category 4 cell



Overview

Post-mitotic, mesenchymally and epidermally located progenitors downstream of the Category 3 cells.

 

Category 4 cell

 

"CATEGORY 4 CELL" TERM REFERENCES

PMID:25017721 , PMID:26457503

 

back to top


 

In Situ Hybridization Data

Smed IDAccessionNameAliasEnriched during stage(s)Tissue/PatternImages
SMED30030681SMED30030681ZPUF-6Stage 5, Stage 6, Stage 7, Stage 8Category 4 cell, epidermal progenitor

 

back to top


Sequences

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30030681 ID=SMED30030681|Name=SMED30030681|organism=Schmidtea mediterranea sexual|type=transcript|length=732bp
TATGGATATACATATAATAAAAAGATTCTTCGTTTTTCTCAAGCTTCCAAGTTATAGTTTCGTAGTTTTAAAAAAAAAAT
TATTATACCCTATTACTAAACAAATAAAATTTTAATTATCTCAAAAACGAAATCCACATTTTAAAAAGCTATGTTTTTAT
AAATTTTGTGCACTTTCATTCGATCACATTTTCCATATCTCTGATAGATCGGATCGCATCTCAAGTGCAATTGATGTGCT
AATTTGTCGCATCTGTGATCGATAATTTCGAATTTTCTGTAACACCATTTTCTGATGACCCGGATACCTTGATCGAGTTT
GGCGTACAAATTATCAATCTCTATTCGACATGACTCAGTTTGAACGTCAACGCATTTGTGATTTGCGATTTCTTCCTTAT
ATTTCAAATGAAAATGAGCTCGGCGTTCATAACAGGCCTTGTGGAGAACATAAGCCTTTTCATCGCATTTCCGATCGGCT
CTGGCCCAGTCTCTGTCACATTTAGTGACAGCATTGTAGAATCGGTATTCGTGTTTGCTGCACTCAGTAACGATAAAAAG
AATAGCCAAAAATATTATGTATTTCATTTTCAAAATAAATTTTGAAAAAAAAAAAAAAAAAAGATAAATTTACCGTATTC
AGCGATATTTTTCTTTGGCATAGCATACATAATATTTTCCATTTTAAAAATGAAATAAAATGAATAAGCAAGTTGTTTTA
ATCAATCATTAG

 

back to top