protonephridial progenitor cell

▻ Planarian Anatomy Ontology Class Overview

▻ Embryonic Molecular Fate Mapping

  ▻ In Situ Hybridization Data

  ▻ Sequences

▻ PAGE: Planarian Anatomy Gene Expression




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  protonephridial progenitor cell


DEFINITON:

  Neoblasts and post-mitotic, differentiating daughters coexpressing POU2-3, six1/2-2, Sal1, Eya and Osr,required for maintenance and regeneration of protonephridial cell types.


TERM DEFINITION CITATIONS:

  PMID:28072387, PMID:24523458


TERM ID:

  PLANA:0000011


ABOUT THIS TERM:

protonephridial progenitor cell

  ↳is a anatomical entity and progenitor cell

  ↳develops into protonephridia


Expand to see terms that develops from protonephridial progenitor cell

  → proximal tubule
  → flame bulb
  → distal tubule
  → protonephridia


BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Embryonic Molecular Fate Mapping


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasExpressed during stage(s)Tissue/PatternImages
SMED30030379POU domain proteinpou2/3Stage 5, Stage 6, Stage 7, Stage 8protonephridia, renal system, protonephridial progenitor cell
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30028196 ID=SMED30028196|Name=POU domain protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1170bp
GTATTTAGTAATTTAAAAATAACCTATTTATATTATTGATTAACATAATATAAATATTTAACATCTATAAGATTTCATGA
ATTATTACTACCAATAATTTTTTTAAACTTAAAACACTTGATAAGTATCATGAAATGTTTTTTATTTCCTATTGAATCTA
CAGAAAAGGATAAGTCTTGCACCTTTGTTCTGAAAGATATTAATGAAATTCGAATTTCTGTTCCTATAAAGATATCAGCA
AATAATGATTGTAATAAAACAATTAGCTTTTCTAATTCAGATTTAGAAACTTTAGCCAAAGAAATATCAGCTGCTTTTTC
TAGTAATACTATTGAAAAGAGTACAGAAATAAAAACACTGAATGATTTTATACTTAATCAAAACAAAGATCTTCAAAATT
ATATTAATCATGTTAATGATATACCTACTTTAGATGACTGTTTGCGAAGTAAAAATTTTATATTCAAAACCGAACAAGAT
TTAGAAAGTTTGCATAAAACTCCTTCGACGGCTAGCGAGCAAGAGTCATTAAATATACTATTGAATAAATCTTTGGTTTT
TGATCTGGATTTTATTAAGCAATTTACTAAAGAATTTAAACAATTTCGACAAAATTTAGGAGTAACCCAAATGGAAGTCG
GCCAGTCCATGAAATATTATTTGAAAAGTGATTTCAGTCAAACAACGATTTGTCGATTTGAGTCTATGACGCTGGCATCA
ACAAATATGTTTGAATTGATTCCATATTTCCGAAAATGGATATCCAAAGTATATAATCCCGACAGAACCAAGACAATTAA
AAATGTCATTTCTAAACTGGAATCAATTGACATTTCTCGAGCATTGGAAGACGAGTTTGCGAAAGATAAAACGGACAGCG
AGTCCAGCAATAACAGTAATGGTGATGAAATGGTAAATGTCAAAAGCAAAACTCGGAAACAACGAATCCAATTTACGAGA
TTTCAGTTGAAAAAAATGGAAAGTCTTTTTCAAACAGTCAAACATACGCAAATTACACCGCATGTTTACAAGAAATATGC
TAAAGAATTGAAATTGAGTGAGAAACAAATCCGATGTTGGTTTACTAAGCGCAGAAGGAGTGATAGAATGCACAAGAATA
AAATGAAAATGGAAAAATTTAATTTATAAATAAAATTATGAAAATTTACG
>SMED30010910 ID=SMED30010910|Name=POU domain protein|organism=Schmidtea mediterranea sexual|type=transcript|length=3203bp
TAGGGCTAAATGTAACGCTACTTATCGGTATTGCCACAATTATATTAAGGCAGTGGCACAAACTTATTTTCTCTACCAGG
CCTGCTGAATCGACAAACAAACATATTCATCGTCATTAAATGGGCAGTAGTAGTAGAAACACAGTGGTAAAGACATGGCA
AACACAGCAGCATCAGTGATAGCTGGAAGAGATAGCTACAGCATCAGCAGCAGTAACTCTCGCAGCTAATAATGAAGATA
ATGAGCTAGACTTAATTATCTTGGCTAATAATTTCAAATAAAATATCGCAACTAATTTTGTCATTCGTATTCTGTGAGGA
TAAATCACAAATTTGTTTCGATTGTTGGAAATTTAAATTTTTTTCCCTCGTATTTTCCAAATACTCCAGAGTTTGAAGAG
TATAATGAATTTGTTACCGAATCCGTTACTCACAAATGTGCTGGATATGACTAAACTTGACCAACAAAACCAAATTATCT
CGTGTGGCAATTCGACAAATTTCACCAACAAAAACACAATTGACAGCTCTTCAAATGATACCACACAAGTCAGTTCAACA
GCCAACAACATCAGTTCAATTGAACATTTCCTTTCATCCCGCAATTTAACAAATCAGCTGATAAATAATTCCGGACTCCC
ATTAGGGGCACAGATATTCACCATTCCGGCATCATTGGCGACATTCCCGAATTCGGATTTGATTCCAGTATTCATCAACA
GTTTAGGACAAATGGTTCTGGCAAATACTGGGAATATTCTGGCGAACAGTTTGGCAAGTTTGGCCACCACACTCACGTCA
ATCCAGCAGCTGTCCGTGAACCGTGAATCGAATGTCATCAACACTAATCAAACTACTAACCCAAATGCAGCTATCATAGA
GCACATGATGCAGCAATACCAACAGCTTCAGCTGCTGAAGAACTCAATGATCCATCAATCATGGCCGAATGAGTTCCAGC
AGACATCCTCAAACAACCAAACCAATTCATTTATTGCAAATAATATACCAGTAGCAACTACAAATTCTAGTACAATTAAA
CCCATAGATAAAGTTAATGGCAGTACGCAATTCCAAATTCCGTTGAATTGCAATCCTGCTCCTCTTCAAAATGAAAAATT
TACTACCAATATCATCTCCATAAATGATCGTGCTATAGATAACAAATCCCCAAGCGTCAACTCTTCGGTATCCTCTAGAT
CAGTAGGAAACAAAATTTGTCAAATGATTGACGTCAGTCATGATTACATTTTAAGTCAAGAAGATCATCTGGTGAAAGAA
AAAGCCGCAGAATTACTCCGACATTCACACAACCAAAAAAACGCTATCAAACATGCCCAATGTTCTGATAAATCAGAACC
AACAGCACATAATGTCACAGTGGATGGTGTTGATCTCGGTGAAATCAAAGAATTTGCCCGTAATTTCAAAATTAGACGTC
TCAGCATGGGGTTAACTCAAACACAAGTCGGTCAAGCGCTGACTGCAGCAGAAGGTCCGGCATACAGTCAAAGTGCAATC
TGCAGATTCGAAAAGTTGGATATCACACCGAAATCGGCTCAGAAAATTAAACCAATTCTAGAGAAATGGATCAAAGAATC
CGAAGAAAAATATCTCAGTGGATCGAACAGTGTTGATGATGGATCCGGATCTGACATCAATAAAAAACGGAAACGTCGAA
CGAGTTTTACACCACAAGCACTGGAAATTCTGAATATTCATTTTGAGAGGAAATCTCATCCGACTGGATCGGAAATGCGA
GCATTGGCTAACGACCTCAATTATGACAGAGAGGTCATTAGAGTTTGGTTTTGCAACAAAAGACAAGCGTTAAAGAATTC
TGCCAAGCGAATTAAACAATGTACACCAAACAGCGAATCAAACAACCAGCACATATCTCCCCAAGTCATGAACAGCAACA
GCAACAGCAACAACACCACCATCACCAACCGGGCAGTCACCTAGGCCAAATGCATCCATCCATGATGGACATGTATCAGC
CACACGCGTTCTCAAGACCCATTACTGCTGAATACCAACAGAGTCTCAATCGGCAACAATATCGACGCAGCGACAGCGAT
TGTGGAACTCATGAGCCTGGATATTCGTACCTGCCGACTCCTCATGGGCCAGAAGTGGTGTCATCTCGTCAACATACTCT
CAATAGTCTTCCAGAACAACCGATGGACAATAACAATCATGATCAGCATGATTCTCCAGTACCGATTATTGCCAACAGTA
GCAACAGTAACATCAACAATAACAACAGCAGTTCTGGTCGACATCATCATCGTCGCAAAACCAGATCTCGACAAACCAAT
AATCAAGAGCCGACATCACTAGAACGGAGCCAAGTAATGAAAAATCACAACGACATACCACCAATGTTAGCGCCACGGAC
AAAATTGCCGTATTCCGAGCATCAGGGAATTCATCGTCTATCCGCTCATGAAATGAATACCATTGACAGTCGTGACAATG
CTGTCAATGATTGCAATTCTGAATCCAATACCGCTGGCGCTGTCAGCGATAATTTCGACCCTCCTCTTCATACTCCGGCC
ATTACGATACCAATGAGTCGAAGTACCGCATGGATTGCAACATCGATATGAATGAAAATGAAGCAACTCCCAGTAATTCT
CTGTTGATTGAGAACCTTCCCAGAGTTAGAGATGTTTCCGAGTATGGAATACCTATAAACAATAACAATCACAACATGAA
ACAAGCTCCCGTGCCTCCTCTTAAATCGAATAGTCGACATAATCCTGTGCCTAACAACAGTTACGGTCTCGAGTGCAATC
CTGATTATTATTCATCTGCCACATCTAGTGACAGATCCGGTCCCAGTCCTCCCCCTAAATATGCGCCAGGAGTAGTTCTT
CCTGCCCGTGCTGATGAAATATATATGCGCGATCAAAGAGAAGGAATGTACTATCACGGAGATACTCATTGTTGATAATT
GTATTTCACAATTTCGTTTCATCGGGTGTTCTCGATTGCTGATACTCTATCTCATACCTTTCGATGAATTTCTGATCCCA
ACTGACAGTTGTACAATTCTTATCATCATCATCATCTTCCTCATCTTTTCATATTTTATCTAGTCCTACTTGCAATCTTC
TCCGTGTGCTCTCCACAGTGCGATTATTATTATAATAATAAATTATTGCTATTGATTATTATAATTATTGTTATTGATAA
TAA
>SMED30001958 ID=SMED30001958|Name=POU domain protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1820bp
GAAGATTTCAACCAATTTCATTGTTAAAATTTTCATAAAATCGCCGTAATTGGCTGTCCGTTGCGGCAGTGGCAGTCAGG
CAACTCCGTTCACTCAGCAGCCAATAAACTCGTTTGGAAATATTCCTACTCAAATCAAATTGATTTCTCATAAAAAAATT
TGCATATCTTCTCACTTTTTCTATATGCATTTCATTGTTACTTGGTGAAAACTGAATGCCATGACCCAAGTTAGTCACAT
AGGTTCCTCTCATTTCAATATTAATTCTTCAATCAAAACTGCTCTTCCTTTAATTAATTCTCAATACAATTCATTGGTAA
CCGAAACATCTATTGGTTCCAACATCAACCTACCGTTTCGACTCGATGCTCCATCTCTATTCAATGGGCTACCGGAAGAA
TGGGGTCCCACTGACAGCGAGTTAACTCAAGCGGTCAATCATGTAAATTACGCCGGATTATCCGAGTCGAGCATTGATTA
CAAGTTTTGCAGCACTCTCAATTCTTATTTTGACTCAAATCAAAGATTTGGAAATGTACCAAACGACACGTATTTAATGG
CAAATTCCATGGCAGCCAACATTGAGAACAATAGCTGGCATAACAGCCGATATTACTTCGACAGTAATCATCCTCTCAGC
CAATGGCTCCCGGTGCCCGTTAACTGTTGGTCCAATAACAATTACATTCGCGATGACTTTTACGAGAAATCTCTCCAGGA
AGATGAGTTCAAATCCCGCTCGGTAATACAAGCAACTGAGAAGAATTCCAATCCGGTAAATCCCGACCTGAATCCTTACA
AATCTATCATTTCCGATGAATCAGAAAGCATGAAAATGGCTAAAACCTCCCACAACCTTATAAATAATGACTCGATGAAT
ATGTGTAGATTTCCTCAAAATGATATTATTATGCCAGATTTAATAAATGCCCCAAGTCCATCACTGACAAATAATAATAA
TAATAATAAAGTAATAAATAATTATTATATAATGAAAATTAATATATTAATAAAAAATATTTATGCACGGTCTCAATTTA
CATCTAAATGCCATCAAATTTGGCAGGGATACTTCTAATATAAAACCTAGATCAGCTGAAAGACTTTTATATTAGATAAA
TAATCGTTAATAAATAAAACCCAATTTGCGATAAATTATGTGTGGCCTCCAGGCGGTTCCTATCAAATAAACATATGTAA
TTATACGTGTAAACACGTGCATTAAATATCTTCACAAAGTCAAATGAGTTGATTGGACAGAAAAATTAGAATCGGAACTA
ATTCTGCAATCATTCAAAAATTTGAGCTAATCTTTATTCTTTAAAAAGCAGAGAATCAGCGGTTCTTTACATTCATGCCA
GTAATGAAAAAAGTAAACCGCAAATGACTTTTATTACTGTTCTAGTAAATGCATCCCCATAAGGAGAGTAATTCACATAA
AACTTTAATTGTCAATAAAATTATTACTGGGACATCAGCGCATCCTGGCATGCACCGCAGCAATGAAAAAGTAGACCGAG
AAACTCTGAGATTATTGAGCCATCAAACGTATCACTCATTTTCTTATGTTTGAATAAAATATTTACAAATTTTAATACAG
AGATAATCGATGGAGGAGGAACACTACTATTTTTGCTATCTATAGCAATCAATAATTATGTGAAAATATAGCTGATCAAA
ACAAGATGCATTAAAACAATTTTACTTCCTATTATATACGTTTTTGAATCCTGAGTGAAGCCAGTCGGGTTAACGAATAT
TATTAAAATGAAAATAACTATAAATCAATAACTATACCTCATCACATGATGAATGGTCCA
>SMED30021108 ID=SMED30021108|Name=POU domain protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1667bp
TTCTGGATTACGAATAGCCTATTGCAATTAATAACCGAGTTTTTTTCAAGATTGTCCTACAATGATCATTAAATAAAAAT
AATCCACATGAGTATATCAGAAAATAATAAAGAAAAAGATATTATTTACGGCTTGGAAGCAAAGCATATTGTAGATTTCA
ATGTTGCATCTCATTTAGATGAAGAACAAGACGCAATTTCAAAATCTATTGGGCGCAACCAAAAAACTGATAAACACTCT
CAGTCGTTAAATGGGAAAACTCCCAATGAACCACTGGATCACAATTCATATATCAAAGCCTATAACGATGCGCTGTTTGA
ACAGCGGACTAATTTCAATGGTTTGAATTCAGATTTAAGCTATTCATTTTTATCTCAGTATGGCTATAATAATGATGAAA
GAATGGATTTTACACCGTATTCTTTGCCAATTGATATGATTGAACAATCTTATAATTCCTGGTCTAAATCTAACGCATGC
ACATTTACAGAGGCGCATCTAAATTCACCTTGGTACAATCATTATCCGTATCCAGGATATGCATCATATAATTCTTATAT
GTGTAATATTCCACCGGTTGCAACTTCATCTATCAATGATCAATCTAATATGAGTTTTCCTAATCATCCAGCATTCTCAG
ATCTGGAAGAGTATGAACAATTAAAACAATTCCAAGCAAGTAATTATTCTGTATTTCCACAAGATTCTTTTTTAAATCAT
TCAATATCAACTCTAATGCCTCCGTTAAGGAATTCTCAAAGCACCACCCCTTTCAACTCAATCAATCCATCATCTCATTG
GTTGGATGTTAAAAATTGGCCGAAATCTGCCTCTCAATCAGATCAATTCGATCAAAATTCATTGAAACGTCAAATTGATC
ATTTTCCTTTGAATATCCCAACGGCGTTTTCTTATCAATCATCCAACTCAATGTCCCTACTCGGCTCTCAACAGCCAGAA
ATCAGTAAAGATCTCTTTTTGTCCGATTCCATAATTGAAAATTCAAAACTAAGCACGATGGACTGTCGAGAATTGGAACA
ATTTGCCAAGACTTTCAAACAAAGACGAATCAAGCTAGGATTTACTCAGGCTGATGTCGGTCTGGCGTTGGGTACGTTAT
ACGGGAACGTATTCAGTCAAACCACAATTTGCCGATTTGAAGCATTACAGTTAAGCTTTAAGAACATGAACAAGTTGCGA
CCGTTATTAAGCAAATGGTTAGAAGAGGCTGATTTGTCCTTGTCAAACACAGTCGTGAATGTAGAGAAATTAGCGAACCA
AAATCGACAAAGAAAGAAAAGAACAAATATAGAAATGAATACCAAAGATATATTGGAATCAAGTTTCAATAAAGATCCAA
AACCAACTGCTGCTCATATTATATCATTGTCAGAGAGAATTTTAATGGATAAAGAAGTAGTTCGGGTTTGGTTTTGTAAT
AGAAGACAGAAAGAAAAAAAATCCAGTTTAACCAAATCTATTTCCAGTAGTTAATACAATCTTTCCAAAAAGAAATTCTT
TTACAGATTCGACGTTTTATTATGGAAATGGTGTGAATAAATAATTTCTTCCCATAAATTTTGCCGGTTTTCTAGCTTGT
ACAGATAAAGAAAAATACCCGTTTTTACATTTTCCTAAACTTAAAATATTCAACATTAATTTTGAAC
>SMED30015552 ID=SMED30015552|Name=POU domain protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1696bp
TTATTTTTAAAGTGTATCTTAATATTTCAAGAAACTGTATTATAAATTTCACAAATTAAAATATTTGGGATATTTGTAAA
TTGTTAATAACTCTTCATAAATGTCTCAATCAGATGGAAATTTCAACTCCTTTAAAAATATTCACATTGAACAGTTATTT
AAAATTATTCAACACCAAGCAGAACAAATTGAAGCACAAAAAGTTCAAATAAACGCTTTAATAAAGTCACAGCAAACGAT
ACTAGAAAGTATGAGACCTCAAAATGATGCAAGCGTCAATTTAAATCCTTTGTCAATGAATTACCTTAATCACAATATCC
GACAATCTTTGTTGAATTCTTCCTTAATGCCTTCAAAAAATATTTTAAACAATCCCTCATTAAATTGTGCTAGCAACAGC
AACAGTAACAGCAGCAACGTCATCATCAACAACAACAACAGCAATATTGATGTTTCAGACCATTTTCTTCAAGACTACAA
TAGTCGATTAACACAACAAATTCTTCTTCAGCCTTCCTTGAATATTCCTCGCTCAAATCCCACAATAAAATCCCCTCATT
TGCCAACGAATATTGGAGGCTCAGGAAATCTAACTCCCACAACTTGTCTTAGCAACGAAACATCTGAATTGAGACCCATG
GAAAATTGGTCCAATTTTAAGTTGCAAGCTCATTCCGATACTCAAAACGTAATCAAAAAAGAAGTAGCAGATCAATCAGA
CAATTGTAACAATTCTGAAATTCCAATTATCGAAAATGATCCAAATGAAGATGAAGGAGAAATGGATTTGTCATCTCTCC
AAGAGTTCGCCGCAAAATTTAAAATGAGTCGTATTGAAATGGGATTCACGCAAAGAGATGTCGGTGTTTGTTTGGGTTTG
ATGCAGGGCAACGATTTTAGCCAGACCACACTGAGTCGGTTTGAAGCTTTAAATCTGAGTTATAGGAATATGAAGAAACT
GCAACCGTTGCTACAAAGGTGGCTGGATGATATTCAACGAGAAGGTCGTGATGCCGTTATGAGTCGCATAACGGCTTTTT
ATCAACAACAAAAAGCGATGGTGGAGGAAGACTGTGATAACAATGACCTCCAAATAGTCAGTGGCTCAAGTAGGAAAAGA
ATTGCAAATGAAGGATTGCTAATATCCGACGAGTTACCCGAAGAACGACATTCAGTCAATGCAGATTCGACTACTATGAA
TTCCAAATTATCACAAAATCAATTACTTCGCACTTGTATAGGAAATATATCGAATAGTCTTTCACCTAGTCTGCTCGGCA
ATTTGACTAATGGGTTTTCTACAAGTCTTTCCACCTCGCTCCCAACTAACCTCACTCACAGTTTTCCGAATATTCAGTTT
CAATCTTCATTACTCCACGACCAAATCGCCAACGGATTCAACAGAAATCTTTCTTCCCAACCAAAAAAACGACGTAAACG
ACCTCTAATATTGGAAGAAGGCAAATCAAGATCGGAATTGTTTCCCGATATTTTGAGACCGTAATCAGACCGGTGGAAAA
GAATCAAAAAAACAACACAAGTTCTACGGCTATTTTATTTATTTTCGCCATTTCTCGCATTGTAATATTTTGTAATTATT
AATATCCTATCTATTGTTTTATAAAATCATATTTTTTTCAAATTGAATTTTTTATTATTTTTCATTTTTATTGACCTGGT
TTGTGAGTGTTCGGAA
>SMED30002016 ID=SMED30002016|Name=POU domain protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1339bp
GTTGAATTTTTCAAAAACCAAATTTACTTATTTTGAATTGCCATAATGGAAAATGGAGTTGCAACAAGCTGTTCACTTCT
AGCTAATGGTGGATATCATAACTCTGCCTCCGTCGGTTGGAGGTTTCCGCAGAACAATTCAGCCAGCGATTCCGTTGAGA
ACGAATTTATATCAAATGCAAATCTCAAAATTACCTCTTCGAATATTCCAAACTTTTTTTACCAATGTCCGGAAAACAGT
CAATCAACGAGCAATTCTAACGGATTTTATTCAGTGGATACGAATTGCTCGGCTGGATTCCAAGACATGAATACTTACTA
TTCAAGGGTTGCAGCAGGCTTCAATCAATCCTTCGACTTGATACCTCAACACCAGTCTTTTGTGAGGCTCAATTCAACTG
GGCTATCGGAAACTGACCAAATGACTTATATAAATCCAAATCTTCATAGTTCATTTCATCGAAATATTTCATATCCGAAT
TACGGTAGTAACTGTCCTCCTAATGTTAACATAGGAGGAGTTTCCATGGTTCAAGGGTCTTCGTCATCCTTTTTAGGCTC
CAATTATTCAGGCATGCAACAACCAATTCAAGCCGTGAATCAAGGTGACATTGAATATGAAACCCGAGAATTAGAAGCTT
TTGCTGAATGGTTTAAACAAAGAAGAATAAAACTGAGAGTGACTCAGGCGGATGTTGGCCGAGCTCTCGGGAATTTAAAA
TTAGCCGGTGTTGGATCATTGAGTCAATCAACAATTTGTCGGTTTGAATCACTAACTCTCAGTCATAACAATATGATTGC
TCTTAAGCCAGTTTTGCAAACCTGGCTCGAAGACGCTGAAACCGAAGCTAAGGAAAGATTAAATGGCTCTGATGCTTTCT
CTGACATAGATGAAAGAAAACGCAAACGAACTTCAATCACAGATTCAGAAAAACGATCACTGGAAGCATTTTTTACGATT
CAACCACGCCCATCAAGCGAGAAAATTATCCAAATTGCGGAGAAATTGAATTTGAAGAAAAACGTTGTTCGAGTATGGTT
TTGTAATCAGCGCCAAAAACAGAAACGAATGAAGTTTTCCACTCTCGGTTTTCAGCACAACTCGTCAAACATGTGAAATC
CTATTTCTGTACAGGACAAATACCAAGCATTGACCCCTCTGTCTTATTACAAAAAGTGGTATGATTAAAAGTAGAATAAA
AATGATTTTTATTATTTCTTGACCGTAGCTTTTGTTTAAATTGTTTGACTTCATTTTTACGAAACTGTTATTTTTCCCAC
TGGACTGAGTCTTAGGTTCAAATGTGAGATTTGAGGTTGAGCTTTTGCTGAGAATGACA
>SMED30030379 ID=SMED30030379|Name=POU domain protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1625bp
AATTAGCTATGCGAGCTGCTTTATCAGGCATGACTGTGATAAAACTGTCATTATTTATGCGCATAATTTGCCGTTAGTAT
TTGCTCAACCAATTTGACGTTCAACAACAACAGCAACAACATCCACCACCTCCACCAACATCCTCATTATCATTATTATT
ATTGTCATGTTAACAAGCGGACTTAATCAGGAACAATCATCGCCTTTAACAATCGTAGGCATGAGTGAGTCTCAGTTTTT
CAACGAATCTATCAGATATTTGCCTCCGGAAACCGTGGAGAGACAAAGCCAATTTTATGCAAATAATAATTATCCCCTTG
GTGAGTTTTGGAATCCACAATCCGAATATGCACAATACTTGCAAAATACCCAGCCAGTCTCGGGGCCTCAATTCATTACT
TCGCCGGCGGTTGGAGAGGCATTCTATCCATCTCTTTATATCAATACTATCCATGAAAATGTATTACTACCTTCGGTTGA
TTCCTTCAATCCTCCCAGTGGATTTATGATTTCGGGATATTCACAGCAAGACCAAACCTTTCCCACGGTCAATGAACCGA
CGTATGACAATATCCCAAACAATTGGAATTATGTTGATCATTGGGTTGATTCCAAGCCAACAACAGTGAATTCTCAGCTG
TTGCCAACCTCGTCAATTTCCGCCGTCCCCATTCAGAATTCGTTTTGGGACTGCGAGTCGATTGACCAATCAGAATATTG
TCCCACAAATGTTGATACCGAGCTCCAAGATCAAATTGATTCCAACGGAGAAATCAGTAGACTCAATCAAAAGATTTCTA
CTGACGAGTTGGAGCAGTTTGCGAAAATTTTCAAACAGCGAAGAATCAAACTCGGATTTACACAAGCCGACGTCGGGTTA
GCCCTCGGTAATTTATACGGCAGCGTGTTCAGTCAAACAACAATTTGCCGGTTTGAGGCACTGCAGCTCAGTTTTAAAAA
CATGTGCAAACTTCGACCTCTGTTAGGGAAGTGGTTGCAAGAAGCCGACTCAACCGGATGTGCTCCGTCCGGTATTGACA
AAGTCACAGCTGCTGGACGAAAACGAAAAAAGCGAACCAGCATTGAGGTTGGAGTGAAAAATGCACTGGAATCTCACTTT
TCTCGACAAAGCAAACCGACAGCCCAAATCATTACACAGCTTGCAGACAGTCTCGGATTGGAAAAAGAAGTTGTCAGGGT
ATGGTTCTGTAATCGGCGACAGAAGGAAAAACGAATGACGCCTCCGCCACTGAATGGAACAAGCTCAGATTTATTTCCAC
ATCCTGGTTTAACTGTCGGAACTGATAGTTCTCCTCATTCCTCATCTCACAGTAATCATGATTCATTCTCGTCCATTGGT
AACCAGTCAAGCTTCAATCGAATAGGTGATCCCTCCTCGACTCATCCCGGAGTCATTGTCACATCTTGCGGTTATTACTA
TGGTCATGTTCCAAATGAATCACTTCTCAATTGTGGGCCTTACCCTCACAACATCATCAACAATTACGAATTCAGACAGT
CCAATGATCCCAATATCCTCAATGTCAAATCCGAGTGCATCAGCTGACTCATGTCGAACTCACCGAAAAGAAAGCTAATA
ATATTCTATTTCAATAATAATAAAA

 

back to top



PAGE: Planarian Anatomy Gene Expression

These transcripts were reported as being expressed in protonephridial progenitor cell. Click this link to learn more about PAGE.


PAGE Curations: 14


PLANA TermReference TranscriptDescriptionGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
protonephridial progenitor cellSMED30005620Homeobox protein SIX1SMESG000005975.1 SMED30005620smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridial progenitor cellSMED30013498LIM zinc-binding domain-containing proteinSMESG000072162.1 SMED30007001smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridial progenitor cellSMED30006365SMED30006365SMESG000006920.1 SMED30006365smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridial progenitor cellSMED30001601Zinc finger-like proteinSMESG000026829.1 SMED30001601smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridial progenitor cellSMED30000756EGFR-5SMESG000044603.1 SMED30000756smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridial progenitor cellSMED30007001SMED30007001SMESG000072162.1 SMED30007001smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridial progenitor cellSMED30014702SMED30014702SMESG000069780.1 SMED30014702smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridial progenitor cellSMED30031524SMED30031524 SMED30031524smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridial progenitor cellSMED30025647Ig-like domain-containing proteinSMESG000079961.1 SMED30025647smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridial progenitor cellSMED30024150C2H2-type domain-containing proteinSMESG000004456.1 SMED30024150smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridial progenitor cellSMED30030379POU domain proteinSMESG000076173.1 SMED30030379smed_20140614PMID:29906446
Zeng et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
protonephridial progenitor cellSMED30030379POU domain proteinSMESG000076173.1 SMED30030379smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 7 colorimetric in situ hybridization evidence
protonephridial progenitor cellSMED30030379POU domain proteinSMESG000076173.1 SMED30030379smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 8 colorimetric in situ hybridization evidence
protonephridial progenitor cellSMED30030379POU domain proteinSMESG000076173.1 SMED30030379smed_20140614PMID:28072387
Davies et al., 2017
whole organism Stage 6 colorimetric in situ hybridization evidence
Note: Hover over icons to view figure legend

 

 

back to top