SMED30009741

Overview
NameSMED30009741
Smed IDSMED30009741
Length (bp)951
Neoblast Clusters

Zeng et. al., 2018



▻ Overview

▻ Neoblast Population

 

 

Overview

 

Single cell RNA-seq of pluripotent neoblasts and its early progenies


We isolated X1 neoblasts cells enriched in high piwi-1 expression (Neoblast Population), and profiled ∼7,614 individual cells via scRNA-seq. Unsupervised analyses uncovered 12 distinct classes from 7,088 high-quality cells. We designated these classes Nb1 to Nb12 and ordered them based on high (Nb1) to low (Nb12) piwi-1 expression levels. We further defined groups of genes that best classified the cells parsed into 12 distinct cell clusters to generate a scaled expression heat map of discriminative gene sets for each cluster. Expression of each cluster’s gene signatures was validated using multiplex fluorescence in situ hybridization (FISH) co-stained with piwi-1 and largely confirmed the cell clusters revealed by scRNA-seq.

We also tested sub-lethal irradiation exposure. To profile rare pluripotent stem cells (PSCs) and avoid interference from immediate progenitor cells, we determined a time point after sub-lethal irradiation (7 DPI) with minimal piwi-1+ cells, followed by isolation and single-cell RNA-seq of 1,200 individual cells derived from X1 (Piwi-1 high) and X2 (Piwi-1 low) cell populations (Sub-lethal Irradiated Surviving X1 and X2 Cell Population)



Explore this single cell expression dataset with our NB Cluster Shiny App



 

Neoblast Population

 

t-SNE plot shows two-dimensional representation of global gene expression relationships among all neoblasts (n = 7,088 after filter). Cluster identity was assigned based on the top 10 marker genes of each cluster (Table S2), followed by inspection of RNA in situ hybridization patterns. Neoblast groups, Nb.


Expression of SMED30009741 (SMED30009741) t-SNE clustered cells

Violin plots show distribution of expression levels for SMED30009741 (SMED30009741) in cells (dots) of each of the 12 neoblast clusters.

 

back to top

 

Embryonic Expression

Davies et. al., 2017

Hover the mouse over a column in the graph to view average RPKM values per sample.
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset

Embryonic Stages: Y: yolk. S2-S8: Stages 2-8. C4: asexual adult. SX: virgin, sexually mature adult.
For further information about sample preparation and analysis for the single animal RNA-Seq experiment, please refer to the Materials and Methods

 

back to top
Anatomical Expression

PAGE et. al., 2020



SMED30009741

has been reported as being expressed in these anatomical structures and/or regions. Read more about PAGE



PAGE Curations: 73

  
Expressed InReference TranscriptGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
nervous systemSMED30009741h1SMcG0013018 BK007043.1smed_ncbi_20240424PMID:20707997
Gurley et al., 2010		whole organism asexual adult fluorescence in situ hybridization evidence
cephalic gangliaSMED30009741h1SMcG0013018 BK007043.1smed_ncbi_20240424PMID:20707997
Gurley et al., 2010		whole organism asexual adult fluorescence in situ hybridization evidence
ventral nerve cordSMED30009741h1SMcG0013018 BK007043.1smed_ncbi_20240424PMID:20707997
Gurley et al., 2010		whole organism asexual adult fluorescence in situ hybridization evidence
nervous systemSMED30009741h1SMcG0013019 BK007043.1smed_ncbi_20240424PMID:20707997
Gurley et al., 2010		whole organism asexual adult fluorescence in situ hybridization evidence
cephalic gangliaSMED30009741h1SMcG0013019 BK007043.1smed_ncbi_20240424PMID:20707997
Gurley et al., 2010		whole organism asexual adult fluorescence in situ hybridization evidence
ventral nerve cordSMED30009741h1SMcG0013019 BK007043.1smed_ncbi_20240424PMID:20707997
Gurley et al., 2010		whole organism asexual adult fluorescence in situ hybridization evidence
head regionSMED30009741h1SMcG0013018 SmedASXL_009486SmedAsxl_ww_GCZZ01PMID:27034770
Currie et al., 2016		whole organism asexual adult RNA-sequencing evidence
gutSMED30009741h1SMcG0013018 tr5_785mu_Smed_v1PMID:25558068
Reuter et al., 2015		whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30009741h1SMcG0013018 BK007043.1smed_ncbi_20240424PMID:25558068
Reuter et al., 2015		whole organism asexual adult fluorescence in situ hybridization evidence
nervous systemSMED30009741h1SMcG0013019 BK007043.1smed_ncbi_20240424PMID:25558068
Reuter et al., 2015		whole organism asexual adult fluorescence in situ hybridization evidence
X1 cellSMED30009741h1SMcG0013018 SmedASXL_048867SmedAsxl_ww_GCZZ01PMID:26114597
Zhu et al., 2015		FACS sorted cell population asexual adult RNA-sequencing evidence
X1 cellSMED30009741h1SMcG0013018 SmedASXL_059563SmedAsxl_ww_GCZZ01PMID:26114597
Zhu et al., 2015		FACS sorted cell population asexual adult RNA-sequencing evidence
X1 cellSMED30009741h1SMcG0013019 SmedASXL_007365SmedAsxl_ww_GCZZ01PMID:26114597
Zhu et al., 2015		FACS sorted cell population asexual adult RNA-sequencing evidence
X2 cellSMED30009741h1SMcG0013019 SmedASXL_007365SmedAsxl_ww_GCZZ01PMID:26114597
Zhu et al., 2015		FACS sorted cell population asexual adult RNA-sequencing evidence
X1 cellSMED30009741h1SMcG0013018 SmedASXL_007365SmedAsxl_ww_GCZZ01PMID:26114597
Zhu et al., 2015		FACS sorted cell population asexual adult RNA-sequencing evidence
X2 cellSMED30009741h1SMcG0013018 SmedASXL_007365SmedAsxl_ww_GCZZ01PMID:26114597
Zhu et al., 2015		FACS sorted cell population asexual adult RNA-sequencing evidence
nervous systemSMED30009741h1SMcG0013018 BK007043.1smed_ncbi_20240424PMID:29557542
Han et al., 2019		whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30009741h1SMcG0013019 BK007043.1smed_ncbi_20240424PMID:29557542
Han et al., 2019		whole organism asexual adult colorimetric in situ hybridization evidence
Smed sexual biotypeSMED30009741h1SMcG0013019 Contig45128newmark_estsPMID:29674431
Fincher et al., 2018		FACS sorted cell population adult hermaphrodite single-cell RNA-sequencing evidence
Smed sexual biotypeSMED30009741h1SMcG0013019 Contig45128uc_Smed_v2PMID:29674431
Fincher et al., 2018		FACS sorted cell population adult hermaphrodite single-cell RNA-sequencing evidence
Smed sexual biotypeSMED30009741h1SMcG0013018 Contig45128newmark_estsPMID:29674431
Fincher et al., 2018		FACS sorted cell population adult hermaphrodite single-cell RNA-sequencing evidence
Smed sexual biotypeSMED30009741h1SMcG0013018 Contig45128uc_Smed_v2PMID:29674431
Fincher et al., 2018		FACS sorted cell population adult hermaphrodite single-cell RNA-sequencing evidence
Smed sexual biotypeSMED30009741h1SMcG0013018 Contig37956newmark_estsPMID:29674431
Fincher et al., 2018		FACS sorted cell population adult hermaphrodite single-cell RNA-sequencing evidence
Smed sexual biotypeSMED30009741h1SMcG0013018 Contig37956uc_Smed_v2PMID:29674431
Fincher et al., 2018		FACS sorted cell population adult hermaphrodite single-cell RNA-sequencing evidence
nervous systemSMED30009741h1SMcG0013018 dd_Smed_v4_1566_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018		FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cephalic gangliaSMED30009741h1SMcG0013018 dd_Smed_v4_1566_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018		FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
central nervous systemSMED30009741h1SMcG0013018 dd_Smed_v4_1566_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018		whole organism asexual adult fluorescence in situ hybridization evidence
neoblastSMED30009741h1SMcG0013018 dd_Smed_v4_1566_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018		FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
non-ciliated neuronSMED30009741h1SMcG0013018 dd_Smed_v4_1566_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018		FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cilated neuronSMED30009741h1SMcG0013018 dd_Smed_v4_1566_0_1dd_Smed_v4PMID:29674431
Fincher et al., 2018		FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
nervous systemSMED30009741h1SMcG0013018 BK007043.1smed_ncbi_20240424PMID:21566185
Wagner et al., 2011		whole organism asexual adult fluorescence in situ hybridization evidence
nervous systemSMED30009741h1SMcG0013019 BK007043.1smed_ncbi_20240424PMID:21566185
Wagner et al., 2011		whole organism asexual adult fluorescence in situ hybridization evidence
nervous systemSMED30009741h1SMcG0013018 BK007043smed_ncbi_20240424PMID:21566185
Wagner et al., 2011		whole organism asexual adult fluorescence in situ hybridization evidence
nervous systemSMED30009741h1SMcG0013019 BK007043smed_ncbi_20240424PMID:21566185
Wagner et al., 2011		whole organism asexual adult fluorescence in situ hybridization evidence
head regionSMED30009741h1SMcG0013018 dd_Smed_v6_1566_0_1dd_Smed_v6PMID:28171748
Stückemann et al., 2017		whole organism asexual adult RNA-sequencing evidence
nervous systemSMED30009741h1SMcG0013018 BK007043.1smed_ncbi_20240424PMID:24131630
März et al., 2013		whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30009741h1SMcG0013019 BK007043.1smed_ncbi_20240424PMID:24131630
März et al., 2013		whole organism asexual adult colorimetric in situ hybridization evidence
embryonic pharynx neuronSMED30009741h1SMcG0013018 BK007043.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017		whole organism Stage 4 colorimetric in situ hybridization evidence
embryonic pharynx neuronSMED30009741h1SMcG0013019 BK007043.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017		whole organism Stage 4 colorimetric in situ hybridization evidence
embryonic pharynx neuronSMED30009741h1SMcG0013019 DAA33932.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017		whole organism Stage 4 colorimetric in situ hybridization evidence
embryonic pharynx neuronSMED30009741h1SMcG0013018 DAA33932.1smed_ncbi_20240424PMID:28072387
Davies et al., 2017		whole organism Stage 4 colorimetric in situ hybridization evidence
embryonic pharynx neuronSMED30009741h1SMcG0013018 SMED30010096smed_20140614PMID:28072387
Davies et al., 2017		whole organism Stage 4 colorimetric in situ hybridization evidence
head regionSMED30009741h1SMcG0013019 OX_Smed_1.0.20218ox_Smed_v2PMID:24238224
Kao et al., 2013		whole organism asexual adult RNA-sequencing evidence
head regionSMED30009741h1SMcG0013018 OX_Smed_1.0.20218ox_Smed_v2PMID:24238224
Kao et al., 2013		whole organism asexual adult RNA-sequencing evidence
pharynxSMED30009741h1SMcG0013018 BK007043smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010		whole organism adult hermaphrodite colorimetric in situ hybridization evidence
photoreceptor neuronSMED30009741h1SMcG0013018 BK007043smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010		whole organism adult hermaphrodite colorimetric in situ hybridization evidence
cephalic gangliaSMED30009741h1SMcG0013018 BK007043smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010		whole organism adult hermaphrodite colorimetric in situ hybridization evidence
ventral nerve cordSMED30009741h1SMcG0013018 BK007043smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010		whole organism adult hermaphrodite colorimetric in situ hybridization evidence
central nervous systemSMED30009741h1SMcG0013018 BK007043smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010		whole organism adult hermaphrodite colorimetric in situ hybridization evidence
testisSMED30009741h1SMcG0013018 BK007043smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010		whole organism adult hermaphrodite colorimetric in situ hybridization evidence
copulatory apparatusSMED30009741h1SMcG0013018 BK007043smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010		whole organism adult hermaphrodite colorimetric in situ hybridization evidence
submuscular nerve plexusSMED30009741h1SMcG0013018 BK007043smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010		whole organism adult hermaphrodite colorimetric in situ hybridization evidence
pharynxSMED30009741h1SMcG0013019 BK007043smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010		whole organism adult hermaphrodite colorimetric in situ hybridization evidence
photoreceptor neuronSMED30009741h1SMcG0013019 BK007043smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010		whole organism adult hermaphrodite colorimetric in situ hybridization evidence
cephalic gangliaSMED30009741h1SMcG0013019 BK007043smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010		whole organism adult hermaphrodite colorimetric in situ hybridization evidence
ventral nerve cordSMED30009741h1SMcG0013019 BK007043smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010		whole organism adult hermaphrodite colorimetric in situ hybridization evidence
central nervous systemSMED30009741h1SMcG0013019 BK007043smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010		whole organism adult hermaphrodite colorimetric in situ hybridization evidence
testisSMED30009741h1SMcG0013019 BK007043smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010		whole organism adult hermaphrodite colorimetric in situ hybridization evidence
copulatory apparatusSMED30009741h1SMcG0013019 BK007043smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010		whole organism adult hermaphrodite colorimetric in situ hybridization evidence
submuscular nerve plexusSMED30009741h1SMcG0013019 BK007043smed_ncbi_20240424PMID:20967238
Collins JJ et al., 2010		whole organism adult hermaphrodite colorimetric in situ hybridization evidence
nervous systemSMED30009741h1SMcG0013019 DAA33932.1smed_ncbi_20240424PMID:22445864
Tu et al., 2012		whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30009741h1SMcG0013018 DAA33932.1smed_ncbi_20240424PMID:22445864
Tu et al., 2012		whole organism asexual adult colorimetric in situ hybridization evidence
nervous systemSMED30009741h1SMcG0013018 SMED30010096smed_20140614PMID:22445864
Tu et al., 2012		whole organism asexual adult colorimetric in situ hybridization evidence
pharynx musculatureSMED30009741h1SMcG0013018 dd_Smed_v4_1566_0_1dd_Smed_v4PMID:30471994
Scimone et al., 2018		FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
neuronSMED30009741h1SMcG0013018 dd_Smed_v6_1566_0dd_Smed_v6PMID:29674432
Plass et al., 2018		FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
cholinergic neuronSMED30009741h1SMcG0013018 dd_Smed_v6_1566_0dd_Smed_v6PMID:29674432
Plass et al., 2018		FACS sorted cell population asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30009741h1SMcG0013018 dd_Smed_v4_17071_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017		whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30009741h1SMcG0013018 dd_Smed_v4_1566_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017		whole organism asexual adult single-cell RNA-sequencing evidence
zeta neoblastSMED30009741h1SMcG0013019 dd_Smed_v4_17071_0_1dd_Smed_v4PMID:28292427
Wurtzel et al., 2017		whole organism asexual adult single-cell RNA-sequencing evidence
neuronSMED30009741h1SMcG0013018 BK007043smed_ncbi_20240424PMID:24737865
Adler et al., 2014		whole organism asexual adult colorimetric in situ hybridization evidence
neuronSMED30009741h1SMcG0013019 BK007043smed_ncbi_20240424PMID:24737865
Adler et al., 2014		whole organism asexual adult colorimetric in situ hybridization evidence
central nervous systemSMED30009741h1SMcG0013018 BK007043.1smed_ncbi_20240424PMID:21566195
Petersen et al., 2011		whole organism asexual adult colorimetric in situ hybridization evidence
central nervous systemSMED30009741h1SMcG0013019 BK007043.1smed_ncbi_20240424PMID:21566195
Petersen et al., 2011		whole organism asexual adult colorimetric in situ hybridization evidence
Note: Hover over icons to view figure legend
Homology
The following BLAST results are available for this feature:
BLAST of SMED30009741 vs. Ensembl Human
Analysis Date: 2016-08-08 (Schmidtea mediterranea smed_20140614 BLASTX Human e!99)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30009741 vs. Ensembl Celegans
Analysis Date: 2020-05-01 (Schmidtea mediterranea smed_20140614 BLASTX Celegan e!99)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30009741 vs. Ensembl Fly
Analysis Date: 2020-05-01 (Schmidtea mediterranea smed_20140614 BLASTX Drosophila e!99)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30009741 vs. Ensembl Zebrafish
Analysis Date: 2016-08-08 (Schmidtea mediterranea smed_20140614 BLASTX Zebrafish e!99)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30009741 vs. Ensembl Xenopus
Analysis Date: 2020-05-01 (Schmidtea mediterranea smed_20140614 BLASTX Xenopus e!99)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30009741 vs. Ensembl Mouse
Analysis Date: 2020-05-01 (Schmidtea mediterranea smed_20140614 BLASTX Mouse e!99)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30009741 vs. UniProt/SwissProt
Analysis Date: 2020-05-01 (Schmidtea mediterranea smed_20140614 BLASTX EMBL-EBI UniProt)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30009741 vs. TrEMBL
Analysis Date: 2020-05-01 (Schmidtea mediterranea smed_20140614 BLASTX EMBL-EBI TrEMBL)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30009741 vs. Ensembl Cavefish
Analysis Date: 2020-05-08 (Schmidtea mediterranea smed_20140614 BLASTX Cavefish e!99)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30009741 vs. Ensembl Sea Lamprey
Analysis Date: 2020-05-08 (Schmidtea mediterranea smed_20140614 BLASTX Sea Lamprey e!99)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30009741 vs. Ensembl Yeast
Analysis Date: 2020-05-08 (Schmidtea mediterranea smed_20140614 BLASTX Yeast e!Fungi46)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30009741 vs. Ensembl Nematostella
Analysis Date: 2020-05-08 (Schmidtea mediterranea smed_20140614 BLASTX Nematostella e!Metazoa46)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30009741 vs. Ensembl Medaka
Analysis Date: 2020-05-08 (Schmidtea mediterranea smed_20140614 BLASTX Medaka e!99)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30009741 vs. Planmine SMEST
Analysis Date: 2020-05-08 (Schmidtea mediterranea smed_20140614 BLASTX Planmine SMEST)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
Sequences
The following sequences are available for this feature:

transcript sequence

>SMED30009741 ID=SMED30009741|Name=SMED30009741|organism=Schmidtea mediterranea sexual|type=transcript|length=951bp
AAAATACCAAAATAAAAAGTCAGGATTGAGGAGGTTAAGGAAAAACATTT
ATTGCTAAATTTGTATTTTTATTATTTCTATATATTTGTTGACAATTTTG
GTAGGATGAAATTTGATTTATTTAAATCGACCGGCTCTTTTTTTGATTAG
AGAGCCAATCGATAACGTTGTGCAATTTTATTCCAGTTATCATTTATGAG
AATTGAAAAAACAAATGTAAATAACAGGCGGTCATACACATATTAGGTAC
GCACTGGGTGAGAGGGAATCATGTGAATTGTAACATTTAGCGTATAAGGA
AGGGATAGGGGTTATTGCAATCCGTACTTACGCAGAAAAATAGAATTAGT
ATACGCCATATTGCTATACATTCGCCTCTGCATCAATGCAGAATATATCA
TCCTTCTCAGTCCAGCTTGAAACGCCATCATCAAATTCGTGGAAAGAATT
ATACGGTTAAGTTGAAGACGTTGAAGTTATGTTCATGTTATCCTAGGTTA
TGACAAAATCAATTGACGTAAAACAGGGCAAAGAAATATCAGTTTGAATA
AATGCAAACAACATTTGAGTCTACTGCAAAATAATACTTTTTTATGTAAA
CGAAATTCTGGATTTTTAATTAAAAATAATAAGAAAAATGTCTTGTTTTT
AGGGGTTATAATATTTGAGATTTCTAAGGTAACCGCGTTACTTAGGTCAG
CTACTTCCATAAACGCATTTTGCTTGACTACTAACGCTCATGCTGGAATT
GTGCAAAGGCTTAGGAAATTAATGAGCATGTCAGCTAACTTTTTACTTAT
ACTCATCATTAATTTTCCTTTCTAAGTTCTTGACTTCCGATAGAAGGACT
TAAGTCTCTTAGGTTTCTCACATCATTCGCATTCCAAGTGCTATATATTG
TTTTGACCTGCCTTAGTCATAAAATATACTCAATTTCCAAGATCGGAAGA
G
back to top
InterPro
Analysis Name: Schmidtea mediteranean smed_20140614 Interproscan
Date Performed: 2020-05-01
IPR TermIPR DescriptionSourceSource TermSource DescriptionAlignment
NoneNo IPR availableMOBIDB_LITEmobidb-litedisorder_predictioncoord: 1..24