category 5 cell



Overview

Post-mitotic, ciliated epidermal cells.

 

Category 5 cell

 

"CATEGORY 5 CELL" TERM REFERENCES

PMID:25017721

 

back to top


 

In Situ Hybridization Data

Smed IDAccessionNameAliasEnriched during stage(s)Tissue/PatternImages
SMED30024865Intermediate filament b-like proteinvim-3Stage 5, Stage 6, Stage 7, Stage 8Category 5 cell, definitive epidermis
SMED30030007RootletinH.2.8b, croccStage 5, Stage 6, Stage 7, Stage 8Category 5 cell, definitive epidermis, protonephridia

 

back to top


Sequences

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30002072 ID=SMED30002072|Name=Intermediate filament b-like protein|organism=Schmidtea mediterranea sexual|type=transcript|length=2324bp
CATAAATGGTGCACTTTTGAGAAATTTGCGTTGGAGTAAATAGAAAGCAGTCTTAACAAAAGGATAACTAGGTCAGAACA
ATAGCTGCGTTGAAAAATCTATTATAAATATATCCAACTTTCAACTTGTTTCTCTAAAGTTATTTTTGTAATAATGGAAT
CGTCTAAAAGAACTGTCATTACGACTTCTAAACAAGAAGGGCCGATTAGTGGCTCAAGTTCGGTTACTAGATCTGGAGTC
TCAATGACATCAGGTTCTGGTTCTACTTACGGATCGGGATCTGGAGGAGAATTGGGCTCAGGTTCAGGATCCGGCTCTGG
AAGTCGATATCAAAGTTCGTCTCGTGTTACTACAACAACTAGATCTGACTATCCACAATCTGGAAATGAAAGAGAAGACT
ATAATGAATCAGGAAGTCAACAATTCAATGAAGATGGATCAGAGATTTCTGGTCGAATCGTTTCAACTACCAGATCCATG
TATAAGCCAATAAGTCAATCAAGGAATAATTTCAAAGACTTGCAAAGAAATGCTGCATCTTTAAGTTATAGTATGCAGTC
TGGAAACCAACAAAGTGGTTCAGTTATGCCACTCATCAGAGGTGATAGTGTAGCCTTACAGACTGGACTGAATTCGATAA
AGAAAGGAAGAGCTCAAGAAAAAAAAGACTTACAAGAGCTGAATGAAAGATTTGCGAGTTATATAGAAAAAGCACGATTT
TTGGAAGAGCAAAATAAGCAATTAGTCGGTGAAATTGAAGAACTCAAAGGGGGAACTATTCAAGATACATCAAAAGTTAA
AGAGATCTATGAAGTTGAAATCAATCAACTCCGATCTTTACTAAACGAATCAGAGAAAAGTAGAGCACCACTGGAAATTC
AAGTGAATTCCTTGGAATACGAAATAGGCGATTTGCAAAAAAGACTGCTGCTATTAGAGGATATAGGTACACAGTATAGA
GCAACGATTGATAAACAGCGTCGAGAACTCGAGACCTTCGAAGGGGAAATGGTTGAATTGAAAAGGTTTAAAGACACTCG
AAGTATCGATGCTACAAAAGAAAAGGATGAAACAAGCAACTTAAGAGATGAAATAAAAAAATTAAGACAAAACTATGAAA
AAGAAGCATTAGCGCATATCACCCTTGAACATGACTTGCAGAGTTTGAGAGAAACTATGGAGTTCGAGAAACAAATCCAT
GCTACAGAAGTAAAAGAGCTGGCAACCGTTGCATATCAAAACCCAACGAAAGAAAACATGGTTTACTGGCAAAGTGAAAT
GGGACGTGCTTTACGGGACATTCAAACTGAATATGAAAACAAGCTTACAGGAATCAAACAAGAATTGGAGGCTTCTTATG
GTTTACAAATGCAGGAAATACGAACAAGTAAAACCAGAGACAATGTGGAAACGACCCATTACAAAGAAGAGAACAGCCGA
ATAAAATCTCAAATCCAAAGCATGAGATCGAGAATCGCTGATCTTGAGATGCAGAATGCTGAATACGAACACAACTTGAA
TAATATTCGTGCTAATTACGAAGAAACTCAAAGAAGTCTTGAATTGCAGTTGTTGTATTTGCAAGAGCAATTGACAGGAA
CTCAACAAGAATTGACAGTCGCTTTGACCGAACTCCAAAGCTTATTGGACGCGAAGTTGGGACTGGAATTAGAAATCGCA
GCCTATGCAAAACTATTAGAATTCGAAGAGAGTCGTGTCAATTTCTCTGGTGATGGCAACGCTACTTTATCTCAATTTAT
GAGTTTCACATCAAGTAGCGGAGCTGGAGGTGCTGGAGGGGCTGGAGGTGCTGGTGGTGCTGGAGGAGGAGGAGGAGGAA
GCAGTGGGTTCGGATCAGGAAGTAGAATTGGAGGGTCAAGTGGTTTCAGCGGAATGACAGAAAGAGAAACAACTGACTAT
CAGTCAAAACGAATGAAATTTAGACGAACGACAAAGGGAAACATTTCCATTGCAGAGACTGACCTTATAGGTTCAACAAT
TATTCTGGAAAATATTGGGACCAAAGTGGAATCACTCGAAGGTATGACTATTAAAAGAGTAGTCGACGGCAGCGAAAATA
AAATCTCATTTACCATTTCCGGAAAAGTTAACTTAAATGCTGGTGAAAAGATTTCTCTTTGTGCCAAAGGGAAAATAACC
GGCAAAGGACGAGAAATCGAAATTGATGATGCTTCATGGGGGGTTGGTAACAATGTCGTAACAACACTTTGTGATTCAGA
AGGAGCGGAAAAGGCAGCTCACTATCAAGAGGTTTCGGCCTAGAAACCTTGCTAAATATTAAACTGAATTTGTATGAACA
TAAC
>SMED30014019 ID=SMED30014019|Name=Intermediate filament b-like protein|organism=Schmidtea mediterranea sexual|type=transcript|length=768bp
AATTAGAAATCGCAGCCTATGCAAGGTTATTAGAAATTGAGGAAGAGCGAGTTTTAAGTTCCGCTGATCAACGTTCTGTG
ATGTCTCAATTTATGAGTTTTTCAGCTGGTGGTGGAGCTGGAGGTTCTAGTGGAGTTGGAGGATCAGGAGTTGGAGGATC
AGGATTTGGAGGATCTAGCTTTGGAGTGTCAGGCACCGGACGATCAGGCTTTGGAGTGTCAGGTACCGGAGGATCTATGG
GAGGAAGTAGATTTAGTGGAAGTCTAGGACTTGGGGGCGGGATTCATTCAAAAAAGATGTCTTCAAGAAGAACGACAACG
GGAAACATTTCTATTGCCGAAAGTGATGAATCTGGGTTATTTATTGTTTTAGAAAATATGGGAAGTCAGACTCAAAGTCT
ATCTGGCATGATGATTAAAAGAAACATAGATGGCGTAGCAAACTTTGTGACCTACTCAATTCCGAAGAAGATCGATCTAT
CCGCTGGTGAAAGAATAACAATTTGTGGACATGGAAAGAAAACAGGTAAAGGAAAAGAACTAGAAATAGAAGAAGATTCT
TGGGGATTTGGAGAAAACGTCATTACTGCGTTATGTGATGCGAATGGCGAGGAAAAAGCGGCTCTTTATCAAGAAATAGT
GGCTTAAATGGCATAGCCGAAAGACTTGCAAATTTAACCTTTTATTTAATGATTTCATTTAATGTTCCTCGCGTTCATTA
TTTGTTTGCTTCTTTCTAGATTAAAGTTTTAAATTTGTTGAAAAAAAA
>SMED30023882 ID=SMED30023882|Name=Rootletin|organism=Schmidtea mediterranea sexual|type=transcript|length=6811bp
TATAAATTTTAGCAATCCATATCAACTGATATGAGATTTTCAATTTCGCATTAATTTAAAATATTTATTCAAGTCACACA
TCTTAAATCTGGTTTTATAAGAATCATAATGAGTTCCGCAAATAGAGACGAGAGATTGGAACAAGTTGCACAAAAACTGA
ATAAATTTACAGATATATTTTACCAGAGAGTGGAAAATGTTTTAGCTGATAGAGACAATCAAGGATACTTAAAATACAAT
TCCGGACGAATTGTAAGCAATACATCTCCTGGCATCGGCGGTTTCGACCTGTCAAACGGCGATAAACCCCAAAAAATGCC
AGAAGTTGTTAAAGACATCATTCTGAGAGATTTTGGTGACACTGATGAGGATGAAGATTCCATAAAGGATTTACGAATGC
CAAAACCAAACTCTCAAAACACTCAGTCAAGCAGTCGCTTACAAACCTACGGCAACGGATTAGATTCCGTAACTCAACTA
AAAGCAGAAAATGCTACTCTTAAAGATAGCTTGTTTAATGTTGAAGAAGAACTGTTACGATTGAAAAATGAAAGAGATAA
TCTAGCAATTAAATTCAATGCCATAAATGAAAAACTCAACAAAACATTTACAGCGGAAAAATGTGGAGATAGAAGAGTGT
CTAATGCCAGCGAAGAACTTAGCAATGCGAATTCTTTAGCATCACAAACGATTCAATTGAGAAAACAACTTGACGACGAT
CATCGGGAGTATAAACGCAAACTTGCCGCCCAGCACGATCACCAGATTAAGCAGGCAGAATTAATTAAAAGACTCCAACA
AAAATTAGAACAACTCGAAGGTCGGAATGGCTTAGTGGAAAAATTAAACCAACAGAATAGTAAGCTACGGTCTGAAATAA
GTCGGTTAAAAAACCATTTCCAAACAACAACTTCGGATTTAAATCGTCGAATTGACATTGCGGAAAATCATCTGAAATCA
GCAGAAACCGATAAAAATATGGATCTCGAATCAGTGGTTAATGAATTGAAAGAGGAACAGTCAAAATCTATGAGTTTGTT
GCAAATGACAGCTTTATTGAGAGACCAATTAGACGAAGCTACAAATGCAAATCAAGGCCTAACAGAGGACGTTCAAAGAC
TGTCAGAAGAAAATAGTTTCTTGAAAAGCGAATTAGAACAAAAAGACATGGATTGGAAAGACGATGAAGCCACGTTTAGT
CGATTCTTGATTGGTGAACAGAATCGCATTAAATCTTTGTGGAATGCAGTTGTAAATTTTAAAAGACAATTCAATGACAT
TAAATCGTCAAATGAACGAGATTTGCATCAGTTACGGGTTAACATTGAACAATCTACTCAGTCGTTACGATTAGCTTGTT
CAAATCTTGACACGAATCACGTAAACAGGTTAAGTCAATTACAGTTCCAACTGGATACAGAAAAAAATAATTGCTCCCAG
TTAGAAAATTCTTTATCCAAAATGAAAGAAGAATTCCGAAAAACTGAAACTCAATATCAAAAACAGATTGAATCATTAAA
TGAGCAATTTGTCCACGTCAATCGCTCTAATGAAAGTCTAACGAAAGAGCTTGCTGATAAAGAAAAAGTCCTAACTACTC
TCCACAAATTAAGAAATGGCATGAATGGAGATTTAGACAATTCAATATACAACAATGATGATTCTGCTACCAGACAGTTG
ATTATTGACACTGATGCTGTTCATCAAGCATTAAGGGATATCGCTCAACTTGTTATGAATGATGTCGATCAAGTTGATGA
CTCTCCATGGATGCAAGATGATTATCTGGACGAATCCAAAACCACGGGACAACTGAAACCAACCCTATCCATAAATAGTT
TGCATTCAAATAGAAGTGTGAGCCCAACTCGCCCATCGAAACGTAGCCACTTCAACTCAGGATCTTTAGACAGAAATCGC
GTTTATCGAAATAAATCTCCAGTGAGTATTGCTGATTCAACATGTGCAGCTGTCAGATCGGCTTTACACAAACGAGCACT
TCAAGTTCAAGATTTAACCAGCAAAATCAATTCCGCAAAAAATAATCACAATAGCGTCAAAAAACAATTGGATGACAGTG
AAAACGAGCGCAGAAATTTAGAAAAACAATTCATTGAATTGCGAAGTGAATACGATTCAAATCATCGGGAACTGGACGAC
ATTCAACGGGAATGTGAACGGATGCGACATACAATTTCAATGCTGGAAGAAGACAAATTAAAGTTGGACAAAAGTCGAAT
GAATTCTTATGAAGAATGTAAATCATACAAACAAGACATGGAAAAACTAAAGACTCTTAATTACGAATTACAACGCGACA
AAGAAAATCTAACAGATAATTGTCAAGATTTAGATAGAAATCTAGAAAGACAAACGAAAGAAGTGGAGAGATTGACGAAA
TCAATTGAAAATTCCGAAAGTAAGAGTAGTCGACTGAAAGAAGAAATTTCTTCCCTTAAAGAATCTTTAAATCGGGCTTT
ACTTGAGAAAGAAGTTTTAGAACAAGAAAATTCAGTTCTCACAGATTCATTGAATAAGACCGAAGTTCTAAAAGCCGAAT
ACGAAGTTAAAGCAAACAAATTTAAAACGGAGGAAGCCAGACTTCGAGATAAATTCCATCAGTTGGAATCTATGAATCAT
TTCTTAGTCAAAGAAAATTCTGAATTCAAAACGATCATAGATCAAACGGAATCGGAAAAGCATCGGCTTTCTGGAGAGAA
AAAAGCCTTGGAACAAGAGAAATACGGCATCCGAGAGGAATTAATGCGGGTTGAAAATGAGAAGGAAGAATTGAATCAAA
TGAAAGATGGTCTTCATCAGTCTATGCAAAATGTTGAAAAATCTTATGAAAATTTACAAGATGAATTATCAAAATTAAAT
TATGAAAAAGGGCAATTAGAAACCGCTAATGTGACTTTACAACGGGAGCGAAATGCACTTTCAACAGAATTGCTCCAAGC
GAGACGAGATGCCGAGCGATTGTCAGCTGCTGTGCAAAAATCAATGAAAGATAAAGAAGTGCTAGCTAAAGAAAAAATCG
ATTTAATATCACAATTGACTACTTTTGAACACGAATTGAGAGAAAATGCGGACGCAATTTATGTTTTACAAGAAGAAAAA
GAACAACTTGATGGTTCACTCTATGAAAGCCAGCAAAACATTTCTCAATTGGAGGCTAAAATAGAAGCTCTCGAATCTAA
TTTGCAACAATTAGAAAGGAAAAGATCCATTATTTTTGACGAAAAACAACGATTGCAACATGAATTTGATGTAGAACTTC
AAAAACTTAGTAAAGCTAAAGAATCTTTACAAATAAAACTTAACGAATCCGAGAAAGAATGGAACAAAATTCTCCGATCG
GAAAAAGAAGCTCGCGAAGAAGACATTGAACGCTTGATTGCTGAGAGAGAAGAGCTTCGAAATGAATTCATGAAGTATAA
AGAAGAAATAAAGCTGCAATTTCAAGAGGAAATTGATGATTTGAGACATAGATTGAATAGAGATAAAGAGGAACTGGCTC
AAGAGATTATTACAATCCAAAGAGAAAGAGACGATTGTTTATTGGAAGCAGAAATGGGAAAACAGCACGCTATTAATTTG
CTGGAGCAGGAAAAAATGTCAATGTATGAGAAGATTTCCCAATTGACAGATCTACTCAGAACTTCTGAATCTGATCTAGA
GCGTACTCGAAATGAATGTGAAATTCGAGCCCAACAAGATCAAAATACAATTCAAACATTTAATGGCGATTTAAAGAAAT
TCCGTCTTCAATTTGAACAAATTCACATCGATCATGATCGGGAAATAAAAAATTTACAATGTGCCTACAAAGAACTTGAA
AATCAAAAATATCAAGATATGAGAGAAAATGAAGAATTGAAGTCACTATTGAAAATTGCAGAAGAAACAAGGGATAATTT
ACGACAAGATCTATCAGAGTCAATGGGGAAAATCAGAGAAACCGAAGACCAAAGGGAAAGATTGCGCCGGGAATTAATGG
ACGAAAAACGAAATTATTTCGAAGTGAAAAAAGAATTGGAAACTATTCAGTTGTCAAATAAGGAACTTAGAGAAAAATTG
AAAACATCTGAAATGCAAAAAATTGATATCCAAAGACAATTACAAGATTTACAAAATAAATTATCAATTCTTGAAGAGCA
GAAACAAGTGTTACAAAAAGAAGTAAAAGATACCAGATATAATTTACAGGATACTGAAAAAGCTCGAGTTGATGTTCGTC
GCGAATTGGAAGAATTACGAAGTCAGGTCAAGAAACTTGATACTGAACGTGGGAAATTGGTAAATGAAGTGAGCGGATTA
CAAGTGCGTGTAGCAACTGATGAAAATAAAGAAGTAGAAGCTAGACGAGAGAACTTTGGATTGAAACAGAAAGTAATAGA
ATCTGAAGCGACCAAAGAAGAATTATCTAAACAGCTTTATCAATCGCTTCGAAAGAATGAGGAACTTGAAGAAATTCTCA
ATTCCAAAGAGAAAACCACTAAACAATATTACGATGAAGTGTTAAAAGATTACAAGTCATTAGAAGAAAGTAAATTAAAT
CTCGAGAATCAATTGGAAATCACAAATCACAATTTTGAGGAATTAAATTCAACTTTATCTACTAAAGAAAATAGAATAAG
TCTTCTGGAAAATCAAATAAATATTTTGGATCAAAAGCGAAAAGGTGCAGAAAATCGGTTGGCAACTATACATAGTCATT
TAAGAAAACTGATTGGATTTCGTCAGCAAATTTGTCAGACATTAAGGAACAGATCTCCGAGTCCTGGCAGACGTTCTCGA
TCAGTGTCTCCTGAAAAAGGACGAGTTTCCAGTAGGAATTCTGTTGAATTTAATTTCTCTGAAGATCGTAAAAGAGTTGG
AAGATTTGGTGATGTGAATCAATATTCAGAATCTGTTATTCCCGGTTCTGATCTGGATCCAGAAGCAGTTCGGATAGCAT
TGAGAGACATTACTCAACACATTGTTTCCATAGAAAGAGAACGCGACGATATGGAAATCAAAGCTAAAAATTCCGCTTTG
AAAAGTGATGAAACATCGGTTCAGTTAGATCAAGCTTTACAAAGAATCAATCAACTGCAGAAAAACTTTGGAGAAGTTGA
AGAAGATAAAAAAGGAATTGATAGTAGATTGTCAAGCGCCCAGACTGCTCTGATGATGCAGGAGGAAACCATTCACAGAA
ATGAGCGCGAAAGAAAATCTTTGATTGATAAAGTTGGGAAACTCGAAAGACAATTAGCCCACGTAGAAACTGAAAAGAAA
TATTTACAAGAACGCGTTGATAAAATGAGAACAGGTGAATCCTATCACGAAGAAGAAAGAAGAGGTTTAATTAAAGCGGT
TGATGATGCAGAAAATAGATGTACACAATTAGAACTTCTGCGTCGAGGTTTGGAAGGTGAGTTGCAGAGACTGAAAATGG
GATTTAATGATAAAGAAACTGAAAACCAAGTCTTGAGGGATAGAGTAGATGCTCTAACAAAACAGATTTCCGATTTAGAA
TCTAAAGCTCAAAGTTTACAATTAACTATAGATAGATTATCAATGAATCTTGCAAGAACCGAAGAAGAGGAGAACACGCA
AAAAGATAAAGTTCACCAACTTAATCTTTCGTTAAGTGAACATCAAGGAAACCTTCAAAGTATGCAAGATAAATTAGTTC
AACTTCAGAGTACTTTGGCAAGTTCGGAACATGATCGAAGAGTGCTTCAGGAAAGATTAGAGTCTGTCAAACATAATTTA
TCAGAAGCTAAATCCCAAAATCATACTCTTGTGGATAGAATGAAGGCCACGCAGCAAGAATTGATGGAATCTGAATCCAG
GAAACACGAAATTGAAGGTGAAATAAAACGACTAAGCCAAATTCTTTCTCAGCGACAAGAAATTGAACAAGAACTTCAAT
CTAAAATTCATCGCTCAGCAATGGAGAAGAATTTGCTAACAGAAAGATTAAATAGTTTAACAGCTTCTCTTGCTGGCCTA
GAATCCGAAAGAAGAGATATTGAGAAAGTTCATATAAAAACTGAAAAAGAAAAGAATTCACTTAAAAAGACATTAGACAA
ACTTGAAAAAGAGAAAAATCGATCTGAAGAATCTATCAATCAATCACTTTTGAAACGCAGTGAATTCGATGAATTTACCC
GCCGGCTTGAGGATGAGAATGAAGTGCTACATCGACAAGTTCAAAAATTACAAAACCAATTGGCAGAAGCTGAACAGTGC
CATGCTCAAAGAATAATGGAATTAACTTCTCGAATAAAAAATGAAATGCTCTCTGAAATTGATAGACTAAAATCTGCTCT
AAATTCCACTGAAAAAACTCTACAGTTTCGAGAAAGATCGCACAGACAAAAAGTAAAAAGTTTAGAAGAACAGATTAACA
TTCTCAAAGATCAACTCTCACAGGAACTCAAAAAACGTGAATTGAATTTAAATAAATCCAATCGTGGCCTTAAAAATGAT
ATTTGTGATATTAAAAGTATTTTGGAAAAGAATTCTAACAACATCTCAAAAACATCATTTGACAACTTACTTTACGAGCC
AGAAATACGAAGGATGAAAGATATATTATCGGAATCTGGTTATTCTAACAACTGCAATGTAATATCCACTATGAAACAAT
CTCAGCGTCCTGGAAGTCGCCTACAAAGCAATTCACTGTCGCGTCAAAACATATCGTCCGCCAGTCCAACTAGAGCCAAA
AAGAAATTATAAATATCCAAATGAAACTTCAAATATTTCTTTACGAAACAGCACTTAACATAAGACGATGATTATTATTA
TTATTATTATT
>SMED30024865 ID=SMED30024865|Name=Intermediate filament b-like protein|organism=Schmidtea mediterranea sexual|type=transcript|length=2214bp
GATCTTATAAATACAACATTAATTGTATAGTGAACTATGTTAGCCATTGAAATGGAGACAAGTAAAAAAATCGCAGTCAA
AACTACGAAACAAGAAGTAAGTGGAAGTGGAAGCTCTGGTGGACTAAATGAACAACAAGCTTTTGGAAGTGGTAGCTTTC
GAACCGGGTCTGGAGGTGTACAGATAAGTGCTAGTGGAGCAATTGGATCTAGCAGTTCAGGCGGAGTTAGTGGCACTGGC
GGAGTTGGTAGCATTGGTGGAGGCAGTGGTGCTGGTGGTGAAGGAACAGGAGCTAGCACAGTTATCACTACAAGCAGATC
TTATTATAAGCCTATCAGTCAACCTAGAAATAATTTAAAAGACTTACAAAAAACTTCTGGTATGAGTTACAGTGCACAAT
CAAACTCCCAGCAAGGTTTAAGTAATATTCCATTGATTAGGGGAGACAGTGTTGCTCTACAATCTGGAGTAACTTCAATG
AAAAAAGGACGAGCTCAAGAGAAAAGAGATCTTCAGGATCTGAATGAAAGATTCGCTAGTTACATTGAAAAAGCTCGATT
TCTAGAGGCGCAAAATAAACAGCTAGCCAATGAGATTGAAAAGTTAAAAGGTGGAACCGTCCAGGACAACTCAAAGATCA
AAGAAATCTATGAAGTCGAAATCAATCAACTTCGAGCTTTGGTAAATGAATCGGAAAAAAGCAAAGCTCCTTTAGAAGCT
CAAGTTGATTCTCTTGAATACGAAATTGATGATTTGAGAAAACGATTAATGATGCTGGAAGACATCAACTCTCAGTACAA
ATCCACCATCGATAAGCAACGCAAAGACATTTCTGGATTTGAAGGGGAATTGGTGGAGCTAAGAAGATTCAAAGGCACCC
AAGGTGCTGATGTAAATAAAGAAAAGGAAGAAGTAAAAACACTAAGAGACGATTTGAAAAAATTGAGACAAGATTATGAG
AAAGAAGCTCTAGCTCATCTCACCCTTGAACATGAATTACAAAGCTTGAAAGAAGCATTAGAATTCGAGAAACAAATACA
TGACACAGAAGTAAAAGAGCTGGCAACCGTTGCATATCGAGACCCAACGAAAGAAAATATGGTTTACTGGCAAAGCGAAA
TGGGACGCGCGTTACGAGACATTCAAACTGAATATGAAAACAAGCTTACAGGAATCAAACAAGAATTGGAGGCTTCTTAT
GGTTTACAAATGCAGGAAATACGAACAAGTAAAACCAGAGACAATGTGGAAACGACCCATTACAAAGAAGAGAACAGCCG
AATAAAATCTCAAATCCAAAGCATGAGATCGAGAATCGCTGATCTTGAGATGCAGAATGCTGAATACGAACACAACTTGA
ATAATATTCGTGCTAATTACGAAGAAACTCAAAGAAGTCTTGAATTGCAGTTGTTGTATTTGCAAGAGCAATTGACAGGA
ACTCAACAAGAATTGACAGTCGCTTTGACCGAACTCCAAAGCTTATTGGACGCGAAGTTGGGACTGGAATTAGAAATCGC
AGCCTATGCAAAACTATTAGAATTCGAAGAGAGTCGTGTCAATTTCTCTGGTGATGGCAACGCTACTTTATCTCAATTTA
TGAGTTTCACATCAAGTAGCGGAGCTGGAGGTGCTGGAGGGGCTGGAGGTGCTGGTGGTGCTGGAGGAGGAGGAGGAGGA
AGCAGTGGGTTCGGATCAGGAAGTAGAATTGGAGGGTCAAGTGGTTTCAGCGGAATGACAGAAAGAGAAACAACTGACTA
TCAGTCAAAACGAATGAAATTTAGACGAACGACAAAGGGAAACATTTCCATTGCAGAGACTGACCTTATAGGTTCAACAA
TTATTCTGGAAAATATTGGGACCAAAGTGGAATCACTCGAAGGTATGACTATTAAAAGAGTAGTCGACGGCAGCGAAAAT
AAAATCTCATTTACCATTTCCGGAAAAGTTAACTTAAATGCTGGTGAAAAGATTTCTCTTTGTGCCAAAGGGAAAATAAC
CGGCAAAGGACGAGAAATCGAAATTGATGATGCTTCATGGGGGGTTGGTAACAATGTCGTAACAACACTTTGTGATTCAG
AAGGAGCGGAAAAGGCAGCTCACTATCAAGAGGTTTCGGCCTAGAAACCTTGCTAAATATTAAACTGAATTTGTATGAAC
ATAACAAAATTTTTAGTAATTTAATAAAAGTTTATTATTTTATAAATCCAAAAA
>SMED30026612 ID=SMED30026612|Name=Intermediate filament b-like protein|organism=Schmidtea mediterranea sexual|type=transcript|length=2359bp
TCTTATAAATACAACATTAATTGTATAGTGAACTATGTTAGCCATTGAAATGGAGACAAGTAAAAAAATCGCAGTCAAAA
CTACGAAACAAGAAGTAAGTGGAAGTGGAAGCTCTGGTGGACTAAATGAACAACAAGCTTTTGGAAGTGGTAGCTTTCGA
ACCGGGTCTGGAGGTGTACAGATAAGTGCTAGTGGAGCAATTGGATCTAGCAGTTCAGGCGGAGTTAGTGGCACTGGCGG
AGTTGGTAGCATTGGTGGAGGCAGTGGTGCTGGTGGTGAAGGAACAGGAGCTAGCACAGTTATCACTACAAGCAGATCTT
ATTATAAGCCTATTAGTCAACCTAGAAATAATTTAAAAGACTTACAAAAAACTTCTGGTATGAGTTACAGTGCACAATCA
AACTCCCAGCAAGGTTCAAGTAATATTCCATTGATTAGGGGAGACAGTGTTGCTCTACAATCTGGAGTAACTTCAATGAA
AAAAGGACGAGCTCAAGAGAAAAGAGATCTTCAGGATCTGAATGAAAGATTCGCTAGTTACATTGAAAAAGCTCGATTTC
TAGAAGCGCAAAATAAACAATTGGTCAATGAAATTGAAAAGTTAAAAGGTGGAACCGTCCAGGACAACTCAAAGATCAAA
GAAATCTATGAAGTCGAAATCAATCAACTTCGAACTTTGTTAAGTGATTCTGAAAAAAGCAGAGCACCCTTAGAAGTACA
AGTTGATTCTCTTGAATACGAAATTGATGATTTGAGAAAACGATTAATGATGCTGGAAGACATAAACTCTCAGTACAAAT
CCACCATCGATAAGCAACGCAAAGACATTTCTGGATTTGAAGGGGAATTGGTGGAGCTCAGAAGATTCAAAGGCACCCAA
GGTGCTGATGTAAATAAAGAAAAGGAAGAAGTAAAAACACTAAGAGACGATTTGAAAAAATTGAGACAAGATTATGAGAA
AGAAGCTCTAGCTCATCTCACCCTTGAACATGAATTACAAAGCTTGAAAGAAGCATTAGAATTCGAGAAACAAATACATG
ACACAGAAGTAAAAGAGCTGGCAACCGTTGCATATCGAGACCCAACGAAAGAAAACATGGTTTACTGGCAAAGCGAAATG
GGACGCGCGTTACGAGACATTCAAAATGAATATGAAAACAAGCTTACAGGAATCAAACAAGAATTGGATTCGTCATATGG
CTCACAACTGCAGGAAATACAAACAAGCAAGACCAGGGATAATGTGGAAACGACCCATTACAAAGAAGAGAACAGCCGGG
TAAAATCTCAAATCCAAAGCATGAGATCGAGAATCGCTGATCTTGAGATGCAGAATGCTGAATACGAACACAACTTGAAT
AATATTCGTGCTAATTACGAAGAAACTCAAAGAAGTCTTGAATTGCAGTTGTTGAATTTGCAAGAGCAATTGACAGGAAC
TCAACAGGACTTGACTATTACTTTGACCGAACTCCAAAGCCTATTGGACGCCAAATTGGGACTGGAATTAGAAATCGCTG
CATACTCAAAGTTGTTAGAATTCGAAGAGAATCGTGTTAATTTTTCATCAGATGGTAACACATCACAATTTATCAGTTTT
TCATCTGGCGTGGGAGCTGGTGGTGTAGGAGGAGGATCAAGTGGAGGGTCAGGTAGAGGATCAGGTGGAGGGTCAGGTGG
TGGGTCAGGTGGTGGATCAGGTGGAGGATCAGGTGGGGGATTTGGAGGTGGAGCAGGATTAGGATCAGGCGGAGGAGGAG
GATCAGGAAGTGGGTCTGGTGGAGGCGCAGGTGGGGCTGGTTCTAGTATTGGAATTGGAGGTGGGGGCAATTTTGTAGGT
GGTTCTCTGAGATTTAACATTAATGAATTGAGCAGTACAGAGGCTGAAGAATACCAATTGAAAAGAATGAAGTTCAGACG
AACAACTAAAGGAAACATATCAATAGCAGAAGCTGACATCAATGGACTGTTTATAGTTCTAGAGAATAACGGAACAAAAT
TTGAATCTTTAACTGGAATGACGATTAAGAGAAATATTGATGGGAATGAGGATGCGGTTTCATTCACCATTCAAAACCGA
ACAAGTTTGAGTTCTGGAGAAAAACTAACTATCTGGGCCAAAGGAAAGAAAACTGGCAAAGGAAAAGAACTTGAAATAGA
AGAAGACGGCTGGGGGCTGGGGGATACTATTGTGACCTCTTTATACAATGCGGAAGGAGAAGAGAAAGCGGTCCATTATC
AAGAAATACAGGGTTGAGCAGGTGCTCACTTAAGACTGACTTGAAATTTATTTGTTTAAATAATACTTTCAATAGGGATT
TTAATGCTAATAAAAAGTATTTAAACTATTAAAAAAAAA
>SMED30030007 ID=SMED30030007|Name=Rootletin|organism=Schmidtea mediterranea sexual|type=transcript|length=6612bp
GTTGTTTTTAAATCACTATTTTTTTTATTTCATCTGATTATAATTTTTTTTTATTGAAATTTGTATTTTGAAATTGGTGA
ACAATGAGTGAGATAGATTATTCCGCTATTGTTCGGAGACGCATTGGAGATATCGATGGGGATTCAAGTGAAGATTCCAG
TTCAAAGGGTTTGCTTCAAGTTAACTTGGAACTGAGAAAGCGCTTAGAGGAAGAACACAATGAGTATCGTAGAAAGCTGA
TAGTTTTCCAAGACAGCCAACAGAAACAAGCGCAATTGGTTCAAAGATTGCAGAAAAAGGTATTGCAATACAAAGAAAAA
TGCACGGAACTTGAATCTAAAATGCAATTTGGCGATTATGAGACTCGAAAAACGAAGTATGGAAGTCCAACGAATAACGG
CTATGGGTCGCGTAGTGAGAATCCCTACGACAATCTGGATTTGGAGAGCACACTCATTAAGTTAGAAGAGGAACAAAAAA
AAACAAATTATCTAACGGAGTTCAATGAACGGCTTCAAGAACAATTAACTCAAGCAACTCAATCAAACCAGAATTTGACG
AGAGACATCAGTAAGCTTTCCGAAGAATGGCAGAGATCAAGGGAGGAGCTTGAACAGAGAGAAAAAATTTGGCGAAATGA
AGAAATGTCATTTAATGACTATTTAGCATCTGAGCATTCGAATCTGCAAAATTTGCAACGCAATACGATAAATTTCCGCC
GTCAATTTATAGAATTGAAAGCTTCAACTGAACGGGAAATAAATAATTTGAAAAATGAATTCAACCGACAGGCACGCTGT
TTGCAAACTGCTTGTTCCAATCTTTCGTGCAACATGAAATCTGCAGAATCTAAACAACAATTGAGTACTGAACGAGAAAG
TCGGGACAAGTTGAATCTCGAAAATCAACTGCGAGAAAAAAACAGAGAATTAACTGATTACCAAACTCGGTATGAATGTG
AAATGACAGAATTGCAACACCGAGTGAAAGAATTAACAGTTCTCAGTGACAAACTGAAAATTCAAAACCTGGAAAAGGAT
CGAGCATTGACAGCTTTGCAAAGAATTAAGAATGGAGATACCGCAGGAGAAATAAATATGGAAGACAAAGCTACAAGAGT
TCTTATTGAAGACACAGAAAGTATGCATCAAGCACTTCGAAATATTTCTCAAGTAGTACTAAATGATTCTGACTATTTCG
ATGCAGAAGACACAGGATTTGAAACAGTTCGAAAGAATAATCGTTCGCCAAGTCCAAGGAGAAATCGTAGCGTCAGTCCT
AACTCAAGATCAGCTAAAACACCGCCATTTGCCGATGCAACGTATGCGGCGGTTCAGTCGGCTATAAATAAAAAATCTCT
ACAGATTCAAGAGCTTAAATCAAAATTAAACAGTTCTAAAGAGAGTTGTACAAACTTCAAAAGACAAATTGATGACAATG
AAAATGAACGTCGACGATTAGAGAATCAAGTTCTCGCCATGAGAGATGAAATTGAAAGTTTACGACGAGATAAAGATGAT
AGTTTTAGAGAAGCGGATCGGTTTAAAAATGCTCTGAACATCACTTCAAATGAACGAAGCCAATTGGAAAAGATTCGATC
ATCACTAAACGATCAAATTGAGCAGCAACTCACAGAAATTGAACGACTTAAGTCAGCCAATCACGAATTACAACGATTGA
GAGAGGCATTGGAAGATGAGCAAGAAGATACTAAAAAAGACTTAGAAAGACAAATTAAAGAAAGTGAAAGATGCCAACGA
TCGATTGATGTTTTGGAAGATAAAATAAGTCGATTTAAAGAAGACGTAGTTAATTACAAAGAGGCAATTAATAAATACCA
ATTAGAAAAAGAAGTATTGGTGCAAGAAAAGGATGAGATTGGTGATGCTTTAAGTCGTTGTGAAATTTCTAAAGCCGAAT
TAGAAATCGAGGTGAATAAACGGCAAACTATTGAAGTAAATTTGGAAGAAAACATTTCAAAATTATCCTCAGAAATCGAA
GAATTGAATGATAAGCGAGCTGAAAACCACAGAACTATTAAACAGCTGGAACATGAAAGAAGTTCTCTTTTGAATGAAAA
ACGATTTTTGGAACAAGAAAAAAGTGGTTTGAAAGATGAGCTTGTTCGATCTGAACAAGAGGCTCTTGGTTTGTCAAATG
AGAAAGCCATTCAACGTCAAAGAATCGAACAACTTGAAATTAATACAGAAAGATTAGAAGAAGAGTTATCGGAACTCAAT
CGAGAAAAGCTAGATCTTACTGAACAAATAGGCTGTTTGCAGAGGCAGAAATCGGCTCTTGCAGAAGAATTGTTGCAATG
TCGTAGAGAATTAGAACGATCTAATAACAGTGTCAACAACTTATCAAAAGAAAAGGAATATCTTACCAAAGAGAAAGGAG
AACTCGTCGTTCAAGTTACAGCTTGCGAAAGGGAAAATCGTCAACAGTCAGAAGTTATTGCTTCTTTGAATTCCGATAGA
GAACAACTGGAAGCTACTCTTTATGATGCTCAACAATTAATCATTCAGTTGGAAACTCGAAAAGAGCAATTAGAAGGCGA
AAACCAAGAGTTGATTGTGAAAAAAGAAAATCTAAATGGAGAACTAGTCAGATTACGACAAGAGTTTCAACTAGAATACG
AGAAGGTTGTTAATTCACGAGAACAATTAAATTGCAGATATCAACAAATGGATAAAGAATATAAGATGGCAATTCAACAA
GAGCGAGATTCTCATGCTGAAGATGTAGAAAGACTAACTAAGATAAACGAAAGCAATCGTCATGGATCTGAAAACGAACG
AGAAGAGCTTATTCATCGATTCAATATGGAGCGTGACGACATGATTCAAAATTACGAACAAGAGAAACAAGAAATGGCCC
AGGAAATCATGACGATCCAACGAGAACGAGATGACTCATTATTAATGGCGGAAAATGAAAAGCAGCAATCATTGAGTTTA
TTAGAACAAGAAAAATGTGCAATCAATGAAAAGCTTATCAAAACGCAATTTGAACTGCAATCGGTTGAGTCGGAATTGGA
TCGCATTAAAAAGGAGTCGTCCAATCGTCAGGAGCAAGACAAACAGAACATTGCCGGCTTGTCGAGTGAACTCAAATCAT
TTAGATCTCAATTTGAGGATAAATGCCAAAATCACGAAATGGAAGTTAAAAGCCTAAATAGTGGAATCAAGGATCTAACA
TTAATGAAAGATCAAGCTCTCAAAGAAGTCCATGATTTGCATACCGGATTAAAAATAGCTGAAGAAACCCGTGATAATTT
GCGTCGGGAAATCATGGAAATGAATCGGAAATTGAAAGAAGCTGAGGAAGCCAAAGAGCACTTAAAGCGTGAAATTAATG
AATTGAAACGTGGATTATGCGAAGAACAAAGGGAAAAAGAAAATGTTATTAACTCAAATGAGAATTTGAGAAAGAAAATT
AAAGATGTTGAAACAGAAAGAATTGATTTGCACAGACAAGTAACGGATTCCAAACAAAAGGTTGCAGTACAAGATGAACA
ATTGGTCAATTCCAAACAAGAGGTCAATGAGTTAAGAAACAATCTTAAAGACGTAGAAAAAGCTCGATTAGATGTCAAAA
GAGAGTTACAAGAACTCAGACGCCATATCAAAGAGCTAGATACGGAAAGGGGCAAATTGACTAAAGAAGTCAATGATTTG
CAAACTCGTGTTGCTAGAGATGAAGAAAAAGAGGATGAAGCTCGTCGGGAAAATTTCGGTCTCAAACAAAAAGTTGTTGA
AACGGAAGCTTCAAGAGAAGCCGTTCGTAAAGATCTTGCTAATGCTCAACGACATATTGTTGATTTGGAAAATGTTCTGC
AGAGCAAAGACAGAGATTTCAGTTCCATGGTGGAATCGAGCCGCCGGGATTATAGGAAACTTGCTGATGCGAGAAATAGC
CTGCAACAAGTATATGATACGATGGTGGCCGATAATAATGAGCTGAGAATTGCTCTCAGTGGAGCAGAAGGTCGGGTCAG
TGCTCTGGAGTCACACATCGCACGAGTTGAAGGAGCTAAGAAAGAAATTGAATTCAAATTGGCTTCTATCCATAGCTCAT
TGCGAAGGCTGATAGGATTCCGACAGGAGAATGTAGTTACTATTCGGTCGAGAAACAACTCCAAATCTCCAGTTAGAGGT
CGATCAGTTAGTCCTCTTAGAAGTAGGCCGGTGTCGCCAACCAAAGGATTTGACAATACCTATGCTACTACAACTGATGG
AAAAGGTAGCCCTATCCCGCGCACAGGGTCTCCGAGTTCTAAACGAAGGCAATTATCAAGATCTCCGTCTAATTGCGATT
TCAATCCAGTCGATATAAATCCAGAAGCAGTTCGTCTGGCCTTGCGAGAATTCGTACAGCAGTTGGTTGATGCTGAACGA
GATAGAGATGACGCTTTTGCTCAAGCTCGCAGCCTAGAATCTCGATTGAAAGAACAAGAAGAACAAAATGAATATGCTGA
AAACCGTTTACAACAACTACAACAAGCTCTGTGTGATGCAGAAGAAGACAAAAAAGGCATTGATGGAAGATTGTCATCAG
CCCAAACTGCCTTAATGATGCAAGAAGAGACTATTCGGCGCAATGAGAGAGATAGAAAAGCAATGGCGGAAAAGTTGAGT
AATTACGATAGAACATTTGCATCCATGGAATCAGAAAAACGACAATTGGAAGATCGGTTGAATAAATTCCGTCATCATGA
TGCCCGATTGGAAGAAGAACATAAGCAGAGCAAAAAAGCTATTGAAAATGCTGAAAATAGAATAACTCAGCTTCAGCTTG
CCAAGCGATCGTTAGAAGGAGATCTTCAAAGAATGAAAATGGCGTTGACAGATAAAGAAACAGAAACCGAAGTTTTGGAT
GACCGCGTAAATAGTTTACTCAAACAAATACAAGATCTCGAGGGAAAATCTCAATCACTTCAACTAACGATTGACAGAAT
GAGTGTCGCCCTTGCAAAAACTGAGGAAGAAGGCAGTTTTCATAAGGACAAAATGCAACAGTTGAATATGAGTTTGAGCA
CTCATTCACAACAACTGGAACAATTACAGAATAAGATTTCTCAATTACAAAAAGCACTCGGCAGTTCAGAACAAGATCGT
CGGCTCTTAGAGGAACGATTAGAAAGCTCTAAAGGAGCATTGCATGAGGCAAAACATCAAAATAATTTGTTGATGGAAAG
AATACAAATAATTCAATCCGATTTAAATGATTCGGAAAATCGTCGATCAGAATTGGAAGGATTAAATCGACAGAGTAACA
CTTTGATTGTACAAAGACAAGAAGCTGAACAAGAACTCAATCAAAAATATCAGAAATTGAACTCGGAGAAAAACACATTA
CAAGAGCGAGTGAATAGCATGCAACGAAATTTGGCTTTGGCAGAAGCAGAAAAACAAGAAATAATAAAAAACCACGGAAA
ATTGGAAAAGGATAGATCTGCCTTGAAAAAGAGTCTTGGAAAAGTTGAACGTCAGAAATTGAAAACCGAAGAAATTGCTA
GCAAAACTGTTTTTGAACGTTCAGAATTAGATCAAATTTTAAGGAGACTTGAAGATGAAAATTGTGAATTACAGAGACAA
GTTGGAATTCTTCAAAATCAATTAGCAGAAGCTGAGCAAGCTCACTGCCACCATTTGATGGAAATCAATTCCCGCCATCG
CCAGGAAATGTCCATGGAAATGGAGCATTTGAGAGCATCGAATGTTCAAATAGAACGAACTCTAGAAGGCAGAGAACGAG
CCCACAGACAAAGAGTTAAGGGTCTGGAAGAACAGATCTCCACCCTCAAAGACCAGCTGACTCATGAAATGCAGAGGCGG
ATGGATAGTGGATATTACGAGTCTACCAGAAAGTCTAATCAATACGATTCAACTGGTGACTTGCGACATGTTCTGGATTC
CAGTTTAACTCGAGTTGCAAAAGACCCTCAACTGGACGCAATGCTACTGGAAACCGAAGCCAGGCGACTCGATGAGTCGA
TATTCATGTGTGGCAGTCGTGATCAGTCTCCGACCCGGCAGAAGCGAATCGAAATGTCAAAGAAGTCCGCAGCCCCTAAC
AATTCCAATCGGCGATTAACTGCCGGCCGTCGCAAATGAACTCGGCCTGTTCCAGTCCGTCCAGAGATGTTATGAAGCCA
CTTTTTAGATGCGTGAGTGTGAGTTCGTGTTGGTGACTGATTCATTTTTAGTAAACAGATTCTGGATTTTTGTTTTTATT
GATAGTGTAATTTCCTAATGCAGATCTGATAGTTGACTTGTTGTTCTTACGTATTCGGTATTTGTGATTCACATAGTCTG
TCATTGTTACTGTGATTTATCCTCTGTGTGACTTTTGTGATTTACTTACTTTATTGCCCCTATAATCAATAAATGGATTT
ATCGATAGTTCAGCCCTCCCCTCCAGCCCTCGTTTTGGGATCCGTAAATTTTGTTTCAATTGAGATCATTATAGTGATTT
TATTCCTTCGAAACCAAACCTTTGGGAGGGACATAAAATTAAATTATTGATTTTTTATTATCTTAGAAGTGAAAGATGTT
TATTTCCCAAATTAACTAATATCAATAATAACTTTAATTTATATCTTCATTA

 

back to top