muscle progenitor



Overview

myoD+ neoblasts and their post-mitotic, differentiating daughters implicated in the maintenance and regeneration of muscles.

 

muscle progenitor

 

"MUSCLE PROGENITOR" TERM REFERENCES

PMID:25017721

 

back to top


 

In Situ Hybridization Data

Smed IDAccessionNameAliasEnriched during stage(s)Tissue/PatternImages
SMED30008639AAN03696.1MyoD-like proteinmyoDStage 5, Stage 6, Stage 7, Stage 8muscle organ, muscle progenitor

 

back to top


Sequences

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30008639 ID=SMED30008639|Name=MyoD-like protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1606bp
GTTCATATTACCAACTGTTCGCCATTAATTCAGCCTGTTTTACGCCTCGTAACAACTGTTACTTCAACAATACCGATCCA
GCCCAATAAACAATGATACACTCCGGATCATTTCCAGGTTCCACTTGTCCGATTAACTATGACTATTCCGGTCCATACTC
AGCAGGTCTTGAGGCAGCTCCATTTTTAGTCAATCAAACCTGTCCATATAACACTGGAACAAATACAATGCCTCCTTCGT
TGTCACTAGTAGATAATATGATGATGAATAATTCCATGCATCTTTATGATAGACTGAATACTCATCATTCAGCGTCGTAT
TTTCCTCAGATTTTAAACAAAATCGAACAGAAATTACCAACAACCTCGAGTAAAACCACTCCATCAACATTGGTTTCAAC
ATCCTCCAATTCCATATCGAATTCTGAGTTTAATTCGTCGCGATCTTCGTCACAATTTCCAACATACGATTTGATTTCGT
CACTCAATAATAGCAACTACGACATGTACGATTCGCCCTATGCCGCCTATCTGGCCGCTGGTTATTATCAATCTCCTGGA
TTTGCGCTCAAACAGTACGACGCTGCTGGAACATCTCAACCATCAATGACAGATTTGTACCATTCATCACTAGCAGCCAG
TTCAGGCTTAAATTTGAATTATTCACAGCATAAATCGAGACATTTATCAGAAGATGCTGGATCATGCCAAGATCCGCAGT
CTCAAAATATCACAAGCAATAATCATCATAACAATTCGTATAGTCCAACAACTGCTGATTTCGGATCACCAAAAGCCTTA
TCAAGTAGCAGCCAGTCCATAAATGATGGAAGACAACCGACCAGTAGTAATTCCAGTCCTCAAAAACTATCACTAGCAAT
TGAACAACACTTATGTCCAAATAAAGAGGAACATGTGCTAGTTCCAGGGTCACATGGTCAATGCTTGTTGTGGGCCTGTA
AAGCTTGCAAAAAGAAAACGGTTCACGTTGATCGCCGCAAAGCGGCAACAATGCGTGAAAGACGTCGATTGAGAAAAGTG
AATGAAGCTTTTGAAACATTGAAACGAAGAACGAGCGGTAACCCAAATCAAAGAATGCCAAAAGTCGAAATTCTAAAGAA
CGCGATTGATTACATTGAGAGTTTGGAAGAGTTGTTGAATTCCGTGGGAAAATTACCTGCAACCGTTGGAGAATTGAAAG
AACGCCGCAAAAACAACCCAGAAAATTCGAGAACAGCAATCGCCGGAAAACAAAAGCCACTAAATAAAATTAATGATAAA
CAGAAAGCTGAAAACAAATATCCCGAGACCATCTGCAAACTCCCGACGACTAGGAAATCCTATGTTGCTTCCGACCTTGA
TCAGCAGATTTATCAATCAAACATGTTGAAGAGTTCAACTCTTGATCAACTTTCCTCGATAGTAGACAAAATCTCTACGA
CTAATACAACAATTGCCGACCATTCAATGGACGCTAAGCCCGAAAATAGTTGAATACATAACAAAACGCAACAAATATTA
TATTAACCTATTAATTTTGTTCTAAACTCGTTTGCCCTGATACATATTGTACATTTTCTTTCAATAGAATGTTCTTATAA
TTATAA

 

back to top