zeta neoblast

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ In Situ Hybridization Data

  ▻ Sequences

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  zeta neoblast


DEFINITON:

  An abundant neoblast subclass consisting of p53+, zfp1+ progenitors required for maintenance and regeneration of epidermal cell type(s).


TERM DEFINITION CITATIONS:

  PMID:25017721


TERM CITATIONS:


TERM ID:

  PLANA:0000014


ABOUT THIS TERM:

zeta neoblast

  ↳is a epidermal progenitor cell and neoblast

  ↳part of integumental system


  → Category 2 cell develops from zeta neoblast



BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30026364ACN51391.1SMED-P53p53Stage 5, Stage 6, Stage 7, Stage 8zeta neoblast, integumental system, Category 2 cell
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30026364 ID=SMED30026364|Name=SMED-P53|organism=Schmidtea mediterranea sexual|type=transcript|length=2047bp
CTCATGACAGTTTTATTAAAGTTACTATTATTAGGAATTCTGCGCGTTAAACTAGACATTATCGATGGCCCAGCAATATA
TTACTTCGGCTTTCGATCCAAACTTCACAACGTTACAGCATCAGACTTCAATACATTATAAATCCTCTCCAATTGAAATG
ATTGTTCCGATGCAATGCAACCAAAACCAAGCCACCTTATCTATAACCCCTGTTCATATTTCTCCATTTGTTAATATATC
AGATTCTAATAATCACAATTTGACGAATATCGTCGAGCCTGTTTCATCAAATACTATGTCTCCTGCTTTTAAATCCGACG
ACATGCCAACATTGTCTTCTTATCCAGGTCCGTATAATTTTCAAATCTTTATTCCCAACGGAGAATTTGATGAATCCAAA
AGAAAAGGACAGACATGTGTGTTTCAAACCGATAAAATGGGAAATCACCAATTATTTACCAAACCTCATCCTCATTATTG
GAGGTTAAATTATTCAGCTGATCCTTCTATGTCAACGGAAAACATGTATATTCGGATGGTTCCAGTTTTTGGGGATCCAG
AAAAAGCTCAATGCATTTTGGAAAGATGTGCAAAACACAAAGAAGTAACAACAGATGAAAATCACTGGAAATATCGTAGC
ATGCTCATTGTAGAAAAAACCTGTGCACATTACTTTCAGGATTCGGCAACGAAAAGAGTTTGCATTTTATTACCGTTTGA
AAAGCATGCGGAAGGAGAGATTTATTCTTCCGTCAACTGTCAATTTGCATGCTACAACAGTTGCTTTAATCAAGATTCAG
GTGGTCGGAAAACACTTTATTTAATCATCACTCTAGAATTTCTCGATAAAAAAACAAATAAATTCGATGTATGGGGTCGA
CAGTGTTTGCAATTTCGCAGTTGTGCTTGTCCAAGTAGAGACTGGAGAGATAAAAAGATTAAAGGCGATCCAGAAATGTT
ACTGAAATTCAAAGAAAAACGAATCAAAACCGAAGAAAAATTAAATAATTTGGTGATTTCTAAAAGCGTCCCTATTAATA
TGGGTGGAAAGGATGCTATCATAAGAGTTCTTCCCTCGTTGCCAGGACTCGATGACGCTATTAACGCATTAGTTTGCGGA
TACTTACTGAATCGAACAACCAACATAAGCGCAATAATAGCAGCATTTAATCAGATGAAAGACGTAGAACATTTAATTAT
CGATCAATTCACATCAAATTTAGATCAAAATACATGTGACAGTAAAAGTCCTTCACAAACTCCAGAGTCTCAGATTTCTC
CGAATACATCAAACCTTCAATTCAACGATTACGGTTCACTTTACGGTGAACCATGTCAACCCTATAGACCGATGCACCAG
CAAGTTGTTAATAATTTTTCCTCTCCAGGAATTTTCAGTAAAATACCTTTTGAAACTTATCCGGTTAGTTATGACATTAA
ACTTTCACATGAAATGCCGCAGCACTTTGATGAGCTGCCATCAGACAACTATAATAGACACTGAAAAATTGCGTCCTTCC
ACGTTTAAAATTGTATAAAAAATAATATGCTTGATTTTTATTTTTGCATTTGTTTTATTTTTTAATGTTGAAAATATTTA
CGTTTGTATTATTTTTTTTTGATTAGTAGTAGTAATGCTGCTTTCAAATTTTATTGAACTTTGATCAGTGATTTTTAATA
TTCAATGACCTGAATTTTTCATGCGTCTTGATGAGGGTTTGAGTGAAAAAATTATCAATTTCTTCACTTTGTCATGTGTG
CTATGTGCATTTATTGATGTATATAACAATATATGTGTAGATAAATTTTATTTTTGTATCCGATTTAGGTTTGCAGGCAC
GATGATGAGTGGTTTTTATTTTGTAAAAATTTTTCGAGATAACATGTGCTCAAATATCAATATTATATATGGTAACATAT
TTTTGCAATAAAAATGCATTTATTGTCAATTTGGCTATAAATTAAGTATCGTACGAATCAAGCAATATTTTATCATTGCT
GTCAATATTTTGTTGATAATTTTTTATTTGCTTTGTTAATAAAGAGC

 

back to top





PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in zeta neoblast. Click this link to learn more about PAGE.


PAGE Curations: 598


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
zeta neoblastSMED30009032Deoxycytidylate deaminaseSMESG000023231.1 dd_Smed_v4_6803_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30006533ADP-ribosylation factorSMESG000052764.1 SMESG000052762.1 SMESG000052759.1 SMESG000052750.1 SMESG000052741.1 SMESG000052739.1 dd_Smed_v4_3383_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30007264Transposase, Tc1-like proteinSMESG000053320.1 SMESG000053319.1 SMESG000053315.1 SMESG000053300.1 dd_Smed_v4_8024_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30001805Zgc:100846SMESG000031124.1 dd_Smed_v4_6804_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30005932Tudor domain-containing protein 1SMESG000026637.1 dd_Smed_v4_3564_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30006979DNA helicaseSMESG000052872.1 SMESG000023403.1 dd_Smed_v4_7682_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30005160Kinesin light chainSMESG000018116.1 dd_Smed_v4_8136_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30006841Serine/threonine-protein phosphataseSMESG000067422.1 dd_Smed_v4_23492_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30009168SMED30009168SMESG000017218.1 dd_Smed_v4_32929_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30008873SMED30008873SMESG000009341.1 dd_Smed_v4_337_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30009778Serine/threonine-protein kinase atrSMESG000018015.1 SMESG000018013.1 dd_Smed_v4_8754_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30000072retinoblastoma binding protein-1SMESG000007931.1 dd_Smed_v4_7612_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30036024DNA primase large subunitSMESG000059950.1 SMESG000059945.1 SMESG000030269.1 SMESG000030252.1 dd_Smed_v4_13727_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30034422Antigen KI-67SMESG000050427.1 dd_Smed_v4_13700_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30035415Helicase ATP-binding domain-containing proteinSMESG000025070.1 dd_Smed_v4_19858_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30034402SMED30034402SMESG000053833.1 dd_Smed_v4_10299_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30010838AGAP003596-PA-like proteinSMESG000029629.1 SMESG000029624.1 SMESG000029622.1 SMESG000012817.1 dd_Smed_v4_4842_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30012458Importin subunit alphaSMESG000063514.1 dd_Smed_v4_3708_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30011429SMED30011429SMESG000010393.1 dd_Smed_v4_58387_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30018726SMED30018726SMESG000026815.1 SMESG000026735.1 dd_Smed_v4_3797_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30011390Nuclear pore complex protein Nup85SMESG000067092.1 SMESG000067087.1 dd_Smed_v4_6403_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30027563Ras and EF-hand domain-containing protein homologSMESG000049774.1 SMESG000049749.1 dd_Smed_v4_2966_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30022014TetraspaninSMESG000043678.1 dd_Smed_v4_2693_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30027781Retinoblastoma binding protein-1SMESG000007931.1 dd_Smed_v4_7612_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30024072Protein argonaute-3SMESG000051000.1 dd_Smed_v4_7594_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30025821Multiple PDZ domain crumbs cell polarity complex componentSMESG000053393.1 dd_Smed_v4_5376_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30025717SMED30025717SMESG000031124.1 dd_Smed_v4_6804_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30025294rRNA 2'-O-methyltransferase fibrillarinSMESG000051648.1 dd_Smed_v4_2811_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30020124Ribosome biogenesis regulatory proteinSMESG000071880.1 dd_Smed_v4_2458_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30024735SMED30024735SMESG000012126.1 dd_Smed_v4_7744_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30020687Aspartate carbamoyltransferaseSMESG000012911.1 dd_Smed_v4_7167_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30000690Protocadherin 1bSMESG000043679.1 SMED30000690smed_20140614PMID:29906446
zeta neoblastSMED30006464TCF15SMESG000044395.1 SMED30006464smed_20140614PMID:29906446
zeta neoblastSMED30011043Protein kinase domain-containing proteinSMESG000025533.1 dd_Smed_v4_12789_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30018266Phosphatidylinositol-binding clathrin assembly proteinSMESG000020797.1 dd_Smed_v4_6650_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30007343Tud-1SMESG000043684.1 dd_Smed_v4_3741_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30014702SMED30014702SMESG000069780.1 SMED30014702smed_20140614PMID:29906446
zeta neoblastSMED30014702SMED30014702SMESG000069780.1 dd_Smed_v4_12876_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED3003144714-3-3 protein beta/alphaSMESG000067831.1 dd_Smed_v4_5419_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30025757JUNLI-1SMESG000067959.1 dd_Smed_v4_4878_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30022975Homeobox protein DTH-2SMESG000037282.1 SMED30022975smed_20140614PMID:29906446
zeta neoblastSMED30025388Myosin heavy chainSMESG000013389.1 dd_Smed_v4_579_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30022232Glutathione s-transferaseSMESG000016846.1 dd_Smed_v4_1206_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30009016SSRP1SMESG000049360.1 dd_Smed_v4_3904_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30011865Serine/threonine-protein kinase Nek10SMESG000037692.1 dd_Smed_v4_25617_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30012024SMED30012024SMESG000042632.1 dd_Smed_v4_13504_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30014925ATP-dependent DNA helicase DDX11SMESG000025070.1 dd_Smed_v4_19858_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30013772SMED30013772SMESG000048236.1 dd_Smed_v4_21608_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30008015slc25a-14SMESG000015827.1 dd_Smed_v4_7507_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30006125C2H2-type domain-containing proteinSMESG000020158.1 dd_Smed_v4_14413_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30003330Ankyrin repeat-containing, putativeSMESG000034407.1 dd_Smed_v4_17293_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30003519SMED30003519SMESG000018116.1 dd_Smed_v4_8136_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30007034SMED30007034SMESG000062795.1 dd_Smed_v4_13536_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30014136Centrosome-associated protein 350SMESG000069358.1 dd_Smed_v4_20651_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30007420hypothetical proteinSMESG000037088.1 SMESG000032688.1 dd_Smed_v4_10376_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30005029SMED30005029SMESG000069925.1 dd_Smed_v4_13790_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30005289SMED30005289SMESG000081180.1 dd_Smed_v4_14387_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30009527Kinesin-like proteinSMESG000051260.1 dd_Smed_v4_18330_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30015608acidic repeat-containing proteinSMESG000016996.1 dd_Smed_v4_14607_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30004598Cytoskeleton-associated protein 5-ASMESG000045157.1 dd_Smed_v4_16537_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30005365Serine/threonine-protein kinaseSMESG000007586.1 dd_Smed_v4_15228_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30023874Aminoacylase-1SMESG000028017.1 dd_Smed_v4_1519_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30017880Alpha-int-1SMESG000022733.1 dd_Smed_v4_11655_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30018395WD_REPEATS_REGION domain-containing proteinSMESG000032761.1 dd_Smed_v4_10217_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30018579SMED30018579SMESG000017019.1 dd_Smed_v4_13580_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30018665TetraspaninSMESG000073695.1 dd_Smed_v4_12033_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30016975histone H2ASMESG000049774.1 SMESG000049749.1 dd_Smed_v4_2966_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30015936SMED30015936SMESG000032761.1 dd_Smed_v4_10217_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30016072SMED30016072SMESG000064318.1 dd_Smed_v4_10400_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30021808SMED30021808SMESG000054507.1 dd_Smed_v4_14111_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30031069SMED30031069SMESG000072053.1 dd_Smed_v4_13666_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30028625PMS1 protein-like protein 1 DNA mismatch repair proteinSMESG000066771.1 dd_Smed_v4_15640_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30021579SMED30021579SMESG000072336.1 dd_Smed_v4_14997_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30022491SMED30022491SMESG000079488.1 dd_Smed_v4_14660_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30023900SMED30023900SMESG000015366.1 dd_Smed_v4_17552_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30032804Ankyrin repeat and LEM domain-containing protein 2SMESG000027557.1 dd_Smed_v4_14491_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30025245Kinesin-like proteinSMESG000030852.1 dd_Smed_v4_13972_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30024374Protein LSM14 homolog B-BSMESG000033950.1 dd_Smed_v4_1594_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30025981SMED30025981SMESG000059781.1 dd_Smed_v4_12332_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30021492Histone H3SMESG000068567.1 dd_Smed_v4_13844_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30020418Ankyrin repeat domain-containing protein 6SMESG000034407.1 dd_Smed_v4_17293_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30032052Cytoskeleton-associated protein 5-ASMESG000045157.1 dd_Smed_v4_16537_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30025079Cytoskeleton-associated protein 5-ASMESG000045157.1 dd_Smed_v4_16537_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30027740SMED30027740SMESG000045107.1 dd_Smed_v4_14425_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30017368Diphthine methyltransferaseSMESG000060795.1 dd_Smed_v4_7236_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30015999aurora kinase-1SMESG000006604.1 dd_Smed_v4_9065_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30013386netrin 1SMESG000006806.1 dd_Smed_v4_9795_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30012735SMED30012735SMESG000031317.1 dd_Smed_v4_9229_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30009618Calcium-transporting ATPaseSMESG000039058.1 dd_Smed_v4_9529_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30007059Dihydrofolate reductaseSMESG000061712.1 dd_Smed_v4_7808_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30006630Calcium-transporting ATPaseSMESG000039058.1 dd_Smed_v4_9529_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30014754Phosphoacetylglucosamine mutaseSMESG000058604.1 dd_Smed_v4_7502_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30015034Mitochondrial ribonuclease P protein 3SMESG000023790.1 SMESG000022512.1 dd_Smed_v4_9514_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30018236Bromodomain adjacent to zinc finger domainSMESG000068165.1 dd_Smed_v4_7394_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30011713Ethanolamine kinase, putativeSMESG000039272.1 dd_Smed_v4_8711_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30008929Aldo-keto reductaseSMESG000062723.1 dd_Smed_v4_9852_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30017448Heat shock 70 kDa proteinSMESG000077989.1 dd_Smed_v4_6850_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30017266Major facilitator superfamily domain-containing protein 3SMESG000044308.1 dd_Smed_v4_37111_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30014417SMED30014417SMESG000027581.1 dd_Smed_v4_8773_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30015950Deoxyribonuclease II family proteinSMESG000062594.1 dd_Smed_v4_9160_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30015686Nuclear pore membrane glycoprotein 210SMESG000046650.1 dd_Smed_v4_4698_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30018750SMED30018750SMESG000032765.1 SMESG000032764.1 dd_Smed_v4_9225_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30018566tRNA pseudouridine synthase ASMESG000053891.1 dd_Smed_v4_8828_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30019099Uridine phosphorylaseSMESG000074532.1 dd_Smed_v4_9107_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30032600SMED30032600SMESG000002929.1 dd_Smed_v4_6253_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30026560SMED30026560SMESG000037542.1 dd_Smed_v4_6734_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30034338SMED30034338SMESG000004213.1 dd_Smed_v4_9017_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30023821DNA helicaseSMESG000060238.1 dd_Smed_v4_5956_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30029526Glutamate [NMDA] receptor subunit 1SMESG000010110.1 SMESG000001343.1 dd_Smed_v4_5682_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30029526Glutamate [NMDA] receptor subunit 1SMESG000010110.1 SMESG000001343.1 dd_Smed_v4_8187_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30028865Sld5 domain-containing proteinSMESG000002897.1 dd_Smed_v4_9624_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30025330Mitochondrial chaperone BCS1SMESG000019745.1 dd_Smed_v4_6593_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30023147SMED30023147SMESG000032765.1 SMESG000032764.1 dd_Smed_v4_9225_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30025497secreted frizzled related protein 2SMESG000050379.1 dd_Smed_v4_8832_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30026247stem loop binding proteinSMESG000060978.1 dd_Smed_v4_9628_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30023617replication factor C subunit 3SMESG000077027.1 SMESG000020661.1 dd_Smed_v4_9695_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30028315DNA excision repair protein ERCC-1SMESG000048855.1 dd_Smed_v4_9619_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30018716Acidic leucine-rich nuclear phosphoprotein 32 family member ASMESG000065271.1 dd_Smed_v4_1396_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30010115ribonucleoside diphosphate reductase subunit M2-2SMESG000079368.1 SMESG000044188.1 SMESG000044184.1 dd_Smed_v4_2286_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30009651NSD-1SMESG000015096.1 SMESG000015015.1 dd_Smed_v4_11074_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30000140SAM domain-containing proteinSMESG000041461.1 dd_Smed_v4_19710_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30010096TPA_inf: prohormone convertase 2SMESG000008070.1 dd_Smed_v4_1566_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30029973Ribonucleoside-diphosphate reductaseSMESG000029273.1 dd_Smed_v4_1651_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30027770high mobility group-2SMESG000020771.1 dd_Smed_v4_1646_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30022145Kinase-like proteinSMESG000036830.1 dd_Smed_v4_12125_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30031978telomerase reverse transcriptase subunit isoform 2SMESG000061912.1 dd_Smed_v4_17877_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30031507Zinc finger and SCAN domain-containing protein 2SMESG000049972.1 SMESG000031902.1 dd_Smed_v4_13890_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30031463VASA-1SMESG000067941.1 dd_Smed_v4_1985_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30001286DNA polymerase nuSMESG000032684.1 dd_Smed_v4_10383_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30001286DNA polymerase nuSMESG000032684.1 dd_Smed_v4_32229_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30008368RTEL1SMESG000064419.1 dd_Smed_v4_12261_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30002348Cell division control proteinSMESG000070150.1 dd_Smed_v4_18778_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30001785Nuclear receptor 2DBD gammaSMESG000007787.1 dd_Smed_v4_16388_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30008985SMED30008985SMESG000033226.1 dd_Smed_v4_16218_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30005282Regulator of telomere elongation helicase 1 homologSMESG000032754.1 dd_Smed_v4_26144_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30005503SMED30005503SMESG000038737.1 dd_Smed_v4_19563_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30001391DNA replication licensing factor MCM8SMESG000004906.1 dd_Smed_v4_22244_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30008519WD_REPEATS_REGION domain-containing proteinSMESG000018097.1 dd_Smed_v4_29867_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30008519WD_REPEATS_REGION domain-containing proteinSMESG000018097.1 dd_Smed_v4_21908_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30009674SMED30009674SMESG000036833.1 SMESG000036832.1 dd_Smed_v4_13015_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30000705Serine/threonine-protein kinase OSR1SMESG000066296.1 dd_Smed_v4_1366_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30008000cdc7-like proteinSMESG000069572.1 dd_Smed_v4_16034_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30002927SAM domain-containing proteinSMESG000041461.1 dd_Smed_v4_19710_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30002635Nucleolar protein 10SMESG000060703.1 dd_Smed_v4_10561_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30007516SMED30007516SMESG000004411.1 dd_Smed_v4_17796_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30002942SMED30002942SMESG000009948.1 dd_Smed_v4_21084_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30009393Cleavage and polyadenylation specificity factor subunit 4SMESG000073172.1 dd_Smed_v4_14360_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30018987SMED30018987SMESG000076175.1 dd_Smed_v4_11221_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30018861Kinesin light chainSMESG000010732.1 dd_Smed_v4_8806_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30004679PRKR-interacting protein 1SMESG000063632.1 SMESG000063625.1 SMESG000063624.1 dd_Smed_v4_8973_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30012533HexosyltransferaseSMESG000050398.1 dd_Smed_v4_24931_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30019908PKD1L-3SMESG000066980.1 dd_Smed_v4_10962_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30019908PKD1L-3SMESG000066980.1 dd_Smed_v4_30941_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30019011DNA repair protein RAD50SMESG000039247.1 SMESG000039215.1 dd_Smed_v4_11475_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30017203Semaphorin-like proteinSMESG000016303.1 dd_Smed_v4_4702_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30005215Retinal rod rhodopsin-sensitive cGMP 3',5'-cyclic phosphodiesterase subunit deltaSMESG000079942.1 SMESG000079687.1 SMESG000044739.1 SMESG000044729.1 SMESG000044723.1 SMESG000044721.1 SMESG000044720.1 SMESG000020739.1 dd_Smed_v4_9168_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30009131IRS-type PTB domain-containing proteinSMESG000055009.1 dd_Smed_v4_4462_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30008074CRAL-TRIO domain-containing proteinSMESG000009863.1 dd_Smed_v4_9151_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30019468protein arginine methyltransferase 1-like proteinSMESG000038790.1 dd_Smed_v4_1302_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30019555TIMELESS-interacting proteinSMESG000025543.1 dd_Smed_v4_12580_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30008750Origin recognition complex subunit 1SMESG000072187.1 dd_Smed_v4_8215_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30002436Histone H2ASMESG000072071.1 dd_Smed_v4_2787_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30000843X1.A.G7.1SMESG000070405.1 dd_Smed_v4_4731_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30018725Protein kinase domain-containing proteinSMESG000025288.1 dd_Smed_v4_19210_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30018630High mobility group proteinSMESG000052032.1 dd_Smed_v4_1331_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30005921tRNA wybutosine-synthesizing protein 5SMESG000010398.1 dd_Smed_v4_8202_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30004136DNA polymeraseSMESG000079942.1 SMESG000079687.1 SMESG000044739.1 SMESG000044729.1 SMESG000044723.1 SMESG000044721.1 SMESG000044720.1 SMESG000020739.1 dd_Smed_v4_9168_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30004366Tyrosine-protein kinase receptorSMESG000063632.1 SMESG000063625.1 SMESG000063624.1 dd_Smed_v4_8973_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30019120Myb_DNA-bind_5 domain-containing proteinSMESG000029917.1 dd_Smed_v4_4675_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30027038PKD1L-1SMESG000066980.1 dd_Smed_v4_30941_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30030377Polypeptide N-acetylgalactosaminyltransferaseSMESG000081429.1 SMESG000081318.1 SMESG000081285.1 dd_Smed_v4_8580_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30033565SMED30033565SMESG000050427.1 dd_Smed_v4_3777_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30021163AquaporinSMESG000005963.1 dd_Smed_v4_13249_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30031773Msh2SMESG000016751.1 dd_Smed_v4_11434_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30028415replication factor C subunit 2SMESG000041142.1 SMESG000041132.1 dd_Smed_v4_8732_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30021292SMED30021292SMESG000003824.1 dd_Smed_v4_12116_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30032831SMED30032831SMESG000055009.1 dd_Smed_v4_4462_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30035316SMED30035316SMESG000072458.1 dd_Smed_v4_11336_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30032106SMED30032106SMESG000080318.1 dd_Smed_v4_8948_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30032258TIR domain-containing proteinSMESG000006301.1 dd_Smed_v4_11412_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30034558breast cancer type 2 susceptibility protein homologSMESG000039871.1 dd_Smed_v4_12551_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30027258ATP-dependent RNA helicase TDRD9SMESG000016118.1 dd_Smed_v4_5842_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30027457Neurogenic locus Notch proteinSMESG000066558.1 dd_Smed_v4_12732_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30030297Kinase, putativeSMESG000029295.1 dd_Smed_v4_22145_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30021639SMED30021639SMESG000074722.1 dd_Smed_v4_21438_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30034951SMED30034951SMESG000009367.1 dd_Smed_v4_15071_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30020070High mobility group protein B1SMESG000034017.1 dd_Smed_v4_1095_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30024602SMED30024602SMESG000064764.1 dd_Smed_v4_40776_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30021376SMED30021376SMESG000039147.1 dd_Smed_v4_18815_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30031380Pogo transposable element with ZNF domainSMESG000014324.1 dd_Smed_v4_2118_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30021439SMED30021439SMESG000022113.1 dd_Smed_v4_18818_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30023910Pogo transposable element with ZNF domainSMESG000014324.1 dd_Smed_v4_2118_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30027700Lipoyl synthase, mitochondrialSMESG000004184.1 SMESG000004174.1 dd_Smed_v4_19176_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30033663SMED30033663SMESG000054684.1 SMESG000054674.1 dd_Smed_v4_18196_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30033663SMED30033663SMESG000054684.1 SMESG000054674.1 dd_Smed_v4_13582_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30035005SMED30035005SMESG000070224.1 dd_Smed_v4_13091_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30023288SMED30023288SMESG000064764.1 dd_Smed_v4_40776_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30027562SMED30027562SMESG000022880.1 dd_Smed_v4_3493_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30032803SMED30032803SMESG000062000.1 dd_Smed_v4_12831_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30023826SMED30023826SMESG000062595.1 dd_Smed_v4_30191_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30030734V-SNARE coiled-coil homology domain-containing proteinSMESG000033532.1 dd_Smed_v4_10790_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30033400DNA replication complex GINS protein SLD5SMESG000062770.1 dd_Smed_v4_23589_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30028809Transient receptor potential cation channel subfamily M member-like 2SMESG000004955.1 dd_Smed_v4_8493_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30032723DNA repair and recombination protein rad54-relatedSMESG000049182.1 dd_Smed_v4_15532_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30022363SMED30022363SMESG000055009.1 dd_Smed_v4_4462_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30031663DNA polymerase epsilon subunitSMESG000037681.1 dd_Smed_v4_16802_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30031095Rho GTPase-activating protein 20SMESG000074055.1 dd_Smed_v4_21560_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30033360SMED30033360SMESG000074320.1 dd_Smed_v4_12537_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30022444SMED30022444SMESG000010201.1 dd_Smed_v4_9821_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30025550Bravo_FIGEY domain-containing proteinSMESG000003824.1 dd_Smed_v4_12116_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30034335SMED30034335SMESG000009102.1 dd_Smed_v4_8341_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30031690Basic phospholipase A2 beta-bungarotoxin A2 chainSMESG000025979.1 SMESG000025902.1 dd_Smed_v4_20589_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30029634Kinesin family member 15SMESG000064131.1 dd_Smed_v4_11717_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30033600DNA replication licensing factor MCM6SMESG000038798.1 dd_Smed_v4_2682_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30000310SMED30000310 dd_Smed_v4_9639_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30005491SMED30005491SMESG000046849.1 SMED30005491smed_20140614PMID:29906446
zeta neoblastSMED30003904SMED30003904 dd_Smed_v4_18353_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30006138Twinkle mtDNA helicaseSMESG000049485.1 dd_Smed_v4_45276_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30010424DNA primaseSMESG000070103.1 dd_Smed_v4_11558_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30002022SMED30002022 dd_Smed_v4_29570_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30018526slc25a-22SMESG000074801.1 dd_Smed_v4_8134_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30014447SMED30014447SMESG000033944.1 SMESG000018200.1 dd_Smed_v4_5651_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30004304Proliferating cell nuclear antigen dd_Smed_v4_1920_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30015678Cyclin-dependent kinases regulatory subunit dd_Smed_v4_6668_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30006905DNA endonuclease RBBP8SMESG000002586.1 dd_Smed_v4_12447_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30004043Cytoskeleton-associated protein 5SMESG000045133.1 dd_Smed_v4_16467_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30008979SMED30008979SMESG000065696.1 dd_Smed_v4_12726_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30017211Mediator of RNA polymerase II transcription subunit 10SMESG000065706.1 dd_Smed_v4_5622_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30005828Ribosome biogenesis protein BOP1SMESG000057062.1 dd_Smed_v4_11041_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30000377Membrane-associated guanylate kinase, WW and PDZ domain-containing protein 1SMESG000026494.1 dd_Smed_v4_5498_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30011104HTH La-type RNA-binding domain-containing proteinSMESG000000519.1 dd_Smed_v4_1420_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30009524SMED30009524 dd_Smed_v4_14230_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30001579SMED30001579SMESG000064601.1 dd_Smed_v4_15533_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30011817SMED30011817SMESG000000519.1 dd_Smed_v4_1420_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30004550Kinesin-domain-containing proteinSMESG000077277.1 dd_Smed_v4_14426_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30015956Metallophos domain-containing protein dd_Smed_v4_17883_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30011900SMED30011900 dd_Smed_v4_11646_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30003764N-alpha-acetyltransferase 40SMESG000077166.1 dd_Smed_v4_5816_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30011950Transcription factor GATA-3SMESG000079514.1 dd_Smed_v4_17393_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30012935TGc domain-containing proteinSMESG000080370.1 dd_Smed_v4_4149_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30019039MetalloendopeptidaseSMESG000005882.1 dd_Smed_v4_5652_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30009590DNA repair and recombination protein RAD54BSMESG000074988.1 dd_Smed_v4_9943_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30001195da proteinSMESG000032044.1 dd_Smed_v4_5579_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30015093SMED30015093SMESG000009339.1 dd_Smed_v4_9636_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30004085hypothetical proteinSMESG000038086.1 dd_Smed_v4_5639_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30006163SMED30006163SMESG000013361.1 dd_Smed_v4_6783_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30008746Serine/threonine-protein kinase dd_Smed_v4_14648_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30018937SMED30018937SMESG000004917.1 SMESG000004916.1 dd_Smed_v4_5623_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30006359Retrovirus-related Pol polyprotein from type-2 retrotransposable element R2DM dd_Smed_v4_32082_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30005823Protein kinase N2SMESG000014536.1 SMESG000014533.1 dd_Smed_v4_7015_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30005246cyclin B-2SMESG000060055.1 dd_Smed_v4_7837_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30009204FGFR4SMESG000054557.1 dd_Smed_v4_11024_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30002220Receptor protein serine/threonine kinase dd_Smed_v4_29570_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30019528SMED30019528SMESG000009339.1 dd_Smed_v4_9636_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30006065Abnormal spindle-like microcephaly-associated protein homolog dd_Smed_v4_15726_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30017216SMED30017216 dd_Smed_v4_5464_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30012816AminomethyltransferaseSMESG000012592.1 dd_Smed_v4_3994_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30000251SMED30000251 dd_Smed_v4_18158_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30008223Retrovirus-related Pol polyprotein LINE-1 dd_Smed_v4_18284_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30007406SMEDWI-1SMESG000036375.1 dd_Smed_v4_659_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30005171SMED30005171SMESG000024345.1 dd_Smed_v4_629_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30001813TNF receptor associated factor 4 dd_Smed_v4_17632_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30006813UDG domain-containing proteinSMESG000064938.1 dd_Smed_v4_10660_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30003242WD repeat-containing protein 3SMESG000002152.1 dd_Smed_v4_7978_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30007383GCR103SMESG000061776.1 dd_Smed_v4_7534_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30002547Peptidyl-prolyl cis-trans isomeraseSMESG000052204.1 SMESG000006596.1 dd_Smed_v4_457_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30017971ANK_REP_REGION domain-containing proteinSMESG000026132.1 dd_Smed_v4_6201_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30015313Venom allergen 5SMESG000047165.1 dd_Smed_v4_14382_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30030946DNA replication licensing factor MCM7SMESG000057772.1 dd_Smed_v4_4712_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30034477Transducer of ERBB2, 1bSMESG000063539.1 dd_Smed_v4_7444_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30025017SMED30025017SMESG000026705.1 dd_Smed_v4_5525_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30024555Cyclin-dependent kinaseSMESG000023609.1 SMESG000023590.1 dd_Smed_v4_14134_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30032563MCM5SMESG000005389.1 dd_Smed_v4_5764_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30029985Serine/threonine-protein kinase atrSMESG000018015.1 SMESG000018013.1 dd_Smed_v4_8754_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30032873U2 snRNP auxiliary factor large subunitSMESG000051274.1 dd_Smed_v4_3590_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30032708Chloride channel nucleotide sensitiveaSMESG000026632.1 dd_Smed_v4_3584_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30020469LIM zinc-binding domain-containing proteinSMESG000026096.1 dd_Smed_v4_7989_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30031235Tubulin alpha chainSMESG000017700.1 dd_Smed_v4_648_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30030072SMED30030072SMESG000031871.1 dd_Smed_v4_34984_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30023808SMED30023808 dd_Smed_v4_11646_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30028549ARMC1SMESG000075605.1 dd_Smed_v4_11494_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30029763histone H1SMESG000024348.1 SMESG000010800.1 dd_Smed_v4_601_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30035969Carbamoyl-phosphate synthase large chainSMESG000012911.1 dd_Smed_v4_7167_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30034098SMED30034098SMESG000022171.1 dd_Smed_v4_4552_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30023063Helicase POLQ-like protein dd_Smed_v4_13290_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30032439HyccinSMESG000023976.1 dd_Smed_v4_5919_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30025781WD repeat-containing protein 36SMESG000037091.1 dd_Smed_v4_6943_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30028317SMED30028317SMESG000053320.1 SMESG000053319.1 SMESG000053315.1 SMESG000053300.1 dd_Smed_v4_8024_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30035831SMED30035831SMESG000046586.1 dd_Smed_v4_2725_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30030213SMED30030213SMESG000012962.1 dd_Smed_v4_4581_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30026733KRR1 small subunit processome component dd_Smed_v4_30487_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30021918Dynein light chain dd_Smed_v4_13760_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30026213SMED30026213SMESG000011137.1 dd_Smed_v4_8223_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30034279IgGFc-binding proteinSMESG000040791.1 dd_Smed_v4_416_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30029203SMED30029203SMESG000026183.1 dd_Smed_v4_4644_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30030543histone h2a.z-1SMESG000020395.1 dd_Smed_v4_2614_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30027026SMED30027026 dd_Smed_v4_18426_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30026659ribonucleoside diphosphate reductase subunit M2SMESG000014842.1 dd_Smed_v4_5862_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30029621Cyclin-dependent kinase 1SMESG000052421.1 dd_Smed_v4_31502_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30031551RING-type domain-containing proteinSMESG000076269.1 dd_Smed_v4_9026_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30025885MATH domain-containing proteinSMESG000067198.1 dd_Smed_v4_16468_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30025885MATH domain-containing proteinSMESG000067198.1 dd_Smed_v4_15397_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30029980SMED30029980SMESG000005589.1 dd_Smed_v4_2921_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30033929CTP synthaseSMESG000012989.1 dd_Smed_v4_5375_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30026622beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase 3SMESG000008883.1 dd_Smed_v4_12381_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30030514N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidaseSMESG000080267.1 dd_Smed_v4_6566_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30024728SMED30024728SMESG000074843.1 SMESG000029191.1 dd_Smed_v4_45479_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30028384BTB domain-containing proteinSMESG000045114.1 dd_Smed_v4_5109_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30028914Photolyase/cryptochrome alpha/beta domain-containing proteinSMESG000003495.1 dd_Smed_v4_2829_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30033528SMED30033528SMESG000031124.1 dd_Smed_v4_6804_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30028300SMED30028300 dd_Smed_v4_22031_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30029434SMED30029434SMESG000045809.1 dd_Smed_v4_6870_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30034520RAD51SMESG000056159.1 dd_Smed_v4_8626_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30023483INX-13SMESG000043575.1 dd_Smed_v4_11501_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30031155Thioredoxin-like proteinSMESG000033891.1 dd_Smed_v4_12826_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30021300Protein SCAISMESG000075968.1 dd_Smed_v4_24482_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30028154Serine/threonine kinase 33SMESG000076986.1 SMESG000076975.1 dd_Smed_v4_12461_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30023708ZFP-1SMESG000066384.1 JQ425154smed_ncbi_20200123PMID:25017721
zeta neoblastSMED30023708ZFP-1SMESG000066384.1 JQ425154smed_ncbi_20200123PMID:25017721
zeta neoblastSMED30023708ZFP-1SMESG000066384.1 JQ425154.1smed_ncbi_20200123PMID:29357350
zeta neoblastSMED30023708ZFP-1SMESG000066384.1 dd_Smed_v4_8720_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30023708ZFP-1SMESG000066384.1 SMED30023708smed_20140614PMID:29906446
zeta neoblastSMED3002866540S ribosomal protein SASMESG000016079.1 dd_Smed_v4_12899_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30021128Checkpoint proteinSMESG000026246.1 dd_Smed_v4_15678_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30034220Flotillin-1SMESG000004975.1 dd_Smed_v4_1637_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30030505LIM homeobox transcription factor 1-alphaSMESG000005304.1 dd_Smed_v4_13371_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30028454WD_REPEATS_REGION domain-containing proteinSMESG000005136.1 dd_Smed_v4_20962_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30029888Histone H4 transcription factorSMESG000014197.1 dd_Smed_v4_26924_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30027599SMED30027599SMESG000039606.1 SMESG000006670.1 dd_Smed_v4_13261_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30032645Heterochromatin protein 1-1SMESG000004606.1 SMESG000004604.1 dd_Smed_v4_928_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30027106SMED30027106SMESG000008069.1 dd_Smed_v4_17071_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30021074Nuclear transport factor 2SMESG000004940.1 dd_Smed_v4_3953_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30027788SMED30027788SMESG000015274.1 dd_Smed_v4_25428_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30026157GAS2-like 3SMESG000003786.1 SMESG000003788.1 SMESG000003787.1 dd_Smed_v4_3326_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30035749Meiotic nuclear division protein 1 homologSMESG000027175.1 dd_Smed_v4_13140_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30034490FGFR1SMESG000036598.1 SMESG000036590.1 JQ425160smed_ncbi_20200123PMID:25017721
zeta neoblastSMED30034490FGFR1SMESG000036598.1 SMESG000036590.1 JQ425160smed_ncbi_20200123PMID:25017721
zeta neoblastSMED30024486cytoplasmic poly(A) binding proteinSMESG000004978.1 dd_Smed_v4_11729_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30025780Serine/threonine-protein kinase PLKSMESG000022441.1 dd_Smed_v4_4273_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30024468SMED30024468SMESG000047438.1 SMESG000028235.1 dd_Smed_v4_12953_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30032522Ras-related protein Rab-33BSMESG000061912.1 dd_Smed_v4_17877_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30029741SMED30029741SMESG000056346.1 dd_Smed_v4_2250_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30031539Origin recognition complex subunit 4SMESG000043431.1 dd_Smed_v4_11263_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30023487Protein LSM14 homolog B-ASMESG000014632.1 dd_Smed_v4_1125_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30009783SMED30009783SMESG000049972.1 SMESG000031902.1 dd_Smed_v4_13890_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30013596Chromodomain-helicase-DNA-binding protein 1-likeSMESG000081089.1 dd_Smed_v4_17704_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30014938SMED30014938SMESG000052729.1 dd_Smed_v4_10341_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30012332EGR-1SMESG000034285.1 JQ425156smed_ncbi_20200123PMID:25017721
zeta neoblastSMED30012332EGR-1SMESG000034285.1 JQ425156smed_ncbi_20200123PMID:25017721
zeta neoblastSMED30012332EGR-1SMESG000034285.1 SMED30012332smed_20140614PMID:29906446
zeta neoblastSMED30019741TetraspaninSMESG000021636.1 dd_Smed_v4_32522_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30019741TetraspaninSMESG000021636.1 dd_Smed_v4_13516_1_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30019647Serine-protein kinase ATMSMESG000023629.1 SMESG000023628.1 dd_Smed_v4_14586_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30008705SMED30008705SMESG000071100.1 dd_Smed_v4_14921_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30014844Flotillin-1SMESG000004975.1 dd_Smed_v4_1637_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30017135Dual specificity mitogen-activated protein kinase kinase 6SMESG000017824.1 dd_Smed_v4_1568_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30004973Chromosome 8 open reading frame 82SMESG000026794.1 dd_Smed_v4_14037_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30013318Serine/threonine-protein kinaseSMESG000074546.1 dd_Smed_v4_15776_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30002298Nucleolar protein isoform 2SMESG000009276.1 dd_Smed_v4_10255_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30017754SMED30017754SMESG000043124.1 dd_Smed_v4_3018_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30018649Regulator of telomere elongation helicase 1 homologSMESG000018012.1 dd_Smed_v4_16638_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30000190SMED30000190SMESG000043124.1 dd_Smed_v4_3018_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30009602SMED30009602SMESG000065696.1 dd_Smed_v4_22938_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30009602SMED30009602SMESG000065696.1 dd_Smed_v4_35838_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30018344COesterase domain-containing proteinSMESG000005922.1 dd_Smed_v4_15930_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30015520SMED30015520SMESG000047158.1 dd_Smed_v4_22739_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30016826fer3l-1 proteinSMESG000028999.1 dd_Smed_v4_16851_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30016237SMED30016237SMESG000036833.1 SMESG000036832.1 dd_Smed_v4_13015_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30016740SMED30016740SMESG000066564.1 SMESG000066563.1 dd_Smed_v4_26668_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30015285SMED30015285SMESG000045945.1 dd_Smed_v4_18168_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30008984Protein phosphatase 1GSMESG000030206.1 dd_Smed_v4_2086_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30003750Vang-3SMESG000046198.1 SMESG000046194.1 dd_Smed_v4_15787_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30015597SMED30015597SMESG000064553.1 dd_Smed_v4_13402_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30003599transverse filament protein SYCP-1SMESG000073774.1 dd_Smed_v4_18547_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30003599transverse filament protein SYCP-1SMESG000073774.1 dd_Smed_v4_30278_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30015687RING-type domain-containing proteinSMESG000007981.1 dd_Smed_v4_10019_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30017889SMED30017889SMESG000006311.1 dd_Smed_v4_22716_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30019019SMED30019019SMESG000000507.1 dd_Smed_v4_20516_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30019097SOXP-1SMESG000010063.1 dd_Smed_v4_7227_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30013701Strawberry notch homolog 1SMESG000037854.1 dd_Smed_v4_20133_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30013701Strawberry notch homolog 1SMESG000037854.1 dd_Smed_v4_21574_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30013701Strawberry notch homolog 1SMESG000037854.1 dd_Smed_v4_53212_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30005964SMED30005964SMESG000065696.1 dd_Smed_v4_22938_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30009760SMED30009760SMESG000026581.1 dd_Smed_v4_18174_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30006060Kinesin proteinSMESG000063375.1 dd_Smed_v4_15120_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30019275FHA domain-containing proteinSMESG000022990.1 dd_Smed_v4_13269_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30008505SOXP-3SMESG000051170.1 JQ425153smed_ncbi_20200123PMID:25017721
zeta neoblastSMED30008505SOXP-3SMESG000051170.1 JQ425153smed_ncbi_20200123PMID:25017721
zeta neoblastSMED30008505SOXP-3SMESG000051170.1 SMED30008505smed_20140614PMID:29906446
zeta neoblastSMED30017903Timeless circadian clockSMESG000030307.1 dd_Smed_v4_29222_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30017903Timeless circadian clockSMESG000030310.1 SMESG000030307.1 dd_Smed_v4_19257_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30017903Timeless circadian clockSMESG000030309.1 dd_Smed_v4_16022_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30013015Flotillin-1SMESG000004975.1 dd_Smed_v4_1637_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30016053TNF receptor-associated factorSMESG000026231.1 dd_Smed_v4_20341_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30000475Bestrophin homologSMESG000016298.1 dd_Smed_v4_10097_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30007328Nuclear transcription factor Y subunit alphaSMESG000031441.1 dd_Smed_v4_18122_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30018826Mov10 like RISC complex RNA helicase 1SMESG000069873.1 dd_Smed_v4_2121_1_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30017670N-terminal Xaa-Pro-Lys N-methyltransferase 1SMESG000059668.1 dd_Smed_v4_1236_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30019073SMED30019073SMESG000041235.1 dd_Smed_v4_21762_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30019073SMED30019073SMESG000041235.1 dd_Smed_v4_13685_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30010451DNA polymerase epsilon catalytic subunitSMESG000044743.1 SMESG000044635.1 dd_Smed_v4_13980_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30018979Tubulin beta chainSMESG000074579.1 SMESG000074423.1 dd_Smed_v4_13626_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30019370SMED30019370SMESG000065696.1 dd_Smed_v4_22938_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30035970transcription initiation factor TFIID subunit 2SMESG000037189.1 dd_Smed_v4_15494_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30035387Nuclear envelope integral membrane protein 1SMESG000002297.1 dd_Smed_v4_10531_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30027408TRAF-6SMESG000067201.1 dd_Smed_v4_16183_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30031636Dpy-19 like C-mannosyltransferase 3SMESG000059607.1 SMESG000059598.1 dd_Smed_v4_18176_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30033562SMED30033562SMESG000019360.1 dd_Smed_v4_11815_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30032932Protein kinase domain-containing proteinSMESG000065913.1 dd_Smed_v4_22191_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30024342Neuropeptide Y receptor, invertebrateSMESG000059151.1 dd_Smed_v4_10020_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30034829fancd2-like proteinSMESG000066544.1 dd_Smed_v4_12881_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30020142ATP-dependent DNA helicase PIF1SMESG000057255.1 dd_Smed_v4_16842_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30023062bruno-likeSMESG000021009.1 dd_Smed_v4_2592_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30027909Mov10 like RISC complex RNA helicase 1SMESG000069873.1 dd_Smed_v4_2121_1_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30021485SMED30021485SMESG000059844.1 dd_Smed_v4_1328_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30020421slc15a-8SMESG000033891.1 dd_Smed_v4_12826_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30023969LIM domain only protein 3SMESG000037556.1 dd_Smed_v4_6263_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30023969LIM domain only protein 3SMESG000037556.1 SMED30023969smed_20140614PMID:29906446
zeta neoblastSMED300215024-hydroxyphenylpyruvate dioxygenaseSMESG000045752.1 SMESG000045750.1 SMESG000037881.1 SMESG000037878.1 dd_Smed_v4_13579_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED3003321128S ribosomal protein S9SMESG000018935.1 dd_Smed_v4_2348_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30030070Calcineurin B subunitSMESG000077376.1 dd_Smed_v4_17410_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30026364SMED-P53SMESG000078256.1 AY068713.3smed_ncbi_20200123PMID:28072387
zeta neoblastSMED30026364SMED-P53SMESG000078256.1 AY068713.3smed_ncbi_20200123PMID:28072387
zeta neoblastSMED30026364SMED-P53SMESG000078256.1 AY068713.3smed_ncbi_20200123PMID:28072387
zeta neoblastSMED30026364SMED-P53SMESG000078256.1 AY068713.3smed_ncbi_20200123PMID:28072387
zeta neoblastSMED30026364SMED-P53SMESG000078256.1 ACN51391.1smed_ncbi_20200123PMID:28072387
zeta neoblastSMED30026364SMED-P53SMESG000078256.1 ACN51391.1smed_ncbi_20200123PMID:28072387
zeta neoblastSMED30026364SMED-P53SMESG000078256.1 ACN51391.1smed_ncbi_20200123PMID:28072387
zeta neoblastSMED30026364SMED-P53SMESG000078256.1 ACN51391.1smed_ncbi_20200123PMID:28072387
zeta neoblastSMED30026364SMED-P53SMESG000078256.1 SMESG000078255.1 SMED30026364smed_20140614PMID:29906446
zeta neoblastSMED30026364SMED-P53SMESG000078256.1 SMESG000078255.1 SMED30026364smed_20140614PMID:28072387
zeta neoblastSMED30026364SMED-P53SMESG000078256.1 SMESG000078255.1 SMED30026364smed_20140614PMID:28072387
zeta neoblastSMED30026364SMED-P53SMESG000078256.1 SMESG000078255.1 SMED30026364smed_20140614PMID:28072387
zeta neoblastSMED30026364SMED-P53SMESG000078256.1 SMESG000078255.1 SMED30026364smed_20140614PMID:28072387
zeta neoblastSMED30033769Orphan chemoreceptor family proteinSMESG000076072.1 dd_Smed_v4_17134_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED300224045'-tyrosyl-DNA phosphodiesteraseSMESG000024529.1 dd_Smed_v4_12962_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30022982N(4)-(Beta-N-acetylglucosaminyl)-L-asparaginaseSMESG000003786.1 SMESG000003788.1 SMESG000003787.1 dd_Smed_v4_3326_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30030632Protein SCAI homologSMESG000075968.1 dd_Smed_v4_24482_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30031701SMED30031701SMESG000072330.1 dd_Smed_v4_21473_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30027352SMED30027352SMESG000075968.1 dd_Smed_v4_24482_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30030295Peroxiredoxin-1SMESG000024235.1 dd_Smed_v4_3517_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30033559SMED30033559SMESG000076700.1 dd_Smed_v4_18869_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30025421exonuclease 1-likeSMESG000064333.1 dd_Smed_v4_14547_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30020331Serine/threonine-protein kinase greatwallSMESG000073737.1 dd_Smed_v4_18303_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30002877IQ motif and SEC7 domain-containing protein 2SMESG000070179.1 dd_Smed_v4_8602_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30016227DNA excision repair protein ERCC-6-likeSMESG000033073.1 dd_Smed_v4_11583_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30004080PIM-1-like proteinSMESG000061809.1 SMESG000061808.1 dd_Smed_v4_16306_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30019215SMED30019215SMESG000064933.1 dd_Smed_v4_15378_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30003244SMED30003244SMESG000065696.1 dd_Smed_v4_35838_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30006574Eukaryotic translation initiation factor 4E family member 2SMESG000002783.1 dd_Smed_v4_10784_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30017232SMED30017232SMESG000035306.1 SMESG000035307.1 dd_Smed_v4_12255_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30011687CBFD_NFYB_HMF domain-containing proteinSMESG000070171.1 dd_Smed_v4_12599_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30000665SMED30000665SMESG000025288.1 dd_Smed_v4_19210_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30018491SMED30018491SMESG000000384.1 dd_Smed_v4_10941_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30014572Cell division cycle protein 16SMESG000050387.1 dd_Smed_v4_13263_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30006456ClaspinSMESG000049039.1 dd_Smed_v4_7575_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30006456ClaspinSMESG000049039.1 dd_Smed_v4_4671_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30018210SMED30018210SMESG000002162.1 dd_Smed_v4_11023_1_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30018210SMED30018210SMESG000003612.1 SMESG000002162.1 dd_Smed_v4_16259_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30003815SMED30003815SMESG000039247.1 SMESG000039215.1 dd_Smed_v4_11475_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30002673Coiled-coil domain-containing protein 89SMESG000017325.1 dd_Smed_v4_12263_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30014746SMED30014746SMESG000040783.1 dd_Smed_v4_14673_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30019926WD_REPEATS_REGION domain-containing proteinSMESG000072635.1 dd_Smed_v4_28345_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30015266adhesion G protein-coupled receptor L2-likeSMESG000058907.1 dd_Smed_v4_16446_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30017131DNA topoisomerase 2-binding protein 1SMESG000012344.1 dd_Smed_v4_14737_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30002896SMED30002896SMESG000065225.1 SMESG000065211.1 SMESG000065210.1 dd_Smed_v4_7442_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30004470Thymidylate synthase-like ProteinSMESG000063577.1 dd_Smed_v4_1260_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30002777Serine/threonine-protein phosphatase 4 regulatory subunit 2SMESG000049039.1 dd_Smed_v4_7575_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30005127Voltage-dependent L-type calcium channel subunit alphaSMESG000000524.1 dd_Smed_v4_8899_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30007318Glutathione S-transferase C-terminal domain-containing protein-like proteinSMESG000075859.1 dd_Smed_v4_16407_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30015584Nesprin-1SMESG000016745.1 dd_Smed_v4_34184_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30005961Aminoacylase-1SMESG000028073.1 dd_Smed_v4_12209_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30007916SMED30007916SMESG000016771.1 dd_Smed_v4_11930_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30013674Hox class homeodomain protein DjAbd-BbSMESG000033048.1 dd_Smed_v4_9061_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30004541SMED30004541SMESG000056767.1 dd_Smed_v4_13044_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30011316SMED30011316SMESG000065696.1 dd_Smed_v4_39554_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30011316SMED30011316SMESG000065696.1 dd_Smed_v4_12726_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30001160SMED30001160SMESG000000384.1 dd_Smed_v4_10941_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30004593SMED30004593SMESG000009948.1 dd_Smed_v4_19022_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30005253EF-hand domain-containing family member C2SMESG000076759.1 dd_Smed_v4_6035_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30017576SMED30017576SMESG000068857.1 dd_Smed_v4_12195_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30013874Nucleolar protein 10SMESG000032335.1 dd_Smed_v4_10617_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30004748SMED30004748SMESG000023870.1 dd_Smed_v4_24476_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30006745SMED30006745SMESG000051026.1 dd_Smed_v4_15522_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30005128SMED30005128SMESG000039707.1 SMESG000039672.1 dd_Smed_v4_13336_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30012311DNA-(apurinic or apyrimidinic site) lyaseSMESG000036124.1 dd_Smed_v4_11417_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30008172TNF receptor-associated factorSMESG000027149.1 dd_Smed_v4_10424_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30003700Uridine-cytidine kinaseSMESG000030126.1 dd_Smed_v4_5820_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30016473SMED30016473SMESG000027085.1 dd_Smed_v4_16541_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30005157SMED30005157SMESG000054684.1 SMESG000054674.1 dd_Smed_v4_18196_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30001057Mcm10 domain-containing proteinSMESG000014794.1 dd_Smed_v4_11868_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30001057Mcm10 domain-containing proteinSMESG000014794.1 dd_Smed_v4_16334_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30011838TRAF interacting proteinSMESG000027291.1 dd_Smed_v4_15562_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30002068SMED30002068SMESG000032008.1 dd_Smed_v4_13194_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30016181Protein regulator of cytokinesis 1aSMESG000006500.1 dd_Smed_v4_12013_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30009506Baculoviral IAP repeat-containing protein 5SMESG000033647.1 dd_Smed_v4_14261_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30005658SMED30005658SMESG000066596.1 dd_Smed_v4_11959_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30002898mRNA export factorSMESG000032008.1 dd_Smed_v4_13194_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30015407Diaphanous, putativeSMESG000036976.1 dd_Smed_v4_18017_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30001491tRNA pseudouridine synthaseSMESG000041371.1 dd_Smed_v4_16208_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30014394cyclin B-1SMESG000028669.1 dd_Smed_v4_11487_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30005716Histone acetyltransferase p300SMESG000002563.1 dd_Smed_v4_16296_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30017782SMED30017782SMESG000079355.1 dd_Smed_v4_10665_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30017514SMED30017514SMESG000055188.1 dd_Smed_v4_12368_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30016537SMED30016537SMESG000072339.1 dd_Smed_v4_16549_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30009905SMED30009905SMESG000000384.1 dd_Smed_v4_10941_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30020884UV excision repair protein RAD23SMESG000077827.1 dd_Smed_v4_10053_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30020733SMED30020733SMESG000013963.1 SMESG000013955.1 dd_Smed_v4_14808_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30032688Cyclin-dependent kinase 1SMESG000052413.1 dd_Smed_v4_11265_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30027313Hepatoma derived growth factor proteinSMESG000069102.1 dd_Smed_v4_14527_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30029264Werner syndrome ATP-dependent helicaseSMESG000065456.1 SMESG000047271.1 dd_Smed_v4_16426_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30031782SMED30031782SMESG000002170.1 dd_Smed_v4_11867_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED300306021.E7.3SMESG000064601.1 dd_Smed_v4_15533_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30025412Nicotinate phosphoribosyltransferaseSMESG000014532.1 dd_Smed_v4_12183_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30021048U1 small nuclear ribonucleoprotein CSMESG000005768.1 dd_Smed_v4_10739_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30035063SOXP-2SMESG000074761.1 dd_Smed_v4_8483_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30028428Poly [ADP-ribose] polymeraseSMESG000045968.1 dd_Smed_v4_10338_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30020647SMED30020647SMESG000079340.1 dd_Smed_v4_11256_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30034043Cactin, spliceosome C complex subunitSMESG000026741.1 dd_Smed_v4_15273_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30020464SMED30020464SMESG000013963.1 SMESG000013955.1 dd_Smed_v4_14808_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30020202SMED30020202SMESG000040789.1 dd_Smed_v4_11118_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30024797SMED30024797SMESG000035306.1 SMESG000035307.1 dd_Smed_v4_12255_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30024332Tousled-like kinaseSMESG000026492.1 dd_Smed_v4_24862_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30033683Cell division control protein 45-relatedSMESG000045786.1 dd_Smed_v4_16942_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30021818SCP domain-containing proteinSMESG000047165.1 dd_Smed_v4_14382_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30035336LLGL scribble cell polarity complex component 2SMESG000018172.1 dd_Smed_v4_2164_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30018034PUM-HD domain-containing proteinSMESG000023171.1 dd_Smed_v4_7389_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30013233Expressed conserved proteinSMESG000062284.1 dd_Smed_v4_565_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30003668SMED30003668SMESG000068296.1 SMESG000068294.1 SMESG000057066.1 SMESG000057064.1 dd_Smed_v4_59927_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30012293SPT16SMESG000033905.1 dd_Smed_v4_2595_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30007181Serine/threonine-protein phosphatase Pgam5, mitochondrialSMESG000060665.1 dd_Smed_v4_6361_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30007973SMED30007973SMESG000073992.1 dd_Smed_v4_8969_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30004988Kinesin-like proteinSMESG000078501.1 SMESG000018967.1 dd_Smed_v4_9585_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED3001663255 kDa erythrocyte membrane proteinSMESG000017603.1 dd_Smed_v4_7653_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30016886SMED30016886SMESG000024144.1 dd_Smed_v4_5183_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30018567SMED30018567SMESG000011874.1 dd_Smed_v4_14669_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30010326TetraspaninSMESG000078589.1 dd_Smed_v4_2698_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30013237Peptidase C50 domain-containing proteinSMESG000017514.1 SMESG000017512.1 dd_Smed_v4_6610_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30007399Ribosomal RNA processing 1-like proteinSMESG000019865.1 dd_Smed_v4_5604_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30019164SMED30019164SMESG000001359.1 dd_Smed_v4_29713_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30015259SMED30015259SMESG000068296.1 SMESG000068294.1 SMESG000057066.1 SMESG000057064.1 dd_Smed_v4_59927_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30012239Transcription initiation factor IIBSMESG000077013.1 dd_Smed_v4_15237_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30010297Lamin-B2SMESG000047473.1 dd_Smed_v4_6732_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30007726Spo11SMESG000009092.1 dd_Smed_v4_43889_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30001485Tudor domain-containing protein 12SMESG000065057.1 dd_Smed_v4_4638_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30017245DNA replication and sister chromatid cohesion 1SMESG000048533.1 SMESG000022220.1 dd_Smed_v4_17862_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30019864Neur_chan_LBD domain-containing proteinSMESG000008589.1 dd_Smed_v4_10171_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30004629Condensin complex subunit 2SMESG000037461.1 dd_Smed_v4_8491_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30018035SMED30018035SMESG000015075.1 dd_Smed_v4_50305_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30016021Chromatin assembly factor 1 subunit ASMESG000061926.1 dd_Smed_v4_8919_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30015789SMED30015789SMESG000071713.1 dd_Smed_v4_14888_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30007929mre11-like proteinSMESG000014105.1 dd_Smed_v4_4961_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30007860SMED30007860SMESG000005610.1 dd_Smed_v4_5994_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30011704SMED30011704SMESG000063079.1 dd_Smed_v4_15194_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30013268SMED30013268SMESG000010034.1 dd_Smed_v4_13472_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30003577Enhancer of yellow 2 transcription factorSMESG000004606.1 SMESG000004604.1 dd_Smed_v4_928_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30010906Structural maintenance of chromosomes proteinSMESG000059543.1 dd_Smed_v4_7123_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30011181fidgetin-like protein 1SMESG000045800.1 dd_Smed_v4_14599_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30018684TGc domain-containing proteinSMESG000073008.1 dd_Smed_v4_10479_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30011535CRAL-TRIO domain-containing proteinSMESG000081079.1 SMESG000081078.1 dd_Smed_v4_14557_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30014840RRM domain-containing proteinSMESG000020677.1 dd_Smed_v4_14052_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30029304Endonuclease III homologSMESG000036384.1 dd_Smed_v4_9966_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30027571SMED30027571SMESG000072057.1 dd_Smed_v4_6054_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30024908Wee1-like protein kinaseSMESG000073764.1 dd_Smed_v4_17244_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30031197Microtubule-associated protein 4SMESG000068843.1 dd_Smed_v4_7133_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30033472Proteasome activator complex subunit 3SMESG000069494.1 dd_Smed_v4_1801_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30020035DNA polymerase subunit gammaSMESG000050799.1 dd_Smed_v4_13411_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30020257DUF3421 domain-containing proteinSMESG000046742.1 dd_Smed_v4_1040_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30033191Crooked neck pre-mRNA splicing factor 1SMESG000006174.1 dd_Smed_v4_4749_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30032725SMED30032725SMESG000011874.1 dd_Smed_v4_14669_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30028420Nucleotide-binding oligomerization domain-containing protein 2SMESG000018415.1 dd_Smed_v4_10594_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30031757Nudix hydrolase domain-containing proteinSMESG000032411.1 dd_Smed_v4_2068_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30035323EOG090X0AVISMESG000010474.1 dd_Smed_v4_15022_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30021402Cell division cycle 20-like proteinSMESG000051492.1 dd_Smed_v4_10335_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30022238Histone-binding protein RBBP4SMESG000062893.1 dd_Smed_v4_5055_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30024148Soluble guanylate cyclase gcySMESG000045324.1 dd_Smed_v4_10514_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30034953SMED30034953SMESG000065075.1 dd_Smed_v4_102_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30024050chromosome transmission fidelity protein 8 homologSMESG000064421.1 dd_Smed_v4_15527_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30027566SMED30027566SMESG000075236.1 dd_Smed_v4_7519_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30030133RNA binding protein fox-1 homolog 1SMESG000019470.1 dd_Smed_v4_6567_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30033538DNA topoisomerase 2SMESG000037559.1 SMESG000037557.1 dd_Smed_v4_4804_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30033075MMS19_N domain-containing proteinSMESG000059575.1 dd_Smed_v4_7061_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30033401SMED30033401SMESG000076072.1 dd_Smed_v4_17134_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30027419msh6SMESG000073017.1 dd_Smed_v4_15463_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30023257SMED30023257SMESG000016203.1 dd_Smed_v4_6987_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30021722Protein-tyrosine phosphatase mitochondrial 1-like proteinSMESG000010568.1 dd_Smed_v4_6276_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30031935SMED30031935SMESG000038209.1 dd_Smed_v4_14806_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30029314SMED30029314SMESG000001359.1 dd_Smed_v4_29713_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30025395Condensin complex subunit 2SMESG000037461.1 dd_Smed_v4_8491_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30021464glucose 6 phosphate 1 dehydrogenaseSMESG000059573.1 JX010505.1smed_ncbi_20200123PMID:25017721
zeta neoblastSMED30024065LAS1-like proteinSMESG000074249.1 dd_Smed_v4_10589_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30035927WD_REPEATS_REGION domain-containing proteinSMESG000039027.1 dd_Smed_v4_14734_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30021387Glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase 1SMESG000061842.1 dd_Smed_v4_14708_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30022087TNFR CD27 30 40 95 cysteine rich regionSMESG000065173.1 dd_Smed_v4_3783_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30030135AAA domain-containing proteinSMESG000045800.1 dd_Smed_v4_14599_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30031477origin recognition complex subunit 3SMESG000033631.1 dd_Smed_v4_15606_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30020974DNA topoisomerase 2SMESG000037559.1 SMESG000037557.1 dd_Smed_v4_4804_0_1dd_Smed_v4PMID:28292427
zeta neoblastSMED30030459SMED30030459SMESG000041220.1 dd_Smed_v4_14151_0_1dd_Smed_v4PMID:28292427

 

 

back to top