SMED30035432

Overview
NameSMED30035432
Smed IDSMED30035432
Length (bp)246
Neoblast Clusters

Zeng et. al., 2018



 

 

Overview

 

Single cell RNA-seq of pluripotent neoblasts and its early progenies


We isolated X1 neoblasts cells enriched in high piwi-1 expression (Neoblast Population), and profiled ∼7,614 individual cells via scRNA-seq. Unsupervised analyses uncovered 12 distinct classes from 7,088 high-quality cells. We designated these classes Nb1 to Nb12 and ordered them based on high (Nb1) to low (Nb12) piwi-1 expression levels. We further defined groups of genes that best classified the cells parsed into 12 distinct cell clusters to generate a scaled expression heat map of discriminative gene sets for each cluster. Expression of each cluster’s gene signatures was validated using multiplex fluorescence in situ hybridization (FISH) co-stained with piwi-1 and largely confirmed the cell clusters revealed by scRNA-seq.

We also tested sub-lethal irradiation exposure. To profile rare pluripotent stem cells (PSCs) and avoid interference from immediate progenitor cells, we determined a time point after sub-lethal irradiation (7 DPI) with minimal piwi-1+ cells, followed by isolation and single-cell RNA-seq of 1,200 individual cells derived from X1 (Piwi-1 high) and X2 (Piwi-1 low) cell populations (Sub-lethal Irradiated Surviving X1 and X2 Cell Population)



Explore this single cell expression dataset with our NB Cluster Shiny App



Embryonic Expression

Davies et. al., 2017

Hover the mouse over a column in the graph to view average RPKM values per sample.
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset

Embryonic Stages: Y: yolk. S2-S8: Stages 2-8. C4: asexual adult. SX: virgin, sexually mature adult.
For further information about sample preparation and analysis for the single animal RNA-Seq experiment, please refer to the Materials and Methods

 

back to top
Anatomical Expression

PAGE et. al., 2020



SMED30035432

has been reported as being expressed in these anatomical structures and/or regions. Read more about PAGE



PAGE Curations: 7

  
Expressed InReference TranscriptGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
protonephridiaSMED30035432 dd_Smed_v4_13633_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018		FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30035432 dd_Smed_v4_13633_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018		FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
epidermisSMED30035432 dd_Smed_v4_13633_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018		FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035432 dd_Smed_v4_13633_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018		FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
muscle cellSMED30035432 dd_Smed_v4_13633_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018		FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
parenchymal cellSMED30035432 dd_Smed_v4_13633_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018		FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cilated neuronSMED30035432 dd_Smed_v4_13633_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018		FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Note: Hover over icons to view figure legend
Alignments
SMED30035432 aligns in the following genomic locations:
Alignment LocationAlignment Score
v31.000410:139929..140170 +1198
v31.006987:17706..17948 -1168
v31.004902:23564..23806 -1159
v31.000346:166058..166300 +1159
v31.014824:5028..5270 -1150
v31.013464:13966..14208 +1150
v31.009136:2541..2783 -1150
v31.001006:36791..37033 +1150
v31.000518:136442..136684 +1150
v31.016325:2455..2694 +1147
v31.001321:32635..32878 +1147
v31.014748:14118..14359 -1142
v31.038033:3945..4187 +1141
v31.020058:8049..8291 -1141
v31.019188:9945..10187 +1141
v31.001321:31073..31315 +1141
v31.015839:12688..12929 +1133
v31.008696:16944..17184 -1133
v31.026593:8852..9094 -1132
v31.017125:11816..12058 +1132
v31.003333:69103..69345 -1132
v31.000363:112917..113159 +1132
v31.000312:42643..42885 -1132
v31.025564:3070..3311 +1124
v31.014272:12999..13241 -1123
v31.000785:83931..84173 -1123
v31.034376:2373..2614 +1115
v31.000507:52195..52437 +1114
v31.000651:104958..105199 +1106
v31.002435:3516..3758 -1105
v31.034028:2686..2933 +1104
v31.010427:11378..11621 +1102
v31.019987:494..736 +1096
v31.018947:6429..6671 -1096
v31.005814:18097..18339 +1087
v31.000482:160624..160867 -1084
v31.017346:10064..10307 -1075
v31.009322:4549..4777 -1071
v31.008557:13376..13604 -1062
v31.000266:98108..98336 +1062
v31.002816:1693..1948 -1058
v31.006745:12891..13137 -1055
v31.024234:10975..11203 +1053
v31.000114:143480..143712 +1052
v31.000031:202924..203163 +1051
v31.000359:22307..22548 -1049
v31.000290:43000..43246 -1046
v31.021428:726..954 +1035
v31.003661:40191..40419 -1035
v31.002481:46320..46566 +1028
v31.000075:98576..98821 -1026
v31.000180:101..333 +1022
v31.000041:73272..73519 -1016
v31.002557:48742..48973 -1006
v31.001723:3285..3531 -992
v31.046395:1022..1264 -962
v31.010392:5748..5990 -962
v31.028262:2348..2588 -952
v31.001224:43475..43715 -943
v31.000935:93126..93366 -943
v31.021720:3460..3700 -934
v31.034620:1929..2169 +925
v31.002445:26699..26939 +925
v31.020863:14879..15119 -916
v31.020571:6440..6680 -916
v31.012392:17142..17382 -916
v31.006360:27217..27457 -916
v31.004923:36884..37119 -912
v31.003271:20652..20887 -903
v31.001001:59092..59332 -898
v31.025547:1350..1583 -883
v31.009304:16246..16442 -851
v31.020827:7152..7372 +781
v31.002625:9059..9295 +727
v31.003846:28708..28922 +617
v31.002625:9110..9352 +341
v31.010392:5895..6146 -295
v31.046395:1169..1420 -294
v31.004923:37025..37275 -284
v31.003271:20793..21043 -284
v31.000041:73366..73624 -268
v31.006745:13011..13241 -264
Homology
The following BLAST results are available for this feature:
BLAST of SMED30035432 vs. Ensembl Human
Analysis Date: 2016-08-08 (Schmidtea mediterranea smed_20140614 BLASTX Human e!99)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30035432 vs. Ensembl Celegans
Analysis Date: 2020-05-01 (Schmidtea mediterranea smed_20140614 BLASTX Celegan e!99)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30035432 vs. Ensembl Fly
Analysis Date: 2020-05-01 (Schmidtea mediterranea smed_20140614 BLASTX Drosophila e!99)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30035432 vs. Ensembl Zebrafish
Analysis Date: 2016-08-08 (Schmidtea mediterranea smed_20140614 BLASTX Zebrafish e!99)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30035432 vs. Ensembl Xenopus
Analysis Date: 2020-05-01 (Schmidtea mediterranea smed_20140614 BLASTX Xenopus e!99)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30035432 vs. Ensembl Mouse
Analysis Date: 2020-05-01 (Schmidtea mediterranea smed_20140614 BLASTX Mouse e!99)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30035432 vs. UniProt/SwissProt
Analysis Date: 2020-05-01 (Schmidtea mediterranea smed_20140614 BLASTX EMBL-EBI UniProt)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30035432 vs. TrEMBL
Analysis Date: 2020-05-01 (Schmidtea mediterranea smed_20140614 BLASTX EMBL-EBI TrEMBL)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30035432 vs. Ensembl Cavefish
Analysis Date: 2020-05-08 (Schmidtea mediterranea smed_20140614 BLASTX Cavefish e!99)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30035432 vs. Ensembl Sea Lamprey
Analysis Date: 2020-05-08 (Schmidtea mediterranea smed_20140614 BLASTX Sea Lamprey e!99)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30035432 vs. Ensembl Yeast
Analysis Date: 2020-05-08 (Schmidtea mediterranea smed_20140614 BLASTX Yeast e!Fungi46)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30035432 vs. Ensembl Nematostella
Analysis Date: 2020-05-08 (Schmidtea mediterranea smed_20140614 BLASTX Nematostella e!Metazoa46)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30035432 vs. Ensembl Medaka
Analysis Date: 2020-05-08 (Schmidtea mediterranea smed_20140614 BLASTX Medaka e!99)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30035432 vs. Planmine SMEST
Analysis Date: 2020-05-08 (Schmidtea mediterranea smed_20140614 BLASTX Planmine SMEST)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
Sequences
The following sequences are available for this feature:

transcript sequence

>SMED30035432 ID=SMED30035432|Name=SMED30035432|organism=Schmidtea mediterranea sexual|type=transcript|length=246bp
ATGTTATTCATTGTTTCGATATTTATTCATTTTGTATTTTTCGTTACTCA
ACTTTCGGGTTATGAAGTTATTCGTTGCATCTTTTTTTCACATATCATTA
TTGACTCTATTCATTCTCTTTCATTTCATTTTGATATTTCTATTTTTACT
GTTGTTGAAATTCATTTTTTTGTGATATTTTTCGCTGTCTTTCTATTCCG
TCATCCGTTTACTTCTAATACTATTTTCCTCTATTTATCAGTTACC
back to top
Annotated Terms
The following terms have been associated with this transcript:
Vocabulary: Planarian Anatomy
TermDefinition
PLANA:0000020protonephridia
PLANA:0000099neuron