SMED30030445

Overview
NameSMED30030445
Smed IDSMED30030445
Length (bp)509
Neoblast Clusters

Zeng et. al., 2018



▻ Overview

▻ Neoblast Population

▻ Sub-lethal Irradiated Surviving X1 and X2 Cell Population

 

 

Overview

 

Single cell RNA-seq of pluripotent neoblasts and its early progenies


We isolated X1 neoblasts cells enriched in high piwi-1 expression (Neoblast Population), and profiled ∼7,614 individual cells via scRNA-seq. Unsupervised analyses uncovered 12 distinct classes from 7,088 high-quality cells. We designated these classes Nb1 to Nb12 and ordered them based on high (Nb1) to low (Nb12) piwi-1 expression levels. We further defined groups of genes that best classified the cells parsed into 12 distinct cell clusters to generate a scaled expression heat map of discriminative gene sets for each cluster. Expression of each cluster’s gene signatures was validated using multiplex fluorescence in situ hybridization (FISH) co-stained with piwi-1 and largely confirmed the cell clusters revealed by scRNA-seq.

We also tested sub-lethal irradiation exposure. To profile rare pluripotent stem cells (PSCs) and avoid interference from immediate progenitor cells, we determined a time point after sub-lethal irradiation (7 DPI) with minimal piwi-1+ cells, followed by isolation and single-cell RNA-seq of 1,200 individual cells derived from X1 (Piwi-1 high) and X2 (Piwi-1 low) cell populations (Sub-lethal Irradiated Surviving X1 and X2 Cell Population)



Explore this single cell expression dataset with our NB Cluster Shiny App



 

Neoblast Population

 

t-SNE plot shows two-dimensional representation of global gene expression relationships among all neoblasts (n = 7,088 after filter). Cluster identity was assigned based on the top 10 marker genes of each cluster (Table S2), followed by inspection of RNA in situ hybridization patterns. Neoblast groups, Nb.


Expression of SMED30030445 (SMED30030445) t-SNE clustered cells

Violin plots show distribution of expression levels for SMED30030445 (SMED30030445) in cells (dots) of each of the 12 neoblast clusters.

 

back to top

 

Sub-lethal Irradiated Surviving X1 and X2 Cell Population

 

t-SNE plot of surviving X1 and X2 cells (n = 1,039 after QC filter) after sub-lethal irradiation. Colors indicate unbiased cell classification via graph-based clustering. SL, sub-lethal irradiated cell groups.

Expression of SMED30030445 (SMED30030445) in the t-SNE clustered sub-lethally irradiated X1 and X2 cells.

Violin plots show distribution of expression levels for SMED30030445 (SMED30030445) in cells (dots) of each of the 10 clusters of sub-leathally irradiated X1 and X2 cells.

 

back to top

 

Embryonic Expression

Davies et. al., 2017

Hover the mouse over a column in the graph to view average RPKM values per sample.
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset

Embryonic Stages: Y: yolk. S2-S8: Stages 2-8. C4: asexual adult. SX: virgin, sexually mature adult.
For further information about sample preparation and analysis for the single animal RNA-Seq experiment, please refer to the Materials and Methods

 

back to top
Anatomical Expression

PAGE et. al., 2020



SMED30030445

has been reported as being expressed in these anatomical structures and/or regions. Read more about PAGE



PAGE Curations: 1

  
Expressed InReference TranscriptGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
X1 cellSMED30030445SMESG000072463.1 SmedASXL_017222SmedAsxl_ww_GCZZ01PMID:26114597
Zhu et al., 2015		FACS sorted cell population asexual adult RNA-sequencing evidence
Note: Hover over icons to view figure legend
Alignments
SMED30030445 aligns in the following genomic locations:
Alignment LocationAlignment Score
v31.000169:36528..37036 -2426
v31.015020:15276..15806 -1306
v31.003105:36309..36816 +1305
v31.001240:20596..21093 +1295
v31.016864:5005..5465 +1280
v31.020621:12911..13425 +1276
v31.003290:850..1310 +1271
v31.002682:29029..29560 +1260
v31.030732:2253..2734 -1246
v31.008375:9604..10077 -1246
v31.015075:11811..12356 +1234
v31.006715:21095..21587 -1224
v31.002296:17105..17563 +1202
v31.009243:22796..23301 -1199
v31.000314:97292..97777 -1199
v31.012433:3979..4418 +1197
v31.014482:3905..4440 -1192
v31.002911:31207..31721 -1188
v31.018144:9079..9541 +1182
v31.020315:3116..3579 +1175
v31.010080:6393..6931 +1172
v31.002735:46565..47061 -1170
v31.010314:12569..13038 +1167
v31.002292:51385..51819 +1167
v31.002352:19516..19971 +1165
v31.002427:33295..33977 -1156
v31.017215:3575..4060 -1151
v31.000057:150523..150970 +1149
v31.018962:8332..8821 -1146
v31.035265:1319..1779 -1145
v31.012294:11859..12356 -1143
v31.012237:22091..22574 +1142
v31.002629:23785..24226 +1134
v31.000058:234589..235093 +1133
v31.008429:3665..4241 +1132
v31.001118:13252..13676 -1121
v31.000742:15390..15854 +1121
v31.000219:179877..180306 +1117
v31.006026:25901..26368 -1115
v31.005719:22744..23256 -1108
v31.003937:37986..38446 +1106
v31.000402:61561..62035 +1104
v31.001324:67079..67532 +1103
v31.000609:45836..46316 +1103
v31.000624:171538..171997 +1098
v31.000292:113728..114230 +1094
v31.000074:184970..185496 -1094
v31.001667:103539..104042 -1090
v31.000118:185285..185722 -1090
v31.001961:18774..19244 +1086
v31.000276:146110..146594 -1086
v31.010362:10415..10881 +1082
v31.001472:87544..88049 -1082
v31.006603:13025..13438 +1076
v31.003250:767..1233 -1076
v31.001695:53676..54187 +1076
v31.026534:5558..6037 +1075
v31.020934:12563..13069 -1074
v31.007048:17368..17790 -1070
v31.004562:5172..5597 -1069
v31.002909:39363..39837 +1069
v31.002294:33172..33600 -1069
v31.007753:576..1015 -1058
v31.009680:4921..5335 -1048
v31.029163:9260..9740 -1046
v31.012140:20769..21269 +1043
v31.014872:12821..13274 -1042
v31.000422:35681..36101 +1036
v31.047828:258..782 +1035
v31.011723:5914..6438 +1035
v31.001597:40951..41427 -1029
v31.017920:15776..16233 -1024
v31.025467:7815..8336 -1017
v31.007324:19710..20241 -1009
v31.003263:10763..11210 -1006
v31.000747:72016..72438 +1002
v31.014872:2170..2589 +946
Homology
The following BLAST results are available for this feature:
BLAST of SMED30030445 vs. Ensembl Human
Analysis Date: 2016-08-08 (Schmidtea mediterranea smed_20140614 BLASTX Human e!99)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30030445 vs. Ensembl Celegans
Analysis Date: 2020-05-01 (Schmidtea mediterranea smed_20140614 BLASTX Celegan e!99)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30030445 vs. Ensembl Fly
Analysis Date: 2020-05-01 (Schmidtea mediterranea smed_20140614 BLASTX Drosophila e!99)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30030445 vs. Ensembl Zebrafish
Analysis Date: 2016-08-08 (Schmidtea mediterranea smed_20140614 BLASTX Zebrafish e!99)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30030445 vs. Ensembl Xenopus
Analysis Date: 2020-05-01 (Schmidtea mediterranea smed_20140614 BLASTX Xenopus e!99)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30030445 vs. Ensembl Mouse
Analysis Date: 2020-05-01 (Schmidtea mediterranea smed_20140614 BLASTX Mouse e!99)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30030445 vs. UniProt/SwissProt
Analysis Date: 2020-05-01 (Schmidtea mediterranea smed_20140614 BLASTX EMBL-EBI UniProt)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30030445 vs. TrEMBL
Analysis Date: 2020-05-01 (Schmidtea mediterranea smed_20140614 BLASTX EMBL-EBI TrEMBL)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30030445 vs. Ensembl Cavefish
Analysis Date: 2020-05-08 (Schmidtea mediterranea smed_20140614 BLASTX Cavefish e!99)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30030445 vs. Ensembl Sea Lamprey
Analysis Date: 2020-05-08 (Schmidtea mediterranea smed_20140614 BLASTX Sea Lamprey e!99)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30030445 vs. Ensembl Yeast
Analysis Date: 2020-05-08 (Schmidtea mediterranea smed_20140614 BLASTX Yeast e!Fungi46)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30030445 vs. Ensembl Nematostella
Analysis Date: 2020-05-08 (Schmidtea mediterranea smed_20140614 BLASTX Nematostella e!Metazoa46)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30030445 vs. Ensembl Medaka
Analysis Date: 2020-05-08 (Schmidtea mediterranea smed_20140614 BLASTX Medaka e!99)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30030445 vs. Planmine SMEST
Analysis Date: 2020-05-08 (Schmidtea mediterranea smed_20140614 BLASTX Planmine SMEST)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
Sequences
The following sequences are available for this feature:

transcript sequence

>SMED30030445 ID=SMED30030445|Name=SMED30030445|organism=Schmidtea mediterranea sexual|type=transcript|length=509bp
GAAATTGAGAAACTTCGCATTGTGGGTCAGATAAAAAAAAGTTAAATGTA
ATTAATTAAAATAATACTATTTAATAGTATGACCAAAAAAATGTTTTCTT
AGTTTTAAATTTAATATTAGGAGTTTTGTATTGAAATCAATTAACAATAT
TTGTGATCGATAAATCTGCATTAACCCTTTCGCTGCGCATTGCTTTGAGA
TTTCGTGTTCGATGTGCGCAAATCTTTCGATTATTGTTCATTACAGATGC
ACAAAATTCCGATTTTACTATAATAAAAGTGAAACATCATCTTAGGATTT
TTGTACCTGACTTGTTTGAGTAATAGGTTTGTGAATAGTTGTGTTGTACC
AGGAAGGTATCGGAGCGTATTGGTCATTCATATTGTGCGAGTATATACGG
CTTGAGCAGTGAAAGGGTTTATGTAAAAATTAGAAAAGCTTCAGTGGTTT
GAATATTAAAAAACAATTAAGAATTTGAATATTTATAATTGCATTGAATA
AATAATTTT
back to top
Annotated Terms
The following terms have been associated with this transcript:
Vocabulary: Planarian Anatomy
TermDefinition
PLANA:0002109X1 cell