Stage 5

▻ Planarian Anatomy Ontology Class Overview

▻ Additional Class Information

  ▻ Description

  ▻ Figures

  ▻ In Situ Hybridization Data

  ▻ Sequences

  ▻ Download Supplemental Table




Planarian Anatomy Ontology Class Overview

For more information about the ontology visit PLANA Overview


NAME:

  Stage 5


DEFINITON:

  A stage of Smed embryonic development defined by a unique gene expression signature and morphology, 5-7 days post-egg capsule deposition at 20˚C. Organogenesis onset. Downregulation of early embryo enriched transcripts and birth of adult lineages within the blastomere population. Early embryonic gut formation continues. Yolk ingestion into the gut cavity.


TERM CITATIONS:

Expand publication list

TERM ID:

  PLANA:0000005


ABOUT THIS TERM:

Stage 5

  ↳is a embryo stage

  ↳specific_to embryo


Expand to see terms that existence ends during or before Stage 5


Expand to see terms that existence starts during or after Stage 5

  → Category 3 cell
  → epidermis
  → gut
  → Category 2 cell
  → Category 4 cell
  → pharynx
  → neoblast


DEPICTED BY:


COMMENTS:


BROWSE PLANARIAN ONTOLOGY TREE (IN OLS):

Click on the '-' and '+' to collapse and expand term 'is a' and 'part of' relationships.



EXPLORE ONTOLOGY GRAPH:


Dynamically explore this term by selecting additional relationships to display (checkboxes on the right). Expand nodes by double-clicking on it . Single-click on a node to display the definition below the graph.

 

back to top


Additional Class Information


All experimental data displayed here is from Davies et. al., 2017, Smed Embryogenesis Molecular Staging Resource


DESCRIPTION:   

Spherical embryos continue to grow via yolk ingestion, reaching maximal size by the end of Stage 5 (~400-800 µm in diameter). Blastomeres fill the parenchyma, forming a dense collection of cells blanketing the sphere. Yolk-laden gut cells generate a continuous, honeycomb-like lattice encircling the central ingested yolk mass. Many early embryo enriched transcripts expressed in S4 blastomeres are downregulated during S5. Progenitors for many of the definitive organs, including the epidermis, nervous system, muscle, gut, pharynx, protonephridia, eyes and primordial germ cells first appear during Stage 5, marking the onset of organogenesis. Pluripotent neoblasts and adult lineage progenitors arise in the blastomere population during S5.


 

back to top


FIGURES:


Brightfield images of live Stage 5 (S5) embryos harvested for RNA-Sequencing (left), a paraffin embedded S5 embryo sectioned and stained with hematoxylin and eosin (middle), and heat maps for S5 enriched transcripts (right). Yellow arrowhead: temporary embryonic pharynx. Scale bars: 100 µm.

 

Figure 1 – figure supplement 7. Mean centered expression and average RPKM profiles for S5 enriched transcripts.Organized by cluster membership presented shown in the heat map and S5 enriched transcript excel file (

 

 

back to top


IN SITU HYBRIDIZATION DATA:


Smed IDAccessionNameAliasEnriched during stage(s)Tissue/PatternImages
SMED30023322Cathepsin LCTSL-likeStage 2, Stage 3, Stage 4, Stage 5, Stage 6embryonic digestive system, embryonic gut cell, primitive gut cell, embryonic pharynx
SMED30001900CUGBP Elav-like family member 3bruli-1Stage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8neoblast, blastomere
SMED30015313Cysteine-rich secretory protein LCCL domain-containing 2VAL-likeStage 3, Stage 4, Stage 5embryonic digestive system, embryonic pharynx
SMED30027428AFJ24799.1forkhead box A-1foxA1Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, digestive system, pharynx, pharynx progenitor cell, embryonic pharynx
SMED30007290AFF18488.1GATA456gata456aStage 2, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, gut, digestive system, gamma neoblast, embryonic pharynx
SMED30014940Gelsolingelsolin-likeStage 2, Stage 3, Stage 4, Stage 5embryonic digestive system, primitive ectoderm cell, primitive ectoderm, embryonic pharynx
SMED30018353Glycine amidinotransferase, mitochondrialAGAT-1Stage 5, Stage 6, Stage 7, Stage 8Category 3 cell, integumental system
SMED30033466Histone H4Stage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, neoblast, primitive ectoderm, embryonic pharynx, blastomere
SMED30005748AFF18489.1HNF4hnf-4Stage 2, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, gut, digestive system, gamma neoblast, embryonic pharynx
SMED30024865Intermediate filament b-like proteinvim-3Stage 5, Stage 6, Stage 7, Stage 8integumental system, Category 5 cell
SMED30028442Lysosomal alpha-glucosidaseStage 2, Stage 3, Stage 4, Stage 5, Stage 6embryonic digestive system, embryonic gut cell, primitive gut cell, embryonic pharynx
SMED30015696Macrophage-expressed gene 1 proteinMPEG1-like-3Stage 2, Stage 3, Stage 4, Stage 5embryonic digestive system, embryonic gut cell, primitive gut cell, embryonic pharynx
SMED30008639AAN03696.1MyoD-like proteinmyoDStage 5, Stage 6, Stage 7, Stage 8musculature system, muscle progenitor cell, body wall musculature
SMED30025388Myosin heavy chainDj-mhcStage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, musculature system, body wall musculature, muscle cell, embryonic pharynx
SMED30024586AFJ24746.1Pax6Apax6AStage 5, Stage 6, Stage 7, Stage 8nervous system, neural progenitor cell
SMED30025591ABW97518.1porcupine-like proteinporcn-AStage 5, Stage 6, Stage 7, Stage 8gut, digestive system
SMED30030379POU domain proteinpou2/3Stage 5, Stage 6, Stage 7, Stage 8protonephridia, renal system, protonephridial progenitor cell
SMED30035904AFP81697.1PROG-1prog-1, NB.21.11eStage 5, Stage 6, Stage 7, Stage 8integumental system, Category 2 cell
SMED30004304Proliferating cell nuclear antigenPCNAStage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8neoblast, blastomere
SMED30010115AFJ24744.1ribonucleoside diphosphate reductase subunit M2-2RRM2-2Stage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8neoblast, blastomere
SMED30030007RootletinH.2.8b, croccStage 5, Stage 6, Stage 7, Stage 8protonephridia, renal system, integumental system, Category 5 cell, proximal tubule
SMED30030681SMED30030681ZPUF-6Stage 5, Stage 6, Stage 7, Stage 8integumental system, Category 4 cell
SMED30026364ACN51391.1SMED-P53p53Stage 5, Stage 6, Stage 7, Stage 8zeta neoblast, integumental system, Category 2 cell
SMED30007406Q2Q5Y9SMEDWI-1piwi-1Stage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8neoblast, blastomere
SMED30014446Q2Q5Y8SMEDWI-2piwi-2Stage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8neoblast, blastomere
SMED30001362ACC97187.1SMEDWI-3piwi-3Stage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8neoblast, blastomere
SMED30019097AFD29619.1SOXP-1SOXP-1Stage 4, Stage 5, Stage 6, Stage 7, Stage 8neoblast, sigma neoblast, blastomere
SMED30035063AFD29620.1SOXP-2SOXP-2Stage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8neoblast, sigma neoblast, blastomere
SMED30022907Synaptotagmin-1Dj-sytStage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8embryonic digestive system, ventral nerve cord, neuron, cephalic ganglia, nervous system, embryonic pharynx
SMED30013909AHC00376.1tud-1tud-1Stage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8neoblast, blastomere
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top


SEQUENCES:

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30004304 ID=SMED30004304|Name=Proliferating cell nuclear antigen|organism=Schmidtea mediterranea sexual|type=transcript|length=907bp
CTAAAAGGTAATAATTTAAATTTAATTAGAACATTGTTTTAATATTCGGTTATATTCTCCATTATTCTAAATTATGTTTG
AAGCAAAATTAATAAAAGGCGAAGTTTGGAAAAAGGTTATAGAAGCTATAAAAGACTTAGTACAAGAAGCAACATTGGAT
TGCTCAGAAAATGGAATTAGTCTTCAAGCCATGGATACATCTCATGTGTCCTTAGTTAGTATGCTTCTTCGAAGTGATGG
TTTTGAGACTTATCGATGTGATAGAAATGTCAATCTCGGTCTTAATATAACAAGTGTTTCAAAAATTTTAAAGGCGCTTG
GTAGTAATGATTCCCTAACAATGAAAGCCGCTGATTCAAGTGAAACAATTTCGCTTTTGATAGAATCTGCAAATGAAAAT
GAATTATCTGAATACGAAATAAAATTAATGGACTTGGATGGAGATCACTTAGGTATACCAGATACTGAATATAAGTGCAT
TGTGAAAATGCCGAGTTCAAAGTTACAAAGAATATGTCGAGATTTAAGCCAAATTGGAGAAGCAATCACGATTTGTGTTA
CTAAAGATGGTGTAACTTTTGCTGCTGCTGGAGATCTAGGAAAAGGAGCTATAAAACTTAATCAAAATTCTAGTGCTGAC
AAAGAAAATGAAGGAGTAACTATTGAAATGACCGAACCTGTTTCGATGACATATTCATTGAGGTATTTCAATATGTTTAC
AAAGGCTGCACCTCTTTCTTCTCAAGTATCTCTGTCGTTGACTGAAAATGTTCCAGCAGTTATTGAGTTCATAATCGAAG
ATTTGGGATTTATTCGATATTACCTAGCTCCTAAAATCGAAGACGACGAGTGAAAGTTTAACTATTAATGTTGTATGTTT
AATAGATGTTATTTTGTTTAAAAAAAA
>SMED30017940 ID=SMED30017940|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=1165bp
CCTGATTGTGTGCTGTAAACAAATGCAACCTCACCGTATGTCATTATCATAATTGAAAAGATTTACGTATAAATTCAACG
TATTTTTGTCAAATTTATTATAACAATGAAGATCGTTCTACTTGCAGTATTTTGCGTTGTCTCGATTAGTGCTGGAAAAT
TAAAGTTTGAAGTCAACGAGGCCCTGAACGAGGAATGGAACATGTACAAGATCCAGTTCCAGAGAAAATACGAATCCATT
ATCGAATTAACTAGACGACTAATTTGGGAAGAAAATCTCAGATTGATACAGAAACACAATATCGAATACGATCTCGGAAA
ACATTCGTATTACCTCGGTCTGAATGAATTCGCAGACATGACCAACGAAGAATACAGAGTAAAGGTTCTCGGACTGAAAC
CAATAAACAAAAATTACACGAGAACAATTTTCCTGGCTCCGGAAAATACTGTCGATCTCCCTAAATCAGTTGATTGGAGA
ACAAAAGGATACGTAACTCCCGTGAAAAATCAGGCTAATTGTGGATCTTGTTGGTCGTTCTCGACTACTGGCTCACTAGA
GGGTCAACATAAGCGTAAAACTGGTCAGTTAATTTCCTTATCCGAACAGCAACTCGTAGACTGCAGTAAACCATTTGGTA
ATAATGGATGCAATGGTGGCCTCATGGATAACGCATTTCAGTACATTCAAAAAGACGGATTGGAATCGGAAGAAGATTAT
TCCTACACAGCAAAAGAAGGTAACTGTAAGTATGACGCCTCAAAGGTTGTTGCTCATTGCACAGGATTTGTCGATATTAA
AAAAGGAAACGAGAAAGACTTAGCAAAGGCTGTCGCAACAGTCGGTCCGATATCAGTGGCAATCGACGCCAGTAAACCAA
CTTTTCAATTATATAAAGGTGGAATCTATAATGAAAAATCATGCTCCTCCCGCCAATTGGACCATGGGGTCCTTGCAGTT
GGTTATGGGAAAGAGAACAATCAACATTTCTGGATTGTTAAAAACAGTTGGGGACCACAATGGGGACTTTCGGGGTACAT
AAAAATGACAAAGGATCGACACAATCAATGTGGAATAGCTACGATGGCTAGCTATCCTCTTGTTTGAGACTGCAATATTT
ATTTTGTTTTAATTTTATACATTTTATTTTATTTGTGAAAAAAAA
>SMED30026323 ID=SMED30026323|Name=Gelsolin|organism=Schmidtea mediterranea sexual|type=transcript|length=1381bp
ATTTAATTATGCTTATTTTAAACCAATCACATTTGGACTAGCGAACTCATAAGACAGACAAGCTTTCATATATTTATTAA
CATTTATTTCTTATTGTATATGAATACGGTTGAAGTGTTTTATTTAAACTAGATCTTTTTAGTATAGCTAAAACAAAATA
GAAATGGTAAAACCGAAAAAATATTCTTGGAAAGATTCTAATGTTGAATTAATAGGAACAAAGGAAGATCGTAGTATAAA
AAAAATATCTGCCGAAACGGAGAAAGCATGGGCTAAAGTAAAGTCATGCAATCATCCGGAATTATTTATCTGGAGGATAG
AGAAGTTCAAAGTAGTTGAATGGCCTATAAACCAATTTGGGGAATTCTATAATGGAGATTCGTATATCATACTAAATATT
TATACAAGAGGAAATGAGATTCTTTACGATGTACATTTTTGGATTGGAAAATATTCAACTCAAGATGAATACGGAACTGC
CGCCTACAAAACAGTAGAATTGGATAATTTCCTTGATGATAAACCGGTACAACATAGAGAGGTGCAGCATTACGAATCAG
AGTTGTTTAAGAGCTATTTTTCTCAATTAATTTATCTGAACGGTGGAATTGAAAGTGGATTTAGACATGTAATTACGAAA
GAATATTCACCAAGATTGCTTCATGTCCGTGGCGACAAACTAAAAGTCATTGTATCGGAAGTTGCTGCAACGAAAAGAAA
TTTGAACTCGGATGATGTTTTTCTGTATGACACAGGCACCCACATTTTTCAATGGATCGGAAAAGGTGCAAATAAAGATG
AAAGATATCATGGTCAGAGGTTTGCTCAACAATTGAGTTCAGATAGAAATGGAAAAGTAAAAATTGAAGTTGTGGATGAA
GATGACTCTTCATCAAATCTTATTTTTTATAATAAATTATCGGATGAAATTAGTGAGGATTGGGATGATGATAAACACTA
TAAACCTTTATGTGAACATGAAAAATTACTTTTTAGAATTTCCGATGAAACAGGAAAACTAAAATTTGAAAAGATAGGCA
AAGGAAATATTTCCAGAGCCCAAATAAATGAAGATGATGTTTTTATTATAGATAACGGACAGCAGATTTTCGTGTACATC
GGTGAAAAATCAAGTCGGGCTGAACGGCAAAATGCACTTATATATGCTCATAACTACCTAAAGGGAACGGAATATCCTCA
AGCTCCAATATCCGTGGTAAAGAAGGATCTGAAAGGAAATAGTGCTGAGCAATTCAATAAAGTTATTGGGGGCTAATCTT
TGGAATTTTCGTTTCATTTTTTTACTTTGATTAAAACAAACATTTCATACTTTGATTTTCATTATTGTTAGAAATTTACA
AAATCCTTTCTTTAAAAAAAA
>SMED30023018 ID=SMED30023018|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=1084bp
CCGCTCACATATTCCCGACCATGAAAGGAATGTATAAACTGAACCTTGATACCAAGCATACTATAAAACTCAAAGTAATC
GCATCATATTTCATAACATGAAGGCATTCATAATTTTGTCGTTATTCCTTGTTGCTATTGAGGCTGGGCCAAGGAGATTC
ACGGTCAACAGTGAGTTGAATGAAGAATGGGAATTATTCAAAACCAAATTTCATAAACAGTATGAACCGCTAACGGAGGC
TGCGAGAAGAATCATTTGGGAAGGAAATCTCGAGTTCATTAGACAACACAATCTTGAATACGATCTCGGAAAACATTCTT
ACACTTTGGGATTGAATGGATATTCTGATGTCACTGATGCAGAATTTAAGGCCAAACCTTTAGGAAACAGAATGAATGGA
TCAAACCCAAAAGGATCCGAATTTATAGTGACAGAAAACATTGGAGCTTTGCCTTCATCTGTGGATTGGAGAACTAAAGG
ATACGTAATCCTTGTGAAAGATCAACTTAATTGCGGGTCATGTTGGGCTTTCTCAGCCACCGGAGCTCTTGAAGGTCAGC
ACCTTCGAAAAACAGGAAAATTAATTAGTTTGTCTGAACAGCAACTTGTTGACTGCAATAGACCAAATGGAAACTTCGGA
TGTATCGGTGGTTTACCGTACCAGGCGTTTGACTATGTTGAAATCTCTGAAATGGAATTAGAGAAACATTACCGTTATTA
CGCGGAAGCCAAGAAATGTATTTATAATAAATCAAAGGTTGTCGCAAATTTCACTTCATATACTAATATCAAAAAGGAAA
CAATTCTGACTTGGCAGCCGCCGTGGCCACCTTGGGACCGCTGTCTGTAGCTATTGATGTCAGTAGCCGATGTTTCCGAT
TTTATAAAAATGGTATTTACAGTGACCTCCAACGTTCACAATATAACCGTTTTAGTCGTTGGCTACGGATCACTCTTTGG
GAGTAATTATTGGATTGTGAAGAATAGTTGGGCCCAAGTTGGGGAAACGGGCGATACATTCTCATGTCAAAAGACAACAA
CATCCAAAGTGGAATTGCTAGTCAAGCCGTTTATCCAGTTCTCT
>SMED30019097 ID=SMED30019097|Name=SOXP-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1596bp
GGAATAACAGCCAATTAGGGATCAGCTGCAATTTGGCCTATGATTGGACATTGATTTTTATAGTCTCAGGCGTTCTCAGC
TTACGTGTGCACCTTTTTAGTGGACACGTTAAATTTGATAGGTGCTTAGTGGTGTTGATTCCTGTTTGGAAACTGTATAT
AACCAAGGTTATTTGTTGCTTTGAGACAAATGCAACACAATCAAATAATTAATTATGCTATGTTCAAATTGTTCAAACAA
TCAGGATACTTTGAAATTATGGATGGTCCATTTAGCTTCTTGTCACCCATTACCTCCTGAATGGCTTAGTGAAAAGGCCA
AAGTATTAAATGATGACGAAAATCAGCGCCCCTATACAATTGTCACTGATTCCCGAAAAAGAAGGCGACGTCCAACCACA
CCAAGACCACTAAATACGTTCATGATTTTTTCGAGGCATATCAGACGAAATATTCTCTCAGTGTTTCCGGATGCATCAAA
TTCCCAATTAAGCAAAGAGCTTGGAATTTTATGGAAGAAAGTCACAAATGAAATTAAATCCCTTTATGAAGAAGAGGCAA
AGCGATTGGCTCAATTACATGCTCTTGAATTTCCCGATTATAAATATCAACCAAAGAAACGAGTCCGAAGATTTGGAAGA
GCGATTTATGATCGACAGCCCTGTACAACAGAAAGATCTAACTCAACTAGTGCAACAGACGAAGAAAATGGTAAAGACAA
TAATAGTGTTCAAGACGGTAGAAGATCAAGCGATATTGAGAATCAGTATATAAGATATTCAGTTTTGGGTAAAAATATTG
TAAAACGAGAATGTCAGTCCTTTAATAGTCCTTTAAAAAGCGACAACGTTAAATTGGAAACGCAAGAACAAGATTTTATC
CAAGCGATGCCCAAACCTCTAAACGTCCGAATAACGAATTACAACGAAAACAGTATATTTTTACGACAACAAAGATTACC
ATCAAGTAGCACAATGTATTTACTTCCTTCAGAAAACCTAATAATTAGTAATGGGATTATGGGATCACAGGACTTGGGTG
AGGATTATTGTAGAGAGTTGTATATAATTAATGATTTTTTCCCAGAAAATGTAAACATAGACGATGAAATTGATATAACA
GGAAACATTTTTAGCAATGATTTAGATTTAGAGTGGTCTGAAATTGATGAAAATTACAAACAAGATTTACCAAATCTTAA
TTCATTATTTCAACACTAATATATTTGATTTATAAAATATTTAAATATTTTTTATTAAACAGTCTTTTACATGTACATAT
AGTATTGGAACTCTTCTCTGACTTATAAGATAACAGAGATATTGTAATAAGATTAAATTGGTTATGTGTTTCGGTTTTTG
TAAGATTGGTAATTTTCAGAAGAATTTAGACTTTTTTCATGGAAATTGGAATTGAGAAACAAACTGAATAAAGAAACAAA
TTTTTGAAAAAAACGAAACAGATACTTATTATCAAAAGAAAATTATCTGAAGCATCGAGTCGGTATGAAAAATAAACTAA
TTAGTCAGAAAATTTTTGATGAAATAACGTCTAATGAAATTAAGATCTCCAAGGAATACTTTTTCTAACATTTGAT
>SMED30029163 ID=SMED30029163|Name=Histone H4|organism=Schmidtea mediterranea sexual|type=transcript|length=537bp
AGGTTACAGTTTTTCAACTAATACCTCAAAGAAATAATGAAAGATGGACAGTAGAGTTTTGTCACCATCAGGAGACCAAG
TGTCATTTAGGATGATAATAGCCCAGTTAAGGAATCTTGCTGATCTAATCAATGCCAAAAATATTACAAAATTTCGATTT
AAAAGAAGCTAAAGGAGAAAAATTACACGGAAAAGTTCAGAGGTACAACATCCAAGGCATCCCTAGGTCTGCAATTAAAC
GATTAGCACAAAAAAGAGGTGTGAAAAGAATTCATGGGCTTATTTACAAAGAAACAATATATGTTATCAAGTTAGTCCTT
GAAAATGTCATCTTATATGATATTAAATACACATTGCAAGCCAAGCAAGAAACTTTTACTGCCAAGGATGTTTTTAATAT
TCTTGAATGTTTGGAGTTTTCTATTTTGTGATAACATCCTTCCCCAAATGAAAGTTATCAGATCATTTTGCAAAGTTTGT
GAGAAGGGATATATATTTACCAACAAGAAAAATGTTTTGAATTTAAGAATAGGACTC
>SMED30028676 ID=SMED30028676|Name=Synaptotagmin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1385bp
AAATCAGAAAAATCAAAAAGAAATTTCACAGAATTACGGAACTTATGAAACAGTGAGCAAAGCGCCGCTGGAAATCACAA
TTACAAAAGCAGAGGATAACGAAGGGGTTTCAAATAAAAAAATAATCCTTCAAGATGACCGTCGATGTACTATGCCATGC
ATTTTACCATCGAGCAACAATTCTTCAGATGGATACTCGGAAAGCAATCTAAGTGTAAATGAAAGTTCTGTATTCTCTCT
TAATTCCAATAATCTTTTGCTTTCCGGTCTGATTTCTCCTGCTCGACGATACAGCGACAATTCAAATACGCAAAATTTCG
TTGAGTTACGAAAGAAAAGTGTCCGACCCGATAGATCAAAACGAACTTTCTTCATATGAGATACTGAATTTATACGGACA
AGGTAAACTATGTTTTTCAATAGTTTACAATGAACATATTTCTCGACTCTACGTGACAATAAACAAAGCAGTTTATTTAA
ACAGTTCCAAAACTAACAATCTGGCCGGATTCTATGTGAAAGTGTATTTATTAAATACAGAAAATGATATGAAATTGCAA
ATGCATAAATCGGAAATTGTAACTGCAAATAAAAATCCAATGTTCGAGCAAACATTTTCGTTTCTTTTAACAAAATCCTC
TTTAGTCAGCATAAAATTACAGTTCAAAGTCAAACAAGCACATATAAAAGTAAAAAAAAATGAATATCTCGGAGGATTCA
TGTTTCATCTTGATAATAATGAAATAATTAACAACCCGGAACTCTTTCAAGAATTATGGCGAGATCTGCGGGGCGACTTG
AGGAAAGACACCAGACGTGGAGAAATCCTCATTTCCCTGATGTACAGCGAACACCAATCTTCAGCTTTTCTATCAGTTAA
TCTGCATCGAGCTAAAAATCTACAAATTCGACAACATGACAATTCTGTTTTTGCCAGATGTACAATGTTGGTTGGAAACA
AACCGATCAAAACAAAGCGATCAATTACAGTAAAACAAGACATCTCTGCGCCCTATGTTGATCTTGAAAGTGTTTTCAAT
GTCGACAAATTGAACATCATGGAAGTCGGCGTTGTTATTCATATATGTAGCCGCAGCAAAATAGGTTTCAGTCACCTGCT
GGGCAAGCTGATCCTGGGATCTGTGATGTATACGGACGATAAGTCAGTCCTAATACACTGGAAGGACATGATCAGTTATC
AGAACAGAACCGTCACTAAGTGGCATACGATTATGTGAACATAAAATAACTTTAGACAATTTGTTGGCATGGATGAATGT
TTACAAATCTCATGAAATTAGCCGTTCATAAAAATGTGTTCACAGACTAATGGTAATTTTTAGGCATAATTCGACCATTC
ATTTAAAATTTCGATTAAATCATAG
>SMED30018353 ID=SMED30018353|Name=Glycine amidinotransferase, mitochondrial|organism=Schmidtea mediterranea sexual|type=transcript|length=1408bp
CAAGGGTAGTTTGATTATTTAGAAAAAAAGGATTTCCACCGGTTTTCTGTGATAAAAATTGTACAAAAATGCTTACCAAA
ATTGCTAGATCTCTGCACGATCAGATTTCCATAAACGTTGTCAACAAATTGTCAGCTAGGTTATGCTCGTATACACCTGG
TAACAAAAAACACAGCCCGGTTTGGGCCTGGAATGAATGGGACCCATTAGAAGAAATCGTTTTGGGACTTCCAGATATGG
CATGTTGTCCAGAGATTTTACCAGAAGCCAAAGCTTGCATTTCGGAAAACAAATTTGATTTCCTTTTAAAACACAAAGGA
AAATATTGGAAGGATGTAATTGAACCAGAACACTACAAAATAATGCTAGATGAGCACAAGAACTTCATAAAGATTCTACA
AGGAGAAGGAGTTAAAGTCGTCCATCCAGAACCGATTGATTTCGCTAAAACGCTCTGTACTCCAAACTTTACTGCCCATG
GAGTCGACTGTGCGATGCCGAGAGATTTTCTATTAATTGTCGGAAATGAAATGATTGAGTCCACCATGACTTGGAGATCG
AGATATTTTGAATTTATGTGCTATAAAAAATTAATTAAAGATTACTGGAGCCGGGGCGCTAAATGGACAGCGGCACCAAA
GCCGATGTGTAAAGAAACACTTTTTAAAGAAAATTATCGTGCTGACGAAGATTCAACAGCATTTTTCGATGAAAAGACTT
CGATTCTAACGGAAGAGGAACCAGTTTTCGACGCCGCAGATTTCATTCGATGTGGTAGGGATATATTTGCGCATGTCAGT
CAGGTTAGCAACAATGCAGGAATTGAATGGGTACGTAGACATTTGGCACCGAAAGGAATTAGAGTTCATTCAATGAATTT
CGTTGACCCTAAACCAATGCATATTGACACGACACTTTTCACACCTCGGCCAGGCCTCGCGATAACATGCCCAGAAAGAC
CATGCTTACAAATTGGTATGCTTAAAAAAGCCGGCTGGGATGTTGTCGTTGCTCCTTATCCAGATATTGCAAAGAATTTC
CCATACTATATCAGCTCTCAATGGTTGTCTCTTAATGTTGTCATGTTGGATGAAAACCGAGTTCTCGTAGAGAAAGATGA
AATTGGAATTCAAAAACTGTTTGAAAAGTGTGGCATTACTCCTGTAAAAGTTCCATTCAAACACTGCTTTTCCATAGGAG
GTGGTATTCATTGCTGGACATCGGATGTTAGAAGGCGAGGAGACCTTCAAAACTATTTTGACTGGCCTCAAGAAATCTTG
GAGAAATTTGAAACTCACTGAATATCACAATTGAAAATATAAAGAACATAACTTTTCCAACGTATATTAATTATTTGTAA
TAAAATACACTGCTTACATCGTGTCAATTTTATTTACTGATTAATTAC
>SMED30020396 ID=SMED30020396|Name=PROG-1|organism=Schmidtea mediterranea sexual|type=transcript|length=571bp
ATAAATATCACAAATATTTTGCTTAACCATTATTTGCAATATGAAATTAATTATTTTGATTATGTTTGCTCTGGCCATCG
TGAATGTCCAATGCAGATTCCGATACCGAAATATCCGAGATTTTGCCAAGAAGGAAGACCTCGATAATAAATGCAAAGAA
CTCAATGCAAAAGTCGACACGGAATGTGAGGATGAATATGAAGAGCTGGACAAATTGTGCGATCCAAAATATGAAGCATT
GGACAAACAATGTTTGCCGAAATATGTTCAAATCAATGCAGATTTTGCCAAGCAAGTTGTAAATGCAAATTTGAAATGTC
AAGAAACTCCGACGAAAGCTGGTCGAAAGGTTGTAAGAGATTTGGAAAAGCAGATTTTCGGCGATTACGACAAACTGGAC
AAGACCTGTGACCCGCAATATGCAGCATTAGATAAGGAATGTTTGGAACAATACCAACAGCTGGATAAGCATTGCCTGCC
ATTGTATGCACAACAGAAGAAATGTGAAAGGCGTTGAAATAATTGAAAATGTTGTGTAAAATATAAATATAAATTTCTGA
ATAAAAAAAAG
>SMED30020614 ID=SMED30020614|Name=ATP-dependent RNA helicase dbp2|organism=Schmidtea mediterranea sexual|type=transcript|length=2242bp
CTTCCGATCTATTTTGTTTAACTTTTTCTCACTTTTAAATAAATATTATTAATCCAAAATGTCAGATTGGTCTGACAATG
GAAGAGATCGTTCTGGAAAATACAATGGCAATGACAGAAGTGGTCGTCATGATCGAAGCGATCGTAATGATCGAAGTGAT
CGTAATGATCAAAAGGAACGAGGATTTAGAAGCAGTTATAGTGGTCATAATGATAAATATAGCAAAAATAGTAGAACCGA
AAGAAATGGATTTGATAAAAACAGGAAGGATAAATCTGATTGGAACGACAAATCCAGGCGATCTAGATCTCGTTCACCCT
ATAGTAATTATAGATCGAAAGATAACAAAAAGGATGAACAAACTTTAGAAGTTGTTGATTGGAAAACCCACAATTTAATT
CCATTTCAAAAAAATTTCTATAAGGAGAAAGCTGTTGTTTTGTGTAGATCACCAGATGAAGTTGAGAGATATCGTAAAAT
AAAAGAAATGACTGTTGCTGGGGATGATATAGCAAAACCAATATTCTCATTTAATGAAATTGATTTTGCTCCTGAAATAG
TGTCAGTGATTATTAAAAATGGATGGGTTGAACCAACCCCAATTCAAGCGCAAGGTTTGCCTATGGCATTAAGCGGTAAA
AATGTTGTAGGTATAGCGAGAACTGGTTCAGGCAAAACTGCCAGTTTCGTTATTCCAGCAATTGTTCATTTAAAAGCGCA
ACCTAGATTAAGAAAAGGTGATGGTCCCATATGTTTAATCATTGTTCCTACGAGAGAACTAGCTCAACAAGTACAAGGTG
TTGCAAATGATTTCTGCAAATCTTATGGTATTAAATCAGTGTGTTGTTATGGTGGAGCTCATAAAGGTGATCAGATTGGT
GAATTACGCAAAGGTGCGGAAATAGTAGTAGCTACCCCAGGTCGACTTATAGATTTACTAAAATGTGAAATAACAAATCT
TCATAGAACAACTTATGTTGTTCTTGATGAAGCTGATCGTATGTTGGATATGGGGTTTGAGCCTCAAATCAGGAAAATCT
TTAGTCAAATTAGACAAGATAGGCAGACCTTGATGTGGTCAGCTACTTGGCCACGAGAAGTTCAAAAATTGGCTCAAGAC
TTTCTTGGTAAATACATTCAAGTAAATATTGGATCTAGAGATCTGCATGCAAATCCTGATATACAACAGTTTGTTGAAAT
TGTCGATGAATATTCTAAAGATACAAGATTAATTGAAATAGTCAGGAAAAATGCTTGGGATAAAATGATAGTATTTACAG
AGACTAAGAAAAAGGCTGATAAGATTTGTGGATTACTTAGGTCTAGTGGTTTCAATTCCGGATCTATGCATGGTGATAAA
TCACAAAAAGATCGGGAATATATTTTACAAGGATTTAGGAATAAATCGTTGAATATTCTTGTTGCTACAGATGTGGCTAG
TAGAGGATTAGATGTTGACGACATTAAAATGGTCATCAATTATGATTTTCCTAATCAGTTTGAAGATTACATACATCGTA
TTGGAAGAACTGCGAGAAGTGGAAAAAGTGGAATGTCATATACATTTTTTAATAATAAAAGTGCAAAGAGTGCTTCATCA
CTTATTAAGATAATGGAAGAGGCTAAACAAATAGTTCCTGATAGTTTGTACAAAATGGCTTGTATTCCAAGAGATCGTCG
AAGAACAGACTTTCGTTTTCAACAGCCATTTTCTAATGGATTTTCTCAGCAGCAGTCAAATATATCCTCAATTGATTCTG
GTACTATAAAAAATCATTATACCGATTCGTCTAAGGAATATAATTTTGATAAACCTCACGTGACACCAGTTTCCCAGACA
AACGGAACACCACACAGAGTCAGTAGATTTGGTGATCGTATTACCCAGTTGCCAAGTTCTTTTACTTTACCACCTCCGAT
TGATAGTTTTGTTAATGATGTGCATTGTAAACCGGTTATACAACCACATCATCCTACTTCTAATGGAAATGTCAATGGTG
GTGTATATACGGATAATTTATCTGATTCTAATATATTTAACGATCCCAGATTTAATCACATGGCGTTTTACGGAGTACCT
CCTCCAATATTAAATGGATCTATTAAACCTTTGTCGTTTGAACGAGACTAGTGATTTTTCAATTTGTCATATCGTTGATA
TTATGAAATATTCGAGTTTTGTTTGACAGGTTAGTTCTTCAGTAATCATATTGTTTTTACGTAATAAATGTTGAGTTAAA
TG
>SMED30000746 ID=SMED30000746|Name=PROG-1|organism=Schmidtea mediterranea sexual|type=transcript|length=506bp
TGGATAGACAATTCAATAACAAATATCAACCATGAAATTGATGATTCAGATCGGACTTCTCGTGGTGTTGGCATTGATCA
ATGTCGAATGCGTGAGCAAGTCAAAGAAAGCTTTTGATTGCCTGACGATGTTGGATAAGATTGACAATGAATGTGACAAG
AGATATTTGGTACTCGATGGCCACTGTGACAGAAGTTACGCCGACTTACACAAGAATTGCGATATTAAATACGACCTATT
AAGTGGTCGTTGCAAAGGGAAATTATCAATGCGTTGCATCAGAAAGTACGGCAAACTCGATGGAAAATGCTTGGGAGCTT
ATGACAAGGTTGATTCCTACTGTGACAAAAGATATAATGTCTTGGACACTCATTGCGATGGCTTGTATAAGCTGCAGGAG
AAATGTGAAAATAATAGTTAGAAAAAGTTATGAATAATTCAACTGCTTGAAGACTTGCGATAATTTTTGTATTTGAATAC
AATTTTCTTTTAGGTCAAAAAAAAAG
>SMED30030681 ID=SMED30030681|Name=SMED30030681|organism=Schmidtea mediterranea sexual|type=transcript|length=732bp
TATGGATATACATATAATAAAAAGATTCTTCGTTTTTCTCAAGCTTCCAAGTTATAGTTTCGTAGTTTTAAAAAAAAAAT
TATTATACCCTATTACTAAACAAATAAAATTTTAATTATCTCAAAAACGAAATCCACATTTTAAAAAGCTATGTTTTTAT
AAATTTTGTGCACTTTCATTCGATCACATTTTCCATATCTCTGATAGATCGGATCGCATCTCAAGTGCAATTGATGTGCT
AATTTGTCGCATCTGTGATCGATAATTTCGAATTTTCTGTAACACCATTTTCTGATGACCCGGATACCTTGATCGAGTTT
GGCGTACAAATTATCAATCTCTATTCGACATGACTCAGTTTGAACGTCAACGCATTTGTGATTTGCGATTTCTTCCTTAT
ATTTCAAATGAAAATGAGCTCGGCGTTCATAACAGGCCTTGTGGAGAACATAAGCCTTTTCATCGCATTTCCGATCGGCT
CTGGCCCAGTCTCTGTCACATTTAGTGACAGCATTGTAGAATCGGTATTCGTGTTTGCTGCACTCAGTAACGATAAAAAG
AATAGCCAAAAATATTATGTATTTCATTTTCAAAATAAATTTTGAAAAAAAAAAAAAAAAAAGATAAATTTACCGTATTC
AGCGATATTTTTCTTTGGCATAGCATACATAATATTTTCCATTTTAAAAATGAAATAAAATGAATAAGCAAGTTGTTTTA
ATCAATCATTAG
>SMED30022586 ID=SMED30022586|Name=Synaptotagmin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1214bp
TCACCATCTTGTCTTTGATGGGATAGTTTGACTAATTTTTGGTTTTGATTGGTTCTCTTAATTGGGAATGCAAATTTTAC
GGTGCTTGCACTTATGACATGGCATTATTTGCAGAATGAGTTTTCAGAGGCTGTGTGGAGATATTATAATAAAACTTTTG
GAAACTTGTTGTTTTTGTTTTCATTCAGAAACTGAAGAAAAAGGGAAACTATACATCCACGATAGAACATCTCCAATGAT
TTTAAACCAAAAACCTTCAATTATGAATCAGGAAATAGAGATAAAAAATATTTCATTGAATCTGCAGACGGAAAATACAT
TAAATCCAAGAAAACAATCTCTTGGAGGCAATTTTCTTGTTCCAAATGCAGGGTTAAATGAAAAACTTCCTTCAGTAATT
AAAGTAAAACGACATTCGGAATCGGATTTGGGGGACATGAATTACAATTTTCCTGTTGAAATTAACCATAACCACATTTT
GAACGTTTTGTCTATTAAAGTTTTTCCAAACGAAAAAATTCCTGATAAATTTGATATTTCTGTGAAAACTAATGACAAAA
TCACCAAGAAAATAAGCTACTTTTACAAAGTTATTACATTTGACAATATAAGTGAAGATGATTTAAATACATCTTTCCTG
AGCTTGACATTTTATAAGAGAAAAACGCCAGATGATAAAAAAAGTTTCGGAGAAATAAAATTTCCTCTAAAGTTAATATT
GAAGAAAAAAATTCAAAATTCAATTAGATTTTACAATACAGATTTCAATTTATTTCAAAACAATGTGAAATTATCCAACG
GAACGCTTGAAATCGGTTTACGTTTTGATCATAAAAACACTCAATTAACGGTAAATGTTTACGAAGGACAGAATTTTTCA
AACCAAAATCAAACCCCTTTAAATACTTTCTGTGTCGTTGAATTATTTAAAACACATACCCTCTATATGACCTACAAAAC
CAGTGTCAAATTCAATTCGAATTGTCCGATTTGGAATGAAACTTTCATCTTTCCAATTAAGCTTGCCGAATTGGCTAATC
ATATCAAACTGATTATAACAGTCTACAATGAAAATGAAACGGCAAATCTACCAATTGGAAAATTGTTTTTCCCGTCTTCT
GAAATGGCATTGGAAACTCGTCATTGGAATGAAATTCATACAAATTCCAACCTACAAATCAGAATGTTGCATAGCTTAAA
ATGACATTTAAATA
>SMED30007290 ID=SMED30007290|Name=GATA456|organism=Schmidtea mediterranea sexual|type=transcript|length=2033bp
AGGTAAGTGTCGTCATCACAAGTGGCTTTATTATTATCATTTAAATTTTTTATCATATTATCATTGATTGCTTGTTTTCC
TCATTCAAAATTTAACTGATTGTTATCAAGCTCATTTGATAACTCCAAATCTAATTGACACTCATGTAAATATCCCATTC
GAATTTCCGTTCCCGTCCGTAAGATCCACGATCCGACAATGTTTCTCCCATCGGTATTGTCGAATTCTCACCAGAGAAAC
TCACCAATAATGGACATTGTATCACCAAAATCCAACACCAGCAATCTGAATGCGTTGATCACGTATTCGAATTGTCCCAA
CATAGATCTACAGTCGAATGATCTGTCAGTGAACTTGACGAATTCTCAAAACTTCCACGAATTGGATCACAAAACCAATT
ACGGATACAAAGTTTCAAACAACGAGACAAAACTGAATGCTTTTCCATATTTAGCTCAATCGAACTTAACAGATTGCACA
ACAGACATCAGTGGAGATCTGAAAAATCCAAATTCACATCTCAACTATGGAAACGGAATTTCGTTCTCGGAATTTTCGAA
AATGTCCGAAACCAACATCCACGGATATCCGCCATATTGTTTCTCCACTAAACTGTTTCCCATTCCAAATCTACAAGAGA
AATCAATTATCAACGACAACTATTCCGTGAAATCCACCGCCGGAGGCTTTATCACCGAATCGAATGAGCATCAAAACTCT
GTAAATACTGGAAATTCCTACAATTCCAATTTAAGCTCATACAGAACGGTAATTCCCGCTCATTTTCATCTCTTCAATCA
GAATTCACCAGAATCGAACTCGTTTTACAATACGGCTTGGAACAACTATCCGTTTCAAATATCCCCAACTTATCCCATAC
AAAATCTACCGGATTCAACAATCAACTGGACAACAAACAATCAAATTCCAAGCAGCAATTTAGTTTTTGATCCCTGGAGC
TGTAAATCAAATCTTAATCTTCCTCCGATTAATGAATTCGGTTCCAATTGCGATGTCAGCAGAGAGTGTGTGAACTGTGG
AGCTAGCAATACTCAGTTGTGGTCCCGGGATAATTCTGGCTATTATTTGTGTGATGAATGCGACAGGTTCTCTCAAAACA
ACAGTAGAAACCTCGAAAAACTACCAACGAATCAAGTCTCATCAAGTACCGAAAATGAGTTCATGAAAAAATCCAATGCC
AACTTTCAACAATATGGAAAAAGATCCGACCTCGAATGCAGCAATTGTAAAATTACCAAGACTTCTTTATGGAGAAGAAA
CAACGAAGGAGAACCTGTCTGCAATGCTTGCGGCTTGTATTATAAATTACATAAGTCTCTAAGACCTCTTTCAATGAGGA
AAGAAGGAATACAAACAAGGAAAAGAAAACGGAAAACACAAATGAAACCGGTTTCCACTCATATTGCCAATAATCAAAAG
GTGCCGTCTTCAGAATCGTCATCAGAACAAAATCAGTTTATAAACACTGTGAAATCAAGTGAAAATTGCTATAACATGAT
TTCTGAAAATTCTCCAACATATATGCCAAATATATCAGTCCAGCCCTTCAATCACATTCTGAACTCCAGCCAATATCAAT
TCCAATCTACAGAAAATCCCATTAATCAATCATATTTAAATTCCTCAATCAAAAACAGCAATCCCTTTTACGATTCCGAA
AGTATACTTTATTCCTACAACAATTCAAACAAAATCAAAGATGAGCCCCTATTATCCATGGACAACGAACCGAAGCCCTA
TTCCTCAATCAACGAGAAAATTGACGTCAACTCCATAGTGAGAATTAATGAAATCTCAAACAATTCGAATTCGAGTTAAT
TATTCTGATCTACTTTTTAATTATATATTTAAGAACCGTATATACTTCGAAATATAATTTTAATGATAAAATTTTATATC
TAAAAAATGTAATTTTTAAGTGCGAATTATTAAGTATGCATTTAAATAGTGCAATTATTGTGGTAGTTATTTTTATTACT
AAATAAATGTTGTTTGTAAATTCGAGAATTTGT
>SMED30023882 ID=SMED30023882|Name=Rootletin|organism=Schmidtea mediterranea sexual|type=transcript|length=6811bp
TATAAATTTTAGCAATCCATATCAACTGATATGAGATTTTCAATTTCGCATTAATTTAAAATATTTATTCAAGTCACACA
TCTTAAATCTGGTTTTATAAGAATCATAATGAGTTCCGCAAATAGAGACGAGAGATTGGAACAAGTTGCACAAAAACTGA
ATAAATTTACAGATATATTTTACCAGAGAGTGGAAAATGTTTTAGCTGATAGAGACAATCAAGGATACTTAAAATACAAT
TCCGGACGAATTGTAAGCAATACATCTCCTGGCATCGGCGGTTTCGACCTGTCAAACGGCGATAAACCCCAAAAAATGCC
AGAAGTTGTTAAAGACATCATTCTGAGAGATTTTGGTGACACTGATGAGGATGAAGATTCCATAAAGGATTTACGAATGC
CAAAACCAAACTCTCAAAACACTCAGTCAAGCAGTCGCTTACAAACCTACGGCAACGGATTAGATTCCGTAACTCAACTA
AAAGCAGAAAATGCTACTCTTAAAGATAGCTTGTTTAATGTTGAAGAAGAACTGTTACGATTGAAAAATGAAAGAGATAA
TCTAGCAATTAAATTCAATGCCATAAATGAAAAACTCAACAAAACATTTACAGCGGAAAAATGTGGAGATAGAAGAGTGT
CTAATGCCAGCGAAGAACTTAGCAATGCGAATTCTTTAGCATCACAAACGATTCAATTGAGAAAACAACTTGACGACGAT
CATCGGGAGTATAAACGCAAACTTGCCGCCCAGCACGATCACCAGATTAAGCAGGCAGAATTAATTAAAAGACTCCAACA
AAAATTAGAACAACTCGAAGGTCGGAATGGCTTAGTGGAAAAATTAAACCAACAGAATAGTAAGCTACGGTCTGAAATAA
GTCGGTTAAAAAACCATTTCCAAACAACAACTTCGGATTTAAATCGTCGAATTGACATTGCGGAAAATCATCTGAAATCA
GCAGAAACCGATAAAAATATGGATCTCGAATCAGTGGTTAATGAATTGAAAGAGGAACAGTCAAAATCTATGAGTTTGTT
GCAAATGACAGCTTTATTGAGAGACCAATTAGACGAAGCTACAAATGCAAATCAAGGCCTAACAGAGGACGTTCAAAGAC
TGTCAGAAGAAAATAGTTTCTTGAAAAGCGAATTAGAACAAAAAGACATGGATTGGAAAGACGATGAAGCCACGTTTAGT
CGATTCTTGATTGGTGAACAGAATCGCATTAAATCTTTGTGGAATGCAGTTGTAAATTTTAAAAGACAATTCAATGACAT
TAAATCGTCAAATGAACGAGATTTGCATCAGTTACGGGTTAACATTGAACAATCTACTCAGTCGTTACGATTAGCTTGTT
CAAATCTTGACACGAATCACGTAAACAGGTTAAGTCAATTACAGTTCCAACTGGATACAGAAAAAAATAATTGCTCCCAG
TTAGAAAATTCTTTATCCAAAATGAAAGAAGAATTCCGAAAAACTGAAACTCAATATCAAAAACAGATTGAATCATTAAA
TGAGCAATTTGTCCACGTCAATCGCTCTAATGAAAGTCTAACGAAAGAGCTTGCTGATAAAGAAAAAGTCCTAACTACTC
TCCACAAATTAAGAAATGGCATGAATGGAGATTTAGACAATTCAATATACAACAATGATGATTCTGCTACCAGACAGTTG
ATTATTGACACTGATGCTGTTCATCAAGCATTAAGGGATATCGCTCAACTTGTTATGAATGATGTCGATCAAGTTGATGA
CTCTCCATGGATGCAAGATGATTATCTGGACGAATCCAAAACCACGGGACAACTGAAACCAACCCTATCCATAAATAGTT
TGCATTCAAATAGAAGTGTGAGCCCAACTCGCCCATCGAAACGTAGCCACTTCAACTCAGGATCTTTAGACAGAAATCGC
GTTTATCGAAATAAATCTCCAGTGAGTATTGCTGATTCAACATGTGCAGCTGTCAGATCGGCTTTACACAAACGAGCACT
TCAAGTTCAAGATTTAACCAGCAAAATCAATTCCGCAAAAAATAATCACAATAGCGTCAAAAAACAATTGGATGACAGTG
AAAACGAGCGCAGAAATTTAGAAAAACAATTCATTGAATTGCGAAGTGAATACGATTCAAATCATCGGGAACTGGACGAC
ATTCAACGGGAATGTGAACGGATGCGACATACAATTTCAATGCTGGAAGAAGACAAATTAAAGTTGGACAAAAGTCGAAT
GAATTCTTATGAAGAATGTAAATCATACAAACAAGACATGGAAAAACTAAAGACTCTTAATTACGAATTACAACGCGACA
AAGAAAATCTAACAGATAATTGTCAAGATTTAGATAGAAATCTAGAAAGACAAACGAAAGAAGTGGAGAGATTGACGAAA
TCAATTGAAAATTCCGAAAGTAAGAGTAGTCGACTGAAAGAAGAAATTTCTTCCCTTAAAGAATCTTTAAATCGGGCTTT
ACTTGAGAAAGAAGTTTTAGAACAAGAAAATTCAGTTCTCACAGATTCATTGAATAAGACCGAAGTTCTAAAAGCCGAAT
ACGAAGTTAAAGCAAACAAATTTAAAACGGAGGAAGCCAGACTTCGAGATAAATTCCATCAGTTGGAATCTATGAATCAT
TTCTTAGTCAAAGAAAATTCTGAATTCAAAACGATCATAGATCAAACGGAATCGGAAAAGCATCGGCTTTCTGGAGAGAA
AAAAGCCTTGGAACAAGAGAAATACGGCATCCGAGAGGAATTAATGCGGGTTGAAAATGAGAAGGAAGAATTGAATCAAA
TGAAAGATGGTCTTCATCAGTCTATGCAAAATGTTGAAAAATCTTATGAAAATTTACAAGATGAATTATCAAAATTAAAT
TATGAAAAAGGGCAATTAGAAACCGCTAATGTGACTTTACAACGGGAGCGAAATGCACTTTCAACAGAATTGCTCCAAGC
GAGACGAGATGCCGAGCGATTGTCAGCTGCTGTGCAAAAATCAATGAAAGATAAAGAAGTGCTAGCTAAAGAAAAAATCG
ATTTAATATCACAATTGACTACTTTTGAACACGAATTGAGAGAAAATGCGGACGCAATTTATGTTTTACAAGAAGAAAAA
GAACAACTTGATGGTTCACTCTATGAAAGCCAGCAAAACATTTCTCAATTGGAGGCTAAAATAGAAGCTCTCGAATCTAA
TTTGCAACAATTAGAAAGGAAAAGATCCATTATTTTTGACGAAAAACAACGATTGCAACATGAATTTGATGTAGAACTTC
AAAAACTTAGTAAAGCTAAAGAATCTTTACAAATAAAACTTAACGAATCCGAGAAAGAATGGAACAAAATTCTCCGATCG
GAAAAAGAAGCTCGCGAAGAAGACATTGAACGCTTGATTGCTGAGAGAGAAGAGCTTCGAAATGAATTCATGAAGTATAA
AGAAGAAATAAAGCTGCAATTTCAAGAGGAAATTGATGATTTGAGACATAGATTGAATAGAGATAAAGAGGAACTGGCTC
AAGAGATTATTACAATCCAAAGAGAAAGAGACGATTGTTTATTGGAAGCAGAAATGGGAAAACAGCACGCTATTAATTTG
CTGGAGCAGGAAAAAATGTCAATGTATGAGAAGATTTCCCAATTGACAGATCTACTCAGAACTTCTGAATCTGATCTAGA
GCGTACTCGAAATGAATGTGAAATTCGAGCCCAACAAGATCAAAATACAATTCAAACATTTAATGGCGATTTAAAGAAAT
TCCGTCTTCAATTTGAACAAATTCACATCGATCATGATCGGGAAATAAAAAATTTACAATGTGCCTACAAAGAACTTGAA
AATCAAAAATATCAAGATATGAGAGAAAATGAAGAATTGAAGTCACTATTGAAAATTGCAGAAGAAACAAGGGATAATTT
ACGACAAGATCTATCAGAGTCAATGGGGAAAATCAGAGAAACCGAAGACCAAAGGGAAAGATTGCGCCGGGAATTAATGG
ACGAAAAACGAAATTATTTCGAAGTGAAAAAAGAATTGGAAACTATTCAGTTGTCAAATAAGGAACTTAGAGAAAAATTG
AAAACATCTGAAATGCAAAAAATTGATATCCAAAGACAATTACAAGATTTACAAAATAAATTATCAATTCTTGAAGAGCA
GAAACAAGTGTTACAAAAAGAAGTAAAAGATACCAGATATAATTTACAGGATACTGAAAAAGCTCGAGTTGATGTTCGTC
GCGAATTGGAAGAATTACGAAGTCAGGTCAAGAAACTTGATACTGAACGTGGGAAATTGGTAAATGAAGTGAGCGGATTA
CAAGTGCGTGTAGCAACTGATGAAAATAAAGAAGTAGAAGCTAGACGAGAGAACTTTGGATTGAAACAGAAAGTAATAGA
ATCTGAAGCGACCAAAGAAGAATTATCTAAACAGCTTTATCAATCGCTTCGAAAGAATGAGGAACTTGAAGAAATTCTCA
ATTCCAAAGAGAAAACCACTAAACAATATTACGATGAAGTGTTAAAAGATTACAAGTCATTAGAAGAAAGTAAATTAAAT
CTCGAGAATCAATTGGAAATCACAAATCACAATTTTGAGGAATTAAATTCAACTTTATCTACTAAAGAAAATAGAATAAG
TCTTCTGGAAAATCAAATAAATATTTTGGATCAAAAGCGAAAAGGTGCAGAAAATCGGTTGGCAACTATACATAGTCATT
TAAGAAAACTGATTGGATTTCGTCAGCAAATTTGTCAGACATTAAGGAACAGATCTCCGAGTCCTGGCAGACGTTCTCGA
TCAGTGTCTCCTGAAAAAGGACGAGTTTCCAGTAGGAATTCTGTTGAATTTAATTTCTCTGAAGATCGTAAAAGAGTTGG
AAGATTTGGTGATGTGAATCAATATTCAGAATCTGTTATTCCCGGTTCTGATCTGGATCCAGAAGCAGTTCGGATAGCAT
TGAGAGACATTACTCAACACATTGTTTCCATAGAAAGAGAACGCGACGATATGGAAATCAAAGCTAAAAATTCCGCTTTG
AAAAGTGATGAAACATCGGTTCAGTTAGATCAAGCTTTACAAAGAATCAATCAACTGCAGAAAAACTTTGGAGAAGTTGA
AGAAGATAAAAAAGGAATTGATAGTAGATTGTCAAGCGCCCAGACTGCTCTGATGATGCAGGAGGAAACCATTCACAGAA
ATGAGCGCGAAAGAAAATCTTTGATTGATAAAGTTGGGAAACTCGAAAGACAATTAGCCCACGTAGAAACTGAAAAGAAA
TATTTACAAGAACGCGTTGATAAAATGAGAACAGGTGAATCCTATCACGAAGAAGAAAGAAGAGGTTTAATTAAAGCGGT
TGATGATGCAGAAAATAGATGTACACAATTAGAACTTCTGCGTCGAGGTTTGGAAGGTGAGTTGCAGAGACTGAAAATGG
GATTTAATGATAAAGAAACTGAAAACCAAGTCTTGAGGGATAGAGTAGATGCTCTAACAAAACAGATTTCCGATTTAGAA
TCTAAAGCTCAAAGTTTACAATTAACTATAGATAGATTATCAATGAATCTTGCAAGAACCGAAGAAGAGGAGAACACGCA
AAAAGATAAAGTTCACCAACTTAATCTTTCGTTAAGTGAACATCAAGGAAACCTTCAAAGTATGCAAGATAAATTAGTTC
AACTTCAGAGTACTTTGGCAAGTTCGGAACATGATCGAAGAGTGCTTCAGGAAAGATTAGAGTCTGTCAAACATAATTTA
TCAGAAGCTAAATCCCAAAATCATACTCTTGTGGATAGAATGAAGGCCACGCAGCAAGAATTGATGGAATCTGAATCCAG
GAAACACGAAATTGAAGGTGAAATAAAACGACTAAGCCAAATTCTTTCTCAGCGACAAGAAATTGAACAAGAACTTCAAT
CTAAAATTCATCGCTCAGCAATGGAGAAGAATTTGCTAACAGAAAGATTAAATAGTTTAACAGCTTCTCTTGCTGGCCTA
GAATCCGAAAGAAGAGATATTGAGAAAGTTCATATAAAAACTGAAAAAGAAAAGAATTCACTTAAAAAGACATTAGACAA
ACTTGAAAAAGAGAAAAATCGATCTGAAGAATCTATCAATCAATCACTTTTGAAACGCAGTGAATTCGATGAATTTACCC
GCCGGCTTGAGGATGAGAATGAAGTGCTACATCGACAAGTTCAAAAATTACAAAACCAATTGGCAGAAGCTGAACAGTGC
CATGCTCAAAGAATAATGGAATTAACTTCTCGAATAAAAAATGAAATGCTCTCTGAAATTGATAGACTAAAATCTGCTCT
AAATTCCACTGAAAAAACTCTACAGTTTCGAGAAAGATCGCACAGACAAAAAGTAAAAAGTTTAGAAGAACAGATTAACA
TTCTCAAAGATCAACTCTCACAGGAACTCAAAAAACGTGAATTGAATTTAAATAAATCCAATCGTGGCCTTAAAAATGAT
ATTTGTGATATTAAAAGTATTTTGGAAAAGAATTCTAACAACATCTCAAAAACATCATTTGACAACTTACTTTACGAGCC
AGAAATACGAAGGATGAAAGATATATTATCGGAATCTGGTTATTCTAACAACTGCAATGTAATATCCACTATGAAACAAT
CTCAGCGTCCTGGAAGTCGCCTACAAAGCAATTCACTGTCGCGTCAAAACATATCGTCCGCCAGTCCAACTAGAGCCAAA
AAGAAATTATAAATATCCAAATGAAACTTCAAATATTTCTTTACGAAACAGCACTTAACATAAGACGATGATTATTATTA
TTATTATTATT
>SMED30018252 ID=SMED30018252|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=1107bp
ATTAACAATCCTACAGTATATAAGTGATGTGAAATCCTTTCAAACTCATTGAGACAATGCAAATCATCATCCTTGTATCT
CTATTCCTTGCCGCAGTAAGTGCCGCTCCACAGCAGTTCACAATCAACAGTGAACTCAACGACGAATGGGAAGCCTACAA
AACCCAATTCGGAAAAAAGTACGTCTCTTTGAATGAAATCTCAAGACGACTTATTTGGGAACAAAATTTGAAATATATTC
AACAACACAATCTTGAGCACGATCTCGGAAAACACACTTACACACTCGGATTGAATCATTTCGCTGACATGACCAACGAG
GAATTCCGGGCGAATTATTTGGGAGTGTCACCAAAACGAATGAACTTCACATCACATTTCATTGCCCCAGAAAATGTGGG
AGCTTTGCCAAGTTCTGTGGATTGGAGAACTAAGGGATTTGTGACCCCAGTGAAAAATCAACAACAATGTGGATCGTGTT
GGTCATTCTCAACGACCGGTTCCTTGGAAGGTCAACATTATCGAAAAACTCAAAATCTTATCAGCTTTTCAGAACAACAG
CTGGTTGATTGCAGTGGCTCTTTTGGAAATAACGGCTGCGATGGGGGGCTAATGGACAGTGCTTTCCAATACATCCAACA
ATACGGAATTGAAGCCGAAAGTACATATCCTTACACCGCACAAGATGGAAATTGTGTATATGACAAATCAAAAGTTGTTG
GAAGCTGCACTGGGTTCTCTGATATCCCCCACGGTAATGAGCAAGCATTGGCTTCAGCTGTTGCTACAGTTGGACCGATT
TCAGTGGCCATTGATGCCAGCAATTATAGTTTCCAATTATACAAGAGTGGTATTTATAACGAACCTCAATGCTCTTCTTC
CCAGTTAGATCACGGCGTCCTCGCCATCGGCTATGGAACCGAAAACGGTAAGAATTTCTGGCTCGTCAAAAATAGTTGGG
GTATCGGATGGGGAATTCAAGGATACATCAAAATGAGCAAAGACCAAGGAAACCAATGTGGAATATCTACAATGGCAAGC
TATCCTTTGGTCTAACTCATTTTGGATAAATGACATTATGCATAATGAAAAAATAAAATGATTTTTT
>SMED30021661 ID=SMED30021661|Name=Carbonic anhydrase 7|organism=Schmidtea mediterranea sexual|type=transcript|length=1073bp
CATACATATATATATATATATATTGAGACTATTCATTTTTTTCCATACAAAATTCAAACAAAATGAAACCATTTCTATTT
CTATTTTTATTTCTTGTCTCATCTCTTGATCTGAAGATCACCGAGGCTTCAGGCACCGGAAATTGGGGCTATACGTCAAC
CAGTGACATCAAAGGCCCCTCGGACTGGAAAGACATTAATCCAACTTGCGACGGAGCTCGGCAATCACCGATTGATATCG
TGACAAGAAGTGCGGTTTATTTGAAAGATTTACAAAGGATTGAAATTAAAAAAATTGACAACTTTGCTAACTTTTCCACT
CTCGAAAGACATGAAACCTCTATTTACTTAAAGCTTAATAACAGTTGGGGAATCACTTTCGGAGGAAATCAATGCCTAAG
ACCTGACTCCATTCATTGGCATTGGGGATCCAAGGGTACTTTAGGATCGGAACACTCTCTAGATGGGAAGCATTATCCAA
TAGAAGGCCATCTGTTGTCATATAATTGTATGAAATACAGTTCTTTGAATGAAGCAAAATCGAGTCCGGAAGGTCTTTAT
GTAATTGGTATTTTTTATAAAATCGGAAAAAAAAATATGTTAATTGACAAAATTATCCCGGCAATGCAAAGTCTGATTTC
CAGTAGTGATATCTCGAGCGTGATCATTAACGAGATTTCGGTGGAGGAAATTCTACCGAAAAATTTGGACAAGTATTATC
AATATGACGGCTCATTGACGACCCCTCCATGTACAGAAAACGTCAGGTGGACAGTGCTAAATGAAGAGCTAACTATAGAT
GAATCTCAATTGGAAGTTTTTCGCCAATTCGACTTCGAATCTCCCAATTCTGGGGAAATGGAGAACAATTTCCGACCAAT
CTTATCAAAGTTCAATGAAAAACGAACAATATATTCCTCATTCAAAACGGGGTCCAGTTAGACAATCTTATTATGGGTGC
TTTGTGCAATCTTCATGTGCCTGAATAGTCGATAATATGATGTTCATAACACTCAAATAGCACATTTAATTCATTTTGAT
TAACACTATTTTTCATTTCATTTATGTCAATTA
>SMED30025221 ID=SMED30025221|Name=Eukaryotic initiation factor 4A-I|organism=Schmidtea mediterranea sexual|type=transcript|length=374bp
GGAATGCATGTTGTAGTTGGAACTCCCGGAAGAGTAAAAGATATGCTAAAAAGAGGTCACATCAAATCAGAATACATCAA
AATGTTTGTACTTGATGAAGCTGATGAAATGTTGAGTCGAGGTTTCCAGGAAGATGTCTGTGAGTGTATTACTTATCTTG
AAGCCGACGCTCAAATGTTCATTTTATCTGCCACAATGCCCGATGAAGTTCTTACAGTAACAAAGAGATTCATGAAAGAT
CCGGTAAAGATCTTAGTCAAGACAGAAGAATTGACTTTGGAAGGAATACGACAATTTTATGTCAATGTTAGTCAAGAAGA
ATACAAATTTGACACTTTGACTGATCTCTATGAATCATTAACGATTACACAGGC
>SMED30028442 ID=SMED30028442|Name=Lysosomal alpha-glucosidase|organism=Schmidtea mediterranea sexual|type=transcript|length=2946bp
ATTGTTATGCAAAATTATTTTAGCAAAAATTCCGATAGGTTTTATCTAATTAGTAATTAAGTAGATACTTCATGCTCTTG
AACTTGATTTTATTTTAAAATGGAGGTGTGTCGCTGATCTGGAAAAGTTTAATTTCAAATTATCTTTAATTAGATCATCA
CACCTATTTTAGTTGTTGTAGAGAGTCAAAGTTCAGCTTTTAATTAATATATATTCAATTAAAAATTTGCAAAAAATTAT
TTCCATTTCAAATGAAATTAATAATATTAATAAGTTTTATTAATTTGATTTCGTTATTCAACTTTTCCAACGCGACAGCA
CAATGTCAAATAGCCAATAACAATGAGAGACTTGATTGCTACCCAGAATCCGGAGCCAATCAAGATTCATGTATAGCAAG
GGGGTGTTGCTGGTCCGAACCAATGAGATTGTCCAATAAATTGCAAGGTGTTCCACTATCAATCCCATATTGCTATTATC
CAACTGATTATTCCAACTATATGATTAAATCCTTAAGAAAATCTTCAAGAGGGATCAAAGCAAAATTAGTCAGGGAATCA
CCAAGTTATTTACCCTATGAAGTTGCAATGTTAGATCTTGAGGTAATTTATGAAACAAAATCTAGAACTCGAGTCAGAAT
AACAGATCCTAAACAAAAAAGATATGAAGTTCCAATGAAACTCAGTCCTCCAGATTTGAAGCCACCGACTGATCGAGAAT
ATGAAGTCATAATCCCATCTGATGGTTCATTTTCTATTGAAATTAAACGAAAATCAGATGATCGTTCACTTTTCAAATCA
TTTGGGCCACTTTTATATTCTGATCAATTTTTACAAATATCTTCAATAATGTCAACTGATCAAATCTATGGAATAGGAGA
ACAAAATAGACCCTTTCTTCATCAATTATCCAATGGCTGGGAAAGAATTGGATTGTGGGCAAGAGACAATCCGATTGAAA
CATTTATGAATCTTTATGGAGCTCATCCATTTTATATCGGTATGCCAGACGATGGAAAAGCTTTCGGTGTTTTTCACTTT
AATAGTAATGGTCAAGAATTCGCTTTACAACCGGCACCAGCAGTAACTTATAGAACAATCGGTGGAATTTTAGATTTCTT
TATTTTTACCGGAGGCAGCCCTGAAGAAACAGTAAAACAATACCTAGAATTGGTAGGAAAGCCAATGCTTCCTCCATATT
GGTCTCTTGGATTCCATCTGTCAAAATGGGGTTACAAAAATATTGAGCAATTGTCTGAAATATTTCAAAGAAATATTAAT
GCCGGTTTCCCAATCGGTACTCAGTGGAGTGATATAGATTATATGGAAAATTATAAAGATTTTACTGTCGACAAAGAGAA
ATTTAATGGATTGGGAAGATTTGTCAGAGAGATTAAACAAAAATATAACTCTAGATTTGTTGCAATTGTTGATCCAGGAA
TAAGCTGCACAAGTGGTAACGAATATCCACCTTATTATGAAGGAGTATTTATGGATATTTTCATCAAAGATTCACAGACC
AATCAACCAATTGTTGGCAAGGTTTGGCCCGGAGAAACAGTTTATCCAGACTTCACTCATCCGAACATTTCTATGTATTG
GTATAAACAAATTCAACGCTTTTATAATGATGTTCCAATTGATGGGCTTTGGATTGATATGAATGAGCCATCTAATTTCT
ACGATGGTTCCAAAAGAGGCTGTCAAGGAAATAGTAAATATGACAATCCATTTTTTGTACCGGATATTCGAGATCAGTCA
TTAATATCTAAAACTATTTGTTCTTCAGCACTCCATTACAATAACGAAAAGCATTATAATTTGCACAATCTCTACGGCTA
TACGGAATCAGTAACAACAAATAAAGCATTATTAAAAACGATACACGGAAAAAGACCTTTTATTTTATCCCGGTCAACTT
TCAGTGGATCTGGTAAATATACCTTCCATTGGACCGGGGATAATCAAGCAAGTTGGGATCAGTTAAGAAATTCCATTAGA
CAAGTGCTTAATTTCAACATGTTTGGTATTCCGATGACTGGTGCTGACATTTGTGGATTTAACGGTAACAGTGATGAAGA
ACTCTGTATTAGATGGATGCAATTGGGCGCTTTTTATCCATTCATGAGGAACCACAATGCAATCAACCAGAGAGATCAAG
ATCCAGCTTCATGGAATACGGAAGCCCAGAAAATAATGAAAACAGCTATTTCTAATCGTTATGCAATGTTGCCTTTATTT
TATACATTATTAGTCAAATCCCATATGAATGGTGGCACCGTAATGAGACCAATGAGCTTTGAATTCTTTTCAGATAAAGT
AACGCATTCTATAGAATTACAGTTTATGATTGGATCCTCGATTATGGCAACTCCAGTTGTTTATCCTGGGGCCAGATCTG
TAGATGCATATTTTCCAGCTGGAGTCTGGTACGATTTTCACAGTGGAAAATTGTTACATTCAGATGCTGAAGGAGCTTGG
TTGACTTTGGATGCTCCTTTGGACAAAATTAATATTGCATTACGCGGCGGTCATATAGTTCCTCTATTGGATTCCAATAG
AAATTCTAAATCAAACATACCAAATAAAATGACATTGTATTGCGGAATGGCACAAGATATGAGTGCTTCTGGAGATTTAT
ATTGGGACGATGGCGAGAGCATTGACTCCTACTCACGCAATAGATATAGCTATGTATCATTCAATGCTAGCCCTGAGCAA
CTGTTAATAACACCGGTTTACTTTGGCTACGACTTGTTGCCGGTCTTAAACAAAATCGTAATCCTTGGGTTTGAGAATAA
GTCAATTACTAAATTTCTATTAAATGACAATGATATTCCTTTCCATTATAATCCGGAGACTTCATCTGTGGTGCTCAGCA
GTTTAAATGCCAATTTAAATTCCGAAATAAAAATTCAATGGATGTGAATAATTTTTTGTATTTTAT
>SMED30018602 ID=SMED30018602|Name=ATP-dependent RNA helicase dbp2|organism=Schmidtea mediterranea sexual|type=transcript|length=607bp
TATTCAAAAGATAAACGATTGTTAGAAGTTGTTAGCAAAACTCCACGGGACAAAATGATTGTGTTCGCAGAAACGAAAAG
GAAAGCTGATATGATTTGTTCTTTCCTACGTTCAAAACAATTCAGAGTTGGTGCAATGCATGGAGATAAGTCACAGAGCG
ACAGAGAATATATTCTTAATGGGTTTCGAGGTGAAAATTTAAATATTCTCGTGGCAACAGATGTAGCAAGCAGGGGTTTA
GATGTTGATGATATTAAAGTTGTAATCAATTACGACTTCCCTATTCAATTTGAAGATTACATTCATAGAATCGGTAGGAC
AGGCCGACGAGGAAAATCCGGTGTGTCTTATACATTTTTCAATAGAAAGAATTCGAAAAGTGCTCGTCAATTGGTGAAAG
TGATGGAAGAAGCTAATCAATCAGTTTCAGATAGTTTGTATGATCTTGCATATATACCAAGAAGTGAGCGTAGACAAAAT
TTCAATCGTCCGCCAATGCCAGTGCCGCAAGTAAATAATTATCAAGTACCTCCGCCTCAATATAATGGTGGAAATAACAT
GTATCCGCAACCAGATTTATATATGCAAAACGGAGCAGCACATCACA
>SMED30033466 ID=SMED30033466|Name=Histone H4|organism=Schmidtea mediterranea sexual|type=transcript|length=421bp
GATCTCACTATATAAATAAGTATTTGTCCCTATTAATTCATAACAATTATTCAACATGTCTGGTCGAGGTAAAGGAGGAA
AAGGACTAGGAAAAGGTGGAGCAAAGCGTCACAGAAAAGTCCTTCGTGATAACATTCAAGGTATCACAAAGCCAGCAATC
AGAAGATTAGCTCGTCGAGGTGGTGTTAAGAGAATTTCTGGATTGATATATGAAGAAACCCGAGGTGTTCTTAAAGTATT
CTTGGAAAATGTTATTAGAGACGCTGTGACATACACTGAGCACGCTAAGCGCAAGACAGTAACTGCCATGGATGTCGTCT
ATGCTTTGAAACGACAAGGAAGAACTTTGTACGGTTTTGGAGGTTAAATAACACTTTCATATTTGTGAATGTTTTAGCGG
CCCTCTTTAGGGCCACAAATG
>SMED30026114 ID=SMED30026114|Name=PROG-1|organism=Schmidtea mediterranea sexual|type=transcript|length=514bp
ATAACTTTTGCAAAGTTAATTATTTTTTTGAAATATTTTGACTGCAGATCATGAAGTTGATGTTTGTTTTAATTGTAATA
TTTGTTCTGGTTATTAATATTGATGGAGGATTCCAGCGGGCCTTTGAAATGTCTCGGAAGTCGGCCTTTGAAATGCCGAT
GGAATGTTACAAATTGATTCAGAAAATGTATGCAAGCTGTGAGTCAAAATGCGACCAGTACGACATGGAATGCTTCAAAG
ATTACACATCTGTTTACAAAAGTTATAAGGAAGATTTTCAACGGTTCAAATCCAAATGTATGGAAAAGAGCGATTTGGCC
TCCTCAAATTGTCTTTTAATGTTTGATACTTTAGAAGATGATTTCTTTGCAAATTTCGATAAAGTGGATAAGAAATGTAG
CGCGAAGTACATAACAATGACGAAGTACTGTGTAAAGGAATTTAATGAAATTGAAAATTGTGAAAAGAAATTCAAAATTT
AGCTGAATAAATTGTTTTTGAATTTTTAAAAAAA
>SMED30011264 ID=SMED30011264|Name=Macrophage-expressed gene 1 protein|organism=Schmidtea mediterranea sexual|type=transcript|length=2311bp
AGTCGCGATAGCACGCAACGTCGACATTGCGATGACGTAATCATTGTGAATCTCTACTACAATCGGATCATTCTAATCAC
GTGCATCCTAAAACAATATAAATCTTACAAACGGGAATCCAATTGAACATTTATTTACTCAAGCGTGAAACCAATGATAC
CGTGTAGACTTAATAGTATAATATTGTTTATATTTGTTTATGGAGTTCTATCGGTTTCATGTGAAATTGAACCTAACCGA
GATCAACCATCTTCAAGACGAGTTCATGAGTGTAAACTCACCAGCAACCAATATCCAGTGAATGTTCTTCCCGGATCTGG
GTGGGATAATCTTGAAAACAAAGAACTCGGTCAAGTTTTAGAAATTTCATATAAAGGATGTTTTGGATCGAATGATGGAA
GCTTTCTCATTCCAGACAATGTGGTGATCACCCCAATAAAGAAATCTATTGTCGAGTTAACTTCAGATATATTTGACCAT
TTCTCAAATGTCACCTCTACAACGGCGATGTCTATCAACGCCGATGCCAGTTACTCAACACCAAGCTACAAAATCAGTGG
ATCATTTTCATTTGAAAAAATAAGAATAAAAAACGATCAAATCAAAGAAAAGTCGTCGATTTCGAGATCCCAGTTAAGAC
ATGAATTATATGAAGTAGCGTTCCAACCACACTCAAAACTAGACGCAAAATTCAGAAACAGAATTCTAGATATTGGAGCG
TTATTGAAAGAAGGAAAAGACACAATTTATCCACAATATTTAGCGGATTTAATTGTCCGTGACTTCGGCACTCACGTCAT
TCGGTCGGTGGATGCGGGAGCGACTTTAATAAAGACTGACGTTCTGAAGTCGAAATACGTTAATAAATTCAAAGGAGATA
CAACAACCATAGCAGCCGCCGCATCGTTTAGTATGACAAAAGTTCTTGGGGTAACAATCAAAGGAAACTACTTCAGTGAC
ACTGCTAGCCTCGATGAATACAACAATAACAGCGCAAGCACTAAAGTTGAAACAGTTGGTGGAAGACCATTCGGTTCGAA
CTTCAAATTGGAAGATTGGGAAAAATCTCTGGATTCAAATTTGGTGGCCATTGATCGTCGAGGCAATCCATTATTCTACG
CAATAACACCAAGAAGTCTCCCGGAATTTGATGATAAAACCGTTAATAAAATTGTTACTCTTATCAAAAACGCTGTCAAC
AGATATTATGCAGCCAACACTAGAGTAGGTAAGTTAAACTTTAATAATAAAATACAACGTTGAGACTAGGGTGCATGAAT
ATGGAATCAGAAAATTTCAATGACGATGCAAATATTGATGGTGGAAATTGTGAAACTCCAAAATCATATTACACACTTGG
AGGAACATTTCAAACCTGCAAAGGGCCGGATTACCAATGTGAAAACGTAGCTGGCAAGAACCCCATAACGAATAGCTATG
CGTGTCCTGCAAATTACAAAACCGTTGAATTGGAAAGTGGATTGAGTAAATGCGAAAAGGTTTGCGTTAGGACTTTTTGG
TTTAGTTACAACTGTCATTACGAATGTTCCTATTACGCACTCTATTGGTGTGCTGCAACGAAAGCGACAACAAAATCAGA
AGGATCATTATTCGGTGGATTTTACTCAAATACATATCCGAACCCGATAACAAATGCCTATAATTGTCCGCAATATTATT
ATCCATCTCGATTTGGAATGGTCGGAACGATTTGTTTGGCATTCAATAGAGCAGAGACAATGGAACACCATTTGCCTTTC
GGAGGATTTTACAGCTGCAAGGTCGGAAATCCACTCTCAGACAAATTTGTAGATAATACCACACAGGATCCCAAATATTG
GTCGGAAGGTTGCGCAACTGGATACTCATCTCATGTGGCTATTGTCAACCGAGGCTGTCAAATTTCTTACTGTATCAAGA
ACAACGCGCTTAGCAAAAGGGAGCAACCTCCTCTTTTTAGACCCCCATTTGTTGATTTGGGATTCGGACCGAATGCGACC
ATCACTACTAGTTTAGAAACTCCAACTGGACTCAAACTCTCCGTCGACGAAAACGGGAAGTGGAGTGAAAACAAAAAATC
AAAATCATCCAATTATAATATTATTATATTTTCTGTAACAGCAGTAGCAATAATCACCATAATGATTATAATATTAATTC
TTGGAATTAAAATTCATAGAAAAACTCGAAGAATAACCGTTTTGCCAGAATATAATGGCAGCGATAGGAGCAATTCTACG
AGTTCTTTGAATAATCCAACAACATCGAATCGCGTTCAGCCATTCAAAATACTTATAGATGAGAATCAATA
>SMED30001362 ID=SMED30001362|Name=SMEDWI-3|organism=Schmidtea mediterranea sexual|type=transcript|length=3093bp
AATTAAGAGACAGCCATTTATGTTTATTTTTAAAATAAATAGTATATATTTAAGTTTCGAATTTTCAGCTACAATTTAAT
AGTACATAATTATACGATGTCAGGAAGTAGTGGAATAGGTAGAGGCCGCAGTCGTGGGCTGTTGATGCAAAAGTTTCTGA
ATAAAGATGTTCTTGTTCCTTCTGTTGAATCTTTAGAAGACAAAGCTCTTAATAAGCTAGGAATTCCACTTCCTGGGTCT
ACCGTAGAAAAAAATACAGAGTCAAGTTCTATATCAAGTGGAGATTCAAGAAGTAATCCCAGTGGAGATTCAAGAAATAA
CATAAAACTACAAGATAGTGATATTGAGAATCGCAATATTACCATTGTTACGCGACCATTATCCTGCATAGGCAGGGGTC
GGGGTTTAAGCAATCCCTCAAGTTTAACTACGTCATCGGGTAAATCGGATAAAATTACTGAAAACGAAGAACCTGGTCAA
ATTAAAAAGTTTGTAGGTCGCGGTAGAGGATTGTTGAATTCTCAGAAAGAATGTTCAAACTCTACTCCATCTGAAGTTTC
AAATGAATTGAAACAAATGAAAATTTCAAATGATGATAAAATGACGGTTTCTTCAGAAGCAAAGTCACAATTTGAGAACA
TTGAAAAACCTATTAGTAAATTTCGTCGACGCGAATATCCAACTCAAATAAAAGAACCATGTAATACAAGAAATGATTCA
TCGCCATCTTTAACTTTAAGTGCTAATTACGTTAAAGTTAGGACTACACAACCCCATATATATCAATACCATGTTTCCTT
TGCACCTCCGATAGATTCAAGGTTGATGAGAATTAAAATAGTTCAAGGGTTATCAGAATCAGATTTAGGGGTTGTCAAAG
AAGCAAGAGCTTTTGACGGTATGAATTTATACATTCCTCAACTTTTAAAAAATAAAGAGACAATAATTAAAGTAAACAAA
CCGACTGATAAGACTGTCGTGGATGTTAAAGTAGTTTTTACTAACAATGTTAATTTTAGTGAATGTCCTATGGTTTATAA
TGTTCTTTTTAAAAGAATTGAAAATTCCCTCAGAATGGTTAAAATTGGTAGGGATTATTTCTACCCTGAAAAAAAGATAG
TACTTGACCGTAGAAGGATGGAAATATGGCCGGGATATGTAACAAGTATCCAAAATTTTGACGGTGGTTTACTGTTACAA
TGCGATGTGTCACACAAAGTTATTCGAAATGATAGTGTGTATGACATAATGATGGAAATTAATAAAACTGTTAACAATAA
AGGTCAAATGCAAACTGCTGCGATTAATCAACTATTGGGTCAAATTGTGTTAACTCCTCACAATAACCGAAATTATAGAA
TTACTGATATAGATTGGGCTAAAAATTGTTTAAGTGAATTCGATAAAGGAGGCGAAAAAATTAGCTACCGGGATTATTTT
AAGAACACGTATGGGCTACAAATTCGTGATCTAGAGCAGCCTATGATAGTTAGTAAATCTAATAGCAGATCTGGTAAAAA
CCGAGGTCCCAAAGGATCAAAAGAAGTGGATGGTGGATTGGTCTATTTAATTCCAGAATTGTGTATGCTAACTGGTTTGA
CAGATGACATGATTAAAGATTTTCGTTTGATGAGAGAATTACACGAGCATTGTCGAGTTACTCCCAAGAAAAGACACGAA
GCCTTACTGGAATTCGTGGATAACATATATAGCTGTGAGGAAGCTAAGAAACTTTTAGGGTATTGGGGTATAACGATTGA
AAAGGACACTGTCAACATAAATGCTTGTAAAATGAATCCAGAAATGATATATTTTGGAAATGAAGCTTCTGTTAGTGCTG
GGGAACAAGCTGAATTTAAACAAGCCTTGGCACATAATAAAGTTATAGGTGGTATTCGTATTGAAAATTGGATATTAATT
TCTCCAAAAAGTTTACTGACAAAAGCAAATGGTCTGTTACAGGCTTTAATGAGCAAATCTCCTAGAGTTGGAGTTATGTT
TGGAAAACCCAAAATAGTTGAAATGAACAATGATCGAACAGAAGAGTATTTAAAAGAATTAAAGAGAAATGTGGCTCCTG
GTGTGCAGTTAGTAGTTACAATTTTATCTGCTGTTAGAGAAGATCGATACAATGCAATAAAAAAATTTTGTTATGTGGAT
TGTCCTGTTCCAAGTCAAGTGGTATTAGCCCAAACATTGAAAGAAGGGCCTAAATTAAATAGTGTGGCAGTTAATATAGC
CCTTCAAATAAACGCAAAATTAGGTGGAGAGCTGTGGGCTGTCAAAATACCTATTAAGAAGTTTATGGTTGTTGGACTTG
ATGTTTGGCATGATACTAAAGGGAGAAGTAGATCAGTTGGAGCCGTAGTTGGTTCAACTAATGCGCTATGCACAAGGTGG
TTTTCGAAATCGCATTTGCAAGAACAAGATAAAGAAATTATGTACGTATTACAGTCGTGTATGTTAAGCCTTTTAAAGGC
TTATTTTGAAGAAAATAATTTTTTGCCTGAGACTATCTTTATGTATAGGGATGGTGTTAGTGATGGTCAGTTAGGATATG
TTCAAAAAACTGAAATTGAACAATTCTTTAAAGTTTTTGAATCGTTTAGTGCTGATTATAAACCTAATATGGTATATAAT
GTTGTTCAAAAGAGAATAAATACTAGGCTCTATGTAAGTGATCCGAAAAATAAAGGACAAATAAATAACCCCAATCCTGG
TACAATTGTCGACCATACTGTTACGAGGGCTAACCTTTATGATTTTTTTCTTGTTTCTCAATCGGTTAGGCAGGGAACTG
TAACTCCGACGCATTACGTTGTTTTATGTGACAATTCTAAATACACTCCGCATCAGGTTCAGTTGATGGCTTATAAAACA
TGTCATATATATTACAATTGGCCGGGAACGGTTCGAGTACCAGCACCTTGTATGTATGCTCATAAATTGGCATATATGGT
TGGTCAGAATTTGAAAGCTGAACCTAGTAATCTTTTATGTGACAGACTTTTTTATTTGTAACATATGTGTTTCTATTTGT
ATTATTGTTAAACTGCATTTCGTAAAATAAATTAATTTCGTTATAAAAAAAAA
>SMED30010115 ID=SMED30010115|Name=ribonucleoside diphosphate reductase subunit M2-2|organism=Schmidtea mediterranea sexual|type=transcript|length=1127bp
GTTTTTAATGAACTGAATCAGGTTTAATGCAAAATAGTCATTTTAATTTCTAGATAAATTAACAGTAATTCTTTCGAGAT
TAGATATTTATTATGGAGATTTTATTAACAGAAGATAAAAGTCGAATAGGATTTCTTAATATACAATATGAAGATATATG
GGAAATGTTTAATAAAGCTCGATCTTCATTTTGGACTGTAAATGAAGTTAATTTATCAAAAGATTTTGCTCACTGGAAAA
AAATGAATGACGATGAACGGTATTTCATTACTCACGTTCTTGCATTTTTTGCTGCCAGTGATGGAATTGTCAATGAAAAT
CTCGTCGAAAGATTCATTCAAGAAGTGAAAATTCCCGAAGCTGAGGCATTTTACAGTTTTCAAATTGCAATTGAAAACAT
TCATTCAGAAATGTATTCTCTATTAATCGATTCTTATGTTACTGATACAGAAACAAAGAATAAATTATTTAATGCCATCG
AAACTATGCCATGCGTTCAGAAAAAAGCTCAATGGGCATTGCGTTGGATTAGCGATAAAAAATCCACTTTTGGAACTAGA
GTTGTTGCATTTGCTGCTGTCGAGGGAATATTTTTCAGTGGTAGTTTTGCATCGATATTTTGGCTTAAAAAGCGTGGATT
AATGCCCGGATTATGTTTCAGCAACGAATTAATTAGCCGAGATGAAGGACTTCATTGCGATTTTGCTTGTTTGATGTTTA
AATATTTAAGTAGCAAACCGTCACCTGAACAAGTTTTGGATTTGATCAAAGAAGCTGTCGGAATCGAGAAGGAATTTCTC
ACCGACGCATTGCCGGTTTCATTGATTGGCATGAACGCTGAATCGATGTGTGAGTATATTGAATTTGTGGCCGACCGGCT
GCTGGTTGAATTGGGCTGTGACAAGTTCTGGAACACAGAGAACCCGTTGGATTTCATGGATAATATTTGCATCGATGGGA
AAACTAACTTCTTTGAGAAACGAGTCGGTGAATATTCCATGTCGAGCGTTGAGGACAAACACAAATTTGATGATGTCAAT
TTCGATATTGATTTTTGAGGGATTCCGTTTTTTGGCGCCAGTGTGCATTTAATGTGTTTTGGTTGTAATTGGCTATTTTT
GTTTGTT
>SMED30035609 ID=SMED30035609|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=1185bp
TGAGATTTAGGCTTGATGTCATATAATTGTGACCCGATCACAAGTTTTATCACAAGCTGATCATGAAATTGAACCTTGGA
AGCAGGCCTACTATAAAAACAAAATTTACACCGACAGAATTATAAAATGAAAGCTTTCGTTTTAATATCCGTTTTCCTTG
TGGCTATTCAAGCTAGACGTCCGACCTTCTCACTCAACAGCGAGTTGAATGAAGATTGGGAACTATACAAGACTCAGTTC
AAAAGACAGTACGAACCCCTCACTGAAATCACGAGAAGAATCATCTGGGAACAAAACCTTGAATACATTCGACAACATAA
CCTCGAGTATGATCTGGGAAAACATACTTACTACTTGGGATTGAATGAATACGCTGATCTAACTAATGAAGAATTTAAAG
CCAAATTTTTGGGAAAAATATTGACTAGATCATCAACAAAAGGATCTCAATTTATGGCTCCAGAAAATATGGGAGCTTTG
CCTACGACTGTGGACTGGAGAACTAAAGGATACGTAACTCCAGTTAAAAATCAACAACAATGCGGATCGTGTTGGGCTTT
CTCGACTACTGGATCTCTTGAAGGTCAACATTTTAGGAAGACTGGAAGTTTAGTTAGTTTCTCAGAACAACAATTAGTTG
ATTGCAGCGGTGCTTATGGAAATGAAGGATGTGGCGGAGGATTAATGGACAATGCATTCAATTATATAATGAAATATGGC
TTGGAATCAGAGAGAGATTACCCATATACTGCAACTGACGGAAAATGTAAGTATGACAGGTCAAAAGTGGTTGGAACATG
CAGTGGATTTACGGATATTAAACATGGAAACGAATCTGATTTGGCAGTTGCGGTAGCAACTGTAGGACCCGTGTCGGTAG
CAATTGATGCCAGTCACTACAGCTTCCAATTATACAAGGGAGGAATTTACAATGAGCCCCAATGTTCTCCTGACCAATTG
GATCACGGAGTTTTGGCAGTCGGTTATGGATCAGAGAATGGAGGCAACTATTGGCTAGTGAAAAATAGCTGGGGTATTTC
TTGGGGCCTTTCTGGATACATCAAAATGTCAAAGGACAGAAACAATCAGTGTGGAATCTCCACCTCTGCAAGCTTTCCAT
TAGTTTAATTTGAACTATTATATTAATTTTTCCAACTTAATTTTTATATTTAATAAACTTTGCTT
>SMED30013843 ID=SMED30013843|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=1112bp
ATTGTTTTAAGATTGAACTCGTCGTTAGACAATAAAGTGGCATATACTATGAAAATAAAATTACTTCCAAATGCAAAGAA
AATGCAATGTTTTGTTTCTAATGAAAATCATTATAAACAAATTATTCAATGTGCTAAATTTGAAGCAATCGGGCATCAAT
CTAGATATTGCAAGGCTAGAAAAGGAAAAGGGATCGATAGTATTCAGGAGTCTCACGCGGTCCCAAATAGGTTTTAAAAG
AAAGACTGCTTCTGATAAATGATAAGTAAAACGATGCTTGATAGATACTGGCAGTTCAACAACAATTATGCGAAGAGATC
CAATAAATTCACCGGATGTTAGAGTATGTTCAGCACATAGATATATATTATTGGTTAGTCGCAGTAAAGCTGAAATAGAA
TTAAAAGGGAAGTATTTTATTATTGATTGTTTTGTTCCCATAAAAATGATATTCAGTTATGATGTGATATTAGGTATTAA
TGGTATTAATGCACTAGGAGGGGAAGTTCTCAACGACGAAGTGAATCATAGTATCCTAATAGTTGCGAGCATACACAATC
TTCAAGATAAGCTGATTGGAAGAAACAATTTCCAGGCAAGATTCGATTATGAATGGAAAGTATTGTGGAATTGGAACATC
AATATTCCTATAGGATGTCAGAAAGATACTCCAAATTAGATCTTAACAAACCAAATACTGGCCTTGTGCCTACAATCATT
GAGTAATGGATAGAAAAGAGTTGGTTAGTTGAATACGATGAAATCCAGTATGGAAAATCAATTGGTTCATTAGTATTATT
CCCAGTCATACAGAAAAACAAGAGTAAATTAAGACCTGTTTTCGATTTGAGGGCATTGAATCACTATGTGAATGTATGTA
GTGGGGAAGCAGTAAGTAAAAGTATGGCTGTTAAAATTTATGGGGATTCAAGACAAAGGATTGTATAAATAAACAGAGTG
CGGTTGAAAAATATTTGATGTTTTCTATACACCGAAGAATTGCGAACTATTATAAGATTTCTGGTAATATACATATAGAG
GTTCGAGAGAGAAAAATGTATAAAACCAGACTTTATGAAAAATCTTTGAAGATTTTCTATAATTAAAAAATC
>SMED30030594 ID=SMED30030594|Name=Opsin|organism=Schmidtea mediterranea sexual|type=transcript|length=1880bp
AATAAAATGAAATTTATAATGCCATTGGTATTTACACTGTGGTTAATAACGATAATAATCAGAATTTTTAATGATAAATA
TAGTAAACGATAACTAGTAACGGTAACCCTAATAATGAATGCTATATTACATATAGTAGTGTTACCAAAATTTTGGAATT
TAAAATAATAAGTTTATTATGAGTGACCATGATAATAAAAAAGATTTTTAAATAAAATGATAATATTACTATATAGTCGG
TTATAGTTCCGATTAGTCTACTATCGTAGACGTAATAAAAAGAGTTTAGTAACCTAATTTTCAATGTTTTTTGAAAGTTG
CTCGTCTCTATGGCAACTTATTATCGTAAGGAAAATTTTCTACTTCACTATGATATTTTCGGAGTGAATTTATTGATTTA
CATTCAAGGACTTTCACTATTGCATTTACTGAAGCGATCGTTTCATTTGGAACTCATATTTTCGCCCCTAATCGTTCTGG
AATTTATTATTTATGATCCTTTATCTGACCTTAAAAATTTTCATATTCATGAGTGTCCAATCTTTTGCCAATTTGGGAAA
TAAGCTCCTAGAAAATGCTACCTTCAATAATGAATCCCTTACAAAGTCAGTATGGCATTGGGATCCTGAATTTGAATCAA
TTGTCCATCCGTACTGGCGGACTTTTGATATGGTGCCAGAAGTTTATCATTATTTAGTTGGAGTGTATATTTCTATTGTT
GGAATATCGGGAGTTCTGGGAAATCTTCTTGTTCTTTACATATTTGCAAGCGCCAAAAGTTTAAGAACTCCTCCAAATAT
GTTTATAATGAGTTTAGCAATTGGAGATTTGACATTTTCTGCTGTGAATGGCTTCCCCTTACTTACTATTTCAAGTTTTA
ACACTCGATGGGCTTGGGGAAAATTAACGTGTGAGATTTATGGTTTCATCGGTGGTCTTTTTGGGTTTATATCCATCAAC
ACAATGGCACTAATTTCTCTGGATAGGTATTTTGTTATTGCCCAACCATTTCAAACAATGAAATCCCTGACAATCAAAAG
AGCAATAATCATGTTGGTTTTCGTATGGCTTTATTCATTAATTTGGTCAACACCGCCATTTTTTGGATATGGAAATTATG
TGCCGGAAGGATTTCAAACGTCTTGTACATTCGACTATTTGACCCAATCAAAAGGTAACATAATATTCAATATTGGGATG
TACATAGGAAATTTCATAATTCCCGTTGGAATAATTATATTTTGCTATTATCAAATTGTCAAAGCAGTGCGAGTACATGA
ATTAGAAATGTTAAAAATGGCTCAAAAGATGAATGCATCTCATCCAACTTCCATGAAAACGGGTGCAAAAAAGGCTGATG
TTCAAGCTGCAAAGATTTCTGTCATAATTGTCTTTTTATATATGTTATCATGGACACCATATGCAATAATTGCCCTTATG
GCTCTCACAGGGCGTAGAGATCATCTGAATCCATACACTGCAGAATTGCCGGTACTCTTTGCTAAGACCTCAGCTATGTA
CAACCCATTTATATACGCAATAAATCATCCAAAATTTCGAATTCAGCTGGAAAAGAAATTTCCATGTTTGATTTGTTGCT
GTCCACCAAAACCAAAAGAAAGGGACACTACAAGTGCAGCATCAGCAACGAAACCGAGTAAATATCAGAGTGAAAGAGAA
AGTTCAATGTCTCAACTGGATCCTGAAGACGATAAACAAGTCGTAGAAACCACCAAGAATCAAACCACAAGTGGACATAC
AAATGAAGCTTACGAGAGTGAACAGAAGTAGTTGATGAAACTAAATTATTCTATTTTTAATGACACTAGATCTTTATAAT
AATTTTATTTAAGGGAATGAGCACTGAATTTTGCGCAAAT
>SMED30022907 ID=SMED30022907|Name=Synaptotagmin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1814bp
ATTTATTGAAAATTATTTTTTCTATTATTAGGAGAAAATTGATTATTTTTTTTTGACAAAATAAGTTTTGGATATATTTC
CCATTTGTTTGTATTCGTAAACCAATGAAGAATTCGACTCACGGATCGGATCATTCGGCCAGCAAGGCCAGTATGAAAAC
GAATGTGGAAAAATTTTGGCATGATCTCGGAAAAAAATTGCACATGGATCCAAAAGCATTAATAGGAGTAACAATCGGTT
TGGGAATATTGTTTTTGTTGTTCCTTTATTGCTTATGTAAAAAATGTGTTTTCAAGCGTCGAAAAAAGAAGGAAACGGCC
AAAAAAGGAGCCAAGGGAGTAGTCGATATGAAAAGTGCCCAATTGTTGGGGAATTCATATAAAGAAAAAATTCAACCCGA
TCTTGAAGAACTTGATGCAAACATGGAAGACAATGAAGGTGTAAAAGAAAAAGAAGATGTTCATTTAGGAAAATTACAAT
ATTCTCTAGATTATGATTTTCAGAAAGGAGAATTAACTGTTGGAGTTATTCAAGCAACTGATCTTCCAGCTATGGATATG
TCAGGAACATCAGATCCATATGTCAAATTATACCTTCTCCCAGACAAGAAAAAGAAATTCGAAACAAAGGTTCATAGGAA
AATTTTAAATCCTGTATTCAATGAAACTTTTGTTTTCAAAGTTCCTTTCAATGAAGTTGCATCGAAGACTTTGATTTTCA
ACGTTTATGACTTTGACAGATTTTCCAAACACGATCAAATCGGTCAAATAAAAGTACCATTGGGAGCTATAGATTTAGGT
CGAGTTATTGAAGAATGGAAGGAACTGGAATCTCCAGAAAACGATGGGGAAAAGGAAAACAGGTTGGGAGACATTTGTTT
CTCTTTAAGATACGTACCGACATCTGGAAAGCTTACAATAGTCATTTTGGAAGCAAAGAATCTTAAAAAAATGGATGTCG
GAGGATTGTCTGATCCATATGTTAAACTTTCCTTGATGCTTAATGGTAAACGAGTGAAGAAGAAGAAAACTACCATCAAA
AAGTATACACTAAATCCTTACTACAATGAATCATTTTCCTTTGAAGTACCATTCGAACAAATACAAAAAGTGAACTTGAT
CGTCACGGTTGTTGATTATGACAGAATCGGAACCAGCGAACCGATAGGTAGAATTGTTCTGGGATGTAACGCAACTGGAG
CAGAATTGCGACATTGGTCGGATATGTTGGCAAATCCCCGGCGACCAATCGCCCAGTGGCATACCCTCCAAGAGATGCCA
GAGAACAATTGATAGTGTTCGTTTGATGCTTTAAAGCGGTTTGCATAATTCGTGAAATAAGTTATCAAAATTTGAGAAAT
GTTTTTTTTTCTGAAACAAAAATGGCATGAGACAATATACCAGAGTTCATTAGTGTGTGGTTTCGTTGAATATTTTGGTG
GTGTTGCATCTTATCGTTTGTCCTCTAATCTAATAATGTTTTATTCTTTATATAGCTGATTTATTCTCGAGCGAAACATT
TTTTATGTGTACCAAAATACTTATGTCATAGCCATTGTGATTAGTCTGTAAACTATTGCGTAATAGCCCCTCTCATTGGC
TTTTTTTAAGAGTAGTGAGTTGGAAAAAAAAATACAAAAATGACTTCAATTGTTAAACATTACTCATATTTTATCAGTAA
GTTAACTTGCATATTTGCAGTTAATTATGGCATTTTATCTCTAAATCTCTGAAGCATGGCCTCAAGTCTTTTGTTTGTTT
TAATGTAATTATGTCTAGATGAGAATATTAAAATACTTCGGTTTATATAAAAGA
>SMED30015313 ID=SMED30015313|Name=Cysteine-rich secretory protein LCCL domain-containing 2|organism=Schmidtea mediterranea sexual|type=transcript|length=614bp
GATTTACTTTACATAAGCGATTGTATCAATAAATTATCGTTTGAGATGAATTCGAAATCAGTAAATTAATCATCGTATTC
ATAGAAAGAAAATGAGAAATTCTCTATTATTTAGTATAATGTTAGGTGTCGTTATCTCAGTTATCCAGTGTTATCTGACT
CCTGACCAACAACAACAAATATTGTATGGAACGATGAAGCTGCACAACGAGCTCAAATGTCGGCTGATCGTTGCGTTTTC
CAATATGATCAATCAAGAGATCGTCGATTTGGAGGTTATAGCTGGGTTGGTCAAAATATTGCATACTGGTCAAGCAATGA
CGTGACAGACGGTATCAAGATGTGGTTCGACGAAGTCAAAGATTACACATTCAATGGAGATAAATGTAGTGGATTTACAT
GCTTGCATTACACAGCTTTAATCTGGGCAAAAACCAAGGAATTTGGATGTGGAATAGCAGATTGTTCTCGAAAGGGTTTA
GGAAATATTTACATCGTCTGTAATTATGGACCCGGTGGAAATTGGAACAACGAAGCACCATATAAAGTTGGACAAGCATG
TTCCAGATGTCCAAATGGAACCAGATGCAGCAATGGACTATGCAGTTAGAAATA
>SMED30001900 ID=SMED30001900|Name=CUGBP Elav-like family member 3|organism=Schmidtea mediterranea sexual|type=transcript|length=1713bp
CTTTTGAGGGAAAAATAATTCTTTTATTAATAATGTTTCATCATTGGAATATAAAATAAAATATTAGGAGAAAACATAAG
TTAACCAACAATATTAGCCACATATTTCGTTTAATTATTGGTCTATCACTTTTCATTTTAACCAATTGTCTTGAGATAAT
GGAGAGTTTATCCTTAATTTTTATTATAAATCACTGGTTTTGATAGACTTATTAACAATGGAAAATTATTTCAAACTTTT
CGTTGGTCAGATACCTCGAAATACACCAGATAAAGAAATTAGACTTATTTTTGAAGCTTTTGGACCAATCTTTGAATTTT
TAATTTTAAGGGACAAGAAAACTGGTTTTCATAAAGGATGTGCTTTTGTTACATTTTATCATAAAGACTCTGCAGAAAAT
TGTCAAAAGGCGTTACATGACAAGAAAATCCTAAACGGGATGAATCGACCACTTCAAGTGAAACCAGCTAAAAATAAGTT
AGCAAAAAATTCAAGTTTGAATGGGGAAAATCAGACAGAAGAGCAGGTTTTCAGTGATGAAAGGAAATTGTTTGTTGGAA
TGTTGAGTAAAAATCAAACTGATGAAAATGTACAAAATATGTTCACAAAATTTGGCAAAATCGAAGAGTGCACTGTATTG
AAAGACCAAAATGGAAATAGTAAAGGATGTGCCTTTGTCAAATTCGTGAACCACACCGATGCTTGTGCAGCAATAAACGC
TCTTCATGCCAGTCAAAAAATGGAGGGTGCTTCATCCAGCCTTGTGGTTAAATTTGCTGACACGGATAAACAAAAACAAA
TAAGAAAATTGCAGCAATATATTCCAGATTTAAGCATTTTAAATTCGCGCATTCCTATTAATATTCCATACTATTCACAA
TACGGTACAATAATTAATCCAGAATATAATTCAACAATTCCTTCAAACCAATATATTCGAAATTGTAACGAATATATTCT
TGCTGCTCAAATTCAACAAATAAATTTGTTTTCTAATTTATCATCGGTCTACCCATCTAATTCAATAGTGTCAATGCCAT
CCAGCCATCCGGTACCAATGATTGACTATTCTGTTCCTATTAACAACTTTCCACAAACTGACCAAATAACAATGAAACCA
ATTGTTGATATACAGCCAATACCTCCAGAAGCTGTACACCGAACCATCGTAACTCCAGGATCACTCTTATCATATCCTTT
TCTTAATGTTCAAATTCCTACAGTATATCCAAACGCCTTTTCCAATGGAAATTTAACAAGTACAACACAAAGTTCAACAG
ATGTGAAAACCACTCCTTTGCCAACAGGTCCTGAAGGCTGCAATCTATTTATTTATCATCTGCCACAAGAAATTGGTGAT
TTACAATTATATCAAATTTTTATGCATTTTGGAAACGTTATCAGTTCTAAAGTTTATGTTGACAGAGCAACAAATCAAAG
CAAATGTTTTGGATTTGTCAGCTACGATGATCCGGCATGTGCCAATGCCGCCATCAAATCTATGAATGGATATCATATCG
GAACAAAAAGATTAAAAGTTCAGTTAAAAAAACCAAAAGAAGCAATAAACGAAATGAAAAACTTCAATCAAATGTTATCA
TCAACTCCCGACATAAACCAAGTATTTTGTTCATCCTAATGATTGTGATATTTTACAGGATTTTCTCGACCATATTGAAA
GCCTGATTGGTGATATGTAAAATGACCCACCGT
>SMED30027428 ID=SMED30027428|Name=forkhead box A-1|organism=Schmidtea mediterranea sexual|type=transcript|length=2149bp
ATCACTTGGTGCTGCTTTTTGCCCCGATAAATCTCTCGGTGCTCCAAAATTTGTGTAAGCGAGCAAAAGATGATTGGGCA
ATTTCTAGCACGTCATTCGGCAACGATGTTTACAAGTTTCTCTGATTGGATGATAAAGTAGAAACTTTCCGAAAATGAAA
CTTCTCCGAACATGCGCATACCGACTGAAAATTAACTCTAAGCCAGCCAATGGAATTGAAGCAAAATTCAAGAGAATATT
AATTGACTTCGCGAATGAACTCAAATTTTCTATTGGCGTATTGTGTGTGCCTCATTGTGAGTGGTTGCGATCGCATCTCA
AATTATTTACACACAAAAAAATAACGCACACAGACATTGAATAGATATATTTGATCAAGTCAATATCACAATGTCAATAT
TAGCTTTTTCTGAAGAAAGAAGACGAACTAGAAGAAAAACAACAACGAAATAGATTCGATAAGGCTACTGAGCGATTTTC
ATAATCTAAATATTATTTTATTATTGATACGGACAAAAATTGGTCTTTTACCAAGTACTACTAGATTGTTGATAAAGAGA
GGTTATTTAGATGCTTGGAAAAAATCCTTATGAAACTGCAATGAGCAACGTGTATTCTCTACCTCCGGGAGGTTCTATTT
ACAATATGAACCCGATGAGTATATCATCAGCTGGCTACAACTCTCAACAAGTATCAACACTATCGTTGAACTTGACCGGA
ATCGGACCTCATTCATTAAGCCCAATGAGTGCAAGCATGTCGGGTATAGCTGCAATGGCCGGTGGAATGAGACAAGGTCT
TGAGTTGGGTCTTGGTAGAAGTGATAGTCCAAGAGATAAAAATTCAATTTCCAATAACAACCGACCATATCAAAGAAGTT
ACACTCATGCCAAGCCTCCATACAGTTATATAAGTTTGATAACAATGGCGATTCAAAATTCTCCAGTAAACATGTGCACT
CTATCGGAGATCTATCAATTCATTATGGATCATTTTCCATACTATCGTCAAAATCAACAGCGATGGCAGAATTCGATTCG
ACATTCTTTGTCCTTCAACGATTGCTTTGTTAAGGTTAGTAGAAGCCCAGAAAAACCAGGTAAAGGCTCATATTGGACCT
TGCATCCTCAATCAGGTAACATGTTTGAAAACGGTTGTTATCTCAGAAGACAAAAGCGATTCAAAGATCCACACAGAGAA
ATCGGCAGACAGAGTCAAAGAGCTGCCACTGGTCCTGGATCAAATGTCACAGAAAACAATCACGACAACGCATCGCAAGA
AGCTAGTGATAACGCAGAAAGTGATACGAAACCCAACATCAAGCAACTTGATTTATCAAGCGATCTCTTAACTAATCAAG
GTCATAATATTAAAAATACTAATCCAACTTCTGTTAGTCAGAGTTGTTCGATGTTTCATCGGAAAAAGGAAAACTGCTCA
CCAGTAGAAATGAAATTGAATAACCAAAACCAACAATCAAACCAGCAAGAACATCCACAAATCCATTACAATCCCAATCA
GCAATTCTACTCAAATCAGCAAAACATTTTCCAACAAAGTTCTCTTGATCATTACAGTCTATTAGCATCCGATGATCCTC
TTGGTCAAGGTATGCACTTGCCACCAGGTGCAAATAGTGTTTTCGGACTTTACGGGGCACATAACTTACCAAACGATGAT
CAAATTTCAGTGTCATTACCATCGATATCCTTATCCGGACATCCGTATGACAATTTATCAACAGCAATGGCATATCAATA
TGAAGCATCTCAACACAATTCTTCATTACTAACGACAAGTAATCCGTTCTCAATAGATCGTTTGATGCATCCAAGACTAG
TCGCTGCAGCGATGGGGGTCAGTCCCCATGATACTCTATACGCAGGAGCTACCGGCCCATCAGTTGATCTAGAACACATG
AAATACTACTCAAACTACAACAATGTGCCTCCTTATTCCTCTGCAATGTCTGACTACTACAAATATGTACAAAATCCTCA
GCCGGGCAACAGCGACATGAGTCTTTGAATTGAGTCCATTGAAGTCTACGGCAGTTTCCTCGAAATTTCACATTCAACCA
GATGTTTATCGCCTAATATAAAGCTGTGTTTTTTTATTTATTTACAATTAAATCTTTGTACAAGAGATC
>SMED30036022 ID=SMED30036022|Name=Lysosomal alpha-glucosidase|organism=Schmidtea mediterranea sexual|type=transcript|length=2871bp
TTCTAGTACTTCGATCAAAGTCCAAACTACGATTTCCTATTTATGATGAAAATTATTGAATTAGCAAAACGCATTATAAT
GAAAAGTTTCATTATTTTTCAGATCTTTTTTTATTTTTATGTTGCCCATAATTCGGCCGCGAATTCTCCTCAGTGCTTGA
TCCAAAATAACAATGAACGTCTTGATTGCCACCCAGAACCTAATGCTAATGAACAATCGTGTAGAAGCAAAGGATGCTGT
TGGTCTGAACCCATGCGATCATCAAATAAATTACAAGCCTTGCCAGGATCAATTCCTTATTGCTATTTTCCCACAAATTA
TCCCAATTATGCTGTCAAAGATATAGAAGTTTCTAACAGAGGAATCAAAGCGAAACTGATCAAGCAGAAATTTAATCATC
TACCAGAGGAAATTTTATCGTTAAATCTAGATGTCATTTATGAAACGAAATCCAGAGTTCGTATCAGAATATCTGACACT
GAAAACAAGCGATTTGAAGTTCCAATAAAACTAAATCCTGCGGATCCTACTCCGCCAACTGATACAGATTATGATGTCTT
CATTCCATCTGAAGGGTCGTTCTCTATTGAAATTAAAAGAAAGTCAGATGGTCGATCGCTTTTTAAAACCTTTGGTCCAC
TTTTGTATTCCGATCAGTTTTTGCAAATATCAACATTGATGTCAACTGATCAAGTTTATGGGATTGGAGAACAAAATAGA
CCTTTCCTTCATCAACTATCTAATGGGTGGACACGAATTGGATTATGGGCGAGAGATTATGGAATTGAAACATTCAACAA
TTTGTACGGAACTCATCCTTTTTATATGGGAATTCCAGACGATGGAAAAGCTTTTGGTGTTTTTCATTTCAATAGTAATG
CCCAAGAATTCTCGTTGCAGCCTGCACCCGCAATTACGTATCGTTCAATTGGAGGAATACTAGATATTTTCATATTTACC
GGAGACACTCCTGAAGAAACCGTTAAGCAGTACGTAACTCTCATTGGTAAGCCAATGCTTCCTCCATATTGGTCTCTTGG
ATTCCATCTGTCAAAATGGGGTTACAAAAATATTGAGCAATTGTCTGAAATATTTCAAAGAAATATTAATGCCGGTTTCC
CAATCGGTACTCAGTGGAGTGATATAGATTATATGGAAAATTATAAAGATTTTACTGTCGACAAAGAGAAATTTAATGGA
TTGGGAAGATTTGTCAGAGAGATTAAACAAAAATATAACTCTAGATTTGTTGCAATTGTTGATCCAGGAATAAGCTGCAC
AAGTGGTAACGAATATCCACCTTATTATGAAGGAGTATTTATGGATATTTTCATCAAAGATTCACAGACCAATCAACCAA
TTGTTGGCAAGGTTTGGCCCGGAGAAACAGTTTATCCAGACTTCACTCATCCGAACATTTCTATGTATTGGTATAAACAA
ATTCAACGCTTTTATAATGATGTTCCAATTGATGGGCTTTGGATTGATATGAATGAGCCATCTAATTTCTACGATGGTTC
CAAAAGAGGCTGTCAAGGAAATAGTAAATATGACAATCCATTTTTTGTACCGGATATTCGAGATCAGTCATTAATATCTA
AAACTATTTGTTCTTCAGCACTCCATTACAATAACGAAAAGCATTATAATTTGCACAATCTCTACGGCTATACGGAATCA
GTAACAACAAATAAAGCATTATTAAAAACGATACACGGAAAAAGACCTTTTATTTTATCCCGGTCAACTTTCAGTGGATC
TGGTAAATATACCTTCCATTGGACCGGGGATAATCAAGCAAGTTGGGATCAGTTAAGAAATTCCATTAGACAAGTGCTTA
ATTTCAACATGTTTGGTATTCCGATGACTGGTGCTGACATTTGTGGATTTAACGGTAACAGTAATGAAGAACTCTGTATT
AGATGGATGCAATTGGGCGCTTTTTATCCATTCATGAGGAACCACAATGCAATCAACCAGAGAGATCAAGATCCAGCTTC
ATGGAGTATTGAAGCTCAGAAAATCATGAAAATTGCAATAAACATTAGATATGCATTATTCCCTCATTTTTATACTTCTC
TTGTTAAATCTCATTTATACGGTGGAACCGTGATGAAACCAATGAGCTTTGAGTTTTACTCTGATAGAAATACCCACGGA
TTGGACCTACAATTCATGATTGGATCATCTATAATGGTTGTTCCTGTAGTTGATCAGGGTGCCAGAAAAGTCAATGCTTA
TTTCCCAGCTGGTATTTGGTATGATTTCCAAAGTGGTAGTATTTTGTATTCTGATTCCAAAGGTGCCCAGGTAACCCTAG
ATGCTCCATTAGATAAAATAAATGTTGCACTAAGAGGAGGCCATATAGTTTCATTGATATCAGATTCTATGACAAATCCT
CAGATGTCAACAAATAAAATGATTTTATATTGTGCTTTATCGGAAGATTCACAGGCATCTGGAGATGCATATTGGGATGA
TGGGGAAAATGTTGATTCTTATTCTGGAAATAAGTACAATTATTTGAAATTTATTGCCAACGGAAATAGGCTGGAAATTT
CAGTAGAATTCAAGGGATATGAACTTGTCCCGGTGTTGTCAAAAGTAGTAATTTTGGGGGTAAAACAAACTGGTGTACAA
AATGTCTCTATAAATGACAGACCAGTAGACTATCAATTCGACGCAGAAAAATCAATTTTACTGATCAGCAATATTGATCT
TAGTATTGATTCGCACATTTTGCTTTCATGGAATTGACTGAAGCAATCTCACAAAAAATATTTTTATTAATAAAACACTA
TTGTTTTTTAATGCTTGATTAAATTATATTTTTAAAGTTTTTAAAGGATTTATTAATAAAAGAAATGTTTG
>SMED30019695 ID=SMED30019695|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=1216bp
TTGAAATTCTGCATTGATGGGAATTGCGTCGTAATAATCACGCGCCGAATATCAAATGTATAAATAAGATATTTGTTCTT
CACTTAATATAATTATAATGTTTGCGATGGGTCCTATCTTGATATGTTTATTATTAGCAGTGATTTCAGAAGCCAGAACC
ACTTATAGCCATCACAAATCAGTTCCAAGTGATGACATTTCTAGTAAATTTGAACTAGAAAATATGGTATCTCTCTTGTC
CCGTTACGACGGAGAATTCCAAACCTTCAAACAGCGATATAATAAATCTTATAGTTCCATGCATGAAGAGAATTCCAGAT
TTTTAAATTTTATATCATCTCTACTTGAGATCAATCATCACAATCAACTTTATGAAAACGGTCAGAAATCATACGAGATT
GGAATCAACCATTTGAGTGATTGGAGTGATGAAGAACTCGCTCAACTGACTAAATTGAAACAATCAAACCTGACGGGCTC
ATCATATTTATCATCCAGTGTGAAAATTGACCTTCCTGATTCATTCGACTGGAGAGAGAAGGGTGCAGTTACTGAAGTTA
AAGATCAAGGAAAGTGTGGATCATGCTATGCATTTGCTGCTACTGGCACTCTAGAAGCCCAAATCTGGAGAAAGACTGGG
AAATTGATCAGTTTATCAGAACAACAAATTGTTGATTGCGATACTAATGATAACAATTGTTACGGTGGATTTGTACAAGA
CGCGTTATCATACATCAAGTCAAATGGAGGCATTGAAAATGAGGAAAATTACCCTTATGTTTCCGGCAAAACAGCAGATA
TGAACCCAAAATGTAATTTCGTAAAAAGCAAAGTAGTGGCGACTGATACTGGATTTGTTAAAATGCCAGCAAATGATGAA
GAAAAATTAAAAGAAGCTCTTGTTACAATTGGCCCTATTTCTGCATTATTATCTGCTCCTAAATCGCTTATAAAATATTC
AAAAGGAATTTTCTACGACAAAGAATGTGAAAAACTAAGAGTTAATCACGCTGTTCTGATAGTCGGATATGGAACAGATC
AAACTTCCGGGACACCATATTGGATAATTAAGAATAGTTGGAACGCATCTTGGGGTGAAAAAGGATATTTCCGGTTACCC
AGAAATATAAATGCTTGCAAAATAGCGTCAGTGCCAGTTTATCCTTTGGTTTGAATTAAAATGTTTATGTAATAAATATA
TTTTTTTGTCTCAAAA
>SMED30003202 ID=SMED30003202|Name=Eukaryotic initiation factor 4A-I|organism=Schmidtea mediterranea sexual|type=transcript|length=1324bp
ATTAATAACAATGGAAAATCCAGGAGAAATAGAAAGTAATTACGACAAAATAGTTGAATCATTTGAAGATTTAAACTTAA
AAGAAGATTTGTTAAGAGGAATCTTTGCTTATGGTTTTGAAAAACCTTCTGCTATTCAGAAGCGTGCTATTTTGCCAGCT
ATTGAAGGTCACGATGTCATTGCCCAAGCACAATCTGGAACCGGAAAAACTGCCACTTTCAGTATTGCTGTTTTGCAGAA
TATTGACACTTCTATCAATTCTACACAAGCTATTATTCTAGCACCTACCAGAGAACTTGCAGTTCAAATCCACAAAGTTA
TAATGACCCTTGGTGACTATATGGGAGCTAAATGTTGCTCATGCATTGGTGGAAGAAATGTCCGTGACGACATTAACAAT
TTGGAAAGTGGAATGCATGTTGTTGTCGGTACTCCAGGACGAGTTAAAGATATGATAAAGAAGGGCCATATTAAATCAGA
TTTCGTGAAAATGTTTGTCCTTGATGAAGCCGATGAAATGTTGAGTCGAGGTTTTCAAAATGACGTTTGTGAATGCGTTC
AATATTTATCTGCCGAAACCCAAAATTTCATTCTTTCTGCAACAATGCCAGATGAAGTTTTAAAAGTCAGTAACGAATTC
ATGAATAATCCAGTGAAAATTCTCGTTAAAAAAGAGGAATTGACTCTGGAAGGTATTCGTCAATTCTACGTTAACGTTAG
CCAAGAAGAATACAAATTTGATACCTTATGTGATTTATATGAATCTCTGACCATCACCCAAGCTGTCATTTTCTGTAACT
TCAAAAACAAAGTTATATTTTTAAATGATAACTTGAAAAGTAAAGGATTTGTTGTTTCATCAGTCCACGGTGACATGGAG
CAACAAGCTAGAGACCAGATTATGAAAGAGTTCCGAAGTGGATCAAGTAGAATTCTCATCACCACAGATTTGCTATGCCG
AGGTATTGACGTCCAACAAGTCTCAATGGTCATTAATTATGATTTGCCTAAAAACAAAGAAAATTATATTCATCGAATTG
GCAGAGGAGGCCGATTCGGAAGGAAAGGAGTTGCACTAAATTTTGTCACAGACAAAGATATTGCTGAAATGCAGGAGCTG
GAAAATTTTTATAACACCAAGATTGAAGAGATGCCCATTAATTTATCTGAATTCTTATAAATGATTTACCGCTATTTTTG
TAAATAAATTTTAATTTACAATTAAATTAGGTTATTCATAACTTCCTTTGTTACGTAATTTTTGCTATCTTATCTATTTT
TGTTAGTAATGTATTTATGCTGCGTCACATTTTTGTTGCAAATT
>SMED30030379 ID=SMED30030379|Name=POU domain protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1625bp
AATTAGCTATGCGAGCTGCTTTATCAGGCATGACTGTGATAAAACTGTCATTATTTATGCGCATAATTTGCCGTTAGTAT
TTGCTCAACCAATTTGACGTTCAACAACAACAGCAACAACATCCACCACCTCCACCAACATCCTCATTATCATTATTATT
ATTGTCATGTTAACAAGCGGACTTAATCAGGAACAATCATCGCCTTTAACAATCGTAGGCATGAGTGAGTCTCAGTTTTT
CAACGAATCTATCAGATATTTGCCTCCGGAAACCGTGGAGAGACAAAGCCAATTTTATGCAAATAATAATTATCCCCTTG
GTGAGTTTTGGAATCCACAATCCGAATATGCACAATACTTGCAAAATACCCAGCCAGTCTCGGGGCCTCAATTCATTACT
TCGCCGGCGGTTGGAGAGGCATTCTATCCATCTCTTTATATCAATACTATCCATGAAAATGTATTACTACCTTCGGTTGA
TTCCTTCAATCCTCCCAGTGGATTTATGATTTCGGGATATTCACAGCAAGACCAAACCTTTCCCACGGTCAATGAACCGA
CGTATGACAATATCCCAAACAATTGGAATTATGTTGATCATTGGGTTGATTCCAAGCCAACAACAGTGAATTCTCAGCTG
TTGCCAACCTCGTCAATTTCCGCCGTCCCCATTCAGAATTCGTTTTGGGACTGCGAGTCGATTGACCAATCAGAATATTG
TCCCACAAATGTTGATACCGAGCTCCAAGATCAAATTGATTCCAACGGAGAAATCAGTAGACTCAATCAAAAGATTTCTA
CTGACGAGTTGGAGCAGTTTGCGAAAATTTTCAAACAGCGAAGAATCAAACTCGGATTTACACAAGCCGACGTCGGGTTA
GCCCTCGGTAATTTATACGGCAGCGTGTTCAGTCAAACAACAATTTGCCGGTTTGAGGCACTGCAGCTCAGTTTTAAAAA
CATGTGCAAACTTCGACCTCTGTTAGGGAAGTGGTTGCAAGAAGCCGACTCAACCGGATGTGCTCCGTCCGGTATTGACA
AAGTCACAGCTGCTGGACGAAAACGAAAAAAGCGAACCAGCATTGAGGTTGGAGTGAAAAATGCACTGGAATCTCACTTT
TCTCGACAAAGCAAACCGACAGCCCAAATCATTACACAGCTTGCAGACAGTCTCGGATTGGAAAAAGAAGTTGTCAGGGT
ATGGTTCTGTAATCGGCGACAGAAGGAAAAACGAATGACGCCTCCGCCACTGAATGGAACAAGCTCAGATTTATTTCCAC
ATCCTGGTTTAACTGTCGGAACTGATAGTTCTCCTCATTCCTCATCTCACAGTAATCATGATTCATTCTCGTCCATTGGT
AACCAGTCAAGCTTCAATCGAATAGGTGATCCCTCCTCGACTCATCCCGGAGTCATTGTCACATCTTGCGGTTATTACTA
TGGTCATGTTCCAAATGAATCACTTCTCAATTGTGGGCCTTACCCTCACAACATCATCAACAATTACGAATTCAGACAGT
CCAATGATCCCAATATCCTCAATGTCAAATCCGAGTGCATCAGCTGACTCATGTCGAACTCACCGAAAAGAAAGCTAATA
ATATTCTATTTCAATAATAATAAAA
>SMED30006887 ID=SMED30006887|Name=Gelsolin|organism=Schmidtea mediterranea sexual|type=transcript|length=1378bp
CGATGAGTGGTAAAATGTATGTCATTGTCTCATTGGCGTTAGACCAATCAAAATCATCACGAATTATTTGCTCTCGATAC
AATTCGATTAGAATATAATTGTCATCGTTTGACCTTCGATATCATTTCCATAAATCAAATTTTGTGAGAACATAATGAAG
AGATCAGCGAAATATGATTGGAAAGATTCAAATGTTGAATTGATTGGTTCCAGCGAAGATCGAGCTGTAAAAAAATCGTC
TGCTGAAACTGAAAAAGCATGGGCTGCTGCAAAGGCTTGCAATCATGCTGCATTATTTGTTTGGAGAATTGAAAAATTCA
AAGTTGTTGAATGGCCAAAAGTGCAATATGGAGAGTTTTACGAAGGTGATTCATATATAGTGCTGAAGATATTTGAAAAA
GAAAAACAACTGAATTATGATGTTCATTTCTGGATTGGGAAATATTCAACACAAGATGAATATGGAACGGCTGCGTATAA
AACGGTTGAATTGGATACGCTGCTCGATGACAAGCCGGTCCAACACCGTGAAGTCCAACATTACGAATCGAATTTGTTTA
AAAGTTATTTCCAAAATATTGTATATCTGAAAGGTGGACATGAAAGCGGGTTTAGACACGTTAATACTAGAGAATATATA
CCAAGACTGCTACATTTTAAAGGTGATAAAAGAAATATAATTATTACTGAGATATCGGCGACGAAAAAAAATCTAAAATC
TGACGACGTTTTTATTTATGATACTGGATCCAGTATTTTCCAGTGGATAGGCAAAGGTGCAAATAAAGATGAAAAATACA
AAGCACAACAATTTGCTCAGCAATTGAATGCCGATCGAAATGGAAAGTTAAATATTGAAGTACTTGATGAAGAAGAAACT
CCATCAAATCATGAATTATTCAAACATTTATCGGATTCTGATCCCGAGGAGGAGGACCAGCATCTAAAAGTTTTAAACTT
ACAAGAAACCAAACTTTTCAAAATATCTGATGCAACTGGCTCGTTAAAATTTGAAAAGGTTGCAGCCGGAAAATTGAATA
AATCTCAAATAAATGAAGAGGATGTTTTTATTGTTGACAACGGTCAAATTGTTTATGTCTATGTTGGAGAAGGATCGAGT
CCCAATGAAAGAAAGAATGCCTTGATATATGCTCATAATTATTTGAAGGAAACGGATTATCCTCAAGCACCGGTTACGGT
TATAAATAAGGATGTCAAAGGCGCCAATGCCGAGAATTTTAACAAATTAGTTGAAAATTAATCGGAAATTAAATAGCTGG
AATTTGTGTTAACTTTTTCTTTGGTAATTATGATTAAATATATTTGCGTTTATATTTCTGATTTATGGATTTTAATATTT
AATAAACACAATATTTTG
>SMED30024586 ID=SMED30024586|Name=Pax6A|organism=Schmidtea mediterranea sexual|type=transcript|length=1992bp
GTTGGTTTTTCTAACAGATTTATTAATGCTAGATTGGCCGCTCAAGATTAATCATAATATTCTGCTACTTTACTGATATA
ATTTTTATACACGGTTACTACTACTCCTCTACTATTTTCGCATTGTTGGCTTCTCAAATTCAATCCCTGGGCATAAATCA
AACCGCTTCATTGACAAAATCCTTTTTGACACTACAAGAAATTGATTCAGTTACTGAAGTAGAAAATATACACAGTCGAA
ACCTATGACCGAATCGAATGAAGAGGAAATAAAAAATAAAAAGAAAGTTAAACGAGGACATTCAGGAATCAATCAATTAG
GTGGAATGTTTGTCAACGGTCGACCTTTGCCCGATTCGACCCGACAGAGAATCGTTGAGTTGGCTCACTCCGGAGCGAGA
CCATGTGATATTTCCCGAATCCTCCAAGTTTCCAATGGATGCGTCAGTAAAATCCTATGCAGATACTACGAAACCGGTTC
AATTCGACCGAAAGCCATCGGAGGCAGCAAACCAAGAGTAGCTACCAGTTCAGTTGTGTCGAAAATTGCCGCCTACAAAC
GTGAATGCCCGTCGATATTTTCTTGGGAAATTCGCGATAGATTATTACAGGAAGGGGTTTGCAATCAGGATAACATTCCC
AGTGTCTCTTCGATAAATCGTGTTCTACGCAGTTTGTCTAATGAAAACCAACGACATTTAGTTGCAGCAACTGGAATGTA
TGACAAACTGTCATTGTTAAGCGGCCAGCCTTGGTCTACTGCAGCTGCTCATGCGGCTTGGTATTCCAGTGCTGCAGCAG
CACATGGGTATGCTTCATCGACATTTCCCAATTGTGGTGCCTATGGAGGCTTAACCGGAATCGGAATTATCAATGGAATG
AGTACAGCCCACGCGGTAGCGTCAATTAATCAGTCGAATTCCGGGGTCACAAATTACCATGTTCAATCAACAACCGATAG
TTCCGACAAACACAAATCAGAAAAATATTCAGAATCCATTGCACATTCTGAATCGAATGCTTCCAGTGAGCCTGGCAACG
AATATATGTCCGGAGTAAAAAGTGAGAATGATGATATGAGAATTAAACTGAAAAGGAAACTTCAAAGAAATCGAACATCG
TTTTCAACAGATCAGCTTGATTCTTTGGAAAAAGAATTTGAACGAACTCATTATCCTGATGTATTCGCCAGAGAGAAATT
GGCAGACAAAATCAGTCTTCCAGAGGCGAGAATACAAGTTTGGTTTTCAAATCGAAGAGCAAAATGGAGACGAGAAGAAA
AACTTCGTCGACAACGGCAAAATCTTATGCTTGGTTCAAACGGAACAAGTTCTACTGCTGATACTAATGTAACAACAAAT
GGAAATACTCAATGTTTGTCGACAACCGGACAAAATTCAATGGGATTTTCTGGAATAAATGATATCAGAAACCAATTTGG
TGATGTTGGAATGCAAACACCTTCATTGTCGGCTGTAGCAGCTGCAGGAATGTACCATTCGGCAGTTGCCTCTGCTGCAG
ATCAGTATGCAAAATCAGCCGGTTTACCAAATCTTTCGCAATCGTCAATCAATTCTCCATATTCCTACATGGCAAATTTG
CAGTCGAGATCCAGTGGTTCCCAAATTGACTTGCCAAACGTTACAAGCAATTCAAATTCTTTTTACAACCCCGGATCAGT
TTATCCCCCAAGTTTATTTCAAGGTGTAATGAGAGGATATGACACCATTGGATATCCCAAGTATCCTTCAGCAATGTTTC
CAGGATCACTCGAAAGTAATAATAATATCAACCCTGCCGGTTTTCTTGCAAATAATATGTCTTCGAATTCATCTAAACCC
GATTACGATTTCTCAGCATTTAATCGGCCCAGCAATTATTGGACTCCGGTCGCATAAAATTGCACAAATGAATGAAAACA
ATTTCAAAAATTCCGAAACAACAATGATTAGAACAAAAAAAACATTTTTCTAAAATAGTTGTTAATTTAAAC
>SMED30023854 ID=SMED30023854|Name=Carbonic anhydrase 7|organism=Schmidtea mediterranea sexual|type=transcript|length=1335bp
GTCCAATAAACTGATAACATATGGTACAAATGTGCCTCGAGGTGTTGTGCAAATATACAAGCACATTTTCATCCAATCAA
ATCGATAATTAAAACAAATTAAATAATATATACGCACAAAATTACTTGCTTATTATCGGTATCTCATTTTAGTTTTTAAT
ATATCGAAATTACTCATGAGAATAATTTTGTGTTTTGGAATAATAATTGCCAGTTTCGTGATCCGATCGGATTCGGTGCT
GGACGTCCACGAGTCCTCCTCGGACAACTGGGGCTACAAAGAAGGCCAATCGTTCAAGGGTCCCTCTCAATGGTGGCAGT
TGCCAAATACAACATGTGGAGGCCAAAGACAGTCTCCAATCGACATCGTGCCGAAGTTCACAATATATTGGGAGGATTTG
AAGTTGCCCATCATTTCCCGAATAAACTCCATCAATCATTCTGTAACAATTGAAAAACATTTTGCCTCAATTTACCTCAA
TTTCAATGACAATTGGAAAATAACCTTCGGTGGAAACGGATGCTTGAAACCGGTTGCAGTCCACTGGCATTGGGGGTCAA
GTAACTATATTGGATCGGAACATAGACTGCAGGGTACCCGGTTCCCGATGGAAGGCCATTTAGTAAGCTATGATTGCGGC
CTTTACTCTTCCTTTCAGCAAGCATCCGTCTCACCAAATGGCCTCCATGTAATTGGCTTCTTTTACCGGGTCGGGTTAAA
TAACCCTGCAATAACTATGGTAGCTAGCGCCATTAAATCACACATGAAATTGAAAACGTTCTCTGTCAATGTCTCAGAAA
TTCCTCCTAAAGATATTTTGCCACTAGAACTGATGAACTATTATAGATATGAGGGCTCCCTTACCACCCCGCCATGTACT
CAGAATGTGATTTGGACGGTGCTGCGATCTGTGCAAGATATCAGCGAAGATCAATTGTCTGTTTTCCGAAATTTAGTCTT
CGGAGATCCCGAATTTGGAAAGTTGGTAAACAATTTTCGGCCGATTTTTCCAATCGAAAAGTCAACGGATTATATTCTCC
GTGTCGTCTACGCATCCTTTAATTACAGTTCGAAACTCATGACCAATTTTGTGTTACCTGCGTTTATTTTATTACTCACG
CCTTTTTTCAACAATTATTTACGGAAGTAAAGTCCCGTACAGACGGACTAGGACAGTACAGAGTGTAGTTTTTGTCTCTT
GGATGAAGTCAAGTTCAGAAATATTAATCATAGTTTTTTTTTCTAATAAACTTTTTATTTATATTTTTGTTTTATGTTAT
TATATTTGCAAAATAAAGTATAATGAGTTTTGGGTTATGTTTATTTTCATCGGAA
>SMED30030007 ID=SMED30030007|Name=Rootletin|organism=Schmidtea mediterranea sexual|type=transcript|length=6612bp
GTTGTTTTTAAATCACTATTTTTTTTATTTCATCTGATTATAATTTTTTTTTATTGAAATTTGTATTTTGAAATTGGTGA
ACAATGAGTGAGATAGATTATTCCGCTATTGTTCGGAGACGCATTGGAGATATCGATGGGGATTCAAGTGAAGATTCCAG
TTCAAAGGGTTTGCTTCAAGTTAACTTGGAACTGAGAAAGCGCTTAGAGGAAGAACACAATGAGTATCGTAGAAAGCTGA
TAGTTTTCCAAGACAGCCAACAGAAACAAGCGCAATTGGTTCAAAGATTGCAGAAAAAGGTATTGCAATACAAAGAAAAA
TGCACGGAACTTGAATCTAAAATGCAATTTGGCGATTATGAGACTCGAAAAACGAAGTATGGAAGTCCAACGAATAACGG
CTATGGGTCGCGTAGTGAGAATCCCTACGACAATCTGGATTTGGAGAGCACACTCATTAAGTTAGAAGAGGAACAAAAAA
AAACAAATTATCTAACGGAGTTCAATGAACGGCTTCAAGAACAATTAACTCAAGCAACTCAATCAAACCAGAATTTGACG
AGAGACATCAGTAAGCTTTCCGAAGAATGGCAGAGATCAAGGGAGGAGCTTGAACAGAGAGAAAAAATTTGGCGAAATGA
AGAAATGTCATTTAATGACTATTTAGCATCTGAGCATTCGAATCTGCAAAATTTGCAACGCAATACGATAAATTTCCGCC
GTCAATTTATAGAATTGAAAGCTTCAACTGAACGGGAAATAAATAATTTGAAAAATGAATTCAACCGACAGGCACGCTGT
TTGCAAACTGCTTGTTCCAATCTTTCGTGCAACATGAAATCTGCAGAATCTAAACAACAATTGAGTACTGAACGAGAAAG
TCGGGACAAGTTGAATCTCGAAAATCAACTGCGAGAAAAAAACAGAGAATTAACTGATTACCAAACTCGGTATGAATGTG
AAATGACAGAATTGCAACACCGAGTGAAAGAATTAACAGTTCTCAGTGACAAACTGAAAATTCAAAACCTGGAAAAGGAT
CGAGCATTGACAGCTTTGCAAAGAATTAAGAATGGAGATACCGCAGGAGAAATAAATATGGAAGACAAAGCTACAAGAGT
TCTTATTGAAGACACAGAAAGTATGCATCAAGCACTTCGAAATATTTCTCAAGTAGTACTAAATGATTCTGACTATTTCG
ATGCAGAAGACACAGGATTTGAAACAGTTCGAAAGAATAATCGTTCGCCAAGTCCAAGGAGAAATCGTAGCGTCAGTCCT
AACTCAAGATCAGCTAAAACACCGCCATTTGCCGATGCAACGTATGCGGCGGTTCAGTCGGCTATAAATAAAAAATCTCT
ACAGATTCAAGAGCTTAAATCAAAATTAAACAGTTCTAAAGAGAGTTGTACAAACTTCAAAAGACAAATTGATGACAATG
AAAATGAACGTCGACGATTAGAGAATCAAGTTCTCGCCATGAGAGATGAAATTGAAAGTTTACGACGAGATAAAGATGAT
AGTTTTAGAGAAGCGGATCGGTTTAAAAATGCTCTGAACATCACTTCAAATGAACGAAGCCAATTGGAAAAGATTCGATC
ATCACTAAACGATCAAATTGAGCAGCAACTCACAGAAATTGAACGACTTAAGTCAGCCAATCACGAATTACAACGATTGA
GAGAGGCATTGGAAGATGAGCAAGAAGATACTAAAAAAGACTTAGAAAGACAAATTAAAGAAAGTGAAAGATGCCAACGA
TCGATTGATGTTTTGGAAGATAAAATAAGTCGATTTAAAGAAGACGTAGTTAATTACAAAGAGGCAATTAATAAATACCA
ATTAGAAAAAGAAGTATTGGTGCAAGAAAAGGATGAGATTGGTGATGCTTTAAGTCGTTGTGAAATTTCTAAAGCCGAAT
TAGAAATCGAGGTGAATAAACGGCAAACTATTGAAGTAAATTTGGAAGAAAACATTTCAAAATTATCCTCAGAAATCGAA
GAATTGAATGATAAGCGAGCTGAAAACCACAGAACTATTAAACAGCTGGAACATGAAAGAAGTTCTCTTTTGAATGAAAA
ACGATTTTTGGAACAAGAAAAAAGTGGTTTGAAAGATGAGCTTGTTCGATCTGAACAAGAGGCTCTTGGTTTGTCAAATG
AGAAAGCCATTCAACGTCAAAGAATCGAACAACTTGAAATTAATACAGAAAGATTAGAAGAAGAGTTATCGGAACTCAAT
CGAGAAAAGCTAGATCTTACTGAACAAATAGGCTGTTTGCAGAGGCAGAAATCGGCTCTTGCAGAAGAATTGTTGCAATG
TCGTAGAGAATTAGAACGATCTAATAACAGTGTCAACAACTTATCAAAAGAAAAGGAATATCTTACCAAAGAGAAAGGAG
AACTCGTCGTTCAAGTTACAGCTTGCGAAAGGGAAAATCGTCAACAGTCAGAAGTTATTGCTTCTTTGAATTCCGATAGA
GAACAACTGGAAGCTACTCTTTATGATGCTCAACAATTAATCATTCAGTTGGAAACTCGAAAAGAGCAATTAGAAGGCGA
AAACCAAGAGTTGATTGTGAAAAAAGAAAATCTAAATGGAGAACTAGTCAGATTACGACAAGAGTTTCAACTAGAATACG
AGAAGGTTGTTAATTCACGAGAACAATTAAATTGCAGATATCAACAAATGGATAAAGAATATAAGATGGCAATTCAACAA
GAGCGAGATTCTCATGCTGAAGATGTAGAAAGACTAACTAAGATAAACGAAAGCAATCGTCATGGATCTGAAAACGAACG
AGAAGAGCTTATTCATCGATTCAATATGGAGCGTGACGACATGATTCAAAATTACGAACAAGAGAAACAAGAAATGGCCC
AGGAAATCATGACGATCCAACGAGAACGAGATGACTCATTATTAATGGCGGAAAATGAAAAGCAGCAATCATTGAGTTTA
TTAGAACAAGAAAAATGTGCAATCAATGAAAAGCTTATCAAAACGCAATTTGAACTGCAATCGGTTGAGTCGGAATTGGA
TCGCATTAAAAAGGAGTCGTCCAATCGTCAGGAGCAAGACAAACAGAACATTGCCGGCTTGTCGAGTGAACTCAAATCAT
TTAGATCTCAATTTGAGGATAAATGCCAAAATCACGAAATGGAAGTTAAAAGCCTAAATAGTGGAATCAAGGATCTAACA
TTAATGAAAGATCAAGCTCTCAAAGAAGTCCATGATTTGCATACCGGATTAAAAATAGCTGAAGAAACCCGTGATAATTT
GCGTCGGGAAATCATGGAAATGAATCGGAAATTGAAAGAAGCTGAGGAAGCCAAAGAGCACTTAAAGCGTGAAATTAATG
AATTGAAACGTGGATTATGCGAAGAACAAAGGGAAAAAGAAAATGTTATTAACTCAAATGAGAATTTGAGAAAGAAAATT
AAAGATGTTGAAACAGAAAGAATTGATTTGCACAGACAAGTAACGGATTCCAAACAAAAGGTTGCAGTACAAGATGAACA
ATTGGTCAATTCCAAACAAGAGGTCAATGAGTTAAGAAACAATCTTAAAGACGTAGAAAAAGCTCGATTAGATGTCAAAA
GAGAGTTACAAGAACTCAGACGCCATATCAAAGAGCTAGATACGGAAAGGGGCAAATTGACTAAAGAAGTCAATGATTTG
CAAACTCGTGTTGCTAGAGATGAAGAAAAAGAGGATGAAGCTCGTCGGGAAAATTTCGGTCTCAAACAAAAAGTTGTTGA
AACGGAAGCTTCAAGAGAAGCCGTTCGTAAAGATCTTGCTAATGCTCAACGACATATTGTTGATTTGGAAAATGTTCTGC
AGAGCAAAGACAGAGATTTCAGTTCCATGGTGGAATCGAGCCGCCGGGATTATAGGAAACTTGCTGATGCGAGAAATAGC
CTGCAACAAGTATATGATACGATGGTGGCCGATAATAATGAGCTGAGAATTGCTCTCAGTGGAGCAGAAGGTCGGGTCAG
TGCTCTGGAGTCACACATCGCACGAGTTGAAGGAGCTAAGAAAGAAATTGAATTCAAATTGGCTTCTATCCATAGCTCAT
TGCGAAGGCTGATAGGATTCCGACAGGAGAATGTAGTTACTATTCGGTCGAGAAACAACTCCAAATCTCCAGTTAGAGGT
CGATCAGTTAGTCCTCTTAGAAGTAGGCCGGTGTCGCCAACCAAAGGATTTGACAATACCTATGCTACTACAACTGATGG
AAAAGGTAGCCCTATCCCGCGCACAGGGTCTCCGAGTTCTAAACGAAGGCAATTATCAAGATCTCCGTCTAATTGCGATT
TCAATCCAGTCGATATAAATCCAGAAGCAGTTCGTCTGGCCTTGCGAGAATTCGTACAGCAGTTGGTTGATGCTGAACGA
GATAGAGATGACGCTTTTGCTCAAGCTCGCAGCCTAGAATCTCGATTGAAAGAACAAGAAGAACAAAATGAATATGCTGA
AAACCGTTTACAACAACTACAACAAGCTCTGTGTGATGCAGAAGAAGACAAAAAAGGCATTGATGGAAGATTGTCATCAG
CCCAAACTGCCTTAATGATGCAAGAAGAGACTATTCGGCGCAATGAGAGAGATAGAAAAGCAATGGCGGAAAAGTTGAGT
AATTACGATAGAACATTTGCATCCATGGAATCAGAAAAACGACAATTGGAAGATCGGTTGAATAAATTCCGTCATCATGA
TGCCCGATTGGAAGAAGAACATAAGCAGAGCAAAAAAGCTATTGAAAATGCTGAAAATAGAATAACTCAGCTTCAGCTTG
CCAAGCGATCGTTAGAAGGAGATCTTCAAAGAATGAAAATGGCGTTGACAGATAAAGAAACAGAAACCGAAGTTTTGGAT
GACCGCGTAAATAGTTTACTCAAACAAATACAAGATCTCGAGGGAAAATCTCAATCACTTCAACTAACGATTGACAGAAT
GAGTGTCGCCCTTGCAAAAACTGAGGAAGAAGGCAGTTTTCATAAGGACAAAATGCAACAGTTGAATATGAGTTTGAGCA
CTCATTCACAACAACTGGAACAATTACAGAATAAGATTTCTCAATTACAAAAAGCACTCGGCAGTTCAGAACAAGATCGT
CGGCTCTTAGAGGAACGATTAGAAAGCTCTAAAGGAGCATTGCATGAGGCAAAACATCAAAATAATTTGTTGATGGAAAG
AATACAAATAATTCAATCCGATTTAAATGATTCGGAAAATCGTCGATCAGAATTGGAAGGATTAAATCGACAGAGTAACA
CTTTGATTGTACAAAGACAAGAAGCTGAACAAGAACTCAATCAAAAATATCAGAAATTGAACTCGGAGAAAAACACATTA
CAAGAGCGAGTGAATAGCATGCAACGAAATTTGGCTTTGGCAGAAGCAGAAAAACAAGAAATAATAAAAAACCACGGAAA
ATTGGAAAAGGATAGATCTGCCTTGAAAAAGAGTCTTGGAAAAGTTGAACGTCAGAAATTGAAAACCGAAGAAATTGCTA
GCAAAACTGTTTTTGAACGTTCAGAATTAGATCAAATTTTAAGGAGACTTGAAGATGAAAATTGTGAATTACAGAGACAA
GTTGGAATTCTTCAAAATCAATTAGCAGAAGCTGAGCAAGCTCACTGCCACCATTTGATGGAAATCAATTCCCGCCATCG
CCAGGAAATGTCCATGGAAATGGAGCATTTGAGAGCATCGAATGTTCAAATAGAACGAACTCTAGAAGGCAGAGAACGAG
CCCACAGACAAAGAGTTAAGGGTCTGGAAGAACAGATCTCCACCCTCAAAGACCAGCTGACTCATGAAATGCAGAGGCGG
ATGGATAGTGGATATTACGAGTCTACCAGAAAGTCTAATCAATACGATTCAACTGGTGACTTGCGACATGTTCTGGATTC
CAGTTTAACTCGAGTTGCAAAAGACCCTCAACTGGACGCAATGCTACTGGAAACCGAAGCCAGGCGACTCGATGAGTCGA
TATTCATGTGTGGCAGTCGTGATCAGTCTCCGACCCGGCAGAAGCGAATCGAAATGTCAAAGAAGTCCGCAGCCCCTAAC
AATTCCAATCGGCGATTAACTGCCGGCCGTCGCAAATGAACTCGGCCTGTTCCAGTCCGTCCAGAGATGTTATGAAGCCA
CTTTTTAGATGCGTGAGTGTGAGTTCGTGTTGGTGACTGATTCATTTTTAGTAAACAGATTCTGGATTTTTGTTTTTATT
GATAGTGTAATTTCCTAATGCAGATCTGATAGTTGACTTGTTGTTCTTACGTATTCGGTATTTGTGATTCACATAGTCTG
TCATTGTTACTGTGATTTATCCTCTGTGTGACTTTTGTGATTTACTTACTTTATTGCCCCTATAATCAATAAATGGATTT
ATCGATAGTTCAGCCCTCCCCTCCAGCCCTCGTTTTGGGATCCGTAAATTTTGTTTCAATTGAGATCATTATAGTGATTT
TATTCCTTCGAAACCAAACCTTTGGGAGGGACATAAAATTAAATTATTGATTTTTTATTATCTTAGAAGTGAAAGATGTT
TATTTCCCAAATTAACTAATATCAATAATAACTTTAATTTATATCTTCATTA
>SMED30035179 ID=SMED30035179|Name=Spondin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=889bp
AGAAAGGAACATGACCATTTTGAGACTTTTTTTCTTATTTATATTACTTATTAATTTATTCAGTAGTCGCAAATGTGCAA
ATTGTGAAAATCGATTCAAATCCGATAAATATTCAATTCAAAACGGTAACGGAGGATTCTATTTGTATTTCACTGACGAG
CATGGCAACCAAGTTGAAAGATTTCAGCCTGGAAAAATTCACCGAATCCTCGTCAAAAACGACATGATCGGAGTCAAGTT
TCACACATTTCAGTTGAAAGTCTTCCCGACTGAAAAGGTTAAAAGAAACGAATCGTTGGGAACTTTCAAATATCCCAAAT
TCATTACCGAGGATCCTCAATGTCCGGGAGTTTTCTCAAATAACAATAAACATCTCGTGTCCAAGGTCCATATCAACTGG
ATTGCGCCTCAATATCCGGAACAGTGCATCAATTTACAAGCAACCGTTGCCATGGACTCGAATCTTGTTTATCAGAATTC
TCACAACTTGCAAAAAACTGTTTGCTCCAATGAAATGTTTACTTTTATAAATGACAAGCCTATTGTAAACAATGGAATGA
AGACGGCTTACAAACAATGTTGCGCCTGTGGAACTGCAAGTTATCGGGTGACTTTTCATGGGTTATGGAACAAAACCACT
CATCCGCAAAACTGGCCCCAAGAAAAGAATCAGCTTCATTGGAGTGGCCCAGTTGGTCACCCACAATCATAATTACTTTA
TTTATCATTTGGGAAGTCAAGCATCCTATCCATTTAGCAGTGTCTGCACTACCGGAGGATCCACTGCGTTAAAGGAAGAA
TTCATATTACCTGAAAATAGATTAAATGTTAAGAGTCTCTTTACGTCAGGCTGGTTAAATGGGGAAGAACAGCTAAATGA
AGAGCGTTC
>SMED30028196 ID=SMED30028196|Name=POU domain protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1170bp
GTATTTAGTAATTTAAAAATAACCTATTTATATTATTGATTAACATAATATAAATATTTAACATCTATAAGATTTCATGA
ATTATTACTACCAATAATTTTTTTAAACTTAAAACACTTGATAAGTATCATGAAATGTTTTTTATTTCCTATTGAATCTA
CAGAAAAGGATAAGTCTTGCACCTTTGTTCTGAAAGATATTAATGAAATTCGAATTTCTGTTCCTATAAAGATATCAGCA
AATAATGATTGTAATAAAACAATTAGCTTTTCTAATTCAGATTTAGAAACTTTAGCCAAAGAAATATCAGCTGCTTTTTC
TAGTAATACTATTGAAAAGAGTACAGAAATAAAAACACTGAATGATTTTATACTTAATCAAAACAAAGATCTTCAAAATT
ATATTAATCATGTTAATGATATACCTACTTTAGATGACTGTTTGCGAAGTAAAAATTTTATATTCAAAACCGAACAAGAT
TTAGAAAGTTTGCATAAAACTCCTTCGACGGCTAGCGAGCAAGAGTCATTAAATATACTATTGAATAAATCTTTGGTTTT
TGATCTGGATTTTATTAAGCAATTTACTAAAGAATTTAAACAATTTCGACAAAATTTAGGAGTAACCCAAATGGAAGTCG
GCCAGTCCATGAAATATTATTTGAAAAGTGATTTCAGTCAAACAACGATTTGTCGATTTGAGTCTATGACGCTGGCATCA
ACAAATATGTTTGAATTGATTCCATATTTCCGAAAATGGATATCCAAAGTATATAATCCCGACAGAACCAAGACAATTAA
AAATGTCATTTCTAAACTGGAATCAATTGACATTTCTCGAGCATTGGAAGACGAGTTTGCGAAAGATAAAACGGACAGCG
AGTCCAGCAATAACAGTAATGGTGATGAAATGGTAAATGTCAAAAGCAAAACTCGGAAACAACGAATCCAATTTACGAGA
TTTCAGTTGAAAAAAATGGAAAGTCTTTTTCAAACAGTCAAACATACGCAAATTACACCGCATGTTTACAAGAAATATGC
TAAAGAATTGAAATTGAGTGAGAAACAAATCCGATGTTGGTTTACTAAGCGCAGAAGGAGTGATAGAATGCACAAGAATA
AAATGAAAATGGAAAAATTTAATTTATAAATAAAATTATGAAAATTTACG
>SMED30026364 ID=SMED30026364|Name=SMED-P53|organism=Schmidtea mediterranea sexual|type=transcript|length=2047bp
CTCATGACAGTTTTATTAAAGTTACTATTATTAGGAATTCTGCGCGTTAAACTAGACATTATCGATGGCCCAGCAATATA
TTACTTCGGCTTTCGATCCAAACTTCACAACGTTACAGCATCAGACTTCAATACATTATAAATCCTCTCCAATTGAAATG
ATTGTTCCGATGCAATGCAACCAAAACCAAGCCACCTTATCTATAACCCCTGTTCATATTTCTCCATTTGTTAATATATC
AGATTCTAATAATCACAATTTGACGAATATCGTCGAGCCTGTTTCATCAAATACTATGTCTCCTGCTTTTAAATCCGACG
ACATGCCAACATTGTCTTCTTATCCAGGTCCGTATAATTTTCAAATCTTTATTCCCAACGGAGAATTTGATGAATCCAAA
AGAAAAGGACAGACATGTGTGTTTCAAACCGATAAAATGGGAAATCACCAATTATTTACCAAACCTCATCCTCATTATTG
GAGGTTAAATTATTCAGCTGATCCTTCTATGTCAACGGAAAACATGTATATTCGGATGGTTCCAGTTTTTGGGGATCCAG
AAAAAGCTCAATGCATTTTGGAAAGATGTGCAAAACACAAAGAAGTAACAACAGATGAAAATCACTGGAAATATCGTAGC
ATGCTCATTGTAGAAAAAACCTGTGCACATTACTTTCAGGATTCGGCAACGAAAAGAGTTTGCATTTTATTACCGTTTGA
AAAGCATGCGGAAGGAGAGATTTATTCTTCCGTCAACTGTCAATTTGCATGCTACAACAGTTGCTTTAATCAAGATTCAG
GTGGTCGGAAAACACTTTATTTAATCATCACTCTAGAATTTCTCGATAAAAAAACAAATAAATTCGATGTATGGGGTCGA
CAGTGTTTGCAATTTCGCAGTTGTGCTTGTCCAAGTAGAGACTGGAGAGATAAAAAGATTAAAGGCGATCCAGAAATGTT
ACTGAAATTCAAAGAAAAACGAATCAAAACCGAAGAAAAATTAAATAATTTGGTGATTTCTAAAAGCGTCCCTATTAATA
TGGGTGGAAAGGATGCTATCATAAGAGTTCTTCCCTCGTTGCCAGGACTCGATGACGCTATTAACGCATTAGTTTGCGGA
TACTTACTGAATCGAACAACCAACATAAGCGCAATAATAGCAGCATTTAATCAGATGAAAGACGTAGAACATTTAATTAT
CGATCAATTCACATCAAATTTAGATCAAAATACATGTGACAGTAAAAGTCCTTCACAAACTCCAGAGTCTCAGATTTCTC
CGAATACATCAAACCTTCAATTCAACGATTACGGTTCACTTTACGGTGAACCATGTCAACCCTATAGACCGATGCACCAG
CAAGTTGTTAATAATTTTTCCTCTCCAGGAATTTTCAGTAAAATACCTTTTGAAACTTATCCGGTTAGTTATGACATTAA
ACTTTCACATGAAATGCCGCAGCACTTTGATGAGCTGCCATCAGACAACTATAATAGACACTGAAAAATTGCGTCCTTCC
ACGTTTAAAATTGTATAAAAAATAATATGCTTGATTTTTATTTTTGCATTTGTTTTATTTTTTAATGTTGAAAATATTTA
CGTTTGTATTATTTTTTTTTGATTAGTAGTAGTAATGCTGCTTTCAAATTTTATTGAACTTTGATCAGTGATTTTTAATA
TTCAATGACCTGAATTTTTCATGCGTCTTGATGAGGGTTTGAGTGAAAAAATTATCAATTTCTTCACTTTGTCATGTGTG
CTATGTGCATTTATTGATGTATATAACAATATATGTGTAGATAAATTTTATTTTTGTATCCGATTTAGGTTTGCAGGCAC
GATGATGAGTGGTTTTTATTTTGTAAAAATTTTTCGAGATAACATGTGCTCAAATATCAATATTATATATGGTAACATAT
TTTTGCAATAAAAATGCATTTATTGTCAATTTGGCTATAAATTAAGTATCGTACGAATCAAGCAATATTTTATCATTGCT
GTCAATATTTTGTTGATAATTTTTTATTTGCTTTGTTAATAAAGAGC
>SMED30013909 ID=SMED30013909|Name=tud-1|organism=Schmidtea mediterranea sexual|type=transcript|length=2414bp
ATTTAGAAAATGGAGGCAACTTGCGATGTTTTTTTAACGAATTTACCTAAGTCGATTAATGAAGTAGTTGTGAAGAACTT
ATTTTCTTCTGCTGGGAAAGTGTTAAAAGTGAAAATAATAGATGACAAAAGAAACGAAAATCAGAAGCTATGCTTCGTTG
GATTTCGAACTATGGATGAAGCATTAGAAGCCGTCAGAATTGCAGATAAATCTGATGCGTTTGGTGATCCAATTAGAGCC
AGTATATCAAAGAAGTGTTTAGACGGAATGGAGAATAATCAAAATAGATCAAATAATAACAGAAATGATTCAAGTTATAA
AGGAACTGATTCATTTTCAAGAAAGAGTGATTCTAATTTCAAGGATAGTGAAAAGTATCCAACAAACAATGGTGACTTTG
CACAAGTAAATCGTTTAAACAACGTTGGAAGAGGAAGAGGAATCCAGACTAAAATTATTAGTGGTCCACCTTCATTCAAA
ACTAATGAAATTAAGTTAAACGATATTAAACTTAAAACAAAAGAACTGATTGACATCGAAATCGTCGATTTAAGTAGAGT
TGACATTATACTTATAAGGCCAGTAAAGTCAACGGAAAATTCAAAAATTGAAATAGCAGATTTATTGTCACAAATAAATT
CAAATAAATCGAATCTAATGCCAGTTGACTGTCCTAAAATAGGAGATTTTTGTCTTGCAAAATGGACTGAAGATGATTGC
TATTATCGGGCTGAATTGTTAGATATATTAAAGGATGGATCTTTCAAAGTTACTTTTGTTGATGAAGGAACTTCGGGTGA
TATTGTGACTGATTTGAAACACATTCCGACTGGTGCTTTACAGCAGTATCCTAAACAATTTTTGAAGGTTTCAATCGGTT
GCTCAGACGCAAAAGAATTAATGTCATTTATTTTACAAGAGTCTGAAGGAAAGGTGATTAAAATTTATTGGCTCGGAGAA
TATTGTGATTCCGTGCCTGTTGTAAATTTATTTCTGAATGAAGATGAAATTGTGGAAAAATATACCCAAATAAATAAAGT
AAATATCAGGAAAAAATTCTCACAGACATTTGATGATCTCCCAGTACATAACCTCGAAACTAATTCACATTTTTCAATAG
CACCATCAATGTATAAAAACCGAAATGATTTTATTCTTCAGATGAAAACTTTCTCGGTATCTTTAAAGCAAAAAAAATGT
CCTACGGTTTTACCAATTCCTGGTGATATATGTATATATGAGAAAAGGAATGCTAATGGCGAATCATTTCTTCGTTGTGT
TATATTAAGGCGCCAACTTTTTTCTTTTGACATCGAGTTAATAGATATCGGTGAAAAAATAATGAATGTTAATATTGATC
ACCTGTACACAGTCGAAGATATTCATGTAAAAGACGCTCCCTGTGCTATTACTTGCGATTTAGATAGTTCTATTAATATA
GATGGTATTAAGCTCCCTCAAGATTTGATCGATGGTGTTCTCTTTAATCTTAAAAAGTACAACAAAAATAATAAATACAC
TGTAAATTTCATTTTACCACAAAAGAAAGCTTATGAATATGCAAAAGTATCATATAAAGATTTGATTGGTAAAAGCTTTA
AAGTAATAATGTCGCACGTTGTCTCTCCCATTAATTTCTTTATTCAACTTGATGATGGAGAGCATCAGCTTGCACTTGGA
GATATTCAAGAAAAATTAAATATTAATTATAATGGATCACCATTCAAAAGTGCTAGCGATGTTAAAGAAACTCAGGCAGT
TATTGCTCCTTTTATTGTTTCCGGAAGTGATGCGGAACTTTTTCGGGCTTATGTTTTAGAGAAACGAAAGGAATCTCCAC
AAATTCATGTATTGTTTATTGATTATGGTAATGATGAATGGGTGAATTATGAAACTTTACTGAATACAAATGAAGAATTA
GTTTCTAAACCAGGTTTCGCAATACATTGTAAATTATCTCTAAATATTAAGAAGGAAGCGTGGAGTCACGCTATTGAATT
ATTTAATGATTTAGCTGGTTATACTGAAAATGACCAGGGGACGTTTGTAATGCAGGTTATTAGTGTCGATGGTGATTCGT
TAGTTGTGGACTTGATTTCAGAACTGAAAGGTTCGTTGACGGCCATCTTAGAAAAAAGTGGTACATGTGTAAAGTCCAAT
GAACCAATATGTAATGGAGGAGGACCCCAAGTTAAATTAAATGGCGTTTCAAATGATAAATCTCAATCAGCTATTCTTGA
AAATTTATCTGAAGGAGAATTATATAAAAAATTTATTGAACTAGAACGGAGATTAAGTGCTTTAGAGATATTGATGAAAT
AATGCTACCCGCGCAATTAGTATTATCAAATTATGATAATCTAGTCTTGATGTGTTTAAAATTTTGTATTTTAACATAAA
TTTATTCCGTGTTG
>SMED30001027 ID=SMED30001027|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=1243bp
TAATAATTTGCACATCAAACCGTAATAATAACGGATCCGTACAATTTCATCAATATAAAATATTACACAACAAATGCGAC
TTGCATCGACAATTCATATAAAAATCTCCAACTTTCACTACTATTCATAAATTACAAATGATCTCCTCAGTTGTATTGTT
ATTTTCTATCTCAGTCGCATTCCTAGCAAATGCCGAAATCTGGGAACCAGATCGAAACCTTTCAAACGTCCATCAGAGTC
ACGCTAATACAAAGTTTTCCAGGAAAATTTCATCTTTGATGGTGGATTTCAAGTCAGAATTCGCCAAATTTAAATTACAA
TATGGAAAGGTTTACGAGTCAATTGAGAAAGAAAACGAAAGATTCAACAATTTCATATTATCTCAAGTTGAAATAAACAA
TCACAATCAAATGTTTGAAAAGGGTCACAAGAAATTCCAAATGGAAATTAATCACATGAGTGATTGGACTCCAGAAGAAT
TCAATCAACTTAATAGCCTAAAGATATCTAATCTCACCGGTTCGACATATTTGCCATTGAACATAAAGCCTGGCCTTCCA
GAGTCTTTTGATTGGAGAGACAAAGGTGCAGTTACTGAAGTCAAAAATCAGAAATATTGCGGTTCGTGCTACGCATTCTC
TACGACAGGCGCGTTAGAAGGTCAACTATTCAGAAAAACCGGAAATTTGATAAGTTTATCTGAACAACAAATTGTTGATT
GTGATCATGTTGATTATGGTTGTAGTGGTGGCTTAGTACCAGACGCTTTCAATTACATCAAATACTCCGGAGGAATTGAA
TCCGAACAAGAGTATCCATATGTATCTGGATTGACAAAGAAACCAAATCCAAATTGTAATTTCAAAGAAAAAAAAGCAGT
TGGAACAGATACCGGATTTGTGAAATTGCCTCCTGGAGATGAAGAGGCTTTGAGAGAAGCTTTAGTGACAATAGGCCCGA
TTTCGATAGCGTTTTCCGCCACTGAGCGATTCAAACATTACAAAAATGGAATTTACCATGATGATTGGTGTTCAAATGTC
CGTATCAATCATGCAGTTTTACTCGTCGGATATGGAATGGATGAAGAATCAGGAACGCCTTATTGGATAATAAAAAATAG
TTGGGGACCCAAATGGGGAGAAAACGGATATTTCCGTTTCGAAAGAAATAAAAACATGTGCAACATGGCATACAATTCAT
ACTATCCATTGGTTTGATTGAACGACTTCTTATGAGTGTGTGC
>SMED30014019 ID=SMED30014019|Name=Intermediate filament b-like protein|organism=Schmidtea mediterranea sexual|type=transcript|length=768bp
AATTAGAAATCGCAGCCTATGCAAGGTTATTAGAAATTGAGGAAGAGCGAGTTTTAAGTTCCGCTGATCAACGTTCTGTG
ATGTCTCAATTTATGAGTTTTTCAGCTGGTGGTGGAGCTGGAGGTTCTAGTGGAGTTGGAGGATCAGGAGTTGGAGGATC
AGGATTTGGAGGATCTAGCTTTGGAGTGTCAGGCACCGGACGATCAGGCTTTGGAGTGTCAGGTACCGGAGGATCTATGG
GAGGAAGTAGATTTAGTGGAAGTCTAGGACTTGGGGGCGGGATTCATTCAAAAAAGATGTCTTCAAGAAGAACGACAACG
GGAAACATTTCTATTGCCGAAAGTGATGAATCTGGGTTATTTATTGTTTTAGAAAATATGGGAAGTCAGACTCAAAGTCT
ATCTGGCATGATGATTAAAAGAAACATAGATGGCGTAGCAAACTTTGTGACCTACTCAATTCCGAAGAAGATCGATCTAT
CCGCTGGTGAAAGAATAACAATTTGTGGACATGGAAAGAAAACAGGTAAAGGAAAAGAACTAGAAATAGAAGAAGATTCT
TGGGGATTTGGAGAAAACGTCATTACTGCGTTATGTGATGCGAATGGCGAGGAAAAAGCGGCTCTTTATCAAGAAATAGT
GGCTTAAATGGCATAGCCGAAAGACTTGCAAATTTAACCTTTTATTTAATGATTTCATTTAATGTTCCTCGCGTTCATTA
TTTGTTTGCTTCTTTCTAGATTAAAGTTTTAAATTTGTTGAAAAAAAA
>SMED30035218 ID=SMED30035218|Name=Gelsolin|organism=Schmidtea mediterranea sexual|type=transcript|length=1573bp
TTATAACAGTCGCTTAATAAAATGATTAAAATCCTTAATTTTTAGTGAATTCAAATAACAAATTTTAAAATCTAATTAAT
AATTAAAATCTGTGACTTTGACAATCGATATGATAAAACAAAAAAAATACAACTGGAAAGACTCCAACTTATCTTTATTT
GGATCTGATACGGAAAAATTAGTCAAAAAAACTTCGTCGGAAACAGAAGCAGCATGGAAATTGGTAAAAACTGTAACTAC
ACCGAGTCTTTTTATTTGGAGAATTGAAAAATTTAAAGTTGTCAATTGGCCTAAAGAAGACTATGGGAAATTTTTCAATG
GAGATTCGTATATCATTTTAAAAATAAAAAAGGAAGAAAATAGTCCTGAATTATTTTATGATATTCATTTTTGGATTGGA
AAAAGAAGTACACAAGACGAGTATGGCACAGCTGCGTACAAAACAGTAGAACTAGATACATTTCTTGATGATAAAGCAAT
ACAGCATCGTGAAGTTCACGGTTTTGAATCTGATTTATTTAAGTCCTATTTTCCGGTTATTACAATAATGAAAGGCGGAT
GTGAAAGTGGTTTCAGACAAGTAACTCCAGAAAAATATGAACCAAGACTTTTACATTTTCACTGTGCTGATCAAAAACAT
GTTGAACTTGTAGAAGTGAAATTTTCAAAAAACTCTTTGGATTCAGGCGATGTATTTATTTTAGACAACGGACTAGAGGC
TTTTCAGTGGAATGGAAAACTATCAAATAAAAATGAGAAAGTTAAAGCAGCACAATTTTTACAGCAATTAGAATCAGAAC
GAAACGGTCGGTGCAAAACAGATGTATTAGACGAAGAAGATACTCCTTTGACGCATAAAATTTACAAATTACTACCTGAT
ACAGCTGTTACTAAGAAGGTTCACAAAGACTTGGCAATTTCCAAACGTCTGTATAGATTATCTGATGAGACAGGCAAAAT
AACGTTTTCTCTAATCTCAGAGGGCAAAACTCCAAAATCTATGCTGAAAGACAATGATGTGTTTATGATAGATAATGGGC
GACACATGTTTGTATATATTGGCGCCGGTGCGTCTCCGGATGAAAAGAAAAATGCAATGTCATATGCACATAATTACTTG
AAAGAAACTGACCATCCATTAATTGGAATTACTTGTCTCCAAGCTGGCCAGCATAGCAAAGAATTTGAGCTTCAATTGGA
CTAGAAAATGATTATGAAATTTTAAATTGCATGGCATTTCAATATTTTTAAATATTTGTGTTTTTACTTAATTTTTACAA
AATGCATGAGTTTATGGTAATTCATTTTCTTAGAAGAGTGAAGAAATATTTTTTTGTTTATGTATTTCATAAATTGCTTA
AATATAATTAAACCTAATGTATATATTGCTGTATTATTTGCTGTTACGAATATTATTGGGCTTGATAGAGCTATCAGAAC
TAACTCGCCATGCTCTTGATCATAACAAGAAATCTACGCAATCAATATATTTGTACCAAAAATCATAACCATTACAATTT
TCACCAACACAAATCAATCTAGTTTTTATTTGTTGCCAGAATCAAATTTTGGG
>SMED30022124 ID=SMED30022124|Name=Gelsolin|organism=Schmidtea mediterranea sexual|type=transcript|length=998bp
TGTACATTAGGATGAATATGGAACAGCAGCGTATAAAACCGTTGAGTTGGACACTTTACTCGACGATAAAGCCATTCAGC
ATAGAGAGGTGCAAGGAAATGAAACTGATCTTTTCAAATCTTATTTCCCAATTATGACAATTATGAAAGGCGGTTGCGAA
AGCGGTTTCCATCATGTTACCCCAGACAAATATGAACCGAGACTTTTACATTTCCGATGCACCGATCACAAGCATGTTGA
ATTGGTGGAGGTGAAACTTTCAAAGCAGGCTTTGGATTCGGAAGATGTTTTAATCTTAGACAATGGCTTAGAGGTTTTCC
AATGGAACGGAAAATTATCCAATAAAAATGAGAAATTTAAAGCCGCACAATTTTTGCAACAGTTGAAATCCGAAAGAAGC
GGACGTGTTAAGACCGATGTTTTGGATGAGGAATTCACTGCTGCCAACCATAGAATATTTAAATTGTTGCCAGATGTTCC
ATTTACAAAGAAAACTCAAAACGATTTAAATATGAGTAAAATGCTTTATCGATTGTCTGATGAAAGTGGAAAAATGACTT
TCTCCTGCATTTCTGAAGGATCAATTCCAAGGTCAATGTTAAAGGATGACGATGTCTACATGATTGACAATGGCAGACAT
TTGTTCGTGTATATTGGAGCACGGGCATCGCAGGAGGAAAAGAAGAACGCGATGTCATATGCCCACAACTACCTGAAGAC
GACTGAGCACCCACTTATCGGAATCACATGCCTCCAATCTGGTCAACATAACAAGGAATATGATCTTCAATTAGAATAGG
ATGTTAAATGATAATTTTGGAATATGTAATAAAAATTAACAAAGCAATTTTTTAAAAACAATAATTTCACAAAATAGGAA
TGAAAATCACAAAAGTATTAAAATTCCATCTATGAATTGAATATCACAATTATAAATTCTTCAACACATAAATCTTGAGC
GAAGCAATAACTTAAAGATTTCAAACATTTACCGCCGC
>SMED30030421 ID=SMED30030421|Name=Macrophage-expressed gene 1 protein|organism=Schmidtea mediterranea sexual|type=transcript|length=802bp
ATTGCATGAAGATATTTCAAATTGTTATTTAATGTGCACCCCATGACGCAAATTATAATTGTATAAAATAATTATCTCAT
TCAAGAAGTTTCATTTCAGGAGCAATAATGACCATTTTATGGGTGTTTTTATTTGCATCAATTCATGGACGTTTTGTATA
TGGAATATTAAATACAAAGGAAGTCACGAATTTAAAACTTAATTACCAGAATTGTCAGTTAGATACGACCCAAAAGACGT
TTGATGTGCTACCAGGAACAGGATGGGATAACTTGGCCAACATTGATATGGGAAGAGTTTTGGACCTTAACTTCTCCTTA
TGCTTATTCTCCAATGATAATAAATATCTGATTCCCAATGAATTGGCTCTATATCCGGAAAAAACTTCAAGAGTAGAAAT
TTCTAGTGAAATCTTTAGTCATTTTGTGAATTATACATCTTCAACGTCAAAATCCATCAACTTGGCCGTAGAAGGAAGTG
TTGAGGATTTGAAATTAGGTGGAGCGTTTTCATTTGAAAATACACAAATAAAGAATGATCAAGGTTGATCAACGTTTGAG
TGACAACCTCTCAATGTATTTACCCAATTCTTCGCAGTTGATAACAAGTGGGCCACCCTCTGACCGGGAGACTACAACAG
CTCGTGAAGTTCACTGCTAGTTTTCATTTGACAAAAAGAAATTTTATTCCGCTTCGATATTTAATAATTGAAATCATGAT
ATTTTCCATTTTTCAACGCTCTGGCGCTATTTCAATCAAGCAAAATGACATATTGGACACAAAATCCATTTTCACCAGAG
TT
>SMED30032088 ID=SMED30032088|Name=Spondin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1776bp
TTACCTGAAAATAGATTAAATGTTAAGAGTCTCTTTACGTCAGGCTGGTTAAATGGGGAAGAACAGCTAAATGAAGAGCG
TTCTGGATTCGTTTCTGTTAATAGAACTCATAATTTATTTAGTATGATTTCAATGATGGGACCAAGTCCGGATTGGTGTA
CCGGAGTGTCAGGAATCGATCTTTGTATGGACGGATGCAAATGGAAATCAAATCTAACAATTCCTCTTTATCCTATCGAC
GCTGGAATACAAACTGGAGAGACCTACAAACCAAATAATGTCACAAGACTTGATGAACCCGACACTATTAGAGAAATTAA
TAAAATTTGGATGAAAAGTAATCCTTTTACTCCAGATACTCCAGTAGCAGAAATCACCCTCACCAGAGTAGAGCCACAGA
AAGACACACAATGTGTTAAAACTCCAGTTAAGGGTGTAAATGAATTTCAAAATGCACAAAAAGAGTCTAGATCTAACACG
CTCGGTAGAAATGGTGCCGTGGAAAAATATAATGTTCTAGATGATCCTCAGTTAGCTCAAATGGCAAAAGCCTTTTGTGG
ATTTTCCGAATGGACCAGCTGGTCACCATGTTCCGTAAAATGTGGAGAAGGTGAAACGTCTCGTACTAGAAATTTGATAA
AAAACTTGAAAAATGAATTGTGTATTCAATTGCCAAGAAAGGAGCAAAAAAATTGTGCCGGTGCTCGATTGGAATGTGAT
CTCTCAAAGAAATGTAGTCTATTACCTTGGAGCTCATGGAGTCCGTGTTCTGCATCTTGTACAACTGAAGGGAAAATGAT
CAGAATTAGAAAATTTGCGAGGTCAAAAGAAAAGGACGAATGCATGAAAAACGTCAAACCAGAAATTATTCTTCAACAAG
TGAAAACTTGTAAATTGGATAAAACGGACTTCCGATGTGATCCGATATCAATTTGCAGCGCCGGTAAATTGGCACCTTGC
ATCAATGGTAAACCCAAGACGAGATTTTTCTACCACATCAAAACTGGAAAATGCGAACCGTTTAAATACTATGATTGCAA
AAAAGGAAATCTGAACAATTTCCCAACTATAGATTCATGTGAAAATGTTTGCTCTAAAGTTATTCAGGAATTACCAAAAA
TAAGACGATCTAATTTAGCCTTGCTTCAAGCAAGAACATCTTATTCAGCTGAAGAGAGTCTTTCGCAAAAAGCCAAAAAC
ATTCCGGAATTCTGCTTTCATGAAGTGGATTCCAGTAAGACCTGCATGAAATCCAAACCAAAGACAATCTGGTATTATAG
TCATCGAAATCGAAAATGCCAATCACTGGTGGATTATGATTGTAAAGGAACTTTAAATAAGTTTTCGACTTTCGACGATT
GCATGAAAACCTGCCGACCTGATTCACAACTCGAATCATTGAAACTTGATAAAGTAGATTGTCAGGTCTCTGAATGGAGT
TTATGGAGGCCATGTTCAAAGTCATGCGGTTGGGGAACTCAATACAAGAAAAGAGTCATTCAAAAGGATTCATTGAATGG
GGGCTTACCATGTCCGGTGCTATATGAATCTCGAAAATGCTTTTCCAAACCTTGTTAATCTGTCAATATTTATTTAAAAA
TTGTTTTTTGTGAATTATAATTTCTATTTCTTAATCTATTTGAAAATGTAATAAATATTACTTTGCGTATTTGATTTAGT
TTAAAGTTTTCTCATTGGTCAATCCGCCGTTGCTAACCAATGAGATCGGCTACTACATCAATTGCGATAATTGACAGTGG
TGAGCAAACCTTTAAG
>SMED30022389 ID=SMED30022389|Name=Proliferating cell nuclear antigen|organism=Schmidtea mediterranea sexual|type=transcript|length=915bp
GTTATTAACGTTATTGGACTATAGTTTTATTATCATAAATTTTTGAATAAAATTGAGATCTTCTTTTAATAATGCTATTT
GAAGCAAAATTAAATAAAGTAGATGCATTTAAAAAGCTGATTGATTCGGTTAAAGAATTAATCCAAGAAGCAGTTTTTGA
ATGTTCATCCAAAGGTATTGAATTACAAGCAATGGATAGTTCACATGTTAGTCTAATATTTCTTTTAATTAAAAAGCAAT
CTTTTTCGTCTTATAAATTTACGAGAAATGTATCTTTGGGTGTAAGTCTTGTAAGTCTATGTAAAATACTCAAACTTTCT
CAAATTAATGATTCAATTACAATTAAAGTTGATAATGAATGTGAAACAGTCGAATTTGTTTTCGAATCATCAGATAGTGA
TCGAATGTCTGAATTCAGTTTGAAGTTAATTGACTTGGATATTGACTGTTTAGCTATTCCGGAATCAGACTATGATTGCG
TAGCAACAATCCCGTCTGTAGAATTTAACAAAATATGCCAGCAATTAGCTGTTATTGGAAGCACTGTAACAATTGTAGTA
ACTAAACAGTCAATTCAATTTTCTTGCTCCGGAGACATGGGGAAAGGGAAAATATTATTAAATCAAACTGTAAATAAACC
GAGAATAGAAGATTCTATTAATATTGAAGTTGTTAATCCATTATCAATGGTTTACTCGCTTCGATTTTTTCATATATTCT
CGAAGGCCTATTCGCTTAGCAACAGAGTTTCTTTATCTTTTGCTAATAATTTCCCAGCTTTGGTGGAGTACAGCATGAAT
GAATTGGAAGGTCATCTACGATTTTACTTAGCTCCAAAATTAGATGATGATTGATTTTGCTCTTTTTCTAGTTTTGGGGT
GATATTTTAATTGTAGTGCTTTTTTAGTATGGTTA
>SMED30012543 ID=SMED30012543|Name=Spondin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=2035bp
CTCCAATGAAATGTTTACTTTTATAAATGACAAGCCTATTGTAAACAATGGAATGAAGACGGCTTACAAACAATGTTGCG
CCTGTGGAACTGCAAGTTATCGGGTGACTTTTCATGGGTTATGGAACAAAACAACTCATCCAAAAGAATGGCCAGAAGAA
AAAGGTCAGCTTCATTGGACAGATCCTATTGGAGTCACCCATAATCATAATTACTTTATTTATCATTTGGGAGGACAAGC
TTCATTTGCGGTTGGTAGTGTATGTACAACAGGAAATTCGAGATCTTTGAAAGAGGAATTCACCTTACCTGAAAATAGAT
TAAATGTTAAGAGTCTCTTTACGTCAGGCTGGTTAAATGGGGAAGAACAGCTAAATGAAGAGCGTTCAGGATTCATTTCT
GTTAATAGAACTCATAATTTATTTAGTATGATTTCAATGATGGGACCAAGTCCGGATTGGTGTACCGGAGTGTCAGGAAT
CGATCTTTGTATGGAAGGATGCAAATGGAAATCAAATCTCACTATACCTTTGTTTCCGTTTGATGCTGGAATACAGACTG
GGGAAACCTATAAACCTGAATCTATTACTCGGCTTGATGAACCGGAGCCTATTAAAGAAATCAGTAAAATTTGGATGAAA
AGTAGTCCGTTTACACCGAATGTTCCTGTTGCTGAATTAATTCTGACAAGAATCTCTCCAAAGACCGACGAAAAATGTTC
TAAATCCCCTATGAAAAATGTTGATGAATTTAATAAGTCAAATGAATTAATAAAACAAAATTATCGCGGTAAAAATAAAG
GAATAGCAAAATATAATGTTCTTGATGACCCCCAGCTGGCTCAGATGGCAAAAGCTTTTTGTGGATTTTCTCAATGGGCT
AGCTGGTCTCGGTGTTCAGTGGATTGTGGAGTTGGGGAATCTTCTCGTAAGCGAGAGTTGATCAAGAATTTTAAAAATGA
ATTATGTGTCCAGCTGCCAAGGAAAGAAACCAGATATTGCTATGGTCGACGAAGAAATTGTGATTTTTCTATGAAATGTA
GTCTTCTTCCGTGGACTGAATGGACTAAATGTACTGCTACTTGTAAAGAAGCAGGAAAGATAGCAAGATCGAGAAGATTC
GTGAGGGAGGCGGAACGAGAAGAATGTTTGAGAGAAGTGACACCAACTACTAGACTATATGAGGAAAAGCCATGTAAACT
CGATCAAACTGACAGCCGCTGTGATCCAGTGTCAATTTGCAGTGCTGGAAAATTGCCTCCTTGTACTAGAGGTAAACGTC
AAACAAGATATTTCTATCACGTCAAGACTGGAAAATGTGAACCGTTTTTTTATTTTAATTTTTGCCAGATTGGCCTAAAC
AACTTTCGCACTGAGGTAGACTGTGAGAAAATGTGCGTTAAAGCCATTGGTCAGCTGCCTGGAATTAAAAGATCAAATTT
AGCTCTTTTGCAGTTTCGAACTTCTTATTCAGGAGACCTTTCTCAAAAAGAAACTAAAATACCAGCTCAATGTTTCAACG
AAATAGAATCAGTAAAGACATGTATTCATAAATCTCCAAGAACCGTATGGTACTACAGTCACCGAAACCAGAAATGTCGT
TCTTTGGTGGATTTCGGTTGTCAGGGAAGTTTGAATAAGTTTTCTTCTTTTGAACAATGCATGAAGATTTGTCGACCTAA
TTTACAGAGTCGTTCTTCAACATCTGATAAAGTAGACTGCCAGGTCTCTAATTGGAGTTCCTGGAGGCCTTGCTCTAAAA
GCTGTGGCAAAGGAACACAGATCAGAAAGCGAATAATTTATAAAGATTCTCTTAATGGTGGAGAACCTTGTCCACTTCTT
TACGATTCTAGAGATTGTTACGGTATATCTTGCAATTAGAGATAGCCATAACTATTTTAGTTTATAAAAGCATTCATCCA
GGCCACAGTTGAAAAGCATTTTAATTATTAATAAATTTTAGAATTGTTAATTTTAGTATTTTAGTATATTTTTGCTGTAT
TTAGTGCAAAAAAAAAAGACGGGTATAAAAAGGTG
>SMED30006796 ID=SMED30006796|Name=tyrosinase|organism=Schmidtea mediterranea sexual|type=transcript|length=1755bp
TGTCAGTTTAGTCATGCTCGTAATCACAATAGGCATAGTCTTTGCATCTTTCTTACCTTTGAGTGACTGCCTAATCCCAA
GGATTTGCAGTAGGAATGTCACTCTTTCTAATTCAACATGTTGTCCAATTTATAATGATTTTGTTTGCGGTGGTCCTTTT
CGTGGATCTTGTGAAGTCTCCATTCTTTTTCAAAATCACACTGAGCACTCGGATGTTATCACCGGAAAATTGGAAAATGA
CGACAGACTCAACTGGCCATCAAGATTTTTTAAATTTCTTTGCAGTTGCAAGTCAAACTATGATGGAATAGCCTGTGACA
AGTGTAAATCAGGGTGGCAAGGGGAAAACTGTGAGGTGGTCTCCCCGAGAAAGATTAGACAAAATATTCTTAACATGAGA
TCATACGATGTTTTTATTTTTTTATCGATACTGAACATCAGCAAATATCAGTTGGCCGATTTCCTGATCACAAATTCGTC
CTCAAACCTTCACTGTGACCCTGTCAATGAAGACAACATTCAATTGGTCAATGCTTCCATTTATGATACAATGGTTTACT
TACATTTCTATGCGTCCAGGAGTACAATGTCTAAAGAACTTATGGAATCCTGCACAGACAAGGATAACAAATTAGACTTC
GCTCATAAAGGTCCAGCTTTTTTTACATGGCACCGACATTATTTACTGATGTTTGAAGACTTATTAAGGAGTATTGCAGT
CGAACAATTTGGATATTATAATTTCACATTACCATATTGGGACTGGACGAATCAAATAACTTGTAATATATGTACAAATG
ACTTACTTGGCGATATTCCCACTGAAGATCAAGAATCTAACAGCACATTTTTTAAATGGAAACCGATTTGCCCTCAGAAA
CCTAACGATTTTGATTGTCATATTTGCGATCCAAGCCAGGAAGAACCTTTTTTATGGAGAAAATACTCATCAACGGTAGA
CAGACTTCCTAATCAGAACGAAATTGATGAGTTATTCTCAATCAACCAATATGATTCGGAGCCCTTCAATTCCAGCTCAT
TTAGTAGGAAAAGCTTTCGGAATTTTGCAGAGGGATATTATCGAGTTCATCCAAACTCAGATGATATGAAAATGAAAGAC
ATTGGGAAGGGACTCCCCCATCAAAATATCATGATGCATAATATGTTTTATCAATGGAACTTGGATGGATTTCACAACGA
GTCCCAATGATCCATTATTTCTACTACATCATACGTTTATGGACAAAATCTTTGAAATTTGGCTATTAAGAAATAGACGA
TCTACATACCCTGGGAAATCTTCAACACCAATCGGGCAGCATGCTGACGATTTTATTGTGCCTTTCCTTCCACTAATCAG
AAACAGGAATTTGTTTACTTCAGCAAATGAATTTGGCTACGCCTACGATAACAATATTGTTGGAAATAAATTGTTCACAA
ATCATCAACTAGATTTCGAAAAGAGCTCATCGGAAATTTACTACATCCTAACGGCAGTTGCCTTTGTAGTACTAGTTGCG
ATCGTCGTCGGATTGTACTGCTTCAGACCCAGTCAAATCAGTCACACGGCTTATGAATTCATTGAAGACCAGGAGCAGGA
GGAAAAGACAAATTACTTTAACAACAATGAAAAAATGCCTCTACTGAAATGACAAGCCATTTCTGATGACTATTATAATA
TTGTCACCTTAAATTTTCTTTGAAACAACTTTATTATTGACAAATTTTGAAGAATCCTTTTAAGCAAAATAAAGT
>SMED30009513 ID=SMED30009513|Name=Glycine amidinotransferase, mitochondrial|organism=Schmidtea mediterranea sexual|type=transcript|length=1650bp
AAATCTATATAAATCTTATATGATCCTTTGATGCTTTCAAAATTCAACCGAATCCTTCCATTAAACAGTGTTTATAAAAT
TAGCGCTCCAGCAGCCAACATCAAATATAGAAATTGTTGTAGCAAATCCTCAACAGATAAACCAACAAATAAGCGTAACA
GTCCCGTATGGAGCTGGAATGAATGGGATCCTTTGGAAGAAGTAATTGTTGGTGTACCTGATCATGGTGTAGTTCCATAT
CCTTATCCAGAAACAGCGGCATGCTTTGGAGAACGTTTAACAGAAAACTTTATGAAAAAATATGGAGGAAAATACTGGAG
TGACATCATGCCTAAAGAAGTTTGGAATAACGTTTTGAAGGAACATAAAGAATTCTGTAACATCCTAAAAGGCGAAGGTG
TGACTGTGGTTCATCCAACACCAATGGATATGAAAAAAGAATACGAAACTCCATATTTCAAATCTGTCGGTTTGGATGTT
GCATTTCCAAGAGATATAATTCTCGTAGTTGGCGATGAAATTATGGAAACAACGATGACTTGGAGGTCAAGATTTTGGGA
ATATCTTTGCTACAGACCATTGATGCTAGATTATTGGAAACGGGGAGCAAATTTTCAATCAGCACCAAAACCAGTGTGTA
GCGAAGAAAGTTTTAAAAAGGATTTTGACATTTCAGGCAATAAATTCGATGAGTTGGGATATGTAACAACTGAATTCGAA
CCGATGTTTGATGCCGCAGATTTCATGAGGGCTGGCCGAGATATTTTTGTTCAACAAAGTCACGTAACAAATGCCACTGG
AATTGAATGGATGCGTCGCCATTTAGCTGAAAAAGGAATTCGGTTACACTTGTTGAATTTCAATGATCCATATGCCATGC
ATATCGATGCTACATTTTTCACAGTGAAACCCGGATACTTAATAGAGAATCCTGAAGTCATAAATCCGTATGCTGATTAT
TTGAAGAAGGCCGGTTGGAAGATTGTGAAGGGTCCAAAACCAGCAGATAGATCAGACATGTATGAAGGCATGAGTTACAA
GTGGCTATCTATGAACGTTTTAGTTCTTGATCAAAAACGAGTGTTAGTTGAAAAGCGAGAGGTTGGAATGCACAAAATGT
TTGAGTCAATCGGCATGCAACCGATCAAAGTTGATTTCGGACATTGTTTCGCTGTTGGCGGAGGGTTGCATTGTTGGACT
TCCGATGTTCGAAGAAAAGGAACTCTGGAAAATTACTTTGATTGGCCACAAGAAGTATTGGAAAAAGTATCATTGGATAA
ATAAACAATAATAGTTGAACAAGCTCCTATACTATCAGCAAAATCGACACTATCGCTGATTATATATAAATATTTATATA
TTTTGATAAAATATGTATTTATAATTTTCTCTTATTTTATTGTTATGATAATTTATAAATTTGAATTTTACTTTGTTTGA
ATCATAAACATTTATTAAAGTTATTTGTCAAAAGATGAAAATTAAAACAAAACGTGTAATCATTGCTATCTTCAATCATG
TAACAAGAAATAATTGCAATTTATCTTTATGTTGAGATAGCTCTTAGAACGCTTGGACCGATAGCGCTAAACTGTATGTT
TTATGCTTCATTTAATTACTTGAATGATAAAGGAAATTTGTTTATTGTAC
>SMED30024865 ID=SMED30024865|Name=Intermediate filament b-like protein|organism=Schmidtea mediterranea sexual|type=transcript|length=2214bp
GATCTTATAAATACAACATTAATTGTATAGTGAACTATGTTAGCCATTGAAATGGAGACAAGTAAAAAAATCGCAGTCAA
AACTACGAAACAAGAAGTAAGTGGAAGTGGAAGCTCTGGTGGACTAAATGAACAACAAGCTTTTGGAAGTGGTAGCTTTC
GAACCGGGTCTGGAGGTGTACAGATAAGTGCTAGTGGAGCAATTGGATCTAGCAGTTCAGGCGGAGTTAGTGGCACTGGC
GGAGTTGGTAGCATTGGTGGAGGCAGTGGTGCTGGTGGTGAAGGAACAGGAGCTAGCACAGTTATCACTACAAGCAGATC
TTATTATAAGCCTATCAGTCAACCTAGAAATAATTTAAAAGACTTACAAAAAACTTCTGGTATGAGTTACAGTGCACAAT
CAAACTCCCAGCAAGGTTTAAGTAATATTCCATTGATTAGGGGAGACAGTGTTGCTCTACAATCTGGAGTAACTTCAATG
AAAAAAGGACGAGCTCAAGAGAAAAGAGATCTTCAGGATCTGAATGAAAGATTCGCTAGTTACATTGAAAAAGCTCGATT
TCTAGAGGCGCAAAATAAACAGCTAGCCAATGAGATTGAAAAGTTAAAAGGTGGAACCGTCCAGGACAACTCAAAGATCA
AAGAAATCTATGAAGTCGAAATCAATCAACTTCGAGCTTTGGTAAATGAATCGGAAAAAAGCAAAGCTCCTTTAGAAGCT
CAAGTTGATTCTCTTGAATACGAAATTGATGATTTGAGAAAACGATTAATGATGCTGGAAGACATCAACTCTCAGTACAA
ATCCACCATCGATAAGCAACGCAAAGACATTTCTGGATTTGAAGGGGAATTGGTGGAGCTAAGAAGATTCAAAGGCACCC
AAGGTGCTGATGTAAATAAAGAAAAGGAAGAAGTAAAAACACTAAGAGACGATTTGAAAAAATTGAGACAAGATTATGAG
AAAGAAGCTCTAGCTCATCTCACCCTTGAACATGAATTACAAAGCTTGAAAGAAGCATTAGAATTCGAGAAACAAATACA
TGACACAGAAGTAAAAGAGCTGGCAACCGTTGCATATCGAGACCCAACGAAAGAAAATATGGTTTACTGGCAAAGCGAAA
TGGGACGCGCGTTACGAGACATTCAAACTGAATATGAAAACAAGCTTACAGGAATCAAACAAGAATTGGAGGCTTCTTAT
GGTTTACAAATGCAGGAAATACGAACAAGTAAAACCAGAGACAATGTGGAAACGACCCATTACAAAGAAGAGAACAGCCG
AATAAAATCTCAAATCCAAAGCATGAGATCGAGAATCGCTGATCTTGAGATGCAGAATGCTGAATACGAACACAACTTGA
ATAATATTCGTGCTAATTACGAAGAAACTCAAAGAAGTCTTGAATTGCAGTTGTTGTATTTGCAAGAGCAATTGACAGGA
ACTCAACAAGAATTGACAGTCGCTTTGACCGAACTCCAAAGCTTATTGGACGCGAAGTTGGGACTGGAATTAGAAATCGC
AGCCTATGCAAAACTATTAGAATTCGAAGAGAGTCGTGTCAATTTCTCTGGTGATGGCAACGCTACTTTATCTCAATTTA
TGAGTTTCACATCAAGTAGCGGAGCTGGAGGTGCTGGAGGGGCTGGAGGTGCTGGTGGTGCTGGAGGAGGAGGAGGAGGA
AGCAGTGGGTTCGGATCAGGAAGTAGAATTGGAGGGTCAAGTGGTTTCAGCGGAATGACAGAAAGAGAAACAACTGACTA
TCAGTCAAAACGAATGAAATTTAGACGAACGACAAAGGGAAACATTTCCATTGCAGAGACTGACCTTATAGGTTCAACAA
TTATTCTGGAAAATATTGGGACCAAAGTGGAATCACTCGAAGGTATGACTATTAAAAGAGTAGTCGACGGCAGCGAAAAT
AAAATCTCATTTACCATTTCCGGAAAAGTTAACTTAAATGCTGGTGAAAAGATTTCTCTTTGTGCCAAAGGGAAAATAAC
CGGCAAAGGACGAGAAATCGAAATTGATGATGCTTCATGGGGGGTTGGTAACAATGTCGTAACAACACTTTGTGATTCAG
AAGGAGCGGAAAAGGCAGCTCACTATCAAGAGGTTTCGGCCTAGAAACCTTGCTAAATATTAAACTGAATTTGTATGAAC
ATAACAAAATTTTTAGTAATTTAATAAAAGTTTATTATTTTATAAATCCAAAAA
>SMED30008977 ID=SMED30008977|Name=Lysosomal alpha-glucosidase|organism=Schmidtea mediterranea sexual|type=transcript|length=2946bp
ATTGTTATGCAAAATTATTTTAGCAAAAATTCCGATAGGTTTTATCTAATTAGTAATTAAGTAGATACTTCATGCTCTTG
AACTTGATTTTATTTTAAAATGGAGGTGTGTCGCTGATCTGGAAAAGTTTAATTTCAAATTATCTTTAATTAGATCATCA
CACCTATTTTAGTTGTTGTAGAGAGTCAAAGTTCAGCTTTTAATTAATATATATTCAATTAAAAATTTGCAAAAAATTAT
TTCCATTTCAAATGAAATTAATAATATTAATAAGTTTTATTAATTTGATTTCGTTATTCAACTTTTCCAACGCGACAGCA
CAATGTCAAATAGCCAATAACAATGAGAGACTTGATTGCTACCCAGAATCCGGAGCCAATCAAGATTCATGTATAGCAAG
GGGGTGTTGCTGGTCCGAACCAATGAGATTGTCCAATAAATTGCAAGGTGTTCCACTATCAATCCCATATTGCTATTATC
CAACTGATTATTCCAACTATATGATTAAATCCTTAAGAAAATCTTCAAGAGGGATCAAAGCAAAATTAGTCAGGGAATCA
CCAAGTTATTTACCCTATGAAGTTGCAATGTTAGATCTTGAGGTAATTTATGAAACAAAATCTAGAACTCGAGTCAGAAT
AACAGATCCTAAACAAAAAAGATATGAAGTTCCAATGAAACTCAGTCCTCCAGATTTGAAGCCACCGACTGATCGAGAAT
ATGAAGTCATAATCCCATCTGATGGTTCATTTTCTATTGAAATTAAACGAAAATCAGATGATCGTTCACTTTTCAAATCA
TTTGGGCCACTTTTATATTCTGATCAATTTTTACAAATATCTTCAATAATGTCAACTGATCAAATCTATGGAATAGGAGA
ACAAAATAGACCCTTTCTTCATCAATTATCCAATGGCTGGGAAAGAATTGGATTGTGGGCAAGAGACAATCCGATTGAAA
CATTTATGAATCTTTATGGAGCTCATCCATTTTATATCGGTATGCCAGACGATGGAAAAGCTTTCGGTGTTTTTCACTTT
AATAGTAATGGTCAAGAATTCGCTTTACAACCGGCACCAGCAGTAACTTATAGAACAATCGGTGGAATTTTAGATTTCTT
TATTTTTACCGGAGGCAGCCCTGAAGAAACAGTAAAACAATACCTAGAATTGGTAGGAAAGCCAATGCTTCCTCCATATT
GGTCTCTCGGATTTCATTTATCTAAATACGGCTATAAAGATATCAAAGAAATCCATGAGACCCTACAAAGAAATGTCAAC
TCCGGTATATCAGTGGATGTCCAATGGTCTGACATAGATTATATGGATGGTTACAAAGATTTTTCGGTTGATAATCAAAA
TTATCAAAACTTTGGAGAATTTGTTAAACAGATCAGAGATGCTTACAATACGCGGTACATTAGTATAATTGATCCCGCCA
TCAGTAATCAGAACACTGACAATTACTCTCCTTATACAGATGGATTGGAAATGGATATTTTCATCAAGAACCCTGACACA
AATGAACCAATAATCGGAGAAGTGTGGCCAGGAAAAACAGTTTTCCCTGATTTTACTCATCCTGATATAACAAAATATTG
GTCAAAACAGATTCGCGCCTTTCATGACATGGTACCAGTGGATGGCTTATGGATTGATATGAATGACCCTTCCAGTTTTG
TTGATGGATCAACCACTGGATGCTCCAATAATAATCGGTATGACAGACCGTTTTTTGTGCCGGAAATTCGAGACCAGTCA
TTAATAGCAAAGACAATTTGTTCATCATCCCTTCATTACAATAAAGAAAAACATTATAATTTACACAATATTTATGGCTT
TAAAGAATCTGTGGTCACTAATGATGTATTACTTCAAATTTTTCCGAAGAAAAGACCTTTTCTTTTATCCCGGTCAACTT
TCAGCGGATCTGGTAAATACGCTTTTCATTGGACGGGGGATAATCAAGCTAGTTGGGATCATTTAAGGAACTCCATTAGA
CAAGTGCTTAATTTCAACATGTTTGGTATTCCGATGACTGGTGCTGACATTTGTGGATTTAACGGTAACAGTGATGAAGA
ACTCTGTATTAGATGGATGCAATTAGGCGCTTTTTATCCATTCATGCGGAATCACAATGCAATCAACCAGAGAGATCAAG
ATCCAGCTTCATGGAATACGGAAGCCCAGAAAATAATGAAAACAGCTATTTCTAATCGTTATGCAATGTTGCCTTTATTT
TATACATTATTAGTCAAATCCCATATGAATGGTGGCACCGTAATGAGACCAATGAGCTTTGAATTCTTTTCAGATAAAGT
AACGCATTCTATAGAATTACAGTTTATGATTGGATCCTCGATTATGGCAACTCCAGTTGTTTATCCTGGGGCCAGATCTG
TAGATGCATATTTTCCAGCTGGAGTCTGGTACGATTTTCACAGTGGAAAATTGTTACATTCAGATGCTGAAGGAGCTTGG
TTGACTTTGGATGCTCCTTTGGACAAAATTAATATTGCATTACGCGGCGGTCATATAGTTCCTCTATTGGATTCCAATAG
AAATTCTAAATCAAACATACCAAATAAAATGACATTGTATTGCGGAATGGCACAAGATATGAGTGCTTCTGGAGATTTAT
ATTGGGACGATGGCGAGAGCATTGACTCCTACTCACGCAATAGATATAGCTATGTATCATTCAATGCTAGCCCTGAGCAA
CTGTTAATAACACCGGTTTACTTTGGCTACGACTTGTTGCCGGTCTTAAACAAAATCGTAATCCTTGGGTTTGAGAATAA
GTCAATTACTAAATTTCTATTAAATGACAATGATATTCCTTTCCATTATAATCCGGAGACTTCATCTGTGGTGCTCAGCA
GTTTAAATGCCAATTTAAATTCCGAAATAAAAATTCAATGGATGTGAATAATTTTTTGTATTTTAT
>SMED30028321 ID=SMED30028321|Name=Synaptotagmin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1303bp
TTTAATTGTGAGTGTATAATTAATTCATTAATAAATGTGCAAAATATGTTCAGACAAGTATAAAGATATATTCATTATTA
ACCATTCAACCATAACAATAGATTCTGTAAGGCCTCTAAATTCTCTGATTGTCATGTATAACAATGTAACAATTCGAAAT
GTAAACCAAACATCAGTTCTTGGAACTTATTTCAATAACCTATTAAAGTTATGGAACATAAGTCCATTACAAGGAATGTT
CATATCCGTCGGACTTTTGCTTGCTGTCGTTCTGACAGTGGCTATCATTATATATTGTGTTAGAAAATCAGTCGAGGGTG
AAGATACCAAAAGGAGTCGACTTTCAAATCTTAAGAAACATCTTCCAGTGAACAGTTCGTCATCAGAGATTGATACTCCA
CATGGGTATATTGAAGCATCAGTCAAGTATAAAAAAAAGCAGAAAGAGATTGAAATTCAAGACATTCAAATTTACAAATT
AGAATTTAACTCAATGAAAAAGCCGGATTGTTATTTAGTAATGTTTGTAAGGCATGGGAAATCTCAGTTGTATCCTTCCC
AAAGAACGAAAACTGCTTTGAATGATTTGTATCCAAATTTCAATGAACACTTTAAGTTTAAAATAAGAAATATGAACAAC
AATATTCTCCAATTTGAACTTTACGACGAAAATCTATCGGGAAATGACATTCTCATTCGTCAGGGAGAAATGATGTTGAA
AGATATCAGCGAAAAGAAATTCCAGGATTATTTTCAGAATTTTGTAATCCACTTGGACAAGCCTTCAGAATTAAAAGGTC
TCGGTGATGTCGCTGTGATTCTGACTGGAAATCCACCAATTTTGAGAATAACAATTCTTGAAGCAAAAGGATTGGCACAA
AAAGAAAATCTTAACTCCAATTCTTTGTACAGTTTTCACGCAGAAGTTAAAGTTTTCGTCAATAAACATTTAGTAAAACA
TTTCAAAACGAAAAAAATTCGTCATATTTCCAATCCGTATTTCCAGGAAACATTTTCATTAAAAGTTTTGTCAAAAATGT
GGGATAAAATTTTAATAAAAATTGAATTATTCCGATCGGGATTTCGTAGAATCGGAAAGGCTTATATCGGTTACAAAGAG
TCCAATTCGAAAGTTAATTATTTGGGGAACTTGCATTGGGAGAATACTTGCAATGACCGTAAAATGTCGAAAGCGATTTG
GCATACGTTGGTCAAATAGGTTGCATATTTCCCTTTGCGGTCTGATTCTTGATGACCCTCACTCTATTCTGACTATAATC
AAAATCTTGTTCAATCTTATTAT
>SMED30022078 ID=SMED30022078|Name=Translationally-controlled tumor protein homolog|organism=Schmidtea mediterranea sexual|type=transcript|length=629bp
GTCAAATATCTTAAATTTGTTTGTTTAAATACTTGTTTACACTAAACACTTTTATTTTGAAAGTTTATTCCACGATGTTA
ATTTACAAAGACATAATTTCGGATGATGAAATAAGCAGTGATTCATATCCAATGAAACTGATTGATGATATTGTGTACGA
ATTTAATGGAAAGAATATTACCATTAAAAATGGCATACCCGATGAAGCAATCGGTGGAAATAAATCTGCTGAAGGTGGAG
ATGATGATTATTCTGAATCATGTGAAACTCAAATAGACATAGTCTATGCTAATCGACTAGTAGAAATGAGTTATTCGAAA
AAAGAGTACACTACTTATATTAAGGATTACATGAAAAGAATACTCGATATTCTTAAAACTAAGAATCCTGCTCGAGTTGA
TGTATTTAAAACGAATGCTCAAAAATATATTACGGAAATTCTTAAAAATTTTAAAGAATACAAATTCTACACGGGTGAAT
CAATGAATCCTGATGCCATGGTAATTTTATGCAATTATCGGGAGGATCAAATTACTCCTTATTTCATCGTCTTTAAAGAT
GGTGTTGTGGAAGAAAAATGCTAGGCCAAATTGCCAATGGAATGTTATATTAATAAAGAATTGATTGAC
>SMED30001973 ID=SMED30001973|Name=Eukaryotic initiation factor 4A-I|organism=Schmidtea mediterranea sexual|type=transcript|length=361bp
ATCGAAACTAATTATGATAAAATTGTGGAGTCTTTTGAAGATCTAAATTTAAAAGAAGATTTGTTGAGAGGAATATTTGC
TTATGGTTTTGAAAAACCATCGGCAATTCAAAAAAGAGCCATTCTCCCAGCAATCGAAGGCCACGATGTCATTGCGCAAG
CACAATCCGGAACTGGTAAAACTGCCACTTTCAGCATCTCAGTTTTGCAAAACATTGACACTTCCATCAACAAAACTCAA
GCTATCATCTTAGCTCCAACTCGTGAATTGGCCCAACAAATTCATAAAGTCATCATGACAATCGGTGATTATTTGTCAGC
AAAATGTTGTGCATGCATCGGCGGAAGAAATGTAAGAGATG
>SMED30014940 ID=SMED30014940|Name=Gelsolin|organism=Schmidtea mediterranea sexual|type=transcript|length=530bp
CAAATAAATTTTCGTTTCGTAATTATTTAAATTTCACATGTTTTTTATTTAACTATAAATTCTGGAAAATAAATTAATTT
TACATTCAATTAATTCAAACAATGAAATTAGATTTTAAAAGTAAATCATTTCTAGAATTTTTTGTTTTTTAAACTTTCTA
AAAAGGAAACAACTACGGAGCAGTCGAAGAAGTTCTTGTCACCGGACACAGAAAGTCTGACAAAACCGGAATGATAAAAC
AAAAAAACTACGATTGGAAAGATTCCAATTTGGCTTTGTTTGGATCAGACACGGAAAAATTAGTAAAAAAAACTTCCGCT
GAAACCGAACCAGCATGGAGAGTTGCTAAGGCAACTACGGTTCCAGGTTTATTTGTTTGGAGAATAGAAAAATTCAAAGT
CATCAGTTTACCAAAGGAAGAATTCGGAAAATTTTACAATGGAGATTCTTACATTATTTTGAAAATCAATAAAGAAGAAG
ACAGTCCGGAGTTGCTATACGATGTGCATTTTTGGATTGGAAAATATTCT
>SMED30031287 ID=SMED30031287|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=505bp
TTGGGCATTTTCAACGACTGAATCATTGAAAGGTCAAAACCAAAGTAAAACTGATAATTTATTCAGTTTTTCTGAGGAAC
AATTGGCTGATTGTAGTCAGGCATACGGTAATTTTTGTTGTGAGGGTGGTCTGATGGACTTTGGTTTCCAATACGTTATG
ATTAATAGAATTGAAGCTGAGGATGATTATCCATATTCCGGCATCTTGAGTTTCATAGGATAATAATTGCCGATGTAATG
GATTCAAAGCAGTCTGGGAATGTATGGAATACAATGACATCGAATCAGGACATGAACAAGATCTTGTAATTGCCATAGCG
ACAGGTGCACCAGTAAAACTATAATTCTGCGCAACTGCAAGTGTACTTGACATATGTTTAGAGACGGAGTTTATGATGAA
CCCGGATGTGCATTGGATAACCTAGACTATGGAGTATTTGCAATACGGTATGGAAATGAGTATGGCAATGACTATTGGCT
TGTCAAGAATAGTTGGAGAACACGT
>SMED30011624 ID=SMED30011624|Name=Cysteine-rich secretory protein LCCL domain-containing 2|organism=Schmidtea mediterranea sexual|type=transcript|length=868bp
AAAATTGATAATTTAAATTAATTGAAGTAATTATATATTATAATTATAAAATATATGGGCCATTCGTAAAAAATGTCAAA
TGCAAAATGGAAGCGAAATTAAAATAATCTCAATTGATAAAATAAATGAAAGTAAACTGTTTTTTATGGAATATGATATT
TGCAATTTATTTTCGGAATGGAAATTTTTTACTTAATAAAAATGAAAGGAAACTTATTTTAAATCTCCATAACAATTATA
GAAATAACGTGAAGCCTCAGTCAAGCAACATGACAAAAATGACATGGAATCAAACCCTTTACAACTTAGCTTTAAATATT
AGCTGGAATTGTTCATTGGATTTTCCTGGTAAAAATAACAGTGAATTTAGTGAATATGGCATAAATATGTATTTTTCCAT
TATGTCTAAATCAACAGTAAAAGATATTCATAAAACCTTTGAGTCTTGGGTCAGCGAAGAGAAAAATTTTATGTATCCAT
TCAAATGCACTGGTAATTGTATGAATTATACTCAAATAGTATGGTCCAGTTCAACGCAACTTGGCTGCAATGATAATATG
TGTTTCATGAAAAACTCTAGTAAAATTAGAAAATGGAATATTTTTTTAACCTGTCTCTATTGGCCAAAAGGAAATATTTT
TGGAATGGTTCCATATGGATCTGGTAAACCTTGCTCAAAGTGTCCGAAGAAAATGGCATATTGTGTCTATAAGTTATGCT
CTAACTGTGCTGTTCCTCATAAATCCGTCGTTTTCAAAATATTAATAGTATTTTACCTGGAGCTTTATTTGGAATTATAA
TAACAAATTCATATTCTCGTGAACTTTACGAAAATAAATTTCTAATATTGTCTCAATATATTATTTTC
>SMED30014692 ID=SMED30014692|Name=Histone H4|organism=Schmidtea mediterranea sexual|type=transcript|length=464bp
AAATCTATATAAATCTTATATGAGATAAATGTCAGGTCGAGGAAAAGGTGGAAAAGGTCTTGGTAAAGGAGGTGCTAAGA
GGCACAGAAAAGTATTGCGTGATAATATTCAAGGAATCACTAAACCTGCAATTAGACGTTTAGCAAGAAGAGGTGGCGTT
AAACGAATATCTGGGCTGATTTATGAAGAAACACGAGGTGTGCTGAAGGTTTTTCTGGAAAATATCATCCGCGATGCTGT
CACATATACGGAACACGCGAAGCGAAAAACCGTGACTGCAATGGATGTTGTTTATGCTTTGAAACGTCAAGGTCGAACTC
TTTATGGGTTCGGTGGATAATCATTTTGTATTTTATTATTTAATGTTGTAATTGCTATAATTGTTGCTAGTATTAATCTT
ATTTTAATAAATTATTTAACTGGATTTTAATTTAAATATGTCGGTTTTGTAAATCCAATTTGTA
>SMED30002016 ID=SMED30002016|Name=POU domain protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1339bp
GTTGAATTTTTCAAAAACCAAATTTACTTATTTTGAATTGCCATAATGGAAAATGGAGTTGCAACAAGCTGTTCACTTCT
AGCTAATGGTGGATATCATAACTCTGCCTCCGTCGGTTGGAGGTTTCCGCAGAACAATTCAGCCAGCGATTCCGTTGAGA
ACGAATTTATATCAAATGCAAATCTCAAAATTACCTCTTCGAATATTCCAAACTTTTTTTACCAATGTCCGGAAAACAGT
CAATCAACGAGCAATTCTAACGGATTTTATTCAGTGGATACGAATTGCTCGGCTGGATTCCAAGACATGAATACTTACTA
TTCAAGGGTTGCAGCAGGCTTCAATCAATCCTTCGACTTGATACCTCAACACCAGTCTTTTGTGAGGCTCAATTCAACTG
GGCTATCGGAAACTGACCAAATGACTTATATAAATCCAAATCTTCATAGTTCATTTCATCGAAATATTTCATATCCGAAT
TACGGTAGTAACTGTCCTCCTAATGTTAACATAGGAGGAGTTTCCATGGTTCAAGGGTCTTCGTCATCCTTTTTAGGCTC
CAATTATTCAGGCATGCAACAACCAATTCAAGCCGTGAATCAAGGTGACATTGAATATGAAACCCGAGAATTAGAAGCTT
TTGCTGAATGGTTTAAACAAAGAAGAATAAAACTGAGAGTGACTCAGGCGGATGTTGGCCGAGCTCTCGGGAATTTAAAA
TTAGCCGGTGTTGGATCATTGAGTCAATCAACAATTTGTCGGTTTGAATCACTAACTCTCAGTCATAACAATATGATTGC
TCTTAAGCCAGTTTTGCAAACCTGGCTCGAAGACGCTGAAACCGAAGCTAAGGAAAGATTAAATGGCTCTGATGCTTTCT
CTGACATAGATGAAAGAAAACGCAAACGAACTTCAATCACAGATTCAGAAAAACGATCACTGGAAGCATTTTTTACGATT
CAACCACGCCCATCAAGCGAGAAAATTATCCAAATTGCGGAGAAATTGAATTTGAAGAAAAACGTTGTTCGAGTATGGTT
TTGTAATCAGCGCCAAAAACAGAAACGAATGAAGTTTTCCACTCTCGGTTTTCAGCACAACTCGTCAAACATGTGAAATC
CTATTTCTGTACAGGACAAATACCAAGCATTGACCCCTCTGTCTTATTACAAAAAGTGGTATGATTAAAAGTAGAATAAA
AATGATTTTTATTATTTCTTGACCGTAGCTTTTGTTTAAATTGTTTGACTTCATTTTTACGAAACTGTTATTTTTCCCAC
TGGACTGAGTCTTAGGTTCAAATGTGAGATTTGAGGTTGAGCTTTTGCTGAGAATGACA
>SMED30015696 ID=SMED30015696|Name=Macrophage-expressed gene 1 protein|organism=Schmidtea mediterranea sexual|type=transcript|length=2665bp
AGTCGCGATAGCACGCAACGTCGACATTGCGATGACGTAATCATTGTGAATCTCTACTACAATCGGATCATTCTAATCAC
GTGCATCCTAAAACAATATAAATCTTACAAACGGGAATCCAATTGAACATTTATTTACTCAAGCGTGAAACCAATGATAC
CGTGTAGACTTAATAGTATAATATTGTTTATATTTGTTTATGGAGTTCTATCGGTTTCATGTGAAATTGAACCTAACCGA
GATCAACCATCTTCAAGACGAGTTCATGAGTGTAAACTCACCAGCAACCAATATCCAGTGAATGTTCTTCCCGGATCTGG
GTGGGATAATCTTGAAAACAAAGAACTCGGTCAAGTTTTAGAAATTTCATATAAAGGATGTTTTGGATCGAATGATGGAA
GCTTTCTCATTCCAGACAATGTGGTGATCACCCCAATAAAGAAATCTATTGTCGAGTTAACTTCAGATATATTTGACCAT
TTCTCAAATGTCACCTCTACAACGGCGATGTCTATCAACGCCGATGCCAGTTACTCAACACCAAGCTACAAAATCAGTGG
ATCATTTTCATTTGAAAAAATAAGAATAAAAAACGATCAAATCAAAGAAAAGTCGTCGATTTCGAGATCCCAGTTAAGAC
ATGAATTATATGAAGTAGCGTTCCAACCACACTCAAAACTAGACGCAAAATTCAGAAACAGAATTCTAGATATTGGAGCG
TTATTGAAAGAAGGAAAAGACACAATTTATCCACAATATTTAGCGGATTTAATTGTCCGTGACTTCGGCACTCACGTCAT
TCGGTCGGTGGATGCGGGAGCGACACTAATAAAGACTGATGTTTTAAAATCGAATTATGTCAAAGGTTTTAAAGGGGATA
CAACTAAGATTGCAGCTGCGGCATCATTCAGTATGACAACAATGCTTTCAGTCAACCTCAAAGGAACCTATGTTGGTGAT
ACCACGAGTCTCAATGAATTCAATAGTAATAGTGCAAGTACAAAAGTCGAAACTTTTGGTGGTATACCGTTTGGTTCGAA
TTTTAAGTTGGAAGATTGGGAGAAAACCCTTGAAACGAATTTGGTAGCAATTGATCGCAAAGGTGAACCGTTGTCCTATG
CTATCACACCAAAAAATCTTCCAGAATTCGATGAACAAGCAGTTTTCAAAATAGCTACGCTCATCAAAGAAGCAGTCAAT
AGATATTATGCAGCCAACACGAGAGTGGGATGTATGAATATGGAGTCAGAAAATTTCAATGACGACGCAAATGTTGACGG
TGGAAACTGCGAACCTCCTAATACATTTTACAGTTTTGGAGGAACTTTTCAAACCTGCTCAGGCCCTGATTATCAGTGTA
TGGATGTCGCGGCAAAAAACCCAGTGACCAATAGTTATGCTTGTCCTGATAACTATGATACCATTGAATTACAAAGTGGA
TTGAATAAATGCATAAATTATTGCACCAAATACTTATTTTCCACTCAATGTCATTACGAGTGTTCCCAATATGCATTGTA
TTGGTGTTCTTCTACAAACAAAACGAAAATATCAGAAGGCGCACTTTTCGGGGGATTCTACACTAATACATTTCCGAATC
CACTTACAAATTCCTATAGTTGTCCACAATACTATGTAGCGACAAGATTCGGCGTAAACGCCAAGGTTTGCACTGCACTC
AATAAGGCAGAGGCTATGGAACACCATTTGCCGTTTGGAGGATTTTATAGTTGCAAAGTTGGAAATCCTCTACTAGATGA
TCCTCTCTACAACATTACACAGGATCCCAAATATTGGCCTCAAGGTTGTTCAACCGGATATTCATCACATGTAGCTATTG
TCGACAGAGCTTGTCAAATTTCCTATTGCGTTAAAAATAACGCCCTTAGCATGAGAGAGCAACCGCCTCTCTACCGACCA
CCTTTTATTGATTTGGGATTTGGACCCAATATGACAGTAATTACCTCTCTGGACACTCCAATGGGGGTCCGATTATCTGT
TGATGAAAACGGGAAATGGAGTCATAATCACCAATACAAATTATCCAATTACAATATTATAATAATATCAGTCATTATGG
CGGCAGGAGCCAGCATTGCAATTATTATTATAATTCTTGGAGTTCAAAGATTCAGCAGAAACCGAAAAGGTCAAGTCTCA
CCGGAATCTCATGAATTTGATAGCAGATATGATTCTACTAAAGATGTTGCCAATCTTGCGTTACCCGGCGAGGTTCCACC
GTTTCGTGTTATAATTGACGGAGCGAAATGATGCTTGGAACCTTTTATTATTTCTGTTGAATCTGATCTGTAAATGTTTT
CAGAATATTTTTCTAATAAAATCGTTCTGAAATTTTAAAGTGATCCTTGATGCTATTAAATGATGGACTTTATTGTACCC
CGAATTGGGTCACCCTTGTTCACGCAAATTCGTGCTTAGGATATTTGTACGGGCTTATGCAACTTTTTAAATTTTTATTT
TTCCTTATTTTTATTAGCAATCCGTTTTATTTATAACGACAAATGCTTGATGTTTGAATCAAATTTTTATTATGTTTCTT
AATGAAACATAGTGAACAATGTGCCACTAATTTCATAACCAAGGTCTAATCAAATAGTTTGGGTAGTGAAAGCAATATTA
CAGAGTTTAGGTTTGTCATTCATAT
>SMED30000139 ID=SMED30000139|Name=Macrophage-expressed gene 1 protein|organism=Schmidtea mediterranea sexual|type=transcript|length=2115bp
GTTTGATAAAAGTTATAATTTTATTATTAAATAGTGAAAATGACAATTTTTATGTTGGGTCGAGTAATTTTATTCCTCTC
AATCGGATCCATTTTGGCTGTGCTGGCTGAGGAGAAAGAGCTAAATATTACTCATCCCCACAAAAATATTGCCACTTCGA
ATTTGCCATCAGCCAAATTTGTACATGGATGCCATTTGACCAACAATCAGTATCCATTCAATGTGCTTCCTGGATCTGGC
TGGGATAATTTGTCAAACCGCGAGTTGGGACAAGTTCTAAAAGTAGCCTATTCTCGTTGCAAATCATCCAATGATGGAAC
CTTTCTCATTCCGGACAAAACAAAAATTACGGCGTTTATGAAATCTAGAGTTCAAATGGATTCAGATATTGTAACACACT
TTTCCAAATATTCCTCCTTGACTTCGAAATCAGTAAATCTTGAAGTCAGTTCTGCAACTCCGAATGTTCAGATCAGCGGT
TCATTTTCTTATGAAAAGAAAGACATCAAGGACAATCAAATGAAAGAAAAATCCGCCTTTTCTCAAACTCAGTTAAGATA
TGAATTGTATCGAGTATCCTTCGAACCGGATAGTGAATTGAATGACAGATTTCGTGAAAGGATCCTTGATCTTGGAGTAC
TTATAGAGAATAAAAAGGGTTCAGCTCATGCTCACTATCTCGCTGATTTGATTGTCAGAGATTTCGGAACTCATGTTATT
AAATCTGTTGATGCTGGAGCAATTCTTTCAAAAATTGATGTCCTAAAAGGTGACTATCTTTCAAAACACGAGGGCTCTCA
ACATTCCGTGACATTAGCTGCGTCAGTTAGTATGAGAGAAACACTTGGAATTAAAATAAGTGGTAATTACAAAACCGGTC
ATTCGGAAATGGAAGAGTACAACAAAAATTGCGTAAGCACTCGAATCTCTACAATCGGTGGTGGACCTTTCGGTTCGAAT
TTCACGCTAACAAAATGGGAAAAAACTCTTTCAACAAATCTTGTGGCCATTGACCGTATTGGGGAACCGCTTAATCACAT
TATTACCAAACGTAACGTACCGGAGTTTGACGATAAAATTGTGTATGAAATCGGAAACCATATCAAGGAAGCAATAAGCC
GATATTATTCTGCTAATACTCGAACTGGATGCATGGACATTATGTCAAAGAACTTTGATGAAAATGCAAATGCCGACAGT
GGATTATGTAATAACATTGAAAATGGAAATTTCTTTGGGGGTTTATACCAAAAATGCAGTTTAGACGATGACTCTCTCTG
TGAGAATATAATACAAAAAAATGCCGCTACTGGGGATTACTCGTGTCCAAATGGGTTCACTCCAGTCAAACTATATTCAT
TCAAGTATAAATGTGAAGGTGATAACTGTCCTATTTATGAAACCTTCTGGTGTGTCTCTAACGGTAAATCGTCAAAAGGA
TATGAAATTTTTTTCGGAGGAATCTACACAACAAATATTCAGAATCCGTTTTATAGGGCTGACAGTTGTCCGCAATACTT
CTTTCCTGCTAATGTTGGAATTAACGGTAAAGTCTGCATTTCAATGGATAAAGAACTGGGATTTAAAAATAGTTTACCAT
TTGGAGGATTTTACAGCTGTTCTATGGGAAATCCATTAGCTCAAAAGAAAGGATTTAATTCAACTGTAAATGGAAGTTAT
TTTCCAAAAGCTTGTGGAAGTGGCTATTCTTCTCATTTTGCTCTCCTAGATGGTGTCTGTCAGTTGTCCTATTGTGTTAG
TACTAATGCACTGACAAAGGGATATGACCTACCGTTGTACAGACCCCCATTTATTGATATTAAAACGGAATCAGAAGTTG
TCAACATCAACGCATTGAAAACGTCGGCTGGAATAAAAATGATTCTTTCTGAAAATGGATCTTGGGAAACAATGATTCCT
GAATTCTATTCCACGTACAAATATGCAATAATAACAGTGCTATTTCTCGTGCTATTATCCTTGCTTTTCCTGATGGCAGT
TTTAGCTTGGAAGGGTTTTAGACAATTTCTTGGAAGGATTTTCACTAAAATACCTTTAGTGAATAAAAAACAATCAAACC
ATAAACCGATTCGCGTACAAATAAAGGTGACCAGA
>SMED30035148 ID=SMED30035148|Name=PROG-1|organism=Schmidtea mediterranea sexual|type=transcript|length=621bp
ATATAATAATCTTAACTATAAATATTATCAATATTATAATCAGAATTTAGTAATATGATGTTACGGATTATTTACGCGTT
CAGCGTGACTTTGGCAGTTCTGCGGGTTAACTGTTTGGAAAGCCCAAAGGTTTTCAAAGACGAAATAGTAAACAATTATG
AAAAAAAATGGATGAAATGCACCAAATTTCTCGATAAGGTTGATGCTGAATGTGACAAAAAATACGATTTACTCGACAAT
GACTGTAACGGCAGTTACAAGCAGCTGTATAAAACGTGCGACGTTAACTACTTGAAACTTAGCGGACGCTGTCAGATGCG
ACTGTCTAAAAATTGCATTAAAAAGTACGGTAAACTCGATCGGCATTGCATTAAAGCCTACGGTGAAATTGACGAATCAT
GCGACAAGCGATACGCAAAATTGGATCCGTATTGCGATGCGCTGTATACAAAAGAAGAAAATTGTGAAAGAAAAATTAAA
TAAATGATAAAAGTGGACTTCCTACTGATGATTTGTGATCTAGTTTATTCAATTTTTCATCCATATATAATAGCAAATTA
TTTCGTCACTTATTTAATTATAATATTTTATATAAAAATGTATTAAATCTTTAAAAAAAAA
>SMED30007406 ID=SMED30007406|Name=SMEDWI-1|organism=Schmidtea mediterranea sexual|type=transcript|length=2730bp
AATCGAATACATAAAAATTTATTTGACACCAAATACAAAGAGACATTAATCTACAAGTAAAATAAGCGTTCGCGAATTCT
GTCATTTATCGCTGGAGGAGTAACACCACGATGAATCTTGCCAACGAGTTCAGCCAAACGATGGGCATAATGCGTTGGAA
CAGGAACTCGGATTGTTCCCATCCAGTTAAAATACAAATGTGTTAACGAATAAGTTATTTGCTGCAATACACTCGGAGAC
ATAACTGAAACCTCATTTGTTTTCTTGTTTGTAAACTTAGTGTCCATAAGAACATTATAATTCGTAGGAGATGCTGTACC
TTTAGTTGTTTTCTGAGACACCAAGTAAAATTCATAGAAATTGGGTTTCACTATTTTCTCATCAACCACAGTACCAGGAT
TTGGATTAGCCCCATCTTTGAAAAATTTAACACTAATTCTCTTCTTAACCACAACATAAATAATTTGGGGCAAAGTTTGA
TTTTCGTAAATTTTCTCTATCATTTTCATAACAGCATCAGTTTCGAACTTTTTGGTAAATGCTAACTGTGAATCTCCAAC
ACCGTCACGATAAATAATCAAACGAAGAGGCATAGTGTTAAATTTGTTTTGGAATGTTGTAAGGGCCGTTAGGAAGTTTT
TGCCCAAATTTTCGTGAAATTCATTTTTACCTTTAGATGAATTGACAAAACTGATATACTGAGAAAATTTGGCACTAATT
GAAAATACGGATGCTTGAACAGATCTTTTACCGGTTTTGCTATGAAAAGTATCCAATCCTACAATCATAGTCGGTGCCAT
TTTAAGATTAATACCCCATGGGTCGTATCCTAATTTAGAAAACATTTGCATAACTGATTTATCTGCAACCGTTTTACGAC
GTCGATCATCTCTATTACTTCCGTTTCTCTGCGTCACACACTGAGTCAATAGACCTGTAGACATTGTAAAATTCTTTACT
TTTGCGTAAACTTTATCATCAGGAATGAACACTAATGCCATATGTACCTTGCTTACACGAATAAAATCTGTTAAAGCGTC
TTCAACTTCATTGGATCGACATGAAGATATACTGTCCATTGTGTAATTGATTCTTAATCTTCCTATTTCTCTTTTAACAT
CTTCAATAAAATTGTTGAAGTGACTAGGGTTTCGATCAACAACCAGTACACCAAAACGATGAGCTGTGCCTTTAGGAACG
TCAAATTTAATTTCCCCAAACTTCCAATCATCAGGGATTTTAGTATTAATTTTAACTTCGTTTGAAAATATATCAACTGG
AGCCAATTCACGACCACGAATCGTAATCGGTTGTTCTTCAATACACATCCCCCAGCTCTTCATATAATCTTTTGATTTCC
CAGCTCCGGTCCACTTACAAAAATCTCTTATGTCATTTAATCGTTCTCTAGGCTCACGTTTCAATACGGTTCCTAAATTC
TTTTGCAAATTTATATTACTTCTTTCACTATCCGAAAATCCACATAAATAGCATAATTCACCTGGAATTGATAAACTTTG
ATCTGTTTCTGTAGGTCCTTCAGGTTCATTTTCAGTTTTTTTCTTTTGGGCGAACCATCGATCGCTTGACTCGCGATATA
ACAAATGGTTGTTTGTCATTTTTCAAATTAATGTTATACCGTTGCTTGAAATAATTCAAATAGGATATCTTTTTATCGCC
TAGCTGAACCTCGTCATTAACATCCATTTCTTTAATATCTGAAATTCTATACGTCTTGTTATTATACTTGGTAATTATGT
CCCTTCCTATTAATTGATCAATTTGATCTCGTCGATACACTGATACTACATTGTTTTCATTTAGAACACGATTAATTCTT
TCAAGATAAAGTAAAGTCGAAGCAGTTCCATTTTCATTTGTTCCTCTTGTAATTGTAGTAGAATACCCTCCTAATATCTT
GAAATTGTCCATTTTAAAAAAGCTAGGTCCTTCTCGAATACCACCACTTTCACAATTTGATCCCAGAAAAAATTGTCTAC
CAATTTTTTCTTGTCCCATAAATATTTGAATATTATTAAATACAATATTTATCATCTGATAATATTCTTCAGAATTTTTT
AAAAACGTCGTCAGCAATCGTATGGAAATTTCAACATCTTTGATAACTAAGTTTTCTGTATCTTCATCTGAGTGCCACTT
AGAAGTCGTAAATAATCTTCTGCCATCAAAACAAAATGGTTGACCATTATTTTTGCTGTTTGCATAAGCTAATAATAACT
CTAGCTTAGTACGGATACTTTTATTCTCCATAACTACATCATACATGTAAAATGGTCCTTCGACTTTAATATTAAAGTTA
GCGTAGTTAGACTTGAGACTAACTACTCTTCCATCTTTCCCTATTTTGTCTGTAACTGTATCAGGCTGTAAAGCAGGTTC
AATAATTGCGAATCTTCTTTGGAGACCTCCTCTTCTTGGTCTTAAATTGGGATCACTTGTAACATTAGTTGAATCCATTT
CGTAAATTTGAGTAAAAATGTTAAAACAAAGACTTCGGTTTAAATAAACAAAATATACTATGTAAAACGATAAATATAAT
TGCTTTAATGGTTTATGATTTGTATTATATAATAATAATAATTTAATTTCCCTGTGAATATTATATTAAAATATAGTAAA
AATTACTCGTAAATGTGTGTTAAAGTAATAGGATTAAATTAAAATAAACATTTTACGAAATAAGTTCTAGTCAATTATGA
AGTCTTTTCT
>SMED30009302 ID=SMED30009302|Name=PROG-1|organism=Schmidtea mediterranea sexual|type=transcript|length=608bp
CTCCATTCTATTGATATTGCTCATAGACTGTAGCTAACAAGTTCCTTCCATTCATATTTCATTCTATAAGTTTGCGTTCC
GACATCATTTGCAATCATTCTAAAATATCATGAATAAAATTTTACTTCTTACGTTTGTGATTTTTTTCGTGTCCGTTGAA
TGCAGATTCCGACTGAGACTGGACAAAATAGCAAAGAGAGAAATGAGTTCCGAATGTAAAGCCGAACTGAAAAAGTTAGA
TGACCAATTCACGGCAGCGGCAAATAAAATCGACGACGACTGCGATGCGGTATACGTAAAATGGTCAAAGAAATATTTGC
CGGAATATGTAGCTCTCAAAGAGAAATGCGGTTTGGATACTTCAAAAATGACAAAAGATTGTAAAACCGAATTAAAAAGA
TTATTTAATCTTTTTGCAGAAGGAAATTATAAAGTCGATTTGGAGTGCGACAATGAATATGCCGCTCTAGTGAGGCAGAC
GAGTAAAGAGAAAGAAAAATTGAAACAACAATGTGCAAGTTCTCGTTAAAGAAAATAAATTTTTCTAAATTTATTCTTAC
CGCCTTTTTTTATGAAAAATTTAGACAAATAAAACAAAATAGATATAA
>SMED30014981 ID=SMED30014981|Name=Gelsolin|organism=Schmidtea mediterranea sexual|type=transcript|length=1397bp
CTCTTCCGATCTTATCAACTTACTCACATAGATGATAAAATGTTTGGCTGGTTGTTTAAATATTTGAAAAAAAATTGACC
AATAAGAAAAATTTCTGTGCGCCAATTCAATCGATAATTTGCTCACTGACATTTGCATAGTTTTACAGCCGATTTGGACA
GTATAAATACGAATGTCACTTTAGATTAATTTCACTTGTCTTTACATTATCATGAAAAAAGCAGAAAAATACGACTGGAA
GGATTCGAATGTCGAATTAATTGGTTCATCGGAGGATCGCAGTGTTAAAAAATCATCGGCAGACACTGAAAAAGCTTGGA
ATGCTGCAAAAACTTGCAAAACAACCGCTTTGTTTATTTGGAGAATCGAGAAATTTAAGGTTGTTGAATGGCCTAAGCAG
AGATTCGGAGAATTCTTCGAAGGTGATTCCTATATTGTTCTAAATATTTATCAAAAAGAAAAAGAACTACTTTATGATAT
CCATTTTTGGATTGGAAAATATTCGACTCAAGACGAGTACGGCACTGCTGCTTACAAGACTGTGGAGTTGGATACCTTAC
TAGATGACAAACCCATCCAACATCGCGAGGTTCAGGATTATGAGTCTGACATGTTTAAAAGCTATTTTCCAAATATTATA
TATCTAAAAGGAGGTTGCGAAAGTGGATTCCGACACGTCAACACAAGAGAGTACAATCCAAGACTACTCCACGTCAGAGG
CGAAAAGAATAATATAATTATATCTGAAGTTTCGTCGACCAAGAAAAATTTAAATTCTGATGATGTATTCATTTTTGATT
CTGGAAGCTGTATATATCAATGGATCGGAAAAGGTGCTAATAAAGATGAAAGATTCAAAGCTCAACAGTTTGCTCAGCAG
TTGAACTCCGATCGAAATGGGAAACTAAAAATCGAGGTACTTGATGAAGGACAAATGTCCCCAAATCATGAATTCTATAA
TAAATTATCTAACAACGAACCAATTGCTGATGACAAAAACCATAAATCCTTAACAGCTCACGAAAAAAAGCTTTTTCGGA
TTTCCGACGAAACTGGACATTTAAAGTTTGAACAAGTAGCAAGTGGAAATTTCAATAAATCTAATATTCATGAAAATGAC
GTCTTTATTATTGACAATGGGCAAGTTATCTACGTTTATGTCGGAGAAAAGGCAAGTGACAATGAACGGAAAAACGCACT
TATCTATGCACATAACTATCTGAAGGCTACGGATTATCCCCAAGCTCCTATTACCGTTGTCAAGAAGGATATCAAAGGTA
AAAATGCCGAAGAATTCAACAAAGTGTTAAATGGCTGACGACTCAACTTCATATAGAATTTAAATAATTTTACTCTTACA
ATAATTTAATTAAAATTTAGTAATTGTTATTAATAAA
>SMED30025482 ID=SMED30025482|Name=Histone H4|organism=Schmidtea mediterranea sexual|type=transcript|length=552bp
TGTCATTATCAAAATATTTTCAATATATAATAAATCAGAAATCACTAAACAGTCATTACTAAACTATTCTAACTCAAAAT
GTCTGGTCGAGGAAAAGGAGGAAAAGGCTTAGGTAAAGGTGGAGCTAAAAGACATAGAAAAGTTTTGCGAGACAACATCC
AAGGAATCACGAAACCAGCTATTAGAAGGTTAGCTCGCAGAGGTGGCGTGAAAAGAATTTCTGGTCTTATCTATGAAGAA
ACTAGAGGTGTTTTAAAGGTTTTCCTTGAAAACGTAATCAGAGATGCTGTTACTTACACTGAACATGCTAAGCGTAAGAC
AGTCACAGCTATGGATGTTGTTTATGCACTTAAACGACAAGGTCGTACTTTATACGGTTTTGGAGGGCCACAAATGTTGA
TTGTAGTGAATTGTTCAAATATTGTTATTCTATCTAGTAATTCTCAGCAATTTTATTAACGTTATTTAGAAATTAATTTT
ACAATTGCTAATTTCGAATGTTATATCTGGTGTCAATGTTCAGTTATATTATTTTACAAATGACTTGAAATG
>SMED30002072 ID=SMED30002072|Name=Intermediate filament b-like protein|organism=Schmidtea mediterranea sexual|type=transcript|length=2324bp
CATAAATGGTGCACTTTTGAGAAATTTGCGTTGGAGTAAATAGAAAGCAGTCTTAACAAAAGGATAACTAGGTCAGAACA
ATAGCTGCGTTGAAAAATCTATTATAAATATATCCAACTTTCAACTTGTTTCTCTAAAGTTATTTTTGTAATAATGGAAT
CGTCTAAAAGAACTGTCATTACGACTTCTAAACAAGAAGGGCCGATTAGTGGCTCAAGTTCGGTTACTAGATCTGGAGTC
TCAATGACATCAGGTTCTGGTTCTACTTACGGATCGGGATCTGGAGGAGAATTGGGCTCAGGTTCAGGATCCGGCTCTGG
AAGTCGATATCAAAGTTCGTCTCGTGTTACTACAACAACTAGATCTGACTATCCACAATCTGGAAATGAAAGAGAAGACT
ATAATGAATCAGGAAGTCAACAATTCAATGAAGATGGATCAGAGATTTCTGGTCGAATCGTTTCAACTACCAGATCCATG
TATAAGCCAATAAGTCAATCAAGGAATAATTTCAAAGACTTGCAAAGAAATGCTGCATCTTTAAGTTATAGTATGCAGTC
TGGAAACCAACAAAGTGGTTCAGTTATGCCACTCATCAGAGGTGATAGTGTAGCCTTACAGACTGGACTGAATTCGATAA
AGAAAGGAAGAGCTCAAGAAAAAAAAGACTTACAAGAGCTGAATGAAAGATTTGCGAGTTATATAGAAAAAGCACGATTT
TTGGAAGAGCAAAATAAGCAATTAGTCGGTGAAATTGAAGAACTCAAAGGGGGAACTATTCAAGATACATCAAAAGTTAA
AGAGATCTATGAAGTTGAAATCAATCAACTCCGATCTTTACTAAACGAATCAGAGAAAAGTAGAGCACCACTGGAAATTC
AAGTGAATTCCTTGGAATACGAAATAGGCGATTTGCAAAAAAGACTGCTGCTATTAGAGGATATAGGTACACAGTATAGA
GCAACGATTGATAAACAGCGTCGAGAACTCGAGACCTTCGAAGGGGAAATGGTTGAATTGAAAAGGTTTAAAGACACTCG
AAGTATCGATGCTACAAAAGAAAAGGATGAAACAAGCAACTTAAGAGATGAAATAAAAAAATTAAGACAAAACTATGAAA
AAGAAGCATTAGCGCATATCACCCTTGAACATGACTTGCAGAGTTTGAGAGAAACTATGGAGTTCGAGAAACAAATCCAT
GCTACAGAAGTAAAAGAGCTGGCAACCGTTGCATATCAAAACCCAACGAAAGAAAACATGGTTTACTGGCAAAGTGAAAT
GGGACGTGCTTTACGGGACATTCAAACTGAATATGAAAACAAGCTTACAGGAATCAAACAAGAATTGGAGGCTTCTTATG
GTTTACAAATGCAGGAAATACGAACAAGTAAAACCAGAGACAATGTGGAAACGACCCATTACAAAGAAGAGAACAGCCGA
ATAAAATCTCAAATCCAAAGCATGAGATCGAGAATCGCTGATCTTGAGATGCAGAATGCTGAATACGAACACAACTTGAA
TAATATTCGTGCTAATTACGAAGAAACTCAAAGAAGTCTTGAATTGCAGTTGTTGTATTTGCAAGAGCAATTGACAGGAA
CTCAACAAGAATTGACAGTCGCTTTGACCGAACTCCAAAGCTTATTGGACGCGAAGTTGGGACTGGAATTAGAAATCGCA
GCCTATGCAAAACTATTAGAATTCGAAGAGAGTCGTGTCAATTTCTCTGGTGATGGCAACGCTACTTTATCTCAATTTAT
GAGTTTCACATCAAGTAGCGGAGCTGGAGGTGCTGGAGGGGCTGGAGGTGCTGGTGGTGCTGGAGGAGGAGGAGGAGGAA
GCAGTGGGTTCGGATCAGGAAGTAGAATTGGAGGGTCAAGTGGTTTCAGCGGAATGACAGAAAGAGAAACAACTGACTAT
CAGTCAAAACGAATGAAATTTAGACGAACGACAAAGGGAAACATTTCCATTGCAGAGACTGACCTTATAGGTTCAACAAT
TATTCTGGAAAATATTGGGACCAAAGTGGAATCACTCGAAGGTATGACTATTAAAAGAGTAGTCGACGGCAGCGAAAATA
AAATCTCATTTACCATTTCCGGAAAAGTTAACTTAAATGCTGGTGAAAAGATTTCTCTTTGTGCCAAAGGGAAAATAACC
GGCAAAGGACGAGAAATCGAAATTGATGATGCTTCATGGGGGGTTGGTAACAATGTCGTAACAACACTTTGTGATTCAGA
AGGAGCGGAAAAGGCAGCTCACTATCAAGAGGTTTCGGCCTAGAAACCTTGCTAAATATTAAACTGAATTTGTATGAACA
TAAC
>SMED30014446 ID=SMED30014446|Name=SMEDWI-2|organism=Schmidtea mediterranea sexual|type=transcript|length=4773bp
ATTTAATTTTCGAAAAAAAATATGGAGGAAATACCAGTAAAAGTAGCTAAACTTGAAGCGAATGGAAGTGAAACAAGAGG
TAAAATGGGAAATCGTGGTGGCCTGAGAAGAACATTTAGAATTGTTGAACCTAACTTGCAACCTGCTGATATCACTGAAA
AAACAGGAAACATAGGAAGAACAGTTAAATTACAATCAAATTTTACCAAATTCTCTGTTTTGCGTTCAGAAAAGTTCATG
ATGTATGATTCCGTGTTTTCTCAAGTTGGTTTGTCACCCAAAGTAAAATTACAGTTTATTGTTCGAGTCTGCCAAGAAAA
TAAATTGCCAGGGGCTTTTTGTTTTGATGGAAGACGTCTATTTACTAGTGAAAAATGGCATGGAGAATCGGACATTCAAG
AATTTAGTCATGATGAAAAAAAAATGACACTAAGATTGGTATCAACTATCCTTCCTGAAACTGAAGAATATTACCAAATG
ATCAATGTATTACTCAATAATTTACAAGTAATGTTAGGTCAAGAAAGAATTGGTAAAGGTTATTTTTTAAGCCCAAATAT
TACAAAAGATGAAGTTCCCCGTAATTCTGGACCGACATTTTTTGAAACCAATAGTTTTAAAGTTCTTGGGGGCTTTGGTA
CAACTTTACAAAGAGGCACAAAACCAACTGGTGAATTAACCACTCTTTTATATATTGAGCGTATTAACAGAGTATTAAAC
GATAACTCTGTTATGAAGGCATACAACAGAAGAAGTATCGATCAGTTGATAGGCAGAGATATCATAACAAAATATAATAA
CAAAACTTATAGGATAAGTGAAATAAAAGAAATGAACGTAGATGAGAAATTTGAAATGGGTGGTAGAACTTTATCGTATG
CCGAATATTTTAAGGAACGATATAATATTCGATTAACTCAAGGCGATCAACCATTTGTTCTAACGCGAGTGAAGAAACCA
ATGCGTCGAGAAAGAAAGAAAAAAGACGAAGAAGGAGTGGAAAAAGAGAAAGAAAAAGAACGCGAAAAAGAGGCTCCAGA
AGAGAAGGACATGACTCTCAATATTCCTGGAGAGTTGTGTTTCTTATGTGGGTTTTCAGATCAAGAGAAATCGAATATGG
ATCTGCAGAAGAATTTAGGGTGCGTTTTAAAAAGAGAGCCACGTGAAAGATTGGATGATATACCAGCTTATTGTAACTGG
ATTAAAAATAGTGATGCGGCAACTGGAATGTGCAATAAATGGCAGCTGAAAATAGATAACAAACCATTAGAAATCGAAGG
TAGAGAATTACCTCCATGCGATGTAATAAGTGGTGGCAGCAAAATTAATGAAAAAATGGGAGATGATTGGAAATTTGGTC
GAGTTCAATTTGATATTAAGCGTGATCGTAAGCATGAAATCGATGTGGTCATCGTTGATCGAAATGACTTTCAGTATAAA
AATTTTATGAATGATGTGGAACAAGAATTAAGAAACATGAGAATTGATGCTCGAGTTGGAAAGGTTAATACTTGTGGTCC
AAATGATGTTGAAAGATGTTTGAATGATGCCGCTAGAAGTGGAAGTGGGTGTGCTAAAATGGCGCTGGTATTCGTCCCAG
ATGATAGAGTATATGCCAAGGTGAAATCATTTACCATGAGTACTGGTCTTTTAACCCAATGTGTAACAACACGTAATGGT
ACTAATAGAAACGATAAACGAAGAAAGGTGGTTTCAAGTAAAACCGTGATGCAAATATTTGCAAAATTCGGATATGATCC
ATGGACAGTTGAAATTAAATTGAGACCAACTATGATTGTCGGTATGGATACCTATCATAACAAGTCCAGCAAGAAATCAA
TTCAAGCATCTGTATTTTCGATCAACAGCACATTTACACAATATATGAGCTTTGTTAATTCTCCTAAAGGACGTCAGGAA
TTCCACGAAACTTTAGGCAAAAATTTCAATTTAGCGTTAGAAGATTTCAAGAAACGTTATGACATATTGCCCCAGCGAAT
TTTAGTCTTTAGAGATGGTGTTGGAGATAACCAACTTCAATTTACTAAAAATTTTGAAGTTGATGCAATGAAACCGCTTA
TTGAAAATATATACAAAGGCAACGGATTCCCTGTTCCACAAATCATTTATGTCATCGTAAAGAAAAGAGTCGGCACTAAG
CTTTTCAACAGAGGAAATAATCCAAATCCTGGAACTGTTGTGGATAAAGAAATTGTCAAACCGAATTTCTATGAATTTTT
CCTAGTTTCACAAAGAACAACGAAAGGAACTGCAACTCCAACTAATTATAATGTTTTAGAAGATACTCGATTGCTAACGA
AAAAAGGTACTATGGATCCTATGGCACCGAATGAGCTGCAAAAGATTACCTATGCTCTAACTCATTTATATTTCAATTGG
ATGGGAACTATCCGAGTTCCGGTTCCAGTGCATTATGCGCATAGATTGGCTGAATTAGTTGGAAAGGTGCATAAGGGCTC
TAATCCCGTTGCCATTAATGAAAGAATAAGAAATAGGCTCTTCTATTTATAAAAAGATCAAAACTTACATTTTTCTGTGT
TGATTACTATCCCAATTGTGGATTTAATTGTTTCTGAAAGCTGTTCATTCAAATTCTTCTGAAATCCATATTGATTCGTA
AGCAGCCTGTATTTGAATACTAAAATTGATAAAGTAGTTATAAGTATTGTAAAAGTATTAAATATTTGTTTATGTTATTC
GTAATACACTTGGGTTATTGCAATGTTTTAGTTGTTTTTCAATGATAATAAAGCTTAGCTGTATAAATTCTTTTAGGTTT
TTTAGAAGGTTTATTTATATCGTGTAATTGATTGTCGTGTTAATATTAATTAAATAAAAGTTTGATGTAATTGCTTTGTG
TTACGCATAATAAATCTTACGAAATTTCTGAATACAACTGCTGGTGATCGGGATATTGAATGCCGGGTCGTTTGAATTAA
TAATACAAATGCTTTCGATTATTGTCATTAATATTTTCTCCAGTGCGTAATGGGCCAGAGTTCCGGTGCCATGATTAATG
GTTCCTAAATTTTAGAAATAACATTTTGAATGACATGTTAAATGTGTATATAATAAATTTTCTAGTTTTTTTGCTAAGAT
TTTGAGAAATTTTAGTTACCTGTTTTTGTTAATTGCTTTGATAATTTCAATGCTGACACGTGCAGAATTTCACACATCTC
CAGCAGTCGACTGAATTCTTGGATTTTGTTTGATACAATTATGCTTGCAGATGTTATGGCGCATAGATCCAAGAAGGCTG
TGAATCTTGGGTCTTGTTTTGTAAAGGAAGCTTTGTAAAATATGATGGGACAGTTGCACATAAATTCTAGGAATCCAGAT
TTTAGGCAAGATTGAAGTAATGTTGAATGGTTCTATTATAGAATAATCAGTTGCACTTTTAGATAACCAATATACCACAA
AGAGCCATCCGCAAATTTTGAAAGCCCAAAGCATTGAATCGTTGTCTATGTTACTCAGTATAGACAGCAGTAAAATGGCG
CTTTTTTGATATTGTAAACCGAAATGATTACTAGAATTCATTGTTTCGTCAAGAGATTTCGCGAAACTCTGAATATTATC
TGATTGATTTGATACTATTCCTTGGAGTTTACAAATTGATTTCAGTTCCAAATTCATACTATTGTGTTCTGCTGATTTGC
TACTATTGGAGCTCTATAAGGAATTATTAGAATCAATTTTGGTTTGATAGTGGGTTTTGCAATCATTGGCTTATTGTGGG
TTGTGTAACCATGGAAGTAATTGTGAATAGTTATAGTGCTCGCTCTGCATAAAATAATATTTAATCAGTGCTTTAAAGTA
GATTTTTAACGATTATTATGAAAGATTTCTCTTATATATTAATGTTTTTGTATCCTTCAAAAGTTTACTAAAAATAATGC
ACATTTGAAATTTACGCGTTACCATAAAATGTCTGAAGTGGTCCAAAGCAATAAAAGCTTAAAAAGAAAGTTCTTGTTTT
TAAATGTATTGGGATATACTCCCACTAACCTTCCGTACTCCGCTGCCTCCCTTCCCATCACATACAATATTTGCTAGTTC
TACTTACAGAGTTGAAAATCGAAAAATTTTCCCAGTCAATGTCCATGATTATGCTGAATAAATTTTGTCCGAACATAATA
GAGATTGCCTCAGCCAGTATTTCTTTCGTTGTTGAGTTTTGATGAATGACATGTGAGACTAAATTTATGGACAACCATTG
ATTTTGGTTTTGCTGAAGTTGAGACTTCTTACGGTAAAGATAAACACGAAATAATGATAAACTCTAATCAAAAGATATTA
CAAACAAATATTATGATATCAAAACCTTCTGTCGAACCAAGGCACTTGTGTGAGATAATAAATGAAGAATGAATTCGAAA
AAGAAGTCATAATTCGAACATCGCTCCAGAATGCTGTCACTGACTTTGACTTCAATCACATTTTCCAATATTGAAATCAG
ACCGGCGATCACATGGACCCTTGATGATTCAGACTGACCACTGATTACGGGTTGATCGGTTAAATTATCTAGAGATTAAA
ATAATAGTCGGTAAAGGAAATTATCCATATAAACGGGAAACAGAAAAGTTTTAACCATGGTTTCAAAAGCTTTTGGGACT
ACCCCCAGCTTTGCAAAACAATTTTTTAACGCTCTTGTTATGACTTGAATCAACATTGTACAATTGTTACAATAGACTTG
ATGATTTACTTATTTACACCCCATCTAAATTGTTTCTTAACCCTTTGCCACCC
>SMED30020209 ID=SMED30020209|Name=Synaptotagmin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1588bp
TGCTTGAACGCTGTTGGGCAATTTCATACTGGTTGAATGACTCTCCCAGCTGTATTCTGACCTATGAAAGTTAAATTAAT
ATAGTTATTTGTATGAGATTGTTATATATGGAATTTCCCAGTGAATTGCGCCCAATAATTGGTATCTTGATGGGCCGATC
TCGGTTTGTGGAATAATTCATTTGATTACAAGCTAAATTACCTTGAAATGACAGAAACAAAAATGAAATTTCATGCCAAT
TTCACTGCTTCAACGACCTCCGGTAAAACCTCAACAAATGCTGCAAAAGAAAAATTCCAGGAAATAATTACATATTTGTC
GAAAAAAATGAAAGTACCCCCATGGGCAGTTTACGCAATTGGAGTAGCAATCATACTTGTTATCCTCATAATTTTCTTTT
GTCTCATAAAGATTTGTTGCTGCAAACGACGCAAAAAATCAAAAGGTGGAGGCAAAAAAGGAAAAAATGCAACAAAGAAT
ATGAAAATCATTGGTGGAGCTGTAGATAATAAGACCCAATCAGATGAAGAAGATTTGGTTCTAGATAAAGATGACGATAA
TGAAAAGAAAGAAGAGGAAAAAGAATATTTGGGAAAATTAGAATACAAATTAGATTACGATTTTACAAAAGGAGAGCTTA
CAGTTGGAATTTTGCAAGCTCAAGAACTACCAGCACTCGATATGAATGGGACGTCAGACCCATACGTCAAAGTCTTTTTA
AAACCAGATAAAAAGAAAAAATTTGAAACAAAAGTTCATCGAAAAACTTTAAATCCGGTCTTTGATGAAGTTTTTCTTTT
TAAAGTACCATTTTCAGAAATAACTTCCAAAACTCTTTGTCTTCATATTTACGATTTTGATAGATTCTCAAAGCATGATC
AAATTGGTCAGTTGGAAATTCCATTGGGTTCAATAGATTTGTGTCAAGTTGTGCAGGAATGGAAGGAACTTGAACCAAGT
AAAGATAGTGCTGAAAAAGAAAATAAACTTGGTGACATTTGTTTTTCGTTGAGATACGTTCCAACAAATGGAAAACTGAC
CGTTGTCGTTTTGGAAGCAAAGAACCTCAAAAAAATGGATGTTGGGGGATTATCTGATCCTTACGTCAAAATTTCGTTAA
TGATGAATGGAAAACGAATAAAAAAGAAGAAAACAACAATCAAAAAATGTACTTTAAATCCATATTACAATGAATCGTTT
TCGTTTGAGGTGCCATTCGAGCAGATACAGAGGATTAATCTAATAGTAACGGTTGTTGATTATGATAGAATCGGAACCTC
GGAGCCGATTGGAAGGGTCGTGTTAGGTTGTAATGCTTCAGGGACTGCTCTTCGTCAATGGTCTGACATGCTTGCTAATC
CTAGAAGACCAATTGCGCAATGGCAAACTTTACAAGAAATGCCAGAAAAATAACTTTTCCTATTTTTCCTATTATATGCT
GATAAAAATTTAAATCTAGTCATTCGTTATGTGATTTCTTATTTTTAGACGACAATTTTAATATTTTCATCGTTTAATGT
AATTTTTTCTTAACTTTAAGGCTAGTTTTGGTTTTTAGCAGTCTGTATCAAGTGAATGTGAAAATCTG
>SMED30020956 ID=SMED30020956|Name=Lysosomal alpha-glucosidase|organism=Schmidtea mediterranea sexual|type=transcript|length=2869bp
GTAAAGTGCTAAATTTCAAGATGATGTATAGAGAAAATGAATGACCAAAGTACAAAATATAAAGATATTTAAGTAATAAA
ATTGAATTCCGAACTTAAATTGAAATGTTGAAGTTATTGTTGATAATCTCCTTGAACTTTATAATCGTGTCCAATGCTCT
CCAATGTTCAGTACCGAATAACAATTATAGGCTAGACTGCTTTCCTGGGTCCAATGCAAATCAGAACGATTGTTTGGCTA
GAGGATGTTGTTGGTCACCACCGGAAACCCGGGAATATAGTCAGAATAATCCGACTATTCCATACTGCTACTTTCCAATA
GAATATCCAAACTACCAAATTAATTCATTCACTCCTACCGATCGAGGATTCAAAGCTCGTCTAACAAAACAACAAAAATC
ATTTTTACCGAAGGAAATATTAAATTTGAACTTTGAAGTGATCTTTGAGACAAATACTCGATTGAGAATAAGAATCACCG
ATCCGAATGTGCAAAGATTTGAAGTTCCGATTCAGCTTGGATCTCCTGATCCGACTCCACCTTCAAATGTTCAATATAAA
TTCACAATGCCCACAAATGGTTCTTTTGGATTCGAAGTCAAAAGAAATTCCGACGGATTGAGCTTGTTCAAAACATTTGG
TCCTCTATTGTATTCTGATCAGTTCATACAAATATCTTCTTTGATGTCAATCCAACACGTTTATGGAATCGGAGAACAGA
ATCGTCCATTTCTACATGATTTGTCTACTCAATGGGAAAGAATAGGACTGTGGGCACGCGATAATGGAATAGATACATAT
AATAATTTATATGGTACTCACCCGTTTTATATGTCACTGCCTGATTCTGGAGAAGCGTTTGGAGTTTATTATTTCAATAG
CAATGCACAAGAATTTGTTTTACAACCGGCTCCAGCGATTACTTACCGAACAATCGGAGGAATACTCGATATTTTCATTT
TTTCAGGTGGAACACCGGAAACAACCGTTAGTCAATACACTGAATTAATAGGAAGACCAATGCTTCCTCCGTTTTGGTCT
CTTGGATTCCATCTATCAAAATACGGTTATAAAAGTATTGCTGATGTTTCTAACACTCTGTATAGAAATATTAATATAAG
CATACCAATAGAGGTCCAGTGGTCTGACATTGATTACATGGACAAATATAAAGACTTCACATCCGATCCGATCAAATATG
CAAATTTTGGTTCATTTGTTGCATATCTTAATATAACTTTAGGAATAAGGTATATTGTTATAATAGATCCCGGAATCAGT
ATACAAAGTCCCGGTGCATATTCCCCATATGATGAAGGACTTGAAATGAACTTATATATTAAAGATGCGAATACTAAGAA
ACCTTTAATTGGACAGGTTTGGCCAGGGGAAACATGTTATCCTGATTTTACTCATCCTAATGCTTCAAAGTATTGGTCAA
ATCAAATTCAAAGATTTCATTCTCAAGTACCAATAGATGGTTTGTGGATTGATATGAATGAACCATCAAATTTCTACGAT
GGATCTAGAACCGGATGCGCTCTAAATAATCCGTATGACTATCCATTCTTTGTACCGACAATCAGAGATGGTTCGTTAAT
TAAAAAAACAATATGTTCATCTTCTCTTCATTATAACAATGTCATGCATTACAACTTGCATAATTTATATGGTTACACCG
AGGCAGTAGCGACTCATAGTGCTTTATTGAATACCATTCCAAACAAAAGACCATTTATTTTATCTCGTTCCACATTCAGT
GGATCTGGTAAGTACACCTTTCATTGGACCGGTGATAATTCGGCAAATTGGGATCAGTTAGCCAATTCAATCAGGCAAGT
CCTCAATTTCAACATGTTTGGTATTCCAATGACGGGTGCGGATATTTGTGGATTCAATGGAGATAGTAATGAAGAACTGT
GTATAAGATGGATGCAATTAGGTGCTTTCTATCCATTCATGCGGAATCATAATACCTATGGTGTAAGAGATCAAGACCCA
GCATCTTGGAGTAAAGAAGCTCAGAACATTATGAGAAAAAGTATCAATTTAAGATATGTTTGGTTACCTAACTTTTATAC
ATTATTGGTTAAATCATATTTGTACGGTGGCACTGTGATGCGACCATTGAGTTTCCAGTTTTACAGTGATGCTGAGACGC
ATGAAATTGAGAGGCAATTTATGATTGGTTCCTCGATGCTCGTCAATCCAGTTGTTGTCCAAGGAGCTAGAAATGTTGTA
GCATATTTTCCAACTGGAGTCTGGTATGATGGATACACAAATCAAGTCGTCCATTCAGGACCAATTGGAAAATGGATCAG
TTTAGATGCGCCGATAGATAAATTGAATTATGCAATTAGAGGGGGCTCTATTTTGACAGGATTGTTTCCAGCTATGACCA
CTACGTCATCTCGCAATGGTCCTTGCTTTTTATATTGTGCTCTTTCTCTTAACAGAACTGCTTCTGGCGAATTGTATTGG
GACGATGGAGAAAGCTTCGACAGTTATTCAGGAAATAAATATAGTTATATTACCTTTACGGCAGACTCGAGGGGATTAAA
GGTGACACCTCAATTCGTTGGATTCCGTTCTATTCCTTTACTGGCAAGTATTTCTGTTGTTGGACTTGAAAATTTGTCAA
TCACAAAAGTGTCATTAAATGGAAAAGAAGTTCCATTTATTGTTTTGAACAATTGCTTAATAATTACGACTGGGAAGGTT
TCAATGTCAACTGATATTCATGTAACTTGGCTATAAAATTCGGGAATTTTATTTTTGATTTAATTATTCATTTGTTTAAA
AGAGTCATTATTATGGTTTCATTTTATTCAAATTAAATTGAGTTACTTTCACAGATAAAAATCTCACCT
>SMED30035800 ID=SMED30035800|Name=POU domain protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1041bp
GTCAAAGGATTCTGATTTCTGATTTACTTGACCATAATCATTTTTTTAAATTTTTTTAAATTTTATTTAAAAAGTTTAAT
GTATTCAGATTCTTCTCATAACTTAATTTCTTTAATAAATCCATTAGATTTAACATGTCAATCTCAACAAAGTTGTGGAA
TCGAAGGTTTAATTTTACTTCCATATACATCTCTTACTATCAATAATTCTGATAAAATTCCATTTAAAATAGGAAATTCT
GGTGAACTTATATTAGCTCATCTCAGTTATGAAAATTTATATCAACATGAAACGAAGTTACATGACATAAAACTTGAAAT
ACAAGAGCCCAATTCTAATATTAGTAATGAATTATTAAATAAAAAGCTTAAGGATATAAAAAATGAAATTGATATGGATT
GCATATTGGAAATTTCGGTTATAGAAAAAGTAAAGGAAAATATTGCATTTCTTAAATCTTTTAAGAAAAAGAGATTAGCA
TGGAAATTATTTCAAAGTCAAATAACAAGTTCATTATATCAATATAATACTTTTCCAAAATTAAGCCAATCTTATCTCAG
TAGATTGGAAAAATTAGATGTAACCTATCGTTCTGCACAGAATGTAATCTTGTATTTGAATATCTGGTTAAAAAATTCTC
AAGAACTTTTTGATTTATACAAATTGAAAAATTACGAAGGTTCTGAATTTGATGTATTTTCACTTGATTCAGAAAATATT
AATAAATTCCATAGCTATTTACTTAATCACTCTCATTTTTTATGTACTCAAATTAAAAAAGCTCCGTGTATTTTAGACCG
TAAAAAGAGAACTGTGTTTTCGAAAAATGTTCTTCAAAAATTGAGAGCAATTTTTCATGTTACAAGATTTCCCAAAAAGG
AAGATATTCAATTAATCTCGAGTAACTATAACATTAATCAAGAATCAATAATGCAATGGTTTACAAATCAACGAAGAAAA
CTTGTAAAAACATAACTTATGTTGTATGTTTTAAGTCTTATTTAAATGTTATGAATTTATTTAATTATACAAGATTAATT
A
>SMED30027646 ID=SMED30027646|Name=Transcription factor BTF3 homolog|organism=Schmidtea mediterranea sexual|type=transcript|length=541bp
AAATTAATTTGTTTAAATAAATTTCTTTAGAATCACGCAATGGACGGTTTTAAAATTAACACTGAAAAATTAGAAAAACT
TAGTAAGTTGTCGGAAAATGTCCGAACAGGTGGTAAAGGTACAATGAGACGAAAGAAGAAGGTCATTGTCAAGAGTTCAG
CAGCAGATGATAAGAAATTAGAGGCAACCTTCAAATCATTGTCAATGAGCCCGGTTCCAGTTGAAGAAGTAAACATGTTC
AAGGATGATGGAACTGTTATTAATTTCGTTAATCCAAAAGTCAATGTGTCACTTCCATGCAACACTCTCTCAGTTACTGG
AAAATCCGAAATTAAGCAATTGACCGAAATACTTCCAAAAGTTTGGCAACAACTTGGCCCACTTAAAGGAGATCTTTTCA
AGAAAATTGCACAAAACATGGAAAATCAAGCAACTGTCGAAGATATTGATGATGAAGACGATGACGTTCCAACTCTCGTC
ACAGACTTCGATCAACAAAGCAAATTGGAATAACTTTTTAATATCAATAAATTTTTTGGAC
>SMED30020435 ID=SMED30020435|Name=Myosin heavy chain|organism=Schmidtea mediterranea sexual|type=transcript|length=3615bp
TCTGAATTTAAACAAAGATATTCAATTTTGGCCGCAGATGTAATAGGGCAAGGATTTATTGATGGAAAACAGTGTACTGC
AAAGATAATGGAAGCAATCCAATTAGATAAAAACAACTACAGGCTTGGATCAACTAAAATCTTTTTCAAGGCCGGAGTAC
TTGCTCAGTTAGAAGACATGCGAGATGAGAAATTATCATCCATTTTGTCTGTATTCCAAGCACAGATGAGAGGATATATA
ATGAGAAAAGCATATAAGACATTGCAAGATCAACGAATTGCTCTTTCTCTCATTCAAAGAAACATCAGAAAATATTTATT
ACTAAAAACATGGCCATGGTGGAGACTATACACTAAAGTCAAACCACTCCTCAATATCGCAAGACAAGAAGAGGAGATGA
AGAAAGCTGCTGAAGAGTTGATTAAATTGAAAGAAGAATATGAAAAGATAGAAAAATTTAAAAAGGAATTGGAAGGTCAA
AATGTGGTTTTGCTTGAGCAGAAAAATGATTTATTTTTACAACTGCAAACAGAACAAGACAATCTTAGTGACGCTGAAGA
AAAGATTCAAAAGATGATCAATCAAAGAGTTGAAATGGAGAACCAATTTAAAGAATTAGAAGATAAATTAATGGATTCGG
AAGACATTCAAGATGAATTGGAAATCGAAAAAAAGAAATTGTTGTTGGATATGGATGAATTGAAATCGGACATTGACGAA
CTTGAAGTATCTTTAGAAAAGTCTGAACAAGAAAAACAAGCTCGCGATCAACAAATTAATAATTTGAAAGAAGAAATTCA
AAAACAAGATACTTCTATCGGAAAAGTTCAAAAGGAGAAAAAGACTCTAGAAGATAACTTAAATCAGACCAGAGAAGCTT
TAAATGCTGAAGAAGACAAGGTCAATCAGTTGACTAAAATCAAATCAAAATTGGAATCTGAAATAGATGAAATGGAAGAA
GCTCTAGAACGGGAAAAGAAGATCCGTGGAGATGTTGAAAAACTTAAACGGAAATTAGAAGCTGATCTCAAATCAAGCCT
TGATAACTGTAATGAGTTGGAAAATATAAAGCAGGAGTTAGAAGAAAATATTCAGAGAAAGGACATTGAAATATCAAAAT
TAAATGTCAAATTGGAAGATGAATCTTCAATTGTCACTCAACTTCAACGAAAAATTAAGGAATTACAAACTGTTATACAA
GATCTTGAAGAAGATCTAGAAGGTGAGAGACAAGGTCGATCAAAATCTGAAAAAGCTCGACAGTTGGCTGAACAAGAACT
CGATGAACTAGCTGACAGACTTGAAGAGCAGGGAGGTGCTACTATGGCACAAGTGGAATTGGCCAAGAAACGAGAAACTG
AATTAATGAAACTTAAAAAAGAATTACAAGATACCAATTTACAGAATGAGCAAATACTCAATGGTTTGAAAAAGAAAAAC
CAAGAAATTACCAATGAATTCTCCGAGCAAGTCGATCAAATAAATAAATCTAAATCAAAAATCGAAAAAGAAAAGGCGAC
TCTTAAGCATGATCTGGATGAATTTGTTTCTCAATTAGAATCTGTTTCAAAGCTAAAGGCCAATACAGAAAAACATTCAA
AACATTTAGAAAGTCAAATTATGGAATTGGAAAACAAAATAGACGAACAGAATCATCAAATATCAGAAATGGTTTCACAG
TCTAATAAAGACTCTCAAGCAATAATGTCTTTAGAACAACAACTAGAACAAGCAGAAAATGAAAATCACCAATTGAGCAA
ATCCAAACAACAATTCCTCCAACAAATTAATGACTGTAAATCGACTCTTGAAGACGAAGAAAAAGTAAAGGCCAAACTTT
TCAATGAAATTCGTAATCTGAATGATGAAATGGGCAATTTAAGATCCAGTTTGGAAGAAGAGCAAGAATCCAAAAGTGAA
ATTCAAAGGTCACTAGCAAAATCCCAATCTGAACTTGTACAAATGAAAAATAAATTTGATAGTGAAGGTTCAGGTCGCAT
TGAAGAAGTTGAAGAAGCTAAACGTAAGTTGCAAACGAAACTTCAAGACATGGAACAAGAATTTGACGCTATTAAAAATA
AATGCGCGCAACTTGAAAAAATCAAAATTCGTCTCACTGGAGAAATCGAAGACATGAGTGTTGATGTTGACAGAGCTAAT
GCAGTGGCTAATCAACTAGAAAAGAAACAAAAGAACTTTGACAAAACCGTCAGTGAATGGCAGTCTAAATGCAACTGCCT
TCAAACTGAAGTTGATGTTGCAAATCAAGAATCAAGATTTTTGTCAACCGAAGTATTTAAATGTAAAAGCCAAAACGAAG
AATTGCTTTCACAAATCGAAAATCTTAAACGAGAAAATAAGTCTCTCAGTGATGAAATTCACGATTTAACGGAACAACTA
AGTGATGGCGGAAAATCTGTTCACGATATAGAAAAGGCAAAACGAAAATTGGAAATAGAAAAGGAAGAACTGGAACAAGC
TTTGGAAGAAGCTGAATCAACATTGGAAAATGAAGAAGCCAAATTACAAAGAGCTCAGTTAGAGTTGAGTCAGATGAAAT
CAGATGTAGAAAAACGATTGTGTGAAAAGGAGGAAGATTTTGAAGGAACTCGCCGTAATCATCAAAGAGCAATGGAATCA
ATGCAAGCTTCTTTGGAGGCAGAAATTAAAATTAAACAGGACTCAATTAAAGCCAAGAAGAAGTTAGAACAAGAAATCAG
TGAACTCGAAGCCAATTTAGATCAAATCCAAAGACTGAAATCAGATGCTGATAAGAACAATTCAAGAATGCAACAGCAAA
TTCATGATTTACATTCAGAGATTGAACAAGAACAACACAGTAAAAACGAAGTCCGAGAACATGCTCAGATGGCTGAAAAG
AGATTTTTATCGGCTAATGGAGAACTAGAAGATTTGCGAGCCAAATTTGAACAATCAGATAGAAATCGTAGAAATGCTGA
ATCTGAGCTTCAAGATTTGAGTGATAAATACAATGAAAGCCAAGCACTGATCACTTCACTTCAAAGTTCAAAAAGAAAAA
TGGAAATGGATTACGTAGCTATGCAGTCCGATCTTGATGATATGTCAAACCATGTTCAACAAGCTGAGGAAAGAGCAAAG
AAAGCAGCTGGTGACGCTGCCCATATGTCAGAACAACTTCATCAAGAACAAGACAATAGTTTGCACACGGATAAAATGAG
GAAGCAAATGGAAATTCAAATCAAAGAAATGCAGTGTAAACTAGAAGAAGCCGAAAGTAATGTTTTGTCAGGCGGCAAAA
AGACTTTGGCAAAGTTAGAGTCAAAAATACGAGAATTGGAAACTAATCTTGATAACGAAATGAGAAAACATGCTGAAACT
CAAAAGAATTATCGCAAAGTAGATAGACGAATGAAAGAACTAACATTACAATTGGAAGACGATAGAGCTCAACAAGAAAA
ATCAAATCAAGTTATTGAAAAATTCCAAGGACAAATCAAAACCCTTCGAAAACAATTAGAAGAATCAGAAGAAGTTGCCG
TTTTGAATATTGCCAAATTTAAGAAAGTACAATGTGATTTTGAAGAAGCCGAAGAAAGAGCGAATGAATCGGAACAAGCT
TTACAAAAATTAAGA
>SMED30035063 ID=SMED30035063|Name=SOXP-2|organism=Schmidtea mediterranea sexual|type=transcript|length=2664bp
TGTACATTGAATTCAATATTTAATAGTGATTAACTTATCCAAATTTTCAGCCACTTTTAGTTTAATTTGCGTGTTTTGTT
GAGCAGTTTTTATTGGCGCATTTTATAAAAAATACAAAACCAATCCAAATCAGTTTGAATCATTGTCAGATTTTAGTCGT
GCAAGATACATTATTTCATTTTAATTCTCTAGCATATGACATTTAAACATGGAGCTGAATTACTCGTTGAATGATAATAA
TTTCAATTTACAATTAGAAAGCGAGTCCTTGACTTATTTCGATTTATGCCAAAAATGTTCAGCGTACCAAAATAGTCTTA
GAGACTGGATGAAACATTTAGTTGACAGACATCCTTTACCTATTCAGTGGATGAGTGATTTGGCAAATAATTTAACAGAT
GATAAATTATCTAAGCCATATTCGACCGTTACAGAATCCCGTAAAAAACGCAAGAAGCATATCACTCCAAGGCCATTGAA
TAGTTTCATGATATTTTCCAGACATTTAAGAAGAAATGTTCTTATTTTCTTTAGTGATGCTTCAAATTCAGAAATAAGCA
AACTTCTTGGGAAGTTATGGAATAACATTCCAGCTACCATTAAATCGATGTATGATAATGAAGCTAAAAAGCTTGCAATT
TTACACTCCAAAGAATTTCCTGAATATAAATATCAACCTAAAAAGAAAAAAAAACAATATCTAACGAAATGCCCCATTAA
TTCCACACCTTTGTCGAGTAATTCATATGAAAGTATTCAAGATATTAATTCAGTAACGGATACACTACAGAATTCATCTA
ACAACTTACAAAAGGAAAGTAATCCGACCTCTGTTTCGTCTTATGGAAGCAATCAGGAATGTAATAATTCATTTAAGAAT
CATAGTGTACAGTCCAGCAATTTTCCCAAAGAAATCAACCATAAACCAAGTAGAAAAATTGAAAAGCAATCGTGCAAAAT
AAGTTCCAATCAAATAATGGATGATTCAGAAGGGGCTGAATCCAGTCCATCATCATTTAAAAACACCATTAAAAATGAAA
TTTATTCCTCTTATAGTCCATTTCTAAATGAATCCCATAGCATTCTTTCAGATTTAAGTTACTCTTCGTCTCTCAATAAC
GTTTCAAAACACACTAGCGATTCCATTATAACGAATTCTCCTATCAGAGAAGAAATTGTCTTAGAAAATAATCAGCCCTC
TCAACAGAATAATATAAACAATTACCGACACGTATTTCAGAGAACTTCGACTCTATCCAACAGTTTGTTGACCCCTTTAA
CCATTGTCACAGAAAAAGTTGACGAACAGAAAGATCTTCCACCATCAAGAATCAATATCCGATATGTGAAAATTAACAAA
CTACCGATTCAAACAAAATCCGATTTCCCATTGACTGGATATTTTCAAAATTTCAATAACGACTCAAATCTTCATTTTCA
GAGTTCCATTCACGCCCTGAATACGACATTGACTCCAGATCTGTCGGTAAAACGCGAAGCCACTGTCAACAACAGCATGA
CAGATTATATCAATCGAAAACGTACAAATGTCGATCCACTTATCATCGATGATATATTTGAAAACGAACAATTTGAAGAT
GAGGAAGTGTTGAATTTTGACAATCCTGATAACAATAACAGTTCTCCTTGGTCGTTTAAATCGCCTAACTTTAAAATATC
TACCGGTTCCTCGACACTGTCAGACAATCCGTACAAAGAACAGTTTTGTTCTTCCCCGTTCCATCTATCAGAAACTGATA
CTCAACCGATTCCAGTTCAACGATTGCCAGCAATCGGCTCATGGTTAAAGTCAAACTATTCTGAATTCATGATCTGATCC
AATCTATTATTCTATTCAATTGTCTGTTTTCATACAATTAGGATTACTTGTTATGAATTCTAGCTGATTTTGAGTGTGTT
TATAAAGCTTTTGTAACGCCTTTTCTATACAGATGTTCGATATATATATATAAATAAATAAATATAAATATATAACAATT
TTATTGACATTGTACAGTATTCCATAAGCCCGATCTTGTAACGCATTTATTACTATACTCAATAGACCAATCTATATGTT
CTCATAATTTCTATGTTGTTATTGTACACGGGAATTATTACTATAAATGATGCGAATTTATCACTTTGTAATTGAGGGAA
ATTATCGATCAATTTGCGCTTTCAGACATTTTTCATGTATAAACTTGTTTTTCTCTTTTTTATCATCAAAAATTTAATTT
TTTTGATATCGCTATTCATCATATTATTATTCTCCGTTGCATTTGTTAGATTATGTAAATTTTTATATGAAAATGTTGTT
ATTTATTGTATTTTTATACGATTTTTTGCTTTGGATACACTTTTATCAAATCATATTGCCAGTGTGAGCATTTATTGGAC
TTGTTGTTATTGCTGCTGCTCGAATAATTGCTTCATACGGGGAGTCTCGATATTTTCATGAAGCGATTTTCATGGTTGCC
GCTCTCCGCCGCCGCCATTCGGTGTAAATATCAATTGCATTGCCAGCACGTTTTCTCAAACTCAATTTTTGTACTCAATT
TCAATTGATTTATGTTCATTTTATTTTTCATAGAAATGAGTAAATAAATTTTCATAAATAGTTTTGTTTTCAATATTTTT
AGGAAATTTGAATGTGTCTCTAGA
>SMED30017650 ID=SMED30017650|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=1091bp
GATGGGTCCTATCTTGATATGTTTATTATTAGCAGTGATTTCAGAAGCCAGAACCACTTATAGCCATCACAAATCAGTTC
CAAGTGATGACATTTCTAGTAAATTTGAACTAGAAAATATGGTATCTCTCTTGTCCCGTTACGATGGAGAATTCCAAACC
TTCAAACAGCGATATAATAAATCTTATAGTTCCATGCATGAAGAGAATTCCAGATTTTTAAATTTTATATCATCTCTACT
TGAGATCAATCATCACAATCAACTTTATGAAAACGGTCAGAAATCATACGAGATTGGAATCAACCATTTGAGTGATTGGA
GTGGCGAAGAACTCGCTCAACTGACTAAATTGAAACAATCAAACCTGACGGGCTCATCATATCTATCATCCAATGTGAAA
ATTGACCTTCCAGATTCATTCGACTGGAGAGAGAAAGGTGCAGTTACTGAAGTAAAAAACCAAGGATTTTGTGGATCATG
TTATGCATTTGCTACTACTGGCACCCTAGAAGCCCAAATCTGGAGGAAGACTGGGAAATTGATCAGTTTATCAGAACAAC
AAATTGTTGATTGCGATACTAATGATGATGGTTGTGATGGCGGATTTGTGCAAGACGCGTTATCATACATCAAGTCAAAT
GGAGGCATTGAAAATGAGGAAAGTTACCCTTACATATCAAGTGAAACATTTAAACCTAATTCTAAATGCAATTTCTTCAA
AAGCAAAGTAGTGGCCACCGACACTGGATTCGTTCAAATGCCAGCAAATGACGAAACAAAAATGAAAGAAGCTCTAGTTA
CAATTGGGCCTATTTCAGTAGCAATATCTGCAACCAAATCGCTCAAAAGATATACAAGTGGCATTTTTCATGAGGATGAA
TGTGACAAACTAAAACTTAATCACGCTGTTCTGATAGTCGGATATGGAACAGATCAAACTTCCGGGACACCATATTGGAT
AATTAAAAATAGTTGGAGCTCATTTTGGGGAGAAAATGGATATTTCCGGTTACCCAGAAATATAAATGCTTGCAAAGTAG
CGATGATGCCAGTTTATCCTTTGGTTTGAATTGATAAAATTTTGTTCACAC
>SMED30019754 ID=SMED30019754|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=1366bp
ATTTAATTTGCTCTATTTTATTTATCAGTAATTTGTTTATTCAAAATATATAATTAACATTGTTTTGGACATCTGTTATG
AAGTTAGTAATAGTTTGTGTTATTCTCTGTTCAGGCCTTGTTAATTGTAATCCAATAACTAAGCTTTCTGACAATGAAGA
CAATTTAATTTTTGATTCAAACCTTTCTAATTCCAAGTCAAATCATGATCATTTTATTGTCAACTTTGGTCAACTAATTA
CTTATGATTCCAAGTTAGTAAAAGAATTGTCGAATTTATTAAATGAATTTCTACAACTCCCAACAATTGAGTTTATAAAT
CAAATAAAAATAGAATGGACAAATTTTAAAGTTAAATTTAAGAAAATTTACAAAGATGTTAAAGAAGAATCTGAACGGTT
TTTGATATTCTTAAAAAATTATCTCAAAATAAAAAGCCACAATTTAAAATTTAATTCCGGAACAGTTCAATTCAATATGT
CAACTAATCATTTATCTGATCTAACTGATTCTGAATATTCAACATTATTGGGCTTTAAATTTGGAAAGCGTAAAGATGGG
CCTTCGTATTTGTCACCTATGTCTCGCGTAATGTTACCGAACCAAGTTGACTGGAGATTAACTGCAGTTACTCCAGTGAA
AGACCAAGGAAATTGTGGGTCATGTTGGGCTTTTTCTGCAACAGGCTCGTTAGAAGGTCAACATTATAGGAAAACGAAAA
AACTTATCAGTTTATCTGAACAGCAATTGGTGGATTGCAGTCTAGATAATAGCGGTTGCAATGGTGGGTTAATGGATCTG
GCTTTCACATATGTCAATGATAATGGGGGTATTGACAATGAGCAAGCCTATCCATATACCAGTGGGAAAACCGGACGAAG
ATCTGCCAAATGTAATTTTACTATACACAATATTGGCGCAAAGGATTTCGGATATATTGATATTCCTCAAGGAAATGAAG
TTTTGCTTAAAGAGACTGTGGCATTGATTGGTCCAATTAGTGTTGCTATTGATGCTAGTCAATTCAGTTTCAGAAATTAC
CATTCTGGTGTTTATGAAGATCCCAATTGTAGTTCTGTAGAACTTGATCATGGTGTATTGTTAGTAGGCTACGGAATCGA
AAAAGAATCGAACATTCCATATTGGTTAGTTAAAAATAGTTGGAGTACAAATTGGGGAGATTCGGGTTACATAAAAATGA
GACGAAATTCTAATAACATGTGCGGAATCGCTACAGCCGCTTCATTTCCTATAGTGTGAAAGTCTGTCATATTTATTATT
GTTCATTCTCATGATATTCTGTTCATGTTTCAATAGTTGTCCATATCGTACTCTACGTTCTTTTTTATATAATAAAAAGT
TAATAT
>SMED30026612 ID=SMED30026612|Name=Intermediate filament b-like protein|organism=Schmidtea mediterranea sexual|type=transcript|length=2359bp
TCTTATAAATACAACATTAATTGTATAGTGAACTATGTTAGCCATTGAAATGGAGACAAGTAAAAAAATCGCAGTCAAAA
CTACGAAACAAGAAGTAAGTGGAAGTGGAAGCTCTGGTGGACTAAATGAACAACAAGCTTTTGGAAGTGGTAGCTTTCGA
ACCGGGTCTGGAGGTGTACAGATAAGTGCTAGTGGAGCAATTGGATCTAGCAGTTCAGGCGGAGTTAGTGGCACTGGCGG
AGTTGGTAGCATTGGTGGAGGCAGTGGTGCTGGTGGTGAAGGAACAGGAGCTAGCACAGTTATCACTACAAGCAGATCTT
ATTATAAGCCTATTAGTCAACCTAGAAATAATTTAAAAGACTTACAAAAAACTTCTGGTATGAGTTACAGTGCACAATCA
AACTCCCAGCAAGGTTCAAGTAATATTCCATTGATTAGGGGAGACAGTGTTGCTCTACAATCTGGAGTAACTTCAATGAA
AAAAGGACGAGCTCAAGAGAAAAGAGATCTTCAGGATCTGAATGAAAGATTCGCTAGTTACATTGAAAAAGCTCGATTTC
TAGAAGCGCAAAATAAACAATTGGTCAATGAAATTGAAAAGTTAAAAGGTGGAACCGTCCAGGACAACTCAAAGATCAAA
GAAATCTATGAAGTCGAAATCAATCAACTTCGAACTTTGTTAAGTGATTCTGAAAAAAGCAGAGCACCCTTAGAAGTACA
AGTTGATTCTCTTGAATACGAAATTGATGATTTGAGAAAACGATTAATGATGCTGGAAGACATAAACTCTCAGTACAAAT
CCACCATCGATAAGCAACGCAAAGACATTTCTGGATTTGAAGGGGAATTGGTGGAGCTCAGAAGATTCAAAGGCACCCAA
GGTGCTGATGTAAATAAAGAAAAGGAAGAAGTAAAAACACTAAGAGACGATTTGAAAAAATTGAGACAAGATTATGAGAA
AGAAGCTCTAGCTCATCTCACCCTTGAACATGAATTACAAAGCTTGAAAGAAGCATTAGAATTCGAGAAACAAATACATG
ACACAGAAGTAAAAGAGCTGGCAACCGTTGCATATCGAGACCCAACGAAAGAAAACATGGTTTACTGGCAAAGCGAAATG
GGACGCGCGTTACGAGACATTCAAAATGAATATGAAAACAAGCTTACAGGAATCAAACAAGAATTGGATTCGTCATATGG
CTCACAACTGCAGGAAATACAAACAAGCAAGACCAGGGATAATGTGGAAACGACCCATTACAAAGAAGAGAACAGCCGGG
TAAAATCTCAAATCCAAAGCATGAGATCGAGAATCGCTGATCTTGAGATGCAGAATGCTGAATACGAACACAACTTGAAT
AATATTCGTGCTAATTACGAAGAAACTCAAAGAAGTCTTGAATTGCAGTTGTTGAATTTGCAAGAGCAATTGACAGGAAC
TCAACAGGACTTGACTATTACTTTGACCGAACTCCAAAGCCTATTGGACGCCAAATTGGGACTGGAATTAGAAATCGCTG
CATACTCAAAGTTGTTAGAATTCGAAGAGAATCGTGTTAATTTTTCATCAGATGGTAACACATCACAATTTATCAGTTTT
TCATCTGGCGTGGGAGCTGGTGGTGTAGGAGGAGGATCAAGTGGAGGGTCAGGTAGAGGATCAGGTGGAGGGTCAGGTGG
TGGGTCAGGTGGTGGATCAGGTGGAGGATCAGGTGGGGGATTTGGAGGTGGAGCAGGATTAGGATCAGGCGGAGGAGGAG
GATCAGGAAGTGGGTCTGGTGGAGGCGCAGGTGGGGCTGGTTCTAGTATTGGAATTGGAGGTGGGGGCAATTTTGTAGGT
GGTTCTCTGAGATTTAACATTAATGAATTGAGCAGTACAGAGGCTGAAGAATACCAATTGAAAAGAATGAAGTTCAGACG
AACAACTAAAGGAAACATATCAATAGCAGAAGCTGACATCAATGGACTGTTTATAGTTCTAGAGAATAACGGAACAAAAT
TTGAATCTTTAACTGGAATGACGATTAAGAGAAATATTGATGGGAATGAGGATGCGGTTTCATTCACCATTCAAAACCGA
ACAAGTTTGAGTTCTGGAGAAAAACTAACTATCTGGGCCAAAGGAAAGAAAACTGGCAAAGGAAAAGAACTTGAAATAGA
AGAAGACGGCTGGGGGCTGGGGGATACTATTGTGACCTCTTTATACAATGCGGAAGGAGAAGAGAAAGCGGTCCATTATC
AAGAAATACAGGGTTGAGCAGGTGCTCACTTAAGACTGACTTGAAATTTATTTGTTTAAATAATACTTTCAATAGGGATT
TTAATGCTAATAAAAAGTATTTAAACTATTAAAAAAAAA
>SMED30023593 ID=SMED30023593|Name=Netrin-1a|organism=Schmidtea mediterranea sexual|type=transcript|length=1962bp
GATCTTGAAATTCTTTTTAAAATTTCTAATCTTATTCATTGGTCTTGTGGCCTTAAATGGAGAACTGCAGACCTGCTACA
GTGCCAATGGAGATCCTAAACCTTGTGAACCATTATTAATAAATTTGGCTCAGCCAATGCATATTGAAGCTAGCTCTACG
TGTGGAGAAAACGGAGCGGAAAGTATTTGTACAGAATGGTTTGACAAACTAGGAAAAGCTCATAAGTCCTGTGAGAAATG
CAATTCTTTAGATCCTAAATTATCAAAATCGTCAAAAATGGTGGTTGATTCACATATACGAGGCAAGGAGACTTGTTGGA
TTTCAGAAGGTGTTCATGAAAGTAGTTATCCAACTAGCGTTAATCTTACATTGGGTTTGAAAAAGAGGTCATTAATATCA
TTTATTACTGTGGAATTATGTGGTCACAACCCGGATGGCATTATTATTTATAAAATGGACAGTGAAACAGATGATTGGTC
TCCTTGGCAATATTTTGCTAAAGACTGTCAACTGACATTTAAGATGCCGGCTTTAACAACGGATACAGTTAATACTTTTT
CCGATATAAATTCATTGAAACCAGTTTGTTTTGATTTGGAAAAAAGTATGGACTATGGAGGAGATGAAAAACTATTCAGA
CTTATCCCATTCAATCCAAGACAAGGCAGAAGTTTTGGAGATGTATTATCTAAAAATGAACAAAACTGGTTGGCAGCTAC
AGAAATACGAATCAGTTATATTCTAACTCCTAAAGAACATTACGGAAATCTGCTGTTGAGAGAAAAGCGAAATGCAGAAA
ATCCTGTTTATCATTTTGGTTCATCTGATATAATGATTGGTGGGCAACCTTTATGTCATGGACATGCTTCGAGAATAATC
AGAACTTCGGATGATACTTATCAGTGTGAATGTCAGCACAGTACTGCTGGAAAGGATTGTGAAAAATGCCATGAAGAATT
CAATGATCAACCGTGGAGTTCAGCAACGATTCGAAACCCAGCGGTTTGTAAAAGATGCGAGTGTAACAATCATTCGATAA
AATGTGTATTCGATTTTAATGTTTTCCTGAAATCTGGTAGAATTCATGGCAGTTCTTGCATAGATTGTGGTGATAACACT
GTCGGCCCTCAGTGTGATCAATGCGCTCCCGGATATTTCCGGCAACATGCTTATCCTATTTACCATAAAAATGCTTGTAA
ACCTTGCTTATGTCATTCAGTTGGATCTCTTTCGGGTACACCCTGCGATCAAGTAAGTGGGAAATGTTTCTGTAAGCCTG
GAGTGACTGGGAAAACATGTACCCATTGTGCACCGGGTTATAAACAAACAAATTCCCTAAAGAATCCTTGCAGAAAGATA
TCAAAATTGCGTCATTTAGTGAAATCAAATTCGAGTTGCGATTTTTGTCAAAGGAAAAGTAAAAGAATTAATTTTAAGAG
ATTTTGCAGCAAGGAAACAAATTTCAAAGTAAATATCAAGAGTAGAGAATCAAGGGGTCAGTGGATTCGGTTCATTTCTG
AAATCGAACAGGTCTGGACAAGAAATCAACAAGATCCCCGAGTATCCCAACTTAATCTAGAATCTAGTGAAGGGACTTCG
ATGTGGGTTCATAAAGATCTCGTGGACTGCGGTTGCGTTGATTTTGAATTCGGTCATTCATATTTAGTCATGGCCAATGT
GAAAACAACGGAATTTATGGGCCAAACTGAACTTATTTTAAACCAAAGTGATGTAATTGAGGATTGGAAGGAGACATGGG
AGGAGCAATTTTCTCAGTTTTATACCCAGGATAAAATGGGAAAATGCAATCGGTTTACTCGACAAAAGCGACACGTCAAG
AGGCGTAATTTTGCCTCAACCTATAACCAATATGCTATCTATTCCTGATCATTTGGACCCGGGATTAATTTAATTAACAT
TTTATCTAGCAGCTGAATGTGATGTCTTATTGTATTTATAAA
>SMED30030773 ID=SMED30030773|Name=ATP-dependent RNA helicase dbp2|organism=Schmidtea mediterranea sexual|type=transcript|length=1968bp
TTTCTTTAAACGCATTATTTTATTTAATATTTTAACTTTCCATTTACAATAACAATAATTTAAAAGATGAATTATAGATA
CAGAAGAGAAAGATCTCGATCTCCTATTAGCAGATTTGGAAGTAAATTTCAAAAGAAACAATTTGACTGTGAAATTACTA
AAATAGATTGGCCTACTATTAGGCTGATGCCATTTAAAAAAAACTTTTATATTGAGCACCCAATTGTGACTGCTAGAAGC
TCATACGAAATAGACAGATTTAGAAATGAAAAAGAAATGACAGTCGTTGGCAAAAATGTCCCACGGCCGATATTTAATTT
TAGTGAAATGAATTTTCCAAATTTTATTTTGACCACAATATTAAAAAATAAATGGGTTAGACCAACACCAATTCAGTGTC
AGGGTTGGCCAATGGCAATGAGTGGTCGAAATGTTGTTGGAATAGCACAAACAGGATCTGGAAAAACTGCAGCTTTTTTG
TTACCTGCTTTAATTCACATTCGAGCACAGCCGCCTCTTGTAGCTGGTGATGGTCCAATTTGCCTAGTTCTTGTGCCTAC
CAGAGAATTGGCACAGCAAGTTGAATCAGTTGTAGAAGAATTTGGCATATCAGGTGGATTCAATATGGTGTGTGTTTACG
GAGGCTCTGATCGGCAGAATCAAATAAAAAATTTACACACTAAACGCCCAGAGATATTAGTTGCTACACCAGGGCGCTTA
TTAGATCTCTTGAAACAAAACGAGACTAATCTAAGACGAACTACCTATTTAGTCTTAGATGAAGCTGATCGAATGCTCGA
TATGGGATTTGAACCACAAATACGCGCAGTTCTAAATCAAGTAAGACCTGATAGGCAAATGTTACTGTGGTCTGCAACCT
GGCCATTAGAAGTCAGGAGGTTGGCTGAAGATTTTTTAAATGAGTATATTCAAGTTAATATTGGGGCTATGTCATTACAC
GCCAATCATAATATCTGTCAGTATGTTGAAGTTATTGACGAATTTGGCAAAGAGCGTCGATTAATTGAGTTACTTAAACA
ATTTAATGGTTTGAAAACATTGGTGTTTGTCGCTCTAAAGAAAAGATGTGATAGAATGTCAGATATGTTGAATTCTAGAA
GCTTTAAAGCCTTAGCCATGCATGGAGATAAGCCTCAAAGAGAAAGAGAACGCGCACTTGAAAATTTCAGAAATGGTAGA
TCAAATATAATGGTTGCAACAGATGTCGCTTCAAGAGGATTAGACATTGATGACATAATGTTGGTAATAAACTATGATTT
TCCAACACAAATCGAAGATTATGTACACAGAATAGGCAGAACTGCCAGACAAGAAAAGAAAGGAACATCTTATACATTTT
TTACAAATAATGAAAAAAAACATGCTCAAAAATTAGTTTCAATTTTGGAAGAAGCTACTCAAAATATTTCGGATAAACTA
TATGATTTGGCGGAAGTTCCGTATTCGAGTCGCAAGAAGTCCACTGCAAATGTACCCAAAGGATTAGTAACAGGTACTCC
TGTAAATAACGATTGGGTAGATTCCGTTACTAATAAAAGAATGCCCAATAAATTTAATGGCGGTATTTCTCGTGATAACT
TTTCAAATGTGGAAAGCGATCATAGAAAGCCAGATTATTTTAAATATAATGGCAGACCGGAAGAAATAGAATCGTTTCCT
CCGAGTAATACTTCTTCATTTAGAGATTCCGGAAATTGGAGAAATAATGAGTCTTTTAATAATTACAACCAACCACAACA
GCAGCAGCAACATCAGCCTCCCTATACTAATAATAGCAATAGCTATAATTCAGCCAAAACTTTCAATTATAATGATGATT
TCAATTCTGTAGGAATCATTGCTAATAGATGGTAAACTTAGCTTATATGTTCTTGTTATATGTTGTAGTTTAAACTTTAA
TTGTAATCAAATTTGTTGTAATTATTTTAATTATTAATATTATTCTTT
>SMED30011059 ID=SMED30011059|Name=Cysteine-rich secretory protein LCCL domain-containing 2|organism=Schmidtea mediterranea sexual|type=transcript|length=824bp
AGTAAATAAAGTCAATATTTTAAATTATTTATGCGGATGAATTTTCAATGCCATTTATGCATTTTCTTTTTACTAATTTT
CGGGAAAAGCTTAACTCTATTGCCAGAGGATCAACAAGCGAGGGTCTTGAGGAAAATAAATGTTCATCGCAACAATTTCA
ATCCAGAAGTAACAAATATGATTAAAGTAAAAACAATGCGCCACCTTGTTGTAATGGCAGAAATTTGGAGTCTAAGATGC
ATAATAGAAAATTATACGGATAAATTCTTTGAATATTCTCAGTACAATGTTCTTGTTTATTATGAAGAAATTCCGCAAAA
CGCAAGATTCGAATTAACGAATGCGTTATTATATTGGATTGGCAAAACGAAACTTCCTTATTGTGCTTTAGATCATTATG
AATTAGAATATTGTGCCGATTTTTTTAAGTATCATGCAGGTGAAAGCGAATATGTCGGATGCGGACAGAATTCCTGCCCT
ACTACAAGACCTGGCTATAAAGGGATATTATTCACATGTTTATATTATCCCAATGCAATGAAACCACGGAAAAAAATAAG
ATATGGTCCAAGATGTTCAGAGTGTCCAAAGAAATATCCATTGTGCGAAAATAGACTTTGTTATAATGAAGCACCCGTTC
TGAATATGACAGAAGAGCCTGACAATAATGAAAGCATGAAAAAACATCTAAATTATTATTTATTATGCTTTATTACTATA
TATTGGATAATTACTAAACTTAAATTTATTTTTAATCGAGTGTGACAGAAATGCTTATTGGGAGGCATAATTTATTATTT
TTAAAATGAAATGTTTTATTATGA
>SMED30012850 ID=SMED30012850|Name=Spondin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=2699bp
GGTGAATGAAAGATTGAAAGTAAACAAATTTATGAGACATTGACATTATTCATTTAACTTACATCACAGGACGACCAATA
TCACATAATACTTCTTCCTGTTTACAAGGTTGAAGTCGTTTATATAAATCGTCAAAGTCTCAGTTAAGATCATTGATATT
ATGAAAATTTACATCTTAATTTGGAATATCCTTTGGATGTTGCTATGTCTTCATTGGATGATCCAGGAAAGTTTTGCCAT
GAATACTAGAACCAATTGTTTTAAAATGCATAAAAAAACCTACCAAAAAGTCATGATGAAAGATGGAGAATTTCGAATAG
TAATTAGAGACATGAAAGGCAAAATGGCAGATAGATTCGAACCTGGTGAAAGCTATAGAATAATTTTGAATAATGCAATG
TATGGAATGGATTTCAGAGATTTTTCAATATTCGCGGCCTACGAGATGGAGGATTCGTTGCAAATGGAAAGTCATAAAAT
GATTCCCGATGAAGGACTTGGTCATTTTATTATAAATAAAAAATTTGGGTTGGTTGATTATAAATGTCCTAACAGAATGC
ATGGAAATGATAATATGTTTCTAACTTATGTAGAGTCGACATGGATAGCTCCGCATAATCCTATAAATTGTATTCGCTTT
GAGGCTCAAGTTGTAAAATTTGATTTTATGGTGTATGAAAGTATCGGACGTTTAGTAAAAGTTATTTGTCCAACAAAAAT
GTATAAAATGATTAGTGAAGAAAATAAAAACATGAAAATATCTAAACCTTTTGATGAGATGACTCCTATGGTTAAAGAAT
GTTGCGCTTGTGGAGTAGCGTCTTATAAAGTAACATTTATGGGGTTATGGTCAAAGAAAACTCATCCCAAAGATTGGCCA
AAACAAAAGAGCATGGTTCATTGGACCAATCTTATAGGGGCCACACATACTGGCGATTACTTTATATATTATAACGGTGG
TCAAGCAAGCCAGGCAGTTCAAAGTATTTGTTCATATGGAGATAGCACGGTTTTGAAACAGCAGTTCGCAGAAGAGACAA
TAAAACCGCATTTGAAGAGTTATTTTAATACTTCAGGCATGTGGAATGAAGACGAAATTGAACAGAGTAGATCGGGATTC
ATATCGGTTAATCGTACTCATCATTTCTTTAGCTTTCTCACAATGATGGGCCCAAGTCCTGATTGGTGTACTGGAGTAGC
AGCTGTAGACATGTGTATGAATGATTGTACATGGAAGGATGATTTCACCATGGATCTATTCCCATTTGATGCTGGAATTA
AAAACGGTTTCACATATTTCCCAGAAAATTCGGACAGGCAAGACATTCCTGATCCAATTAGAACAATCAACACTACATAT
ATGACCCAATTCCCTTTCACAGCAAATGTTCCAGTTGCCCGGGTAATTTATCAAAAGATCAAACCAAAACACAATTGGGA
GTGCACCAAGATGAATGCAAAACAAGTAAAAGAATTTGATGAAATGAATTCAAACAAAAACGGAAATTCTCAATTCGATG
GAAGTAGTTTGACGAAAAAACGCCGACACATTAACAAGAAAAGTCCCCTTGATGATCCGACTTTGGCCAATATGGCTACA
TTTTTGTGTATAACATCTCCATGGAGTGAGTGGACTAAATGTTCAGTTACGTGTGGCATTGGGACAGAGATGAGATCTCG
AGACATGTTGAAAAATGCTAAAACAGAATTATGTCGTCACTTACCTTTGCTTGAAAGTCGGACATGCGAAGGAAGAAAAC
GTTCGTGTGATTTCTCAGCACCATGTAGCCTTCTTTCCTGGTCAAGATGGGGTCCATGCAATGCAACTTGTGAGATGCAC
GGATACCAACAGAGATCTCGAATGTTTGCAAGATTTGAAGAAAAAGAGAAATGTCTCAAAAACAAAGAAAGACGATTTAA
AATTTTTGAAGAAAAACGGTGCAAAAAAGACACAGCCTTGTGTGACCCAGTTATTATATGTAGTGAGGGCCTAATAATGG
GCAGCAGCTGTGGCAAGCCTGTTATGAAATATTTCTATGATGCTGCCAAACACAGTTGTGTGCCTTTTGAATACCTCGGT
TGTAAAGGAAGTCTGAATAACTTTCCTTCTAAAATGTCTTGCGAAAAGACTTGCTTAGCAGCTGTCAATGCGCTGCCTCA
GTGGAGAAAAGACAAAATGGCTCACTTACAGTTTCAGTCTCAGTCGAATTCAGATAAACGAAAGAAAATGCCAACAATGG
CTAACAAATGTCGGCTTGAAGTAAAATACGGCGGAATGAATTGCGATGGAACAATGGGACCGGACATTCGATATTATTAT
GATAACAGAAATGGACGCTGTAGACAATTTAAATACACTGGCTGTGATGGGAATAGTAACAACTTCCGGTCTTATCACAG
CTGCATTAAGGCTTGCATGCCAGATCAAATCGACTTTATGAAAACTGCTCCGATCAAAGCTTGTCAAGTATCTGAGTGGT
CACATTGGGGTCCATGTTCTACGACCTGCGGTGTGGGAGAGAGATTCAAATGGCGATCTGTGCTTCGGCCGGCATTGAAT
GGCGGTCCAGCTTGTCCAGAGTTATTTCTATCGGAACCTTGTTTCGCGACAACTTGTTGAAAAATTTATATAAATTTTGT
ATCCATTTTTGATGACATTTATAATAATTTTATGGGTAAATATATTTTAGTTCTTCCTC
>SMED30008458 ID=SMED30008458|Name=Lysosomal alpha-glucosidase|organism=Schmidtea mediterranea sexual|type=transcript|length=3017bp
ATTGTTATGCAAAATTATTTTAGCAAAAATTCCGATAGGTTTTATCTAATTAGTAATTAAGTAGATACTTCATGCTCTTG
AACTTGATTTTATTTTAAAATGGAGGTGTGTCGCTGATCTGGAAAAGTTTAATTTCAAATTATCTTTAATTAGATCATCA
CACCTATTTTAGTTGTTGTAGAGAGTCAAAGTTCAGCTTTTAATTAATATATATTCAATTAAAAATTTGCAAAAAATTAT
TTCCATTTCAAATGAAATTAATAATATTAATAAGTTTTATTAATTTGATTTCGTTATTCAACTTTTCCAACGCGACAGCA
CAATGTCAAATAGCCAATAACAATGAGAGACTTGATTGCTACCCAGAATCCGGAGCCAATCAAGATTCATGTATAGCAAG
GGGGTGTTGCTGGTCCGAACCAATGAGATTGTCCAATAAATTGCAAGGTGTTCCACTATCAATCCCATATTGCTATTATC
CAACTGATTATTCCAACTATATGATTAAATCCTTAAGAAAATCTTCAAGAGGGATCAAAGCAAAATTAGTCAGGGAATCA
CCAAGTTATTTACCCTATGAAGTTGCAATGTTAGATCTTGAGGTAATTTATGAAACAAAATCTAGAACTCGAGTCAGAAT
AACAGATCCTAAACAAAAAAGATATGAAGTTCCAATGAAACTCAGTCCTCCAGATTTGAAGCCACCGACTGATCGAGAAT
ATGAAGTCATAATCCCATCTGATGGTTCATTTTCTATTGAAATTAAACGAAAATCAGATGATCGTTCACTTTTCAAATCA
TTTGGGCCACTTTTATATTCTGATCAATTTTTACAAATATCTTCAATAATGTCAACTGATCAAATCTATGGAATAGGAGA
ACAAAATAGACCCTTTCTTCATCAATTATCCAATGGCTGGGAAAGAATTGGATTGTGGGCAAGAGACAATCCGATTGAAA
CATTTATGAATCTTTATGGAGCTCATCCATTTTATATCGGTATGCCAGACGATGGAAAAGCTTTCGGTGTTTTTCACTTT
AATAGTAATGGTCAAGAATTCGCTTTACAACCGGCACCAGCAGTAACTTATAGAACAATCGGTGGAATTTTAGATTTCTT
TATTTTTACCGGAGGCAGCCCTGAAGAAACAGTAAAACAATACCTAGAATTGGTAGGAAAGCCAATGCTTCCTCCATATT
GGTCTCTTGGATTCCATCTGTCAAAATGGGGTTACAAAAATATTGAGCAATTGTCTGAAATATTTCAAAGAAATATTAAT
GCCGGTTTCCCAATCGGTACTCAGTGGAGTGATATAGATTATATGGAAAATTATAAAGATTTTACTGTCGACAAAGAGAA
ATTTAATGGATTGGGAAGATTTGTCAGAGAGATTAAACAAAAATATAACTCTAGATTTGTTGCAATTGTTGATCCAGGAA
TAAGCTGCACAAGTGGTAACGAATATCCACCTTATTATGAAGGAGTATTTATGGATATTTTCATCAAAGATTCACAGACC
AATCAACCAATTGTTGGCAAGGTTTGGCCCGGAGAAACAGTTTATCCAGACTTCACTCATCCGAACATTTCTATGTATTG
GTATAAACAAATTCAACGCTTTTATAATGATGTTCCAATTGATGGGCTTTGGATTGATATGAATGAGCCATCTAATTTCT
ACGATGGTTCCAAAAGAGGCTGTCAAGGAAATAGTAAATATGACAATCCATTTTTTGTACCGGATATTCGAGATCAGTCA
TTAATATCTAAAACTATTTGTTCTTCAGCACTCCATTACAATAACGAAAAGCATTATAATTTGCACAATCTCTACGGCTA
TACGGAATCAGTAACAACAAATAAAGCATTATTAAAAACGATACACGGAAAAAGACCTTTTATTTTATCCCGGTCAACTT
TCAGTGGATCTGGTAAATATACCTTCCATTGGACCGGGGATAATCAAGCAAGTTGGGATCAGTTAAGAAATTCCATTAGA
CAAGTGCTTAATTTCAACATGTTTGGTATTCCGATGACTGGTGCTGACATTTGTGGATTTAACGGTAACAGTGATGAAGA
ACTCTGTATTAGATGGATGCAATTGGGCGCTTTTTATCCATTCATGAGGAACCACAATGCAATCAACCAGAGAGATCAAG
ATCCAGCTTCATGGAGTATTGAAGCTCAGAAAATCATGAAAATTGCAATAAACATTAGATATGCATTATTCCCTCATTTT
TATACTTCTCTTGTTAAATCTCATTTATACGGTGGAACCGTGATGAAACCAATGAGCTTTGAGTTTTACTCTGATAGAAA
TACCCACGGATTGGACCTACAATTCATGATTGGATCATCTATAATGGTTGTTCCTGTAGTTGATCAGGGTGCCAGAAAAG
TCAATGCTTATTTCCCAGCTGGTATTTGGTATGATTTCCAAAGTGGTAGTATTTTGTATTCTGATTCCAAAGGTGCCCAG
GTAACCCTAGATGCTCCATTAGATAAAATAAATGTTGCACTAAGAGGAGGCCATATAGTTTCATTGATATCAGATTCTAT
GACAAATCCTCAGATGTCAACAAATAAAATGATTTTATATTGTGCTTTATCGGAAGATTCACAGGCATCTGGAGATGCAT
ATTGGGATGATGGGGAAAATGTTGATTCTTATTCTGGAAATAAGTACAATTATTTGAAATTTATTGCCAACGGAAATAGG
CTGGAAATTTCAGTAGAATTCAAGGGATATGAACTTGTCCCGGTGTTGTCAAAAGTAGTAATTTTGGGGGTAAAACAAAC
TGGTGTACAAAATGTCTCTATAAATGACAGACCAGTAGACTATCAATTCGACGCAGAAAAATCAATTTTACTGATCAGCA
ATATTGATCTTAGTATTGATTCGCACATTTTGCTTTCATGGAATTGACTGAAGCAATCTCACAAAAAATATTTTTATTAA
TAAAACACTATTGTTTTTTAATGCTTGATTAAATTATATTTTTAAAGTTTTTAAAAA
>SMED30019471 ID=SMED30019471|Name=Synaptotagmin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1910bp
TTTGGGACTTCTCCAATCTATTAAATATATTTAGAACGAACATCGTTGTGAGAAGCTTTGTCTTGCAAATGCACACCAAC
ACATTCTCTGCCTACTCGAGACCAGCCTGAAGGACGCACCCAGTCATCTCTTATAAAAAAAAAACTCTTCTCTGATTCGG
TATTTTCTGATTAATGGAGATCAAACAATGATTGGGCAACGTCTAGTTTAGAATATTTACAACTAAATCTGCGTATTTCA
ATTTTTTTTCGATTTTGATTGTTGCAAATATTTATGAGTATATCCAATAATATAAGCAGCGCTAGTAATATGACGATAAA
AATGCAACAAAATGTTGAAAAGTCTGTATCACAGCATGTAACAGCGCAAACAAAGGAATCAACATCAAATAAACTTCATA
CAACAACAGCCGGTATCTCGGTTTTGGAGAAAACATTAAAAACATTTCACATGAGTACTGGCACTTTGATTGGAATCGGA
GTTACAGTGTCTATCGTAGTTTTATTACTTCTTTATTGTATTTGCAAACGATGCATTAAGAAACGAAAGAAAAAGAAAGA
TGGCGGCAAAAAAGGTGGAAAAGGCGTAGACATGAAAAGCGTACAACTATTAGGAAATGCTTATAAAGAAAAGGTACAGC
CGGACCTAGAAGAACTGGATGCTAACATGGAAGATAATGAAGGGGCGCAAGATAAAGAAGCAGTCAATCTTGGAAAATTA
CAGTATTCCCTTGATTACGATTTTACAAAAGGCGAGCTAACAGTCGGAGTAATTCAAGCCACAGATCTCCCAGCAATGGA
CATGTCAGGAACTTCTGATCCATATGTGAAAGTTTTTCTATTACCGGATAAAAAGAAAAAATTCGAAACCAAAGTTCATC
GAAAAATATTAAATCCAGTCTTTAATGAGACATTTGTATTCAAGATTCCTTATTCTGAGGTCGGGTCTAAAACTTTGGTA
TTTAATGTTTTCGATTTCGACAGATTTTCAAAGCATGATCAAATTGGGCAAATCCAAATTCCACTGGGTTCAGTAGATTT
ATGCAAAGTTATTGAGGAATGGAAGGAACTCGGCCCACCTGACAGTGATAATGAAAAGGAAAATCGATTAGGAGACATTT
GTTTTTCTTTGAGATATGTTCCAACGTCTGGAAAGTTGAATATCGTCATTCTGGAAGCTAAAAACCTCAAGAAAATGGAT
GTTGGAGGATTGTCGGATCCTTACGTGAAACTATCGTTGATGCTTAACGGCAAACGAGTGAAAAAGAAGAAAACCACAAT
AAAAAAATACACATTAAATCCTTATTATAATGAGTCATTTTCATTCGAAGTTCCATTCGAGCAAATACAAAAAGTTAATT
TAATAGTGACAGTAGTTGATTATGATAGAATTGGAACAAGTGAACCTATTGGAAGAGTAGTTCTTGGATGCAATGCTACA
GGAGCAGAACTTCGGCACTGGTCCGATATGCTTGCTAATCCTAGGAGACCAATTGCCCAGTGGCATACCCTTCAAGATAT
GCCGGAGAAGAGCTGATTTCATTGATTTTAATTTTAAAATCTGTCATATTTTGTGATAAATTTTGCGTATTTATACAATC
ATTCGATTCGATCTTTCCATCAAGTTTCGTAAAATCTGCAGACATTCACGAGGATGCAGAAGAAATAGAAACTTTGTAAT
AAATTAGCATTAGCTGTGATCTCCTATTGACCAAAAAACATAAACTTAATTTTTATAAAGAATTGTGGTGAAATGTTGTT
AGGTTTCAGTCATAGATAACTGTATTTGTGTAATAGTTTGTGTATTTCTCGTCCTGGCCCGATTTTGTGCATTCCACTGG
CAATACTATTTCACTAATAAATTATGTCTGATAATGTATACCAGTATAGGATTTTGTTTGAATTAATGAA
>SMED30015672 ID=SMED30015672|Name=Gelsolin|organism=Schmidtea mediterranea sexual|type=transcript|length=1435bp
TCTTGTCATTTCAGCATGCATATATCATTAGCGTAAAGATAAAAATACTAACAACTCCTAGTCAAATTGCAACCAACCGT
AAATTGCAGACACACACGAACCAATCACATTTGCTGCCATCGGACAGCCTATGAGACAGCAGATTGGATTAATCAATAAA
GATTTATTGTTCGGTTTTCATTGTATAAATACTGAAATCATTTGTCAATCCAATTGTTAAGTCAACCATGCAGAAAACTA
AAAAATATGACTGGAAAGATTCCAATGTGGAATTGATTGGAAGCAGCGAGGACAGAGCTGTCAAGAAATCATCGGCTGAA
AACGAGCCAGCTTGGAAGAAAGCTAAAGCTTGCGGCCATTCTGAATTGTTTATATGGCGAATTGAGAAATTCAAAGTTGT
TGAATGGCCTCAAAAGCAACATGGGGAATTTTATGAAGGAGATTCTTACATTGTCTTAAATATATATCAAAGAGAAAATG
AATTACTGTACGATGTGCATTTTTGGATTGGTAAATATTCTACCCAAGACGAGTATGGGACTGCTGCCTACAAAACTGTG
GAATTGGACAATTTGCTCGATGACAAACCAGTTCAACATAGAGAGGTCCAACATTACGAATCGGAATTGTTCAAAAGTTA
TTTCAAAAATCTAATATATCTGAAAGGTGGTTGCGAAAGTGGATTTAGACATGTTAAAACTGTAGAGTACACTCCGAGAT
TATTACATGTACGAGGGGAAAAACGTAACATCATTGTTTCTGAGGTGACTGCAACTAAACATAATTTAAATTCCAATGAT
GTGTTCATCTATGACACTGGAACTCACATTTTTGAGTGGATTGGAAAAGGTGCGAACAAAGATGAAAAGTTCAAAGGTCA
AGAATTTGCGCAAGCGCTAAATAGTGACCGCAATGGAAAGGCTAAAGTTGAAGTTGTCGACGAGGCAAATATATCAGAAA
ATCACGAATTCTACAAACATTTATCAGATTTACAACCCGACGAAGATGACAAATGGCAAAATAAGTTATCAGTTAAAGAT
AAGAAACTTTTTAGAATATCTGATGCCAGTGGATCTTTGAAATTCGAAAATATTGCTATTGGAAAATTTGCAAAAAAGGA
CATTAACGAAGATGATATTTTCATTGTTGACAACGGTTTAGAAGTATATGTTTATATTGGAGAAAACGCCAGCCCTAACG
AAAGGCAAAATGCCTTGATTTATGCCCATAATTACCTAAAACAAACCGAATATCCCCAAGTTCCGGTGACAGTAATGAAA
AAGGATGTCAAAGGCAAGAATGCTGAAAACTTCAATAAAGTAATTGAAGGATAAACTCTGGCAAATTTGTTTGTTATTTA
ATTCATAATTTATTTTCAATCTAACTAGGTTTTACTTTTCAATAATAAAATATTTATGTTTGTTTTAAAAAAAAA
>SMED30025591 ID=SMED30025591|Name=porcupine-like protein|organism=Schmidtea mediterranea sexual|type=transcript|length=3526bp
TTCCGATCTTTTCTTTTGAAATTTTTGAAATTTTAAATAAAATTAATGACAAAGGCAGAAAATCAGAGAACTACTAAAGC
ATCCGACTTCAAATTTGGAAAAGAAATCGGCCATGGCTCGTTCTCAACTGTAATGATAGCTAAGGAAATTTCTACCAATA
AACATTATGCTGCAAAAATTATTGATAAAGTTTTTATTTCTAAACAGCGAATGGTTAATACTGTTATGATTGAAAAAGAA
GTTCTCCGAAGAATAAATCACCAGTTTTTTGTATGTCTCAATTATACATTCCAAGATCCAGAGAGATTGTATTTTATTAT
ATCATATGCCGAACGAGGAGAACTTTTATCTCATTTAACAAGACTTTCGTGTTTTGATTTAACGTGCACACAATTTTATT
CCGCGGAAATTATTCTTGCATTAGAATATTTACATGGAATTAACGTTGTTCATCGAGATATAAAACCAGAAAATATTTTA
CTGAGTGAAAATATGCATATAAAAATTTGTGATTTTGGCAGTGCAATTATTATCGATAAACCAGATCTCAAGCCTTCTTC
TTTTACAGGTACAGCTCAATTCGTTTCTCCAGAAATGCTGGGATTCAGTAAAGAAACACGTGACAATAGCTATTCAGATG
AACCGAATTCTGATTCAGAGGAACATAGCGAAATTGAAGTTAAACGAACTAGTTCACCTGATAATTCTAGGGAAATATTA
TATCTAATGGACTTCTGGGCATTAGGATGCATCGTCTATCAAATGTTGTCTGGACGAATGCCATTTCACGTCAGGCATTC
ACGGCATGAATATGAAATTTTCCAAAAGATCCGAAATTTAAAATATGAGTTTCCGGTTGGGTTTGATGATACTGCTAAAG
ATTTTGTCTCTAAACTTCTTGTATTGAATCCACTGGAAAGATTAGGCAATCCATCCGATGGAAAGCACGCTGCTTTAAAA
GCCCACCCCCTTTTCCGTTCAATTGATTTCGAAATTATCGGATCACAAAAACCTCCGCTATTACTTCCAAATATTGAGCC
CATTGTTCAAAGTAATTGGGACGAAATTCCTGTTGGTTTTGAAGAAGCATGGAAATTCAATATCAAAAAAGAGTTTCAAG
AAATGGAAAAAGCCGATAAACAAAAATTATTGCAAAACCAAGAAAAACTAAATCCGTTTCATAGATTTGTACGCAATCGA
TTGATCATAAAACAAGGCATCTTGTACAAACGGCGTGGATTATTTACTCGTAAAAGAATGTTTCTATTAACTGAAGGACC
TCATTTATTTTATGTCGACCCCGATGCTATGCAATTTAAAAAAGAAGTCAGTCTAAACTTAATTACTGGCATAGAAGTAA
AAAATGACAAAGTATTTTATATCGTTACTAAAAGGCGAACATATTTTCTCGAAGATCCTTCAGCAAAGGCTGATGAATGG
CGACAGAGTATTGAATCGATTTGTGTAGAATATTATGGATCATTTAAATTATCCCCTGGCACTTGCACTCAAACGCCTCT
AGTTACATCATCTGAATCATAACTTTCGGTTTTATTTAAATTTATTTGTCATATAGAAAAAAATGTGAATTTAACGGTTT
TTAATATAATAATTTAATATTGGTTTGAATTCTTGTTTTTCATTTTAAAATTTAATGGATATAATTTAAATATTTTAATA
AATAAAAATATTCACATTGTTTTAATATTCTCTTTATGTCGTAATTGATAAATGATGCATTGTAAATGTATTTTACAACT
GATCTAAATGAAACCAATAGGAAACGAGTGGTTCGATGTCATGTGAATCAGCATGCAACCAATCATAGTTTTGTGATTCA
TTAAATATATTTTAAATTTTTAAAACAAATTAAATCACTTAATTAATTTTTAGACAATGTCACAATTTTATGGCGGATCC
ACGATATTGGCACCTCTATCGAACGTTATGGGTATACCAGTGGATCAAATTAATTTTATTGTGTGTAGTTTATTGTCAAT
CGGACTGGGTCAAATTATGCGACACAAATTCCCTCCTTCTAAATTGTCAGGAAGTACAAGAGGAATCATAGAAGCATTTT
TTGGAATACTAATTGTTCTTTTCTGCTTCGGATACCAAGTCAAGTATTTGTTACTACAATCAACAGTTTCCTATGTAATA
CTATTATTTTTGCCTTCACAAATATCAGCGCATTTGGTAACGTATTGGTGTATGGCTTTCATGGCGATAGTCCATTTATA
CAGGATGCATTACGATTACGGAGGTTATACTCTCGATATATCTGGTCCGGTTATGATTCAAACCCAAAAATTGACCAGCC
TCGCATTTAATCTTCTAGATGGACATCGAATAAATCAAGGAATAAAACTGCAACAGAGAAATCATGAATCTCACGCTGTG
AAAAAACTACCAGATGCAATCAAGTTTTTCGGTTACACATTCTACTTTCATGGTGTATTAGCGGGTCCTTTTGTATTCTA
CAATGAATATAAAGAATATATCACTGGATATGACGACAAGCATATTCCATGCTCCAAAAAGCAATTATCTTCAGCACTTT
GTTTATCAGTGATCCATGGATTATTAACAGCATATGTCGCACCGCAGTTTCCATATATATTTGTTTGCAGCACCGATTAC
CAACGGATGCATATGACTCGTAGAATAATGTTCACAATGATTTCATTTTTCCTCGTAAGACAAAAGTATTACTTTGCCTG
GTCAATGGTTGAAGCTGGTGCTCTTAGTACCGGATTGGGATATTGTGGAAAGGATAAAAACGGAGAGAATAATTGGTCGA
AAGTGAAAAATTACGATTTCATGGCAATCGAAAGCGGCAGTAGTTTGAAAGTGCTAGTGGACGGATGGAATATTTCCACA
ACAAGATGGCTCAGAGAATTAATTTATGAACGAGCTCCTTTATTCTGTCGGACAATTCTAGTTTTCACCGTCAGTGCATT
TTGGCATGGATTCTATCCTGGATATTATTTGATGTTTTTGACATTTTCTCTCTTTACGTTTTGCGCTAGAACCGTTAGGA
AACACATTCGACCATTGTTCATTGTCAGTCCAATTACACTTCAACTCTATCATGTTCTAACGAAAATATTCACAAATCTG
GCTTTAAATTACGGACAAGGACCATTTTATTTGCTGGAGTTTCAATCGGGACTTTTGTTTTGGAAGCCATATTACTTTTT
CGGACACGTTCTAGCAATGTTCTGCGTATTGACCTTGCAATTTCGGCCGATAATCAACGACAAAGTCAACATAATGAACA
ATGTTTTCACCAGAAAAGCCCAATATCGGTTTCAGAAACTAAAGATCCATTTGCAGAAAAAGTTGAGATGAAATTTTATT
GATTTTGATAATTTATATAAAATATTATAATTTTGTTTTTCGTTTTATTTTTATATCGATGAATTTATGATAAATGCTAA
ATATTCGATCCGGAATGAATTATTATTAATCTGGTTTTTATAATTGTTCATTTTTAATAGTTTTGTTTGTTTTTCGAAAA
TGGCGG
>SMED30000837 ID=SMED30000837|Name=Histone H4|organism=Schmidtea mediterranea sexual|type=transcript|length=1387bp
ATTAACACTAAATTTTGTTTATATAATGATTAAATATTTCAATAATCAATTAATTGAAAAATGTCTGGTCGTGGTAAAGG
AGGAAAAGGGTTAGGAAAAGGTGGAGCCAAGCGTCATCGTAAGGTTTTACGTGATAACATTCAAGGAATAACTAAGCCGG
CAATTAGAAGATTAGCTCGTAGAGGCGGAGTAAAAAGAATATCTGGTTTAATTTACGAAGAAACTCGTGGTGTTCTCAAA
GTTTTCCTGGAAAATGTTATAAGAGACGCTGTTACTTATACTGAACATGCTAAGCGTAAGACAGTAACTGCAATGGATGT
TGTTTACGCTCTTAAACGCCAAGGAAGAACTTTATACGGATTCGGAGGTTAAATGTGAAACCAATGATATTTTAAGCTAA
CATTTATTTGTTGAGAATGTTTATGGTCCTCCTTAGGGCCACAATTTTTGATTGTTTACTTTATTTTGTTAGCATTACGT
AATTTTACAGTGATTGGTTATCTTGCTGGTTGTCTGAAATATTAAATAATAATATGCTATAATTAAATGATATTAGTATA
GAAAACAAAAATCGGTTTTATTGTTTGATCAACACAATGAATATGTTTATCAATTATCATCATTTCCAGTTTTTCGATTT
CAGTTGATAATAATTATTTGCGAATTTGTGATTATATTTTCTAATGGGTTGCGAGACATAAATGAGCGTGCAGATATCAC
ATGCGAACCTGGTTCATGTAGTGTTTTGAGCTACACACTGCAGATAGACGATCAAATCTATAAAGTGAAAAAAGGGTTCA
AATCAGCTTGCAGCACCAGACTATGTGAAAATTGTGCTCACAAAGGTGATTGGTCAATGAGACTGATTGACGGAAACAAA
TATATGGTACGACAAGTCAATAAATGTTTAACTAATAATATTTTGGCAGTTGAGCAACTTTTCACAAATTTATATACTCC
TGTCTCAGATTTTACATGCTCCTTGCATAAGTGCTCTAAATATAATTATTCTTATAATGGAAATATGATTAGCTTTAGCT
ATATAGGAGTTTGTGACCATTCTTACTGTGACTCATGCCGCTATTCCGACAATTGGAGTCTATTAACCGGATATTTGCAG
CGGACGACCATTTCATGTTATGTTGTCGATAAAATTAGACTTGAAGATTATTTTCTCATTCCAGAGTTTACCGAAACCTT
CTATACACTAATTCGGAAATTAGCAATAACTATAAGCTGCGCTTCATTTTTGTGTTTGGTGATCATTCTTTTGGTTTGTT
TTGCTAAAAAATGAGATCTTACAGAAGCTTTAAGGAACTTAATTTTATTTAACAATATATTTATACTTAGATCTAATGCT
TTGAATGATCCTTTCGCAAGTCCATCC
>SMED30011876 ID=SMED30011876|Name=Macrophage-expressed gene 1 protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1880bp
AACGGAAATACAAATAAATTCTCGATTTGTCAACTCTCTAAAGTTCAAGAGTGCTACAAAGAAAAAAATAGATCACAAAT
GTCCTCTGAGCAATAATCAAACTCAATTCAACACTTTTCCCGGGTTGGGGTGGGACAATTTGGTAAATCAAGAAATGAAG
CCCGTTCTGAAGATCTCATTTTCCAAGTGCGAAGAGTCCAGTGATGGAGTTTATCTCATTCCAGACATGACGACCATTTT
TCCATTAAAAAAATCAAAATTTCATATGAATTCTGATTTATTCTCCAGCTCTTCTGAATATGTTTCTCTCACTTCTCAGT
CCATTAATGAAGATATTAATTTCTCTGATTTCCCTACTTTAATAAATGGCGCATTTTCAAACGAAAAGACCTCTTTGAAA
AGGAAAAAAATAAAGAAAAATTCTATTTTATCTCAAGTTCAATTGAGATACGAAGTTTATAATATTTTGTCTCAACCGGA
CAGTGATCTCTCGAGGGAATTCAAAGACCGAATTGTTGAATTAACGAAATACTTGGACGACGAAAAGAATTTGTTATATT
TGGATTACTTGTCGGATTTGATCATAAGAGATTTCGGAACGCATGTCATCAAGTCCGTGACAGCCGGGGCAATTCTTGCC
AAAATTGACGTTCTCAAACCGGAATATGCGTCAAAATATAATAAAAATCAAGGGGAAATTAAATTAGCAGCCGCCTCAAG
CATGGCTGAAAACGTCGGTACGAATCATGAAAAAGATGAAAGATCAAAAAAATTATTAAAAGAATATAAAGACAATTGTA
TCAGTTCGACAATGAAAGCAATCGGTGGAATGCCAATTGAGTCAAATTTCAATTTGCAAAAATGGACAAATACCATAAAG
TCGAACTTAGCACCCATCGACCGACAAGGTGACCCACTCAATTATGTGGTGACAAAGAAAAGTTTACCGGAATTGAAAGA
TAAAGCAATTTTCGATATAAATAAATTAATTAGTAAAGCAATAAACCGTTACTACAGAGCAAATATGGGATCAGATTGTA
CGAATATTGGTTCTATGAGTAATGAAAATAATGGAAATATTAATAATAAAATGTGCGAGCAGTCAACAGAAATTAAAAGA
TTTGGTGGAATATACCAAACATGCGATGGTGAATCGTGTAGTGAATACAAACAGGATAATCCTGCGACTGGAAATTTAAG
CTGTCCAAAAGGCTACAATTCGTCTATCCTTTATAAAACCATGAACATTAGTAAATGTAAAGAAAATTGTCGAAGCTTAA
CTTTGTACATGTGTTATGCAAACAGCAATGGATTCAATGATCTTGGTTTTTCTTTTGGTAGAATAATACCCAGATTCAAG
CCGAAGTCCGATTGCCCTAAATATCACATCTCGCTACGCTTTGGTGCGCAAAACATTTTATGTGTCACTTCAGGTAGAGA
GCAAGTAGAAGAAAACAGCTTACAATTCGGTGGTTTTTACAGCTGTTTGATAGGAAATCCGTTTACTATAAAAAAACAAT
CAAACGACAGTGCGAATGGCATTTATGAAAAATCATGCCCCCCAGGATTTACAAGTCAACTTAGTCAAGTCGATTCGGAT
TGCCCGGTTTATTATTGTACGAGAATATACAAAACCATCAGCAGAGTCGTTTTATTAAGACCGCCATTTATCAAAATTGA
TTGGAATTTAACTGCTACTAGCGCTGAAACATTCGACAAAATTGACGGTAAAACTGAGATGAAAAAGATCTGGAATAATA
AAGCGTTTCGGTATTGTGTAATTGCATTAGCAATTTTCTTATTTGTTTTCTTACTTCTATTTTTAATATTGTTCCATCTG
AAATTTTGCAAAAAATAAATGTTAACTAATTGGTGAGGCC
>SMED30016824 ID=SMED30016824|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=375bp
AAATGTATTTATGATAAATCAAAAGTTGTTGCAAATTTCACTTCGTTTACTGTTATCGAGCCAGGAAACGAATCTGACTT
GGCAGCCGCCGTGGCCACCGTTGGACCTGTGTCCGTATGCATCGATGCCGATCATCCAGGTTTCCAACATTATAAAACTG
GTATTTACAATAACCCCAAATGTTCATTTTTATGCTTAAATCATGCCGTTTTAATCGTTGGTTATGGATCACTCAATGGA
GATAACTTTTGGATTGTGAAGAACAGTTGGGGACCAGATTGGGGAATAGAAGGATACATACTCATGTCAAAGGACAAGGA
CAACCAATGTGGAATTGCTAGTCTAGCCGCTTATCCAGTGGTCTAATATGCATGC
>SMED30002704 ID=SMED30002704|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=1178bp
GAAGATCAAAGGAAGAACCGCTCACATAGGCCCCGCCATGAAAGGAATGTATAAACTGACCCTTGATACCAAGCATACTA
TAAAACTCAAAGTAATCGCATCATATTTCATAACATGAAGGCATTCATAATTTTGTCGTTATTCCTTGTTGCTATTGAGG
CTGGGCCAAGGAGATTCACGGTCAACAGTGAGTTGAATGAAGAATGGGAAATATTCAAAGCCCAATTTCATAAACAGTAT
GAACCGCTAACGGAGGTTATGAGAAGAATCATTTGGGAAGAAAATCTCGACTTCATTAGACAACACAATCTTGAATACGA
TCTCGGAAAACATTCTTACACTTTGGGATTGAATGAATATTCTGATCTCACTAATGCAGAATTTAAAGCCAAACTTTTAG
GAAACAGATTGAATGGATCAAACTCAAAAGGATCAGAATTTATGGTGCCAGAAAACATTGGAGCTTTGCCTTCATCTGTG
GATTGGAGAACTAAAGGATACGTAACCCCTGTGAAAAATCAATATACTTGCGGTTCATGTTGGGCTTTCTCAGCCACGGG
AGCTCTTGAAGGTCAATATTTTCGAAAAACAGGAAAATTAATTAGTTTGTCTGAACAGCAACTTGTTGACTGCAGTAGAC
CATATGGAAACCTTGGATGTGGTGGTGGGTTTCCGTATCAGGCGTTTGACTATGTTAATAAATACGGAATGGAATCCGAG
GATGATTATATATATCGTAACAAAGAAAACAAATGTATTTATGATAAATCAAAAGTTGTTGCAAATTTCACTTCGTATAC
TTTTACCAAGCAAAGAAACGAATCTGACTTGGCAGCCGCCGTGGCCACAGTTGGACCTTTGTCTGTAGGCATCGATGCCC
GTGATTGGCGTCTTCAATATTATAAAAATGGTATTTACAATAACCCCAATTGTTCTTCAGAATACTTAGGTCATTACGTT
TTAGTCGTTGGTTACGGATCACTCAATGGAGATAACTATTGGATTGTGAAGAACAGTTGGGGAACTGACTATGGAATAGG
AGGATACATCCTCATGTCAAAGGACAAGGACAACCAATGTGGAATTGCTACTCGAGCCGTTTATCCAGTGGTCTAATATA
AACAATTCTTGATTGAATTTATGACTTTTATTATTAATAAATAAATAAATTTGCTTTC
>SMED30028453 ID=SMED30028453|Name=Lysosomal alpha-glucosidase|organism=Schmidtea mediterranea sexual|type=transcript|length=2906bp
AGAATTAGGTAAAGTGCTAAATTTCAAGATGATGGATAGAGAAAATGAATGACCAAAGTACAAAATATAAAGATATTTAA
GTAATAAAATTGAATTCCGAACTTAAATTGAAATGTTGAAGTTATTGTTGATAATCTCCTTGAACTTTATAATTGTGTCC
AATGCTCTCCAATGTTCAGTACCGAATAACAATTATAGGCTAGACTGCTTTCCTGGGTCCAATGCAAATCAGAACGATTG
TTTGGCTAGAGGATGTTGTTGGTCACCACCGGAAACCCGGGAATATAGTCAGAATAATCCGACTATTCCATACTGCTTCT
TTCCAATAGAATATCCAAACTACCAAATTAATTCATTCACTCCTACCGATCGAGGATTCAAAGCTCGTCTAACAAAACAA
CAAAAATCATTTTTACGGAAGGAAATATTAAATTTGAACTTTGAAGTGATCTTTGAGACAAATACTCGATTGAGAATAAG
AATCACCGATCCGAATGTGCAAAGATTTGAAGTTCCGATTCAGCTTGGATCTCCTGATCCGACTCCACCTTCAAATATTC
AATATAAATTCACAATGCCCACAAATGGTTCTTTTGGATTCGAAGTCAAAAGAAATTCCGACGGATTGAGCTTGTTCAAA
ACATTTGGTCCTCTATTGTATTCTGATCAGTTCATACAAATATCTTCTTTGATGTCAATCCAACACGTTTATGGAATCGG
AGAACAGAATCGTCCATTTCTACATGATTTGTCTACTCAATGGGAAAGAATAGGACTGTGGGCACGCGATAATGGAATAG
ATACATATAATAATTTATATGGTACTCACCCATTCTATATGTCACTGCCTGATTCTGGAGAAGCGTTTGGAGTTTATTAT
TTCAATAGCAATGCACAAGAATTTGTTTTACAACCGGCTCCAGCGATTACTTACCGAACAATCGGAGGAATACTCGATAT
TTTCATTTTTTCAGGAGGAACACCGGAAACCACCGTTAGTCAATACACTGAATTAATAGGAAGACCAATGCTTCCTCCGT
TTTGGTCTCTTGGATTCCATCTATCAAAATACGGTTATAAAAGTATTGCAGATGTTTCTAACACTCTGTATAGAAATATT
AATATAAGCATACCAATAGAGGTCCAGTGGTCTGACATTGATTACATGGACAAATACAAAGACTTCACATCGGATCCGAT
AAGATACCCTAACTTTGGTTCTTTTGTCGCCCATTTGAATCAATCTTTAGGAATAAAGTATATTGTTATAATTGATCCTG
GAATCAGTATACAAAGTCCCGGTGTATATTCTGCTTACGATGAAGGACTTGAATTGAATATATTCATTAAAGATGCGAAT
ACTAAGAAAGATTTGATTTCAAATGTTTGGCCAGGAGAAACATGTTTTCCTGACTTTACTCATCCTAATGCTTCAAAGTA
TTGGTCACATCAAATTCAACGATTTCATTCTCAAGTACCAATAGATGGTTTGTGGATTGATATGAATGAACCATCAAATT
TCTACGATGGATCTAGAACCGGATGCGCTCTAAATAATCCGTACGACTATCCATTCTTTGTACCGACAATCAGAGATGGT
TCATTAATTAAGAAAACAATATGTTCATCCTCTCTTCATTATAACAATGTCATGCATTACAACTTGCATAATTTATATGG
TTACACCGAGGCAGTAGCCACTCATAGTGCTTTATTGAATACCATTCCAAACAAAAGACCATTTATTTTATCTCGTTCCA
CATTCAGCGGATCTGGTAAGTACACCTTTCATTGGACCGGTGATAATTCGGCAAATTGGGATCAGTTAGCCAATTCAATC
AGGCAAGTCCTCAATTTTAACATGTTTGGTATTCCAATGACGGGTGCGGATATTTGTGGATTCAATGGAGATAGTAATGA
AGAACTGTGTATAAGATGGATGCAATTAGGTGCTTTCTATCCATTCATGCGAAATCATAATAGTATTGGCGCTAAAGCCC
AAGATCCAGCTTCATGGAGTCAAGAAGCTCAAATTATTATGAAAAAAAGTATTATAATAAGATATGTTTGGTTACCTAAC
TTTTATACATTATTGGTTAAATCATATTTGTACGGTGGCACTGTGATGCGACCATTGAGTTTCCAGTTTTACAGTGATGC
TGAGACGCATGAAATTGAGAGGCAATTTATGATTGGTTCCTCGATGCTCGTCAATCCAGTTGTTGTCCAAGGAGCTAGAA
ATGTTGTAGCATATTTCCCAGCTGGGATTTGGTATGATGCAACAGATTTGAGTGTTATTTATTCGGGGAAAACTGGAAAA
TGGATTTCTTTGAATGCACCTCTTGAAAGAACTAATGTTGCATTACGTGGAGGACATGCTTTGATTTTATCAAGTTTGGT
AAACAGTACCGAGTATTCAAGAAAGGTCATTAATTTGGTTTGTATATTATCAATGAATCAAACAGCTGCGGGAGATTTGT
ATTGGGATGATGGAGAGAGTATGGACAGTTATTCTGGTAAGAAATTCAGTTATTTTAAATTTACTGCAACTTCCAGCAGT
GTTCTTATCAATCCTGAAATATTAGGATATAGTGTTCTTCCGTCTTTGAATAGTATTATAATACTCGGAATTAATACCTC
CTCAATCACTACTGTAACTATAAATGATAAACCAATACAGTTTTATAAAAAATCTAATTTGTTAGACGCCCTCCTTGGCG
GCTTGTTTCCTATTGGTCAGAAATTAATTTTAAAATGGAAATGACGAGATTCATTATTTAGTGCATAATTATGATTTTAT
ATTTTTTATTTTTTTATTTTTTTAATGAAGATTGATTGATTGATTGACTAATCATTAAATTGTGATTTATTGAAATTAAA
AATTTGTTCGATTTTTATAAAAAAAA
>SMED30034696 ID=SMED30034696|Name=Macrophage-expressed gene 1 protein|organism=Schmidtea mediterranea sexual|type=transcript|length=2009bp
AGCGAAAATATGACTCGTTTTTCTGTTGCCAGTGCAACATTTATTTGGTTTTTATTTTTCGGTTCCACACTAGCGGATGA
AGCAGTCATTGAGCCGGATAACGTAATTCAGAACTCGAATTTTCCATCCAAACGTGTTGTAAATGATTGCCACCTGACTA
ATGATCAGTATGCATTCAATGTCTTGCCGGGGTCCGGTTGGGATAATCTTGCCAATCAAGAGTTAGGCCAGATTCTGAAA
TTATCCTATAAAAACTGCAAATCTTCCAATGATGCCAGCTTCCTAATTCCCGATGAGGTTTCAATGTCACCAGAAATGTT
GTCTAATGTTCAATTGGATTCCGACCTAGTCTCACATTTTTCAAAATACGATTCAATGACTTCCAAGTCTATTAACATTG
AAGCAAACGCCGCAACGCCAAATTATCAAGTCAGTGGATCGTTTTCTTTTGAAAAGAAAGATGTTAAGAAAAATCAAATG
AAAGAAAAATCCGAAATTTCTCATACGCAACTGAGATACGAACTTCACCACCTTGCCTTTCAGCCAGACAGTGAATTGGA
TCCTACCTTTCTCAATAGGGTCATTGACATGGGAATAGTTTTGGAAAAAGAAAGTAAAAATACTTACTCAGAGTTTTGGC
TGATTTGATCGTAAGAGACTACGGAACTCATGTAATACGGTCTGTTGTCGCTGGAGCTATTCTTTCTAAAACTGATGTTC
TCAAAGGCAATTTTATGTCCAAATCCAGGGGAAATTCTATAAATGTTGCGGCCTCTGCCGCTGTAAGCATGAGAATGGCT
GTGGGAATTAAGATTGGAGGAGGTTATGGCAATTCTGAAACCAATGCCACGGAATATGAAAAGAATTGCGCAAGTTCAAG
AATTAACACCTTTGGTGGAGGACCATATGGTTCTAATTTCAAATTAGAAGATTGGGAAAAGACCCTTCCTACTAACCTTG
TTACTATAGATCGTACTGGTGATCCTTTATATTACGTAATAACAAAAAGAAACGTACCGTATTTCAGTGACAAAACAATA
TTTAACATCAACACTTTGATTAAAAATGCAATCAACAGGTATTACTCAGCTAATTCTCGCCCTGGATGCATGGATATTAA
ATCTGATAATTTTGATGAAAATGCTAACATTGACAATGGCATATGCCAAAATCCAGACGATAATTTCAAATTCGGAGGAG
TTTATCAATTTTGTTATGGGCTGAGTGCTAAATGTAAGGAACTGAACCAACTCAACCCAATCACTGGAACATCCTCATGT
CCAGATGGATTTGACCCTGTTGAGCTATTTTATGTATATAGTAATGAGAATAACGATGGTATGGTCATCAACACGTTTTG
GTGTGCTCCTAATCAAAAATCAACTCATTCAAATGGATATTTATTTGGCGGGATTTTTACCGATGCATATCCGAACCCTG
TTACTGGATCTTCTAGTTGTCCACAATATTTTCTATCTTTGAAATTTGGACGTACCGCAAAGATTTGCGTTTCACAGGAT
ATCGAACTTGGAATGAAAAATAGTCTGCCTTTTGGAGGGTTTTTCAGTTGTTCCATGGGGAATCCCTTGACACAGAAGAA
GACGACTAATTCTCCCGCTGACTATTGGACCCAATCATGCGCACCCGGTTATTCTGCACATTTGGCGGTCATCGAAATTA
ATTGTCAGATTTCATATTGTATCAAGAGTAACGCATTAAAAGGCAAAGAAGAAATTCCTCTTTATCGGCCACCATTCATT
AATTTAGACGATGGAATTAAGTATAATTCTATAAAGAAATTTCAAACTACTTCCGGGATAGAATTGAAACTTTCCAAGGA
CGGAATGTGGAATAAAGTGAAATATGTTCCTTTCGCAAGATCTAAATTTGGTTTAATTATTTTTTCCGAGGTTACCCTAA
TCTTGGTAATTATTGTTGTGGTTTTAATGGTTTGTTGGTTTAAATCCCGTTAAAAGAAAAATTGTTTTAAATAAAGACAG
ATCGGAAGA
>SMED30025555 ID=SMED30025555|Name=Lysosomal alpha-glucosidase|organism=Schmidtea mediterranea sexual|type=transcript|length=769bp
TGTCAAATGTCGCACGGAAGATTATTGTCTGCTTTGCCAGAATTTATAGTTCCAAGAAACAATGACAGACTTGATTGTTT
TCCTCAGTCAAATTCTAATAGAAATGATTACATTGCAAGAGGTTGTTGCTGGTCACCCGCACTTTCGCTTAATAAAATAT
ACGGATATAGTGAGATATCTGTTCCTTATTGTTATTTTCCAAATGATTTTCCAAATTATGAAATAAAAAATATCCAGGAA
ACGAAAAATGGAATAAAAGATGAGTTGATAAAAAAAGCGAAAAGTCATTTATCCGATGAAATATTGAATCTATTCTTTGA
AATAAGCTATGAAACCGATACGATAGCTAGAATTAGGATAACTGATCAAAAAGAAAAAAGATTTGAAGTTCCGATTACTT
ATAATTTAGGTCGTTCACTGGTAAATCAAAAAAAGTATGATGTCATCATTTCATCCAGTGGATCGTTTTCTGTTGAAATT
ACCAGAAATTCAGACAAACGCTCACTTTTCAAATCATTTGGTCCACTTTTATATTCTGATCAATTTTTACAAATATCAAC
ATTGATGTCAACAGATCAAATTTATGGAATTAGAGAACAAAATGGACCCTTTCTTCATCAATTATCCAATGGCTGGGAAA
TAATTGGATTGTGGGCAAGAGACAATGATTTTGATTGTTATCCACATACATGTTAATTCTATATTTATTGCGTCCTATTG
TATATTATTTTAATCCCGTTTTCATTATTTTCCCATCTTCCAATATGAG
>SMED30018592 ID=SMED30018592|Name=ovo|organism=Schmidtea mediterranea sexual|type=transcript|length=1211bp
GTCATATTGAACACTGAGACTAGCTATCAATAGCTGACAATTAGACGTATAAAATGTTAGGGTACGCCTTTTTGGCCATT
ATTTCACACCAAAATTTCCATGAGTATTTTTCTAATAAGCACTCTACTCGCAAACGATGACGAAATGCCCACAGATTTGT
CATCGAAAACTGAAAAGATTGAAAACCATGAAAAATCTGAAAGGAATCTCTGCAAGTATTCCAGTCAGTTTCTTTCCTGT
TTTTATTCACAGGAAATGTTGACACTACTTATGAGAAAAAATTTCATCAATCAATATTCATTTTATTTAAAGATTTTCTC
GGGGTTTCCACAATTCGTCGATAACTTCAACTTAGTAAATCCAACAGATTTCACCGTCAATTCAAATTCAACAACAATTT
TGCCCTCATTCAACTTCCATAAAACGTCATTGAATATCGAAATGAACACCTCACTGGCCAATTCTTCAAGCACTGGTAGG
TCGTCTCCAACTGAAACTGTGTCTGAAAATCTTTGGTTAGAAAAAGTAAAGGTGGAAAAATATTTCCATTTAATTGAAAA
TCTATCACAATCCCAAGAGAACATTGAAGACATTGTCAAAACGATCAAAGTCAAACGAAGAAATTTTGCTGAATATATTA
AGAAACTTTACCTAAGTGATCCAGCCAAATTTAAGTTGACAAATGGTGGAGATGGAATAGTAAATCCATTTAGAAAACAA
TTCAAAGAAGAACGAGATAAATCTATGGACAAATTTTGCATCGAAGTTAATCACAATTATCAATGTAAGATATGTAACAA
GGTGTTTCCTTCCAAAAAGCACATGCAACGTCATATACGTTCACACGGTGTAAATTTTGATTGGTTGTGTAAATATTGTT
TTAAACCGTTTATTGATTCCTACGATTTAAAACGACATACGAGAGTCCATACAGGAGTTCAACCATACAAATGTCAAAGT
TGCACAAGAAAATTCAGTCAACGATGCTCATTGGAAAGTCATCAGGTGAAAATCCATGGAGTAGCACTGAATTATCTATA
CAAAGAAAGAAGGAACAAGTTGTATCCGTGTGAAATCTGCAGTTATAGTACGTCTTGTAAAGCAACTTGGTTGAGTCACA
TCATTCAGGAGCACCCGAATTCACTTTATGCAAAAGAAGAAGCACTCAAAGGAAAATACAACTGACTTTGAAAAATATTG
ATTTTTCAAGC
>SMED30025388 ID=SMED30025388|Name=Myosin heavy chain|organism=Schmidtea mediterranea sexual|type=transcript|length=6089bp
TTTTTTTTCGAGTTTGTGCTAGAAATTAATTTCAGTTTGAAATTTTTTGCCTATTTCGAGTTCTTTGAAAACAATCTGAA
AACATGAACCCATCTGATCCCGATTTTCAATATCTCGGTGTCGACCGAAAAGCTTTAATGAAGCAGTATGGGGATTCCTT
TGACAGCAAGAAAAACTGTTGGATTCCTGACGAGAAAGAAGCCTTCATTGCGGCGACAATTGAAGATGCGTCTGGAGATG
TCTATACGGTCAAAACCGATAAAAGTGAAACCAAGACTGTTAAAAAGGACGAAATCGAACAAATGAATCCACCGAAATTT
TTGATGATTGAAGACATGGCAAATTTAACCTTTCTAAACGATGCCAGCGTTCTTGATAATTTAAGACAAAGATATTACAA
GAATCTGATTTATACCTACTCTGGACTGTTTTGTGTGACAATAAATCCATACAAAAGATTTCCAATTTACACCCCGCAGG
TGATTTCAAAATACAAAGGTAAACGACGAACTGAAATGCCTCCACATATTTTCTCGATATCCGACAATGCTTACACCAAC
ATGTTGGCGGACCGAGATAATCAATCTGTCTTAATTACTGGTGAAAGTGGAGCTGGGAAAACTGAAAATACAAAAAAAGT
TATCACTTATTTTGCACACGTTGCAGCTGCTACTAAAAAAGAAGAGGATGATACTGGAACTGGTCAAAAGAGAAAGGGAA
CATTGGAAGACCAAATCGTGCAAGCAAATCCTGTTTTAGAAGCATACGGTAACGCAAAAACTGTGCGAAACAACAATTCA
TCCAGATTTGGTAAATTCATTCGTATTCATTTCGGTACAAGTGGAAAAATAGCTGGAGCTGATATTGAATTTTACTTACT
CGAAAAATCGAGAGTAAATTCTCAACAGAAAGGTGAAAGAAACTATCACATTTTCTATCAAATTTTATCGAACGGAGGAA
AACCATTTCATGAAAAATTACTCATCTCTCCTGATCCAGCTTTGTATTCCTTCATTAATCAAGGTGAATTAACAATCGAT
GGAGTCGACGATGAAGAAGAAATGAAAATAACTGATGAAGCTTTCGACATTTTGGGATTTTCTGCCGAAGAAAAAATGAG
CTTGTTCAAGTGTACTTGCTCAATTTTAAACATGGGCGAAATGAAATTTAAACAAAGGCCAAGAGAAGAACAAGCCGAAG
CCGACGGTACTGCTGAAGCTGAGAAAGTGGCTTTTCTGTTGGGTGTCAATGCAAAAGATTTAATGCAATCGATTCTGAAA
CCGAAAGTTAAAGTTGGTAATGAATATGTCACAAAGGGGCAGAATAAAGATCAAGTTCTTTATTCGGTTGGTGCGCTAGC
AAAATCTCTTTACAACAGAATGTTTGCGTGGTTGGTTTTGAGAGTTAACAAAACCCTCGACACTAAAGTCAAGCGACAAT
TTTTCATCGGTGTTTTGGATATTGCCGGTTTCGAAATTTTCAATTTCAATGGATTTGAACAAATTTGTATTAATTACACC
AATGAAAGATTGCAGCAATTTTTTAACCATCACATGTTCGTGTTGGAACAGGAAGAGTACAAGAAGGAAGCGATCGATTG
GGAGTTCATTGATTTTGGAATGGATCTTCAAGCGTGCATTGAGCTCATTGAAAAGCCAATGGGTATTCTGTCAATCTTAG
AAGAAGAGTGCATGTTTCCGAAAGCATCTGATATGACATTTAAAGCAAAATTGTATGATAATCATCTCGGAAAAAGTCCC
AATTTTGGAAAGCCAAAACCTCCAAAACCCGGACAGGCTGAAGCTCACTTCGAATTGCATCACTATGCTGGCAGTGTGCC
ATACAATGTTACTGGTTGGCTGGAAAAGAATAAAGATCCTCTCAACGAAACTGTGATAAATCTACTTGCGGCAAGTAAAG
AGGCATTAGTTTCGAGTTTGTTTGCTCCGGCTGAAGATCCAAATAATACGGGTAAACGGAAAAAGGGTGGGGCCATGCAG
ACCATTTCTTCAACTCATAGGGAATCCTTGAATAAATTGATGAAAAATTTACAAAGTACCAGTCCACATTTTATCCGATG
CATTGTTCCAAACGAATTCAAACAACCTGGTGTAATCGACGCTCATTTGGTATTACATCAATTGCATTGTAACGGTGTCC
TTGAAGGCATCAGAATCTGTCGAAAGGGTTTCCCAAACAGAATGATTTATTCTGAATTTAAACAAAGATATTCTATCTTG
GCTCCAAATGCAATTCCACAGGGATTTGTTGAAGGCAAACAAGTAACGAGCAAAATTCTGGAAGCTGTTCAATTGGACAC
CAATCTTTACCGCCTGGGAAATACTAAGGTATTTTTCAAAGCTGGAACTTTGGCTGATTTAGAAGACATGCGTGATGAAA
AATTATCTTCACTGATTTCATTGTTTCAAGCTCAAATACGCGGATATTTGATGCGAAGACAATATAAAAAATTACAAGAT
CAGAGAGTTGCTCTATCTATCATTCAAAGAAATATTCGTAAATATCTTCTTCTGAGAACATGGCCATGGTGGAAATTGTA
TACCAAAGTTAAGCCACTTTTGAACATTGCTCGTCAAGAGGAAGAAATGAAAAAGGCCGCTGAAGAATTGACAAAATTAA
AGGAAGAATTCGAAAAAGTTGACAAATTCAAAAAAGAACTTGAAGAACAAAACGTCAAATTGTTGGAAGCTAAAAACGAT
TTGTTCTTACAATTACAAACCGAACAAGACAGTTTAGCCGATGCCGAGGAAAAGGTTTCAAAATTGGTTATGCAAAAAGC
CGATATGGAAGGAAGAATTAAAGAATTGGAAGATCACCTTCTAGAAGAAGAAGATAATGCTGCTGGACTGGAAGATATCA
AGAAGAAAATGCAGGGTGAGATTGAAGAGTTGAAAAAAGATGTTGTCGATTTGGAATCTTCATTACAAAAGGCTGAACAA
GAGAAAACCGCGAAAGATCAACAGATAAAATCGTTACAAGATCAAATGGCAAAACAAGAAGAAGAGATGAACAAATTGAA
AAAGGAGAAAAAGGCCGCCGATGAAGTGCAAAAGAAAACCGAAGAATCTCTACTAGCGGAAGAAGAGAAAGTCAAAAATC
TAAACAAAGCTAAAGCCAAATTGGAACAGACCATTGATGAGATGGAAGAAAACCTCTCGCGAGAACAGAAAATCCGAGCT
GACGTAGAAAAAGTTAAACGAAAAATCGAAACTGAACTGAAACAAACTCAAGAGACCGTAGACGATTTGGAAAGAGTAAA
ACGAGAATTAGAGGAACAATTGAAGCGCAAGGAAATGGAATTAGTCAATGCTTCATCGAAAATTGAAGACGAATCGGGAT
TAGTTGCCCAGCTTCAGAGGAAAATCAAAGAACTTCAAGCTCGAATTCAAGAATTGGAAGAAGATCTGGAAGCAGAAAGA
CAAGCCCGTGCAAAAGCAGAGAAAAGCCGACATCAACTCGAAGGCGAGTTGGAAGAATTGAGTGATCGACTGGAAGAACA
AGGAGGCGCAACCTCAGCTCAAATGGATCTCAATAAGAAGCGAGAGGCAGAATTAATGAAATTAAAGAGAGATTTAGAAG
AATCGAATATGCAACACGATCAGGTTATCGCACAAGCTCGAAAGAAGCAACAGGATGTTGTCAATGAATTCTCAGAACAG
CTCGATCAACTGCAGAAAGTCAAAGCTAAAGTTGAAAAAGAAAAGAATGAGATGAAAGAAGATTTAAATGACCTACAAGG
ACAGCTGGAATCATTAAATAAAGCCAAGGCTAACAGCGACAAACGAATCAAAGAAATCGAAGCTCAAAATTCCGAATTAC
AGGGCAAATTGGAAGAGGCAAATAGACATATCAATGATGCCAACAATACATCTGGAAAGAATCAACAAACCAATGCGGAA
CTCCAAGCACGTTTAGAAGAAGCCGAATCGCAAATCAATCAGCTGGGTAAAGTCAAGCAACAAATGCAGACTCAACTCGA
AGAAGCCAGGCAAATCGCTGAGGAAGAGTCGAGAGCAAAGGCTAAATTGAGTTCTGATGTTCGCAATCTCAATGCCGATT
TAGACAATCTCAGGGAGGCACTGGAAGAGGAAAATGAGAACAAAAGTGACATACAGAGACAGCTAGTTAAAGCTCAGGGA
GAAATGCAACAATTGAAGGCTAAATTCGAAGGCTCGGGATCCATTCGTTCAGAAGAGTTGGATGAAGCCAAGCGAAAGTT
TATGACACGAATCCATGAGCTGGAAGAGGAAGCTGAAACCGCCAAATCGAAAGCCGGACAACTAGAAAAAGTTAAAGCTC
GACTCCAAGGAGAAATCGAAGATATGCTGGTCGACGTTGACAGAGCGAATACACTCGCATCTCAGTTGGAAAAGAAGCAG
AAAACATTCGATAAAGTCGTGTCAGAATGGCAGCAGAAATATGCTGAATCTCAGGCGGAATTGGAAGCATCCCAGAGAGA
AAGCAGGACGATTTCAGCTGAGGTGTTTCGAATGAAAGCACAAATCGAAGAAAGTCAAGAGCAGTTGGAAAGCGTTAAAC
GGGAAAACAAAAATCTAGCAGATGAAATCCACGATTTGACAGAGCAAATCGGAGAAGGAGGTCGCAGTGTTCACGAAATC
GACAAAGCAAGGAAACGATTGGAAATGGAAAAGGAAGAATTGCAACATGCGTTAGAAGAAGCCGAACAAGCTTTGGAACA
GGAAGAAGCCAAGTCTCAACGATCACAACTGGAAATGAGCCAGATCAGACAAGAAATCGACAGGCGATTGGCTGAGAAGG
AAGAGGAATTCGAGGCCACTCGAGTCAATCATCAAAGAGCAATGGAGTCAATGGAAGCCTCACTTGAAGCCGAATCCAGA
GGCAGGGCTGAAGCAACGAAGATGAAAAAGAAACTGGAGCACGATATCGGTGAACTGGAAGTTGCAGTGGATACCGCCAA
CAGAATCCGATCGGAGCAAGAAAAGAACGCAAAGAAATTCCAGCAGCAAGTTCAAGAATTGCTATCAATGGTGGAGGATG
AGAAACACCAGAAGGATCAGATACGAGAGCAAACGACGATGACAGAAAGGAAATTGACAATGGTCCTGGCAGAGCTTGAG
GAGGTTCGTGGCTCATTGGAAAATTCCGAGAGAAACAGGAAAAATACCGAGAATGAGAAAATGGAAATAACTGATCGATT
GAATGAGTTGAGTGTCCAGAGCTCCGGTTTCATGGCTACCAAGCGGAAATTGGAAGCTGATTTGGCTGCTATGCAGTCCG
ATTTAGAGGAGGCCGCTACTGAAGCCCGACAAGCCAATGAACAAGCCAAGAAGGCTGTTGCTGACAGTGCGAGATTGTTT
GATGAAATCCGGCAAGAGCAGGAACACGCACAGCAAATCGATAAGATCAAGAAACAACTCGAGGCCCAAAATAAAGAATT
GCAAGCCAAATTAGATGAATCGGAGAATAATGCTTTGAAAGGTGGCAAAAAAGCCTTGAGCAAACTAGAGCAACGCGTTC
GTGAACTTGAAGCCGAATTAGACGGAGAACAAAAAAGACACGTTGAAAGTCAAAAGAACTCCAGAAAAGTTGAAAGACGG
CTTAAGGAGCTTGGATTACAAACCGACGAAGATAAGAAGAACCAAGAAAGATTGCAAGATCTGGTGGAGAAGCTTCAAGG
TAAAATCAAAACCTACAAACGCCAGGTGGAAGAGGCGGAAGAAATTGCTGCTGTAAACTTAGCAAAATACAGAAAGATCC
AACAGGAAATCGAAGATTCCGAAGAAAGAGCTGATCAAGCTGAACAAGCGTTGCAGAAGCTGAGGACCAAAAACCGCAGC
TCCGTTTCGACAGCGAGAGGCGGTAGCATGGCTCCCGGCATGACCACAGTGAAATCGACATCACTCTCTGTTTCGGCTTC
GAGCCGACGACAAGGTTCTAGTGTTTCCAGAGAGAGCTAAGTCAGAAATTCTAGTAACACAACGATAAATTATTAGGATT
TACTTAATTGACATTATTTGCATGTTATCAATTATTGGACACAATTTAGTGATGCTTTTATTTAATAAAATTTACATTTT
GAAAAAAAA
>SMED30015552 ID=SMED30015552|Name=POU domain protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1696bp
TTATTTTTAAAGTGTATCTTAATATTTCAAGAAACTGTATTATAAATTTCACAAATTAAAATATTTGGGATATTTGTAAA
TTGTTAATAACTCTTCATAAATGTCTCAATCAGATGGAAATTTCAACTCCTTTAAAAATATTCACATTGAACAGTTATTT
AAAATTATTCAACACCAAGCAGAACAAATTGAAGCACAAAAAGTTCAAATAAACGCTTTAATAAAGTCACAGCAAACGAT
ACTAGAAAGTATGAGACCTCAAAATGATGCAAGCGTCAATTTAAATCCTTTGTCAATGAATTACCTTAATCACAATATCC
GACAATCTTTGTTGAATTCTTCCTTAATGCCTTCAAAAAATATTTTAAACAATCCCTCATTAAATTGTGCTAGCAACAGC
AACAGTAACAGCAGCAACGTCATCATCAACAACAACAACAGCAATATTGATGTTTCAGACCATTTTCTTCAAGACTACAA
TAGTCGATTAACACAACAAATTCTTCTTCAGCCTTCCTTGAATATTCCTCGCTCAAATCCCACAATAAAATCCCCTCATT
TGCCAACGAATATTGGAGGCTCAGGAAATCTAACTCCCACAACTTGTCTTAGCAACGAAACATCTGAATTGAGACCCATG
GAAAATTGGTCCAATTTTAAGTTGCAAGCTCATTCCGATACTCAAAACGTAATCAAAAAAGAAGTAGCAGATCAATCAGA
CAATTGTAACAATTCTGAAATTCCAATTATCGAAAATGATCCAAATGAAGATGAAGGAGAAATGGATTTGTCATCTCTCC
AAGAGTTCGCCGCAAAATTTAAAATGAGTCGTATTGAAATGGGATTCACGCAAAGAGATGTCGGTGTTTGTTTGGGTTTG
ATGCAGGGCAACGATTTTAGCCAGACCACACTGAGTCGGTTTGAAGCTTTAAATCTGAGTTATAGGAATATGAAGAAACT
GCAACCGTTGCTACAAAGGTGGCTGGATGATATTCAACGAGAAGGTCGTGATGCCGTTATGAGTCGCATAACGGCTTTTT
ATCAACAACAAAAAGCGATGGTGGAGGAAGACTGTGATAACAATGACCTCCAAATAGTCAGTGGCTCAAGTAGGAAAAGA
ATTGCAAATGAAGGATTGCTAATATCCGACGAGTTACCCGAAGAACGACATTCAGTCAATGCAGATTCGACTACTATGAA
TTCCAAATTATCACAAAATCAATTACTTCGCACTTGTATAGGAAATATATCGAATAGTCTTTCACCTAGTCTGCTCGGCA
ATTTGACTAATGGGTTTTCTACAAGTCTTTCCACCTCGCTCCCAACTAACCTCACTCACAGTTTTCCGAATATTCAGTTT
CAATCTTCATTACTCCACGACCAAATCGCCAACGGATTCAACAGAAATCTTTCTTCCCAACCAAAAAAACGACGTAAACG
ACCTCTAATATTGGAAGAAGGCAAATCAAGATCGGAATTGTTTCCCGATATTTTGAGACCGTAATCAGACCGGTGGAAAA
GAATCAAAAAAACAACACAAGTTCTACGGCTATTTTATTTATTTTCGCCATTTCTCGCATTGTAATATTTTGTAATTATT
AATATCCTATCTATTGTTTTATAAAATCATATTTTTTTCAAATTGAATTTTTTATTATTTTTCATTTTTATTGACCTGGT
TTGTGAGTGTTCGGAA
>SMED30035691 ID=SMED30035691|Name=Macrophage-expressed gene 1 protein|organism=Schmidtea mediterranea sexual|type=transcript|length=2718bp
TATATTTTAGAGATTATGATTATAAAAATTTAAAGTGCCGACAGTTAATAAAAACAATTAATGCTTACAACGTAAGGTCA
TCATGATGATGTAATCATTCGGATGTTCTATGACGTTCGGATAACCCTTATCACGTGGATCCTAAACAAAATATATCAAT
CAACTAGGAATTACAATATACATTTGTTTGTTCAACAGTGAAACCAGTGATACTTTGTATGTTTAATAATATAATAATAA
TTATATTTGTCTGTGGAGTTCTATCTTTTAAATGTAAAAGCGAATCAAACAGAGACCTCCCGTCAGAGAGGCAAGTCCAT
AAATGTAAACTTACTAACAAACAATACGCATTCGATATCCTCCCTGGATCTGGATGGGATAATCTTGAAAACAAGGAACT
CGGTCAAGTTTTAGAAATTTCATACAAGGAATGTTTGGCTTCGAATGATGGCAGCTTTCTCATTCCTGACAACTCGGTGA
TTATTCCGATCAAAAGGTCAACTGTCGAATTGGCATCTGACATATTTGATCATTTCTCTAATTTCACATCTGCCACGTCC
AAATCCATAAATGCCGATGCAAGTTACGCCACACCAAGCTATCAGATTAGTGGCTCGTTTTCATGGGAAAAAAAGGATGT
AAAAAATGACCAAATCAAAGAAAAGTCTTTGGTTTCTCGGGTACAATTGAGACACGAATTTTACACCGTTTCATTTCAGC
CAGACTCGAAATTTGATCGTCAATTCAAGAACAGAATTCTAGATATTGGAGCGTTATTGAAAGAAGGAAAAGACACAATT
TATCCACAATATTTAGCGGATTTAATTGTCCGTGACTTCGGCACTCACGTCATTCGGTCGGTGGATGCGGGAGCGACACT
AATAAAGACTGATGTTTTAAAATCGAATTATGTCAAAGGTTTTAAAGGGGATACAACTAAGATTGCAGCTGCGGCATCAT
TCAGTATGACAACAATGCTTTCAGTCAACCTCAAAGGAACCTATGTTGGTGATACCACGAGTCTCAATGAATTCAATAGT
AATAGTGCAAGTACAAAAGTCGAAACTTTTGGTGGTATACCGTTTGGTTCGAATTTTAAGTTGGAAGATTGGGAGAAAAC
CCTTGAAACGAATTTGGTAGCAATTGATCGCAAAGGTGAACCGTTGTCCTATGCTATTACATCAAGAACTCTTCCAGAAT
TTGACGAGAAAATTATTTACAAAATCGCTACTCTCATCAAAGAAGCAGTCAATAGATATTATGCAGCCAACACGAGAGTG
GGATGTATGAATATGGAGTCAGAAAATTTCAATGACGACGCAAATGTTGACGGTGGAAACTGCGAACCTCCTAATACATT
TTACAGTTTTGGAGGAACTTTTCAAACCTGCTCAGGCCCTGATTATCAGTGTATGGATGTCGCGGCAAAAAACCCAGTGA
CCAATAGTTATGCTTGTCCTGATAACTATGATACCATTGAATTACAAAGTGGATTGAATAAATGCATAAATTATTGCACC
AAATACTTATTTTCCACTCAATGTCATTACGAGTGTTCCCAATATGCATTGTATTGGTGTTCTTCTACAAACAAAACGAA
AATATCAGAAGGCGCACTTTTCGGGGGATTCTACACTAATACATTTCCGAATCCACTTACAAATTCCTATAGTTGTCCAC
AATACTATGTAGCGACAAGATTCGGCGTAAACGCCAAGGTTTGCACTGCACTCAATAAGGCAGAGGCTATGGAACACCAT
TTGCCGTTTGGAGGATTTTATAGTTGCAAAGTTGGAAATCCTCTACTAGATGATCCTCTCTACAACATTACACAGGATCC
CAAATATTGGCCTCAAGGTTGTTCAACCGGATATTCATCACATGTAGCTATTGTCGACAGAGCTTGTCAAATTTCCTATT
GCGTTAAAAATAACGCCCTTAGCATGAGAGAGCAACCGCCTCTCTACCGACCACCTTTTATTGATTTGGGATTTGGACCC
AATATGACAGTAATTACCTCTCTGGACACTCCAATGGGGGTCCGATTATCTGTTGATGAAAACGGGAAATGGAGTCATAA
TCACCAATACAAATTATCCAATTACAATATTATAATAATATCAGTCATTATGGCGGCAGGAGCCAGCATTGCAATTATTA
TTATAATTCTTGGAGTTCAAAGATTCAGCAGAAACCGAAAAGGTCAAGTCTCACCGGAATCTCATGAATTTGATAGCAGA
TATGATTCTACTAAAGATGTTGCCAATCTTGCGTTACCCGGCGAGGTTCCACCGTTTCGTGTTATAATTGACGGAGCGAA
ATGATGCTTGGAACCTTTTATTATTTCTGTTGAATCTGATCTGTAAATGTTTTCAGAATATTTTTCTAATAAAATCGTTC
TGAAATTTTAAAGTGATCCTTGATGCTATTAAATGATGGACTTTATTGTACCCCGAATTGGGTCACCCTTGTTCACGCAA
ATTCGTGCTTAGGATATTTGTACGGGCTTATGCAACTTTTTAAATTTTTATTTTTCCTTATTTTTATTAGCAATCCGTTT
TATTTATAACGACAAATGCTTGATGTTTGAATCAAATTTTTATTATGTTTCTTAATGAAACATAGTGAACAATGTGCCAC
TAATTTCATAACCAAGGTCTAATCAAATAGTTTGGGTAGTGAAAGCAATATTACAGAGTTTAGGTTTGTCATTCATAT
>SMED30033415 ID=SMED30033415|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=703bp
AGAACAAAAGGATACGTAACTCCAGTGAAGTATCAAAAAAAATGTAAGTCCTGTTATTCCTTTTCAACTGCAGGATCTCT
TGAAGGTCAATATTTTCGGAAAACAGGCAAATTGGTTAATTTTTCTGCACAGCAATTAGTTGACTGCAGTAGTTCTTTTG
GAAATGAAGGATGCCGAGGAGGATTTGTAGAAACGTCCTACAGCTATGTGATGGAATACGGCATTCAGTTAGAAAGTGAT
TACCCGTATGAAGGAAAATTTAGACAGTGTAAATACAATAAATCTCAAGTCGTAGGAAAATGCAGTGGATTTGTTCGCAT
AGAAGAAGGGAATGAAACTGATTTGGCCATCGCGGTTTCAACGGTTGGACCTCTGTCCGTTTCAATAAATGTTCAAAAGG
ATTTCATGGATTACAAAAGTGGCATTTACAATAATGCGAATTGTCTGTTTTATTCATTAAATCATGCTCTTCTACTTGTC
GGTTATGGATCAGAAAACGGAGTCAACTATTGGCTTTTGAAAAATCAATGGGGAACTGCTTGGGGTGAAGAAGGATACGC
CAAAATGGTAAAAGACGCGAGAAATCACTGTGGAATCGCTACAGCTGCCAATTATCCCTTAATATAAAATAGACTGATAT
TAATAAAAATGTTTTGTTATAAATTTTAGAATTAAAAAAAGTAATAATAATAATAATAAATTG
>SMED30016085 ID=SMED30016085|Name=Macrophage-expressed gene 1 protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1970bp
TTACAATATAGAAAATGCTTTGCTTTCCTCTGGGAGGGTTGATTCTACTGATATCCATAGCATTTAGCTTAGCTGACATC
AATCTACCTCAATATCAAAGAGGATCAAACACGAATTTCCCATCGAGACGAATGGCCCATGGGTGCCAGTTGACAAATAA
TGAATATCCATTCAATGTGTTGCCAGGATCAGGTTGGGATAACCTCTCTAATCGGGAGCAAGCACAAGTGTTAAAAATAT
CATATGACAAATGTAAAGCCTCAAATGACGGAAGATTTCTAATTCCTGATCAAACGAAATTAGTGCCAAAAATGAAGTCA
ATAGTGCAGTTAGATTCAAATTTGATTTCACATTTTTCAAAATATCCGTCGACTACTTCTAAATCTATTAATGCGGAAGC
AAGTGGAGAAACGAAGAAATATTCAATCAGTGGATCTTTTTCCAATGAAAGGGAAGACGTAAAACGAAATCAGTTAAATT
CTAAATCCTCAATATCCCAATCTCAATTGAGATACGATCTTTACAAAATTTCTCATATCGTAGACGCTGAACTTGATACA
AAGTTTCACCAAAGAATCCTAAACATTGGGGTGTTGATTGAAACAAAAAAGGATTCTTTATATTCAGCATATCTCGCTGA
TTTAATCGTCAGAGAATTTGGAACTCATGTCATTACATCGGTGGATGCTGGAGCCGTTTTGTCGAAAATTGACATCTTGA
AACAAAAATATGTCTTAGATAGTCAAGTACAAAATAGTGACGTATCAGTTGCAGCATCATTCAGTTTGGGACAAATTTGT
GGATTTAAATTCGGTTCAAATTTTAAAAATGATGACACAAAAATTGAGGAATATAACAATAATTGTGCCAGTACGAGAAT
TAAAACAATTGGCGGTGGACCTTTCGGCTCGGATTTCTCTTTAGAAGAATGGGAAAAAACCCTTGACACAAACTTGGTGG
CTATAGATAGAATCGGAGAGCCTTTGTATAACGTAATTACAAAGCATAATATTCCAGAATTTAGTGACAAAACGATTTAC
GAAATAAACTTACTTGTCAAAACTGCTATTGAGAAATATTATTCCACAAACACTCGATTAGGATGCATGGATTTTAATTC
ACATAGCTTTGATGAAAATGCCAATGTCAACTCCGGTTTGTGCAATGAAACGGGAAATACTTATCCCTTTGGTGGGGTTT
ATCAAACCTGCCAGAATTCAGACAAATGTGACACATATAATCAAAAGAATCCCGCCACCGGAGACTATAGCTGTCCAAAG
GCATTTAATCCTATCAAACTGTTTGAACTTGACAATCCAAGTATCACTTTTGTTTGGTGTGCTCCACGAAGCTCTTCAAG
CGCAATAAATGGATATCTATTTGGCGGAATGTATACTGAACAATATCCGAATCTTGTTACTAATAATCACAACTGTCCGC
AATATTACTTTCCTGTCCAGTATGGAATCAGTGGGAAAATATGCATAACTCAAGATAAAGAACTCGGCGGCAAAAATAGT
TTGCCATTCGGAGGATTCTACAGCTGCAAGACTGGAAATCCATTAGCTTTGGCCATTTACAATGGAACTCAGACAAACTT
TCCTCTGACCTGCGGTTCGGGTTATTCTACTCATTTAGCGTCTATTTTTAACAACTGCCATTATTCGTATTGCGTTAAAA
ATAATGCTATAAAAACGAAAGCTGCGACTCCACTTTACAGGCCTCCGTTTGTTGATTTGCAAATGGATTCGAATATTGAA
GTCGTCAGTGAACTCACTACTTCAGCAGGAATGAAGCTGGTTTTAGCCGAAGATGGAATATGGAAGGAAGAAATCCTGAG
AACTTACATGGTCGAGTATATAATGATAGCAGTAACTGTTGCGTTGCTGACTCTAATTGCTATATATATCAAGTTCAAAT
GTTTCGTTGGAAAGAAGTTAAATCCTACTCAAGTTTCAGCAGATCGGAAG
>SMED30022362 ID=SMED30022362|Name=Synaptotagmin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1443bp
CTCTTCCGATCTCAAACATTTCAGTCGCAAAGCAGGTCGCCACGAAATACATAAATCCGAACTCAACTGCTATTTGCATT
AAGCATTTCAATGGCCTTCACGAACATACCAAGCACACACCGACCTTTTGCATAGCAAAATAATTTATTATCATTAAAAC
AACCTTTGTGACTCTATTTTATCGATTTGAACGAAATTCACCACGATGGCACCATAAACAATCAGATCTCACAAATGTCT
GCGACTCTAAGCACAATGTCAACACTGAAGTTCACAAGGCCAACAAATGTAACCTCAAACCTCTACAAAGACATAATCAA
ATATCTTGATCTCCCGGAACCGTTGATTGTAGCAATCTTTGCCGCTGCTGGTTTGTTAATATTCGTTATTTTCATATTGT
TTTGTTCGAGATGCTGCTGCAGAAAATGCTGCAAGCAAACTGCCGATAAAGACAAATACAAAAGACGGAAGCTAGAAACA
AAAGAAATTGACAAAATTTTCAGAGACGAGTTGAATCTTGGATTTAATGAGAGTTTTGGAAAGATATATTTTGCGCTCAA
ATATCTCCTCGTAAAAGAATTGTTAATTGTAAAGGTTATTAAGGTGGAAAACCTACCGACACCAATTGACGACTGTCTTG
ATCCATACGTTGTCGTACAAGTGAAATCAAAAAGTTTGACTGAGGAAAAGAAAACCAAAATTAAATACAAACATATAGAT
CCGGTATTCAATGAAAAGTTTACTTTCAAAATTCTCCATCCAGAACTTAATGATTCGGAAATTTTTTTTAAGGTTTTTGA
CTATGATAAATTTGGAGCCGACTCATTGCTAGGTCAACTTGCACTAAATTTTAAAGACCTCAATCCCAGTAGCATCATAA
ACATGTTGTCAGAGTTTTCCAAAGATTTAAAAGAAGGTGAAGATACATCGGAAGGCATGGGACAGGTATGCATAATTCTG
AATTCAAATGGACAGGCAGGATTACTAGTCACTATACTAGAAGCTAAAAATCTTCGAGTTAAAGAAAACATGAGTTATTC
TCACATTTTTGTCACAGTTAAAATCAAGTCTCGGAAACACGGGAACAAATTTAAAACTCACTCGAAAAAAAGAACCAAAG
ACGCTCATTGTGGACCTTTTCCGTATTTCAATGAAACATTTCTTTTCCCGAAACCTCATGGAACGATATCAGACTGTTTA
GTATCAGTTAAAATTTGGATCAGTAGAATGTTTAAAATGCCAATCTGCATCGGGTACGTCTCATTAGGTTCTGAAATGAA
TATGACTTCCGGCGCCATTCATTGGCAAAGCATGCTTGACAGTCCCCGACACCCGGTTGCAAAATGGCATGTCCTAACCA
ATCCTAATGTGAAAGAATAAAGATTTAATATTTAGTCCTTCAACATATCTTTTTAATAATTAAAATAATAATTATTTGTC
GGT
>SMED30023322 ID=SMED30023322|Name=Cathepsin L|organism=Schmidtea mediterranea sexual|type=transcript|length=613bp
ACGCATTCTCTACGACAGGCGCGTTAGAAGGTCAACTATTCAGAAAAACTGGAAATTTGATAAGTTTATCTGAACAACAG
ATTGTTGATTGTGATAGTTTTGATTATGCATGTAACGGTGGATTTGTGACTGATACTTTAACTTATATTAAACAAAATGG
AGGAATTGAATCTGAGCAAGATTATCCATATGTGTCAGGAAGGACGAAGAAACCTAATAAAAAATGTTATTTCAAAAAAG
AAAAAATAGTGGGAACAGATACTGGTTTCGTATCTTTACCTCCAGGAGATGAAGAAGCTCTGAGAGAAGCTCTAGTAACA
ATTGGGCCAATTTCAATAGCTTTTTCCGCGTCGCCTTTGTTATCAGGATATAAGAATGGGATATATCATGATTACATGTG
TGCTGATGTTCGCATCAATCATGCAGTTTTACTAGTAGGATATGGAACGGATGAAGAATCAGGAACACCTTATTGGATAA
TAAAAAACAGTTGGGGTCCCGCATGGGGAGAAAATGGATATTTTCGAATGGAAAGAAATAAAAACATGTGCAACATGGCA
TACAATTCATACTATCCATTGGTTTGATTGAACGACTTCTTATGAGTGTGTGT
>SMED30005748 ID=SMED30005748|Name=HNF4|organism=Schmidtea mediterranea sexual|type=transcript|length=3066bp
GAAGAATAACAAAGAAATTTATTGCCAAACTAAAATACCCGGCCTATTTCATCAAAAAAAAAACAATCAAAAACACAAAT
CGCTACGAAAACTTGTATAAAAGATTCACATTAAAAGTCATCAATATTCCTCTTTTTTAAAGACTGATGATTCAGATTCT
TGGATCCGAATGGGGTGATCTGTTAGGAAGTGAGCTGTTGACGAGATAGCTGAATAGTTTGATCTGGAATTGTGCTGTTG
GTTCGCTTCCGATGATCTGTTGGCGATTGATTGAATTTGGCAGTTTTCTATCGGCGAGTTTGGAAGCGACTTGGTATAGG
CCACAAGAAGCGACGGATCAACGACATTTTGAGTGGAATTCACAGAAAGAGCTGGGTGGATTAGGTCATCTGAATTGGAA
GAATTTGAGCAGTTATGATTTGCGTCACTGTTATAGGCGTATTTTGACTGGTTGATCATGGGGAACCCTTGATCAAGGTT
GACCAAGAAATGGCTGGTATCCTGTGATAAATTGGAATGCTGATAAAGATTGATGGAATCATTGACGCATGAAAACAGAG
AAGGAACGCCGACTCTTTCATTTTTCAGCATCATCCCATCGCTGTTGATTATCATACCGAAGTTGCTATTGTCCTGGGAA
TTTTGCTGCATTATTTCAGTTCCTTGATTAACAAAAGCTCGATATATATTTCCTGAAGGCATCGACGTAGAACTTGGCAA
ATATGCACTCCATATTTTTGAGGCCGCTTCAGGTGATATGTTTTGGTTGTTGATATTGAGTAGGACACTGTCTGGCATGA
AAGGGGGAATTCCGTAGCAGTCCTGGTAAGTATATTTCGGTGAGGAAATCCTGTGGGAGTTAATTATATCCATGGAATCG
TTTTGATTATTGTTATTGTTCCCATCTGTTTCTGGATCTATGCTGAATACCCCTGGTGGATTGTCACCCAATAATGTTTC
AGATAACAAGCTATCAATCTCGGCTAATCCTGTCATTTTCATGAACTCGACCTTCTTTACCATCAGCTGGGTGACCAATC
TCAGATCAGGAATTGTCAGCAGCAATTCCCCGAATCTACCCGGCTTGTGGTATTGCTTGTCATTCATGTGGTTCATCAGG
TCCATTTGTATTTGGTATCGGCATCGTCTCACGAACTCCTTGCCAGACTCGCTGACTCTCGGATCAAAAAATACGATCGC
TTTCAAACAAGCGAATTCTGCGTCATCCAATTGCAATTCTCGCAGCGGAATGAACAGGTCGTCAAGGATGTGACTGGCTA
TTTCAGCGAAATGTTTGTCACTGGAGTTCCTACTGATGATAAGATTGTTTCCCAATAATAGCACATCGTCTTCGTCCAAT
TGAAACGACCGCCTTATTACTCCAAGAATTAGAATTTCTCCCGCGTGTGCTTTTAAAAGGGAAATTTGATCGCTCAAGTT
TAACTGTGAAAAACAAGGCAAAGACTTTGCCCAATTCACTAGAAGAAATAACTGATTTTTCATGGACTCGCAAACATCAG
GCACATCGGCATATCTGTTCATGTATTCCTGAGGATTCGGGGGCTTTTGTATTGCAACCCTTTGCTCGGCCTGCATCAAC
TGAGAAATGGAGAGAATGACATTCGGAGGAATATCATCAAACGACGATCTTCGAGTACTGATCCTATCTCGTTCATTTTG
AACCGCTGCTCGCTTCATTCCTACAAGAATGCATTTCTTTAGCCGACAATAACGGCATTGGTTTCGTTTATCCTTGTCCA
TTTTACAATTCCGATTGTACTGGCAAGTGTAGTTATTCTTCTTCCTCACTGACCTCCGAAAAAATCCTTTACAACCGTCA
CACGAGAAAGCCCCATAATGTTTTCCTGTAGCTTTGTCACTGCAAATGAGACAGAGTTGATTGTTTTCCATTCCTTCTGG
TCCCGACGCGTTAGACGCATAGACTTCATGTTGTTGCGAGGACACTGAAACGAAAACTATTTGATAATATTTGTACAAAA
CAACTGACAGATGGTTTCGGAAAAGGTTCAATGTTCAGCCATAGTTCAGCGAAAGGTCAAATTCCTGAACTACTATTTCA
AGGTATAAATTTGAATATATTGGTTTTGCCTCGTGCTAACAAAGTCCAGAAATATAATAAGCAAAGTCTGAATCGTGTAC
TTTGGATTTCTAGCCAGGGGCACACAATAACCTATATTTAATAGCAGTTCATTGCGTTCACTCGTTATTTCTCCGACTGA
ACTGCATTGCAGGAGGATCCGCAACCATGGAGATTTCATAATTATTATCAAAATGATAATAATAATAATTATTATGAGGT
ATTGTAAAAGAAAACGTAACTCACTTTCACTTTCCAATGGATATTGCATCGAGGAAGCGTTGCTGGAAATGGAAATCGGA
GCTGAATTGCTAGTCAATAGTTGATAGGAGAATGCTGGATTGAGGTTCGGATGCTGGGTAGACGTCATATAGAATTGGCT
CGACGGATTCGGTAAAATTATGGTGAAGTTTACAATCGAAGCTCAGATATAACGTATTATAATGAAGTATTATTAATAAA
CTGCAAGTAACGTGCGCGCATTCTGAAGTGGTTGATTGAGAATAATCAGTTCTTATTCGACAAATTCAGATAAAAAAGGC
ACCACTCGAATTGTTCAGCTGCGTCATGTGAATGCCGGAACGTTGTGCGTTGGCTGTTGGCAGATCAGCGCTCCGTGTTC
ACTGCAATCCGGATACACCAGACCACTTGAAATCGTTGCGAATTCAGCGTGTCGAGTGCATTGTGCGAGATCAGTATCGG
TGTGTATGTGTGTCTGCCTGTGTGCGTGTGGATGTGTGTGCTTGTCGAGTCGGTTGTGTGTTTATGAGTGTAACTGTGTC
GATTTGGTCGAATGCAGTAGCAGATAGCTGAAATGCGATTGTTCCTATTTTTCATTTAATATTGTTTTATGTTTTGTTTC
TATTTTTATAATTTAATTTATCAGTTTTTGTTTAGATTATGCAATCATTGTTTAATTTATTTTTGTCAATTTAAAATTTA
TTATTAATTAAATTATTATAATTATT
>SMED30008639 ID=SMED30008639|Name=MyoD-like protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1606bp
GTTCATATTACCAACTGTTCGCCATTAATTCAGCCTGTTTTACGCCTCGTAACAACTGTTACTTCAACAATACCGATCCA
GCCCAATAAACAATGATACACTCCGGATCATTTCCAGGTTCCACTTGTCCGATTAACTATGACTATTCCGGTCCATACTC
AGCAGGTCTTGAGGCAGCTCCATTTTTAGTCAATCAAACCTGTCCATATAACACTGGAACAAATACAATGCCTCCTTCGT
TGTCACTAGTAGATAATATGATGATGAATAATTCCATGCATCTTTATGATAGACTGAATACTCATCATTCAGCGTCGTAT
TTTCCTCAGATTTTAAACAAAATCGAACAGAAATTACCAACAACCTCGAGTAAAACCACTCCATCAACATTGGTTTCAAC
ATCCTCCAATTCCATATCGAATTCTGAGTTTAATTCGTCGCGATCTTCGTCACAATTTCCAACATACGATTTGATTTCGT
CACTCAATAATAGCAACTACGACATGTACGATTCGCCCTATGCCGCCTATCTGGCCGCTGGTTATTATCAATCTCCTGGA
TTTGCGCTCAAACAGTACGACGCTGCTGGAACATCTCAACCATCAATGACAGATTTGTACCATTCATCACTAGCAGCCAG
TTCAGGCTTAAATTTGAATTATTCACAGCATAAATCGAGACATTTATCAGAAGATGCTGGATCATGCCAAGATCCGCAGT
CTCAAAATATCACAAGCAATAATCATCATAACAATTCGTATAGTCCAACAACTGCTGATTTCGGATCACCAAAAGCCTTA
TCAAGTAGCAGCCAGTCCATAAATGATGGAAGACAACCGACCAGTAGTAATTCCAGTCCTCAAAAACTATCACTAGCAAT
TGAACAACACTTATGTCCAAATAAAGAGGAACATGTGCTAGTTCCAGGGTCACATGGTCAATGCTTGTTGTGGGCCTGTA
AAGCTTGCAAAAAGAAAACGGTTCACGTTGATCGCCGCAAAGCGGCAACAATGCGTGAAAGACGTCGATTGAGAAAAGTG
AATGAAGCTTTTGAAACATTGAAACGAAGAACGAGCGGTAACCCAAATCAAAGAATGCCAAAAGTCGAAATTCTAAAGAA
CGCGATTGATTACATTGAGAGTTTGGAAGAGTTGTTGAATTCCGTGGGAAAATTACCTGCAACCGTTGGAGAATTGAAAG
AACGCCGCAAAAACAACCCAGAAAATTCGAGAACAGCAATCGCCGGAAAACAAAAGCCACTAAATAAAATTAATGATAAA
CAGAAAGCTGAAAACAAATATCCCGAGACCATCTGCAAACTCCCGACGACTAGGAAATCCTATGTTGCTTCCGACCTTGA
TCAGCAGATTTATCAATCAAACATGTTGAAGAGTTCAACTCTTGATCAACTTTCCTCGATAGTAGACAAAATCTCTACGA
CTAATACAACAATTGCCGACCATTCAATGGACGCTAAGCCCGAAAATAGTTGAATACATAACAAAACGCAACAAATATTA
TATTAACCTATTAATTTTGTTCTAAACTCGTTTGCCCTGATACATATTGTACATTTTCTTTCAATAGAATGTTCTTATAA
TTATAA
>SMED30035904 ID=SMED30035904|Name=PROG-1|organism=Schmidtea mediterranea sexual|type=transcript|length=728bp
GCAATATTTTGTCATGAATGTTTAATTGAAAAATATGAAAGTTTTAATTATATTTCTATTTGTGATTGCGTTCGCGTATA
TTGAATGCCGTCCTCAACATCTATTGGGGTTCATGAGGAAAGAAAAGTCCAAGCTAGAAAAAGACTCAGCAGATGACGTG
AAACAAGGAAAAGATTCGGATAAAAGCTCTGATAAATATTCACATGAAGGATCTAATAAAGAGTCTGACAAAGAGACAGA
TAAAGAAGAAGAAACTAATTCTAAGACTTCTGCAAAGTCTCCCGCCAAATCAAGTAGACGAAAGAAACAAGTGGAAAAAT
TGGAAGAAGAGGAAGGAGAAACTTTAAAAGAGAAATTAAAAGGACACATTACGAAAGCAGATTGCATGAAATTATACGAA
GAAACTGATAAATACTGCGATCCACTTTATTTGAAGCTCGACAAAGATTGCGACTGCAGATATGTGAAAGCATTGAATGA
CTACACGAAAAGATGGGACAGTTATCATTCCAAATGTGGTAGCAAATATGACAAAAAATGCCGAACCGAATTGCGAGCTT
TGGAGAATTGGTTTAATGGCCTTTATGATTCAATCGACGGCCACTGTGACGCAGAATATGACGCGCTGGATAAATATTGT
GACGTAGAATACAACAAAGTTGATCAATGTGAAAAAGGACAGAAAGTGTAATAAAATTGATTTGTAATAAAATTTATTAA
ATAAAAAA
>SMED30002168 ID=SMED30002168|Name=Spondin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=2693bp
CAATTGCTTAATAAAATTTTCCTTTCAATAATTACCGTAAAAGTTGATGAAATTAATTTTGAATATTTTATCCACTTTTT
TCATATTGAAATTTGATTTTGCTGAATGTTTCGGATTTTGTGACATTCAATTTCCGAAATCATACGTTGCCTTTTCCACT
AGATTCAATCTCTATACGAATCATGAAAAAGAAAAACTGACCAAAATCACCTCGTACATTCCTGATAAAACCTACGACAT
AACTGTGTCATTGAATGATAAAGCTATGCACGAAAAGTTGACAATAAAAGAAATATACGTCTTAGTCTCAAATGTTCACA
CGGAAATGGAAGAATTGTCGGAACATGACTGGAAAAACGCCGGTGAAGTGGTTTTTAATGTAACTCACGCATCCAAAACA
GAATATTGCCCCCAAAGAGCTTACGTTCAGTATTTATATACCCAACCCCAACATGTCACATTCTATTGGATAGCACCTAA
AATACCGAATTTTTGTATTAGAATAACAGTTATTTTGAAAATGAACGATTTGATTTCAGAAAGCAAATTCGAAGAAAGAT
CCCACTGGATATGTGAACAAAAAAGAAACAAAATGGATCAGATGCAAGCAGATCAATATGCATCTACCTCTTGCGCAATG
AAACAAAAAACTGATCCAGTTAAACAATGTAATATTGGATCAACAGCGGTATATAGAATGACAATTGAAAATAAATGGAA
TTTATTAAATCATTGGAAAGATTGGCCGGGCAAAGACGGGTATTCTCCTAAAATAACTCAATATCTCGGAGCTTCTCATT
CAAATGAGTTTAATATTTATCATCTTGGTGGAATGGCCAATGAAGGAGTTTCTCAGGTATGTGGAAACGGGAGCTACACT
GAATTGCAAAAGCAATTCTACAAAGCTGGGAACGGGATCATGACAGTTATATTGGCCAGGTCACTAGATGCGTCATCAAA
AACCAATAAAAGATCAGCACTGATTGTTGTAAATGCAACTCAACATTTGGTTAGTTTTCTTGCAAGACTTCATCCAAGTC
CCGATTGGTGCACAGGTCTAAGTAGATTTGATCTTTGTAACGGCTCATGCAAATGGCAAGAAAAATTTATCGTCCATTTA
TATCCTTGGGATGCCGGTGTTTACAGTGGAGAGACTTATTTAAATAAAAACGAGAAAACTAGACAGACTCCAATATGTCC
AATCACTAGCAGTTGGCCAAAGGATAACCCTTTCACGGTGATGAACGGAAAAATCAAAAATATCGGAGTGGTAACCTTCC
AATTAATACAAGAATATAACAAAAATGATAACCAGTATTGTAATTCTATTAATTCAATCCTTCAAGACGAAGCATACCAA
AATGAACCGAAATCCAGTGCTCTGAAATCAAATCCAGATAAAACCAGGCATTGCTTATTGTCAGAATGGAGTGAATGGAG
CTCTTGTTCAGAATCTTGTGGTAAAGGTGAAAAAACTCGTTACCGAAAACTGCTGAAAGGAAAATCCGAACAATGCATTG
AATCTTCCCTAACTAATACAGAGAGCTGTAGCAGTAAATGTTCGACAGTAATTTCATTCGAAACATGTTCGTTTCGCTTG
TGGGGCCAATGGAGCCCATGCAATGCTACTTGTTCCCAGAAGGGAATTATTCATAGGGAACGTGTTTTTATCAATGAACA
GGAAAAACACGAATGTATGCAATATTCCGAAATGAAAGCCTCTCTTGAATGTGCATTAGCAAGCGAGAGGTGCAAACCCG
ACGTGATCTGCAAGGAATATGTTTATCCTGGAGATTCGTGTTCTTGGTCTAGCCCATCACAAAGATTTTATTACGATTTT
TCTAGTGGAACTTGTAATGCATTTATTTACAAAGGCTGCTATGGGGGTCTGAATAATTTTCACACCTACGAGGAATGTAT
TTTACTCTGTCGACCAAAATTAAAAGAAACAGATCAAAGACGATTTAATACGCCAGAAACTTATCCCAACCGATGCGGAG
TTTCGATGACATGGGGAATCTTTTGTGATAGTCAATCTTCATCAAACCGTTGGTACTATGACAATATTAATAAAGAATGC
TACCGATTTCGTTTCGGGGGCTGTCGAGGGAATGCCAACAATTTCCGAACTAAAACTGAATGTCAAAATGTTTGCTTGAG
AGAAAAGTCTACTTCAACAACAACGACAACGATCAGTCAGCCAGTAACGGTAAGAAAAGTCTGCATCTATTCCAACTGGT
CGGACTGGAGTTCTTGTGATAACAACTGTCAAAATCAACAAACAAGAATAAGATTTTTAATTGAAAAAAATGACGACTGC
ACCGAAAGTATCAGTGAAACAAGAAAATGTCAATCAGAGAAATGCAATTCGCCAAATAACGGGTTTATTTCACTAAGGAA
TTGCAAGTATTCGAGTTGGTCGGAATGGTCGGCTTGTTCATCAAGATGCGGTCCTGGCGTTAGAGAGAGAAAGCGGAAGA
AACTTTCTCGTAATTGTAAACCGGAATTTCCGCAATTTACTGACCGAGAATCATGTTACAATGCTTGTGCTTATGACTGA
ATCCGGTAAAGAAAAAAAAACTGTCAATGTATTTGTGTCATGACATTTTACCTATTGTGCATTTCATTTTGTGAACTTTG
TTTGGTTTTTGATTTATTTTTTCTTGGTGTTTTTCTCTAGAATATGATTTGTT
>SMED30032169 ID=SMED30032169|Name=Glycine amidinotransferase, mitochondrial|organism=Schmidtea mediterranea sexual|type=transcript|length=1380bp
CGTGTTTCTGCCAGAATCCAAGTTTGGTAGGGTGGGTGGAGTAGGCTTTTATATCATATCTAAATCTGAAAATGAATTTT
TATCATCATATTTTCTCAAATGTTGTCTGTATTACGACAAATTAGCCATTCAAAATCTGCCATTTCTTCGAAAATATCGG
TAATTCACATTTCAAAGTACTTCGGTCATTATTCATGCCACGATGAAAAGAAACAGACTTCTCCAGTTTGGGCTTGGAAT
GAATGGGATCCACTTGAAGAAGTTGTGGTCGGTGTTCCTAATAATGCAACTTTGCCCTTTCCATCACAGGAAGTAGCAGC
CACTTTTGGACCCCCTAGACTTCCATTTTTTCAAAAACATGGTGGCAAAAAATTCTCAGAGGTTATGGGTCAAGAAATGT
GGATGAAAATTGAAAATGAAATAAAAGAATTAGTAAGAGTATTAGAGGGAGAAGGTGTAAAAGTTGTGCAACCAGAGGCT
ATAGATTACGATCAAAAGTGGACTACGCCAAAGTTTTCTTCAACAGGTTTGTATGCCGCTATGCCAAGAGATTTTTTACT
TATCGTTGGTGATGAAATCATTGAATCCCCTATGGCTTGGAGGTGTAGATACTTTGAATACGAAGCATACAGACCACTTA
TTCGAAAATATTTTAATGAAGGAGCCAGATGGACATCGGCTCCTAAATGCACTATGGAAGACGCTCTCTATGATATGGAA
TTCGATGTTGCTCAAGAGAAACCATATGTGTATGTAACAACTGAATTAGAACCATGTTTTGATGCGGCTGACTTTACAAG
AATTGGCAGGGATATTTTTGGTCAAAGAAGTCATGTAACCAACAAAAAGGCAATACAGTGGCTCCGGCGTCATTTAGCTC
CTAGTGGAGTCAGGGTCCATGACATTGAATTTGACTCTCTCTATTCAATGCATATTGATACCAATTTTTTCCCCGTGAAA
CCTGGTATGTTTTTACTTAAAGATGGACTCAATTGTAAAACCCCGGATCTATTAAAAAAATCTAAATGGGACATAGTCAT
TATGCCAAAAGGACCTCATCGAGACGAGCATTACAAATGGATGAATTATCACGGATTACCGAACAATATGCTCAGTATAG
ACACAGAGAGGGTCCTAGTTGAGAAAACCGAAGAATACATGATAAAATTCATGCAAGAAATTGGATTCAAACCGATTCCA
GTTTCGCTTAAATTCGCAAATAATCTAGGAGGGGGCTTCCACTGCTGGACAGCGGACATCAGACGGCGAGGAAAACTAGA
AAGCTATTTTGAGTGGCCAGATGAGATTTTGGAGCGATTGACTCCATAAATCGGAAATATTAAATTAAAAAATATTTTTT
GTTTTAATTTTCTATACAAT
>SMED30025427 ID=SMED30025427|Name=Translationally-controlled tumor protein homolog|organism=Schmidtea mediterranea sexual|type=transcript|length=570bp
AAGTAATACTTTTATCATTTAATTGAAAAAATGCTCATTTACAAGGATATTGTTGCCGGCGATGAGTTGTGCTCTGATAC
ATTCCCAATGACGATTGTCGACGATGTCGTTTACGAATTCAACGGAAGAAATATTACTATTAAAAACGGTATTTCTGACG
CCCTCTTTGGTGGAAATGCTTCAGAGGAAGCTGCTGGCGATGATGACGTTGCTGATTCGGACGAGACAGCAATTGACATT
GTATACAGCAACCGATTAGTCGAAATGAGCTTTGACAAGAAAGGTTACACGAGTTACATCAAAGGTTACATGAAAAGTAT
TTTGGAAAGATTGAATGCCACTAATAAAGAACGAGCTGAAATCTTCAAATCCAAAGTCGGTGCCTATGTTACAAAAATCA
TCAAAAATTTTGATGAATATCGTTTCTACTGTGGAGAGTCAATGAACCCTGACGGAATGATCATTCCATGCAATTACAGA
GAAGACCAAATTACCCCATACTTTGTTCTCTTCAAAGATGGCCTCGAAGAAGAAAAATGCTAGATTTCTGTTAAATAAAT
TTAGTGGAAC

 

back to top


Download Supplemental Table

 

 

Figure 1 – source data 5. S5 enriched transcripts from pairwise and/or mixed stage reference comparisons
Criteria for flagging differentially expressed transcripts:

1) Pairwise comparison (S4 vs S5): adjusted p-value < 1e-5 S5 vs mixed reference comparison: adjusted p-value <1e-52) log2 ratio ≥ 2.322 (5-fold upregulation, both comparisons) or log2 ratio ≤ -2.322 (5 fold downregulation, pairwise comparison only)3) Average scaled RPKM value ≥ 1.0 for S54) Transcript has ≥ 1 ORF5) Transcripts derived from transposase or retroviruses were omitted.

Tabs in this excel file contain 1) pairwise comparison data (if applicable), 2) mixed stage reference comparison data, 3) cluster membership, average RPKM values across embryogenesis (Y-S8), and in C4 and SX adults, as well as best BLASTx hits (E < 0.001) versus the NR, Swiss-Prot, C. elegans, D. melanogaster, D. rerio, X. tropicalis, M. musculus and H. sapiens REF-Seq databases, 4) GO analysis: Manually curated and categorized Biological Process (BP) GO IDs and 5) GO analysis: unabridged results. S2-S8: Stages 2-8. Y: Yolk. C4: C4 asexual adults. SX: Mature sexual adults

 

 

 

back to top