muscle organ



Overview

Organ consisting of a tissue made up of various elongated cells that are specialized to contract and thus to produce movement and mechanical work[GO].

 

muscle organ

 

"MUSCLE ORGAN" TERM REFERENCES

UBERON:0001630

 

back to top


 

Tissue Description

 

S2-S4 embryos solely contain radial muscle fibers within the temporary embryonic pharynx (Figure 1 – figure supplement 17 C). Presumptive progenitors for body wall musculature, cells that coexpress piwi-1 and myoD, emerged during S5 (Figure 1 – figure supplement 17 A-B, Figure 6 C). myoD upregulation was first noted during S4, and was significantly enriched in S5 and S6 embryos (albeit the adjusted p-values were higher than the threshold set for inclusion in the S5 and S6 enriched transcript lists) (Figure 1 – figure supplement 17 A-B, Figure 1 – source data 5, Figure 1 – source data 6). While a genetic requirement for myoD in muscle cell regeneration has not been demonstrated conclusively during adulthood, myoD expression within the adult neoblast compartment has been observed previously (Scimone et al., 2014), and myoD knock-down impaired regeneration in two independent reports (Cowles et al., 2013; Reddien et al., 2005). mhc-1+ cells were first observed in the parenchyma during S5, without noticeable bias in distribution toward either the oral or aboral hemispheres (Figure 1 – figure supplement 17 C). Expression within the temporary embryonic pharynx remained strong through S6. During S6, fusiform mhc-1+ cells became more numerous, and were more densely packed beneath the presumptive dorsal surface of elongating embryos. As elongation proceeded, mhc-1+ cells were densely packed along the dorsoventral margin, particularly in the anterior half of the embryo (Figure 1 – figure supplement 17 C). The dorsal bias in mhc-1+ cell density was transient, and was not obvious by S7. myoD+ cells were located around the developing cephalic ganglia and ventral nerve cords, in S6-S8 embryos (Figure 1 – figure supplement 17 A). Concentrations of myoD+ cells, as well as mhc-1+ muscle cells, were seen around the definitive pharynx rudiment and along the developing tail stripe, a muscular septum that bifurcates the posterior gut and connects the dorsal and ventral body wall musculature (Figure 1 – figure supplement 17 A,C). Generation of robust, increasingly dense transverse and longitudinal body wall muscle fiber networks and enteric musculature proceeded during S7-S8 (Figure 1 – figure supplement 17 C).

 

back to top


 

Figures

Figure 1 – figure supplement 17: Molecular markers for the developing musculature

A, C: Expression of the muscle progenitor marker myoD and the mature muscle marker mhc-1, Stages (S), S2-S8. Anterior: top (S6-S8).  O: oral hemisphere. A: aboral hemisphere. D: dorsal. V: ventral. Black arrowheads: temporary embryonic pharynx.  Red arrowheads: definitive pharynx. Cyan arrows: cephalic ganglia. Cyan arrowheads: ventral nerve cords. Scale bars: 100 µm. 

B, D: Average RPKM values per embryo for the putative muscle progenitor marker myoD (B) and transcripts enriched in adult muscle (D), Y (yolk), S2-S8. Transcripts in D showed enriched expression during S5, S6, S7 and/or S8 (n=166 transcripts, or 42% of the muscle cell enriched transcripts reported in (Wurtzel et al., 2015). Muscle-enriched transcripts are flagged in excel tables for S5-S8 enriched transcripts (Figure 1 – source data 5, Figure 1 – source data 6, Figure 1 – source data 7, Figure 1 – source data 8).

 

 

back to top


 

In Situ Hybridization Data

Smed IDAccessionNameAliasEnriched during stage(s)Tissue/PatternImages
SMED30008639AAN03696.1MyoD-like proteinmyoDStage 5, Stage 6, Stage 7, Stage 8muscle organ, muscle progenitor
SMED30025388Myosin heavy chainDj-mhcStage 2, Stage 3, Stage 4, Stage 5, Stage 6, Stage 7, Stage 8muscle organ, temporary embryonic pharynx

 

back to top


Sequences

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30008639 ID=SMED30008639|Name=MyoD-like protein|organism=Schmidtea mediterranea sexual|type=transcript|length=1606bp
GTTCATATTACCAACTGTTCGCCATTAATTCAGCCTGTTTTACGCCTCGTAACAACTGTTACTTCAACAATACCGATCCA
GCCCAATAAACAATGATACACTCCGGATCATTTCCAGGTTCCACTTGTCCGATTAACTATGACTATTCCGGTCCATACTC
AGCAGGTCTTGAGGCAGCTCCATTTTTAGTCAATCAAACCTGTCCATATAACACTGGAACAAATACAATGCCTCCTTCGT
TGTCACTAGTAGATAATATGATGATGAATAATTCCATGCATCTTTATGATAGACTGAATACTCATCATTCAGCGTCGTAT
TTTCCTCAGATTTTAAACAAAATCGAACAGAAATTACCAACAACCTCGAGTAAAACCACTCCATCAACATTGGTTTCAAC
ATCCTCCAATTCCATATCGAATTCTGAGTTTAATTCGTCGCGATCTTCGTCACAATTTCCAACATACGATTTGATTTCGT
CACTCAATAATAGCAACTACGACATGTACGATTCGCCCTATGCCGCCTATCTGGCCGCTGGTTATTATCAATCTCCTGGA
TTTGCGCTCAAACAGTACGACGCTGCTGGAACATCTCAACCATCAATGACAGATTTGTACCATTCATCACTAGCAGCCAG
TTCAGGCTTAAATTTGAATTATTCACAGCATAAATCGAGACATTTATCAGAAGATGCTGGATCATGCCAAGATCCGCAGT
CTCAAAATATCACAAGCAATAATCATCATAACAATTCGTATAGTCCAACAACTGCTGATTTCGGATCACCAAAAGCCTTA
TCAAGTAGCAGCCAGTCCATAAATGATGGAAGACAACCGACCAGTAGTAATTCCAGTCCTCAAAAACTATCACTAGCAAT
TGAACAACACTTATGTCCAAATAAAGAGGAACATGTGCTAGTTCCAGGGTCACATGGTCAATGCTTGTTGTGGGCCTGTA
AAGCTTGCAAAAAGAAAACGGTTCACGTTGATCGCCGCAAAGCGGCAACAATGCGTGAAAGACGTCGATTGAGAAAAGTG
AATGAAGCTTTTGAAACATTGAAACGAAGAACGAGCGGTAACCCAAATCAAAGAATGCCAAAAGTCGAAATTCTAAAGAA
CGCGATTGATTACATTGAGAGTTTGGAAGAGTTGTTGAATTCCGTGGGAAAATTACCTGCAACCGTTGGAGAATTGAAAG
AACGCCGCAAAAACAACCCAGAAAATTCGAGAACAGCAATCGCCGGAAAACAAAAGCCACTAAATAAAATTAATGATAAA
CAGAAAGCTGAAAACAAATATCCCGAGACCATCTGCAAACTCCCGACGACTAGGAAATCCTATGTTGCTTCCGACCTTGA
TCAGCAGATTTATCAATCAAACATGTTGAAGAGTTCAACTCTTGATCAACTTTCCTCGATAGTAGACAAAATCTCTACGA
CTAATACAACAATTGCCGACCATTCAATGGACGCTAAGCCCGAAAATAGTTGAATACATAACAAAACGCAACAAATATTA
TATTAACCTATTAATTTTGTTCTAAACTCGTTTGCCCTGATACATATTGTACATTTTCTTTCAATAGAATGTTCTTATAA
TTATAA
>SMED30020435 ID=SMED30020435|Name=Myosin heavy chain|organism=Schmidtea mediterranea sexual|type=transcript|length=3615bp
TCTGAATTTAAACAAAGATATTCAATTTTGGCCGCAGATGTAATAGGGCAAGGATTTATTGATGGAAAACAGTGTACTGC
AAAGATAATGGAAGCAATCCAATTAGATAAAAACAACTACAGGCTTGGATCAACTAAAATCTTTTTCAAGGCCGGAGTAC
TTGCTCAGTTAGAAGACATGCGAGATGAGAAATTATCATCCATTTTGTCTGTATTCCAAGCACAGATGAGAGGATATATA
ATGAGAAAAGCATATAAGACATTGCAAGATCAACGAATTGCTCTTTCTCTCATTCAAAGAAACATCAGAAAATATTTATT
ACTAAAAACATGGCCATGGTGGAGACTATACACTAAAGTCAAACCACTCCTCAATATCGCAAGACAAGAAGAGGAGATGA
AGAAAGCTGCTGAAGAGTTGATTAAATTGAAAGAAGAATATGAAAAGATAGAAAAATTTAAAAAGGAATTGGAAGGTCAA
AATGTGGTTTTGCTTGAGCAGAAAAATGATTTATTTTTACAACTGCAAACAGAACAAGACAATCTTAGTGACGCTGAAGA
AAAGATTCAAAAGATGATCAATCAAAGAGTTGAAATGGAGAACCAATTTAAAGAATTAGAAGATAAATTAATGGATTCGG
AAGACATTCAAGATGAATTGGAAATCGAAAAAAAGAAATTGTTGTTGGATATGGATGAATTGAAATCGGACATTGACGAA
CTTGAAGTATCTTTAGAAAAGTCTGAACAAGAAAAACAAGCTCGCGATCAACAAATTAATAATTTGAAAGAAGAAATTCA
AAAACAAGATACTTCTATCGGAAAAGTTCAAAAGGAGAAAAAGACTCTAGAAGATAACTTAAATCAGACCAGAGAAGCTT
TAAATGCTGAAGAAGACAAGGTCAATCAGTTGACTAAAATCAAATCAAAATTGGAATCTGAAATAGATGAAATGGAAGAA
GCTCTAGAACGGGAAAAGAAGATCCGTGGAGATGTTGAAAAACTTAAACGGAAATTAGAAGCTGATCTCAAATCAAGCCT
TGATAACTGTAATGAGTTGGAAAATATAAAGCAGGAGTTAGAAGAAAATATTCAGAGAAAGGACATTGAAATATCAAAAT
TAAATGTCAAATTGGAAGATGAATCTTCAATTGTCACTCAACTTCAACGAAAAATTAAGGAATTACAAACTGTTATACAA
GATCTTGAAGAAGATCTAGAAGGTGAGAGACAAGGTCGATCAAAATCTGAAAAAGCTCGACAGTTGGCTGAACAAGAACT
CGATGAACTAGCTGACAGACTTGAAGAGCAGGGAGGTGCTACTATGGCACAAGTGGAATTGGCCAAGAAACGAGAAACTG
AATTAATGAAACTTAAAAAAGAATTACAAGATACCAATTTACAGAATGAGCAAATACTCAATGGTTTGAAAAAGAAAAAC
CAAGAAATTACCAATGAATTCTCCGAGCAAGTCGATCAAATAAATAAATCTAAATCAAAAATCGAAAAAGAAAAGGCGAC
TCTTAAGCATGATCTGGATGAATTTGTTTCTCAATTAGAATCTGTTTCAAAGCTAAAGGCCAATACAGAAAAACATTCAA
AACATTTAGAAAGTCAAATTATGGAATTGGAAAACAAAATAGACGAACAGAATCATCAAATATCAGAAATGGTTTCACAG
TCTAATAAAGACTCTCAAGCAATAATGTCTTTAGAACAACAACTAGAACAAGCAGAAAATGAAAATCACCAATTGAGCAA
ATCCAAACAACAATTCCTCCAACAAATTAATGACTGTAAATCGACTCTTGAAGACGAAGAAAAAGTAAAGGCCAAACTTT
TCAATGAAATTCGTAATCTGAATGATGAAATGGGCAATTTAAGATCCAGTTTGGAAGAAGAGCAAGAATCCAAAAGTGAA
ATTCAAAGGTCACTAGCAAAATCCCAATCTGAACTTGTACAAATGAAAAATAAATTTGATAGTGAAGGTTCAGGTCGCAT
TGAAGAAGTTGAAGAAGCTAAACGTAAGTTGCAAACGAAACTTCAAGACATGGAACAAGAATTTGACGCTATTAAAAATA
AATGCGCGCAACTTGAAAAAATCAAAATTCGTCTCACTGGAGAAATCGAAGACATGAGTGTTGATGTTGACAGAGCTAAT
GCAGTGGCTAATCAACTAGAAAAGAAACAAAAGAACTTTGACAAAACCGTCAGTGAATGGCAGTCTAAATGCAACTGCCT
TCAAACTGAAGTTGATGTTGCAAATCAAGAATCAAGATTTTTGTCAACCGAAGTATTTAAATGTAAAAGCCAAAACGAAG
AATTGCTTTCACAAATCGAAAATCTTAAACGAGAAAATAAGTCTCTCAGTGATGAAATTCACGATTTAACGGAACAACTA
AGTGATGGCGGAAAATCTGTTCACGATATAGAAAAGGCAAAACGAAAATTGGAAATAGAAAAGGAAGAACTGGAACAAGC
TTTGGAAGAAGCTGAATCAACATTGGAAAATGAAGAAGCCAAATTACAAAGAGCTCAGTTAGAGTTGAGTCAGATGAAAT
CAGATGTAGAAAAACGATTGTGTGAAAAGGAGGAAGATTTTGAAGGAACTCGCCGTAATCATCAAAGAGCAATGGAATCA
ATGCAAGCTTCTTTGGAGGCAGAAATTAAAATTAAACAGGACTCAATTAAAGCCAAGAAGAAGTTAGAACAAGAAATCAG
TGAACTCGAAGCCAATTTAGATCAAATCCAAAGACTGAAATCAGATGCTGATAAGAACAATTCAAGAATGCAACAGCAAA
TTCATGATTTACATTCAGAGATTGAACAAGAACAACACAGTAAAAACGAAGTCCGAGAACATGCTCAGATGGCTGAAAAG
AGATTTTTATCGGCTAATGGAGAACTAGAAGATTTGCGAGCCAAATTTGAACAATCAGATAGAAATCGTAGAAATGCTGA
ATCTGAGCTTCAAGATTTGAGTGATAAATACAATGAAAGCCAAGCACTGATCACTTCACTTCAAAGTTCAAAAAGAAAAA
TGGAAATGGATTACGTAGCTATGCAGTCCGATCTTGATGATATGTCAAACCATGTTCAACAAGCTGAGGAAAGAGCAAAG
AAAGCAGCTGGTGACGCTGCCCATATGTCAGAACAACTTCATCAAGAACAAGACAATAGTTTGCACACGGATAAAATGAG
GAAGCAAATGGAAATTCAAATCAAAGAAATGCAGTGTAAACTAGAAGAAGCCGAAAGTAATGTTTTGTCAGGCGGCAAAA
AGACTTTGGCAAAGTTAGAGTCAAAAATACGAGAATTGGAAACTAATCTTGATAACGAAATGAGAAAACATGCTGAAACT
CAAAAGAATTATCGCAAAGTAGATAGACGAATGAAAGAACTAACATTACAATTGGAAGACGATAGAGCTCAACAAGAAAA
ATCAAATCAAGTTATTGAAAAATTCCAAGGACAAATCAAAACCCTTCGAAAACAATTAGAAGAATCAGAAGAAGTTGCCG
TTTTGAATATTGCCAAATTTAAGAAAGTACAATGTGATTTTGAAGAAGCCGAAGAAAGAGCGAATGAATCGGAACAAGCT
TTACAAAAATTAAGA
>SMED30025388 ID=SMED30025388|Name=Myosin heavy chain|organism=Schmidtea mediterranea sexual|type=transcript|length=6089bp
TTTTTTTTCGAGTTTGTGCTAGAAATTAATTTCAGTTTGAAATTTTTTGCCTATTTCGAGTTCTTTGAAAACAATCTGAA
AACATGAACCCATCTGATCCCGATTTTCAATATCTCGGTGTCGACCGAAAAGCTTTAATGAAGCAGTATGGGGATTCCTT
TGACAGCAAGAAAAACTGTTGGATTCCTGACGAGAAAGAAGCCTTCATTGCGGCGACAATTGAAGATGCGTCTGGAGATG
TCTATACGGTCAAAACCGATAAAAGTGAAACCAAGACTGTTAAAAAGGACGAAATCGAACAAATGAATCCACCGAAATTT
TTGATGATTGAAGACATGGCAAATTTAACCTTTCTAAACGATGCCAGCGTTCTTGATAATTTAAGACAAAGATATTACAA
GAATCTGATTTATACCTACTCTGGACTGTTTTGTGTGACAATAAATCCATACAAAAGATTTCCAATTTACACCCCGCAGG
TGATTTCAAAATACAAAGGTAAACGACGAACTGAAATGCCTCCACATATTTTCTCGATATCCGACAATGCTTACACCAAC
ATGTTGGCGGACCGAGATAATCAATCTGTCTTAATTACTGGTGAAAGTGGAGCTGGGAAAACTGAAAATACAAAAAAAGT
TATCACTTATTTTGCACACGTTGCAGCTGCTACTAAAAAAGAAGAGGATGATACTGGAACTGGTCAAAAGAGAAAGGGAA
CATTGGAAGACCAAATCGTGCAAGCAAATCCTGTTTTAGAAGCATACGGTAACGCAAAAACTGTGCGAAACAACAATTCA
TCCAGATTTGGTAAATTCATTCGTATTCATTTCGGTACAAGTGGAAAAATAGCTGGAGCTGATATTGAATTTTACTTACT
CGAAAAATCGAGAGTAAATTCTCAACAGAAAGGTGAAAGAAACTATCACATTTTCTATCAAATTTTATCGAACGGAGGAA
AACCATTTCATGAAAAATTACTCATCTCTCCTGATCCAGCTTTGTATTCCTTCATTAATCAAGGTGAATTAACAATCGAT
GGAGTCGACGATGAAGAAGAAATGAAAATAACTGATGAAGCTTTCGACATTTTGGGATTTTCTGCCGAAGAAAAAATGAG
CTTGTTCAAGTGTACTTGCTCAATTTTAAACATGGGCGAAATGAAATTTAAACAAAGGCCAAGAGAAGAACAAGCCGAAG
CCGACGGTACTGCTGAAGCTGAGAAAGTGGCTTTTCTGTTGGGTGTCAATGCAAAAGATTTAATGCAATCGATTCTGAAA
CCGAAAGTTAAAGTTGGTAATGAATATGTCACAAAGGGGCAGAATAAAGATCAAGTTCTTTATTCGGTTGGTGCGCTAGC
AAAATCTCTTTACAACAGAATGTTTGCGTGGTTGGTTTTGAGAGTTAACAAAACCCTCGACACTAAAGTCAAGCGACAAT
TTTTCATCGGTGTTTTGGATATTGCCGGTTTCGAAATTTTCAATTTCAATGGATTTGAACAAATTTGTATTAATTACACC
AATGAAAGATTGCAGCAATTTTTTAACCATCACATGTTCGTGTTGGAACAGGAAGAGTACAAGAAGGAAGCGATCGATTG
GGAGTTCATTGATTTTGGAATGGATCTTCAAGCGTGCATTGAGCTCATTGAAAAGCCAATGGGTATTCTGTCAATCTTAG
AAGAAGAGTGCATGTTTCCGAAAGCATCTGATATGACATTTAAAGCAAAATTGTATGATAATCATCTCGGAAAAAGTCCC
AATTTTGGAAAGCCAAAACCTCCAAAACCCGGACAGGCTGAAGCTCACTTCGAATTGCATCACTATGCTGGCAGTGTGCC
ATACAATGTTACTGGTTGGCTGGAAAAGAATAAAGATCCTCTCAACGAAACTGTGATAAATCTACTTGCGGCAAGTAAAG
AGGCATTAGTTTCGAGTTTGTTTGCTCCGGCTGAAGATCCAAATAATACGGGTAAACGGAAAAAGGGTGGGGCCATGCAG
ACCATTTCTTCAACTCATAGGGAATCCTTGAATAAATTGATGAAAAATTTACAAAGTACCAGTCCACATTTTATCCGATG
CATTGTTCCAAACGAATTCAAACAACCTGGTGTAATCGACGCTCATTTGGTATTACATCAATTGCATTGTAACGGTGTCC
TTGAAGGCATCAGAATCTGTCGAAAGGGTTTCCCAAACAGAATGATTTATTCTGAATTTAAACAAAGATATTCTATCTTG
GCTCCAAATGCAATTCCACAGGGATTTGTTGAAGGCAAACAAGTAACGAGCAAAATTCTGGAAGCTGTTCAATTGGACAC
CAATCTTTACCGCCTGGGAAATACTAAGGTATTTTTCAAAGCTGGAACTTTGGCTGATTTAGAAGACATGCGTGATGAAA
AATTATCTTCACTGATTTCATTGTTTCAAGCTCAAATACGCGGATATTTGATGCGAAGACAATATAAAAAATTACAAGAT
CAGAGAGTTGCTCTATCTATCATTCAAAGAAATATTCGTAAATATCTTCTTCTGAGAACATGGCCATGGTGGAAATTGTA
TACCAAAGTTAAGCCACTTTTGAACATTGCTCGTCAAGAGGAAGAAATGAAAAAGGCCGCTGAAGAATTGACAAAATTAA
AGGAAGAATTCGAAAAAGTTGACAAATTCAAAAAAGAACTTGAAGAACAAAACGTCAAATTGTTGGAAGCTAAAAACGAT
TTGTTCTTACAATTACAAACCGAACAAGACAGTTTAGCCGATGCCGAGGAAAAGGTTTCAAAATTGGTTATGCAAAAAGC
CGATATGGAAGGAAGAATTAAAGAATTGGAAGATCACCTTCTAGAAGAAGAAGATAATGCTGCTGGACTGGAAGATATCA
AGAAGAAAATGCAGGGTGAGATTGAAGAGTTGAAAAAAGATGTTGTCGATTTGGAATCTTCATTACAAAAGGCTGAACAA
GAGAAAACCGCGAAAGATCAACAGATAAAATCGTTACAAGATCAAATGGCAAAACAAGAAGAAGAGATGAACAAATTGAA
AAAGGAGAAAAAGGCCGCCGATGAAGTGCAAAAGAAAACCGAAGAATCTCTACTAGCGGAAGAAGAGAAAGTCAAAAATC
TAAACAAAGCTAAAGCCAAATTGGAACAGACCATTGATGAGATGGAAGAAAACCTCTCGCGAGAACAGAAAATCCGAGCT
GACGTAGAAAAAGTTAAACGAAAAATCGAAACTGAACTGAAACAAACTCAAGAGACCGTAGACGATTTGGAAAGAGTAAA
ACGAGAATTAGAGGAACAATTGAAGCGCAAGGAAATGGAATTAGTCAATGCTTCATCGAAAATTGAAGACGAATCGGGAT
TAGTTGCCCAGCTTCAGAGGAAAATCAAAGAACTTCAAGCTCGAATTCAAGAATTGGAAGAAGATCTGGAAGCAGAAAGA
CAAGCCCGTGCAAAAGCAGAGAAAAGCCGACATCAACTCGAAGGCGAGTTGGAAGAATTGAGTGATCGACTGGAAGAACA
AGGAGGCGCAACCTCAGCTCAAATGGATCTCAATAAGAAGCGAGAGGCAGAATTAATGAAATTAAAGAGAGATTTAGAAG
AATCGAATATGCAACACGATCAGGTTATCGCACAAGCTCGAAAGAAGCAACAGGATGTTGTCAATGAATTCTCAGAACAG
CTCGATCAACTGCAGAAAGTCAAAGCTAAAGTTGAAAAAGAAAAGAATGAGATGAAAGAAGATTTAAATGACCTACAAGG
ACAGCTGGAATCATTAAATAAAGCCAAGGCTAACAGCGACAAACGAATCAAAGAAATCGAAGCTCAAAATTCCGAATTAC
AGGGCAAATTGGAAGAGGCAAATAGACATATCAATGATGCCAACAATACATCTGGAAAGAATCAACAAACCAATGCGGAA
CTCCAAGCACGTTTAGAAGAAGCCGAATCGCAAATCAATCAGCTGGGTAAAGTCAAGCAACAAATGCAGACTCAACTCGA
AGAAGCCAGGCAAATCGCTGAGGAAGAGTCGAGAGCAAAGGCTAAATTGAGTTCTGATGTTCGCAATCTCAATGCCGATT
TAGACAATCTCAGGGAGGCACTGGAAGAGGAAAATGAGAACAAAAGTGACATACAGAGACAGCTAGTTAAAGCTCAGGGA
GAAATGCAACAATTGAAGGCTAAATTCGAAGGCTCGGGATCCATTCGTTCAGAAGAGTTGGATGAAGCCAAGCGAAAGTT
TATGACACGAATCCATGAGCTGGAAGAGGAAGCTGAAACCGCCAAATCGAAAGCCGGACAACTAGAAAAAGTTAAAGCTC
GACTCCAAGGAGAAATCGAAGATATGCTGGTCGACGTTGACAGAGCGAATACACTCGCATCTCAGTTGGAAAAGAAGCAG
AAAACATTCGATAAAGTCGTGTCAGAATGGCAGCAGAAATATGCTGAATCTCAGGCGGAATTGGAAGCATCCCAGAGAGA
AAGCAGGACGATTTCAGCTGAGGTGTTTCGAATGAAAGCACAAATCGAAGAAAGTCAAGAGCAGTTGGAAAGCGTTAAAC
GGGAAAACAAAAATCTAGCAGATGAAATCCACGATTTGACAGAGCAAATCGGAGAAGGAGGTCGCAGTGTTCACGAAATC
GACAAAGCAAGGAAACGATTGGAAATGGAAAAGGAAGAATTGCAACATGCGTTAGAAGAAGCCGAACAAGCTTTGGAACA
GGAAGAAGCCAAGTCTCAACGATCACAACTGGAAATGAGCCAGATCAGACAAGAAATCGACAGGCGATTGGCTGAGAAGG
AAGAGGAATTCGAGGCCACTCGAGTCAATCATCAAAGAGCAATGGAGTCAATGGAAGCCTCACTTGAAGCCGAATCCAGA
GGCAGGGCTGAAGCAACGAAGATGAAAAAGAAACTGGAGCACGATATCGGTGAACTGGAAGTTGCAGTGGATACCGCCAA
CAGAATCCGATCGGAGCAAGAAAAGAACGCAAAGAAATTCCAGCAGCAAGTTCAAGAATTGCTATCAATGGTGGAGGATG
AGAAACACCAGAAGGATCAGATACGAGAGCAAACGACGATGACAGAAAGGAAATTGACAATGGTCCTGGCAGAGCTTGAG
GAGGTTCGTGGCTCATTGGAAAATTCCGAGAGAAACAGGAAAAATACCGAGAATGAGAAAATGGAAATAACTGATCGATT
GAATGAGTTGAGTGTCCAGAGCTCCGGTTTCATGGCTACCAAGCGGAAATTGGAAGCTGATTTGGCTGCTATGCAGTCCG
ATTTAGAGGAGGCCGCTACTGAAGCCCGACAAGCCAATGAACAAGCCAAGAAGGCTGTTGCTGACAGTGCGAGATTGTTT
GATGAAATCCGGCAAGAGCAGGAACACGCACAGCAAATCGATAAGATCAAGAAACAACTCGAGGCCCAAAATAAAGAATT
GCAAGCCAAATTAGATGAATCGGAGAATAATGCTTTGAAAGGTGGCAAAAAAGCCTTGAGCAAACTAGAGCAACGCGTTC
GTGAACTTGAAGCCGAATTAGACGGAGAACAAAAAAGACACGTTGAAAGTCAAAAGAACTCCAGAAAAGTTGAAAGACGG
CTTAAGGAGCTTGGATTACAAACCGACGAAGATAAGAAGAACCAAGAAAGATTGCAAGATCTGGTGGAGAAGCTTCAAGG
TAAAATCAAAACCTACAAACGCCAGGTGGAAGAGGCGGAAGAAATTGCTGCTGTAAACTTAGCAAAATACAGAAAGATCC
AACAGGAAATCGAAGATTCCGAAGAAAGAGCTGATCAAGCTGAACAAGCGTTGCAGAAGCTGAGGACCAAAAACCGCAGC
TCCGTTTCGACAGCGAGAGGCGGTAGCATGGCTCCCGGCATGACCACAGTGAAATCGACATCACTCTCTGTTTCGGCTTC
GAGCCGACGACAAGGTTCTAGTGTTTCCAGAGAGAGCTAAGTCAGAAATTCTAGTAACACAACGATAAATTATTAGGATT
TACTTAATTGACATTATTTGCATGTTATCAATTATTGGACACAATTTAGTGATGCTTTTATTTAATAAAATTTACATTTT
GAAAAAAAA

 

back to top


 

References

Cowles, M.W., Brown, D.D., Nisperos, S.V., Stanley, B.N., Pearson, B.J., and Zayas, R.M. (2013). Genome-wide analysis of the bHLH gene family in planarians identifies factors required for adult neurogenesis and neuronal regeneration. Development 140, 4691-4702.

Reddien, P.W., Bermange, A.L., Murfitt, K.J., Jennings, J.R., and Sánchez Alvarado, A. (2005). Identification of genes needed for regeneration, stem cell function, and tissue homeostasis by systematic gene perturbation in planaria. Dev Cell 8, 635-649.

Scimone, M.L., Kravarik, K.M., Lapan, S.W., and Reddien, P.W. (2014). Neoblast specialization in regeneration of the planarian Schmidtea mediterranea. Stem Cell Reports 3, 339-352.

 

back to top