pharynx
▻ Planarian Anatomy Ontology Class Overview
▻ Embryonic Molecular Fate Mapping
▻ Description
▻ Figures
▻ In Situ Hybridization Data
▻ Sequences
▻ References
▻ PAGE: Planarian Anatomy Gene Expression
Planarian Anatomy Ontology Class Overview
For more information about the ontology visit PLANA Overview
NAME:
pharynx
DEFINITON:
A plicate and protrusible organ that is the sole point of entry and exit for the Triclad gut. It contains epithelial, muscular, secretory and neuronal cell types.
TERM DEFINITION CITATIONS:
OCLC:16809160
TERM CITATIONS:
Expand publication list
- PMID:16033796
- OCLC:16809160
- PMID:18063757
- PMID:27612384
- PMID:19211673
- PMID:24737865
- PMID:22451003
- PMID:16311336
- PMID:21458439
- PMID:24238224
- PMID:29906446
- PMID:28171748
- PMID:26114597
- PMID:17251262
- PMID:25725068
- PMID:21852957
- PMID:24063805
- PMID:27240733
- PMID:20215344
- PMID:17390146
- PMID:17905225
- PMID:27612382
- PMID:20707997
- PMID:30399335
- PMID:20223763
- PMID:22884275
- PMID:27063937
- PMID:21937596
- https://doi.org/10.1101/279364
- PMID:30471994
- PMID:30237141
- PMID:22125640
- PMID:21747960
- PMID:19174194
- PMID:23297191
- PMID:27122174
- PMID:22339734
- PMID:23123964
- PMID:24922054
- PMID:16890156
- PMID:28126842
- PMID:28287248
- PMID:26062938
- PMID:29291981
- PMID:19852954
- PMID:28245923
- PMID:23250205
- PMID:28495872
- PMID:30729158
- PMID:23405188
- PMID:18786419
- PMID:23079596
- PMID:18063755
- PMID:20967238
- PMID:27163480
- PMID:30282036
- PMID:21356107
- PMID:25017721
- PMID:26525673
- PMID:17942485
- PMID:21295483
- PMID:21806978
- PMID:28686611
- PMID:27034770
- PMID:30383829
- PMID:27501047
- PMID:20422023
- PMID:24704339
- PMID:21179478
- PMID:22411224
- PMID:25356635
- PMID:22371573
- PMID:23318635
- PMID:21282632
- PMID:15866156
- PMID:18456843
- PMID:28072387
- PMID:23629965
- PMID:23954785
- PMID:28434803
- PMID:23652002
- PMID:24173799
- PMID:27074666
- PMID:24131630
- PMID:20511647
- PMID:20865784
- PMID:30194301
- PMID:21894189
- ISBN:9780070316607
- PMID:29674431
- PMID:24120894
- PMID:27441386
- PMID:28461239
- PMID:24040508
- PMID:27150006
- PMID:25558068
- PMID:18287199
- PMID:19048075
- PMID:19766622
- PMID:22543868
- PMID:19247960
- PMID:26457503
- PMID:21664348
- PMID:30962434
- PMID:28292427
- PMID:28893948
- PMID:22439894
- PMID:18202849
- PMID:19933103
- PMID:26711341
- PMID:21828097
- PMID:27551436
- PMID:20599901
- PMID:22385657
- PMID:30485821
- PMID:28807897
- PMID:27654173
- PMID:25956527
- PMID:26459857
- PMID:17670787
- PMID:25254346
- PMID:17376870
TERM ID:
PLANA:0000016
ABOUT THIS TERM:
pharynx
↳is a material entity and organ ↳contained in posterior region of the whole animal and parapharyngeal region
↳existence overlaps Stage 6, Stage 5, juvenile stage, asexual adult, adult hermaphrodite, Stage 8 and Stage 7
↳existence starts during or after Stage 5
↳part of digestive system
→ pharynx progenitor cell and pharynx primordium develops into pharynx
→ pharynx lumen luminal space of pharynx
Expand to see terms that part of pharynx
BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):
Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.
EXPLORE ONTOLOGY GRAPH:
Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.
Embryonic Molecular Fate Mapping
All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource
DESCRIPTION:
foxA1, a pioneer transcription factor required for pharynx maintenance and regeneration during adulthood (Adler et al., 2014; Scimone et al., 2014), may similarly be required for construction of the definitive pharynx during embryogenesis. Development of the definitive pharynx, the single opening of the Smed digestive tract, commenced during S4-S5 with the onset of foxA1 expression in parenchymal cells, many of which were located in the oral hemisphere (Figure 1 – figure supplement 14A). The distribution of foxA1+ cells remained concentrated in and around the developing definitive pharynx rudiment during S6-S8, a pattern reminiscent of that observed in S. polychroa embryos (Martín-Durán et al., 2010), as well as in intact and regenerating Smed asexual adults (Adler et al., 2014; Scimone et al., 2014). The definitive pharynx develops beneath the degenerating temporary embryonic pharynx, and marks the ventral side of the embryos during S6 and thereafter (Martín-Durán and Romero, 2011). foxA1 upregulation during S5-S8 was statistically significant, albeit the adjusted p-values were above the thresholds set for inclusion in the enriched transcript lists presented in Figure 1 – source data 5, Figure 1 – source data 6, Figure 1 – source data 7, Figure 1 – source data 8. meis, a transcription factor coexpressed in foxA1+ neoblasts and expressed within the regenerating pharynx (Scimone et al., 2014), was among the S5 enriched transcripts (Figure 1 – source data 5); its expression trend was similar to foxA1 during embryogenesis (Figure 1 – figure supplement 14B). Two markers exhibiting pharynx-restricted expression in adults, laminin and npp-1 (Adler et al., 2014), were upregulated during S6-S8, after development of the definitive pharynx rudiment was evident (Figure 1 – figure supplement 14B).
FIGURES:
Figure 1 – figure supplement 14: Molecular markers for the definitive pharynx
A: WISH developmental time course using foxA1 riboprobes (blue), S3-S8. foxA1 expression was consistently detected in the embryonic pharynx lumen during S3-S5 (black arrowheads). Anterior: top (S6-S8). Black arrowheads: embryonic pharynx. Red arrowheads: definitive pharynx. O: oral hemisphere. A: aboral hemisphere. D: dorsal. V: ventral. Scale bars: 100 µm.
B: Average RPKM values per embryo for the definitive pharynx markers foxA1, meis, laminin, npp-1 during embryogenesis (Adler et al., 2014; Scimone et al., 2014), Y (yolk), Stage (S) S2-S8.
IN SITU HYBRIDIZATION DATA:
Smed ID Accession Name Alias Expressed during stage(s) Tissue/Pattern Images
SMED30027428 AFJ24799.1 forkhead box A-1 foxA1 Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8 embryonic digestive system, digestive system, pharynx, pharynx progenitor cell, embryonic pharynx 
Click to see image symbols and abbreviations
Abbreviation or symbol Definition
O oral hemisphere
A aboral hemisphere
D dorsal
V ventral
L lateral
black arrowhead embryonic pharynx
red arrowhead definitive pharynx
black arrows primitive gut
yellow arrows primitive ectoderm cells
cyan arrows brain
cyan arrowheads nerve cords
blue arrowheads eye progenitors (trail cells)
purple arrowheads eyes
scale bar 100 µm
SEQUENCES:
smed_20140614 transcript sequences for genes validated by in situ hybridization (above).
>SMED30027428 ID=SMED30027428|Name=forkhead box A-1|organism=Schmidtea mediterranea sexual|type=transcript|length=2149bp
ATCACTTGGTGCTGCTTTTTGCCCCGATAAATCTCTCGGTGCTCCAAAATTTGTGTAAGCGAGCAAAAGATGATTGGGCA
ATTTCTAGCACGTCATTCGGCAACGATGTTTACAAGTTTCTCTGATTGGATGATAAAGTAGAAACTTTCCGAAAATGAAA
CTTCTCCGAACATGCGCATACCGACTGAAAATTAACTCTAAGCCAGCCAATGGAATTGAAGCAAAATTCAAGAGAATATT
AATTGACTTCGCGAATGAACTCAAATTTTCTATTGGCGTATTGTGTGTGCCTCATTGTGAGTGGTTGCGATCGCATCTCA
AATTATTTACACACAAAAAAATAACGCACACAGACATTGAATAGATATATTTGATCAAGTCAATATCACAATGTCAATAT
TAGCTTTTTCTGAAGAAAGAAGACGAACTAGAAGAAAAACAACAACGAAATAGATTCGATAAGGCTACTGAGCGATTTTC
ATAATCTAAATATTATTTTATTATTGATACGGACAAAAATTGGTCTTTTACCAAGTACTACTAGATTGTTGATAAAGAGA
GGTTATTTAGATGCTTGGAAAAAATCCTTATGAAACTGCAATGAGCAACGTGTATTCTCTACCTCCGGGAGGTTCTATTT
ACAATATGAACCCGATGAGTATATCATCAGCTGGCTACAACTCTCAACAAGTATCAACACTATCGTTGAACTTGACCGGA
ATCGGACCTCATTCATTAAGCCCAATGAGTGCAAGCATGTCGGGTATAGCTGCAATGGCCGGTGGAATGAGACAAGGTCT
TGAGTTGGGTCTTGGTAGAAGTGATAGTCCAAGAGATAAAAATTCAATTTCCAATAACAACCGACCATATCAAAGAAGTT
ACACTCATGCCAAGCCTCCATACAGTTATATAAGTTTGATAACAATGGCGATTCAAAATTCTCCAGTAAACATGTGCACT
CTATCGGAGATCTATCAATTCATTATGGATCATTTTCCATACTATCGTCAAAATCAACAGCGATGGCAGAATTCGATTCG
ACATTCTTTGTCCTTCAACGATTGCTTTGTTAAGGTTAGTAGAAGCCCAGAAAAACCAGGTAAAGGCTCATATTGGACCT
TGCATCCTCAATCAGGTAACATGTTTGAAAACGGTTGTTATCTCAGAAGACAAAAGCGATTCAAAGATCCACACAGAGAA
ATCGGCAGACAGAGTCAAAGAGCTGCCACTGGTCCTGGATCAAATGTCACAGAAAACAATCACGACAACGCATCGCAAGA
AGCTAGTGATAACGCAGAAAGTGATACGAAACCCAACATCAAGCAACTTGATTTATCAAGCGATCTCTTAACTAATCAAG
GTCATAATATTAAAAATACTAATCCAACTTCTGTTAGTCAGAGTTGTTCGATGTTTCATCGGAAAAAGGAAAACTGCTCA
CCAGTAGAAATGAAATTGAATAACCAAAACCAACAATCAAACCAGCAAGAACATCCACAAATCCATTACAATCCCAATCA
GCAATTCTACTCAAATCAGCAAAACATTTTCCAACAAAGTTCTCTTGATCATTACAGTCTATTAGCATCCGATGATCCTC
TTGGTCAAGGTATGCACTTGCCACCAGGTGCAAATAGTGTTTTCGGACTTTACGGGGCACATAACTTACCAAACGATGAT
CAAATTTCAGTGTCATTACCATCGATATCCTTATCCGGACATCCGTATGACAATTTATCAACAGCAATGGCATATCAATA
TGAAGCATCTCAACACAATTCTTCATTACTAACGACAAGTAATCCGTTCTCAATAGATCGTTTGATGCATCCAAGACTAG
TCGCTGCAGCGATGGGGGTCAGTCCCCATGATACTCTATACGCAGGAGCTACCGGCCCATCAGTTGATCTAGAACACATG
AAATACTACTCAAACTACAACAATGTGCCTCCTTATTCCTCTGCAATGTCTGACTACTACAAATATGTACAAAATCCTCA
GCCGGGCAACAGCGACATGAGTCTTTGAATTGAGTCCATTGAAGTCTACGGCAGTTTCCTCGAAATTTCACATTCAACCA
GATGTTTATCGCCTAATATAAAGCTGTGTTTTTTTATTTATTTACAATTAAATCTTTGTACAAGAGATC
ADDITIONAL REFERENCES:
Adler, C.E., Seidel, C.W., McKinney, S.A., and Sánchez Alvarado, A. (2014). Selective amputation of the pharynx identifies a FoxA-dependent regeneration program in planaria. Elife 3, e02238.
Martín-Durán, J.M., Amaya, E., and Romero, R. (2010). Germ layer specification and axial patterning in the embryonic development of the freshwater planarian Schmidtea polychroa. Dev Biol 340, 145-158.
Martín-Durán, J.M., and Romero, R. (2011). Evolutionary implications of morphogenesis and molecular patterning of the blind gut in the planarian Schmidtea polychroa. Dev Biol 352, 164-176.
Scimone, M.L., Kravarik, K.M., Lapan, S.W., and Reddien, P.W. (2014). Neoblast specialization in regeneration of the planarian Schmidtea mediterranea. Stem Cell Reports 3, 339-352.
PAGE: Planarian Anatomy Gene Expression
These transcripts were reported as being expressed in pharynx. Click this link to learn more about PAGE.
PAGE Curations: 3229
PLANA Term Reference Transcript Description Gene Models Published Transcript Transcriptome Publication Specimen Lifecycle Evidence pharynx SMED30028347 Engulfment and cell motility 3 SMESG000013936.1 Contig1935 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30028347 Engulfment and cell motility 3 SMESG000039535.1 Contig1935 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30020100 SMED30020100 SMESG000013936.1 Contig1935 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30020100 SMED30020100 SMESG000013936.1 Contig1935 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30020100 SMED30020100 SMESG000039535.1 Contig1935 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30020100 SMED30020100 SMESG000039535.1 Contig1935 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30021127 SMED30021127 SMESG000037626.1 Contig1315 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30021127 SMED30021127 SMESG000037626.1 Contig1315 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30021127 SMED30021127 SMESG000048042.1 Contig1315 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30021127 SMED30021127 SMESG000048042.1 Contig1315 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30008091 Serine/threonine-protein kinase PLK SMESG000012131.1 SMESG000012127.1 Contig809 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30008091 Serine/threonine-protein kinase PLK SMESG000027686.1 Contig2364 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30008091 Serine/threonine-protein kinase PLK SMESG000012131.1 SMESG000012127.1 Contig2364 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30003053 1-acyl-sn-glycerol-3-phosphate acyltransferase delta SMESG000081135.1 Contig3433 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30001630 Ras-related C3 botulinum toxin substrate 1 SMESG000005612.1 Contig594 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30001630 Ras-related C3 botulinum toxin substrate 1 SMESG000005612.1 Contig594 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30001630 Ras-related C3 botulinum toxin substrate 1 SMESG000011575.1 Contig594 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30001630 Ras-related C3 botulinum toxin substrate 1 SMESG000011575.1 Contig594 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30019325 Myosin regulatory light chain SMESG000068156.1 SMESG000064685.1 SMESG000043474.1 SMESG000010609.1 SMESG000076470.1 SMESG000073857.1 SMESG000062429.1 SMESG000058575.1 SMESG000053533.1 SMESG000020635.1 SMESG000015751.1 SMESG000005260.1 Contig246 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30019325 Myosin regulatory light chain SMESG000000175.1 Contig246 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30019325 Myosin regulatory light chain SMESG000000175.1 Contig2068 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30021698 14-3-3 protein epsilon SMESG000047644.1 Contig5316 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30022398 C2H2-type domain-containing protein SMESG000032119.1 Contig3970 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30023739 SMED30023739 SMESG000058452.1 Contig1190 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30023739 SMED30023739 SMESG000057519.1 Contig1190 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30013050 SMED30013050 SMESG000000175.1 Contig2068 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30009175 Transcription elongation factor spt6 SMESG000059332.1 Contig5500 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30009175 Transcription elongation factor spt6 SMESG000059332.1 Contig5500 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30009175 Transcription elongation factor spt6 SMESG000024114.1 Contig5500 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30009175 Transcription elongation factor spt6 SMESG000024114.1 Contig5500 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30034573 Tubulin beta chain SMESG000047291.1 SMESG000044907.1 SMESG000044888.1 SMESG000035804.1 SMESG000035755.1 SMESG000047284.1 Contig5821 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30030227 flotillin-2 SMESG000059332.1 Contig5500 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30030227 flotillin-2 SMESG000024114.1 Contig5500 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30032776 SMED30032776 SMESG000063221.1 Contig1068 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30022483 CGG triplet repeat-binding protein 1 SMESG000020470.1 Contig1680 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30022483 CGG triplet repeat-binding protein 1 SMESG000020470.1 Contig1680 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30027682 NAD(P)H-dependent FMN reductase SMESG000060640.1 Contig3408 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30027682 NAD(P)H-dependent FMN reductase SMESG000060640.1 Contig3408 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30027682 NAD(P)H-dependent FMN reductase SMESG000074871.1 Contig3408 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30027682 NAD(P)H-dependent FMN reductase SMESG000074871.1 Contig3408 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30031780 Ras-related protein Rab-5A SMESG000065500.1 Contig1027 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30033807 SMED30033807 SMESG000076385.1 SMESG000076375.1 SMESG000076363.1 SMESG000076223.1 SMESG000076482.1 SMESG000076470.1 SMESG000076410.1 SMESG000076358.1 Contig1645 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30030757 SMED30030757 SMESG000016990.1 Contig1765 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30020811 SMED30020811 SMESG000005612.1 Contig594 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30020811 SMED30020811 SMESG000005612.1 Contig594 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30020811 SMED30020811 SMESG000011575.1 Contig594 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30020811 SMED30020811 SMESG000011575.1 Contig594 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30015409 cAMP-responsive element modulator SMESG000016695.1 Contig4585 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30015409 cAMP-responsive element modulator SMESG000033655.1 Contig4585 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30009357 ubiquilin-1 SMESG000045386.1 Contig2009 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30015310 DUF3421 domain-containing protein SMESG000046710.1 SMESG000046697.1 PL020001000E05 ncbi_smed_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30015706 Twinfilin-1 SMESG000041071.1 Contig2453 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30012677 Coiled-coil domain-containing protein 51 SMESG000058452.1 Contig1190 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30012677 Coiled-coil domain-containing protein 51 SMESG000058452.1 Contig1190 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30012677 Coiled-coil domain-containing protein 51 SMESG000057519.1 Contig1190 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30012677 Coiled-coil domain-containing protein 51 SMESG000057519.1 Contig1190 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30002822 RING-type domain-containing protein SMESG000076385.1 SMESG000076375.1 SMESG000076363.1 SMESG000076223.1 SMESG000076482.1 SMESG000076470.1 SMESG000076410.1 SMESG000076358.1 Contig1645 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30007555 GCR098 SMESG000016695.1 Contig4585 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30007555 GCR098 SMESG000016695.1 Contig4585 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30007555 GCR098 SMESG000033655.1 Contig4585 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30007555 GCR098 SMESG000033655.1 Contig4585 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30007716 Ankyrin repeat domain 28b SMESG000060640.1 Contig3408 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30007716 Ankyrin repeat domain 28b SMESG000074871.1 Contig3408 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30001294 Phosphatidylinositol-binding clathrin assembly protein SMESG000043423.1 Contig1792 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30001294 Phosphatidylinositol-binding clathrin assembly protein SMESG000072544.1 Contig1792 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30004606 Cytochrome P450 2K1-like protein SMESG000020470.1 Contig1680 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30011213 Osteoclast-stimulating factor 1 SMESG000004952.1 Contig516 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30015345 Tropomyosin SMESG000066854.1 Contig3688 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30015345 Tropomyosin SMESG000066854.1 Contig3688 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30015345 Tropomyosin SMESG000026500.1 Contig3688 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30015345 Tropomyosin SMESG000026500.1 Contig3688 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30025964 SMED30025964 SMESG000041071.1 Contig2453 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30033014 Phosphatidylinositol-4,5-bisphosphate 4-phosphatase SMESG000063221.1 Contig1068 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30023334 Partitioning defective 6 SMESG000066854.1 Contig3688 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30022468 secreted frizzled-related protein 1 SMESG000075831.1 SMESG000029446.1 EU296635 smed_ncbi_20200123 PMID:24704339
Vogg et al., 2014
pharynx SMED30027297 winged helix/forkhead transcription factor SMESG000077075.1 KC577557.1 smed_ncbi_20200123 PMID:24704339
Vogg et al., 2014
pharynx SMED30027297 winged helix/forkhead transcription factor SMESG000077075.1 KC577557 smed_ncbi_20200123 PMID:24704339
Vogg et al., 2014
pharynx SMED30029487 Smed-NDK SMESG000062038.1 GU592830.1 smed_ncbi_20200123 PMID:24704339
Vogg et al., 2014
pharynx SMED30005045 zinc finger protein A SMESG000022958.1 KF751216.1 smed_ncbi_20200123 PMID:24704339
Vogg et al., 2014
pharynx SMED30020359 Smed-NDK-3 SMESG000046244.1 SMESG000046208.1 GU592832.1 smed_ncbi_20200123 PMID:23318641
Chen et al., 2013
pharynx SMED30031256 wntP-2 SMESG000066476.1 wntP-2 smed_ncbi_20200123 PMID:23318641
Chen et al., 2013
pharynx SMED30027299 PBX SMESG000022232.1 SMESG000001913.1 KC353351.1 smed_ncbi_20200123 PMID:23318641
Chen et al., 2013
pharynx SMED30026602 Wnt2-1 SMESG000002069.1 FJ463753.1 smed_ncbi_20200123 PMID:23318641
Chen et al., 2013
pharynx SMED30011780 Si:ch73-222h13.1 SMESG000081135.1 Contig3433 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30011780 Si:ch73-222h13.1 SMESG000081135.1 Contig3433 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30014645 HP domain-containing protein SMESG000075965.1 PL04009A1F04 ncbi_smed_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30020872 Myosin IE SMESG000003513.1 Contig59 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30020872 Myosin IE SMESG000068232.1 Contig59 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30005336 Phtf-FEM1B_bdg domain-containing protein SMESG000058788.1 Contig2701 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30005012 SMED30005012 Contig1286 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30008812 AP complex subunit sigma SMESG000038889.1 Contig2145 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30002222 SMED30002222 Contig7536 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30002222 SMED30002222 Contig7536 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30005745 Protein kinase SMESG000079303.1 Contig2289 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30005745 Protein kinase SMESG000017260.1 Contig2289 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30011909 SMED30011909 SMESG000027686.1 Contig2364 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30011909 SMED30011909 SMESG000012131.1 SMESG000012127.1 Contig2364 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30001668 SMED30001668 SMESG000033527.1 Contig2307 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30029698 Caspase-7 SMESG000053168.1 Contig2992 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30015801 SMED30015801 SMESG000079303.1 Contig2289 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30015801 SMED30015801 SMESG000017260.1 Contig2289 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30024411 Protein kinase domain-containing protein SMESG000028899.1 Contig1093 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30024411 Protein kinase domain-containing protein SMESG000071997.1 Contig1093 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30001281 SMED30001281 SMESG000038153.1 SMESG000018862.1 Contig1 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30001281 SMED30001281 SMESG000033840.1 Contig1 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30019715 Tumor protein p63-regulated gene 1 protein SMESG000038153.1 SMESG000018862.1 Contig1 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30019715 Tumor protein p63-regulated gene 1 protein SMESG000033840.1 Contig1 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30013976 SMED30013976 SMESG000003513.1 Contig59 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30013976 SMED30013976 SMESG000003513.1 Contig59 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30013976 SMED30013976 SMESG000068232.1 Contig59 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30013976 SMED30013976 SMESG000068232.1 Contig59 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30014474 Tumor susceptibility gene 101 protein SMESG000049597.1 Contig5044 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30014474 Tumor susceptibility gene 101 protein SMESG000004871.1 Contig5044 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30016832 SH3 domain-binding protein 5-like SMESG000061052.1 Contig4742 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30016832 SH3 domain-binding protein 5-like SMESG000061052.1 Contig4742 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30016832 SH3 domain-binding protein 5-like SMESG000022856.1 Contig4742 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30016832 SH3 domain-binding protein 5-like SMESG000022856.1 Contig4742 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30016022 SMED30016022 SMESG000053405.1 Contig1766 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30016022 SMED30016022 SMESG000053405.1 Contig1766 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30016022 SMED30016022 SMESG000046314.1 SMESG000028362.1 Contig1766 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30016022 SMED30016022 SMESG000046314.1 SMESG000028362.1 Contig1766 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30005434 SMED30005434 SMESG000038889.1 Contig2145 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30004187 SMED30004187 SMESG000043423.1 Contig1792 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30004187 SMED30004187 SMESG000043423.1 Contig1792 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30004187 SMED30004187 SMESG000072544.1 Contig1792 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30004187 SMED30004187 SMESG000072544.1 Contig1792 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30015161 Vacuolar protein sorting-associated protein 45 SMESG000053405.1 Contig1766 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30015161 Vacuolar protein sorting-associated protein 45 SMESG000046314.1 SMESG000028362.1 Contig1766 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30008147 SMED30008147 SMESG000053405.1 Contig1766 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30008147 SMED30008147 SMESG000053405.1 Contig1766 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30008147 SMED30008147 SMESG000046314.1 SMESG000028362.1 Contig1766 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30008147 SMED30008147 SMESG000046314.1 SMESG000028362.1 Contig1766 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30008321 SMED30008321 SMESG000068172.1 Contig3306 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30008321 SMED30008321 SMESG000068172.1 Contig3306 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30008321 SMED30008321 SMESG000025870.1 Contig3306 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30008321 SMED30008321 SMESG000025870.1 Contig3306 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30017930 SMED30017930 SMESG000049597.1 Contig5044 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30017930 SMED30017930 SMESG000004871.1 Contig5044 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30004652 SMED30004652 SMESG000033527.1 Contig2307 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30014928 Formin-like protein SMESG000044336.1 Contig1407 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30014928 Formin-like protein SMESG000015063.1 Contig1407 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30017833 SMED30017833 SMESG000053168.1 Contig2992 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30014138 LIM homeobox 1b SMESG000061052.1 Contig4742 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30014138 LIM homeobox 1b SMESG000022856.1 Contig4742 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30012769 SMED30012769 SMESG000058788.1 Contig2701 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30012769 SMED30012769 SMESG000058788.1 Contig2701 uc_Smed_v2 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30017937 WASP like actin nucleation promoting factor b SMESG000036683.1 Contig4572 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30017937 WASP like actin nucleation promoting factor b SMESG000074788.1 Contig4572 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30029557 SMED30029557 SMESG000028899.1 Contig1093 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30029557 SMED30029557 SMESG000071997.1 Contig1093 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30020784 SMED30020784 SMESG000011782.1 Contig1076 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30032408 SMED30032408 SMESG000027686.1 Contig2364 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30032408 SMED30032408 SMESG000012131.1 SMESG000012127.1 Contig2364 newmark_ests PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30033476 Zinc finger protein, putative SMESG000068172.1 Contig3306 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30033476 Zinc finger protein, putative SMESG000025870.1 Contig3306 GPL15192 PMID:23079596
Forsthoefel et al., 2012
pharynx SMED30017079 LRRCC1 SMESG000016752.1 dd_Smed_v4_10086_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30018901 SMED30018901 SMESG000033673.1 dd_Smed_v4_1071_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30018901 SMED30018901 SMESG000033673.1 dd_1071 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30017667 SMED30017667 SMESG000044691.1 SMESG000022166.1 dd_Smed_v4_10233_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30017399 Transmembrane protein 81 SMESG000026648.1 dd_Smed_v4_10248_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30014347 plexin A SMESG000049328.1 SMESG000006542.1 SMESG000006541.1 dd_Smed_v4_11934_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30014685 SMED30014685 SMESG000036334.1 dd_Smed_v4_13648_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30027141 SMED30027141 SMESG000059828.1 dd_Smed_v4_1549_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30026061 SMED30026061 SMESG000076482.1 SMESG000076409.1 SMESG000076405.1 SMESG000076390.1 SMESG000076375.1 SMESG000076364.1 SMESG000076223.1 SMESG000040665.1 SMESG000019753.1 dd_Smed_v4_1097_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30026256 vault protein inter alpha trypsin-1 SMESG000053671.1 SMESG000053669.1 SMESG000053667.1 SMESG000053664.1 SMESG000053657.1 SMESG000053638.1 dd_Smed_v4_1027_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30027019 Innexin SMESG000030971.1 SMESG000030964.1 dd_Smed_v4_10061_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30004498 SMED30004498 SMESG000035916.1 dd_Smed_v4_13051_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30003902 Tetratricopeptide repeat protein 21B SMESG000011579.1 dd_Smed_v4_12056_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001404 Dual specificity tyrosine-phosphorylation-regulated kinase 2 SMESG000076586.1 SMESG000076583.1 dd_Smed_v4_12119_1_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30014199 Myosin SMESG000047361.1 dd_Smed_v4_4503_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30004582 SMED30004582 SMESG000035916.1 dd_Smed_v4_13051_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013319 Long-chain-fatty-acid--CoA ligase ACSBG2 SMESG000027204.1 dd_Smed_v4_1026_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30004097 SMED30004097 SMESG000031258.1 dd_Smed_v4_12080_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30008671 Phosphodiesterase SMESG000021196.1 dd_Smed_v4_8589_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30000421 TPR_REGION domain-containing protein SMESG000071973.1 dd_Smed_v4_11462_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30002516 SMED30002516 SMESG000011859.1 dd_Smed_v4_1283_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30002162 Glycosyl transferase SMESG000030921.1 dd_Smed_v4_11247_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30005046 Dynein heavy chain, axonemal SMESG000050247.1 dd_Smed_v4_13135_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30005046 Dynein heavy chain, axonemal SMESG000050247.1 SMESG000050248.1 dd_Smed_v4_10191_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30004648 Dual specificity tyrosine phosphorylation regulated kinase 2 SMESG000076586.1 SMESG000076583.1 dd_Smed_v4_12119_1_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001414 UPF0728 protein C10orf53 homolog SMESG000073355.1 dd_Smed_v4_10501_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30027672 Plac8 onzin related protein 1 SMESG000050229.1 SMESG000050221.1 dd_Smed_v4_1219_1_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30030642 Cytochrome P450 2C3 SMESG000023530.1 SMESG000023528.1 dd_Smed_v4_7874_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30005292 Post-GPI attachment to proteins factor 3 SMESG000077193.1 dd_Smed_v4_11282_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30000918 Coiled-coil domain containing 13 SMESG000058204.1 dd_Smed_v4_12055_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001801 NME/NM23 nucleoside diphosphate kinase 1 SMESG000008082.1 dd_Smed_v4_1096_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001071 Low density lipoprotein-receptor, class A,domain-containing protein SMESG000037863.1 dd_Smed_v4_12756_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30006515 ZZ-type domain-containing protein SMESG000055420.1 dd_Smed_v4_10173_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30004972 SMED30004972 SMESG000007019.1 dd_Smed_v4_10965_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30000840 Coiled-coil domain-containing protein 42-like protein SMESG000046807.1 dd_Smed_v4_12378_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30003249 Prohibitin SMESG000038397.1 dd_Smed_v4_1038_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30002934 forkhead box J1-like protein 4 SMESG000010030.1 dd_Smed_v4_10152_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001031 TRAF3-interacting protein 1 SMESG000006345.1 dd_Smed_v4_10562_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013692 Small HSP protein SMESG000059879.1 SMESG000059868.1 SMESG000059853.1 dd_Smed_v4_1039_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30004559 CULT domain-containing protein SMESG000077110.1 SMESG000077108.1 dd_Smed_v4_11915_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001654 SMED30001654 SMESG000012124.1 dd_Smed_v4_11272_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001176 SMED30001176 SMESG000020646.1 dd_Smed_v4_10759_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30026934 SMED30026934 SMESG000050824.1 dd_Smed_v4_12162_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023483 INX-13 SMESG000043575.1 dd_Smed_v4_11501_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30003780 Serine/threonine-protein kinase 36 SMESG000076885.1 dd_Smed_v4_11067_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30003093 SMED30003093 SMESG000056847.1 SMESG000056843.1 SMESG000056838.1 SMESG000044770.1 SMESG000044762.1 SMESG000007140.1 dd_Smed_v4_1137_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30004871 Mitogen-activated protein kinase SMESG000023035.1 SMESG000023025.1 dd_Smed_v4_10933_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30014131 RPTOR independent companion of MTOR, complex 2 a SMESG000024212.1 SMESG000033570.1 dd_Smed_v4_9324_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001192 ras-related protein Rab-14 SMESG000066109.1 SMESG000052687.1 SMESG000014240.1 SMESG000069832.1 SMESG000037642.1 dd_Smed_v4_106_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001473 Lipoxygenase homology domain-containing protein 1 SMESG000059926.1 SMESG000059927.1 dd_Smed_v4_10460_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30004224 Sodium/hydrogen exchanger 11 SMESG000052479.1 dd_Smed_v4_10212_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30003458 Ras-related protein Rab-27B SMESG000077907.1 dd_Smed_v4_10266_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30015061 G protein regulated inducer of neurite outgrowth SMESG000062691.1 dd_Smed_v4_10294_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30035904 PROG-1 SMESG000024882.1 SMESG000024707.1 dd_Smed_v4_332_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30026063 TNF receptor-associated factor SMESG000044583.1 dd_Smed_v4_11100_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30025647 Ig-like domain-containing protein SMESG000079961.1 dd_Smed_v4_12974_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30019526 Membrane protein insertase YidC SMESG000039158.1 dd_Smed_v4_4072_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012622 Intraflagellar transport 43 SMESG000067883.1 dd_Smed_v4_5237_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30014257 Oxysterol-binding protein SMESG000008795.1 dd_Smed_v4_4931_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30019494 Ubiquitin-fold modifier-conjugating enzyme 1 SMESG000068795.1 dd_Smed_v4_4590_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30015538 SMED30015538 SMESG000011215.1 SMESG000011194.1 dd_Smed_v4_6952_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30018507 Calcium-transporting ATPase SMESG000038461.1 dd_Smed_v4_4559_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30018507 Calcium-transporting ATPase SMESG000038461.1 dd_Smed_v4_3170_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012764 SMED30012764 SMESG000059203.1 dd_Smed_v4_5415_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30016848 SMED30016848 SMESG000079496.1 dd_Smed_v4_6860_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30011982 60S ribosomal protein L17 SMESG000009564.1 dd_Smed_v4_95_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30014550 Intraflagellar transport protein 43 SMESG000067883.1 dd_Smed_v4_5237_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30018495 ATPase_AAA_core domain-containing protein SMESG000073596.1 dd_Smed_v4_9568_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30018495 ATPase_AAA_core domain-containing protein SMESG000073596.1 dd_Smed_v4_9484_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30000178 SMED30000178 dd_Smed_v4_13403_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30018756 SMED30018756 dd_Smed_v4_6916_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30016918 UPF0466 protein-like dd_Smed_v4_5792_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001925 SMED30001925 dd_4476 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001925 SMED30001925 dd_Smed_v4_4476_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30016577 SMED30016577 dd_Smed_v4_10215_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013141 Pleckstrin homology domain-containing family F member 2-like protein dd_Smed_v4_2374_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30019959 NADH dehydrogenase subunit 4 dd_Smed_v4_292_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30019959 NADH dehydrogenase subunit 4 dd_Smed_v4_344_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30016673 Cylindromatosis (turban tumor syndrome), b SMESG000056847.1 SMESG000056843.1 SMESG000056838.1 SMESG000044770.1 SMESG000044762.1 SMESG000007140.1 dd_Smed_v4_1137_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30002680 SMED30002680 dd_Smed_v4_11691_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30004099 SMED30004099 dd_Smed_v4_15498_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30018518 Protein chibby 1 dd_Smed_v4_11618_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012451 SMED30012451 dd_Smed_v4_215_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30010808 Elongation of very long chain fatty acids protein SMESG000009665.1 dd_Smed_v4_10529_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30005911 SMED30005911 dd_Smed_v4_12_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30016010 SMED30016010 SMESG000042231.1 dd_Smed_v4_10980_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30015411 GLTP domain-containing protein dd_Smed_v4_2621_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30017048 cilia- and flagella-associated protein 206 SMESG000021247.1 dd_Smed_v4_11199_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30006652 dynein heavy chain 6, axonemal SMESG000004477.1 SMESG000004475.1 dd_Smed_v4_10969_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012212 NADH dehydrogenase subunit 1 dd_Smed_v4_258_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30009030 Selenoprotein W dd_Smed_v4_572_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001799 NADH dehydrogenase subunit 5 dd_Smed_v4_258_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001799 NADH dehydrogenase subunit 5 dd_Smed_v4_957_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30010134 SMED30010134 dd_Smed_v4_34037_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013571 NADH dehydrogenase subunit 4L dd_Smed_v4_344_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30000702 cytochrome b dd_Smed_v4_344_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30005542 SMED30005542 dd_Smed_v4_23179_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30002689 SMED30002689 dd_Smed_v4_680_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30004402 Dimer_Tnp_hAT domain-containing protein dd_Smed_v4_14487_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013526 SMED30013526 dd_Smed_v4_11243_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001366 SMED30001366 SMESG000014648.1 dd_Smed_v4_1227_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012522 Ankyrin-2 SMESG000026655.1 dd_Smed_v4_10835_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30017231 NEPH-3 SMESG000022777.1 dd_Smed_v4_11280_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30010320 Radial spoke head 10-like protein B2 SMESG000039156.1 SMESG000039153.1 dd_Smed_v4_12762_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30010500 Fibronectin type III domain protein SMESG000033545.1 dd_Smed_v4_15017_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30004124 14-3-3 protein beta/alpha SMESG000055903.1 dd_Smed_v4_138_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30002886 SMED30002886 SMESG000017779.1 dd_Smed_v4_11049_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30009231 Transmembrane protein SMESG000002927.1 dd_Smed_v4_12002_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30009231 Transmembrane protein SMESG000002927.1 dd_Smed_v4_16643_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30002489 Apical junction component 1 homolog SMESG000037093.1 dd_Smed_v4_11689_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30018224 Adenylate kinase SMESG000077377.1 SMESG000076900.1 SMESG000063429.1 SMESG000060686.1 SMESG000043019.1 SMESG000031308.1 SMESG000028811.1 SMESG000023833.1 SMESG000023573.1 SMESG000019820.1 SMESG000011532.1 SMESG000052813.1 dd_Smed_v4_1229_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30019223 Protein FAM47E SMESG000026097.1 dd_Smed_v4_10346_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30019942 Roc domain-containing protein SMESG000038728.1 dd_Smed_v4_11334_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30010203 C2H2-type domain-containing protein SMESG000067728.1 dd_Smed_v4_1455_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30019453 Asparagine rich antigen SMESG000022424.1 dd_Smed_v4_10530_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30005211 cilia- and flagella-associated protein 47 SMESG000060264.1 dd_Smed_v4_8294_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30002712 Dynein heavy chain 3, axonemal SMESG000040511.1 SMESG000040510.1 SMESG000040507.1 dd_Smed_v4_10846_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30010655 SMED30010655 SMESG000028897.1 dd_Smed_v4_12473_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30018493 Ras and EF-hand domain-containing protein SMESG000028852.1 dd_Smed_v4_12567_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30019487 Phosphodiesterase SMESG000054903.1 SMESG000054901.1 SMESG000054878.1 SMESG000044092.1 dd_Smed_v4_10593_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023017 SMED30023017 SMESG000065348.1 dd_1320 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023017 SMED30023017 SMESG000065348.1 dd_Smed_v4_1320_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30020291 Centrosomal protein 104 SMESG000023549.1 dd_Smed_v4_10228_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30034247 SMED30034247 SMESG000005178.1 dd_Smed_v4_10371_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30027439 SMED30027439 SMESG000031258.1 dd_Smed_v4_12080_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30033718 SMED30033718 SMESG000061174.1 dd_Smed_v4_12214_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30028591 Protein kinase SMESG000030545.1 dd_Smed_v4_11177_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30025195 SMED30025195 SMESG000001693.1 dd_Smed_v4_10480_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30027291 Death domain-containing protein SMESG000064407.1 dd_Smed_v4_12177_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30032529 SMED30032529 SMESG000077536.1 dd_Smed_v4_11079_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30020260 SMED30020260 SMESG000005697.1 dd_Smed_v4_12813_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30020257 DUF3421 domain-containing protein SMESG000046742.1 dd_Smed_v4_1040_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023857 Calpain 5a SMESG000009459.1 dd_Smed_v4_101944_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30028302 SMED30028302 SMESG000056261.1 dd_Smed_v4_8391_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023085 Non-specific serine/threonine protein kinase SMESG000004478.1 dd_Smed_v4_11674_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021590 Spectrin beta chain SMESG000081696.1 dd_Smed_v4_1122_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023193 Tau tubulin kinase SMESG000026133.1 dd_Smed_v4_12470_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30029471 Collagen alpha-1(XXVIII) chain SMESG000033673.1 dd_Smed_v4_1071_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30029471 Collagen alpha-1(XXVIII) chain SMESG000033673.1 dd_1071 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022653 Stromal interaction molecule 1 SMESG000081265.1 dd_Smed_v4_12888_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30025753 SMED30025753 SMESG000016791.1 dd_Smed_v4_10_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30020615 prohibitin-1 SMESG000021272.1 dd_Smed_v4_1089_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30031582 Innexin SMESG000081749.1 dd_Smed_v4_10287_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30031582 Innexin SMESG000081749.1 dd_Smed_v4_11302_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023718 Histone-lysine N-methyltransferase SMESG000081033.1 dd_Smed_v4_10189_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30025084 Ankyrin repeat and EF-hand domain-containing protein 1 SMESG000006940.1 SMESG000006938.1 SMESG000006933.1 dd_Smed_v4_12476_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30020686 Transmembrane protein 80 SMESG000018777.1 dd_Smed_v4_13318_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30035412 SMED30035412 SMESG000077193.1 dd_Smed_v4_11282_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30025883 Forkhead associated phosphopeptide binding domain 1 SMESG000071072.1 dd_Smed_v4_14350_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30025629 Enkurin domain-containing protein SMESG000020205.1 dd_Smed_v4_12663_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021807 SMED30021807 SMESG000030582.1 dd_Smed_v4_1124_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022225 Bidirectional sugar transporter SWEET SMESG000012540.1 dd_Smed_v4_12308_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30033487 cilia- and flagella-associated protein 70 SMESG000009189.1 dd_Smed_v4_10893_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30027319 SMED30027319 SMESG000006149.1 dd_Smed_v4_11660_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30024189 60S ribosomal protein L31 SMESG000017099.1 dd_Smed_v4_113_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30020398 Kinesin-like protein SMESG000007019.1 dd_Smed_v4_10965_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30028626 C2H2-type domain-containing protein SMESG000019280.1 SMESG000019279.1 dd_Smed_v4_10324_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30030586 slc10a-2 SMESG000064833.1 dd_Smed_v4_10199_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30020109 R3H domain containing-like SMESG000044056.1 dd_Smed_v4_11014_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022717 SMED30022717 SMESG000005697.1 dd_Smed_v4_12813_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30032420 SMED30032420 SMESG000050229.1 SMESG000050221.1 dd_Smed_v4_1219_1_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30025696 Carbonic anhydrase SMESG000035022.1 dd_Smed_v4_10041_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021977 Beta-1,3-galactosyltransferase 1 SMESG000035184.1 dd_Smed_v4_11741_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30024787 SMED30024787 SMESG000056261.1 dd_Smed_v4_8391_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022344 FERM domain containing-1 SMESG000070273.1 dd_Smed_v4_1131_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30031219 deleted in lung and esophageal cancer protein 1 SMESG000079694.1 dd_Smed_v4_10833_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022997 ELMO domain containing 3 SMESG000008416.1 dd_Smed_v4_13608_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022844 NEPH-3 SMESG000022777.1 dd_Smed_v4_11280_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30026336 Beta-hexosaminidase SMESG000008181.1 dd_Smed_v4_12408_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022370 Calcium-activated potassium channel slo-1, putative SMESG000049145.1 dd_Smed_v4_12503_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023266 cilia- and flagella-associated protein 43 SMESG000000491.1 dd_Smed_v4_10271_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013257 Tektin-2 SMESG000026446.1 SMESG000026445.1 SMESG000026429.1 dd_Smed_v4_2694_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30004312 Parvo_coat_N domain-containing protein dd_Smed_v4_91560_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30017080 FHA domain-containing protein SMESG000061238.1 dd_Smed_v4_11335_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30011607 SMED30011607 dd_Smed_v4_15559_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30004042 dynein heavy chain 3, axonemal SMESG000013738.1 SMESG000013737.1 dd_Smed_v4_9009_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30004042 dynein heavy chain 3, axonemal SMESG000013737.1 SMESG000013731.1 dd_Smed_v4_23484_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30007024 G_PROTEIN_RECEP_F1_2 domain-containing protein SMESG000078415.1 dd_Smed_v4_24316_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30018740 SMED30018740 dd_Smed_v4_1700_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30008074 CRAL-TRIO domain-containing protein SMESG000009863.1 dd_Smed_v4_9151_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013157 KHD-1 SMESG000070471.1 dd_Smed_v4_294_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30018956 SMED30018956 dd_Smed_v4_2990_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30006480 SMED30006480 dd_Smed_v4_479_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30005334 SMED30005334 dd_Smed_v4_344_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30005537 TIGR00341 family protein SMESG000062412.1 dd_Smed_v4_9934_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30016430 SMED30016430 dd_Smed_v4_275_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30005692 Cytoplasmic dynein 2 heavy chain 1 SMESG000008384.1 SMESG000008382.1 dd_Smed_v4_9136_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30003987 60S ribosomal protein L29 dd_Smed_v4_481_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30000212 Vacuolar protein sorting-associated protein 26B SMESG000026617.1 dd_Smed_v4_912_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30008414 NADH-ubiquinone oxidoreductase chain 3 dd_Smed_v4_289_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30005555 Tigger transposable element-derived protein 1 dd_Smed_v4_20966_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30006347 U2 small nuclear ribonucleoprotein B dd_Smed_v4_2274_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012826 SMED30012826 SMESG000017012.1 SMESG000017011.1 dd_Smed_v4_309_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30015561 SMED30015561 dd_Smed_v4_6429_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013798 Dual specificity phosphatase 10 dd_Smed_v4_653_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30002786 SMED30002786 dd_Smed_v4_19765_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30004246 SMED30004246 dd_Smed_v4_344_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30000207 SMED30000207 dd_Smed_v4_45021_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30014345 Dynein light chain roadblock dd_Smed_v4_5440_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013315 SMED30013315 SMESG000022425.1 dd_Smed_v4_3843_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30003889 SMED30003889 SMESG000051911.1 dd_Smed_v4_5276_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30000270 Histone H3 SMESG000049112.1 SMESG000049109.1 dd_Smed_v4_532_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001681 SMED30001681 SMESG000049443.1 dd_Smed_v4_1193_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30003997 SMED30003997 SMESG000059318.1 SMESG000059304.1 dd_Smed_v4_483_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30015125 SMED30015125 SMESG000061766.1 dd_Smed_v4_12632_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30008242 SMED30008242 SMESG000068886.1 dd_Smed_v4_12913_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30007804 Immunoglobulin-like domain-containing protein SMESG000010356.1 dd_Smed_v4_1827_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30000289 SMED30000289 SMESG000076644.1 SMESG000076643.1 dd_Smed_v4_227_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30017333 centrosomal protein of 83 kDa-like SMESG000033227.1 SMESG000033225.1 dd_Smed_v4_12969_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30009090 Mushroom body large-type Kenyon-related protein SMESG000070784.1 dd_Smed_v4_17498_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30019328 Armadillo repeat-containing protein 2 SMESG000077074.1 dd_Smed_v4_12684_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30019425 Neuronal acetylcholine receptor subunit alpha-2 SMESG000015263.1 SMESG000015256.1 dd_Smed_v4_18201_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30031929 zf-LYAR domain-containing protein SMESG000081140.1 dd_Smed_v4_5281_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30033594 Microtubule-associated protein 1A SMESG000014298.1 dd_Smed_v4_1301_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30033594 Microtubule-associated protein 1A SMESG000014298.1 dd_Smed_v4_3654_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023688 Leucine-rich repeat and guanylate kinase domain-containing protein SMESG000033759.1 dd_Smed_v4_9362_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022574 START domain-containing protein SMESG000046413.1 SMESG000037645.1 dd_Smed_v4_3734_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30027683 Golgi phosphoprotein 3 SMESG000073543.1 SMESG000073542.1 dd_Smed_v4_1770_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30026551 Ankyrin and armadillo repeat-containing protein SMESG000058465.1 dd_Smed_v4_13064_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021896 SMED30021896 SMESG000041611.1 dd_Smed_v4_1935_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023889 SMED30023889 SMESG000055805.1 dd_Smed_v4_857_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30026601 Dynein heavy chain axonemal SMESG000033128.1 dd_Smed_v4_7062_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30020821 SMED30020821 SMESG000014298.1 dd_Smed_v4_1301_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023490 SMED30023490 SMESG000076531.1 dd_Smed_v4_7027_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30025664 TSNAXIP1_N domain-containing protein SMESG000060720.1 dd_Smed_v4_13434_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30025076 SMED30025076 SMESG000010166.1 dd_Smed_v4_2518_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30027280 60S acidic ribosomal protein P0 SMESG000079482.1 dd_Smed_v4_161_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30031142 Protein kinase domain-containing protein SMESG000073002.1 SMESG000072984.1 dd_Smed_v4_12680_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023059 EF-hand calcium-binding domain-containing protein 6 SMESG000052556.1 SMESG000052552.1 dd_Smed_v4_7065_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30028759 Mediator of RNA polymerase II transcription subunit 11 SMESG000036125.1 dd_Smed_v4_9527_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30029694 Kinesin light chain SMESG000023454.1 SMESG000018677.1 SMESG000018676.1 dd_Smed_v4_6449_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023176 SMED30023176 SMESG000015263.1 SMESG000015256.1 dd_Smed_v4_18201_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30025052 histone-lysine N-methyltransferase SETD1B-A SMESG000062286.1 dd_Smed_v4_11834_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021960 Aminopeptidase SMESG000067986.1 dd_Smed_v4_2224_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021616 Rho GTPase-activating protein SMESG000060252.1 dd_Smed_v4_3376_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30031188 Casein kinase I SMESG000050144.1 SMESG000050130.1 dd_Smed_v4_16169_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30031468 Propionyl-CoA carboxylase alpha chain, mitochondrial SMESG000034830.1 dd_Smed_v4_1247_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30020711 Protein LKAAEAR1 SMESG000010224.1 dd_Smed_v4_8554_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022443 Ankyrin repeat protein SMESG000009520.1 SMESG000009519.1 dd_Smed_v4_9418_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30024770 SMED30024770 SMESG000035481.1 dd_Smed_v4_7894_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30028659 Cilia-and flagella-associated protein 100 SMESG000033127.1 dd_Smed_v4_6518_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30030095 coiled-coil domain-containing protein 87 isoform X1 SMESG000004454.1 dd_Smed_v4_12480_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30024394 Dynein light chain SMESG000005286.1 dd_Smed_v4_898_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30032272 FMN_red domain-containing protein SMESG000023871.1 dd_Smed_v4_1834_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30034198 SMED30034198 SMESG000002829.1 dd_Smed_v4_12484_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30024248 SMED30024248 SMESG000055844.1 dd_Smed_v4_6835_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30028624 Synaptotagmin, putative SMESG000034832.1 dd_Smed_v4_13224_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30027644 cAMP-dependent protein kinase regulatory subunit SMESG000003135.1 dd_Smed_v4_14355_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021030 slc25a-7 SMESG000074820.1 dd_Smed_v4_8013_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021265 2-acylglycerol O-acyltransferase 2 SMESG000052656.1 dd_Smed_v4_6550_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023210 Phosphodiesterase SMESG000034055.1 SMESG000034048.1 dd_Smed_v4_9276_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30025171 SMED30025171 SMESG000014769.1 dd_Smed_v4_1952_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022425 Peroxiredoxin SMESG000002993.1 dd_Smed_v4_1290_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012075 SMED30012075 SMESG000059352.1 SMESG000059351.1 dd_Smed_v4_420_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30019576 SMED30019576 SMESG000079563.1 SMESG000052448.1 dd_Smed_v4_3113_1_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013149 MIEAP domain-containing protein SMESG000019081.1 dd_Smed_v4_6321_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30003118 SMED30003118 SMESG000006534.1 dd_Smed_v4_4662_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013198 SMED30013198 SMESG000057605.1 dd_Smed_v4_24714_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012198 UPF0764 protein C16orf89 homolog isoform X3 SMESG000053422.1 dd_Smed_v4_4213_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30009505 SMED30009505 SMESG000015390.1 dd_Smed_v4_4166_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30008882 Cilia and flagella associated protein 157 SMESG000036345.1 dd_Smed_v4_9862_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30017410 Peptidoglycan-recognition protein SMESG000004536.1 dd_Smed_v4_817_1_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30008784 hypothetical protein SMESG000047305.1 dd_Smed_v4_9312_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30004297 Eukaryotic translation initiation factor 3 subunit K SMESG000017237.1 dd_Smed_v4_621_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30005665 SMED30005665 SMESG000074689.1 dd_Smed_v4_2429_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30004957 Anoctamin SMESG000033730.1 SMESG000033728.1 dd_Smed_v4_6514_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30019584 Ventral anterior homeobox 1 SMESG000055068.1 dd_Smed_v4_49879_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30007379 YTH domain-containing family protein 2 SMESG000008619.1 dd_Smed_v4_7891_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30008351 SMED30008351 SMESG000081198.1 dd_Smed_v4_39279_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30006541 SMED30006541 SMESG000012332.1 SMESG000012317.1 SMESG000058954.1 dd_Smed_v4_246_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30017794 Coiled-coil domain containing 191 SMESG000064321.1 dd_Smed_v4_8967_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012300 SMED30012300 SMESG000013739.1 dd_Smed_v4_5519_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30010664 SMED30010664 SMESG000053423.1 dd_Smed_v4_8209_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30006764 Phosphatidylinositol 3-kinase regulatory subunit alpha SMESG000078199.1 dd_Smed_v4_4794_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012487 SMED30012487 SMESG000009419.1 dd_Smed_v4_5926_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30002803 Dynein light chain SMESG000043382.1 dd_Smed_v4_7954_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30008757 Piezo-type mechanosensitive ion channel component SMESG000051188.1 dd_Smed_v4_7182_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30006667 SMED30006667 SMESG000023553.1 dd_Smed_v4_8057_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30007581 cilia- and flagella-associated protein 69 SMESG000047535.1 dd_Smed_v4_7432_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30007124 EF-hand domain-containing protein SMESG000062171.1 dd_Smed_v4_3568_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30009450 TIR domain-containing protein SMESG000008937.1 dd_Smed_v4_9242_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30019305 wdr-1 SMESG000045753.1 SMESG000037894.1 dd_Smed_v4_2585_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012017 SMED30012017 SMESG000022399.1 dd_Smed_v4_708_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001306 SMED30001306 SMESG000060566.1 SMESG000060556.1 dd_Smed_v4_4002_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30015160 SMED30015160 SMESG000016267.1 SMESG000058374.1 dd_Smed_v4_3391_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30019873 plasminogen-1 SMESG000018453.1 dd_Smed_v4_23420_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30007279 Neurocalcin-delta SMESG000068889.1 dd_Smed_v4_2568_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30007607 SMED30007607 SMESG000050535.1 SMESG000050533.1 dd_Smed_v4_5107_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30004860 STRA6-like SMESG000041900.1 SMESG000031061.1 dd_Smed_v4_8135_1_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001290 semaphorin 5-3 SMESG000033853.1 dd_Smed_v4_9914_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30008437 Nuclear and cytoplasmic polyadenylated RNA-binding protein SMESG000044649.1 dd_Smed_v4_3605_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30010991 SMED30010991 SMESG000014346.1 dd_Smed_v4_6441_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30010991 SMED30010991 SMESG000014346.1 dd_Smed_v4_2231_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30008534 cGMP-dependent protein kinase SMESG000052811.1 dd_Smed_v4_5704_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30017369 Disabled 2-interacting protein SMESG000043888.1 dd_Smed_v4_3238_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30006047 EF-hand calcium-binding domain-containing protein 5 SMESG000053423.1 dd_Smed_v4_8209_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30007217 Death domain-containing protein SMESG000078437.1 dd_Smed_v4_7428_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30018451 Lipopolysaccharide-induced TNF-alpha factor SMESG000020870.1 SMESG000046087.1 SMESG000046084.1 dd_Smed_v4_2768_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30008957 Meckelin SMESG000043913.1 dd_Smed_v4_7765_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30000581 Centlein, centrosomal protein SMESG000000357.1 dd_Smed_v4_9882_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012136 radial spoke head protein 9 homolog SMESG000046857.1 dd_Smed_v4_4707_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013768 SMED30013768 SMESG000056915.1 dd_Smed_v4_3761_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30008873 SMED30008873 SMESG000009341.1 dd_Smed_v4_337_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012432 SMED30012432 SMESG000060566.1 SMESG000060556.1 dd_Smed_v4_4002_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012149 NPHS1-7 SMESG000016267.1 SMESG000058374.1 dd_Smed_v4_3391_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013882 Spds-1 SMESG000023363.1 dd_Smed_v4_3295_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30014184 Tumor necrosis factor alpha-induced protein 8-like protein SMESG000002914.1 dd_Smed_v4_2386_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012046 5'-AMP-activated protein kinase subunit beta-1 SMESG000037698.1 dd_Smed_v4_6112_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30002703 60S ribosomal protein L23a SMESG000074545.1 dd_Smed_v4_281_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30010637 Nucleolar RNA helicase II/Gu protein SMESG000065959.1 dd_Smed_v4_283_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30003084 Cilia-and flagella-associated protein 45 SMESG000016410.1 dd_Smed_v4_3732_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001271 SMED30001271 SMESG000038975.1 dd_Smed_v4_930_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30009834 TNF receptor-associated factor SMESG000047296.1 dd_Smed_v4_2916_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30003501 Surface protein SMESG000064752.1 dd_Smed_v4_3240_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30010227 SMED30010227 SMESG000078872.1 dd_Smed_v4_673_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30019364 Si:ch211-193l2.10 SMESG000062713.1 dd_Smed_v4_3203_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30015588 SMED30015588 SMESG000009089.1 dd_Smed_v4_5692_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30011285 DNA polymerase subunit gamma-1 SMESG000077612.1 SMESG000050769.1 dd_Smed_v4_5734_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30018439 XK-related protein SMESG000080414.1 dd_Smed_v4_2770_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30002286 formimidoyltransferase-cyclodeaminase SMESG000070969.1 dd_Smed_v4_7815_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30025510 UHRF1-binding protein 1-like SMESG000044305.1 dd_Smed_v4_11401_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021589 Agrin, putative SMESG000028865.1 SMESG000028859.1 dd_Smed_v4_3649_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023766 SMED30023766 SMESG000073811.1 dd_Smed_v4_116_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30027593 Protein polyglycylase TTLL10 SMESG000042729.1 SMESG000042734.1 dd_Smed_v4_14858_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30025041 Protein phosphatase 2c SMESG000018373.1 dd_Smed_v4_2362_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30026726 RING domain ligase2 isoform 3 SMESG000003596.1 dd_Smed_v4_6423_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30026726 RING domain ligase2 isoform 3 SMESG000003596.1 dd_Smed_v4_5871_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30028898 BZIP domain-containing protein SMESG000067543.1 dd_Smed_v4_1399_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021874 Caveolin SMESG000052389.1 dd_Smed_v4_877_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30033197 SMED30033197 SMESG000073811.1 dd_Smed_v4_116_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30028905 Chaperone protein DnaJ SMESG000036198.1 dd_Smed_v4_24393_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023379 Piezo-type mechanosensitive ion channel component SMESG000051188.1 dd_Smed_v4_7182_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30015457 SMED30015457 SMESG000022017.1 dd_Smed_v4_9360_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30004876 Nuclear receptor subfamily 4 group A SMESG000063104.1 dd_Smed_v4_12229_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30015948 SMED30015948 SMESG000042166.1 dd_Smed_v4_4173_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30016474 Serine/threonine-protein kinase SMESG000040958.1 dd_Smed_v4_22156_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30019874 Calmodulin SMESG000010769.1 dd_Smed_v4_255_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30002742 Dystonin SMESG000043809.1 SMESG000043799.1 dd_Smed_v4_1205_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30004930 Irregular chiasm C-roughest-like isoform X2 SMESG000077979.1 dd_Smed_v4_12549_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30003829 SMED30003829 dd_Smed_v4_1576_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30017015 Deferrochelatase/peroxidase YfeX SMESG000077723.1 dd_Smed_v4_2999_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30019455 LIM domain-containing protein SMESG000066861.1 SMESG000059630.1 SMESG000066862.1 dd_Smed_v4_6647_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30017387 von Willebrand factor A domain containing 3B SMESG000047774.1 dd_Smed_v4_9363_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30019133 SMED30019133 SMESG000019555.1 dd_Smed_v4_6722_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30017032 slc2a-11 SMESG000025420.1 dd_Smed_v4_2995_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30000146 GLI-3 SMESG000078300.1 dd_Smed_v4_17566_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30000411 Dynamin-1 SMESG000021502.1 dd_Smed_v4_2160_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30017542 SMED30017542 SMESG000033620.1 dd_Smed_v4_22810_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001142 Cadherin SMESG000020082.1 SMESG000020071.1 dd_Smed_v4_2107_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023008 HSP27 SMESG000030472.1 dd_Smed_v4_2189_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30029624 Heterogeneous nuclear ribonucleoprotein K SMESG000064674.1 dd_Smed_v4_1998_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30031277 SMED30031277 SMESG000040958.1 dd_Smed_v4_22156_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021635 Succinate dehydrogenase [ubiquinone] flavoprotein subunit, mitochondrial SMESG000008280.1 dd_Smed_v4_897_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30030971 Hemicentin 1 SMESG000050805.1 dd_Smed_v4_22836_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30025473 mxi-2 protein SMESG000060394.1 dd_Smed_v4_4048_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30031139 WASH complex subunit 2C SMESG000014537.1 SMESG000014534.1 dd_Smed_v4_19560_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30035079 Phospholipid-transporting ATPase SMESG000061014.1 dd_Smed_v4_2913_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30025004 Magnesium-dependent phosphatase 1 SMESG000025378.1 dd_Smed_v4_1958_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30026337 Ankyrin SMESG000000606.1 dd_Smed_v4_2072_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30030159 SMED30030159 SMESG000000606.1 dd_Smed_v4_2072_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023691 sperm-tail PG-rich repeat-containing protein 2 SMESG000034428.1 dd_Smed_v4_9462_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30031837 SMED30031837 SMESG000054635.1 SMESG000054602.1 SMESG000052914.1 dd_Smed_v4_2185_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30029546 Tektin 3 SMESG000020792.1 dd_Smed_v4_3187_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30029269 Structural maintenance of chromosomes protein SMESG000022017.1 dd_Smed_v4_9360_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30030643 Methylmalonic aciduria and homocystinuria type D-like protein, mitochondrial SMESG000030431.1 dd_Smed_v4_2046_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30020849 SMED30020849 SMESG000044682.1 dd_Smed_v4_3494_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022184 Protein transport protein Sec61 subunit beta SMESG000050010.1 SMESG000013437.1 dd_Smed_v4_418_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30031631 6-phosphogluconate dehydrogenase, decarboxylating SMESG000005721.1 dd_Smed_v4_366_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30034254 calreticulin-1 SMESG000009012.1 dd_Smed_v4_220_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30026527 Serine palmitoyltransferase 2 SMESG000011189.1 dd_Smed_v4_4337_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30025231 radial spoke head protein 6 homolog A SMESG000079294.1 SMESG000044179.1 dd_Smed_v4_3854_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30026371 SMED30026371 SMESG000059828.1 dd_Smed_v4_2479_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30026457 Fumarate hydratase, class I SMESG000075499.1 SMESG000009591.1 dd_Smed_v4_2405_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30026004 SMED30026004 SMESG000016872.1 dd_Smed_v4_3108_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30028925 Adiponectin receptor protein SMESG000011535.1 dd_Smed_v4_2696_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30031567 Ribonucloprotein SMESG000040544.1 SMESG000027686.1 dd_Smed_v4_3155_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022121 SMED30022121 SMESG000042798.1 dd_Smed_v4_2204_1_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30015158 Translation initiation factor SUI1 SMESG000033176.1 dd_Smed_v4_1183_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30006549 SMED30006549 SMESG000016886.1 SMESG000016875.1 dd_Smed_v4_7893_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30005523 Alpha-actinin SMESG000026000.1 dd_Smed_v4_1951_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30006438 EF-hand domain-containing family member B SMESG000077905.1 dd_Smed_v4_11909_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30002663 TNF receptor-associated factor SMESG000018404.1 dd_Smed_v4_4392_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30005770 Cell number regulator 7 SMESG000060415.1 dd_Smed_v4_743_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013060 Transcription factor IIIB 90 kDa subunit SMESG000049775.1 dd_Smed_v4_1437_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30005158 WD_REPEATS_REGION domain-containing protein SMESG000071691.1 dd_Smed_v4_6137_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30008772 Golgi-associated plant pathogenesis-related protein 1 SMESG000035954.1 dd_Smed_v4_27440_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30008280 Class E vacuolar protein-sorting machinery protein HSE1 SMESG000077597.1 dd_Smed_v4_4190_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30000895 SMED30000895 SMESG000034252.1 dd_Smed_v4_41846_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013095 DDE_Tnp_1_7 domain-containing protein SMESG000080622.1 SMESG000068757.1 SMESG000055125.1 SMESG000038294.1 SMESG000032747.1 SMESG000023322.1 dd_Smed_v4_3830_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30007704 Actin SMESG000051672.1 SMESG000051670.1 dd_Smed_v4_3_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013909 tud-1 SMESG000029236.1 SMESG000029232.1 dd_Smed_v4_1582_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001929 F-box domain-containing protein SMESG000077869.1 dd_Smed_v4_14890_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30002066 SMED30002066 SMESG000016886.1 SMESG000016875.1 dd_Smed_v4_7893_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30009218 Receptor expression-enhancing protein SMESG000036637.1 dd_Smed_v4_1995_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30008456 Type I inositol-1,4,5-trisphosphate 5-phosphatase SMESG000074184.1 SMESG000019975.1 dd_Smed_v4_266_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30009817 testis-expressed protein 52 SMESG000070302.1 dd_Smed_v4_6766_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30000671 Fibronectin type III domain protein SMESG000043560.1 dd_Smed_v4_33732_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30009281 Netrin-4 SMESG000062589.1 dd_Smed_v4_6093_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30007579 SMED30007579 SMESG000038305.1 SMESG000038298.1 SMESG000038313.1 SMESG000035859.1 dd_Smed_v4_9798_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30018534 Muscleblind-like protein SMESG000067960.1 SMESG000079855.1 SMESG000037170.1 dd_Smed_v4_2838_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001449 Propionyl-CoA carboxylase subunit beta dd_Smed_v4_513_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30010316 Echinoderm microtubule-associated protein-like 4 SMESG000027261.1 dd_Smed_v4_10540_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30016583 SMED30016583 SMESG000020949.1 dd_Smed_v4_29455_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30016583 SMED30016583 SMESG000020949.1 dd_Smed_v4_13527_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30010704 SMED30010704 dd_Smed_v4_14348_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30010364 SMED30010364 SMESG000056847.1 SMESG000056843.1 SMESG000056838.1 SMESG000044770.1 SMESG000044762.1 SMESG000007140.1 dd_Smed_v4_1137_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30010231 SMED30010231 SMESG000015116.1 dd_Smed_v4_10874_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30000682 SMED30000682 dd_Smed_v4_1303_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001550 Flagellar outer dynein arm light chain 2 dd_Smed_v4_19018_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30014496 Ribosome biogenesis protein NSA2 SMESG000028599.1 dd_Smed_v4_1012_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30015973 myosin-11 SMESG000064787.1 dd_Smed_v4_13489_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30014310 ANK_REP_REGION domain-containing protein SMESG000055419.1 dd_Smed_v4_13629_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30010674 SPATA6 domain-containing protein SMESG000053714.1 dd_Smed_v4_10543_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30005442 General transcription factor II-I repeat domain-containing protein 2A dd_Smed_v4_14922_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013779 Tubulin monoglycylase TTLL3 SMESG000029205.1 dd_Smed_v4_10244_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30018838 SMED30018838 dd_Smed_v4_17031_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30006326 piggyBac transposable element-derived protein 4-like dd_Smed_v4_14301_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30017298 SMED30017298 dd_Smed_v4_17790_0_2 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013459 SMED30013459 dd_Smed_v4_16904_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013261 Retrovirus-related Pol polyprotein from transposon dd_Smed_v4_15498_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012385 C2H2-type domain-containing protein dd_Smed_v4_17695_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012660 28S ribosomal protein S16 dd_Smed_v4_1539_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30006335 SMED30006335 SMESG000046906.1 dd_Smed_v4_10831_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30028521 Cadmium metallothionein (MT-Cd) (Cd-MT) SMESG000013781.1 dd_Smed_v4_3412_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023104 SMED30023104 dd_Smed_v4_1576_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30031446 Neuronal guanine nucleotide exchange factor SMESG000003812.1 dd_Smed_v4_5524_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30034412 E3 ubiquitin-protein ligase CBL SMESG000056433.1 dd_Smed_v4_6780_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022077 Cytospin-A SMESG000039310.1 dd_Smed_v4_6934_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30032531 SMED30032531 SMESG000024850.1 dd_Smed_v4_9209_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30029481 SMED30029481 SMESG000079496.1 dd_Smed_v4_6860_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023491 SMED30023491 dd_Smed_v4_14238_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30031687 TNF receptor-associated factor SMESG000014725.1 SMESG000014724.1 SMESG000014706.1 SMESG000014702.1 SMESG000014700.1 dd_Smed_v4_4420_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023859 Serine/threonine protein phosphatase 2A regulatory subunit SMESG000026797.1 dd_Smed_v4_6134_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30027978 Calcyphosin protein SMESG000025859.1 dd_Smed_v4_4512_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30027517 translin-associated factor X-interacting protein 1 SMESG000041265.1 dd_Smed_v4_9718_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30028057 Retinal homeobox protein Rax SMESG000019089.1 dd_Smed_v4_6404_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023613 SMED30023613 dd_Smed_v4_12778_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30030073 Thymus, brain and testes associated SMESG000053617.1 dd_Smed_v4_4229_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30029763 histone H1 SMESG000024348.1 SMESG000010800.1 dd_Smed_v4_601_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30033785 Cell division cycle and apoptosis regulator protein 1 dd_Smed_v4_1181_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022806 Calcyphosin protein SMESG000025859.1 dd_Smed_v4_4512_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30029902 Protein kinase domain-containing protein SMESG000074943.1 SMESG000074941.1 dd_Smed_v4_6760_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023430 set nuclear proto-oncogene SMESG000031906.1 SMESG000031905.1 dd_Smed_v4_618_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022841 Chromosome 17 open reading frame 98 SMESG000007056.1 dd_Smed_v4_9687_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30028081 SMED30028081 SMESG000028922.1 dd_Smed_v4_9517_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021559 SMED30021559 SMESG000079496.1 dd_Smed_v4_6860_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30025067 Endoplasmic reticulum chaperone BiP SMESG000062699.1 dd_Smed_v4_511_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30032907 Alpha-galactosidase SMESG000009912.1 dd_Smed_v4_606_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021508 Glutamate dehydrogenase SMESG000061402.1 dd_Smed_v4_932_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30032094 RIIa domain-containing protein 1 SMESG000079320.1 dd_Smed_v4_4716_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30029583 SMED30029583 dd_Smed_v4_1338_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30034271 Eukaryotic translation initiation factor 5A SMESG000081077.1 dd_Smed_v4_484_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30034308 Integrase catalytic domain-containing protein dd_Smed_v4_12778_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30029781 SMED30029781 dd_Smed_v4_1213_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30024583 SMED30024583 dd_Smed_v4_215_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30030306 ABC transporter domain-containing protein SMESG000058880.1 SMESG000039065.1 dd_Smed_v4_4225_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022339 SMED30022339 dd_Smed_v4_14770_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30032675 Glutamine-rich protein 2 SMESG000081231.1 dd_Smed_v4_6048_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022237 SMED30022237 dd_Smed_v4_15266_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022075 Synaptotagmin protein 5 SMESG000074360.1 dd_Smed_v4_4335_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022564 SMED30022564 dd_Smed_v4_14487_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30032225 SMED30032225 dd_Smed_v4_16904_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30020666 Glutamine-rich protein 2 SMESG000081231.1 dd_Smed_v4_6048_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30030788 SMED30030788 SMESG000079496.1 dd_Smed_v4_6860_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30028337 SAP domain-containing protein dd_Smed_v4_1181_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30024648 RRM domain-containing protein dd_Smed_v4_11998_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001515 Annexin SMESG000042839.1 dd_Smed_v4_1104_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001112 SMED30001112 SMESG000061228.1 dd_Smed_v4_8351_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001112 SMED30001112 SMESG000061228.1 dd_Smed_v4_13515_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30017314 Dynein regulatory complex subunit 7 SMESG000078850.1 dd_Smed_v4_12588_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30011615 SMED30011615 SMESG000036524.1 dd_Smed_v4_11034_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30009224 early growth response-3 SMESG000000959.1 dd_Smed_v4_12410_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30009224 early growth response-3 SMESG000000959.1 dd_Smed_v4_14711_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30006633 SMED30006633 SMESG000040042.1 dd_Smed_v4_11386_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30017925 Dynein light chain Tctex-type 1 SMESG000026631.1 dd_Smed_v4_1166_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30003032 SMED30003032 SMESG000061110.1 dd_Smed_v4_11638_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30005150 3' histone mRNA exonuclease 1 SMESG000058668.1 dd_Smed_v4_1266_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30018893 Enkurin domain-containing protein SMESG000081414.1 dd_Smed_v4_12339_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30019298 Heterogeneous nuclear ribonucleoprotein L SMESG000005298.1 dd_Smed_v4_1327_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30015672 Gelsolin-like protein SMESG000015928.1 dd_Smed_v4_1215_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30010024 SMED30010024 SMESG000038072.1 dd_Smed_v4_13847_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30007143 Nucleolar GTP-binding protein 2 SMESG000026847.1 dd_Smed_v4_1134_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30002882 SMED30002882 SMESG000069367.1 dd_Smed_v4_11838_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30002882 SMED30002882 SMESG000069367.1 dd_Smed_v4_9233_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012858 serine/threonine-protein kinase DCLK1 SMESG000078466.1 dd_Smed_v4_13093_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012858 serine/threonine-protein kinase DCLK1 dd_Smed_v4_5129_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30016422 2-oxoisovalerate dehydrogenase subunit alpha SMESG000021412.1 dd_Smed_v4_10732_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30007188 Calmodulin SMESG000078272.1 dd_Smed_v4_11942_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30017312 Coiled-coil domain-containing protein 189 SMESG000046576.1 dd_Smed_v4_12703_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012981 Cyclic nucleotide gated channel 1 SMESG000036524.1 dd_Smed_v4_11034_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30014144 Phytanoyl-CoA dioxygenase domain-containing protein 1-like SMESG000023010.1 dd_Smed_v4_1207_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30009282 EF-hand calcium binding domain 2 SMESG000049879.1 SMESG000003119.1 dd_Smed_v4_11976_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30010322 SMED30010322 SMESG000006336.1 dd_Smed_v4_11671_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30018865 DUF1619 domain-containing protein SMESG000057489.1 dd_Smed_v4_11225_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30011581 AP2-associated protein kinase 1-like Protein SMESG000041938.1 SMESG000041937.1 SMESG000051989.1 dd_Smed_v4_1179_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30005771 SMED30005771 SMESG000042003.1 dd_Smed_v4_12482_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013262 SMED30013262 SMESG000060779.1 dd_Smed_v4_11792_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30007470 Coiled-coil domain-containing protein 180 SMESG000039547.1 dd_Smed_v4_12302_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30009968 Intraflagellar transport protein 122 homolog SMESG000039305.1 SMESG000039304.1 dd_Smed_v4_11912_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013865 OFD1 SMESG000046592.1 dd_Smed_v4_13339_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30003236 Tropomodulin SMESG000054078.1 dd_Smed_v4_3279_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30016092 SMED30016092 dd_Smed_v4_3534_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30007568 NADH-ubiquinone oxidoreductase 75 kDa subunit, mitochondrial SMESG000081864.1 dd_Smed_v4_2402_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30011383 NEDD8 dd_Smed_v4_403_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30011412 Ribosomal protein L37 dd_Smed_v4_97_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30010375 cytochrome c oxidase subunit I dd_Smed_v4_753_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001197 SMED30001197 SMESG000004996.1 dd_Smed_v4_4124_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30003686 NADH dehydrogenase subunit 2 dd_Smed_v4_505_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30025791 B box-type domain-containing protein SMESG000078465.1 dd_Smed_v4_11048_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30031485 Lipoxygenase homology domain-containing protein 1 SMESG000001054.1 dd_Smed_v4_10315_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30034851 Procollagen galactosyltransferase SMESG000037408.1 dd_Smed_v4_10276_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30031490 SMED30031490 SMESG000017778.1 dd_Smed_v4_10175_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30033756 60S ribosomal protein L37 dd_Smed_v4_97_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30027979 40S ribosomal protein S27 SMESG000066109.1 SMESG000052687.1 SMESG000014240.1 SMESG000069832.1 SMESG000037642.1 dd_Smed_v4_106_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30027150 Pleckstrin homology and RhoGEF domain containing G5 SMESG000052365.1 dd_Smed_v4_14038_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30028184 Ras-related protein Rab-32 SMESG000060723.1 dd_Smed_v4_1037_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021731 Multidrug resistance protein 1-like protein SMESG000004996.1 dd_Smed_v4_4124_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30024872 Cysteine and histidine-rich domain-containing protein 1 SMESG000019808.1 dd_Smed_v4_1390_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30029518 Selenoprotein W dd_Smed_v4_572_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30027383 SMED30027383 dd_Smed_v4_19765_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30025849 Centrosome and spindle pole-associated protein 1 SMESG000080361.1 dd_Smed_v4_13453_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30030595 DDE_Tnp_IS1595 domain-containing protein dd_Smed_v4_42270_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022118 Kunitz-like protease inhibitor dd_Smed_v4_2814_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30025688 Protein tilB homolog SMESG000058220.1 dd_Smed_v4_10124_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021433 60S ribosomal protein L39 dd_Smed_v4_394_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30031746 SMED30031746 dd_Smed_v4_24183_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30029361 KIF3B-like protein SMESG000020245.1 dd_Smed_v4_9308_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30029361 KIF3B-like protein SMESG000075065.1 dd_Smed_v4_4343_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30025953 SMED30025953 dd_Smed_v4_5792_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30031754 SMED30031754 dd_Smed_v4_14636_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30034173 Calcium-dependent protein kinase SMESG000033648.1 dd_Smed_v4_13677_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30033234 SMED30033234 dd_Smed_v4_37328_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30026188 ER membrane protein complex subunit 10 dd_Smed_v4_2594_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30020913 SMED30020913 SMESG000009078.1 dd_Smed_v4_13484_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30026825 Dimer_Tnp_hAT domain-containing protein dd_Smed_v4_48621_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30031308 ATP synthase F0 subunit 6 dd_Smed_v4_258_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30034623 cytochrome c oxidase subunit III dd_Smed_v4_258_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30035193 Heat shock protein 90 dd_Smed_v4_56_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30035174 SMED30035174 dd_Smed_v4_6013_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30029698 Caspase-7 SMESG000053168.1 dd_Smed_v4_1167_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30034101 SMED30034101 dd_Smed_v4_3534_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30026531 cytochrome c oxidase subunit II dd_Smed_v4_297_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30033740 SMED30033740 dd_Smed_v4_258_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30033740 SMED30033740 dd_Smed_v4_957_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30033869 SMED30033869 dd_Smed_v4_6382_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30027076 FAD-binding PCMH-type domain-containing protein SMESG000066568.1 dd_Smed_v4_10292_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022681 Dynein heavy chain 7 axonemal SMESG000012956.1 dd_Smed_v4_13792_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022681 Dynein heavy chain 7 axonemal SMESG000012956.1 dd_Smed_v4_5350_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30025223 Neuropeptide Y prohormone-2 SMESG000050247.1 SMESG000050248.1 dd_Smed_v4_10191_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30033335 SMED30033335 SMESG000002226.1 dd_Smed_v4_10738_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30026477 SMED30026477 dd_Smed_v4_275_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30029399 SMED30029399 SMESG000015116.1 dd_Smed_v4_10874_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30029350 Serine incorporator 3 SMESG000020805.1 dd_Smed_v4_1130_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022007 SMED30022007 dd_Smed_v4_90717_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023388 GRB2 associated binding protein-1 dd_Smed_v4_5117_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30025152 cilia- and flagella-associated protein 91 SMESG000056200.1 dd_Smed_v4_10405_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30025152 cilia- and flagella-associated protein 91 SMESG000056200.1 dd_Smed_v4_9724_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30028343 Cytosolic carboxypeptidase 2 SMESG000006325.1 dd_Smed_v4_13454_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30027761 SMED30027761 dd_Smed_v4_54604_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013975 Ras association domain-containing protein 1 SMESG000029652.1 dd_Smed_v4_5323_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30002774 SMED30002774 SMESG000017229.1 dd_Smed_v4_613_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30014618 SMED30014618 SMESG000067158.1 SMESG000079384.1 SMESG000006522.1 dd_Smed_v4_6854_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30000831 Golgi-associated plant pathogenesis protein 1 SMESG000036937.1 dd_Smed_v4_2081_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30006230 Sperm surface protein Sp17 SMESG000046919.1 dd_Smed_v4_2279_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30006230 Sperm surface protein Sp17 SMESG000046919.1 dd_Smed_v4_4783_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001049 Ubiquitin carboxyl-terminal hydrolase SMESG000038532.1 SMESG000038519.1 SMESG000038510.1 SMESG000036103.1 SMESG000036102.1 SMESG000036062.1 dd_Smed_v4_8017_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30006006 SMED30006006 SMESG000007018.1 SMESG000007017.1 dd_Smed_v4_1969_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001916 IRS-type PTB domain-containing protein SMESG000027222.1 dd_Smed_v4_9490_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013825 Acyl-coenzyme A thioesterase 13 SMESG000063995.1 dd_Smed_v4_4659_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013498 LIM zinc-binding domain-containing protein SMESG000072162.1 dd_Smed_v4_537_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30002502 Choline-phosphate cytidylyltransferase SMESG000081359.1 dd_Smed_v4_5385_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001113 FERM domain-containing protein SMESG000048801.1 dd_Smed_v4_5600_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30003405 GCR135 SMESG000076928.1 dd_Smed_v4_39877_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001158 SMED30001158 SMESG000009491.1 dd_Smed_v4_9572_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30003738 hadrian SMESG000043826.1 SMESG000043821.1 dd_Smed_v4_3606_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30017235 SMED30017235 SMESG000067158.1 SMESG000079384.1 SMESG000006522.1 dd_Smed_v4_6854_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30004739 TNF receptor-associated factor SMESG000014725.1 SMESG000014724.1 SMESG000014706.1 SMESG000014702.1 SMESG000014700.1 dd_Smed_v4_4420_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30002976 Integrase_H2C2 domain-containing protein SMESG000031440.1 dd_Smed_v4_9924_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30017053 SMED30017053 SMESG000004885.1 dd_Smed_v4_5297_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30000819 Acid sphingomyelinase-like phosphodiesterase SMESG000071517.1 dd_Smed_v4_5377_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30015316 Cell division control protein 42 homolog SMESG000056490.1 dd_Smed_v4_8621_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30008984 Protein phosphatase 1G SMESG000030206.1 dd_Smed_v4_2086_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30015252 Mitochondrial inner membrane protein OXA1L SMESG000039158.1 dd_Smed_v4_4072_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30010504 SMED30010504 SMESG000010514.1 dd_Smed_v4_4965_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001920 SMED30001920 SMESG000013429.1 dd_Smed_v4_21056_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30000512 cilia- and flagella-associated protein 61 SMESG000059955.1 dd_Smed_v4_4908_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30010410 SMED30010410 SMESG000021757.1 dd_Smed_v4_8797_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30009981 Ras-related protein SMESG000044147.1 dd_Smed_v4_6181_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30002256 coiled-coil domain-containing protein 81 SMESG000036887.1 dd_Smed_v4_6753_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30018603 Receptor expression-enhancing protein SMESG000043862.1 dd_Smed_v4_838_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30005802 SMED30005802 SMESG000072483.1 dd_Smed_v4_5611_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30000605 UPF0193 protein EVG1 SMESG000056865.1 dd_Smed_v4_9772_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001147 Ras-like GTP-binding protein YPT1 SMESG000044147.1 dd_Smed_v4_6181_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30002166 SMED30002166 SMESG000058880.1 SMESG000039065.1 dd_Smed_v4_4225_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013430 Vigilin High density lipoprotein-binding protein SMESG000018596.1 SMESG000006601.1 dd_Smed_v4_6161_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30016840 Phosphodiesterase SMESG000019038.1 dd_Smed_v4_8595_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30014640 Small heat shock protein p36 SMESG000028601.1 dd_Smed_v4_6399_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012665 FERM domain-containing protein SMESG000062741.1 SMESG000053535.1 SMESG000049374.1 SMESG000033049.1 SMESG000024644.1 SMESG000016667.1 dd_Smed_v4_6227_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001248 SMED30001248 SMESG000013596.1 dd_Smed_v4_6322_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30003228 Dach-1 SMESG000005090.1 dd_Smed_v4_5823_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001782 Fibronectin type III domain-containing protein SMESG000024682.1 dd_Smed_v4_3381_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30007764 SMED30007764 SMESG000036249.1 dd_Smed_v4_9326_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30008229 SMED30008229 SMESG000077869.1 dd_Smed_v4_14890_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30009913 Beta-ureidopropionase SMESG000060425.1 dd_Smed_v4_1584_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30008926 ATP-dependent DNA helicase SMESG000023939.1 dd_Smed_v4_6024_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30009268 SMED30009268 SMESG000065344.1 dd_Smed_v4_3354_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30011898 Protein F37C4.5 SMESG000008044.1 dd_Smed_v4_9190_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001096 40S ribosomal protein S23 SMESG000017264.1 dd_Smed_v4_290_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30019834 Guanine nucleotide-binding protein subunit beta-2-like 1 SMESG000076568.1 dd_Smed_v4_174_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001380 Zinc finger FYVE domain-containing protein SMESG000014968.1 dd_Smed_v4_4344_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30005206 Serine/arginine-rich splicing factor 1 SMESG000075205.1 dd_Smed_v4_1192_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001560 SMED30001560 SMESG000033391.1 dd_Smed_v4_5969_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30011242 Synaptosomal-associated protein 29 SMESG000001576.1 dd_Smed_v4_1819_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30008655 Tubulin alpha chain SMESG000054547.1 dd_Smed_v4_508_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30005190 SMED30005190 SMESG000041069.1 dd_Smed_v4_237_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30008579 ST13 Hsp70 interacting protein SMESG000071677.1 SMESG000069228.1 SMESG000017570.1 SMESG000017358.1 SMESG000017347.1 SMESG000013728.1 SMESG000001430.1 dd_Smed_v4_668_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30009642 Neural-cadherin SMESG000045006.1 dd_Smed_v4_9254_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30016387 HAP1 N-terminal domain-containing protein SMESG000065238.1 SMESG000065237.1 dd_Smed_v4_4847_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30010044 Rho GTPase-activating protein 7 SMESG000056012.1 dd_Smed_v4_9530_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30011727 Dedicator of cytokinesis 4b SMESG000063593.1 SMESG000063592.1 SMESG000063595.1 dd_Smed_v4_6156_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30009859 40S ribosomal protein S24 SMESG000035929.1 dd_Smed_v4_164_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001950 Muscle associated receptor tyrosine kinase SMESG000017131.1 dd_Smed_v4_6799_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30011604 Long-chain-fatty-acid--CoA ligase SMESG000081754.1 dd_Smed_v4_2153_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001490 ADF-H domain-containing protein SMESG000080129.1 dd_Smed_v4_260_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30000372 Dmd-2 splice form 1 SMESG000075920.1 dd_Smed_v4_31674_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001237 Tubulin polymerization-promoting protein family member 3 SMESG000002261.1 dd_Smed_v4_650_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30003905 Far upstream element-binding protein SMESG000037106.1 dd_Smed_v4_812_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30010222 FKBP2 SMESG000026974.1 dd_Smed_v4_1536_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30000794 Luc7-like protein 3 SMESG000041410.1 dd_Smed_v4_1899_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30004335 TBC1 domain family member 2B SMESG000012909.1 dd_Smed_v4_2925_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30014009 Tubulin polyglutamylase TTLL4 SMESG000073336.1 dd_Smed_v4_17537_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30002133 Polyubiquitin SMESG000039444.1 SMESG000014081.1 dd_Smed_v4_34_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30007243 Polypeptide N-acetylgalactosaminyltransferase SMESG000081451.1 dd_Smed_v4_5333_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30000065 SMED30000065 SMESG000049103.1 dd_Smed_v4_397_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30005283 SMED30005283 SMESG000052690.1 dd_Smed_v4_9995_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30004634 Mitochondrial processing peptidase beta subunit SMESG000037024.1 dd_Smed_v4_729_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30009510 intraflagellar transport protein 80 homolog SMESG000066998.1 dd_Smed_v4_9110_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30002589 Oxysterol-binding protein SMESG000065901.1 dd_Smed_v4_3179_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30000108 Glycerol-3-phosphate dehydrogenase [NAD( )] SMESG000008767.1 dd_Smed_v4_4661_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001079 PSDC domain-containing protein SMESG000023831.1 dd_Smed_v4_5455_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30011431 SMED30011431 SMESG000063184.1 dd_Smed_v4_2217_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30000950 slc16a-22 SMESG000077590.1 dd_Smed_v4_6317_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30008231 Calponin-homology (CH) domain-containing protein SMESG000036289.1 dd_Smed_v4_5824_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30006655 60S ribosomal protein L32 SMESG000060036.1 dd_Smed_v4_149_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30011294 Protein kinase domain-containing protein SMESG000041899.1 SMESG000031064.1 dd_Smed_v4_8347_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30001702 SMED30001702 SMESG000042167.1 dd_Smed_v4_8527_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30014459 bak-2 SMESG000008222.1 dd_Smed_v4_1767_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30005762 Contactin/TAG-1 cell adhesion molecule SMESG000036495.1 dd_Smed_v4_2673_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30034763 c-Jun N-terminal kinases SMESG000043618.1 dd_Smed_v4_5924_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30035047 Sperm associated antigen 17 SMESG000038878.1 dd_Smed_v4_9301_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30032970 Alpha-int-3 SMESG000034289.1 dd_Smed_v4_8943_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021019 CYTOSOL_AP domain-containing protein SMESG000037599.1 dd_Smed_v4_181_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30031752 Metal transporter cnnm2 SMESG000070597.1 dd_Smed_v4_18450_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30035599 meis SMESG000006530.1 dd_Smed_v4_15951_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30028172 Serine palmitoyltransferase 2 SMESG000016646.1 dd_Smed_v4_1633_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30033139 TNF receptor-associated factor SMESG000079607.1 SMESG000072955.1 SMESG000049847.1 SMESG000049844.1 SMESG000049832.1 SMESG000049812.1 SMESG000049806.1 SMESG000049805.1 SMESG000049772.1 SMESG000049767.1 SMESG000049756.1 SMESG000049745.1 SMESG000049740.1 SMESG000049739.1 SMESG000049695.1 SMESG000049688.1 SMESG000049683.1 SMESG000049676.1 SMESG000049665.1 SMESG000049663.1 SMESG000049647.1 SMESG000049621.1 SMESG000049614.1 SMESG000049601.1 SMESG000049567.1 SMESG000049548.1 SMESG000040301.1 SMESG000040257.1 SMESG000032755.1 SMESG000032715.1 SMESG000022696.1 SMESG000022691.1 SMESG000022676.1 SMESG000022665.1 SMESG000022640.1 SMESG000022619.1 SMESG000022612.1 dd_Smed_v4_490_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30034947 SMED30034947 SMESG000077223.1 dd_Smed_v4_7005_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30024572 SMED30024572 SMESG000022691.1 SMESG000022690.1 dd_Smed_v4_2130_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30025898 SMED30025898 SMESG000051187.1 dd_Smed_v4_16909_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30034315 Adenylyl cyclase-associated protein SMESG000032321.1 dd_Smed_v4_727_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30034099 SMED30034099 SMESG000040016.1 SMESG000040019.1 dd_Smed_v4_22578_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30035924 SMED30035924 SMESG000043662.1 dd_Smed_v4_11896_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022778 SMED30022778 SMESG000079288.1 SMESG000017831.1 dd_Smed_v4_15746_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30030220 Helicase for meiosis 1 SMESG000065404.1 dd_Smed_v4_9538_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30033701 chromobox protein homolog 1 SMESG000055315.1 SMESG000055314.1 SMESG000054375.1 SMESG000054374.1 dd_Smed_v4_4855_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30035339 RIMS binding protein 2 SMESG000001071.1 SMESG000001061.1 SMESG000001060.1 dd_Smed_v4_9824_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30033399 Ras-related protein Rab-11A SMESG000023556.1 dd_Smed_v4_6025_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30035074 SMED30035074 SMESG000068982.1 dd_Smed_v4_1190_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30032159 Oxysterol-binding protein SMESG000046022.1 dd_Smed_v4_5423_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023736 sine oculis-1/2 SMESG000001687.1 dd_Smed_v4_15436_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30028489 START domain-containing protein SMESG000028630.1 dd_Smed_v4_3237_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30028489 START domain-containing protein SMESG000078713.1 SMESG000060505.1 SMESG000055485.1 SMESG000051367.1 SMESG000073216.1 SMESG000045326.1 SMESG000032032.1 SMESG000021912.1 SMESG000017091.1 dd_Smed_v4_12660_2_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30030892 Intraflagellar transport protein 172 SMESG000028841.1 dd_Smed_v4_7533_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30030892 Intraflagellar transport protein 172 SMESG000028841.1 dd_Smed_v4_10638_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30020664 Potassium voltage-gated channel subfamily A member 2 SMESG000028841.1 dd_Smed_v4_7533_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30032500 Ras-related protein Rab-10 SMESG000052620.1 dd_Smed_v4_6049_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30032202 Doublecortin domain-containing protein SMESG000017756.1 dd_Smed_v4_11770_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30017854 SMED30017854 SMESG000014767.1 dd_Smed_v4_75560_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30019452 Ceramide glucosyltransferase SMESG000070132.1 dd_Smed_v4_7543_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30018300 slc42a-2 SMESG000005978.1 dd_Smed_v4_2323_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30003044 Reticulocalbin SMESG000077405.1 dd_Smed_v4_5905_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013386 netrin 1 SMESG000006806.1 dd_Smed_v4_9795_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30019836 CCDC151 SMESG000007771.1 dd_Smed_v4_4526_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30017018 SMED30017018 SMESG000007294.1 dd_Smed_v4_371_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30014525 Dolichyl-diphosphooligosaccharide--protein glycosyltransferase 48 kDa subunit SMESG000010589.1 dd_Smed_v4_948_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30019565 Radial spoke head protein 4-like protein A SMESG000044927.1 dd_Smed_v4_5346_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30011748 SMED30011748 SMESG000013713.1 dd_Smed_v4_9787_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30014692 Histone H4 SMESG000036410.1 dd_Smed_v4_506_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013731 Centrin SMESG000040368.1 dd_Smed_v4_7903_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30015423 Cilia- and flagella-associated protein 20 SMESG000057288.1 dd_Smed_v4_4843_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30016950 Dystrophin SMESG000020523.1 dd_Smed_v4_5325_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30007886 SMED30007886 SMESG000055169.1 dd_Smed_v4_9583_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30013227 WD repeat-containing protein SMESG000042025.1 dd_Smed_v4_9187_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30016446 Root phototropism protein 2 SMESG000067415.1 dd_Smed_v4_8081_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012572 Leucine--tRNA ligase SMESG000071689.1 dd_Smed_v4_9705_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30014181 slc23a-2 SMESG000066926.1 SMESG000066923.1 SMESG000066912.1 SMESG000066905.1 dd_Smed_v4_9401_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30005449 SMED30005449 SMESG000014251.1 dd_Smed_v4_9793_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30015650 FGFR1 oncogene partner SMESG000006505.1 dd_Smed_v4_5371_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30019240 Protein FAM151A SMESG000000164.1 dd_Smed_v4_9939_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30011943 Fibronectin type III and ankyrin repeat domains 1 SMESG000033969.1 dd_Smed_v4_7571_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30018550 CEP78 SMESG000064712.1 dd_Smed_v4_9671_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30018632 Protein kinase domain-containing protein SMESG000017261.1 dd_Smed_v4_2030_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30015426 SMED30015426 SMESG000038532.1 SMESG000038520.1 SMESG000038497.1 SMESG000036112.1 SMESG000036067.1 dd_Smed_v4_5097_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30017802 SMED30017802 SMESG000073243.1 dd_Smed_v4_5953_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30008679 Leucine rich repeat containing 34 SMESG000053819.1 dd_Smed_v4_9926_1_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30012605 FERM domain-containing protein SMESG000034888.1 dd_Smed_v4_4999_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30017971 ANK_REP_REGION domain-containing protein SMESG000026132.1 dd_Smed_v4_6201_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30005322 SMED30005322 SMESG000078208.1 dd_2727 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30016580 SMED30016580 SMESG000044545.1 dd_Smed_v4_5799_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022501 Fatty acid-binding protein, heart SMESG000029500.1 dd_Smed_v4_599_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30026396 Receptor expression-enhancing protein SMESG000044545.1 dd_Smed_v4_5799_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30020213 tensin isoform X3 SMESG000033851.1 dd_Smed_v4_5620_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021194 Calcitonin-like receptor SMESG000080399.1 dd_Smed_v4_7328_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30031389 Calnexin SMESG000016275.1 dd_Smed_v4_632_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30026112 Sorting nexin-27 SMESG000081127.1 dd_Smed_v4_2513_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30029077 Macrophage-expressed gene 1 protein SMESG000044681.1 dd_Smed_v4_983_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30026870 SWIM-type domain-containing protein SMESG000060198.1 dd_Smed_v4_5330_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30026696 40S ribosomal protein S19 SMESG000023987.1 SMESG000009719.1 dd_Smed_v4_202_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30020736 nucleolar protein 58 SMESG000071386.1 dd_Smed_v4_1982_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30025960 SMED30025960 SMESG000027347.1 dd_27863 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022622 Centrosomal protein 350 SMESG000033533.1 dd_Smed_v4_5967_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021790 UBX domain-containing protein 4 SMESG000047328.1 dd_Smed_v4_823_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30034470 PDZ ring finger protein 4 SMESG000021620.1 dd_Smed_v4_5781_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30035681 Intraflagellar transport protein 88 SMESG000039906.1 dd_Smed_v4_5484_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30028734 SMED30028734 SMESG000038532.1 SMESG000038520.1 SMESG000038497.1 SMESG000036112.1 SMESG000036067.1 dd_Smed_v4_5097_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022032 SMED30022032 SMESG000038532.1 SMESG000038520.1 SMESG000038497.1 SMESG000036112.1 SMESG000036067.1 dd_Smed_v4_5097_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30026979 SMED30026979 SMESG000076644.1 SMESG000076643.1 dd_Smed_v4_227_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30026287 SMED30026287 SMESG000057102.1 dd_Smed_v4_45699_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30024358 Protein 4.1 SMESG000029732.1 dd_Smed_v4_5331_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30024358 Protein 4.1 SMESG000029732.1 dd_Smed_v4_2825_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021940 SMED30021940 SMESG000017261.1 dd_Smed_v4_2030_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30029166 Coiled-coil domain-containing protein 178 SMESG000021560.1 dd_Smed_v4_8905_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022531 Triadin-like isoform X4 SMESG000069834.1 dd_Smed_v4_5981_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30034766 Enolase SMESG000052380.1 dd_Smed_v4_510_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30031822 SMED30031822 SMESG000077258.1 dd_Smed_v4_8993_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021479 SMED30021479 SMESG000017261.1 dd_Smed_v4_2030_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30025634 MFS domain-containing protein SMESG000066500.1 dd_Smed_v4_9883_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30027431 Protein arginine N-methyltransferase 7 SMESG000008380.1 dd_Smed_v4_8814_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022565 SMED30022565 SMESG000040891.1 dd_Smed_v4_5934_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30031429 SMED30031429 SMESG000038604.1 dd_Smed_v4_1973_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30029360 Low density lipoprotein receptor class A cysteine rich SMESG000073751.1 dd_Smed_v4_2114_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30032105 Polypeptide N-acetylgalactosaminyltransferase SMESG000025206.1 dd_Smed_v4_4615_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30027244 Protein TBATA SMESG000022377.1 dd_Smed_v4_8051_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30028261 Innexin SMESG000030970.1 dd_Smed_v4_6798_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30026742 Calpain B SMESG000017238.1 dd_Smed_v4_8673_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021332 Cytochrome c SMESG000045852.1 dd_Smed_v4_464_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30029668 Adenylate kinase isoenzyme 5 SMESG000020486.1 SMESG000020480.1 dd_Smed_v4_5119_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021145 SMED30021145 SMESG000023086.1 dd_Smed_v4_6287_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022035 Dihydroorotate dehydrogenase (Quinone), mitochondrial SMESG000065729.1 dd_Smed_v4_4266_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30029899 slc25a-30 SMESG000044697.1 SMESG000022161.1 dd_Smed_v4_50_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30027818 Si:ch211-163l21.7 SMESG000026490.1 dd_Smed_v4_3833_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30028417 Bardet-Biedl syndrome 1 protein homolog SMESG000009880.1 dd_Smed_v4_7298_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30029274 SMED30029274 SMESG000014251.1 dd_Smed_v4_9793_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022421 RIB43A-like with coiled-coils protein 2 SMESG000037028.1 dd_Smed_v4_4547_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30027540 Cathepsin F SMESG000005279.1 dd_Smed_v4_456_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30025990 NPHP1 SMESG000061008.1 dd_Smed_v4_9990_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30016875 Rho-associated kinase SMESG000057753.1 dd_Smed_v4_2914_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30018252 Cathepsin L2 SMESG000049723.1 dd_Smed_v4_48_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30018815 Sperm flagellar protein 1 SMESG000014677.1 dd_Smed_v4_5648_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30019531 NPHP6 SMESG000072747.1 dd_Smed_v4_7145_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30000058 SMED30000058 SMESG000022049.1 dd_Smed_v4_499_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30008195 Non-specific serine/threonine protein kinase SMESG000022413.1 dd_Smed_v4_10848_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30016453 SMED30016453 SMESG000033480.1 SMESG000033479.1 SMESG000033473.1 dd_Smed_v4_5607_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30016080 Deoxyhypusine hydroxylase SMESG000051726.1 SMESG000051721.1 dd_Smed_v4_703_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30018730 SOCS box domain-containing protein SMESG000001445.1 SMESG000001437.1 dd_Smed_v4_9937_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30016917 Tctex1 domain containing 1 SMESG000040148.1 dd_Smed_v4_9321_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30016922 Parkin coregulated protein SMESG000000577.1 dd_Smed_v4_3899_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30018731 MORN repeat-containing protein 5 SMESG000023247.1 dd_Smed_v4_7020_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30002139 Vacuole membrane protein 1 SMESG000034612.1 dd_Smed_v4_1156_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30003047 Nalp (Nacht leucine rich repeat and pyrin domain containing) SMESG000047177.1 SMESG000045615.1 dd_Smed_v4_16437_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30017807 SMED30017807 SMESG000041639.1 dd_Smed_v4_9130_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30017762 SMED30017762 SMESG000016810.1 dd_Smed_v4_783_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30024215 intraflagellar transport protein 81 homolog SMESG000026141.1 dd_Smed_v4_8803_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021941 SMED30021941 SMESG000051593.1 dd_Smed_v4_9206_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30031423 ATP synthase subunit SMESG000021514.1 dd_Smed_v4_428_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30031908 SMED30031908 SMESG000054111.1 dd_Smed_v4_9796_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30031547 Na_H_Exchanger domain-containing protein SMESG000005979.1 dd_Smed_v4_7736_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30032906 SMED30032906 SMESG000022399.1 dd_Smed_v4_8295_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30035468 DNAHb-1 SMESG000072114.1 SMESG000072113.1 SMESG000072112.1 dd_Smed_v4_3670_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30027239 Tetratricopeptide repeat protein 30A SMESG000024323.1 dd_Smed_v4_8798_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30032910 Protein ANKUB1 SMESG000033543.1 dd_Smed_v4_9027_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30035317 Phosphoglycerate kinase SMESG000039090.1 dd_Smed_v4_972_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30032692 Histone H3 SMESG000074938.1 SMESG000074937.1 dd_Smed_v4_9531_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30020178 Ubiquitinyl hydrolase 1 SMESG000057792.1 SMESG000057788.1 dd_Smed_v4_2744_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023409 Glutamate-rich 3 SMESG000029848.1 SMESG000029846.1 dd_Smed_v4_8627_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30021661 Carbonic anhydrase 7 SMESG000017176.1 SMESG000017171.1 dd_Smed_v4_4841_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30025815 SMED30025815 SMESG000028784.1 SMESG000061889.1 dd_Smed_v4_3519_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30035908 Serine-rich adhesin for platelets (Staphylococcus aureus surface protein A) SMESG000025158.1 dd_Smed_v4_3220_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30035790 SMED30035790 SMESG000006146.1 dd_Smed_v4_28660_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30027701 ATP dependent RNA helicase DDX5 SMESG000012031.1 dd_Smed_v4_3816_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30026278 Pre-mRNA-splicing factor ISY1 SMESG000047126.1 SMESG000004187.1 dd_Smed_v4_8243_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30034500 early growth response-2 SMESG000004840.1 dd_Smed_v4_9273_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023111 RBR-type E3 ubiquitin transferase SMESG000054560.1 dd_Smed_v4_4845_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30023258 Cell cycle associated protein 1a SMESG000043092.1 dd_Smed_v4_936_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022043 Protein odd-skipped-related 2 SMESG000032229.1 dd_Smed_v4_10039_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30022522 Centrin-3 SMESG000016538.1 dd_Smed_v4_11582_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30020261 SMED30020261 SMESG000045656.1 dd_Smed_v4_797_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30035611 Fras1 related extracellular matrix protein SMESG000032220.1 dd_Smed_v4_2407_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30026364 SMED-P53 SMESG000078256.1 SMESG000078255.1 dd_Smed_v4_5563_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30031461 Phosphatidylinositol 4-phosphate 5-kinase 2 SMESG000012434.1 dd_Smed_v4_9195_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30002944 GGACT domain-containing protein SMESG000081395.1 dd_Smed_v4_8685_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx SMED30014876 SMED30014876 SMESG000054780.1 SMESG000025014.1 SMESG000025004.1 dd_Smed_v4_61_0_1 dd_Smed_v4 PMID:29674431
Fincher et al., 2018
pharynx
↳contained in posterior region of the whole animal and parapharyngeal region
↳existence overlaps Stage 6, Stage 5, juvenile stage, asexual adult, adult hermaphrodite, Stage 8 and Stage 7
↳existence starts during or after Stage 5
↳part of digestive system
→ pharynx progenitor cell and pharynx primordium develops into pharynx
→ pharynx lumen luminal space of pharynx
Expand to see terms that part of pharynx
BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):
Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.
EXPLORE ONTOLOGY GRAPH:
Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.
Embryonic Molecular Fate Mapping
All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource
DESCRIPTION:
foxA1, a pioneer transcription factor required for pharynx maintenance and regeneration during adulthood (Adler et al., 2014; Scimone et al., 2014), may similarly be required for construction of the definitive pharynx during embryogenesis. Development of the definitive pharynx, the single opening of the Smed digestive tract, commenced during S4-S5 with the onset of foxA1 expression in parenchymal cells, many of which were located in the oral hemisphere (Figure 1 – figure supplement 14A). The distribution of foxA1+ cells remained concentrated in and around the developing definitive pharynx rudiment during S6-S8, a pattern reminiscent of that observed in S. polychroa embryos (Martín-Durán et al., 2010), as well as in intact and regenerating Smed asexual adults (Adler et al., 2014; Scimone et al., 2014). The definitive pharynx develops beneath the degenerating temporary embryonic pharynx, and marks the ventral side of the embryos during S6 and thereafter (Martín-Durán and Romero, 2011). foxA1 upregulation during S5-S8 was statistically significant, albeit the adjusted p-values were above the thresholds set for inclusion in the enriched transcript lists presented in Figure 1 – source data 5, Figure 1 – source data 6, Figure 1 – source data 7, Figure 1 – source data 8. meis, a transcription factor coexpressed in foxA1+ neoblasts and expressed within the regenerating pharynx (Scimone et al., 2014), was among the S5 enriched transcripts (Figure 1 – source data 5); its expression trend was similar to foxA1 during embryogenesis (Figure 1 – figure supplement 14B). Two markers exhibiting pharynx-restricted expression in adults, laminin and npp-1 (Adler et al., 2014), were upregulated during S6-S8, after development of the definitive pharynx rudiment was evident (Figure 1 – figure supplement 14B).
FIGURES:

Figure 1 – figure supplement 14: Molecular markers for the definitive pharynx
A: WISH developmental time course using foxA1 riboprobes (blue), S3-S8. foxA1 expression was consistently detected in the embryonic pharynx lumen during S3-S5 (black arrowheads). Anterior: top (S6-S8). Black arrowheads: embryonic pharynx. Red arrowheads: definitive pharynx. O: oral hemisphere. A: aboral hemisphere. D: dorsal. V: ventral. Scale bars: 100 µm.
B: Average RPKM values per embryo for the definitive pharynx markers foxA1, meis, laminin, npp-1 during embryogenesis (Adler et al., 2014; Scimone et al., 2014), Y (yolk), Stage (S) S2-S8.
IN SITU HYBRIDIZATION DATA:
Smed ID | Accession | Name | Alias | Expressed during stage(s) | Tissue/Pattern | Images |
---|---|---|---|---|---|---|
SMED30027428 | AFJ24799.1 | forkhead box A-1 | foxA1 | Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8 | embryonic digestive system, digestive system, pharynx, pharynx progenitor cell, embryonic pharynx | ![]() |
Click to see image symbols and abbreviations
Abbreviation or symbol | Definition |
---|---|
O | oral hemisphere |
A | aboral hemisphere |
D | dorsal |
V | ventral |
L | lateral |
black arrowhead | embryonic pharynx |
red arrowhead | definitive pharynx |
black arrows | primitive gut |
yellow arrows | primitive ectoderm cells |
cyan arrows | brain |
cyan arrowheads | nerve cords |
blue arrowheads | eye progenitors (trail cells) |
purple arrowheads | eyes |
scale bar | 100 µm |
SEQUENCES:
smed_20140614 transcript sequences for genes validated by in situ hybridization (above).
>SMED30027428 ID=SMED30027428|Name=forkhead box A-1|organism=Schmidtea mediterranea sexual|type=transcript|length=2149bp
ATCACTTGGTGCTGCTTTTTGCCCCGATAAATCTCTCGGTGCTCCAAAATTTGTGTAAGCGAGCAAAAGATGATTGGGCA
ATTTCTAGCACGTCATTCGGCAACGATGTTTACAAGTTTCTCTGATTGGATGATAAAGTAGAAACTTTCCGAAAATGAAA
CTTCTCCGAACATGCGCATACCGACTGAAAATTAACTCTAAGCCAGCCAATGGAATTGAAGCAAAATTCAAGAGAATATT
AATTGACTTCGCGAATGAACTCAAATTTTCTATTGGCGTATTGTGTGTGCCTCATTGTGAGTGGTTGCGATCGCATCTCA
AATTATTTACACACAAAAAAATAACGCACACAGACATTGAATAGATATATTTGATCAAGTCAATATCACAATGTCAATAT
TAGCTTTTTCTGAAGAAAGAAGACGAACTAGAAGAAAAACAACAACGAAATAGATTCGATAAGGCTACTGAGCGATTTTC
ATAATCTAAATATTATTTTATTATTGATACGGACAAAAATTGGTCTTTTACCAAGTACTACTAGATTGTTGATAAAGAGA
GGTTATTTAGATGCTTGGAAAAAATCCTTATGAAACTGCAATGAGCAACGTGTATTCTCTACCTCCGGGAGGTTCTATTT
ACAATATGAACCCGATGAGTATATCATCAGCTGGCTACAACTCTCAACAAGTATCAACACTATCGTTGAACTTGACCGGA
ATCGGACCTCATTCATTAAGCCCAATGAGTGCAAGCATGTCGGGTATAGCTGCAATGGCCGGTGGAATGAGACAAGGTCT
TGAGTTGGGTCTTGGTAGAAGTGATAGTCCAAGAGATAAAAATTCAATTTCCAATAACAACCGACCATATCAAAGAAGTT
ACACTCATGCCAAGCCTCCATACAGTTATATAAGTTTGATAACAATGGCGATTCAAAATTCTCCAGTAAACATGTGCACT
CTATCGGAGATCTATCAATTCATTATGGATCATTTTCCATACTATCGTCAAAATCAACAGCGATGGCAGAATTCGATTCG
ACATTCTTTGTCCTTCAACGATTGCTTTGTTAAGGTTAGTAGAAGCCCAGAAAAACCAGGTAAAGGCTCATATTGGACCT
TGCATCCTCAATCAGGTAACATGTTTGAAAACGGTTGTTATCTCAGAAGACAAAAGCGATTCAAAGATCCACACAGAGAA
ATCGGCAGACAGAGTCAAAGAGCTGCCACTGGTCCTGGATCAAATGTCACAGAAAACAATCACGACAACGCATCGCAAGA
AGCTAGTGATAACGCAGAAAGTGATACGAAACCCAACATCAAGCAACTTGATTTATCAAGCGATCTCTTAACTAATCAAG
GTCATAATATTAAAAATACTAATCCAACTTCTGTTAGTCAGAGTTGTTCGATGTTTCATCGGAAAAAGGAAAACTGCTCA
CCAGTAGAAATGAAATTGAATAACCAAAACCAACAATCAAACCAGCAAGAACATCCACAAATCCATTACAATCCCAATCA
GCAATTCTACTCAAATCAGCAAAACATTTTCCAACAAAGTTCTCTTGATCATTACAGTCTATTAGCATCCGATGATCCTC
TTGGTCAAGGTATGCACTTGCCACCAGGTGCAAATAGTGTTTTCGGACTTTACGGGGCACATAACTTACCAAACGATGAT
CAAATTTCAGTGTCATTACCATCGATATCCTTATCCGGACATCCGTATGACAATTTATCAACAGCAATGGCATATCAATA
TGAAGCATCTCAACACAATTCTTCATTACTAACGACAAGTAATCCGTTCTCAATAGATCGTTTGATGCATCCAAGACTAG
TCGCTGCAGCGATGGGGGTCAGTCCCCATGATACTCTATACGCAGGAGCTACCGGCCCATCAGTTGATCTAGAACACATG
AAATACTACTCAAACTACAACAATGTGCCTCCTTATTCCTCTGCAATGTCTGACTACTACAAATATGTACAAAATCCTCA
GCCGGGCAACAGCGACATGAGTCTTTGAATTGAGTCCATTGAAGTCTACGGCAGTTTCCTCGAAATTTCACATTCAACCA
GATGTTTATCGCCTAATATAAAGCTGTGTTTTTTTATTTATTTACAATTAAATCTTTGTACAAGAGATC
ADDITIONAL REFERENCES:
Adler, C.E., Seidel, C.W., McKinney, S.A., and Sánchez Alvarado, A. (2014). Selective amputation of the pharynx identifies a FoxA-dependent regeneration program in planaria. Elife 3, e02238.
Martín-Durán, J.M., Amaya, E., and Romero, R. (2010). Germ layer specification and axial patterning in the embryonic development of the freshwater planarian Schmidtea polychroa. Dev Biol 340, 145-158.
Martín-Durán, J.M., and Romero, R. (2011). Evolutionary implications of morphogenesis and molecular patterning of the blind gut in the planarian Schmidtea polychroa. Dev Biol 352, 164-176.
Scimone, M.L., Kravarik, K.M., Lapan, S.W., and Reddien, P.W. (2014). Neoblast specialization in regeneration of the planarian Schmidtea mediterranea. Stem Cell Reports 3, 339-352.
PAGE: Planarian Anatomy Gene Expression
These transcripts were reported as being expressed in pharynx. Click this link to learn more about PAGE.
PAGE Curations: 3229
PLANA Term | Reference Transcript | Description | Gene Models | Published Transcript | Transcriptome | Publication | Specimen | Lifecycle | Evidence |
---|---|---|---|---|---|---|---|---|---|
pharynx | SMED30028347 | Engulfment and cell motility 3 | SMESG000013936.1 | Contig1935 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30028347 | Engulfment and cell motility 3 | SMESG000039535.1 | Contig1935 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30020100 | SMED30020100 | SMESG000013936.1 | Contig1935 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30020100 | SMED30020100 | SMESG000013936.1 | Contig1935 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30020100 | SMED30020100 | SMESG000039535.1 | Contig1935 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30020100 | SMED30020100 | SMESG000039535.1 | Contig1935 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30021127 | SMED30021127 | SMESG000037626.1 | Contig1315 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30021127 | SMED30021127 | SMESG000037626.1 | Contig1315 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30021127 | SMED30021127 | SMESG000048042.1 | Contig1315 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30021127 | SMED30021127 | SMESG000048042.1 | Contig1315 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30008091 | Serine/threonine-protein kinase PLK | SMESG000012131.1 SMESG000012127.1 | Contig809 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30008091 | Serine/threonine-protein kinase PLK | SMESG000027686.1 | Contig2364 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30008091 | Serine/threonine-protein kinase PLK | SMESG000012131.1 SMESG000012127.1 | Contig2364 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30003053 | 1-acyl-sn-glycerol-3-phosphate acyltransferase delta | SMESG000081135.1 | Contig3433 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30001630 | Ras-related C3 botulinum toxin substrate 1 | SMESG000005612.1 | Contig594 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30001630 | Ras-related C3 botulinum toxin substrate 1 | SMESG000005612.1 | Contig594 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30001630 | Ras-related C3 botulinum toxin substrate 1 | SMESG000011575.1 | Contig594 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30001630 | Ras-related C3 botulinum toxin substrate 1 | SMESG000011575.1 | Contig594 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30019325 | Myosin regulatory light chain | SMESG000068156.1 SMESG000064685.1 SMESG000043474.1 SMESG000010609.1 SMESG000076470.1 SMESG000073857.1 SMESG000062429.1 SMESG000058575.1 SMESG000053533.1 SMESG000020635.1 SMESG000015751.1 SMESG000005260.1 | Contig246 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30019325 | Myosin regulatory light chain | SMESG000000175.1 | Contig246 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30019325 | Myosin regulatory light chain | SMESG000000175.1 | Contig2068 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30021698 | 14-3-3 protein epsilon | SMESG000047644.1 | Contig5316 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30022398 | C2H2-type domain-containing protein | SMESG000032119.1 | Contig3970 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30023739 | SMED30023739 | SMESG000058452.1 | Contig1190 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30023739 | SMED30023739 | SMESG000057519.1 | Contig1190 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30013050 | SMED30013050 | SMESG000000175.1 | Contig2068 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30009175 | Transcription elongation factor spt6 | SMESG000059332.1 | Contig5500 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30009175 | Transcription elongation factor spt6 | SMESG000059332.1 | Contig5500 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30009175 | Transcription elongation factor spt6 | SMESG000024114.1 | Contig5500 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30009175 | Transcription elongation factor spt6 | SMESG000024114.1 | Contig5500 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30034573 | Tubulin beta chain | SMESG000047291.1 SMESG000044907.1 SMESG000044888.1 SMESG000035804.1 SMESG000035755.1 SMESG000047284.1 | Contig5821 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30030227 | flotillin-2 | SMESG000059332.1 | Contig5500 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30030227 | flotillin-2 | SMESG000024114.1 | Contig5500 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30032776 | SMED30032776 | SMESG000063221.1 | Contig1068 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30022483 | CGG triplet repeat-binding protein 1 | SMESG000020470.1 | Contig1680 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30022483 | CGG triplet repeat-binding protein 1 | SMESG000020470.1 | Contig1680 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30027682 | NAD(P)H-dependent FMN reductase | SMESG000060640.1 | Contig3408 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30027682 | NAD(P)H-dependent FMN reductase | SMESG000060640.1 | Contig3408 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30027682 | NAD(P)H-dependent FMN reductase | SMESG000074871.1 | Contig3408 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30027682 | NAD(P)H-dependent FMN reductase | SMESG000074871.1 | Contig3408 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30031780 | Ras-related protein Rab-5A | SMESG000065500.1 | Contig1027 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30033807 | SMED30033807 | SMESG000076385.1 SMESG000076375.1 SMESG000076363.1 SMESG000076223.1 SMESG000076482.1 SMESG000076470.1 SMESG000076410.1 SMESG000076358.1 | Contig1645 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30030757 | SMED30030757 | SMESG000016990.1 | Contig1765 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30020811 | SMED30020811 | SMESG000005612.1 | Contig594 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30020811 | SMED30020811 | SMESG000005612.1 | Contig594 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30020811 | SMED30020811 | SMESG000011575.1 | Contig594 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30020811 | SMED30020811 | SMESG000011575.1 | Contig594 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30015409 | cAMP-responsive element modulator | SMESG000016695.1 | Contig4585 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30015409 | cAMP-responsive element modulator | SMESG000033655.1 | Contig4585 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30009357 | ubiquilin-1 | SMESG000045386.1 | Contig2009 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30015310 | DUF3421 domain-containing protein | SMESG000046710.1 SMESG000046697.1 | PL020001000E05 | ncbi_smed_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30015706 | Twinfilin-1 | SMESG000041071.1 | Contig2453 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30012677 | Coiled-coil domain-containing protein 51 | SMESG000058452.1 | Contig1190 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30012677 | Coiled-coil domain-containing protein 51 | SMESG000058452.1 | Contig1190 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30012677 | Coiled-coil domain-containing protein 51 | SMESG000057519.1 | Contig1190 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30012677 | Coiled-coil domain-containing protein 51 | SMESG000057519.1 | Contig1190 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30002822 | RING-type domain-containing protein | SMESG000076385.1 SMESG000076375.1 SMESG000076363.1 SMESG000076223.1 SMESG000076482.1 SMESG000076470.1 SMESG000076410.1 SMESG000076358.1 | Contig1645 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30007555 | GCR098 | SMESG000016695.1 | Contig4585 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30007555 | GCR098 | SMESG000016695.1 | Contig4585 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30007555 | GCR098 | SMESG000033655.1 | Contig4585 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30007555 | GCR098 | SMESG000033655.1 | Contig4585 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30007716 | Ankyrin repeat domain 28b | SMESG000060640.1 | Contig3408 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30007716 | Ankyrin repeat domain 28b | SMESG000074871.1 | Contig3408 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30001294 | Phosphatidylinositol-binding clathrin assembly protein | SMESG000043423.1 | Contig1792 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30001294 | Phosphatidylinositol-binding clathrin assembly protein | SMESG000072544.1 | Contig1792 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30004606 | Cytochrome P450 2K1-like protein | SMESG000020470.1 | Contig1680 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30011213 | Osteoclast-stimulating factor 1 | SMESG000004952.1 | Contig516 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30015345 | Tropomyosin | SMESG000066854.1 | Contig3688 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30015345 | Tropomyosin | SMESG000066854.1 | Contig3688 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30015345 | Tropomyosin | SMESG000026500.1 | Contig3688 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30015345 | Tropomyosin | SMESG000026500.1 | Contig3688 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30025964 | SMED30025964 | SMESG000041071.1 | Contig2453 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30033014 | Phosphatidylinositol-4,5-bisphosphate 4-phosphatase | SMESG000063221.1 | Contig1068 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30023334 | Partitioning defective 6 | SMESG000066854.1 | Contig3688 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30022468 | secreted frizzled-related protein 1 | SMESG000075831.1 SMESG000029446.1 | EU296635 | smed_ncbi_20200123 | PMID:24704339 Vogg et al., 2014 | ![]() | ![]() | ![]() |
pharynx | SMED30027297 | winged helix/forkhead transcription factor | SMESG000077075.1 | KC577557.1 | smed_ncbi_20200123 | PMID:24704339 Vogg et al., 2014 | ![]() | ![]() | ![]() |
pharynx | SMED30027297 | winged helix/forkhead transcription factor | SMESG000077075.1 | KC577557 | smed_ncbi_20200123 | PMID:24704339 Vogg et al., 2014 | ![]() | ![]() | ![]() |
pharynx | SMED30029487 | Smed-NDK | SMESG000062038.1 | GU592830.1 | smed_ncbi_20200123 | PMID:24704339 Vogg et al., 2014 | ![]() | ![]() | ![]() |
pharynx | SMED30005045 | zinc finger protein A | SMESG000022958.1 | KF751216.1 | smed_ncbi_20200123 | PMID:24704339 Vogg et al., 2014 | ![]() | ![]() | ![]() |
pharynx | SMED30020359 | Smed-NDK-3 | SMESG000046244.1 SMESG000046208.1 | GU592832.1 | smed_ncbi_20200123 | PMID:23318641 Chen et al., 2013 | ![]() | ![]() | ![]() |
pharynx | SMED30031256 | wntP-2 | SMESG000066476.1 | wntP-2 | smed_ncbi_20200123 | PMID:23318641 Chen et al., 2013 | ![]() | ![]() | ![]() |
pharynx | SMED30027299 | PBX | SMESG000022232.1 SMESG000001913.1 | KC353351.1 | smed_ncbi_20200123 | PMID:23318641 Chen et al., 2013 | ![]() | ![]() | ![]() |
pharynx | SMED30026602 | Wnt2-1 | SMESG000002069.1 | FJ463753.1 | smed_ncbi_20200123 | PMID:23318641 Chen et al., 2013 | ![]() | ![]() | ![]() |
pharynx | SMED30011780 | Si:ch73-222h13.1 | SMESG000081135.1 | Contig3433 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30011780 | Si:ch73-222h13.1 | SMESG000081135.1 | Contig3433 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30014645 | HP domain-containing protein | SMESG000075965.1 | PL04009A1F04 | ncbi_smed_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30020872 | Myosin IE | SMESG000003513.1 | Contig59 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30020872 | Myosin IE | SMESG000068232.1 | Contig59 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30005336 | Phtf-FEM1B_bdg domain-containing protein | SMESG000058788.1 | Contig2701 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30005012 | SMED30005012 | Contig1286 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() | |
pharynx | SMED30008812 | AP complex subunit sigma | SMESG000038889.1 | Contig2145 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30002222 | SMED30002222 | Contig7536 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() | |
pharynx | SMED30002222 | SMED30002222 | Contig7536 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() | |
pharynx | SMED30005745 | Protein kinase | SMESG000079303.1 | Contig2289 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30005745 | Protein kinase | SMESG000017260.1 | Contig2289 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30011909 | SMED30011909 | SMESG000027686.1 | Contig2364 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30011909 | SMED30011909 | SMESG000012131.1 SMESG000012127.1 | Contig2364 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30001668 | SMED30001668 | SMESG000033527.1 | Contig2307 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30029698 | Caspase-7 | SMESG000053168.1 | Contig2992 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30015801 | SMED30015801 | SMESG000079303.1 | Contig2289 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30015801 | SMED30015801 | SMESG000017260.1 | Contig2289 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30024411 | Protein kinase domain-containing protein | SMESG000028899.1 | Contig1093 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30024411 | Protein kinase domain-containing protein | SMESG000071997.1 | Contig1093 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30001281 | SMED30001281 | SMESG000038153.1 SMESG000018862.1 | Contig1 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30001281 | SMED30001281 | SMESG000033840.1 | Contig1 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30019715 | Tumor protein p63-regulated gene 1 protein | SMESG000038153.1 SMESG000018862.1 | Contig1 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30019715 | Tumor protein p63-regulated gene 1 protein | SMESG000033840.1 | Contig1 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30013976 | SMED30013976 | SMESG000003513.1 | Contig59 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30013976 | SMED30013976 | SMESG000003513.1 | Contig59 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30013976 | SMED30013976 | SMESG000068232.1 | Contig59 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30013976 | SMED30013976 | SMESG000068232.1 | Contig59 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30014474 | Tumor susceptibility gene 101 protein | SMESG000049597.1 | Contig5044 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30014474 | Tumor susceptibility gene 101 protein | SMESG000004871.1 | Contig5044 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30016832 | SH3 domain-binding protein 5-like | SMESG000061052.1 | Contig4742 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30016832 | SH3 domain-binding protein 5-like | SMESG000061052.1 | Contig4742 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30016832 | SH3 domain-binding protein 5-like | SMESG000022856.1 | Contig4742 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30016832 | SH3 domain-binding protein 5-like | SMESG000022856.1 | Contig4742 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30016022 | SMED30016022 | SMESG000053405.1 | Contig1766 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30016022 | SMED30016022 | SMESG000053405.1 | Contig1766 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30016022 | SMED30016022 | SMESG000046314.1 SMESG000028362.1 | Contig1766 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30016022 | SMED30016022 | SMESG000046314.1 SMESG000028362.1 | Contig1766 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30005434 | SMED30005434 | SMESG000038889.1 | Contig2145 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30004187 | SMED30004187 | SMESG000043423.1 | Contig1792 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30004187 | SMED30004187 | SMESG000043423.1 | Contig1792 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30004187 | SMED30004187 | SMESG000072544.1 | Contig1792 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30004187 | SMED30004187 | SMESG000072544.1 | Contig1792 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30015161 | Vacuolar protein sorting-associated protein 45 | SMESG000053405.1 | Contig1766 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30015161 | Vacuolar protein sorting-associated protein 45 | SMESG000046314.1 SMESG000028362.1 | Contig1766 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30008147 | SMED30008147 | SMESG000053405.1 | Contig1766 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30008147 | SMED30008147 | SMESG000053405.1 | Contig1766 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30008147 | SMED30008147 | SMESG000046314.1 SMESG000028362.1 | Contig1766 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30008147 | SMED30008147 | SMESG000046314.1 SMESG000028362.1 | Contig1766 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30008321 | SMED30008321 | SMESG000068172.1 | Contig3306 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30008321 | SMED30008321 | SMESG000068172.1 | Contig3306 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30008321 | SMED30008321 | SMESG000025870.1 | Contig3306 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30008321 | SMED30008321 | SMESG000025870.1 | Contig3306 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30017930 | SMED30017930 | SMESG000049597.1 | Contig5044 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30017930 | SMED30017930 | SMESG000004871.1 | Contig5044 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30004652 | SMED30004652 | SMESG000033527.1 | Contig2307 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30014928 | Formin-like protein | SMESG000044336.1 | Contig1407 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30014928 | Formin-like protein | SMESG000015063.1 | Contig1407 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30017833 | SMED30017833 | SMESG000053168.1 | Contig2992 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30014138 | LIM homeobox 1b | SMESG000061052.1 | Contig4742 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30014138 | LIM homeobox 1b | SMESG000022856.1 | Contig4742 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30012769 | SMED30012769 | SMESG000058788.1 | Contig2701 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30012769 | SMED30012769 | SMESG000058788.1 | Contig2701 | uc_Smed_v2 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30017937 | WASP like actin nucleation promoting factor b | SMESG000036683.1 | Contig4572 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30017937 | WASP like actin nucleation promoting factor b | SMESG000074788.1 | Contig4572 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30029557 | SMED30029557 | SMESG000028899.1 | Contig1093 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30029557 | SMED30029557 | SMESG000071997.1 | Contig1093 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30020784 | SMED30020784 | SMESG000011782.1 | Contig1076 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30032408 | SMED30032408 | SMESG000027686.1 | Contig2364 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30032408 | SMED30032408 | SMESG000012131.1 SMESG000012127.1 | Contig2364 | newmark_ests | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30033476 | Zinc finger protein, putative | SMESG000068172.1 | Contig3306 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30033476 | Zinc finger protein, putative | SMESG000025870.1 | Contig3306 | GPL15192 | PMID:23079596 Forsthoefel et al., 2012 | ![]() | ![]() | ![]() |
pharynx | SMED30017079 | LRRCC1 | SMESG000016752.1 | dd_Smed_v4_10086_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30018901 | SMED30018901 | SMESG000033673.1 | dd_Smed_v4_1071_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30018901 | SMED30018901 | SMESG000033673.1 | dd_1071 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30017667 | SMED30017667 | SMESG000044691.1 SMESG000022166.1 | dd_Smed_v4_10233_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30017399 | Transmembrane protein 81 | SMESG000026648.1 | dd_Smed_v4_10248_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30014347 | plexin A | SMESG000049328.1 SMESG000006542.1 SMESG000006541.1 | dd_Smed_v4_11934_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30014685 | SMED30014685 | SMESG000036334.1 | dd_Smed_v4_13648_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30027141 | SMED30027141 | SMESG000059828.1 | dd_Smed_v4_1549_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30026061 | SMED30026061 | SMESG000076482.1 SMESG000076409.1 SMESG000076405.1 SMESG000076390.1 SMESG000076375.1 SMESG000076364.1 SMESG000076223.1 SMESG000040665.1 SMESG000019753.1 | dd_Smed_v4_1097_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30026256 | vault protein inter alpha trypsin-1 | SMESG000053671.1 SMESG000053669.1 SMESG000053667.1 SMESG000053664.1 SMESG000053657.1 SMESG000053638.1 | dd_Smed_v4_1027_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30027019 | Innexin | SMESG000030971.1 SMESG000030964.1 | dd_Smed_v4_10061_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30004498 | SMED30004498 | SMESG000035916.1 | dd_Smed_v4_13051_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30003902 | Tetratricopeptide repeat protein 21B | SMESG000011579.1 | dd_Smed_v4_12056_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001404 | Dual specificity tyrosine-phosphorylation-regulated kinase 2 | SMESG000076586.1 SMESG000076583.1 | dd_Smed_v4_12119_1_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30014199 | Myosin | SMESG000047361.1 | dd_Smed_v4_4503_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30004582 | SMED30004582 | SMESG000035916.1 | dd_Smed_v4_13051_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30013319 | Long-chain-fatty-acid--CoA ligase ACSBG2 | SMESG000027204.1 | dd_Smed_v4_1026_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30004097 | SMED30004097 | SMESG000031258.1 | dd_Smed_v4_12080_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30008671 | Phosphodiesterase | SMESG000021196.1 | dd_Smed_v4_8589_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30000421 | TPR_REGION domain-containing protein | SMESG000071973.1 | dd_Smed_v4_11462_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30002516 | SMED30002516 | SMESG000011859.1 | dd_Smed_v4_1283_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30002162 | Glycosyl transferase | SMESG000030921.1 | dd_Smed_v4_11247_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30005046 | Dynein heavy chain, axonemal | SMESG000050247.1 | dd_Smed_v4_13135_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30005046 | Dynein heavy chain, axonemal | SMESG000050247.1 SMESG000050248.1 | dd_Smed_v4_10191_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30004648 | Dual specificity tyrosine phosphorylation regulated kinase 2 | SMESG000076586.1 SMESG000076583.1 | dd_Smed_v4_12119_1_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001414 | UPF0728 protein C10orf53 homolog | SMESG000073355.1 | dd_Smed_v4_10501_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30027672 | Plac8 onzin related protein 1 | SMESG000050229.1 SMESG000050221.1 | dd_Smed_v4_1219_1_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30030642 | Cytochrome P450 2C3 | SMESG000023530.1 SMESG000023528.1 | dd_Smed_v4_7874_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30005292 | Post-GPI attachment to proteins factor 3 | SMESG000077193.1 | dd_Smed_v4_11282_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30000918 | Coiled-coil domain containing 13 | SMESG000058204.1 | dd_Smed_v4_12055_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001801 | NME/NM23 nucleoside diphosphate kinase 1 | SMESG000008082.1 | dd_Smed_v4_1096_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001071 | Low density lipoprotein-receptor, class A,domain-containing protein | SMESG000037863.1 | dd_Smed_v4_12756_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30006515 | ZZ-type domain-containing protein | SMESG000055420.1 | dd_Smed_v4_10173_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30004972 | SMED30004972 | SMESG000007019.1 | dd_Smed_v4_10965_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30000840 | Coiled-coil domain-containing protein 42-like protein | SMESG000046807.1 | dd_Smed_v4_12378_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30003249 | Prohibitin | SMESG000038397.1 | dd_Smed_v4_1038_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30002934 | forkhead box J1-like protein 4 | SMESG000010030.1 | dd_Smed_v4_10152_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001031 | TRAF3-interacting protein 1 | SMESG000006345.1 | dd_Smed_v4_10562_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30013692 | Small HSP protein | SMESG000059879.1 SMESG000059868.1 SMESG000059853.1 | dd_Smed_v4_1039_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30004559 | CULT domain-containing protein | SMESG000077110.1 SMESG000077108.1 | dd_Smed_v4_11915_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001654 | SMED30001654 | SMESG000012124.1 | dd_Smed_v4_11272_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001176 | SMED30001176 | SMESG000020646.1 | dd_Smed_v4_10759_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30026934 | SMED30026934 | SMESG000050824.1 | dd_Smed_v4_12162_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30023483 | INX-13 | SMESG000043575.1 | dd_Smed_v4_11501_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30003780 | Serine/threonine-protein kinase 36 | SMESG000076885.1 | dd_Smed_v4_11067_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30003093 | SMED30003093 | SMESG000056847.1 SMESG000056843.1 SMESG000056838.1 SMESG000044770.1 SMESG000044762.1 SMESG000007140.1 | dd_Smed_v4_1137_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30004871 | Mitogen-activated protein kinase | SMESG000023035.1 SMESG000023025.1 | dd_Smed_v4_10933_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30014131 | RPTOR independent companion of MTOR, complex 2 a | SMESG000024212.1 SMESG000033570.1 | dd_Smed_v4_9324_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001192 | ras-related protein Rab-14 | SMESG000066109.1 SMESG000052687.1 SMESG000014240.1 SMESG000069832.1 SMESG000037642.1 | dd_Smed_v4_106_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001473 | Lipoxygenase homology domain-containing protein 1 | SMESG000059926.1 SMESG000059927.1 | dd_Smed_v4_10460_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30004224 | Sodium/hydrogen exchanger 11 | SMESG000052479.1 | dd_Smed_v4_10212_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30003458 | Ras-related protein Rab-27B | SMESG000077907.1 | dd_Smed_v4_10266_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30015061 | G protein regulated inducer of neurite outgrowth | SMESG000062691.1 | dd_Smed_v4_10294_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30035904 | PROG-1 | SMESG000024882.1 SMESG000024707.1 | dd_Smed_v4_332_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30026063 | TNF receptor-associated factor | SMESG000044583.1 | dd_Smed_v4_11100_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30025647 | Ig-like domain-containing protein | SMESG000079961.1 | dd_Smed_v4_12974_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30019526 | Membrane protein insertase YidC | SMESG000039158.1 | dd_Smed_v4_4072_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30012622 | Intraflagellar transport 43 | SMESG000067883.1 | dd_Smed_v4_5237_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30014257 | Oxysterol-binding protein | SMESG000008795.1 | dd_Smed_v4_4931_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30019494 | Ubiquitin-fold modifier-conjugating enzyme 1 | SMESG000068795.1 | dd_Smed_v4_4590_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30015538 | SMED30015538 | SMESG000011215.1 SMESG000011194.1 | dd_Smed_v4_6952_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30018507 | Calcium-transporting ATPase | SMESG000038461.1 | dd_Smed_v4_4559_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30018507 | Calcium-transporting ATPase | SMESG000038461.1 | dd_Smed_v4_3170_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30012764 | SMED30012764 | SMESG000059203.1 | dd_Smed_v4_5415_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30016848 | SMED30016848 | SMESG000079496.1 | dd_Smed_v4_6860_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30011982 | 60S ribosomal protein L17 | SMESG000009564.1 | dd_Smed_v4_95_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30014550 | Intraflagellar transport protein 43 | SMESG000067883.1 | dd_Smed_v4_5237_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30018495 | ATPase_AAA_core domain-containing protein | SMESG000073596.1 | dd_Smed_v4_9568_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30018495 | ATPase_AAA_core domain-containing protein | SMESG000073596.1 | dd_Smed_v4_9484_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30000178 | SMED30000178 | dd_Smed_v4_13403_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30018756 | SMED30018756 | dd_Smed_v4_6916_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30016918 | UPF0466 protein-like | dd_Smed_v4_5792_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30001925 | SMED30001925 | dd_4476 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30001925 | SMED30001925 | dd_Smed_v4_4476_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30016577 | SMED30016577 | dd_Smed_v4_10215_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30013141 | Pleckstrin homology domain-containing family F member 2-like protein | dd_Smed_v4_2374_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30019959 | NADH dehydrogenase subunit 4 | dd_Smed_v4_292_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30019959 | NADH dehydrogenase subunit 4 | dd_Smed_v4_344_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30016673 | Cylindromatosis (turban tumor syndrome), b | SMESG000056847.1 SMESG000056843.1 SMESG000056838.1 SMESG000044770.1 SMESG000044762.1 SMESG000007140.1 | dd_Smed_v4_1137_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30002680 | SMED30002680 | dd_Smed_v4_11691_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30004099 | SMED30004099 | dd_Smed_v4_15498_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30018518 | Protein chibby 1 | dd_Smed_v4_11618_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30012451 | SMED30012451 | dd_Smed_v4_215_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30010808 | Elongation of very long chain fatty acids protein | SMESG000009665.1 | dd_Smed_v4_10529_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30005911 | SMED30005911 | dd_Smed_v4_12_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30016010 | SMED30016010 | SMESG000042231.1 | dd_Smed_v4_10980_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30015411 | GLTP domain-containing protein | dd_Smed_v4_2621_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30017048 | cilia- and flagella-associated protein 206 | SMESG000021247.1 | dd_Smed_v4_11199_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30006652 | dynein heavy chain 6, axonemal | SMESG000004477.1 SMESG000004475.1 | dd_Smed_v4_10969_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30012212 | NADH dehydrogenase subunit 1 | dd_Smed_v4_258_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30009030 | Selenoprotein W | dd_Smed_v4_572_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30001799 | NADH dehydrogenase subunit 5 | dd_Smed_v4_258_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30001799 | NADH dehydrogenase subunit 5 | dd_Smed_v4_957_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30010134 | SMED30010134 | dd_Smed_v4_34037_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30013571 | NADH dehydrogenase subunit 4L | dd_Smed_v4_344_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30000702 | cytochrome b | dd_Smed_v4_344_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30005542 | SMED30005542 | dd_Smed_v4_23179_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30002689 | SMED30002689 | dd_Smed_v4_680_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30004402 | Dimer_Tnp_hAT domain-containing protein | dd_Smed_v4_14487_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30013526 | SMED30013526 | dd_Smed_v4_11243_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30001366 | SMED30001366 | SMESG000014648.1 | dd_Smed_v4_1227_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30012522 | Ankyrin-2 | SMESG000026655.1 | dd_Smed_v4_10835_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30017231 | NEPH-3 | SMESG000022777.1 | dd_Smed_v4_11280_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30010320 | Radial spoke head 10-like protein B2 | SMESG000039156.1 SMESG000039153.1 | dd_Smed_v4_12762_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30010500 | Fibronectin type III domain protein | SMESG000033545.1 | dd_Smed_v4_15017_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30004124 | 14-3-3 protein beta/alpha | SMESG000055903.1 | dd_Smed_v4_138_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30002886 | SMED30002886 | SMESG000017779.1 | dd_Smed_v4_11049_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30009231 | Transmembrane protein | SMESG000002927.1 | dd_Smed_v4_12002_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30009231 | Transmembrane protein | SMESG000002927.1 | dd_Smed_v4_16643_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30002489 | Apical junction component 1 homolog | SMESG000037093.1 | dd_Smed_v4_11689_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30018224 | Adenylate kinase | SMESG000077377.1 SMESG000076900.1 SMESG000063429.1 SMESG000060686.1 SMESG000043019.1 SMESG000031308.1 SMESG000028811.1 SMESG000023833.1 SMESG000023573.1 SMESG000019820.1 SMESG000011532.1 SMESG000052813.1 | dd_Smed_v4_1229_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30019223 | Protein FAM47E | SMESG000026097.1 | dd_Smed_v4_10346_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30019942 | Roc domain-containing protein | SMESG000038728.1 | dd_Smed_v4_11334_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30010203 | C2H2-type domain-containing protein | SMESG000067728.1 | dd_Smed_v4_1455_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30019453 | Asparagine rich antigen | SMESG000022424.1 | dd_Smed_v4_10530_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30005211 | cilia- and flagella-associated protein 47 | SMESG000060264.1 | dd_Smed_v4_8294_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30002712 | Dynein heavy chain 3, axonemal | SMESG000040511.1 SMESG000040510.1 SMESG000040507.1 | dd_Smed_v4_10846_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30010655 | SMED30010655 | SMESG000028897.1 | dd_Smed_v4_12473_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30018493 | Ras and EF-hand domain-containing protein | SMESG000028852.1 | dd_Smed_v4_12567_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30019487 | Phosphodiesterase | SMESG000054903.1 SMESG000054901.1 SMESG000054878.1 SMESG000044092.1 | dd_Smed_v4_10593_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30023017 | SMED30023017 | SMESG000065348.1 | dd_1320 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30023017 | SMED30023017 | SMESG000065348.1 | dd_Smed_v4_1320_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30020291 | Centrosomal protein 104 | SMESG000023549.1 | dd_Smed_v4_10228_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30034247 | SMED30034247 | SMESG000005178.1 | dd_Smed_v4_10371_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30027439 | SMED30027439 | SMESG000031258.1 | dd_Smed_v4_12080_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30033718 | SMED30033718 | SMESG000061174.1 | dd_Smed_v4_12214_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30028591 | Protein kinase | SMESG000030545.1 | dd_Smed_v4_11177_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30025195 | SMED30025195 | SMESG000001693.1 | dd_Smed_v4_10480_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30027291 | Death domain-containing protein | SMESG000064407.1 | dd_Smed_v4_12177_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30032529 | SMED30032529 | SMESG000077536.1 | dd_Smed_v4_11079_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30020260 | SMED30020260 | SMESG000005697.1 | dd_Smed_v4_12813_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30020257 | DUF3421 domain-containing protein | SMESG000046742.1 | dd_Smed_v4_1040_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30023857 | Calpain 5a | SMESG000009459.1 | dd_Smed_v4_101944_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30028302 | SMED30028302 | SMESG000056261.1 | dd_Smed_v4_8391_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30023085 | Non-specific serine/threonine protein kinase | SMESG000004478.1 | dd_Smed_v4_11674_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021590 | Spectrin beta chain | SMESG000081696.1 | dd_Smed_v4_1122_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30023193 | Tau tubulin kinase | SMESG000026133.1 | dd_Smed_v4_12470_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30029471 | Collagen alpha-1(XXVIII) chain | SMESG000033673.1 | dd_Smed_v4_1071_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30029471 | Collagen alpha-1(XXVIII) chain | SMESG000033673.1 | dd_1071 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022653 | Stromal interaction molecule 1 | SMESG000081265.1 | dd_Smed_v4_12888_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30025753 | SMED30025753 | SMESG000016791.1 | dd_Smed_v4_10_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30020615 | prohibitin-1 | SMESG000021272.1 | dd_Smed_v4_1089_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30031582 | Innexin | SMESG000081749.1 | dd_Smed_v4_10287_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30031582 | Innexin | SMESG000081749.1 | dd_Smed_v4_11302_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30023718 | Histone-lysine N-methyltransferase | SMESG000081033.1 | dd_Smed_v4_10189_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30025084 | Ankyrin repeat and EF-hand domain-containing protein 1 | SMESG000006940.1 SMESG000006938.1 SMESG000006933.1 | dd_Smed_v4_12476_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30020686 | Transmembrane protein 80 | SMESG000018777.1 | dd_Smed_v4_13318_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30035412 | SMED30035412 | SMESG000077193.1 | dd_Smed_v4_11282_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30025883 | Forkhead associated phosphopeptide binding domain 1 | SMESG000071072.1 | dd_Smed_v4_14350_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30025629 | Enkurin domain-containing protein | SMESG000020205.1 | dd_Smed_v4_12663_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021807 | SMED30021807 | SMESG000030582.1 | dd_Smed_v4_1124_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022225 | Bidirectional sugar transporter SWEET | SMESG000012540.1 | dd_Smed_v4_12308_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30033487 | cilia- and flagella-associated protein 70 | SMESG000009189.1 | dd_Smed_v4_10893_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30027319 | SMED30027319 | SMESG000006149.1 | dd_Smed_v4_11660_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30024189 | 60S ribosomal protein L31 | SMESG000017099.1 | dd_Smed_v4_113_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30020398 | Kinesin-like protein | SMESG000007019.1 | dd_Smed_v4_10965_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30028626 | C2H2-type domain-containing protein | SMESG000019280.1 SMESG000019279.1 | dd_Smed_v4_10324_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30030586 | slc10a-2 | SMESG000064833.1 | dd_Smed_v4_10199_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30020109 | R3H domain containing-like | SMESG000044056.1 | dd_Smed_v4_11014_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022717 | SMED30022717 | SMESG000005697.1 | dd_Smed_v4_12813_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30032420 | SMED30032420 | SMESG000050229.1 SMESG000050221.1 | dd_Smed_v4_1219_1_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30025696 | Carbonic anhydrase | SMESG000035022.1 | dd_Smed_v4_10041_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021977 | Beta-1,3-galactosyltransferase 1 | SMESG000035184.1 | dd_Smed_v4_11741_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30024787 | SMED30024787 | SMESG000056261.1 | dd_Smed_v4_8391_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022344 | FERM domain containing-1 | SMESG000070273.1 | dd_Smed_v4_1131_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30031219 | deleted in lung and esophageal cancer protein 1 | SMESG000079694.1 | dd_Smed_v4_10833_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022997 | ELMO domain containing 3 | SMESG000008416.1 | dd_Smed_v4_13608_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022844 | NEPH-3 | SMESG000022777.1 | dd_Smed_v4_11280_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30026336 | Beta-hexosaminidase | SMESG000008181.1 | dd_Smed_v4_12408_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022370 | Calcium-activated potassium channel slo-1, putative | SMESG000049145.1 | dd_Smed_v4_12503_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30023266 | cilia- and flagella-associated protein 43 | SMESG000000491.1 | dd_Smed_v4_10271_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30013257 | Tektin-2 | SMESG000026446.1 SMESG000026445.1 SMESG000026429.1 | dd_Smed_v4_2694_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30004312 | Parvo_coat_N domain-containing protein | dd_Smed_v4_91560_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30017080 | FHA domain-containing protein | SMESG000061238.1 | dd_Smed_v4_11335_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30011607 | SMED30011607 | dd_Smed_v4_15559_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30004042 | dynein heavy chain 3, axonemal | SMESG000013738.1 SMESG000013737.1 | dd_Smed_v4_9009_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30004042 | dynein heavy chain 3, axonemal | SMESG000013737.1 SMESG000013731.1 | dd_Smed_v4_23484_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30007024 | G_PROTEIN_RECEP_F1_2 domain-containing protein | SMESG000078415.1 | dd_Smed_v4_24316_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30018740 | SMED30018740 | dd_Smed_v4_1700_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30008074 | CRAL-TRIO domain-containing protein | SMESG000009863.1 | dd_Smed_v4_9151_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30013157 | KHD-1 | SMESG000070471.1 | dd_Smed_v4_294_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30018956 | SMED30018956 | dd_Smed_v4_2990_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30006480 | SMED30006480 | dd_Smed_v4_479_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30005334 | SMED30005334 | dd_Smed_v4_344_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30005537 | TIGR00341 family protein | SMESG000062412.1 | dd_Smed_v4_9934_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30016430 | SMED30016430 | dd_Smed_v4_275_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30005692 | Cytoplasmic dynein 2 heavy chain 1 | SMESG000008384.1 SMESG000008382.1 | dd_Smed_v4_9136_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30003987 | 60S ribosomal protein L29 | dd_Smed_v4_481_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30000212 | Vacuolar protein sorting-associated protein 26B | SMESG000026617.1 | dd_Smed_v4_912_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30008414 | NADH-ubiquinone oxidoreductase chain 3 | dd_Smed_v4_289_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30005555 | Tigger transposable element-derived protein 1 | dd_Smed_v4_20966_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30006347 | U2 small nuclear ribonucleoprotein B | dd_Smed_v4_2274_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30012826 | SMED30012826 | SMESG000017012.1 SMESG000017011.1 | dd_Smed_v4_309_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30015561 | SMED30015561 | dd_Smed_v4_6429_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30013798 | Dual specificity phosphatase 10 | dd_Smed_v4_653_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30002786 | SMED30002786 | dd_Smed_v4_19765_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30004246 | SMED30004246 | dd_Smed_v4_344_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30000207 | SMED30000207 | dd_Smed_v4_45021_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30014345 | Dynein light chain roadblock | dd_Smed_v4_5440_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30013315 | SMED30013315 | SMESG000022425.1 | dd_Smed_v4_3843_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30003889 | SMED30003889 | SMESG000051911.1 | dd_Smed_v4_5276_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30000270 | Histone H3 | SMESG000049112.1 SMESG000049109.1 | dd_Smed_v4_532_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001681 | SMED30001681 | SMESG000049443.1 | dd_Smed_v4_1193_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30003997 | SMED30003997 | SMESG000059318.1 SMESG000059304.1 | dd_Smed_v4_483_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30015125 | SMED30015125 | SMESG000061766.1 | dd_Smed_v4_12632_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30008242 | SMED30008242 | SMESG000068886.1 | dd_Smed_v4_12913_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30007804 | Immunoglobulin-like domain-containing protein | SMESG000010356.1 | dd_Smed_v4_1827_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30000289 | SMED30000289 | SMESG000076644.1 SMESG000076643.1 | dd_Smed_v4_227_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30017333 | centrosomal protein of 83 kDa-like | SMESG000033227.1 SMESG000033225.1 | dd_Smed_v4_12969_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30009090 | Mushroom body large-type Kenyon-related protein | SMESG000070784.1 | dd_Smed_v4_17498_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30019328 | Armadillo repeat-containing protein 2 | SMESG000077074.1 | dd_Smed_v4_12684_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30019425 | Neuronal acetylcholine receptor subunit alpha-2 | SMESG000015263.1 SMESG000015256.1 | dd_Smed_v4_18201_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30031929 | zf-LYAR domain-containing protein | SMESG000081140.1 | dd_Smed_v4_5281_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30033594 | Microtubule-associated protein 1A | SMESG000014298.1 | dd_Smed_v4_1301_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30033594 | Microtubule-associated protein 1A | SMESG000014298.1 | dd_Smed_v4_3654_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30023688 | Leucine-rich repeat and guanylate kinase domain-containing protein | SMESG000033759.1 | dd_Smed_v4_9362_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022574 | START domain-containing protein | SMESG000046413.1 SMESG000037645.1 | dd_Smed_v4_3734_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30027683 | Golgi phosphoprotein 3 | SMESG000073543.1 SMESG000073542.1 | dd_Smed_v4_1770_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30026551 | Ankyrin and armadillo repeat-containing protein | SMESG000058465.1 | dd_Smed_v4_13064_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021896 | SMED30021896 | SMESG000041611.1 | dd_Smed_v4_1935_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30023889 | SMED30023889 | SMESG000055805.1 | dd_Smed_v4_857_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30026601 | Dynein heavy chain axonemal | SMESG000033128.1 | dd_Smed_v4_7062_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30020821 | SMED30020821 | SMESG000014298.1 | dd_Smed_v4_1301_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30023490 | SMED30023490 | SMESG000076531.1 | dd_Smed_v4_7027_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30025664 | TSNAXIP1_N domain-containing protein | SMESG000060720.1 | dd_Smed_v4_13434_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30025076 | SMED30025076 | SMESG000010166.1 | dd_Smed_v4_2518_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30027280 | 60S acidic ribosomal protein P0 | SMESG000079482.1 | dd_Smed_v4_161_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30031142 | Protein kinase domain-containing protein | SMESG000073002.1 SMESG000072984.1 | dd_Smed_v4_12680_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30023059 | EF-hand calcium-binding domain-containing protein 6 | SMESG000052556.1 SMESG000052552.1 | dd_Smed_v4_7065_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30028759 | Mediator of RNA polymerase II transcription subunit 11 | SMESG000036125.1 | dd_Smed_v4_9527_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30029694 | Kinesin light chain | SMESG000023454.1 SMESG000018677.1 SMESG000018676.1 | dd_Smed_v4_6449_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30023176 | SMED30023176 | SMESG000015263.1 SMESG000015256.1 | dd_Smed_v4_18201_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30025052 | histone-lysine N-methyltransferase SETD1B-A | SMESG000062286.1 | dd_Smed_v4_11834_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021960 | Aminopeptidase | SMESG000067986.1 | dd_Smed_v4_2224_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021616 | Rho GTPase-activating protein | SMESG000060252.1 | dd_Smed_v4_3376_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30031188 | Casein kinase I | SMESG000050144.1 SMESG000050130.1 | dd_Smed_v4_16169_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30031468 | Propionyl-CoA carboxylase alpha chain, mitochondrial | SMESG000034830.1 | dd_Smed_v4_1247_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30020711 | Protein LKAAEAR1 | SMESG000010224.1 | dd_Smed_v4_8554_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022443 | Ankyrin repeat protein | SMESG000009520.1 SMESG000009519.1 | dd_Smed_v4_9418_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30024770 | SMED30024770 | SMESG000035481.1 | dd_Smed_v4_7894_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30028659 | Cilia-and flagella-associated protein 100 | SMESG000033127.1 | dd_Smed_v4_6518_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30030095 | coiled-coil domain-containing protein 87 isoform X1 | SMESG000004454.1 | dd_Smed_v4_12480_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30024394 | Dynein light chain | SMESG000005286.1 | dd_Smed_v4_898_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30032272 | FMN_red domain-containing protein | SMESG000023871.1 | dd_Smed_v4_1834_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30034198 | SMED30034198 | SMESG000002829.1 | dd_Smed_v4_12484_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30024248 | SMED30024248 | SMESG000055844.1 | dd_Smed_v4_6835_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30028624 | Synaptotagmin, putative | SMESG000034832.1 | dd_Smed_v4_13224_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30027644 | cAMP-dependent protein kinase regulatory subunit | SMESG000003135.1 | dd_Smed_v4_14355_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021030 | slc25a-7 | SMESG000074820.1 | dd_Smed_v4_8013_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021265 | 2-acylglycerol O-acyltransferase 2 | SMESG000052656.1 | dd_Smed_v4_6550_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30023210 | Phosphodiesterase | SMESG000034055.1 SMESG000034048.1 | dd_Smed_v4_9276_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30025171 | SMED30025171 | SMESG000014769.1 | dd_Smed_v4_1952_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022425 | Peroxiredoxin | SMESG000002993.1 | dd_Smed_v4_1290_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30012075 | SMED30012075 | SMESG000059352.1 SMESG000059351.1 | dd_Smed_v4_420_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30019576 | SMED30019576 | SMESG000079563.1 SMESG000052448.1 | dd_Smed_v4_3113_1_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30013149 | MIEAP domain-containing protein | SMESG000019081.1 | dd_Smed_v4_6321_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30003118 | SMED30003118 | SMESG000006534.1 | dd_Smed_v4_4662_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30013198 | SMED30013198 | SMESG000057605.1 | dd_Smed_v4_24714_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30012198 | UPF0764 protein C16orf89 homolog isoform X3 | SMESG000053422.1 | dd_Smed_v4_4213_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30009505 | SMED30009505 | SMESG000015390.1 | dd_Smed_v4_4166_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30008882 | Cilia and flagella associated protein 157 | SMESG000036345.1 | dd_Smed_v4_9862_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30017410 | Peptidoglycan-recognition protein | SMESG000004536.1 | dd_Smed_v4_817_1_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30008784 | hypothetical protein | SMESG000047305.1 | dd_Smed_v4_9312_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30004297 | Eukaryotic translation initiation factor 3 subunit K | SMESG000017237.1 | dd_Smed_v4_621_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30005665 | SMED30005665 | SMESG000074689.1 | dd_Smed_v4_2429_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30004957 | Anoctamin | SMESG000033730.1 SMESG000033728.1 | dd_Smed_v4_6514_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30019584 | Ventral anterior homeobox 1 | SMESG000055068.1 | dd_Smed_v4_49879_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30007379 | YTH domain-containing family protein 2 | SMESG000008619.1 | dd_Smed_v4_7891_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30008351 | SMED30008351 | SMESG000081198.1 | dd_Smed_v4_39279_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30006541 | SMED30006541 | SMESG000012332.1 SMESG000012317.1 SMESG000058954.1 | dd_Smed_v4_246_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30017794 | Coiled-coil domain containing 191 | SMESG000064321.1 | dd_Smed_v4_8967_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30012300 | SMED30012300 | SMESG000013739.1 | dd_Smed_v4_5519_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30010664 | SMED30010664 | SMESG000053423.1 | dd_Smed_v4_8209_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30006764 | Phosphatidylinositol 3-kinase regulatory subunit alpha | SMESG000078199.1 | dd_Smed_v4_4794_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30012487 | SMED30012487 | SMESG000009419.1 | dd_Smed_v4_5926_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30002803 | Dynein light chain | SMESG000043382.1 | dd_Smed_v4_7954_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30008757 | Piezo-type mechanosensitive ion channel component | SMESG000051188.1 | dd_Smed_v4_7182_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30006667 | SMED30006667 | SMESG000023553.1 | dd_Smed_v4_8057_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30007581 | cilia- and flagella-associated protein 69 | SMESG000047535.1 | dd_Smed_v4_7432_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30007124 | EF-hand domain-containing protein | SMESG000062171.1 | dd_Smed_v4_3568_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30009450 | TIR domain-containing protein | SMESG000008937.1 | dd_Smed_v4_9242_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30019305 | wdr-1 | SMESG000045753.1 SMESG000037894.1 | dd_Smed_v4_2585_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30012017 | SMED30012017 | SMESG000022399.1 | dd_Smed_v4_708_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001306 | SMED30001306 | SMESG000060566.1 SMESG000060556.1 | dd_Smed_v4_4002_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30015160 | SMED30015160 | SMESG000016267.1 SMESG000058374.1 | dd_Smed_v4_3391_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30019873 | plasminogen-1 | SMESG000018453.1 | dd_Smed_v4_23420_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30007279 | Neurocalcin-delta | SMESG000068889.1 | dd_Smed_v4_2568_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30007607 | SMED30007607 | SMESG000050535.1 SMESG000050533.1 | dd_Smed_v4_5107_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30004860 | STRA6-like | SMESG000041900.1 SMESG000031061.1 | dd_Smed_v4_8135_1_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001290 | semaphorin 5-3 | SMESG000033853.1 | dd_Smed_v4_9914_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30008437 | Nuclear and cytoplasmic polyadenylated RNA-binding protein | SMESG000044649.1 | dd_Smed_v4_3605_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30010991 | SMED30010991 | SMESG000014346.1 | dd_Smed_v4_6441_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30010991 | SMED30010991 | SMESG000014346.1 | dd_Smed_v4_2231_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30008534 | cGMP-dependent protein kinase | SMESG000052811.1 | dd_Smed_v4_5704_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30017369 | Disabled 2-interacting protein | SMESG000043888.1 | dd_Smed_v4_3238_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30006047 | EF-hand calcium-binding domain-containing protein 5 | SMESG000053423.1 | dd_Smed_v4_8209_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30007217 | Death domain-containing protein | SMESG000078437.1 | dd_Smed_v4_7428_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30018451 | Lipopolysaccharide-induced TNF-alpha factor | SMESG000020870.1 SMESG000046087.1 SMESG000046084.1 | dd_Smed_v4_2768_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30008957 | Meckelin | SMESG000043913.1 | dd_Smed_v4_7765_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30000581 | Centlein, centrosomal protein | SMESG000000357.1 | dd_Smed_v4_9882_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30012136 | radial spoke head protein 9 homolog | SMESG000046857.1 | dd_Smed_v4_4707_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30013768 | SMED30013768 | SMESG000056915.1 | dd_Smed_v4_3761_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30008873 | SMED30008873 | SMESG000009341.1 | dd_Smed_v4_337_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30012432 | SMED30012432 | SMESG000060566.1 SMESG000060556.1 | dd_Smed_v4_4002_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30012149 | NPHS1-7 | SMESG000016267.1 SMESG000058374.1 | dd_Smed_v4_3391_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30013882 | Spds-1 | SMESG000023363.1 | dd_Smed_v4_3295_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30014184 | Tumor necrosis factor alpha-induced protein 8-like protein | SMESG000002914.1 | dd_Smed_v4_2386_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30012046 | 5'-AMP-activated protein kinase subunit beta-1 | SMESG000037698.1 | dd_Smed_v4_6112_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30002703 | 60S ribosomal protein L23a | SMESG000074545.1 | dd_Smed_v4_281_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30010637 | Nucleolar RNA helicase II/Gu protein | SMESG000065959.1 | dd_Smed_v4_283_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30003084 | Cilia-and flagella-associated protein 45 | SMESG000016410.1 | dd_Smed_v4_3732_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001271 | SMED30001271 | SMESG000038975.1 | dd_Smed_v4_930_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30009834 | TNF receptor-associated factor | SMESG000047296.1 | dd_Smed_v4_2916_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30003501 | Surface protein | SMESG000064752.1 | dd_Smed_v4_3240_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30010227 | SMED30010227 | SMESG000078872.1 | dd_Smed_v4_673_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30019364 | Si:ch211-193l2.10 | SMESG000062713.1 | dd_Smed_v4_3203_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30015588 | SMED30015588 | SMESG000009089.1 | dd_Smed_v4_5692_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30011285 | DNA polymerase subunit gamma-1 | SMESG000077612.1 SMESG000050769.1 | dd_Smed_v4_5734_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30018439 | XK-related protein | SMESG000080414.1 | dd_Smed_v4_2770_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30002286 | formimidoyltransferase-cyclodeaminase | SMESG000070969.1 | dd_Smed_v4_7815_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30025510 | UHRF1-binding protein 1-like | SMESG000044305.1 | dd_Smed_v4_11401_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021589 | Agrin, putative | SMESG000028865.1 SMESG000028859.1 | dd_Smed_v4_3649_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30023766 | SMED30023766 | SMESG000073811.1 | dd_Smed_v4_116_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30027593 | Protein polyglycylase TTLL10 | SMESG000042729.1 SMESG000042734.1 | dd_Smed_v4_14858_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30025041 | Protein phosphatase 2c | SMESG000018373.1 | dd_Smed_v4_2362_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30026726 | RING domain ligase2 isoform 3 | SMESG000003596.1 | dd_Smed_v4_6423_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30026726 | RING domain ligase2 isoform 3 | SMESG000003596.1 | dd_Smed_v4_5871_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30028898 | BZIP domain-containing protein | SMESG000067543.1 | dd_Smed_v4_1399_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021874 | Caveolin | SMESG000052389.1 | dd_Smed_v4_877_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30033197 | SMED30033197 | SMESG000073811.1 | dd_Smed_v4_116_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30028905 | Chaperone protein DnaJ | SMESG000036198.1 | dd_Smed_v4_24393_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30023379 | Piezo-type mechanosensitive ion channel component | SMESG000051188.1 | dd_Smed_v4_7182_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30015457 | SMED30015457 | SMESG000022017.1 | dd_Smed_v4_9360_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30004876 | Nuclear receptor subfamily 4 group A | SMESG000063104.1 | dd_Smed_v4_12229_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30015948 | SMED30015948 | SMESG000042166.1 | dd_Smed_v4_4173_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30016474 | Serine/threonine-protein kinase | SMESG000040958.1 | dd_Smed_v4_22156_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30019874 | Calmodulin | SMESG000010769.1 | dd_Smed_v4_255_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30002742 | Dystonin | SMESG000043809.1 SMESG000043799.1 | dd_Smed_v4_1205_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30004930 | Irregular chiasm C-roughest-like isoform X2 | SMESG000077979.1 | dd_Smed_v4_12549_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30003829 | SMED30003829 | dd_Smed_v4_1576_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30017015 | Deferrochelatase/peroxidase YfeX | SMESG000077723.1 | dd_Smed_v4_2999_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30019455 | LIM domain-containing protein | SMESG000066861.1 SMESG000059630.1 SMESG000066862.1 | dd_Smed_v4_6647_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30017387 | von Willebrand factor A domain containing 3B | SMESG000047774.1 | dd_Smed_v4_9363_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30019133 | SMED30019133 | SMESG000019555.1 | dd_Smed_v4_6722_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30017032 | slc2a-11 | SMESG000025420.1 | dd_Smed_v4_2995_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30000146 | GLI-3 | SMESG000078300.1 | dd_Smed_v4_17566_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30000411 | Dynamin-1 | SMESG000021502.1 | dd_Smed_v4_2160_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30017542 | SMED30017542 | SMESG000033620.1 | dd_Smed_v4_22810_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001142 | Cadherin | SMESG000020082.1 SMESG000020071.1 | dd_Smed_v4_2107_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30023008 | HSP27 | SMESG000030472.1 | dd_Smed_v4_2189_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30029624 | Heterogeneous nuclear ribonucleoprotein K | SMESG000064674.1 | dd_Smed_v4_1998_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30031277 | SMED30031277 | SMESG000040958.1 | dd_Smed_v4_22156_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021635 | Succinate dehydrogenase [ubiquinone] flavoprotein subunit, mitochondrial | SMESG000008280.1 | dd_Smed_v4_897_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30030971 | Hemicentin 1 | SMESG000050805.1 | dd_Smed_v4_22836_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30025473 | mxi-2 protein | SMESG000060394.1 | dd_Smed_v4_4048_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30031139 | WASH complex subunit 2C | SMESG000014537.1 SMESG000014534.1 | dd_Smed_v4_19560_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30035079 | Phospholipid-transporting ATPase | SMESG000061014.1 | dd_Smed_v4_2913_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30025004 | Magnesium-dependent phosphatase 1 | SMESG000025378.1 | dd_Smed_v4_1958_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30026337 | Ankyrin | SMESG000000606.1 | dd_Smed_v4_2072_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30030159 | SMED30030159 | SMESG000000606.1 | dd_Smed_v4_2072_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30023691 | sperm-tail PG-rich repeat-containing protein 2 | SMESG000034428.1 | dd_Smed_v4_9462_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30031837 | SMED30031837 | SMESG000054635.1 SMESG000054602.1 SMESG000052914.1 | dd_Smed_v4_2185_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30029546 | Tektin 3 | SMESG000020792.1 | dd_Smed_v4_3187_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30029269 | Structural maintenance of chromosomes protein | SMESG000022017.1 | dd_Smed_v4_9360_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30030643 | Methylmalonic aciduria and homocystinuria type D-like protein, mitochondrial | SMESG000030431.1 | dd_Smed_v4_2046_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30020849 | SMED30020849 | SMESG000044682.1 | dd_Smed_v4_3494_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022184 | Protein transport protein Sec61 subunit beta | SMESG000050010.1 SMESG000013437.1 | dd_Smed_v4_418_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30031631 | 6-phosphogluconate dehydrogenase, decarboxylating | SMESG000005721.1 | dd_Smed_v4_366_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30034254 | calreticulin-1 | SMESG000009012.1 | dd_Smed_v4_220_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30026527 | Serine palmitoyltransferase 2 | SMESG000011189.1 | dd_Smed_v4_4337_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30025231 | radial spoke head protein 6 homolog A | SMESG000079294.1 SMESG000044179.1 | dd_Smed_v4_3854_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30026371 | SMED30026371 | SMESG000059828.1 | dd_Smed_v4_2479_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30026457 | Fumarate hydratase, class I | SMESG000075499.1 SMESG000009591.1 | dd_Smed_v4_2405_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30026004 | SMED30026004 | SMESG000016872.1 | dd_Smed_v4_3108_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30028925 | Adiponectin receptor protein | SMESG000011535.1 | dd_Smed_v4_2696_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30031567 | Ribonucloprotein | SMESG000040544.1 SMESG000027686.1 | dd_Smed_v4_3155_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022121 | SMED30022121 | SMESG000042798.1 | dd_Smed_v4_2204_1_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30015158 | Translation initiation factor SUI1 | SMESG000033176.1 | dd_Smed_v4_1183_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30006549 | SMED30006549 | SMESG000016886.1 SMESG000016875.1 | dd_Smed_v4_7893_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30005523 | Alpha-actinin | SMESG000026000.1 | dd_Smed_v4_1951_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30006438 | EF-hand domain-containing family member B | SMESG000077905.1 | dd_Smed_v4_11909_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30002663 | TNF receptor-associated factor | SMESG000018404.1 | dd_Smed_v4_4392_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30005770 | Cell number regulator 7 | SMESG000060415.1 | dd_Smed_v4_743_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30013060 | Transcription factor IIIB 90 kDa subunit | SMESG000049775.1 | dd_Smed_v4_1437_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30005158 | WD_REPEATS_REGION domain-containing protein | SMESG000071691.1 | dd_Smed_v4_6137_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30008772 | Golgi-associated plant pathogenesis-related protein 1 | SMESG000035954.1 | dd_Smed_v4_27440_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30008280 | Class E vacuolar protein-sorting machinery protein HSE1 | SMESG000077597.1 | dd_Smed_v4_4190_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30000895 | SMED30000895 | SMESG000034252.1 | dd_Smed_v4_41846_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30013095 | DDE_Tnp_1_7 domain-containing protein | SMESG000080622.1 SMESG000068757.1 SMESG000055125.1 SMESG000038294.1 SMESG000032747.1 SMESG000023322.1 | dd_Smed_v4_3830_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30007704 | Actin | SMESG000051672.1 SMESG000051670.1 | dd_Smed_v4_3_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30013909 | tud-1 | SMESG000029236.1 SMESG000029232.1 | dd_Smed_v4_1582_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001929 | F-box domain-containing protein | SMESG000077869.1 | dd_Smed_v4_14890_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30002066 | SMED30002066 | SMESG000016886.1 SMESG000016875.1 | dd_Smed_v4_7893_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30009218 | Receptor expression-enhancing protein | SMESG000036637.1 | dd_Smed_v4_1995_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30008456 | Type I inositol-1,4,5-trisphosphate 5-phosphatase | SMESG000074184.1 SMESG000019975.1 | dd_Smed_v4_266_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30009817 | testis-expressed protein 52 | SMESG000070302.1 | dd_Smed_v4_6766_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30000671 | Fibronectin type III domain protein | SMESG000043560.1 | dd_Smed_v4_33732_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30009281 | Netrin-4 | SMESG000062589.1 | dd_Smed_v4_6093_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30007579 | SMED30007579 | SMESG000038305.1 SMESG000038298.1 SMESG000038313.1 SMESG000035859.1 | dd_Smed_v4_9798_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30018534 | Muscleblind-like protein | SMESG000067960.1 SMESG000079855.1 SMESG000037170.1 | dd_Smed_v4_2838_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001449 | Propionyl-CoA carboxylase subunit beta | dd_Smed_v4_513_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30010316 | Echinoderm microtubule-associated protein-like 4 | SMESG000027261.1 | dd_Smed_v4_10540_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30016583 | SMED30016583 | SMESG000020949.1 | dd_Smed_v4_29455_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30016583 | SMED30016583 | SMESG000020949.1 | dd_Smed_v4_13527_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30010704 | SMED30010704 | dd_Smed_v4_14348_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30010364 | SMED30010364 | SMESG000056847.1 SMESG000056843.1 SMESG000056838.1 SMESG000044770.1 SMESG000044762.1 SMESG000007140.1 | dd_Smed_v4_1137_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30010231 | SMED30010231 | SMESG000015116.1 | dd_Smed_v4_10874_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30000682 | SMED30000682 | dd_Smed_v4_1303_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30001550 | Flagellar outer dynein arm light chain 2 | dd_Smed_v4_19018_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30014496 | Ribosome biogenesis protein NSA2 | SMESG000028599.1 | dd_Smed_v4_1012_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30015973 | myosin-11 | SMESG000064787.1 | dd_Smed_v4_13489_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30014310 | ANK_REP_REGION domain-containing protein | SMESG000055419.1 | dd_Smed_v4_13629_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30010674 | SPATA6 domain-containing protein | SMESG000053714.1 | dd_Smed_v4_10543_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30005442 | General transcription factor II-I repeat domain-containing protein 2A | dd_Smed_v4_14922_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30013779 | Tubulin monoglycylase TTLL3 | SMESG000029205.1 | dd_Smed_v4_10244_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30018838 | SMED30018838 | dd_Smed_v4_17031_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30006326 | piggyBac transposable element-derived protein 4-like | dd_Smed_v4_14301_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30017298 | SMED30017298 | dd_Smed_v4_17790_0_2 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30013459 | SMED30013459 | dd_Smed_v4_16904_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30013261 | Retrovirus-related Pol polyprotein from transposon | dd_Smed_v4_15498_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30012385 | C2H2-type domain-containing protein | dd_Smed_v4_17695_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30012660 | 28S ribosomal protein S16 | dd_Smed_v4_1539_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30006335 | SMED30006335 | SMESG000046906.1 | dd_Smed_v4_10831_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30028521 | Cadmium metallothionein (MT-Cd) (Cd-MT) | SMESG000013781.1 | dd_Smed_v4_3412_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30023104 | SMED30023104 | dd_Smed_v4_1576_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30031446 | Neuronal guanine nucleotide exchange factor | SMESG000003812.1 | dd_Smed_v4_5524_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30034412 | E3 ubiquitin-protein ligase CBL | SMESG000056433.1 | dd_Smed_v4_6780_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022077 | Cytospin-A | SMESG000039310.1 | dd_Smed_v4_6934_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30032531 | SMED30032531 | SMESG000024850.1 | dd_Smed_v4_9209_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30029481 | SMED30029481 | SMESG000079496.1 | dd_Smed_v4_6860_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30023491 | SMED30023491 | dd_Smed_v4_14238_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30031687 | TNF receptor-associated factor | SMESG000014725.1 SMESG000014724.1 SMESG000014706.1 SMESG000014702.1 SMESG000014700.1 | dd_Smed_v4_4420_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30023859 | Serine/threonine protein phosphatase 2A regulatory subunit | SMESG000026797.1 | dd_Smed_v4_6134_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30027978 | Calcyphosin protein | SMESG000025859.1 | dd_Smed_v4_4512_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30027517 | translin-associated factor X-interacting protein 1 | SMESG000041265.1 | dd_Smed_v4_9718_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30028057 | Retinal homeobox protein Rax | SMESG000019089.1 | dd_Smed_v4_6404_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30023613 | SMED30023613 | dd_Smed_v4_12778_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30030073 | Thymus, brain and testes associated | SMESG000053617.1 | dd_Smed_v4_4229_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30029763 | histone H1 | SMESG000024348.1 SMESG000010800.1 | dd_Smed_v4_601_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30033785 | Cell division cycle and apoptosis regulator protein 1 | dd_Smed_v4_1181_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30022806 | Calcyphosin protein | SMESG000025859.1 | dd_Smed_v4_4512_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30029902 | Protein kinase domain-containing protein | SMESG000074943.1 SMESG000074941.1 | dd_Smed_v4_6760_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30023430 | set nuclear proto-oncogene | SMESG000031906.1 SMESG000031905.1 | dd_Smed_v4_618_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022841 | Chromosome 17 open reading frame 98 | SMESG000007056.1 | dd_Smed_v4_9687_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30028081 | SMED30028081 | SMESG000028922.1 | dd_Smed_v4_9517_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021559 | SMED30021559 | SMESG000079496.1 | dd_Smed_v4_6860_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30025067 | Endoplasmic reticulum chaperone BiP | SMESG000062699.1 | dd_Smed_v4_511_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30032907 | Alpha-galactosidase | SMESG000009912.1 | dd_Smed_v4_606_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021508 | Glutamate dehydrogenase | SMESG000061402.1 | dd_Smed_v4_932_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30032094 | RIIa domain-containing protein 1 | SMESG000079320.1 | dd_Smed_v4_4716_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30029583 | SMED30029583 | dd_Smed_v4_1338_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30034271 | Eukaryotic translation initiation factor 5A | SMESG000081077.1 | dd_Smed_v4_484_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30034308 | Integrase catalytic domain-containing protein | dd_Smed_v4_12778_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30029781 | SMED30029781 | dd_Smed_v4_1213_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30024583 | SMED30024583 | dd_Smed_v4_215_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30030306 | ABC transporter domain-containing protein | SMESG000058880.1 SMESG000039065.1 | dd_Smed_v4_4225_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022339 | SMED30022339 | dd_Smed_v4_14770_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30032675 | Glutamine-rich protein 2 | SMESG000081231.1 | dd_Smed_v4_6048_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022237 | SMED30022237 | dd_Smed_v4_15266_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30022075 | Synaptotagmin protein 5 | SMESG000074360.1 | dd_Smed_v4_4335_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022564 | SMED30022564 | dd_Smed_v4_14487_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30032225 | SMED30032225 | dd_Smed_v4_16904_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30020666 | Glutamine-rich protein 2 | SMESG000081231.1 | dd_Smed_v4_6048_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30030788 | SMED30030788 | SMESG000079496.1 | dd_Smed_v4_6860_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30028337 | SAP domain-containing protein | dd_Smed_v4_1181_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30024648 | RRM domain-containing protein | dd_Smed_v4_11998_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30001515 | Annexin | SMESG000042839.1 | dd_Smed_v4_1104_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001112 | SMED30001112 | SMESG000061228.1 | dd_Smed_v4_8351_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001112 | SMED30001112 | SMESG000061228.1 | dd_Smed_v4_13515_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30017314 | Dynein regulatory complex subunit 7 | SMESG000078850.1 | dd_Smed_v4_12588_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30011615 | SMED30011615 | SMESG000036524.1 | dd_Smed_v4_11034_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30009224 | early growth response-3 | SMESG000000959.1 | dd_Smed_v4_12410_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30009224 | early growth response-3 | SMESG000000959.1 | dd_Smed_v4_14711_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30006633 | SMED30006633 | SMESG000040042.1 | dd_Smed_v4_11386_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30017925 | Dynein light chain Tctex-type 1 | SMESG000026631.1 | dd_Smed_v4_1166_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30003032 | SMED30003032 | SMESG000061110.1 | dd_Smed_v4_11638_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30005150 | 3' histone mRNA exonuclease 1 | SMESG000058668.1 | dd_Smed_v4_1266_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30018893 | Enkurin domain-containing protein | SMESG000081414.1 | dd_Smed_v4_12339_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30019298 | Heterogeneous nuclear ribonucleoprotein L | SMESG000005298.1 | dd_Smed_v4_1327_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30015672 | Gelsolin-like protein | SMESG000015928.1 | dd_Smed_v4_1215_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30010024 | SMED30010024 | SMESG000038072.1 | dd_Smed_v4_13847_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30007143 | Nucleolar GTP-binding protein 2 | SMESG000026847.1 | dd_Smed_v4_1134_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30002882 | SMED30002882 | SMESG000069367.1 | dd_Smed_v4_11838_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30002882 | SMED30002882 | SMESG000069367.1 | dd_Smed_v4_9233_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30012858 | serine/threonine-protein kinase DCLK1 | SMESG000078466.1 | dd_Smed_v4_13093_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30012858 | serine/threonine-protein kinase DCLK1 | dd_Smed_v4_5129_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30016422 | 2-oxoisovalerate dehydrogenase subunit alpha | SMESG000021412.1 | dd_Smed_v4_10732_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30007188 | Calmodulin | SMESG000078272.1 | dd_Smed_v4_11942_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30017312 | Coiled-coil domain-containing protein 189 | SMESG000046576.1 | dd_Smed_v4_12703_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30012981 | Cyclic nucleotide gated channel 1 | SMESG000036524.1 | dd_Smed_v4_11034_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30014144 | Phytanoyl-CoA dioxygenase domain-containing protein 1-like | SMESG000023010.1 | dd_Smed_v4_1207_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30009282 | EF-hand calcium binding domain 2 | SMESG000049879.1 SMESG000003119.1 | dd_Smed_v4_11976_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30010322 | SMED30010322 | SMESG000006336.1 | dd_Smed_v4_11671_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30018865 | DUF1619 domain-containing protein | SMESG000057489.1 | dd_Smed_v4_11225_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30011581 | AP2-associated protein kinase 1-like Protein | SMESG000041938.1 SMESG000041937.1 SMESG000051989.1 | dd_Smed_v4_1179_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30005771 | SMED30005771 | SMESG000042003.1 | dd_Smed_v4_12482_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30013262 | SMED30013262 | SMESG000060779.1 | dd_Smed_v4_11792_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30007470 | Coiled-coil domain-containing protein 180 | SMESG000039547.1 | dd_Smed_v4_12302_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30009968 | Intraflagellar transport protein 122 homolog | SMESG000039305.1 SMESG000039304.1 | dd_Smed_v4_11912_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30013865 | OFD1 | SMESG000046592.1 | dd_Smed_v4_13339_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30003236 | Tropomodulin | SMESG000054078.1 | dd_Smed_v4_3279_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30016092 | SMED30016092 | dd_Smed_v4_3534_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30007568 | NADH-ubiquinone oxidoreductase 75 kDa subunit, mitochondrial | SMESG000081864.1 | dd_Smed_v4_2402_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30011383 | NEDD8 | dd_Smed_v4_403_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30011412 | Ribosomal protein L37 | dd_Smed_v4_97_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30010375 | cytochrome c oxidase subunit I | dd_Smed_v4_753_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30001197 | SMED30001197 | SMESG000004996.1 | dd_Smed_v4_4124_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30003686 | NADH dehydrogenase subunit 2 | dd_Smed_v4_505_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30025791 | B box-type domain-containing protein | SMESG000078465.1 | dd_Smed_v4_11048_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30031485 | Lipoxygenase homology domain-containing protein 1 | SMESG000001054.1 | dd_Smed_v4_10315_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30034851 | Procollagen galactosyltransferase | SMESG000037408.1 | dd_Smed_v4_10276_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30031490 | SMED30031490 | SMESG000017778.1 | dd_Smed_v4_10175_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30033756 | 60S ribosomal protein L37 | dd_Smed_v4_97_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30027979 | 40S ribosomal protein S27 | SMESG000066109.1 SMESG000052687.1 SMESG000014240.1 SMESG000069832.1 SMESG000037642.1 | dd_Smed_v4_106_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30027150 | Pleckstrin homology and RhoGEF domain containing G5 | SMESG000052365.1 | dd_Smed_v4_14038_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30028184 | Ras-related protein Rab-32 | SMESG000060723.1 | dd_Smed_v4_1037_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021731 | Multidrug resistance protein 1-like protein | SMESG000004996.1 | dd_Smed_v4_4124_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30024872 | Cysteine and histidine-rich domain-containing protein 1 | SMESG000019808.1 | dd_Smed_v4_1390_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30029518 | Selenoprotein W | dd_Smed_v4_572_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30027383 | SMED30027383 | dd_Smed_v4_19765_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30025849 | Centrosome and spindle pole-associated protein 1 | SMESG000080361.1 | dd_Smed_v4_13453_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30030595 | DDE_Tnp_IS1595 domain-containing protein | dd_Smed_v4_42270_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30022118 | Kunitz-like protease inhibitor | dd_Smed_v4_2814_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30025688 | Protein tilB homolog | SMESG000058220.1 | dd_Smed_v4_10124_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021433 | 60S ribosomal protein L39 | dd_Smed_v4_394_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30031746 | SMED30031746 | dd_Smed_v4_24183_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30029361 | KIF3B-like protein | SMESG000020245.1 | dd_Smed_v4_9308_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30029361 | KIF3B-like protein | SMESG000075065.1 | dd_Smed_v4_4343_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30025953 | SMED30025953 | dd_Smed_v4_5792_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30031754 | SMED30031754 | dd_Smed_v4_14636_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30034173 | Calcium-dependent protein kinase | SMESG000033648.1 | dd_Smed_v4_13677_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30033234 | SMED30033234 | dd_Smed_v4_37328_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30026188 | ER membrane protein complex subunit 10 | dd_Smed_v4_2594_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30020913 | SMED30020913 | SMESG000009078.1 | dd_Smed_v4_13484_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30026825 | Dimer_Tnp_hAT domain-containing protein | dd_Smed_v4_48621_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30031308 | ATP synthase F0 subunit 6 | dd_Smed_v4_258_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30034623 | cytochrome c oxidase subunit III | dd_Smed_v4_258_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30035193 | Heat shock protein 90 | dd_Smed_v4_56_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30035174 | SMED30035174 | dd_Smed_v4_6013_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30029698 | Caspase-7 | SMESG000053168.1 | dd_Smed_v4_1167_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30034101 | SMED30034101 | dd_Smed_v4_3534_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30026531 | cytochrome c oxidase subunit II | dd_Smed_v4_297_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30033740 | SMED30033740 | dd_Smed_v4_258_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30033740 | SMED30033740 | dd_Smed_v4_957_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30033869 | SMED30033869 | dd_Smed_v4_6382_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30027076 | FAD-binding PCMH-type domain-containing protein | SMESG000066568.1 | dd_Smed_v4_10292_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022681 | Dynein heavy chain 7 axonemal | SMESG000012956.1 | dd_Smed_v4_13792_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022681 | Dynein heavy chain 7 axonemal | SMESG000012956.1 | dd_Smed_v4_5350_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30025223 | Neuropeptide Y prohormone-2 | SMESG000050247.1 SMESG000050248.1 | dd_Smed_v4_10191_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30033335 | SMED30033335 | SMESG000002226.1 | dd_Smed_v4_10738_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30026477 | SMED30026477 | dd_Smed_v4_275_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30029399 | SMED30029399 | SMESG000015116.1 | dd_Smed_v4_10874_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30029350 | Serine incorporator 3 | SMESG000020805.1 | dd_Smed_v4_1130_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022007 | SMED30022007 | dd_Smed_v4_90717_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30023388 | GRB2 associated binding protein-1 | dd_Smed_v4_5117_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30025152 | cilia- and flagella-associated protein 91 | SMESG000056200.1 | dd_Smed_v4_10405_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30025152 | cilia- and flagella-associated protein 91 | SMESG000056200.1 | dd_Smed_v4_9724_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30028343 | Cytosolic carboxypeptidase 2 | SMESG000006325.1 | dd_Smed_v4_13454_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30027761 | SMED30027761 | dd_Smed_v4_54604_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() | |
pharynx | SMED30013975 | Ras association domain-containing protein 1 | SMESG000029652.1 | dd_Smed_v4_5323_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30002774 | SMED30002774 | SMESG000017229.1 | dd_Smed_v4_613_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30014618 | SMED30014618 | SMESG000067158.1 SMESG000079384.1 SMESG000006522.1 | dd_Smed_v4_6854_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30000831 | Golgi-associated plant pathogenesis protein 1 | SMESG000036937.1 | dd_Smed_v4_2081_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30006230 | Sperm surface protein Sp17 | SMESG000046919.1 | dd_Smed_v4_2279_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30006230 | Sperm surface protein Sp17 | SMESG000046919.1 | dd_Smed_v4_4783_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001049 | Ubiquitin carboxyl-terminal hydrolase | SMESG000038532.1 SMESG000038519.1 SMESG000038510.1 SMESG000036103.1 SMESG000036102.1 SMESG000036062.1 | dd_Smed_v4_8017_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30006006 | SMED30006006 | SMESG000007018.1 SMESG000007017.1 | dd_Smed_v4_1969_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001916 | IRS-type PTB domain-containing protein | SMESG000027222.1 | dd_Smed_v4_9490_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30013825 | Acyl-coenzyme A thioesterase 13 | SMESG000063995.1 | dd_Smed_v4_4659_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30013498 | LIM zinc-binding domain-containing protein | SMESG000072162.1 | dd_Smed_v4_537_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30002502 | Choline-phosphate cytidylyltransferase | SMESG000081359.1 | dd_Smed_v4_5385_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001113 | FERM domain-containing protein | SMESG000048801.1 | dd_Smed_v4_5600_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30003405 | GCR135 | SMESG000076928.1 | dd_Smed_v4_39877_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001158 | SMED30001158 | SMESG000009491.1 | dd_Smed_v4_9572_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30003738 | hadrian | SMESG000043826.1 SMESG000043821.1 | dd_Smed_v4_3606_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30017235 | SMED30017235 | SMESG000067158.1 SMESG000079384.1 SMESG000006522.1 | dd_Smed_v4_6854_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30004739 | TNF receptor-associated factor | SMESG000014725.1 SMESG000014724.1 SMESG000014706.1 SMESG000014702.1 SMESG000014700.1 | dd_Smed_v4_4420_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30002976 | Integrase_H2C2 domain-containing protein | SMESG000031440.1 | dd_Smed_v4_9924_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30017053 | SMED30017053 | SMESG000004885.1 | dd_Smed_v4_5297_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30000819 | Acid sphingomyelinase-like phosphodiesterase | SMESG000071517.1 | dd_Smed_v4_5377_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30015316 | Cell division control protein 42 homolog | SMESG000056490.1 | dd_Smed_v4_8621_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30008984 | Protein phosphatase 1G | SMESG000030206.1 | dd_Smed_v4_2086_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30015252 | Mitochondrial inner membrane protein OXA1L | SMESG000039158.1 | dd_Smed_v4_4072_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30010504 | SMED30010504 | SMESG000010514.1 | dd_Smed_v4_4965_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001920 | SMED30001920 | SMESG000013429.1 | dd_Smed_v4_21056_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30000512 | cilia- and flagella-associated protein 61 | SMESG000059955.1 | dd_Smed_v4_4908_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30010410 | SMED30010410 | SMESG000021757.1 | dd_Smed_v4_8797_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30009981 | Ras-related protein | SMESG000044147.1 | dd_Smed_v4_6181_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30002256 | coiled-coil domain-containing protein 81 | SMESG000036887.1 | dd_Smed_v4_6753_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30018603 | Receptor expression-enhancing protein | SMESG000043862.1 | dd_Smed_v4_838_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30005802 | SMED30005802 | SMESG000072483.1 | dd_Smed_v4_5611_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30000605 | UPF0193 protein EVG1 | SMESG000056865.1 | dd_Smed_v4_9772_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001147 | Ras-like GTP-binding protein YPT1 | SMESG000044147.1 | dd_Smed_v4_6181_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30002166 | SMED30002166 | SMESG000058880.1 SMESG000039065.1 | dd_Smed_v4_4225_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30013430 | Vigilin High density lipoprotein-binding protein | SMESG000018596.1 SMESG000006601.1 | dd_Smed_v4_6161_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30016840 | Phosphodiesterase | SMESG000019038.1 | dd_Smed_v4_8595_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30014640 | Small heat shock protein p36 | SMESG000028601.1 | dd_Smed_v4_6399_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30012665 | FERM domain-containing protein | SMESG000062741.1 SMESG000053535.1 SMESG000049374.1 SMESG000033049.1 SMESG000024644.1 SMESG000016667.1 | dd_Smed_v4_6227_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001248 | SMED30001248 | SMESG000013596.1 | dd_Smed_v4_6322_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30003228 | Dach-1 | SMESG000005090.1 | dd_Smed_v4_5823_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001782 | Fibronectin type III domain-containing protein | SMESG000024682.1 | dd_Smed_v4_3381_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30007764 | SMED30007764 | SMESG000036249.1 | dd_Smed_v4_9326_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30008229 | SMED30008229 | SMESG000077869.1 | dd_Smed_v4_14890_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30009913 | Beta-ureidopropionase | SMESG000060425.1 | dd_Smed_v4_1584_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30008926 | ATP-dependent DNA helicase | SMESG000023939.1 | dd_Smed_v4_6024_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30009268 | SMED30009268 | SMESG000065344.1 | dd_Smed_v4_3354_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30011898 | Protein F37C4.5 | SMESG000008044.1 | dd_Smed_v4_9190_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001096 | 40S ribosomal protein S23 | SMESG000017264.1 | dd_Smed_v4_290_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30019834 | Guanine nucleotide-binding protein subunit beta-2-like 1 | SMESG000076568.1 | dd_Smed_v4_174_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001380 | Zinc finger FYVE domain-containing protein | SMESG000014968.1 | dd_Smed_v4_4344_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30005206 | Serine/arginine-rich splicing factor 1 | SMESG000075205.1 | dd_Smed_v4_1192_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001560 | SMED30001560 | SMESG000033391.1 | dd_Smed_v4_5969_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30011242 | Synaptosomal-associated protein 29 | SMESG000001576.1 | dd_Smed_v4_1819_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30008655 | Tubulin alpha chain | SMESG000054547.1 | dd_Smed_v4_508_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30005190 | SMED30005190 | SMESG000041069.1 | dd_Smed_v4_237_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30008579 | ST13 Hsp70 interacting protein | SMESG000071677.1 SMESG000069228.1 SMESG000017570.1 SMESG000017358.1 SMESG000017347.1 SMESG000013728.1 SMESG000001430.1 | dd_Smed_v4_668_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30009642 | Neural-cadherin | SMESG000045006.1 | dd_Smed_v4_9254_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30016387 | HAP1 N-terminal domain-containing protein | SMESG000065238.1 SMESG000065237.1 | dd_Smed_v4_4847_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30010044 | Rho GTPase-activating protein 7 | SMESG000056012.1 | dd_Smed_v4_9530_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30011727 | Dedicator of cytokinesis 4b | SMESG000063593.1 SMESG000063592.1 SMESG000063595.1 | dd_Smed_v4_6156_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30009859 | 40S ribosomal protein S24 | SMESG000035929.1 | dd_Smed_v4_164_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001950 | Muscle associated receptor tyrosine kinase | SMESG000017131.1 | dd_Smed_v4_6799_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30011604 | Long-chain-fatty-acid--CoA ligase | SMESG000081754.1 | dd_Smed_v4_2153_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001490 | ADF-H domain-containing protein | SMESG000080129.1 | dd_Smed_v4_260_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30000372 | Dmd-2 splice form 1 | SMESG000075920.1 | dd_Smed_v4_31674_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001237 | Tubulin polymerization-promoting protein family member 3 | SMESG000002261.1 | dd_Smed_v4_650_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30003905 | Far upstream element-binding protein | SMESG000037106.1 | dd_Smed_v4_812_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30010222 | FKBP2 | SMESG000026974.1 | dd_Smed_v4_1536_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30000794 | Luc7-like protein 3 | SMESG000041410.1 | dd_Smed_v4_1899_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30004335 | TBC1 domain family member 2B | SMESG000012909.1 | dd_Smed_v4_2925_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30014009 | Tubulin polyglutamylase TTLL4 | SMESG000073336.1 | dd_Smed_v4_17537_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30002133 | Polyubiquitin | SMESG000039444.1 SMESG000014081.1 | dd_Smed_v4_34_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30007243 | Polypeptide N-acetylgalactosaminyltransferase | SMESG000081451.1 | dd_Smed_v4_5333_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30000065 | SMED30000065 | SMESG000049103.1 | dd_Smed_v4_397_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30005283 | SMED30005283 | SMESG000052690.1 | dd_Smed_v4_9995_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30004634 | Mitochondrial processing peptidase beta subunit | SMESG000037024.1 | dd_Smed_v4_729_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30009510 | intraflagellar transport protein 80 homolog | SMESG000066998.1 | dd_Smed_v4_9110_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30002589 | Oxysterol-binding protein | SMESG000065901.1 | dd_Smed_v4_3179_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30000108 | Glycerol-3-phosphate dehydrogenase [NAD( )] | SMESG000008767.1 | dd_Smed_v4_4661_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001079 | PSDC domain-containing protein | SMESG000023831.1 | dd_Smed_v4_5455_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30011431 | SMED30011431 | SMESG000063184.1 | dd_Smed_v4_2217_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30000950 | slc16a-22 | SMESG000077590.1 | dd_Smed_v4_6317_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30008231 | Calponin-homology (CH) domain-containing protein | SMESG000036289.1 | dd_Smed_v4_5824_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30006655 | 60S ribosomal protein L32 | SMESG000060036.1 | dd_Smed_v4_149_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30011294 | Protein kinase domain-containing protein | SMESG000041899.1 SMESG000031064.1 | dd_Smed_v4_8347_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30001702 | SMED30001702 | SMESG000042167.1 | dd_Smed_v4_8527_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30014459 | bak-2 | SMESG000008222.1 | dd_Smed_v4_1767_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30005762 | Contactin/TAG-1 cell adhesion molecule | SMESG000036495.1 | dd_Smed_v4_2673_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30034763 | c-Jun N-terminal kinases | SMESG000043618.1 | dd_Smed_v4_5924_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30035047 | Sperm associated antigen 17 | SMESG000038878.1 | dd_Smed_v4_9301_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30032970 | Alpha-int-3 | SMESG000034289.1 | dd_Smed_v4_8943_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021019 | CYTOSOL_AP domain-containing protein | SMESG000037599.1 | dd_Smed_v4_181_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30031752 | Metal transporter cnnm2 | SMESG000070597.1 | dd_Smed_v4_18450_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30035599 | meis | SMESG000006530.1 | dd_Smed_v4_15951_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30028172 | Serine palmitoyltransferase 2 | SMESG000016646.1 | dd_Smed_v4_1633_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30033139 | TNF receptor-associated factor | SMESG000079607.1 SMESG000072955.1 SMESG000049847.1 SMESG000049844.1 SMESG000049832.1 SMESG000049812.1 SMESG000049806.1 SMESG000049805.1 SMESG000049772.1 SMESG000049767.1 SMESG000049756.1 SMESG000049745.1 SMESG000049740.1 SMESG000049739.1 SMESG000049695.1 SMESG000049688.1 SMESG000049683.1 SMESG000049676.1 SMESG000049665.1 SMESG000049663.1 SMESG000049647.1 SMESG000049621.1 SMESG000049614.1 SMESG000049601.1 SMESG000049567.1 SMESG000049548.1 SMESG000040301.1 SMESG000040257.1 SMESG000032755.1 SMESG000032715.1 SMESG000022696.1 SMESG000022691.1 SMESG000022676.1 SMESG000022665.1 SMESG000022640.1 SMESG000022619.1 SMESG000022612.1 | dd_Smed_v4_490_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30034947 | SMED30034947 | SMESG000077223.1 | dd_Smed_v4_7005_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30024572 | SMED30024572 | SMESG000022691.1 SMESG000022690.1 | dd_Smed_v4_2130_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30025898 | SMED30025898 | SMESG000051187.1 | dd_Smed_v4_16909_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30034315 | Adenylyl cyclase-associated protein | SMESG000032321.1 | dd_Smed_v4_727_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30034099 | SMED30034099 | SMESG000040016.1 SMESG000040019.1 | dd_Smed_v4_22578_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30035924 | SMED30035924 | SMESG000043662.1 | dd_Smed_v4_11896_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022778 | SMED30022778 | SMESG000079288.1 SMESG000017831.1 | dd_Smed_v4_15746_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30030220 | Helicase for meiosis 1 | SMESG000065404.1 | dd_Smed_v4_9538_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30033701 | chromobox protein homolog 1 | SMESG000055315.1 SMESG000055314.1 SMESG000054375.1 SMESG000054374.1 | dd_Smed_v4_4855_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30035339 | RIMS binding protein 2 | SMESG000001071.1 SMESG000001061.1 SMESG000001060.1 | dd_Smed_v4_9824_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30033399 | Ras-related protein Rab-11A | SMESG000023556.1 | dd_Smed_v4_6025_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30035074 | SMED30035074 | SMESG000068982.1 | dd_Smed_v4_1190_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30032159 | Oxysterol-binding protein | SMESG000046022.1 | dd_Smed_v4_5423_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30023736 | sine oculis-1/2 | SMESG000001687.1 | dd_Smed_v4_15436_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30028489 | START domain-containing protein | SMESG000028630.1 | dd_Smed_v4_3237_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30028489 | START domain-containing protein | SMESG000078713.1 SMESG000060505.1 SMESG000055485.1 SMESG000051367.1 SMESG000073216.1 SMESG000045326.1 SMESG000032032.1 SMESG000021912.1 SMESG000017091.1 | dd_Smed_v4_12660_2_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30030892 | Intraflagellar transport protein 172 | SMESG000028841.1 | dd_Smed_v4_7533_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30030892 | Intraflagellar transport protein 172 | SMESG000028841.1 | dd_Smed_v4_10638_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30020664 | Potassium voltage-gated channel subfamily A member 2 | SMESG000028841.1 | dd_Smed_v4_7533_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30032500 | Ras-related protein Rab-10 | SMESG000052620.1 | dd_Smed_v4_6049_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30032202 | Doublecortin domain-containing protein | SMESG000017756.1 | dd_Smed_v4_11770_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30017854 | SMED30017854 | SMESG000014767.1 | dd_Smed_v4_75560_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30019452 | Ceramide glucosyltransferase | SMESG000070132.1 | dd_Smed_v4_7543_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30018300 | slc42a-2 | SMESG000005978.1 | dd_Smed_v4_2323_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30003044 | Reticulocalbin | SMESG000077405.1 | dd_Smed_v4_5905_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30013386 | netrin 1 | SMESG000006806.1 | dd_Smed_v4_9795_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30019836 | CCDC151 | SMESG000007771.1 | dd_Smed_v4_4526_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30017018 | SMED30017018 | SMESG000007294.1 | dd_Smed_v4_371_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30014525 | Dolichyl-diphosphooligosaccharide--protein glycosyltransferase 48 kDa subunit | SMESG000010589.1 | dd_Smed_v4_948_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30019565 | Radial spoke head protein 4-like protein A | SMESG000044927.1 | dd_Smed_v4_5346_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30011748 | SMED30011748 | SMESG000013713.1 | dd_Smed_v4_9787_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30014692 | Histone H4 | SMESG000036410.1 | dd_Smed_v4_506_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30013731 | Centrin | SMESG000040368.1 | dd_Smed_v4_7903_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30015423 | Cilia- and flagella-associated protein 20 | SMESG000057288.1 | dd_Smed_v4_4843_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30016950 | Dystrophin | SMESG000020523.1 | dd_Smed_v4_5325_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30007886 | SMED30007886 | SMESG000055169.1 | dd_Smed_v4_9583_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30013227 | WD repeat-containing protein | SMESG000042025.1 | dd_Smed_v4_9187_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30016446 | Root phototropism protein 2 | SMESG000067415.1 | dd_Smed_v4_8081_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30012572 | Leucine--tRNA ligase | SMESG000071689.1 | dd_Smed_v4_9705_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30014181 | slc23a-2 | SMESG000066926.1 SMESG000066923.1 SMESG000066912.1 SMESG000066905.1 | dd_Smed_v4_9401_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30005449 | SMED30005449 | SMESG000014251.1 | dd_Smed_v4_9793_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30015650 | FGFR1 oncogene partner | SMESG000006505.1 | dd_Smed_v4_5371_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30019240 | Protein FAM151A | SMESG000000164.1 | dd_Smed_v4_9939_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30011943 | Fibronectin type III and ankyrin repeat domains 1 | SMESG000033969.1 | dd_Smed_v4_7571_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30018550 | CEP78 | SMESG000064712.1 | dd_Smed_v4_9671_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30018632 | Protein kinase domain-containing protein | SMESG000017261.1 | dd_Smed_v4_2030_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30015426 | SMED30015426 | SMESG000038532.1 SMESG000038520.1 SMESG000038497.1 SMESG000036112.1 SMESG000036067.1 | dd_Smed_v4_5097_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30017802 | SMED30017802 | SMESG000073243.1 | dd_Smed_v4_5953_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30008679 | Leucine rich repeat containing 34 | SMESG000053819.1 | dd_Smed_v4_9926_1_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30012605 | FERM domain-containing protein | SMESG000034888.1 | dd_Smed_v4_4999_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30017971 | ANK_REP_REGION domain-containing protein | SMESG000026132.1 | dd_Smed_v4_6201_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30005322 | SMED30005322 | SMESG000078208.1 | dd_2727 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30016580 | SMED30016580 | SMESG000044545.1 | dd_Smed_v4_5799_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022501 | Fatty acid-binding protein, heart | SMESG000029500.1 | dd_Smed_v4_599_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30026396 | Receptor expression-enhancing protein | SMESG000044545.1 | dd_Smed_v4_5799_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30020213 | tensin isoform X3 | SMESG000033851.1 | dd_Smed_v4_5620_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021194 | Calcitonin-like receptor | SMESG000080399.1 | dd_Smed_v4_7328_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30031389 | Calnexin | SMESG000016275.1 | dd_Smed_v4_632_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30026112 | Sorting nexin-27 | SMESG000081127.1 | dd_Smed_v4_2513_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30029077 | Macrophage-expressed gene 1 protein | SMESG000044681.1 | dd_Smed_v4_983_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30026870 | SWIM-type domain-containing protein | SMESG000060198.1 | dd_Smed_v4_5330_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30026696 | 40S ribosomal protein S19 | SMESG000023987.1 SMESG000009719.1 | dd_Smed_v4_202_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30020736 | nucleolar protein 58 | SMESG000071386.1 | dd_Smed_v4_1982_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30025960 | SMED30025960 | SMESG000027347.1 | dd_27863 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022622 | Centrosomal protein 350 | SMESG000033533.1 | dd_Smed_v4_5967_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021790 | UBX domain-containing protein 4 | SMESG000047328.1 | dd_Smed_v4_823_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30034470 | PDZ ring finger protein 4 | SMESG000021620.1 | dd_Smed_v4_5781_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30035681 | Intraflagellar transport protein 88 | SMESG000039906.1 | dd_Smed_v4_5484_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30028734 | SMED30028734 | SMESG000038532.1 SMESG000038520.1 SMESG000038497.1 SMESG000036112.1 SMESG000036067.1 | dd_Smed_v4_5097_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022032 | SMED30022032 | SMESG000038532.1 SMESG000038520.1 SMESG000038497.1 SMESG000036112.1 SMESG000036067.1 | dd_Smed_v4_5097_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30026979 | SMED30026979 | SMESG000076644.1 SMESG000076643.1 | dd_Smed_v4_227_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30026287 | SMED30026287 | SMESG000057102.1 | dd_Smed_v4_45699_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30024358 | Protein 4.1 | SMESG000029732.1 | dd_Smed_v4_5331_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30024358 | Protein 4.1 | SMESG000029732.1 | dd_Smed_v4_2825_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021940 | SMED30021940 | SMESG000017261.1 | dd_Smed_v4_2030_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30029166 | Coiled-coil domain-containing protein 178 | SMESG000021560.1 | dd_Smed_v4_8905_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022531 | Triadin-like isoform X4 | SMESG000069834.1 | dd_Smed_v4_5981_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30034766 | Enolase | SMESG000052380.1 | dd_Smed_v4_510_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30031822 | SMED30031822 | SMESG000077258.1 | dd_Smed_v4_8993_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021479 | SMED30021479 | SMESG000017261.1 | dd_Smed_v4_2030_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30025634 | MFS domain-containing protein | SMESG000066500.1 | dd_Smed_v4_9883_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30027431 | Protein arginine N-methyltransferase 7 | SMESG000008380.1 | dd_Smed_v4_8814_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022565 | SMED30022565 | SMESG000040891.1 | dd_Smed_v4_5934_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30031429 | SMED30031429 | SMESG000038604.1 | dd_Smed_v4_1973_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30029360 | Low density lipoprotein receptor class A cysteine rich | SMESG000073751.1 | dd_Smed_v4_2114_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30032105 | Polypeptide N-acetylgalactosaminyltransferase | SMESG000025206.1 | dd_Smed_v4_4615_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30027244 | Protein TBATA | SMESG000022377.1 | dd_Smed_v4_8051_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30028261 | Innexin | SMESG000030970.1 | dd_Smed_v4_6798_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30026742 | Calpain B | SMESG000017238.1 | dd_Smed_v4_8673_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021332 | Cytochrome c | SMESG000045852.1 | dd_Smed_v4_464_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30029668 | Adenylate kinase isoenzyme 5 | SMESG000020486.1 SMESG000020480.1 | dd_Smed_v4_5119_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021145 | SMED30021145 | SMESG000023086.1 | dd_Smed_v4_6287_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022035 | Dihydroorotate dehydrogenase (Quinone), mitochondrial | SMESG000065729.1 | dd_Smed_v4_4266_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30029899 | slc25a-30 | SMESG000044697.1 SMESG000022161.1 | dd_Smed_v4_50_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30027818 | Si:ch211-163l21.7 | SMESG000026490.1 | dd_Smed_v4_3833_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30028417 | Bardet-Biedl syndrome 1 protein homolog | SMESG000009880.1 | dd_Smed_v4_7298_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30029274 | SMED30029274 | SMESG000014251.1 | dd_Smed_v4_9793_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022421 | RIB43A-like with coiled-coils protein 2 | SMESG000037028.1 | dd_Smed_v4_4547_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30027540 | Cathepsin F | SMESG000005279.1 | dd_Smed_v4_456_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30025990 | NPHP1 | SMESG000061008.1 | dd_Smed_v4_9990_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30016875 | Rho-associated kinase | SMESG000057753.1 | dd_Smed_v4_2914_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30018252 | Cathepsin L2 | SMESG000049723.1 | dd_Smed_v4_48_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30018815 | Sperm flagellar protein 1 | SMESG000014677.1 | dd_Smed_v4_5648_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30019531 | NPHP6 | SMESG000072747.1 | dd_Smed_v4_7145_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30000058 | SMED30000058 | SMESG000022049.1 | dd_Smed_v4_499_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30008195 | Non-specific serine/threonine protein kinase | SMESG000022413.1 | dd_Smed_v4_10848_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30016453 | SMED30016453 | SMESG000033480.1 SMESG000033479.1 SMESG000033473.1 | dd_Smed_v4_5607_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30016080 | Deoxyhypusine hydroxylase | SMESG000051726.1 SMESG000051721.1 | dd_Smed_v4_703_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30018730 | SOCS box domain-containing protein | SMESG000001445.1 SMESG000001437.1 | dd_Smed_v4_9937_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30016917 | Tctex1 domain containing 1 | SMESG000040148.1 | dd_Smed_v4_9321_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30016922 | Parkin coregulated protein | SMESG000000577.1 | dd_Smed_v4_3899_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30018731 | MORN repeat-containing protein 5 | SMESG000023247.1 | dd_Smed_v4_7020_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30002139 | Vacuole membrane protein 1 | SMESG000034612.1 | dd_Smed_v4_1156_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30003047 | Nalp (Nacht leucine rich repeat and pyrin domain containing) | SMESG000047177.1 SMESG000045615.1 | dd_Smed_v4_16437_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30017807 | SMED30017807 | SMESG000041639.1 | dd_Smed_v4_9130_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30017762 | SMED30017762 | SMESG000016810.1 | dd_Smed_v4_783_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30024215 | intraflagellar transport protein 81 homolog | SMESG000026141.1 | dd_Smed_v4_8803_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021941 | SMED30021941 | SMESG000051593.1 | dd_Smed_v4_9206_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30031423 | ATP synthase subunit | SMESG000021514.1 | dd_Smed_v4_428_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30031908 | SMED30031908 | SMESG000054111.1 | dd_Smed_v4_9796_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30031547 | Na_H_Exchanger domain-containing protein | SMESG000005979.1 | dd_Smed_v4_7736_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30032906 | SMED30032906 | SMESG000022399.1 | dd_Smed_v4_8295_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30035468 | DNAHb-1 | SMESG000072114.1 SMESG000072113.1 SMESG000072112.1 | dd_Smed_v4_3670_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30027239 | Tetratricopeptide repeat protein 30A | SMESG000024323.1 | dd_Smed_v4_8798_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30032910 | Protein ANKUB1 | SMESG000033543.1 | dd_Smed_v4_9027_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30035317 | Phosphoglycerate kinase | SMESG000039090.1 | dd_Smed_v4_972_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30032692 | Histone H3 | SMESG000074938.1 SMESG000074937.1 | dd_Smed_v4_9531_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30020178 | Ubiquitinyl hydrolase 1 | SMESG000057792.1 SMESG000057788.1 | dd_Smed_v4_2744_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30023409 | Glutamate-rich 3 | SMESG000029848.1 SMESG000029846.1 | dd_Smed_v4_8627_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30021661 | Carbonic anhydrase 7 | SMESG000017176.1 SMESG000017171.1 | dd_Smed_v4_4841_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30025815 | SMED30025815 | SMESG000028784.1 SMESG000061889.1 | dd_Smed_v4_3519_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30035908 | Serine-rich adhesin for platelets (Staphylococcus aureus surface protein A) | SMESG000025158.1 | dd_Smed_v4_3220_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30035790 | SMED30035790 | SMESG000006146.1 | dd_Smed_v4_28660_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30027701 | ATP dependent RNA helicase DDX5 | SMESG000012031.1 | dd_Smed_v4_3816_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30026278 | Pre-mRNA-splicing factor ISY1 | SMESG000047126.1 SMESG000004187.1 | dd_Smed_v4_8243_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30034500 | early growth response-2 | SMESG000004840.1 | dd_Smed_v4_9273_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30023111 | RBR-type E3 ubiquitin transferase | SMESG000054560.1 | dd_Smed_v4_4845_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30023258 | Cell cycle associated protein 1a | SMESG000043092.1 | dd_Smed_v4_936_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022043 | Protein odd-skipped-related 2 | SMESG000032229.1 | dd_Smed_v4_10039_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30022522 | Centrin-3 | SMESG000016538.1 | dd_Smed_v4_11582_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30020261 | SMED30020261 | SMESG000045656.1 | dd_Smed_v4_797_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30035611 | Fras1 related extracellular matrix protein | SMESG000032220.1 | dd_Smed_v4_2407_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30026364 | SMED-P53 | SMESG000078256.1 SMESG000078255.1 | dd_Smed_v4_5563_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30031461 | Phosphatidylinositol 4-phosphate 5-kinase 2 | SMESG000012434.1 | dd_Smed_v4_9195_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30002944 | GGACT domain-containing protein | SMESG000081395.1 | dd_Smed_v4_8685_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx | SMED30014876 | SMED30014876 | SMESG000054780.1 SMESG000025014.1 SMESG000025004.1 | dd_Smed_v4_61_0_1 | dd_Smed_v4 | PMID:29674431 Fincher et al., 2018 | ![]() | ![]() | ![]() |
pharynx |