG000016774.1 SMESG000016773.1 SMESG000016772.1 dd_Smed_v4_422_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3000270360S ribosomal protein L23aSMESG000074545.1 dd_Smed_v4_281_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011561SMED30011561SMESG000066396.1 dd_Smed_v4_7890_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017620SMED30017620SMESG000068887.1 dd_Smed_v4_31113_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017807SMED30017807SMESG000041639.1 dd_Smed_v4_9130_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019717inositol phosphoceramide mannosyltransferase 2-likeSMESG000059812.1 SMESG000045480.1 SMESG000045292.1 SMESG000045267.1 SMESG000037990.1 dd_Smed_v4_2174_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30019364Si:ch211-193l2.10SMESG000062713.1 dd_Smed_v4_3203_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026656Pre-mRNA-splicing factor CWC21SMESG000056252.1 dd_Smed_v4_4340_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022501Fatty acid-binding protein, heartSMESG000029500.1 dd_Smed_v4_599_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED300298901-phosphatidylinositol 4,5-bisphosphate phosphodiesteraseSMESG000024212.1 SMESG000033570.1 dd_Smed_v4_9324_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035468DNAHb-1SMESG000072114.1 SMESG000072113.1 SMESG000072112.1 dd_Smed_v4_3670_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025755DNA-binding protein RFX5SMESG000072002.1 dd_Smed_v4_6108_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3002518133 kDa inner dynein arm light chain, axonemalSMESG000067639.1 SMESG000001266.1 dd_Smed_v4_4453_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30030435Serine/arginine-rich splicing factorSMESG000015564.1 dd_Smed_v4_3431_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020334Leucine-rich repeat-containing protein 57SMESG000037709.1 dd_Smed_v4_17742_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022560Ribosomal_L28e domain-containing proteinSMESG000026745.1 dd_Smed_v4_221_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025664TSNAXIP1_N domain-containing proteinSMESG000060720.1 dd_Smed_v4_13434_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032005SIAH-type domain-containing proteinSMESG000042443.1 dd_Smed_v4_13836_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027661PhosphodiesteraseSMESG000044149.1 dd_Smed_v4_35318_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027661PhosphodiesteraseSMESG000044149.1 dd_Smed_v4_15950_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026298Protein kinase domain-containing proteinSMESG000014613.1 dd_Smed_v4_4447_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022246Coiled-coil domain-containing protein 77SMESG000045184.1 dd_Smed_v4_4812_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3003108940S ribosomal protein S12SMESG000052688.1 dd_Smed_v4_268_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034546Protein transport protein Sec61 subunit gammaSMESG000062123.1 SMESG000063809.1 dd_Smed_v4_429_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30028023adenylate kinase 7SMESG000075900.1 dd_Smed_v4_7959_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029763histone H1SMESG000024348.1 SMESG000010800.1 dd_Smed_v4_601_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029491Outer dense fiber of sperm tails 2SMESG000016357.1 dd_Smed_v4_3609_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED3002930240S ribosomal protein S16SMESG000018349.1 SMESG000018333.1 dd_Smed_v4_170_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026136Nad dependent epimerase dehydrataseSMESG000035068.1 dd_Smed_v4_3452_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035831SMED30035831SMESG000046586.1 dd_Smed_v4_2725_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30035260SMED30035260SMESG000035564.1 dd_Smed_v4_12208_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032961Voltage-dependent calcium channel gamma-5 subunitSMESG000040150.1 dd_Smed_v4_22484_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30032510TIGR00341 family proteinSMESG000062412.1 dd_Smed_v4_9934_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30034296Protein kinase domain-containing proteinSMESG000017258.1 dd_Smed_v4_5255_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026887Myosin light chain proteinSMESG000075512.1 dd_Smed_v4_223_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022178SMED30022178SMESG000057910.1 dd_Smed_v4_1090_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033644titin homologSMESG000002539.1 dd_Smed_v4_8111_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021154Calmodulin, putativeSMESG000040933.1 SMESG000040932.1 dd_Smed_v4_603_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30020166Coiled-coil domain-containing proteinSMESG000005080.1 dd_Smed_v4_9816_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30023471Myosin, light chain kinase aSMESG000081274.1 dd_Smed_v4_3482_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30033399Ras-related protein Rab-11ASMESG000023556.1 dd_Smed_v4_6025_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30024951SMED30024951SMESG000004925.1 dd_Smed_v4_8053_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30026808EF-hand domain-containing proteinSMESG000081370.1 dd_Smed_v4_446_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30025223Neuropeptide Y prohormone-2SMESG000050247.1 SMESG000050248.1 dd_Smed_v4_10191_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013021SMED30013021SMESG000025420.1 dd_Smed_v4_2995_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013021SMED30013021SMESG000067960.1 SMESG000079855.1 SMESG000037170.1 dd_Smed_v4_2838_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30017032slc2a-11SMESG000025420.1 dd_Smed_v4_2995_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011943Fibronectin type III and ankyrin repeat domains 1SMESG000033969.1 dd_Smed_v4_7571_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004214SMED30004214SMESG000055805.1 dd_Smed_v4_857_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30001032Kinesin-like proteinSMESG000024428.1 dd_Smed_v4_9952_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30012419Non-specific serine/threonine protein kinaseSMESG000069962.1 SMESG000069953.1 SMESG000069952.1 dd_Smed_v4_3244_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30018550CEP78SMESG000064712.1 dd_Smed_v4_9671_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30013563Serine/threonine-protein kinase 10SMESG000064983.1 dd_Smed_v4_5720_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011060SMED30011060SMESG000018625.1 dd_Smed_v4_7135_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015945Centrin-1SMESG000052182.1 SMESG000015458.1 dd_Smed_v4_3644_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007543nesprin-1-likeSMESG000016747.1 SMESG000016745.1 dd_Smed_v4_5365_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30011294Protein kinase domain-containing proteinSMESG000041899.1 SMESG000031064.1 dd_Smed_v4_8347_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30002842SMED30002842SMESG000056914.1 dd_Smed_v4_8301_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30007939Lysophosphatidylglycerol acyltransferase 1SMESG000066297.1 dd_Smed_v4_7263_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30009156WH2 domain-containing proteinSMESG000024265.1 dd_Smed_v4_3207_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30015588SMED30015588SMESG000009089.1 dd_Smed_v4_5692_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30004315Bestrophin homologSMESG000070057.1 dd_Smed_v4_8073_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30027687RRM domain-containing proteinSMESG000038824.1 dd_Smed_v4_3002_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30029806CIA30 domain-containing proteinSMESG000077270.1 dd_Smed_v4_8887_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30021589Agrin, putativeSMESG000028865.1 SMESG000028859.1 dd_Smed_v4_3649_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
pharynxSMED30022383TNF receptor-associated factor