Overview
Name SMED30004152
Smed ID SMED30004152
Length (bp) 452
Neoblast Clusters
Zeng et. al., 2018
Overview
Single cell RNA-seq of pluripotent neoblasts and its early progenies
We isolated X1 neoblasts cells enriched in high piwi-1 expression (Neoblast Population), and profiled ∼7,614 individual cells via scRNA-seq. Unsupervised analyses uncovered 12 distinct classes from 7,088 high-quality cells. We designated these classes Nb1 to Nb12 and ordered them based on high (Nb1) to low (Nb12) piwi-1 expression levels. We further defined groups of genes that best classified the cells parsed into 12 distinct cell clusters to generate a scaled expression heat map of discriminative gene sets for each cluster. Expression of each cluster’s gene signatures was validated using multiplex fluorescence in situ hybridization (FISH) co-stained with piwi-1 and largely confirmed the cell clusters revealed by scRNA-seq.
We also tested sub-lethal irradiation exposure. To profile rare pluripotent stem cells (PSCs) and avoid interference from immediate progenitor cells, we determined a time point after sub-lethal irradiation (7 DPI) with minimal piwi-1+ cells, followed by isolation and single-cell RNA-seq of 1,200 individual cells derived from X1 (Piwi-1 high) and X2 (Piwi-1 low) cell populations (Sub-lethal Irradiated Surviving X1 and X2 Cell Population)
Explore this single cell expression dataset with our NB Cluster Shiny App
Neoblast Population
t-SNE plot shows two-dimensional representation of global gene expression relationships among all neoblasts (n = 7,088 after filter). Cluster identity was assigned based on the top 10 marker genes of each cluster (Table S2 ), followed by inspection of RNA in situ hybridization patterns. Neoblast groups, Nb.
Expression of SMED30004152 (SMED30004152) t-SNE clustered cells
Violin plots show distribution of expression levels for SMED30004152 (SMED30004152) in cells (dots) of each of the 12 neoblast clusters.
back to top
Sub-lethal Irradiated Surviving X1 and X2 Cell Population
t-SNE plot of surviving X1 and X2 cells (n = 1,039 after QC filter) after sub-lethal irradiation. Colors indicate unbiased cell classification via graph-based clustering. SL, sub-lethal irradiated cell groups.
Expression of SMED30004152 (SMED30004152) in the t-SNE clustered sub-lethally irradiated X1 and X2 cells.
Violin plots show distribution of expression levels for SMED30004152 (SMED30004152) in cells (dots) of each of the 10 clusters of sub-leathally irradiated X1 and X2 cells.
back to top
Anatomical Expression
PAGE et. al., 2020
SMED30004152
has been reported as being expressed in these anatomical structures and/or regions. Read more about PAGE
Expressed In Reference Transcript Gene Models Published Transcript Transcriptome Publication Specimen Lifecycle Evidence Smed sexual biotype SMED30004152 h1SMcG0008787 Contig14133 newmark_ests PMID:29674431 Fincher et al., 2018 Smed sexual biotype SMED30004152 h1SMcG0008787 Contig14133 uc_Smed_v2 PMID:29674431 Fincher et al., 2018 Smed sexual biotype SMED30004152 h1SMcG0008787 Contig46004 uc_Smed_v2 PMID:29674431 Fincher et al., 2018 Smed sexual biotype SMED30004152 h1SMcG0008787 Contig46004 newmark_ests PMID:29674431 Fincher et al., 2018 Smed sexual biotype SMED30004152 h1SMcG0008788 Contig5395 newmark_ests PMID:29674431 Fincher et al., 2018 Smed sexual biotype SMED30004152 h1SMcG0008788 Contig5395 uc_Smed_v2 PMID:29674431 Fincher et al., 2018 Smed sexual biotype SMED30004152 h1SMcG0009013 Contig5395 newmark_ests PMID:29674431 Fincher et al., 2018 Smed sexual biotype SMED30004152 h1SMcG0009013 Contig5395 uc_Smed_v2 PMID:29674431 Fincher et al., 2018 pharynx SMED30004152 h1SMcG0008881 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 gut SMED30004152 h1SMcG0008881 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 epidermis SMED30004152 h1SMcG0008881 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 intestinal phagocyte SMED30004152 h1SMcG0008881 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 pharynx SMED30004152 h1SMcG0008787 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 gut SMED30004152 h1SMcG0008787 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 epidermis SMED30004152 h1SMcG0008787 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 intestinal phagocyte SMED30004152 h1SMcG0008787 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 pharynx SMED30004152 h1SMcG0008824 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 gut SMED30004152 h1SMcG0008824 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 epidermis SMED30004152 h1SMcG0008824 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 intestinal phagocyte SMED30004152 h1SMcG0008824 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 pharynx SMED30004152 h1SMcG0008880 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 gut SMED30004152 h1SMcG0008880 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 epidermis SMED30004152 h1SMcG0008880 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 intestinal phagocyte SMED30004152 h1SMcG0008880 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 pharynx SMED30004152 h1SMcG0008883 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 gut SMED30004152 h1SMcG0008883 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 epidermis SMED30004152 h1SMcG0008883 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 intestinal phagocyte SMED30004152 h1SMcG0008883 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 pharynx SMED30004152 h1SMcG0008893 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 gut SMED30004152 h1SMcG0008893 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 epidermis SMED30004152 h1SMcG0008893 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 intestinal phagocyte SMED30004152 h1SMcG0008893 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 pharynx SMED30004152 h1SMcG0008788 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 gut SMED30004152 h1SMcG0008788 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 epidermis SMED30004152 h1SMcG0008788 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 intestinal phagocyte SMED30004152 h1SMcG0008788 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 pharynx SMED30004152 h1SMcG0008881 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 gut SMED30004152 h1SMcG0008881 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 epidermis SMED30004152 h1SMcG0008881 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 intestinal phagocyte SMED30004152 h1SMcG0008881 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 pharynx SMED30004152 h1SMcG0008787 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 gut SMED30004152 h1SMcG0008787 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 epidermis SMED30004152 h1SMcG0008787 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 intestinal phagocyte SMED30004152 h1SMcG0008787 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 pharynx SMED30004152 h1SMcG0008824 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 gut SMED30004152 h1SMcG0008824 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 epidermis SMED30004152 h1SMcG0008824 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 intestinal phagocyte SMED30004152 h1SMcG0008824 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 pharynx SMED30004152 h1SMcG0008880 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 gut SMED30004152 h1SMcG0008880 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 epidermis SMED30004152 h1SMcG0008880 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 intestinal phagocyte SMED30004152 h1SMcG0008880 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 pharynx SMED30004152 h1SMcG0008883 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 gut SMED30004152 h1SMcG0008883 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 epidermis SMED30004152 h1SMcG0008883 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 intestinal phagocyte SMED30004152 h1SMcG0008883 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 pharynx SMED30004152 h1SMcG0008893 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 gut SMED30004152 h1SMcG0008893 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 epidermis SMED30004152 h1SMcG0008893 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 intestinal phagocyte SMED30004152 h1SMcG0008893 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 pharynx SMED30004152 h1SMcG0008788 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 gut SMED30004152 h1SMcG0008788 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 epidermis SMED30004152 h1SMcG0008788 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 intestinal phagocyte SMED30004152 h1SMcG0008788 Contig1645 GPL15192 PMID:23079596 Forsthoefel et al., 2012 head region SMED30004152 h1SMcG0008788 SmedASXL_078386 SmedAsxl_ww_GCZZ01 PMID:27034770 Currie et al., 2016 head region SMED30004152 SmedASXL_078270 SmedAsxl_ww_GCZZ01 PMID:27034770 Currie et al., 2016 head region SMED30004152 SmedASXL_078391 SmedAsxl_ww_GCZZ01 PMID:27034770 Currie et al., 2016 head region SMED30004152 h1SMcG0008788 SmedASXL_078386 SmedAsxl_ww_GCZZ01 PMID:27034770 Currie et al., 2016 head region SMED30004152 SmedASXL_078270 SmedAsxl_ww_GCZZ01 PMID:27034770 Currie et al., 2016 head region SMED30004152 SmedASXL_078391 SmedAsxl_ww_GCZZ01 PMID:27034770 Currie et al., 2016 Smed sexual biotype SMED30004152 h1SMcG0008787 Contig20188 uc_Smed_v2 PMID:29674431 Fincher et al., 2018 Smed sexual biotype SMED30004152 h1SMcG0008787 Contig20188 newmark_ests PMID:29674431 Fincher et al., 2018 Smed sexual biotype SMED30004152 h1SMcG0008787 Contig14133 newmark_ests PMID:29674431 Fincher et al., 2018 Smed sexual biotype SMED30004152 h1SMcG0008787 Contig14133 uc_Smed_v2 PMID:29674431 Fincher et al., 2018 Smed sexual biotype SMED30004152 h1SMcG0008787 Contig14877 newmark_ests PMID:29674431 Fincher et al., 2018 Smed sexual biotype SMED30004152 h1SMcG0008787 Contig14877 uc_Smed_v2 PMID:29674431 Fincher et al., 2018 Smed sexual biotype SMED30004152 h1SMcG0008787 Contig46004 uc_Smed_v2 PMID:29674431 Fincher et al., 2018 Smed sexual biotype SMED30004152 h1SMcG0008787 Contig46004 newmark_ests PMID:29674431 Fincher et al., 2018 Smed sexual biotype SMED30004152 h1SMcG0008788 Contig5395 newmark_ests PMID:29674431 Fincher et al., 2018 Smed sexual biotype SMED30004152 h1SMcG0008788 Contig5395 uc_Smed_v2 PMID:29674431 Fincher et al., 2018 Smed sexual biotype SMED30004152 h1SMcG0009013 Contig5395 newmark_ests PMID:29674431 Fincher et al., 2018 Smed sexual biotype SMED30004152 h1SMcG0009013 Contig5395 uc_Smed_v2 PMID:29674431 Fincher et al., 2018 Smed sexual biotype SMED30004152 h1SMcG0008787 Contig20188 uc_Smed_v2 PMID:29674431 Fincher et al., 2018 Smed sexual biotype SMED30004152 h1SMcG0008787 Contig20188 newmark_ests PMID:29674431 Fincher et al., 2018 Smed sexual biotype SMED30004152 h1SMcG0008787 Contig14877 newmark_ests PMID:29674431 Fincher et al., 2018 Smed sexual biotype SMED30004152 h1SMcG0008787 Contig14877 uc_Smed_v2 PMID:29674431 Fincher et al., 2018
Note: Hover over icons to view figure legend
Alignments
SMED30004152 aligns in the following genomic locations:
Homology
The following BLAST results are available for this feature:
Analyses
This transcript is derived from or has results from the following analyses
Sequences
The following sequences are available for this feature:
transcript sequence
>SMED30004152 ID=SMED30004152|Name=SMED30004152|organism=Schmidtea mediterranea sexual|type=transcript|length=452bp GAAACTATTTTCTTTGAATAAATTGGGTTTCATCCACAAAATTCTTTCGG TCGCACTATAGTCAGGGGGTATTTTTGACTTTCGATAAAAACCATAAAAT TAAAATTGACTCAATTTGCCTACGATGGTCATCCGCAAAATTATTTTTTT TTGATCACACTATAGTCAGGAATAATTTTAACTAGTGAAGAAAAAACAAT CAATATTTGGTTTCAATATTTTCTATAGGTAAATATAGACATAAAATAAA AATGGCTTGAATCGCCTTCCGAATAAAAAATTGTCAGGGGTATTTTATAG GCTTGTTAAAAAAACACTTGTAATATTTGGTCACACAATTTTCATGGGCA AATTTAGACTTTATATAAAAATAAGTTAAAATACCTAAAGTAAATTAAGG TAAATTAACGTAAATTAAGATACATTAGAGTACATTTAATTATATTACAG TA back to top
Annotated Terms
The following terms have been associated with this transcript:
Vocabulary: Planarian Anatomy
Term Definition
PLANA:0000418 head