SMED30035013

Overview
NameSMED30035013
Smed IDSMED30035013
Length (bp)344
Neoblast Clusters

Zeng et. al., 2018




▻ Overview

▻ Neoblast Population

▻ Sub-lethal Irradiated Surviving X1 and X2 Cell Population

 



 

Overview

 

Single cell RNA-seq of pluripotent neoblasts and its early progenies


We isolated X1 neoblasts cells enriched in high piwi-1 expression (Neoblast Population), and profiled ∼7,614 individual cells via scRNA-seq. Unsupervised analyses uncovered 12 distinct classes from 7,088 high-quality cells. We designated these classes Nb1 to Nb12 and ordered them based on high (Nb1) to low (Nb12) piwi-1 expression levels. We further defined groups of genes that best classified the cells parsed into 12 distinct cell clusters to generate a scaled expression heat map of discriminative gene sets for each cluster. Expression of each cluster’s gene signatures was validated using multiplex fluorescence in situ hybridization (FISH) co-stained with piwi-1 and largely confirmed the cell clusters revealed by scRNA-seq.

We also tested sub-lethal irradiation exposure. To profile rare pluripotent stem cells (PSCs) and avoid interference from immediate progenitor cells, we determined a time point after sub-lethal irradiation (7 DPI) with minimal piwi-1+ cells, followed by isolation and single-cell RNA-seq of 1,200 individual cells derived from X1 (Piwi-1 high) and X2 (Piwi-1 low) cell populations (Sub-lethal Irradiated Surviving X1 and X2 Cell Population)




Explore this single cell expression dataset with our NB Cluster Shiny App




 

Neoblast Population

 

t-SNE plot shows two-dimensional representation of global gene expression relationships among all neoblasts (n = 7,088 after filter). Cluster identity was assigned based on the top 10 marker genes of each cluster (Table S2), followed by inspection of RNA in situ hybridization patterns. Neoblast groups, Nb.


Expression of SMED30035013 (SMED30035013) t-SNE clustered cells

Violin plots show distribution of expression levels for SMED30035013 (SMED30035013) in cells (dots) of each of the 12 neoblast clusters.

 

back to top


 

Sub-lethal Irradiated Surviving X1 and X2 Cell Population

 

t-SNE plot of surviving X1 and X2 cells (n = 1,039 after QC filter) after sub-lethal irradiation. Colors indicate unbiased cell classification via graph-based clustering. SL, sub-lethal irradiated cell groups.

Expression of SMED30035013 (SMED30035013) in the t-SNE clustered sub-lethally irradiated X1 and X2 cells.

Violin plots show distribution of expression levels for SMED30035013 (SMED30035013) in cells (dots) of each of the 10 clusters of sub-leathally irradiated X1 and X2 cells.

 

back to top


 

Embryonic Expression

Davies et. al., 2017




Hover the mouse over a column in the graph to view average RPKM values per sample.
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset

Embryonic Stages: Y: yolk. S2-S8: Stages 2-8. C4: asexual adult. SX: virgin, sexually mature adult.
For further information about sample preparation and analysis for the single animal RNA-Seq experiment, please refer to the Materials and Methods

 

back to top
Anatomical Expression

PAGE et. al., 2020




SMED30035013

has been reported as being expressed in these anatomical structures and/or regions. Read more about PAGE



PAGE Curations: 13

  
Expressed InReference TranscriptGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
Smed sexual biotypeSMED30035013h1SMcG0004884 Contig43287uc_Smed_v2PMID:29674431
Fincher et al., 2018
FACS sorted cell population adult hermaphrodite single-cell RNA-sequencing evidence
Smed sexual biotypeSMED30035013h1SMcG0004884 Contig43287newmark_estsPMID:29674431
Fincher et al., 2018
FACS sorted cell population adult hermaphrodite single-cell RNA-sequencing evidence
nervous systemSMED30035013 dd_Smed_v4_1760_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
epidermisSMED30035013 dd_Smed_v4_1760_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30035013 dd_Smed_v4_1760_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30035013 dd_Smed_v4_1760_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
whole organism asexual adult colorimetric in situ hybridization evidence
muscle cellSMED30035013 dd_Smed_v4_1760_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neoblastSMED30035013 dd_Smed_v4_1760_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
parenchymal cellSMED30035013 dd_Smed_v4_1760_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cilated neuronSMED30035013 dd_Smed_v4_1760_1_1dd_Smed_v4PMID:29674431
Fincher et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neural progenitor cellSMED30035013 dd_Smed_v6_1760_1dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30035013 dd_Smed_v6_1760_1dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cholinergic neuronSMED30035013 dd_Smed_v6_1760_1dd_Smed_v6PMID:29674432
Plass et al., 2018
FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
Note: Hover over icons to view figure legend
Alignments
SMED30035013 aligns in the following genomic locations:
Alignment LocationAlignment Score
v31.000822:18..361 -1720
v31.041284:1658..2001 +1711
v31.000730:82915..83258 +1711
v31.043528:1508..1853 -1695
v31.022895:8037..8379 +1694
v31.000080:186371..186715 -1690
v31.043692:399..740 -1685
v31.019641:1298..1640 -1685
v31.038729:221..564 -1682
v31.017178:1018..1363 -1677
v31.009281:18709..19052 +1676
v31.006841:2805..3148 -1676
v31.004929:404..746 -1676
v31.002365:47198..47540 +1676
v31.000299:36691..37033 +1676
v31.003649:17745..18089 +1672
v31.000555:87272..87613 +1668
v31.001331:120445..120786 +1667
v31.000393:162563..162905 -1667
v31.010906:134..482 -1665
v31.018288:8840..9189 +1658
v31.017860:806..1148 -1658
v31.014177:1..337 -1658
v31.023591:7261..7607 +1657
v31.033777:1976..2325 +1653
v31.002357:59025..59372 +1651
v31.039256:243..591 -1647
v31.013763:17194..17538 +1647
v31.010786:22862..23213 +1642
v31.003576:56949..57296 +1642
v31.003853:12384..12724 -1633
v31.016136:10693..11027 +1622
v31.009385:17099..17432 -1613
v31.049720:167..502 -1610
v31.020506:541..882 +1609
v31.000507:108847..109188 +1604
v31.001179:1668..2008 -1603
v31.043987:574..921 +1597
v31.007209:18..346 -1597
v31.037325:1340..1674 +1595
v31.000040:144435..144783 +1594
v31.000053:117246..117581 -1592
v31.001039:11437..11776 +1589
v31.014871:37..378 -1586
v31.000083:180743..181083 +1584
v31.012272:13079..13412 -1575
v31.000042:315598..315939 -1572
v31.039087:1541..1882 -1569
v31.037494:4620..4956 +1568
v31.018397:715..1051 -1563
v31.001180:79736..80070 -1562
v31.001038:36050..36385 +1559
v31.013882:22327..22665 +1553
v31.033534:2859..3206 +1552
v31.005380:18758..19099 +1546
v31.000416:108267..108605 -1546
v31.000003:119259..119609 +1546
v31.020610:782..1121 -1540
v31.004240:1461..1797 -1517
v31.000398:650..985 +1517
v31.032380:5103..5406 +1493
v31.002231:54295..54618 +1472
v31.005772:25023..25355 -1464
v31.003390:26..351 -1458
v31.020178:10551..10874 -1454
v31.001921:52554..52877 -1453
v31.027723:4273..4609 -1451
v31.031023:2921..3243 -1445
v31.000211:57553..57865 +1433
v31.021508:1..297 -1428
v31.001999:45429..45755 -1427
v31.018465:7537..7849 +1424
v31.017543:1980..2302 +1423
v31.025686:3246..3584 -1417
v31.002926:1444..1768 +1416
v31.000849:107489..107821 -1404
v31.028525:7258..7571 +1394
v31.002660:113746..114072 +1381
v31.001546:16..294 +1352
v31.031761:118..437 -1348
v31.046168:2049..2365 -1345
v31.043827:486..789 -1335
v31.037080:2679..2984 +1335
v31.022072:7417..7742 -1333
v31.033906:1718..2015 +1318
v31.004965:597..899 +1317
v31.020054:12104..12436 -1172
v31.013859:1351..1608 -1130
v31.021188:1..263 -1083
v31.000671:67537..67902 -889
v31.001999:46630..47521 -480
Homology
The following BLAST results are available for this feature:
BLAST of SMED30035013 vs. Ensembl Human
Analysis Date: 2016-08-08 (Schmidtea mediterranea smed_20140614 BLASTX Human e!99)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30035013 vs. Ensembl Celegans
Analysis Date: 2020-05-01 (Schmidtea mediterranea smed_20140614 BLASTX Celegan e!99)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30035013 vs. Ensembl Fly
Analysis Date: 2020-05-01 (Schmidtea mediterranea smed_20140614 BLASTX Drosophila e!99)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30035013 vs. Ensembl Zebrafish
Analysis Date: 2016-08-08 (Schmidtea mediterranea smed_20140614 BLASTX Zebrafish e!99)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30035013 vs. Ensembl Xenopus
Analysis Date: 2020-05-01 (Schmidtea mediterranea smed_20140614 BLASTX Xenopus e!99)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30035013 vs. Ensembl Mouse
Analysis Date: 2020-05-01 (Schmidtea mediterranea smed_20140614 BLASTX Mouse e!99)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30035013 vs. UniProt/SwissProt
Analysis Date: 2020-05-01 (Schmidtea mediterranea smed_20140614 BLASTX EMBL-EBI UniProt)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30035013 vs. TrEMBL
Analysis Date: 2020-05-01 (Schmidtea mediterranea smed_20140614 BLASTX EMBL-EBI TrEMBL)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30035013 vs. Ensembl Cavefish
Analysis Date: 2020-05-08 (Schmidtea mediterranea smed_20140614 BLASTX Cavefish e!99)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30035013 vs. Ensembl Sea Lamprey
Analysis Date: 2020-05-08 (Schmidtea mediterranea smed_20140614 BLASTX Sea Lamprey e!99)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30035013 vs. Ensembl Yeast
Analysis Date: 2020-05-08 (Schmidtea mediterranea smed_20140614 BLASTX Yeast e!Fungi46)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30035013 vs. Ensembl Nematostella
Analysis Date: 2020-05-08 (Schmidtea mediterranea smed_20140614 BLASTX Nematostella e!Metazoa46)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30035013 vs. Ensembl Medaka
Analysis Date: 2020-05-08 (Schmidtea mediterranea smed_20140614 BLASTX Medaka e!99)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30035013 vs. Planmine SMEST
Analysis Date: 2020-05-08 (Schmidtea mediterranea smed_20140614 BLASTX Planmine SMEST)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
Sequences
The following sequences are available for this feature:

transcript sequence

>SMED30035013 ID=SMED30035013|Name=SMED30035013|organism=Schmidtea mediterranea sexual|type=transcript|length=344bp
TAGTTGCATAAACAAATTAACGAACTAAAATTAAACAGTAAATAAGTTAA
TTTAATAAGCATCAATAAGTTAATTTAATAAGCAACACGAGCACTTGCAA
TCACCGGGGTTTGGCTACCCTGGACAGCGATTGCAAGTGTTCGGTTACTA
TGAAGGTAGTTGAGGACAGCATGGTAAAAAGAATCACAAAAACAAAAAAT
AACAAAAGACAAGTAATCACTTACGTCCATAGTAATTGAGGGATGGCGTT
ACTAAAATTCAAAAAAAAAATATGAAAAAGAAAAATAAAATATAAAATGC
TTACTTCAAGATTGGCAAGACAAAACTAACGAAAAGTGGTAAAG
back to top
Annotated Terms
The following terms have been associated with this transcript:
Vocabulary: Planarian Anatomy
TermDefinition
PLANA:0000012neural progenitor cell
PLANA:0000099neuron
PLANA:0000101muscle cell
PLANA:0000463cholinergic neuron