zeta neoblast

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ In Situ Hybridization Data

  ▻ Sequences

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  zeta neoblast


DEFINITON:

  An abundant neoblast subclass consisting of p53+, zfp1+ progenitors required for maintenance and regeneration of epidermal cell type(s).


TERM DEFINITION CITATIONS:

  PMID:25017721


TERM CITATIONS:


TERM ID:

  PLANA:0000014


ABOUT THIS TERM:

zeta neoblast

  ↳is a epidermal progenitor cell and neoblast

  ↳develops from sigma neoblast

  ↳part of integumental system


  → Category 2 cell develops from zeta neoblast



BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30026364ACN51391.1SMED-P53p53Stage 5, Stage 6, Stage 7, Stage 8zeta neoblast, integumental system, Category 2 cell
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30026364 ID=SMED30026364|Name=SMED-P53|organism=Schmidtea mediterranea sexual|type=transcript|length=2047bp
CTCATGACAGTTTTATTAAAGTTACTATTATTAGGAATTCTGCGCGTTAAACTAGACATTATCGATGGCCCAGCAATATA
TTACTTCGGCTTTCGATCCAAACTTCACAACGTTACAGCATCAGACTTCAATACATTATAAATCCTCTCCAATTGAAATG
ATTGTTCCGATGCAATGCAACCAAAACCAAGCCACCTTATCTATAACCCCTGTTCATATTTCTCCATTTGTTAATATATC
AGATTCTAATAATCACAATTTGACGAATATCGTCGAGCCTGTTTCATCAAATACTATGTCTCCTGCTTTTAAATCCGACG
ACATGCCAACATTGTCTTCTTATCCAGGTCCGTATAATTTTCAAATCTTTATTCCCAACGGAGAATTTGATGAATCCAAA
AGAAAAGGACAGACATGTGTGTTTCAAACCGATAAAATGGGAAATCACCAATTATTTACCAAACCTCATCCTCATTATTG
GAGGTTAAATTATTCAGCTGATCCTTCTATGTCAACGGAAAACATGTATATTCGGATGGTTCCAGTTTTTGGGGATCCAG
AAAAAGCTCAATGCATTTTGGAAAGATGTGCAAAACACAAAGAAGTAACAACAGATGAAAATCACTGGAAATATCGTAGC
ATGCTCATTGTAGAAAAAACCTGTGCACATTACTTTCAGGATTCGGCAACGAAAAGAGTTTGCATTTTATTACCGTTTGA
AAAGCATGCGGAAGGAGAGATTTATTCTTCCGTCAACTGTCAATTTGCATGCTACAACAGTTGCTTTAATCAAGATTCAG
GTGGTCGGAAAACACTTTATTTAATCATCACTCTAGAATTTCTCGATAAAAAAACAAATAAATTCGATGTATGGGGTCGA
CAGTGTTTGCAATTTCGCAGTTGTGCTTGTCCAAGTAGAGACTGGAGAGATAAAAAGATTAAAGGCGATCCAGAAATGTT
ACTGAAATTCAAAGAAAAACGAATCAAAACCGAAGAAAAATTAAATAATTTGGTGATTTCTAAAAGCGTCCCTATTAATA
TGGGTGGAAAGGATGCTATCATAAGAGTTCTTCCCTCGTTGCCAGGACTCGATGACGCTATTAACGCATTAGTTTGCGGA
TACTTACTGAATCGAACAACCAACATAAGCGCAATAATAGCAGCATTTAATCAGATGAAAGACGTAGAACATTTAATTAT
CGATCAATTCACATCAAATTTAGATCAAAATACATGTGACAGTAAAAGTCCTTCACAAACTCCAGAGTCTCAGATTTCTC
CGAATACATCAAACCTTCAATTCAACGATTACGGTTCACTTTACGGTGAACCATGTCAACCCTATAGACCGATGCACCAG
CAAGTTGTTAATAATTTTTCCTCTCCAGGAATTTTCAGTAAAATACCTTTTGAAACTTATCCGGTTAGTTATGACATTAA
ACTTTCACATGAAATGCCGCAGCACTTTGATGAGCTGCCATCAGACAACTATAATAGACACTGAAAAATTGCGTCCTTCC
ACGTTTAAAATTGTATAAAAAATAATATGCTTGATTTTTATTTTTGCATTTGTTTTATTTTTTAATGTTGAAAATATTTA
CGTTTGTATTATTTTTTTTTGATTAGTAGTAGTAATGCTGCTTTCAAATTTTATTGAACTTTGATCAGTGATTTTTAATA
TTCAATGACCTGAATTTTTCATGCGTCTTGATGAGGGTTTGAGTGAAAAAATTATCAATTTCTTCACTTTGTCATGTGTG
CTATGTGCATTTATTGATGTATATAACAATATATGTGTAGATAAATTTTATTTTTGTATCCGATTTAGGTTTGCAGGCAC
GATGATGAGTGGTTTTTATTTTGTAAAAATTTTTCGAGATAACATGTGCTCAAATATCAATATTATATATGGTAACATAT
TTTTGCAATAAAAATGCATTTATTGTCAATTTGGCTATAAATTAAGTATCGTACGAATCAAGCAATATTTTATCATTGCT
GTCAATATTTTGTTGATAATTTTTTATTTGCTTTGTTAATAAAGAGC

 

back to top



PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in zeta neoblast. Click this link to learn more about PAGE.


PAGE Curations: 703


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
zeta neoblastSMED30005246cyclin B2 dd_Smed_v4_7837_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30029526glutamate ionotropic receptor NMDA type subunit 1 dd_Smed_v4_5682_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30029526glutamate ionotropic receptor NMDA type subunit 1 dd_Smed_v4_8187_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30005160kinesin light chain dd_Smed_v4_8136_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30008172TNF receptor associated factor 6 dd_Smed_v4_10424_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30018210kinetochore associated 1 dd_Smed_v4_11023_1_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30018210kinetochore associated 1 dd_Smed_v4_16259_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30025497secreted frizzled related protein 1 dd_Smed_v4_8832_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30016564proprotein convertase subtilisin/kexin type 2 dd_Smed_v4_1566_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30016564proprotein convertase subtilisin/kexin type 2 dd_Smed_v4_17071_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30034558Breast cancer type 2 susceptibility protein homolog dd_Smed_v4_12551_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30017670N-terminal Xaa-Pro-Lys N-methyltransferase 1 dd_Smed_v4_1236_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30028428poly(ADP-ribose) polymerase 1 dd_Smed_v4_10338_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30000072Uncharacterized protein dd_Smed_v4_7612_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30003700uridine-cytidine kinase 1 dd_Smed_v4_5820_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30023487LSM14A mRNA processing body assembly factor dd_Smed_v4_1125_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30019039tolloid like 1 dd_Smed_v4_5652_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30025757Transcription factor jun-1 dd_Smed_v4_4878_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30007399Ribosomal RNA processing protein dd_Smed_v4_5604_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30033401Galanin receptor 2b dd_Smed_v4_17134_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30020679histone H2A dd_Smed_v4_2787_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30002673coiled-coil domain containing 89 dd_Smed_v4_12263_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30009741proprotein convertase subtilisin/kexin type 2 dd_Smed_v4_1566_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30009741proprotein convertase subtilisin/kexin type 2 dd_Smed_v4_17071_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30005253EF-hand domain containing 2 dd_Smed_v4_6035_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30000475Bestrophin homolog dd_Smed_v4_10097_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30004598Protein mini spindles dd_Smed_v4_16537_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30002896ZFP62 zinc finger protein dd_Smed_v4_7442_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30012213transient receptor potential cation channel subfamily M member 8 dd_Smed_v4_8493_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30017971transient receptor potential cation channel subfamily A member 1 dd_Smed_v4_6201_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30005921tRNA-yW synthesizing protein 5 dd_Smed_v4_8202_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30009032dCMP deaminase dd_Smed_v4_6803_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30028415replication factor C subunit 2 dd_Smed_v4_8732_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30010297IF rod domain-containing protein dd_Smed_v4_6732_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30015093Asteroid domain-containing protein dd_Smed_v4_9636_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30003229ribonucleotide reductase catalytic subunit M1 dd_Smed_v4_1651_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30006979minichromosome maintenance complex component 2 dd_Smed_v4_7682_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30015034Mitochondrial ribonuclease P catalytic subunit dd_Smed_v4_9514_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30018236bromodomain adjacent to zinc finger domain 2A dd_Smed_v4_7394_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30014887golgin A4 dd_Smed_v4_21084_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30014887golgin A4 dd_Smed_v4_19022_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30004136DNA polymerase alpha 1, catalytic subunit dd_Smed_v4_9168_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30030514EGF-like domain-containing protein dd_Smed_v4_6566_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30011811non-SMC condensin I complex subunit H dd_Smed_v4_8491_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30011687DNA polymerase epsilon 4 accessory subunit dd_Smed_v4_12599_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30015950deoxyribonuclease 2 beta dd_Smed_v4_9160_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30011838TRAF interacting protein dd_Smed_v4_15562_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30033929CTP synthase 1 dd_Smed_v4_5375_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30013386netrin 3 dd_Smed_v4_9795_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30009783zinc finger protein dd_Smed_v4_13890_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30002547peptidylprolyl isomerase A like 4E dd_Smed_v4_457_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30022087domain-containing protein dd_Smed_v4_3783_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30023617replication factor C subunit 3 dd_Smed_v4_9695_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30004593golgin A4 dd_Smed_v4_21084_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30004593golgin A4 dd_Smed_v4_19022_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30018649BRCA1 interacting protein C-terminal helicase 1 dd_Smed_v4_16638_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30001785nuclear receptor subfamily 1 group d member 1 dd_Smed_v4_16388_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30016632Discs large MAGUK scaffold protein 2 dd_Smed_v4_7653_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30027571TNF receptor-associated factor 6 dd_Smed_v4_6054_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30004629non-SMC condensin I complex subunit H dd_Smed_v4_8491_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30005282BRCA1 interacting protein C-terminal helicase 1 dd_Smed_v4_26144_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30032873U2 small nuclear riboprotein auxiliary factor 50; transcript_id=FBtr0307176 dd_Smed_v4_3590_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30013596chromodomain helicase DNA binding protein 1 like dd_Smed_v4_17704_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30012293FACT complex subunit dd_Smed_v4_2595_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30007264Fanconi anemia group I protein homolog dd_Smed_v4_8024_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30015999aurora kinase A dd_Smed_v4_9065_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30035063Transcription factor Sox-7 dd_Smed_v4_8483_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30006533ADP-ribosylation factor dd_Smed_v4_3383_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30008074alpha tocopherol transfer protein dd_Smed_v4_9151_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30024072Eukaryotic translation initiation factor 2c dd_Smed_v4_7594_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30008750origin recognition complex subunit 1 dd_Smed_v4_8215_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30011104La-related protein 6 dd_Smed_v4_1420_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30018665Tetraspanin 42Ec dd_Smed_v4_12033_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30029985meiotic 41 dd_Smed_v4_8754_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30012816aminomethyltransferase dd_Smed_v4_3994_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30004366PRKR interacting protein 1 dd_Smed_v4_8973_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30033528C9orf72-SMCR8 complex subunit dd_Smed_v4_6804_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30025395non-SMC condensin I complex subunit H dd_Smed_v4_8491_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30018002golgin A4 dd_Smed_v4_21084_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30018002golgin A4 dd_Smed_v4_19022_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30002942golgin A4 dd_Smed_v4_21084_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30002942golgin A4 dd_Smed_v4_19022_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30009778meiotic 41 dd_Smed_v4_8754_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30010424DNA primase subunit 1 dd_Smed_v4_11558_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30024332serine/threonine-protein kinase tousled-like 2 dd_Smed_v4_24862_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30011817La-related protein 6 dd_Smed_v4_1420_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30001491pseudouridine synthase 3 dd_Smed_v4_16208_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30021722Phosphatidylglycerophosphate phosphatase PTPMT1 dd_Smed_v4_6276_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30024374LSM14A mRNA processing body assembly factor dd_Smed_v4_1594_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30007059dihydrofolate reductase dd_Smed_v4_7808_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30018861kinesin light chain 4 dd_Smed_v4_8806_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30005127Ca[2 ]-channel protein alpha[[1]] subunit D dd_Smed_v4_8899_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30028315ERCC excision repair 1, endonuclease non-catalytic subunit dd_Smed_v4_9619_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30017211mediator complex subunit 10 dd_Smed_v4_5622_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30035969carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase dd_Smed_v4_7167_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30006630ATPase sarcoplasmic/endoplasmic reticulum Ca2 transporting 3 dd_Smed_v4_9529_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30034520RAD51 recombinase dd_Smed_v4_8626_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30027970kinesin light chain 4 dd_Smed_v4_8806_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30026247Histone RNA hairpin-binding protein dd_Smed_v4_9628_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30004988Kinesin-like protein dd_Smed_v4_9585_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30021048 dd_Smed_v4_10739_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30024148 dd_Smed_v4_10514_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30033562 dd_Smed_v4_11815_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30035316 dd_Smed_v4_11336_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30034651 dd_Smed_v4_11336_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30014447 dd_Smed_v4_5651_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30030602 dd_Smed_v4_15533_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30011316 dd_Smed_v4_12726_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30011316 dd_Smed_v4_22938_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30011316 dd_Smed_v4_39554_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30011316 dd_Smed_v4_35838_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30033255 dd_Smed_v4_12726_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30033255 dd_Smed_v4_22938_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30033255 dd_Smed_v4_39554_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30033255 dd_Smed_v4_35838_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30007056 dd_Smed_v4_12726_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30007056 dd_Smed_v4_22938_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30007056 dd_Smed_v4_39554_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30007056 dd_Smed_v4_35838_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30003244 dd_Smed_v4_12726_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30003244 dd_Smed_v4_22938_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30003244 dd_Smed_v4_39554_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30003244 dd_Smed_v4_35838_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30032309 dd_Smed_v4_12726_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30032309 dd_Smed_v4_22938_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30032309 dd_Smed_v4_39554_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30032309 dd_Smed_v4_35838_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30005964 dd_Smed_v4_12726_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30005964 dd_Smed_v4_22938_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30005964 dd_Smed_v4_39554_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30005964 dd_Smed_v4_35838_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30009602 dd_Smed_v4_12726_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30009602 dd_Smed_v4_22938_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30009602 dd_Smed_v4_39554_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30009602 dd_Smed_v4_35838_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30017365 dd_Smed_v4_12726_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30017365 dd_Smed_v4_22938_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30017365 dd_Smed_v4_39554_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30017365 dd_Smed_v4_35838_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30019370 dd_Smed_v4_12726_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30019370 dd_Smed_v4_22938_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30019370 dd_Smed_v4_39554_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30019370 dd_Smed_v4_35838_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30018197 dd_Smed_v4_12726_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30018197 dd_Smed_v4_22938_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30018197 dd_Smed_v4_39554_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30018197 dd_Smed_v4_35838_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30008979 dd_Smed_v4_12726_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30008979 dd_Smed_v4_22938_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30008979 dd_Smed_v4_39554_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30008979 dd_Smed_v4_35838_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30008985 dd_Smed_v4_16218_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30023035 dd_Smed_v4_13700_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30023035 dd_Smed_v4_3777_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30033565 dd_Smed_v4_13700_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30033565 dd_Smed_v4_3777_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30009415 dd_Smed_v4_13700_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30009415 dd_Smed_v4_3777_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30034422 dd_Smed_v4_13700_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30034422 dd_Smed_v4_3777_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30019215 dd_Smed_v4_15378_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30009674 dd_Smed_v4_13015_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30016237 dd_Smed_v4_13015_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30031935 dd_Smed_v4_14806_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30019073 dd_Smed_v4_13685_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30019073 dd_Smed_v4_21762_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30014702 dd_Smed_v4_12876_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30005658 dd_Smed_v4_11959_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30020647 dd_Smed_v4_11256_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30006745 dd_Smed_v4_15522_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30027599 dd_Smed_v4_13261_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30033360 dd_Smed_v4_12537_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30007034 dd_Smed_v4_13536_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30004541 dd_Smed_v4_13044_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30009524 dd_Smed_v4_14230_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30015789 dd_Smed_v4_14888_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30017232 dd_Smed_v4_12255_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30025981 dd_Smed_v4_12332_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30005029 dd_Smed_v4_13790_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30017889 dd_Smed_v4_22716_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30010517 dd_Smed_v4_2286_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30010115 dd_Smed_v4_2286_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30017754 dd_Smed_v4_3018_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30000190 dd_Smed_v4_3018_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30007343 dd_Smed_v4_3741_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30022588 dd_Smed_v4_3493_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30027562 dd_Smed_v4_3493_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30009760 dd_Smed_v4_18174_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30004748 dd_Smed_v4_24476_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30014425 dd_Smed_v4_24476_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30002022 dd_Smed_v4_29570_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30002220 dd_Smed_v4_29570_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30009168 dd_Smed_v4_32929_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30028300 dd_Smed_v4_22031_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30033472 dd_Smed_v4_1801_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30019120 dd_Smed_v4_4675_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30023288 dd_Smed_v4_40776_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30024602 dd_Smed_v4_40776_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30008873 dd_Smed_v4_337_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30033348 dd_Smed_v4_34984_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30026364Cellular tumor antigen p53 SMED30026364smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30022975caudal type homeobox 4 SMED30022975smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30012332Early growth response protein 3 SMED30012332smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30006464Transcription factor 15 SMED30006464smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30023708Zinc finger protein 341 SMED30023708smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30023969LIM domain only 3 SMED30023969smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30008505Transcription factor Sox-8 SMED30008505smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30000690protocadherin 8 SMED30000690smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30014702 SMED30014702smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30005491 SMED30005491smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30023708Zinc finger protein 341 JQ425154.1smed_ncbi_20240424PMID:30194301
Mihaylova et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
zeta neoblastSMED30023708Zinc finger protein 341 SMED30023708smed_20140614PMID:30194301
Mihaylova et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
zeta neoblastSMED30008505Transcription factor Sox-8 JQ425153.1smed_ncbi_20240424PMID:30194301
Mihaylova et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
zeta neoblastSMED30008505Transcription factor Sox-8 SMED30008505smed_20140614PMID:30194301
Mihaylova et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
zeta neoblastSMED30026364Cellular tumor antigen p53 ACN51391.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
zeta neoblastSMED30026364Cellular tumor antigen p53 ACN51391.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
zeta neoblastSMED30026364Cellular tumor antigen p53 ACN51391.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 5 colorimetric in situ hybridization evidence
zeta neoblastSMED30026364Cellular tumor antigen p53 ACN51391.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
zeta neoblastSMED30026364Cellular tumor antigen p53 AY068713.3smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
zeta neoblastSMED30026364Cellular tumor antigen p53 AY068713.3smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 5 colorimetric in situ hybridization evidence
zeta neoblastSMED30026364Cellular tumor antigen p53 AY068713.3smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
zeta neoblastSMED30026364Cellular tumor antigen p53 AY068713.3smed_ncbi_20240424PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
zeta neoblastSMED30026364Cellular tumor antigen p53 SMED30026364smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
zeta neoblastSMED30026364Cellular tumor antigen p53 SMED30026364smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
zeta neoblastSMED30026364Cellular tumor antigen p53 SMED30026364smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 5 colorimetric in situ hybridization evidence
zeta neoblastSMED30026364Cellular tumor antigen p53 SMED30026364smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
zeta neoblastSMED30012332Early growth response protein 3 JQ425156smed_ncbi_20240424PMID:25017721
van Wolfswinkel et al., 2014
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30012332Early growth response protein 3 JQ425156smed_ncbi_20240424PMID:25017721
van Wolfswinkel et al., 2014
FACS sorted cell population asexual adult fluorescence in situ hybridization evidence
zeta neoblastSMED30023708Zinc finger protein 341 JQ425154smed_ncbi_20240424PMID:25017721
van Wolfswinkel et al., 2014
FACS sorted cell population asexual adult fluorescence in situ hybridization evidence
zeta neoblastSMED30023708Zinc finger protein 341 JQ425154smed_ncbi_20240424PMID:25017721
van Wolfswinkel et al., 2014
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30008505Transcription factor Sox-8 JQ425153smed_ncbi_20240424PMID:25017721
van Wolfswinkel et al., 2014
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30008505Transcription factor Sox-8 JQ425153smed_ncbi_20240424PMID:25017721
van Wolfswinkel et al., 2014
FACS sorted cell population asexual adult fluorescence in situ hybridization evidence
zeta neoblastSMED30034490fms-related tyrosine kinase 1 vascular endothelial growth factor/vascular permeability factor receptor JQ425160smed_ncbi_20240424PMID:25017721
van Wolfswinkel et al., 2014
FACS sorted cell population asexual adult fluorescence in situ hybridization evidence
zeta neoblastSMED30034490fms-related tyrosine kinase 1 vascular endothelial growth factor/vascular permeability factor receptor JQ425160smed_ncbi_20240424PMID:25017721
van Wolfswinkel et al., 2014
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30021464glucose-6-phosphate dehydrogenase JX010505.1smed_ncbi_20240424PMID:25017721
van Wolfswinkel et al., 2014
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30023708Zinc finger protein 341 JQ425154.1smed_ncbi_20240424PMID:29357350
de Sousa et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
zeta neoblastSMED30023483Innexin 5 dd_Smed_v4_11501_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30006813G/T mismatch-specific thymine DNA glycosylase dd_Smed_v4_10660_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30026622Glucosaminyl N-acetyl transferase 3 mucin type dd_Smed_v4_12381_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30010096proprotein convertase subtilisin/kexin type 2 dd_Smed_v4_1566_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30010096proprotein convertase subtilisin/kexin type 2 dd_Smed_v4_17071_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30003750Vang-like protein 1 dd_Smed_v4_15787_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30025388Paramyosin; transcript_id=FBtr0076594 dd_Smed_v4_579_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30022145Protein kinase domain-containing protein dd_Smed_v4_12125_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30003764N-alpha-acetyltransferase 40, NatD catalytic subunit dd_Smed_v4_5816_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30015687E3 ubiquitin-protein ligase RNF8 dd_Smed_v4_10019_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30006065assembly factor for spindle microtubules dd_Smed_v4_15726_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30031463h1SMcT0016303.3 dd_Smed_v4_1985_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30031978Telomerase reverse transcriptase dd_Smed_v4_17877_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30002348cell division cycle 6 dd_Smed_v4_18778_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30012024Protein CBFA2T2 dd_Smed_v4_13504_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30002436histone H2A dd_Smed_v4_2787_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30031447tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta dd_Smed_v4_5419_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30025885TNF receptor-associated factor 4 dd_Smed_v4_16468_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30025885TNF receptor-associated factor 4 dd_Smed_v4_15397_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30004304proliferating cell nuclear antigen dd_Smed_v4_1920_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30022232glutathione S-transferase alpha 5 dd_Smed_v4_1206_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30028549armadillo repeat containing 1 dd_Smed_v4_11494_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30029973ribonucleotide reductase catalytic subunit M1 dd_Smed_v4_1651_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30031507zinc finger protein dd_Smed_v4_13890_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30027770high mobility group box 2 dd_Smed_v4_1646_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30023063helicase, POLQ like dd_Smed_v4_13290_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30023874ABHD14A-ACY1 readthrough dd_Smed_v4_1519_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30009651nuclear receptor binding SET domain protein 2 dd_Smed_v4_11074_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30014394cyclin B1 dd_Smed_v4_11487_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30001441Lysine-specific demethylase 5D dd_Smed_v4_15120_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30002068ribonucleic acid export 1 dd_Smed_v4_13194_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30006574tetraspanin 13 dd_Smed_v4_10784_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30006060Lysine-specific demethylase 5D dd_Smed_v4_15120_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30000705serine/threonine kinase 39 dd_Smed_v4_1366_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30003815RAD50 double strand break repair protein dd_Smed_v4_11475_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30006574eukaryotic translation initiation factor 4E family member 2 dd_Smed_v4_10784_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30001195Transcription factor 12 (Fragment) dd_Smed_v4_5579_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30002898ribonucleic acid export 1 dd_Smed_v4_13194_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30001286DNA polymerase nu dd_Smed_v4_10383_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30001286DNA polymerase nu dd_Smed_v4_32229_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30013674motor neuron and pancreas homeobox 1 dd_Smed_v4_9061_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30032052Protein mini spindles dd_Smed_v4_16537_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30025717C9orf72-SMCR8 complex subunit dd_Smed_v4_6804_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30030234tubulin alpha chain dd_Smed_v4_648_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30026070Acetylcholine esterase dd_Smed_v4_15930_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30027258tudor domain containing 9 dd_Smed_v4_5842_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30029155kinesin light chain dd_Smed_v4_8136_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30032788Protein kinase domain-containing protein dd_Smed_v4_14648_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30032723RAD54 like dd_Smed_v4_15532_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30001805C9orf72-SMCR8 complex subunit dd_Smed_v4_6804_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30029980Deoxyuridine triphosphatase; transcript_id=FBtr0080157 dd_Smed_v4_2921_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30010838h1SMcT0002567.1 dd_Smed_v4_4842_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30030377polypeptide N-acetylgalactosaminyltransferase 12 dd_Smed_v4_8580_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30035970transcription initiation factor TFIID subunit 2 dd_Smed_v4_15494_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30029161Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_5464_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30032723Serine/threonine-protein phosphatase 6 regulatory ankyrin repeat subunit B dd_Smed_v4_15532_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30001391minichromosome maintenance 8 homologous recombination repair factor dd_Smed_v4_22244_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30012839phosphoglucomutase 3 dd_Smed_v4_7502_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30020257h1SMcT0006001.1 dd_Smed_v4_1040_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30029225C9orf72-SMCR8 complex subunit dd_Smed_v4_6804_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30001485Putative ATP-dependent RNA helicase TDRD12 dd_Smed_v4_4638_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30002877IQ motif and SEC7 domain-containing protein 1 dd_Smed_v4_8602_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30021492Histone H2A/H2B/H3 domain-containing protein dd_Smed_v4_13844_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30020124h1SMcT0007689.2 dd_Smed_v4_2458_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30009506Baculoviral IAP dd_Smed_v4_14261_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30027457Notch dd_Smed_v4_12732_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30026823transient receptor potential cation channel subfamily M member 8 dd_Smed_v4_8493_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30012311apurinic/apyrimidinic endodeoxyribonuclease 1 dd_Smed_v4_11417_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30020035DNA polymerase gamma, catalytic subunit dd_Smed_v4_13411_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30018034pumilio RNA binding family member 3 dd_Smed_v4_7389_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30027563calcium release activated channel regulator 2A dd_Smed_v4_2966_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30013318Uncharacterized ATP-dependent helicase IRC20 dd_Smed_v4_15776_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30007929MRE11 homolog, double strand break repair nuclease dd_Smed_v4_4961_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30015520transcription elongation factor A N-terminal and central domain containing 2 dd_Smed_v4_22739_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30031551E3 ubiquitin-protein ligase RNF10 dd_Smed_v4_9026_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30030133RNA binding protein fox-1 homolog 1 dd_Smed_v4_6567_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30002811sphingomyelin phosphodiesterase acid like 3A dd_Smed_v4_17883_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30032106h1SMcT0012728.1 dd_Smed_v4_8948_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30004550Kinesin-like protein dd_Smed_v4_14426_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30031757nudix hydrolase 8 dd_Smed_v4_2068_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30008368RTEL1-TNFRSF6B readthrough (NMD candidate) dd_Smed_v4_12261_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30010326Tetraspanin dd_Smed_v4_2698_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30020202zinc finger protein 107 dd_Smed_v4_11118_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30018566h1SMcT0017367.1 dd_Smed_v4_8828_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30025599h1SMcT0020855.2 dd_Smed_v4_14607_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30030505LIM homeobox 9 dd_Smed_v4_13371_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30029304nth like DNA glycosylase 1 dd_Smed_v4_9966_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30026733KRR1 small subunit processome component homolog dd_Smed_v4_30487_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30035336LLGL scribble cell polarity complex component 1 dd_Smed_v4_2164_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30035927Protein NEDD1 dd_Smed_v4_14734_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30028809transient receptor potential cation channel subfamily M member 8 dd_Smed_v4_8493_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30025421Exonuclease 1 dd_Smed_v4_14547_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30022404tyrosyl-DNA phosphodiesterase 2 dd_Smed_v4_12962_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30024555cyclin dependent kinase 4 dd_Smed_v4_14134_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30031380Suppressor of hairy wing dd_Smed_v4_2118_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30032688Protein kinase domain-containing protein dd_Smed_v4_11265_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30035387Nuclear envelope integral membrane protein dd_Smed_v4_10531_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30019864Gamma-aminobutyric acid receptor subunit gamma-3 dd_Smed_v4_10171_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30011658kinesin light chain dd_Smed_v4_8136_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30000377Glutamate receptor-interacting protein 2-like dd_Smed_v4_5498_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30009527Kinesin-like protein KIF21A dd_Smed_v4_18330_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30008172tnf receptor-associated factor dd_Smed_v4_10424_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30017880integrin subunit alpha 8 dd_Smed_v4_11655_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30007726SPO11 initiator of meiotic double stranded breaks dd_Smed_v4_43889_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30008015solute carrier family 25 member 19 dd_Smed_v4_7507_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30030295peroxiredoxin 1 dd_Smed_v4_3517_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30019097Transcription factor SOX-6 dd_Smed_v4_7227_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30029888histone H4 transcription factor dd_Smed_v4_26924_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30003242WD repeat domain 3 dd_Smed_v4_7978_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30023821minichromosome maintenance complex component 4 dd_Smed_v4_5956_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30020142PIF1 5'-to-3' DNA helicase dd_Smed_v4_16842_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30031539origin recognition complex subunit 4 dd_Smed_v4_11263_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30002635lethal (2) 34Fd; transcript_id=FBtr0080639 dd_Smed_v4_10561_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30005365Serine/threonine-protein kinase ppk6 dd_Smed_v4_15228_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30009204Fibroblast growth factor receptor 1 dd_Smed_v4_11024_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30020469LIM domain-containing protein 2 dd_Smed_v4_7989_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30006125Zinc finger protein 142 dd_Smed_v4_14413_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30019468protein arginine methyltransferase 1 dd_Smed_v4_1302_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30035898kyphoscoliosis peptidase dd_Smed_v4_4149_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30018526solute carrier family 25 member 24 dd_Smed_v4_8134_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30021808coiled-coil domain containing 150 dd_Smed_v4_14111_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30027313Hepatoma-derived growth factor-related protein 3 dd_Smed_v4_14527_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30008984protein phosphatase, Mg2 /Mn2 dependent 1G dd_Smed_v4_2086_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30013015Flotillin 1; transcript_id=FBtr0087352 dd_Smed_v4_1637_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30021402Anaphase-promoting complex subunit 4 WD40 domain-containing protein dd_Smed_v4_10335_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30022584minichromosome maintenance complex component 4 dd_Smed_v4_5956_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30026659ribonucleoside-diphosphate reductase dd_Smed_v4_5862_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30031477origin recognition complex subunit 3 dd_Smed_v4_15606_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30032563minichromosome maintenance complex component 5 dd_Smed_v4_5764_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30012935kyphoscoliosis peptidase dd_Smed_v4_4149_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30020070high mobility group dd_Smed_v4_1095_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30018684Hillarin dd_Smed_v4_10479_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30025821multiple PDZ domain crumbs cell polarity complex component dd_Smed_v4_5376_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30011678Uncharacterized protein dd_Smed_v4_7612_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30005716histone acetyltransferase dd_Smed_v4_16296_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30010338proprotein convertase subtilisin/kexin type 2 dd_Smed_v4_1566_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30010338proprotein convertase subtilisin/kexin type 2 dd_Smed_v4_17071_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30007406Protein piwi dd_Smed_v4_659_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30006046tnf receptor-associated factor dd_Smed_v4_10424_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30004080Ribosomal protein S6 kinase alpha-5 dd_Smed_v4_16306_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30005932Tudor domain-containing protein 1 dd_Smed_v4_3564_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30029322Transcription factor 12 (Fragment) dd_Smed_v4_5579_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30015407diaphanous related formin 2 dd_Smed_v4_18017_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30006046TNF receptor associated factor 6 dd_Smed_v4_10424_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30014572cell division cycle 16 dd_Smed_v4_13263_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30011862Transcription factor SOX-6 dd_Smed_v4_7227_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30015266adhesion G-protein coupled receptor dd_Smed_v4_16446_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30019011RAD50 double strand break repair protein dd_Smed_v4_11475_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30005823Serine/threonine-protein kinase PRP4 homolog dd_Smed_v4_7015_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30029634kinesin family member 20B dd_Smed_v4_11717_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30030543Histone H2A dd_Smed_v4_2614_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30018630HMG box domain-containing protein dd_Smed_v4_1331_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30027419mutS homolog 6 dd_Smed_v4_15463_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30008000cell division cycle 7 dd_Smed_v4_16034_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30009016structure specific recognition protein 1 dd_Smed_v4_3904_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30006168Fucolectin dd_Smed_v4_15258_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30009393Cleavage and polyadenylation specificity factor subunit 4 dd_Smed_v4_14360_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30014844Flotillin 1; transcript_id=FBtr0087352 dd_Smed_v4_1637_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30001057minichromosome maintenance 10 replication initiation factor dd_Smed_v4_11868_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30001057minichromosome maintenance 10 replication initiation factor dd_Smed_v4_16334_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30004470Thymidylate synthase dd_Smed_v4_1260_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30020884UV excision repair protein RAD23 homolog B dd_Smed_v4_10053_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30031235tubulin alpha chain dd_Smed_v4_648_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30006411ribonucleotide reductase catalytic subunit M1 dd_Smed_v4_1651_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30023910Suppressor of hairy wing dd_Smed_v4_2118_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30029763H1.5 linker histone, cluster member dd_Smed_v4_601_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30009131Docking protein 3 dd_Smed_v4_4462_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30011713ethanolamine kinase 1 dd_Smed_v4_8711_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30015608SprT-like domain-containing protein dd_Smed_v4_14607_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30019099uridine phosphorylase 1 dd_Smed_v4_9107_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30006841Serine/threonine-protein phosphatase dd_Smed_v4_23492_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30015608h1SMcT0020855.2 dd_Smed_v4_14607_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30004043Cytoskeleton-associated protein 5-A dd_Smed_v4_16467_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30004679PRKR interacting protein 1 dd_Smed_v4_8973_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30009618ATPase sarcoplasmic/endoplasmic reticulum Ca2 transporting 3 dd_Smed_v4_9529_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30012239Transcription initiation factor iib dd_Smed_v4_15237_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30016227DNA annealing helicase and endonuclease ZRANB3-like dd_Smed_v4_11583_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30015467IQ motif and SEC7 domain-containing protein 1 dd_Smed_v4_8602_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30030946minichromosome maintenance complex component 7 dd_Smed_v4_4712_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30021610sister of feo; transcript_id=FBtr0073409 dd_Smed_v4_12013_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30021163aquaporin dd_Smed_v4_13249_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30027740coiled-coil domain containing 62 dd_Smed_v4_14425_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30021781tubulin beta class I dd_Smed_v4_13626_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30025245kinesin family member 20A dd_Smed_v4_13972_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30021300Protein SCAI dd_Smed_v4_24482_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30016053TNF receptor associated factor 6 dd_Smed_v4_20341_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30021387h1SMcT0018514.3 dd_Smed_v4_14708_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30005961aminoacylase 1 dd_Smed_v4_12209_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30028597h1SMcT0003267.1 dd_Smed_v4_21908_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30028597h1SMcT0003267.1 dd_Smed_v4_29867_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30019908Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_30941_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30019908Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_10962_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30035973Muscle-specific protein 300 kDa dd_Smed_v4_34184_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30023283tubulin beta class I dd_Smed_v4_13626_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30019555TIMELESS interacting protein dd_Smed_v4_12580_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30003690Nuclear transcription factor Y subunit A-1 dd_Smed_v4_18122_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30002275h1SMcT0003267.1 dd_Smed_v4_21908_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30002275h1SMcT0003267.1 dd_Smed_v4_29867_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30034043cactin, spliceosome C complex subunit dd_Smed_v4_15273_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30016181sister of feo; transcript_id=FBtr0073409 dd_Smed_v4_12013_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30007328Nuclear transcription factor Y subunit A-1 dd_Smed_v4_18122_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30031663DNA polymerase epsilon 2, accessory subunit dd_Smed_v4_16802_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30027352Protein SCAI dd_Smed_v4_24482_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30031155Tc1-like transposase DDE domain-containing protein dd_Smed_v4_12826_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30024486poly(A) binding protein cytoplasmic 1 dd_Smed_v4_11729_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30033600minichromosome maintenance complex component 6 dd_Smed_v4_2682_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30031636dpy-19 like C-mannosyltransferase 3 dd_Smed_v4_18176_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30033211mitochondrial ribosomal protein S9 dd_Smed_v4_2348_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30024908Wee1-like protein kinase 2 dd_Smed_v4_17244_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30026430h1SMcT0003267.1 dd_Smed_v4_21908_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30026430h1SMcT0003267.1 dd_Smed_v4_29867_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30033683cell division cycle 45 dd_Smed_v4_16942_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30011092h1SMcT0003267.1 dd_Smed_v4_21908_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30011092h1SMcT0003267.1 dd_Smed_v4_29867_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30019647Serine-protein kinase ATM dd_Smed_v4_14586_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30019162Coagulation factor IX dd_Smed_v4_5109_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30022238Histone-binding protein RBBP4 N-terminal domain-containing protein dd_Smed_v4_5055_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30030135Fidgetin dd_Smed_v4_14599_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30028154PDLIM1 interacting kinase 1 like dd_Smed_v4_12461_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30017245DNA replication and sister chromatid cohesion 1 dd_Smed_v4_17862_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30006456Claspin dd_Smed_v4_4671_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30006456Claspin dd_Smed_v4_7575_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30014746NDC80 kinetochore complex component dd_Smed_v4_14673_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30019647Glycerol kinase dd_Smed_v4_14586_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30027038Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_30941_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30027038Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_10962_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30004973chromosome 8 open reading frame 82 dd_Smed_v4_14037_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30019741tetraspanin dd_Smed_v4_13516_1_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30019741tetraspanin dd_Smed_v4_32522_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30017131BRCT domain-containing protein dd_Smed_v4_14737_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30035323origin recognition complex subunit 2 dd_Smed_v4_15022_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30008519h1SMcT0003267.1 dd_Smed_v4_21908_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30008519h1SMcT0003267.1 dd_Smed_v4_29867_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30036024DNA primase subunit 2 dd_Smed_v4_13727_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30032932nuclear receptor binding protein 2 dd_Smed_v4_22191_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30031408h1SMcT0003267.1 dd_Smed_v4_21908_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30031408h1SMcT0003267.1 dd_Smed_v4_29867_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30018579DNA replication factor Cdt1 dd_Smed_v4_13580_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30034951essential meiotic structure-specific endonuclease 1 dd_Smed_v4_15071_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30035415DEAD/H-box helicase 11 dd_Smed_v4_19858_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30027751NIMA related kinase 10 dd_Smed_v4_25617_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30034465h1SMcT0003267.1 dd_Smed_v4_21908_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30034465h1SMcT0003267.1 dd_Smed_v4_29867_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30030632Protein SCAI dd_Smed_v4_24482_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30018979tubulin beta class I dd_Smed_v4_13626_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30027788Poly(A) polymerase dd_Smed_v4_25428_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30006138P-loop containing nucleoside triphosphate hydrolase protein dd_Smed_v4_45276_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30032804Ankyrin repeat and LEM domain-containing protein 2 dd_Smed_v4_14491_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30019162influenza virus NS1A binding protein dd_Smed_v4_5109_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30011535h1SMcT0021902.3 dd_Smed_v4_14557_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30018725Interferon-induced, double-stranded RNA-activated protein kinase dd_Smed_v4_19210_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30022014Tetraspanin 96F dd_Smed_v4_2693_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30011865NIMA related kinase 10 dd_Smed_v4_25617_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30033191crooked neck pre-mRNA splicing factor 1 dd_Smed_v4_4749_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30034829FA complementation group D2 dd_Smed_v4_12881_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30021128HUS1 checkpoint clamp component dd_Smed_v4_15678_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30032708methylosome subunit pICln dd_Smed_v4_3584_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30016072 dd_Smed_v4_10400_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30018491 dd_Smed_v4_10941_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30009905 dd_Smed_v4_10941_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30001160 dd_Smed_v4_10941_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30018987 dd_Smed_v4_11221_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30020418Ankyrin repeat dd_Smed_v4_17293_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30021074nuclear transport factor 2 dd_Smed_v4_3953_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30023708Zinc finger protein 341 dd_Smed_v4_8720_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30017368h1SMcT0004996.1 dd_Smed_v4_7236_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30012533beta-1,3-galactosyltransferase 5 dd_Smed_v4_24931_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30018826RNA helicase dd_Smed_v4_2121_1_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED300292643'-5' exonuclease domain-containing protein dd_Smed_v4_16426_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30002298Nucleolar protein 4-like dd_Smed_v4_10255_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30024050chromosome transmission fidelity factor 8 dd_Smed_v4_15527_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30018266phosphatidylinositol-binding clathrin assembly protein dd_Smed_v4_6650_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30010838h1SMcT0002566.1 dd_Smed_v4_4842_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30023969LIM domain only 3 dd_Smed_v4_6263_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30025486major facilitator superfamily domain containing 3 dd_Smed_v4_37111_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30020687carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase dd_Smed_v4_7167_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30014754phosphoglucomutase 3 dd_Smed_v4_7502_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30025294fibrillarin dd_Smed_v4_2811_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30007181PGAM family member 5, mitochondrial serine/threonine protein phosphatase dd_Smed_v4_6361_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30017473nucleolar protein 10 dd_Smed_v4_10617_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30009590RAD54 homolog B dd_Smed_v4_9943_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30019926Anaphase-promoting complex subunit 4 WD40 domain-containing protein dd_Smed_v4_28345_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30018395WD repeat and HMG-box DNA-binding protein 1 dd_Smed_v4_10217_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30030734vesicle associated membrane protein 2 dd_Smed_v4_10790_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30014136Dynactin subunit 1 dd_Smed_v4_20651_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30028914photorepair; transcript_id=FBtr0088838 dd_Smed_v4_2829_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30020974DNA topoisomerase II beta dd_Smed_v4_4804_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30017266major facilitator superfamily domain containing 3 dd_Smed_v4_37111_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30027106proprotein convertase subtilisin/kexin type 2 dd_Smed_v4_17071_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30025781WD repeat domain 36 dd_Smed_v4_6943_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30018344Acetylcholine esterase dd_Smed_v4_15930_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30013874nucleolar protein 10 dd_Smed_v4_10617_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30023826deoxyribonuclease 2 beta dd_Smed_v4_30191_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30017216Derived by automated computational analysis using gene prediction method Gnomon dd_Smed_v4_5464_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30015285spindle apparatus coiled-coil protein 1 dd_Smed_v4_18168_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30030297Serine/threonine-protein kinase haspin dd_Smed_v4_22145_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30017448heat shock protein dd_Smed_v4_6850_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30025079Protein mini spindles dd_Smed_v4_16537_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30029621cyclin dependent kinase 1 dd_Smed_v4_31502_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30032439family with sequence similarity 126 member dd_Smed_v4_5919_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30026560minichromosome maintenance complex component 3 dd_Smed_v4_6734_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30032645chromobox 1 dd_Smed_v4_928_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30012458alpha Karyopherin-4 dd_Smed_v4_3708_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30015936WD repeat and HMG-box DNA-binding protein 1 dd_Smed_v4_10217_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30010418DNA topoisomerase II beta dd_Smed_v4_4804_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30007318glutathione S-transferase C-terminal domain containing dd_Smed_v4_16407_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30008746Protein kinase domain-containing protein dd_Smed_v4_14648_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30012218nucleoporin 210 dd_Smed_v4_4698_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30025330BCS1 homolog, ubiquinol-cytochrome c reductase complex chaperone dd_Smed_v4_6593_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30020974DNA topoisomerase II alpha dd_Smed_v4_4804_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30020331kinase greatwall dd_Smed_v4_18303_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30033400GINS complex subunit 4 dd_Smed_v4_23589_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30029741Uncharacterized protein dd_Smed_v4_2250_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30015686nucleoporin 210 dd_Smed_v4_4698_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30021378Uncharacterized protein dd_Smed_v4_2250_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30003330Ankyrin repeat dd_Smed_v4_17293_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30028454TATA-box binding protein associated factor 5 like dd_Smed_v4_20962_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30011181Fidgetin dd_Smed_v4_14599_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30034098uncharacterized protein dd_Smed_v4_4552_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30013701strawberry notch homolog 2 dd_Smed_v4_20133_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30013701strawberry notch homolog 2 dd_Smed_v4_21574_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30013701strawberry notch homolog 2 dd_Smed_v4_53212_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30025412nicotinate phosphoribosyltransferase dd_Smed_v4_12183_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30028625PMS1 protein homolog 1 dd_Smed_v4_15640_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30019528Asteroid domain-containing protein dd_Smed_v4_9636_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30003599synaptonemal complex protein 1 dd_Smed_v4_30278_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30003599synaptonemal complex protein 1 dd_Smed_v4_18547_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30033575h1SMcT0020855.2 dd_Smed_v4_14607_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30014925DEAD/H-box helicase 11 dd_Smed_v4_19858_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30028865GINS complex subunit 3 dd_Smed_v4_9624_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30008929Aldo-keto reductase 1B; transcript_id=FBtr0331547 dd_Smed_v4_9852_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30015597Transcription factor dcp-66 dd_Smed_v4_13402_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30028317Fanconi anemia group I protein homolog dd_Smed_v4_8024_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30015956sphingomyelin phosphodiesterase acid like 3A dd_Smed_v4_17883_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30015584Muscle-specific protein 300 kDa dd_Smed_v4_34184_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30035749meiotic nuclear divisions 1 dd_Smed_v4_13140_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30033075MMS19 nucleotide excision repair protein dd_Smed_v4_7061_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30013676Muscle-specific protein 300 kDa dd_Smed_v4_34184_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED300215024-hydroxyphenylpyruvate dioxygenase like dd_Smed_v4_13579_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30011950Trans-acting T-cell-specific transcription factor GATA-3 dd_Smed_v4_17393_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30025599SprT-like domain-containing protein dd_Smed_v4_14607_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30018716acidic nuclear phosphoprotein 32 family member E dd_Smed_v4_1396_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30031773mutS homolog 2 dd_Smed_v4_11434_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30024468Disks large-associated protein 1 dd_Smed_v4_12953_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30012311apurinic/apyrimidinic endodeoxyribonuclease 1 dd_Smed_v4_11417_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30016021chromatin assembly factor 1 subunit dd_Smed_v4_8919_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30022444family with sequence similarity 184 member A dd_Smed_v4_9821_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30034477Anti-proliferative protein domain-containing protein dd_Smed_v4_7444_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30017903timeless circadian regulator dd_Smed_v4_16022_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30017903timeless circadian regulator dd_Smed_v4_29222_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30017903timeless circadian regulator dd_Smed_v4_19257_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30025780polo like kinase 1 dd_Smed_v4_4273_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30007543Muscle-specific protein 300 kDa dd_Smed_v4_34184_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30010451DNA polymerase epsilon, catalytic subunit dd_Smed_v4_13980_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30034279fibrillin 1 dd_Smed_v4_416_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30010906structural maintenance of chromosomes 2 dd_Smed_v4_7123_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30023062CUGBP Elav-like family member dd_Smed_v4_2592_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30000665Interferon-induced, double-stranded RNA-activated protein kinase dd_Smed_v4_19210_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30011043grapes; transcript_id=FBtr0080886 dd_Smed_v4_12789_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30027566TNF receptor-associated factor 6-B dd_Smed_v4_7519_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30005828BOP1 ribosomal biogenesis factor dd_Smed_v4_11041_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30033575SprT-like domain-containing protein dd_Smed_v4_14607_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30030072 dd_Smed_v4_34984_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30000843 dd_Smed_v4_4731_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30021439 dd_Smed_v4_18818_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30007516 dd_Smed_v4_17796_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30030213 dd_Smed_v4_4581_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30024728 dd_Smed_v4_45479_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30035831 dd_Smed_v4_2725_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30021579 dd_Smed_v4_14997_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30005157 dd_Smed_v4_18196_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30005157 dd_Smed_v4_13582_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30033663 dd_Smed_v4_18196_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30033663 dd_Smed_v4_13582_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30014840 dd_Smed_v4_14052_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30023808 dd_Smed_v4_11646_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30011900 dd_Smed_v4_11646_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30018567 dd_Smed_v4_14669_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30019019 dd_Smed_v4_20516_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30006905 dd_Smed_v4_12447_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30031782 dd_Smed_v4_11867_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30021376 dd_Smed_v4_18815_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30007916 dd_Smed_v4_11930_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30005503 dd_Smed_v4_19563_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30027700 dd_Smed_v4_19176_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30005289 dd_Smed_v4_14387_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30003904 dd_Smed_v4_18353_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30031701 dd_Smed_v4_21473_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30016537 dd_Smed_v4_16549_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30033559 dd_Smed_v4_18869_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30031069 dd_Smed_v4_13666_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30021818 dd_Smed_v4_14382_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30015313 dd_Smed_v4_14382_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30025550 dd_Smed_v4_12116_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30021292 dd_Smed_v4_12116_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30008705 dd_Smed_v4_14921_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30011704 dd_Smed_v4_15194_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30021485 dd_Smed_v4_1328_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30001813 dd_Smed_v4_17632_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30000251 dd_Smed_v4_18158_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30016473 dd_Smed_v4_16541_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30000140 dd_Smed_v4_19710_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30002927 dd_Smed_v4_19710_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30017514 dd_Smed_v4_12368_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30021918 dd_Smed_v4_13760_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30027026 dd_Smed_v4_18426_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30013772 dd_Smed_v4_21608_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30032258 dd_Smed_v4_11412_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30019275 dd_Smed_v4_13269_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30017576 dd_Smed_v4_12195_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30022491 dd_Smed_v4_14660_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30030459 dd_Smed_v4_14151_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30032803 dd_Smed_v4_12831_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30025017 dd_Smed_v4_5525_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30028149 dd_Smed_v4_32082_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30006359 dd_Smed_v4_32082_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30004726 dd_Smed_v4_32082_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30031095 dd_Smed_v4_21560_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30024065 dd_Smed_v4_10589_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30007420 dd_Smed_v4_10376_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30014938 dd_Smed_v4_10341_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30016740 dd_Smed_v4_26668_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30005128 dd_Smed_v4_13336_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30030070 dd_Smed_v4_17410_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30016762 dd_Smed_v4_59927_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30020464 dd_Smed_v4_14808_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30020733 dd_Smed_v4_14808_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30016826 dd_Smed_v4_16851_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30007860 dd_Smed_v4_5994_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30035005 dd_Smed_v4_13091_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30011429 dd_Smed_v4_58387_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30013268 dd_Smed_v4_13472_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30008223 dd_Smed_v4_18284_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30013233 dd_Smed_v4_565_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30034402 dd_Smed_v4_10299_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30027408 dd_Smed_v4_16183_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30017782 dd_Smed_v4_10665_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30023900 dd_Smed_v4_17552_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30034953 dd_Smed_v4_102_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30024342 dd_Smed_v4_10020_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30019164 dd_Smed_v4_29713_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30029314 dd_Smed_v4_29713_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30021639 dd_Smed_v4_21438_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30029203 dd_Smed_v4_4644_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30018035 dd_Smed_v4_50305_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30017203 dd_Smed_v4_4702_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30005171 dd_Smed_v4_629_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30007973 dd_Smed_v4_8969_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30024735 dd_Smed_v4_7744_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30032600 dd_Smed_v4_6253_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30015678 dd_Smed_v4_6668_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30018726 dd_Smed_v4_3797_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30007383 dd_Smed_v4_7534_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30026213 dd_Smed_v4_8223_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30018612 dd_Smed_v4_8247_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30031197 dd_Smed_v4_7133_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30006163 dd_Smed_v4_6783_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30034335 dd_Smed_v4_8341_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30016886 dd_Smed_v4_5183_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30023257 dd_Smed_v4_6987_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30004085 dd_Smed_v4_5639_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30029434 dd_Smed_v4_6870_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30012735 dd_Smed_v4_9229_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30000310 dd_Smed_v4_9639_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30014417 dd_Smed_v4_8773_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30018750 dd_Smed_v4_9225_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30034338 dd_Smed_v4_9017_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017
whole organism asexual adult single-cell RNA-sequencing evidence
Note: Hover over icons to view figure legend

 

 

back to top