SMED30004152

Overview
NameSMED30004152
Smed IDSMED30004152
Length (bp)452
Neoblast Clusters

Zeng et. al., 2018




▻ Overview

▻ Neoblast Population

▻ Sub-lethal Irradiated Surviving X1 and X2 Cell Population

 



 

Overview

 

Single cell RNA-seq of pluripotent neoblasts and its early progenies


We isolated X1 neoblasts cells enriched in high piwi-1 expression (Neoblast Population), and profiled ∼7,614 individual cells via scRNA-seq. Unsupervised analyses uncovered 12 distinct classes from 7,088 high-quality cells. We designated these classes Nb1 to Nb12 and ordered them based on high (Nb1) to low (Nb12) piwi-1 expression levels. We further defined groups of genes that best classified the cells parsed into 12 distinct cell clusters to generate a scaled expression heat map of discriminative gene sets for each cluster. Expression of each cluster’s gene signatures was validated using multiplex fluorescence in situ hybridization (FISH) co-stained with piwi-1 and largely confirmed the cell clusters revealed by scRNA-seq.

We also tested sub-lethal irradiation exposure. To profile rare pluripotent stem cells (PSCs) and avoid interference from immediate progenitor cells, we determined a time point after sub-lethal irradiation (7 DPI) with minimal piwi-1+ cells, followed by isolation and single-cell RNA-seq of 1,200 individual cells derived from X1 (Piwi-1 high) and X2 (Piwi-1 low) cell populations (Sub-lethal Irradiated Surviving X1 and X2 Cell Population)




Explore this single cell expression dataset with our NB Cluster Shiny App




 

Neoblast Population

 

t-SNE plot shows two-dimensional representation of global gene expression relationships among all neoblasts (n = 7,088 after filter). Cluster identity was assigned based on the top 10 marker genes of each cluster (Table S2), followed by inspection of RNA in situ hybridization patterns. Neoblast groups, Nb.


Expression of SMED30004152 (SMED30004152) t-SNE clustered cells

Violin plots show distribution of expression levels for SMED30004152 (SMED30004152) in cells (dots) of each of the 12 neoblast clusters.

 

back to top


 

Sub-lethal Irradiated Surviving X1 and X2 Cell Population

 

t-SNE plot of surviving X1 and X2 cells (n = 1,039 after QC filter) after sub-lethal irradiation. Colors indicate unbiased cell classification via graph-based clustering. SL, sub-lethal irradiated cell groups.

Expression of SMED30004152 (SMED30004152) in the t-SNE clustered sub-lethally irradiated X1 and X2 cells.

Violin plots show distribution of expression levels for SMED30004152 (SMED30004152) in cells (dots) of each of the 10 clusters of sub-leathally irradiated X1 and X2 cells.

 

back to top


 

Embryonic Expression

Davies et. al., 2017




Hover the mouse over a column in the graph to view average RPKM values per sample.
Sort Descending | Sort Ascending | Only Non-Zero Values | Tile/Chart | Reset

Embryonic Stages: Y: yolk. S2-S8: Stages 2-8. C4: asexual adult. SX: virgin, sexually mature adult.
For further information about sample preparation and analysis for the single animal RNA-Seq experiment, please refer to the Materials and Methods

 

back to top
Anatomical Expression

PAGE et. al., 2020




SMED30004152

has been reported as being expressed in these anatomical structures and/or regions. Read more about PAGE



PAGE Curations: 86

  
Expressed InReference TranscriptGene ModelsPublished TranscriptTranscriptomePublicationSpecimenLifecycleEvidence
Smed sexual biotypeSMED30004152h1SMcG0008787 Contig14133newmark_estsPMID:29674431
Fincher et al., 2018
FACS sorted cell population adult hermaphrodite single-cell RNA-sequencing evidence
Smed sexual biotypeSMED30004152h1SMcG0008787 Contig14133uc_Smed_v2PMID:29674431
Fincher et al., 2018
FACS sorted cell population adult hermaphrodite single-cell RNA-sequencing evidence
Smed sexual biotypeSMED30004152h1SMcG0008787 Contig46004uc_Smed_v2PMID:29674431
Fincher et al., 2018
FACS sorted cell population adult hermaphrodite single-cell RNA-sequencing evidence
Smed sexual biotypeSMED30004152h1SMcG0008787 Contig46004newmark_estsPMID:29674431
Fincher et al., 2018
FACS sorted cell population adult hermaphrodite single-cell RNA-sequencing evidence
Smed sexual biotypeSMED30004152h1SMcG0008788 Contig5395newmark_estsPMID:29674431
Fincher et al., 2018
FACS sorted cell population adult hermaphrodite single-cell RNA-sequencing evidence
Smed sexual biotypeSMED30004152h1SMcG0008788 Contig5395uc_Smed_v2PMID:29674431
Fincher et al., 2018
FACS sorted cell population adult hermaphrodite single-cell RNA-sequencing evidence
Smed sexual biotypeSMED30004152h1SMcG0009013 Contig5395newmark_estsPMID:29674431
Fincher et al., 2018
FACS sorted cell population adult hermaphrodite single-cell RNA-sequencing evidence
Smed sexual biotypeSMED30004152h1SMcG0009013 Contig5395uc_Smed_v2PMID:29674431
Fincher et al., 2018
FACS sorted cell population adult hermaphrodite single-cell RNA-sequencing evidence
pharynxSMED30004152h1SMcG0008881 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004152h1SMcG0008881 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
epidermisSMED30004152h1SMcG0008881 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
intestinal phagocyteSMED30004152h1SMcG0008881 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
FACS sorted cell population asexual adult cDNA to DNA expression microarray evidence
pharynxSMED30004152h1SMcG0008787 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004152h1SMcG0008787 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
epidermisSMED30004152h1SMcG0008787 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
intestinal phagocyteSMED30004152h1SMcG0008787 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
FACS sorted cell population asexual adult cDNA to DNA expression microarray evidence
pharynxSMED30004152h1SMcG0008824 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004152h1SMcG0008824 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
epidermisSMED30004152h1SMcG0008824 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
intestinal phagocyteSMED30004152h1SMcG0008824 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
FACS sorted cell population asexual adult cDNA to DNA expression microarray evidence
pharynxSMED30004152h1SMcG0008880 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004152h1SMcG0008880 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
epidermisSMED30004152h1SMcG0008880 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
intestinal phagocyteSMED30004152h1SMcG0008880 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
FACS sorted cell population asexual adult cDNA to DNA expression microarray evidence
pharynxSMED30004152h1SMcG0008883 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004152h1SMcG0008883 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
epidermisSMED30004152h1SMcG0008883 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
intestinal phagocyteSMED30004152h1SMcG0008883 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
FACS sorted cell population asexual adult cDNA to DNA expression microarray evidence
pharynxSMED30004152h1SMcG0008893 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004152h1SMcG0008893 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
epidermisSMED30004152h1SMcG0008893 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
intestinal phagocyteSMED30004152h1SMcG0008893 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
FACS sorted cell population asexual adult cDNA to DNA expression microarray evidence
pharynxSMED30004152h1SMcG0008788 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004152h1SMcG0008788 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
epidermisSMED30004152h1SMcG0008788 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
intestinal phagocyteSMED30004152h1SMcG0008788 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
FACS sorted cell population asexual adult cDNA to DNA expression microarray evidence
pharynxSMED30004152h1SMcG0008881 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004152h1SMcG0008881 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
epidermisSMED30004152h1SMcG0008881 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
intestinal phagocyteSMED30004152h1SMcG0008881 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
FACS sorted cell population asexual adult cDNA to DNA expression microarray evidence
pharynxSMED30004152h1SMcG0008787 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004152h1SMcG0008787 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
epidermisSMED30004152h1SMcG0008787 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
intestinal phagocyteSMED30004152h1SMcG0008787 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
FACS sorted cell population asexual adult cDNA to DNA expression microarray evidence
pharynxSMED30004152h1SMcG0008824 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004152h1SMcG0008824 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
epidermisSMED30004152h1SMcG0008824 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
intestinal phagocyteSMED30004152h1SMcG0008824 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
FACS sorted cell population asexual adult cDNA to DNA expression microarray evidence
pharynxSMED30004152h1SMcG0008880 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004152h1SMcG0008880 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
epidermisSMED30004152h1SMcG0008880 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
intestinal phagocyteSMED30004152h1SMcG0008880 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
FACS sorted cell population asexual adult cDNA to DNA expression microarray evidence
pharynxSMED30004152h1SMcG0008883 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004152h1SMcG0008883 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
epidermisSMED30004152h1SMcG0008883 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
intestinal phagocyteSMED30004152h1SMcG0008883 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
FACS sorted cell population asexual adult cDNA to DNA expression microarray evidence
pharynxSMED30004152h1SMcG0008893 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004152h1SMcG0008893 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
epidermisSMED30004152h1SMcG0008893 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
intestinal phagocyteSMED30004152h1SMcG0008893 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
FACS sorted cell population asexual adult cDNA to DNA expression microarray evidence
pharynxSMED30004152h1SMcG0008788 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
gutSMED30004152h1SMcG0008788 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
epidermisSMED30004152h1SMcG0008788 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
whole organism asexual adult colorimetric in situ hybridization evidence
intestinal phagocyteSMED30004152h1SMcG0008788 Contig1645GPL15192PMID:23079596
Forsthoefel et al., 2012
FACS sorted cell population asexual adult cDNA to DNA expression microarray evidence
head regionSMED30004152h1SMcG0008788 SmedASXL_078386SmedAsxl_ww_GCZZ01PMID:27034770
Currie et al., 2016
whole organism asexual adult RNA-sequencing evidence
head regionSMED30004152 SmedASXL_078270SmedAsxl_ww_GCZZ01PMID:27034770
Currie et al., 2016
whole organism asexual adult RNA-sequencing evidence
head regionSMED30004152 SmedASXL_078391SmedAsxl_ww_GCZZ01PMID:27034770
Currie et al., 2016
whole organism asexual adult RNA-sequencing evidence
head regionSMED30004152h1SMcG0008788 SmedASXL_078386SmedAsxl_ww_GCZZ01PMID:27034770
Currie et al., 2016
whole organism asexual adult RNA-sequencing evidence
head regionSMED30004152 SmedASXL_078270SmedAsxl_ww_GCZZ01PMID:27034770
Currie et al., 2016
whole organism asexual adult RNA-sequencing evidence
head regionSMED30004152 SmedASXL_078391SmedAsxl_ww_GCZZ01PMID:27034770
Currie et al., 2016
whole organism asexual adult RNA-sequencing evidence
Smed sexual biotypeSMED30004152h1SMcG0008787 Contig20188uc_Smed_v2PMID:29674431
Fincher et al., 2018
FACS sorted cell population adult hermaphrodite single-cell RNA-sequencing evidence
Smed sexual biotypeSMED30004152h1SMcG0008787 Contig20188newmark_estsPMID:29674431
Fincher et al., 2018
FACS sorted cell population adult hermaphrodite single-cell RNA-sequencing evidence
Smed sexual biotypeSMED30004152h1SMcG0008787 Contig14133newmark_estsPMID:29674431
Fincher et al., 2018
FACS sorted cell population adult hermaphrodite single-cell RNA-sequencing evidence
Smed sexual biotypeSMED30004152h1SMcG0008787 Contig14133uc_Smed_v2PMID:29674431
Fincher et al., 2018
FACS sorted cell population adult hermaphrodite single-cell RNA-sequencing evidence
Smed sexual biotypeSMED30004152h1SMcG0008787 Contig14877newmark_estsPMID:29674431
Fincher et al., 2018
FACS sorted cell population adult hermaphrodite single-cell RNA-sequencing evidence
Smed sexual biotypeSMED30004152h1SMcG0008787 Contig14877uc_Smed_v2PMID:29674431
Fincher et al., 2018
FACS sorted cell population adult hermaphrodite single-cell RNA-sequencing evidence
Smed sexual biotypeSMED30004152h1SMcG0008787 Contig46004uc_Smed_v2PMID:29674431
Fincher et al., 2018
FACS sorted cell population adult hermaphrodite single-cell RNA-sequencing evidence
Smed sexual biotypeSMED30004152h1SMcG0008787 Contig46004newmark_estsPMID:29674431
Fincher et al., 2018
FACS sorted cell population adult hermaphrodite single-cell RNA-sequencing evidence
Smed sexual biotypeSMED30004152h1SMcG0008788 Contig5395newmark_estsPMID:29674431
Fincher et al., 2018
FACS sorted cell population adult hermaphrodite single-cell RNA-sequencing evidence
Smed sexual biotypeSMED30004152h1SMcG0008788 Contig5395uc_Smed_v2PMID:29674431
Fincher et al., 2018
FACS sorted cell population adult hermaphrodite single-cell RNA-sequencing evidence
Smed sexual biotypeSMED30004152h1SMcG0009013 Contig5395newmark_estsPMID:29674431
Fincher et al., 2018
FACS sorted cell population adult hermaphrodite single-cell RNA-sequencing evidence
Smed sexual biotypeSMED30004152h1SMcG0009013 Contig5395uc_Smed_v2PMID:29674431
Fincher et al., 2018
FACS sorted cell population adult hermaphrodite single-cell RNA-sequencing evidence
Smed sexual biotypeSMED30004152h1SMcG0008787 Contig20188uc_Smed_v2PMID:29674431
Fincher et al., 2018
FACS sorted cell population adult hermaphrodite single-cell RNA-sequencing evidence
Smed sexual biotypeSMED30004152h1SMcG0008787 Contig20188newmark_estsPMID:29674431
Fincher et al., 2018
FACS sorted cell population adult hermaphrodite single-cell RNA-sequencing evidence
Smed sexual biotypeSMED30004152h1SMcG0008787 Contig14877newmark_estsPMID:29674431
Fincher et al., 2018
FACS sorted cell population adult hermaphrodite single-cell RNA-sequencing evidence
Smed sexual biotypeSMED30004152h1SMcG0008787 Contig14877uc_Smed_v2PMID:29674431
Fincher et al., 2018
FACS sorted cell population adult hermaphrodite single-cell RNA-sequencing evidence
Note: Hover over icons to view figure legend
Alignments
SMED30004152 aligns in the following genomic locations:
Alignment LocationAlignment Score
v31.029299:1260..1723 +2010
v31.006456:26014..26477 +2010
v31.021898:2867..3330 +2001
v31.019293:6118..6581 -1965
v31.010341:25133..25562 +1867
v31.030677:3582..4015 -1828
v31.004941:188..758 +1540
v31.027119:3740..5126 -1523
v31.007780:4360..4933 +1509
v31.000592:163790..164329 -1488
v31.012120:10828..11465 +1484
v31.004340:28623..29216 +1464
v31.000451:74625..75196 -1445
v31.018041:7411..7950 -1436
v31.001956:48853..49455 +1435
v31.009641:10198..10777 +1429
v31.004941:8704..9180 -1426
v31.022098:3120..3665 +1397
v31.030973:2049..2735 +1394
v31.029781:5787..6195 -1377
v31.001658:54084..54544 +1366
v31.003389:1025..1654 -1355
v31.011589:9611..10070 +1350
v31.000464:32..511 -1338
v31.018536:5814..6269 +1335
v31.015859:11773..12460 +1331
v31.006475:16032..16706 +1313
v31.016085:6223..6884 +1310
v31.007113:18750..19206 -1302
v31.000467:93899..94507 -1302
v31.000467:89306..89914 +1302
v31.034655:978..1600 -1277
v31.006796:39433..39881 -1276
v31.000141:205829..206265 -1274
v31.028823:187..752 -1272
v31.001524:36804..37368 +1260
v31.003930:9811..10234 +1254
v31.011063:1304..1765 -1253
v31.002860:5647..6065 +1250
v31.017915:3865..4318 -1226
v31.027133:6945..7516 -1224
v31.028342:9015..9468 -1220
v31.000176:165887..166324 -1217
v31.001646:15389..15915 -1211
v31.027133:965..1523 +1205
v31.012881:10168..10718 -1196
v31.000451:72100..72660 +1195
v31.021971:7716..8163 -1194
v31.002205:51872..52314 -1186
v31.010353:5674..6385 +1184
v31.002454:4239..4736 -1181
v31.019550:13774..14396 -1178
v31.004200:1..346 -1178
v31.017421:15627..16177 -1174
v31.003708:46961..47455 +1172
v31.011770:239..750 -1171
v31.021710:7094..7607 +1167
v31.003708:49014..49587 -1167
v31.019637:9686..10222 +1160
v31.000622:138995..139520 +1156
v31.001295:19201..19761 +1150
v31.001252:13356..13908 +1150
v31.000860:84741..85188 +1140
v31.002575:18749..19204 -1137
v31.003241:19570..20102 -1127
v31.002149:75846..76287 -1122
v31.026333:3645..4085 +1105
v31.012540:19435..19821 +1080
v31.013077:16228..17002 -1069
v31.002205:53981..54510 +1023
v31.005332:63301..63824 -1014
v31.029781:5850..6304 -663
v31.000860:84768..85306 +599
v31.000410:25066..25663 +556
v31.002205:51911..52375 -521
v31.001658:53973..54429 +510
v31.001524:36854..37451 -503
v31.006796:39313..39831 -499
v31.018536:5932..6351 +492
v31.002575:18619..19132 +492
v31.000592:163991..164439 -489
v31.016085:6076..6636 +488
Homology
The following BLAST results are available for this feature:
BLAST of SMED30004152 vs. Ensembl Human
Analysis Date: 2016-08-08 (Schmidtea mediterranea smed_20140614 BLASTX Human e!99)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30004152 vs. Ensembl Celegans
Analysis Date: 2020-05-01 (Schmidtea mediterranea smed_20140614 BLASTX Celegan e!99)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30004152 vs. Ensembl Fly
Analysis Date: 2020-05-01 (Schmidtea mediterranea smed_20140614 BLASTX Drosophila e!99)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30004152 vs. Ensembl Zebrafish
Analysis Date: 2016-08-08 (Schmidtea mediterranea smed_20140614 BLASTX Zebrafish e!99)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30004152 vs. Ensembl Xenopus
Analysis Date: 2020-05-01 (Schmidtea mediterranea smed_20140614 BLASTX Xenopus e!99)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30004152 vs. Ensembl Mouse
Analysis Date: 2020-05-01 (Schmidtea mediterranea smed_20140614 BLASTX Mouse e!99)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30004152 vs. UniProt/SwissProt
Analysis Date: 2020-05-01 (Schmidtea mediterranea smed_20140614 BLASTX EMBL-EBI UniProt)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30004152 vs. TrEMBL
Analysis Date: 2020-05-01 (Schmidtea mediterranea smed_20140614 BLASTX EMBL-EBI TrEMBL)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30004152 vs. Ensembl Cavefish
Analysis Date: 2020-05-08 (Schmidtea mediterranea smed_20140614 BLASTX Cavefish e!99)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30004152 vs. Ensembl Sea Lamprey
Analysis Date: 2020-05-08 (Schmidtea mediterranea smed_20140614 BLASTX Sea Lamprey e!99)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30004152 vs. Ensembl Yeast
Analysis Date: 2020-05-08 (Schmidtea mediterranea smed_20140614 BLASTX Yeast e!Fungi46)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30004152 vs. Ensembl Nematostella
Analysis Date: 2020-05-08 (Schmidtea mediterranea smed_20140614 BLASTX Nematostella e!Metazoa46)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30004152 vs. Ensembl Medaka
Analysis Date: 2020-05-08 (Schmidtea mediterranea smed_20140614 BLASTX Medaka e!99)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
BLAST of SMED30004152 vs. Planmine SMEST
Analysis Date: 2020-05-08 (Schmidtea mediterranea smed_20140614 BLASTX Planmine SMEST)
Total hits: 0
Match NameE-valueIdentityDescription
back to top
Sequences
The following sequences are available for this feature:

transcript sequence

>SMED30004152 ID=SMED30004152|Name=SMED30004152|organism=Schmidtea mediterranea sexual|type=transcript|length=452bp
GAAACTATTTTCTTTGAATAAATTGGGTTTCATCCACAAAATTCTTTCGG
TCGCACTATAGTCAGGGGGTATTTTTGACTTTCGATAAAAACCATAAAAT
TAAAATTGACTCAATTTGCCTACGATGGTCATCCGCAAAATTATTTTTTT
TTGATCACACTATAGTCAGGAATAATTTTAACTAGTGAAGAAAAAACAAT
CAATATTTGGTTTCAATATTTTCTATAGGTAAATATAGACATAAAATAAA
AATGGCTTGAATCGCCTTCCGAATAAAAAATTGTCAGGGGTATTTTATAG
GCTTGTTAAAAAAACACTTGTAATATTTGGTCACACAATTTTCATGGGCA
AATTTAGACTTTATATAAAAATAAGTTAAAATACCTAAAGTAAATTAAGG
TAAATTAACGTAAATTAAGATACATTAGAGTACATTTAATTATATTACAG
TA
back to top
Annotated Terms
The following terms have been associated with this transcript:
Vocabulary: Planarian Anatomy
TermDefinition
PLANA:0000418head