category 2 cell



Overview

Post-mitotic, mesenchymally located epidermal progenitors downstream of the zeta neoblasts.

 

Category 2 cell

 

"CATEGORY 2 CELL" TERM REFERENCES

PMID:18786419 , PMID:20040488 , PMID:22385657 , PMID:25017721 , PMID:26114597

 

back to top


 

In Situ Hybridization Data

Smed IDAccessionNameAliasEnriched during stage(s)Tissue/PatternImages
SMED30035904AFP81697.1PROG-1prog-1, NB.21.11eStage 5, Stage 6, Stage 7, Stage 8Category 2 cell, epidermal progenitor
SMED30026364ACN51391.1SMED-P53p53Stage 5, Stage 6, Stage 7, Stage 8Category 2 cell, epidermal progenitor, zeta neoblast

 

back to top


Sequences

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30000746 ID=SMED30000746|Name=PROG-1|organism=Schmidtea mediterranea sexual|type=transcript|length=506bp
TGGATAGACAATTCAATAACAAATATCAACCATGAAATTGATGATTCAGATCGGACTTCTCGTGGTGTTGGCATTGATCA
ATGTCGAATGCGTGAGCAAGTCAAAGAAAGCTTTTGATTGCCTGACGATGTTGGATAAGATTGACAATGAATGTGACAAG
AGATATTTGGTACTCGATGGCCACTGTGACAGAAGTTACGCCGACTTACACAAGAATTGCGATATTAAATACGACCTATT
AAGTGGTCGTTGCAAAGGGAAATTATCAATGCGTTGCATCAGAAAGTACGGCAAACTCGATGGAAAATGCTTGGGAGCTT
ATGACAAGGTTGATTCCTACTGTGACAAAAGATATAATGTCTTGGACACTCATTGCGATGGCTTGTATAAGCTGCAGGAG
AAATGTGAAAATAATAGTTAGAAAAAGTTATGAATAATTCAACTGCTTGAAGACTTGCGATAATTTTTGTATTTGAATAC
AATTTTCTTTTAGGTCAAAAAAAAAG
>SMED30009302 ID=SMED30009302|Name=PROG-1|organism=Schmidtea mediterranea sexual|type=transcript|length=608bp
CTCCATTCTATTGATATTGCTCATAGACTGTAGCTAACAAGTTCCTTCCATTCATATTTCATTCTATAAGTTTGCGTTCC
GACATCATTTGCAATCATTCTAAAATATCATGAATAAAATTTTACTTCTTACGTTTGTGATTTTTTTCGTGTCCGTTGAA
TGCAGATTCCGACTGAGACTGGACAAAATAGCAAAGAGAGAAATGAGTTCCGAATGTAAAGCCGAACTGAAAAAGTTAGA
TGACCAATTCACGGCAGCGGCAAATAAAATCGACGACGACTGCGATGCGGTATACGTAAAATGGTCAAAGAAATATTTGC
CGGAATATGTAGCTCTCAAAGAGAAATGCGGTTTGGATACTTCAAAAATGACAAAAGATTGTAAAACCGAATTAAAAAGA
TTATTTAATCTTTTTGCAGAAGGAAATTATAAAGTCGATTTGGAGTGCGACAATGAATATGCCGCTCTAGTGAGGCAGAC
GAGTAAAGAGAAAGAAAAATTGAAACAACAATGTGCAAGTTCTCGTTAAAGAAAATAAATTTTTCTAAATTTATTCTTAC
CGCCTTTTTTTATGAAAAATTTAGACAAATAAAACAAAATAGATATAA
>SMED30020396 ID=SMED30020396|Name=PROG-1|organism=Schmidtea mediterranea sexual|type=transcript|length=571bp
ATAAATATCACAAATATTTTGCTTAACCATTATTTGCAATATGAAATTAATTATTTTGATTATGTTTGCTCTGGCCATCG
TGAATGTCCAATGCAGATTCCGATACCGAAATATCCGAGATTTTGCCAAGAAGGAAGACCTCGATAATAAATGCAAAGAA
CTCAATGCAAAAGTCGACACGGAATGTGAGGATGAATATGAAGAGCTGGACAAATTGTGCGATCCAAAATATGAAGCATT
GGACAAACAATGTTTGCCGAAATATGTTCAAATCAATGCAGATTTTGCCAAGCAAGTTGTAAATGCAAATTTGAAATGTC
AAGAAACTCCGACGAAAGCTGGTCGAAAGGTTGTAAGAGATTTGGAAAAGCAGATTTTCGGCGATTACGACAAACTGGAC
AAGACCTGTGACCCGCAATATGCAGCATTAGATAAGGAATGTTTGGAACAATACCAACAGCTGGATAAGCATTGCCTGCC
ATTGTATGCACAACAGAAGAAATGTGAAAGGCGTTGAAATAATTGAAAATGTTGTGTAAAATATAAATATAAATTTCTGA
ATAAAAAAAAG
>SMED30026114 ID=SMED30026114|Name=PROG-1|organism=Schmidtea mediterranea sexual|type=transcript|length=514bp
ATAACTTTTGCAAAGTTAATTATTTTTTTGAAATATTTTGACTGCAGATCATGAAGTTGATGTTTGTTTTAATTGTAATA
TTTGTTCTGGTTATTAATATTGATGGAGGATTCCAGCGGGCCTTTGAAATGTCTCGGAAGTCGGCCTTTGAAATGCCGAT
GGAATGTTACAAATTGATTCAGAAAATGTATGCAAGCTGTGAGTCAAAATGCGACCAGTACGACATGGAATGCTTCAAAG
ATTACACATCTGTTTACAAAAGTTATAAGGAAGATTTTCAACGGTTCAAATCCAAATGTATGGAAAAGAGCGATTTGGCC
TCCTCAAATTGTCTTTTAATGTTTGATACTTTAGAAGATGATTTCTTTGCAAATTTCGATAAAGTGGATAAGAAATGTAG
CGCGAAGTACATAACAATGACGAAGTACTGTGTAAAGGAATTTAATGAAATTGAAAATTGTGAAAAGAAATTCAAAATTT
AGCTGAATAAATTGTTTTTGAATTTTTAAAAAAA
>SMED30026364 ID=SMED30026364|Name=SMED-P53|organism=Schmidtea mediterranea sexual|type=transcript|length=2047bp
CTCATGACAGTTTTATTAAAGTTACTATTATTAGGAATTCTGCGCGTTAAACTAGACATTATCGATGGCCCAGCAATATA
TTACTTCGGCTTTCGATCCAAACTTCACAACGTTACAGCATCAGACTTCAATACATTATAAATCCTCTCCAATTGAAATG
ATTGTTCCGATGCAATGCAACCAAAACCAAGCCACCTTATCTATAACCCCTGTTCATATTTCTCCATTTGTTAATATATC
AGATTCTAATAATCACAATTTGACGAATATCGTCGAGCCTGTTTCATCAAATACTATGTCTCCTGCTTTTAAATCCGACG
ACATGCCAACATTGTCTTCTTATCCAGGTCCGTATAATTTTCAAATCTTTATTCCCAACGGAGAATTTGATGAATCCAAA
AGAAAAGGACAGACATGTGTGTTTCAAACCGATAAAATGGGAAATCACCAATTATTTACCAAACCTCATCCTCATTATTG
GAGGTTAAATTATTCAGCTGATCCTTCTATGTCAACGGAAAACATGTATATTCGGATGGTTCCAGTTTTTGGGGATCCAG
AAAAAGCTCAATGCATTTTGGAAAGATGTGCAAAACACAAAGAAGTAACAACAGATGAAAATCACTGGAAATATCGTAGC
ATGCTCATTGTAGAAAAAACCTGTGCACATTACTTTCAGGATTCGGCAACGAAAAGAGTTTGCATTTTATTACCGTTTGA
AAAGCATGCGGAAGGAGAGATTTATTCTTCCGTCAACTGTCAATTTGCATGCTACAACAGTTGCTTTAATCAAGATTCAG
GTGGTCGGAAAACACTTTATTTAATCATCACTCTAGAATTTCTCGATAAAAAAACAAATAAATTCGATGTATGGGGTCGA
CAGTGTTTGCAATTTCGCAGTTGTGCTTGTCCAAGTAGAGACTGGAGAGATAAAAAGATTAAAGGCGATCCAGAAATGTT
ACTGAAATTCAAAGAAAAACGAATCAAAACCGAAGAAAAATTAAATAATTTGGTGATTTCTAAAAGCGTCCCTATTAATA
TGGGTGGAAAGGATGCTATCATAAGAGTTCTTCCCTCGTTGCCAGGACTCGATGACGCTATTAACGCATTAGTTTGCGGA
TACTTACTGAATCGAACAACCAACATAAGCGCAATAATAGCAGCATTTAATCAGATGAAAGACGTAGAACATTTAATTAT
CGATCAATTCACATCAAATTTAGATCAAAATACATGTGACAGTAAAAGTCCTTCACAAACTCCAGAGTCTCAGATTTCTC
CGAATACATCAAACCTTCAATTCAACGATTACGGTTCACTTTACGGTGAACCATGTCAACCCTATAGACCGATGCACCAG
CAAGTTGTTAATAATTTTTCCTCTCCAGGAATTTTCAGTAAAATACCTTTTGAAACTTATCCGGTTAGTTATGACATTAA
ACTTTCACATGAAATGCCGCAGCACTTTGATGAGCTGCCATCAGACAACTATAATAGACACTGAAAAATTGCGTCCTTCC
ACGTTTAAAATTGTATAAAAAATAATATGCTTGATTTTTATTTTTGCATTTGTTTTATTTTTTAATGTTGAAAATATTTA
CGTTTGTATTATTTTTTTTTGATTAGTAGTAGTAATGCTGCTTTCAAATTTTATTGAACTTTGATCAGTGATTTTTAATA
TTCAATGACCTGAATTTTTCATGCGTCTTGATGAGGGTTTGAGTGAAAAAATTATCAATTTCTTCACTTTGTCATGTGTG
CTATGTGCATTTATTGATGTATATAACAATATATGTGTAGATAAATTTTATTTTTGTATCCGATTTAGGTTTGCAGGCAC
GATGATGAGTGGTTTTTATTTTGTAAAAATTTTTCGAGATAACATGTGCTCAAATATCAATATTATATATGGTAACATAT
TTTTGCAATAAAAATGCATTTATTGTCAATTTGGCTATAAATTAAGTATCGTACGAATCAAGCAATATTTTATCATTGCT
GTCAATATTTTGTTGATAATTTTTTATTTGCTTTGTTAATAAAGAGC
>SMED30035148 ID=SMED30035148|Name=PROG-1|organism=Schmidtea mediterranea sexual|type=transcript|length=621bp
ATATAATAATCTTAACTATAAATATTATCAATATTATAATCAGAATTTAGTAATATGATGTTACGGATTATTTACGCGTT
CAGCGTGACTTTGGCAGTTCTGCGGGTTAACTGTTTGGAAAGCCCAAAGGTTTTCAAAGACGAAATAGTAAACAATTATG
AAAAAAAATGGATGAAATGCACCAAATTTCTCGATAAGGTTGATGCTGAATGTGACAAAAAATACGATTTACTCGACAAT
GACTGTAACGGCAGTTACAAGCAGCTGTATAAAACGTGCGACGTTAACTACTTGAAACTTAGCGGACGCTGTCAGATGCG
ACTGTCTAAAAATTGCATTAAAAAGTACGGTAAACTCGATCGGCATTGCATTAAAGCCTACGGTGAAATTGACGAATCAT
GCGACAAGCGATACGCAAAATTGGATCCGTATTGCGATGCGCTGTATACAAAAGAAGAAAATTGTGAAAGAAAAATTAAA
TAAATGATAAAAGTGGACTTCCTACTGATGATTTGTGATCTAGTTTATTCAATTTTTCATCCATATATAATAGCAAATTA
TTTCGTCACTTATTTAATTATAATATTTTATATAAAAATGTATTAAATCTTTAAAAAAAAA
>SMED30035904 ID=SMED30035904|Name=PROG-1|organism=Schmidtea mediterranea sexual|type=transcript|length=728bp
GCAATATTTTGTCATGAATGTTTAATTGAAAAATATGAAAGTTTTAATTATATTTCTATTTGTGATTGCGTTCGCGTATA
TTGAATGCCGTCCTCAACATCTATTGGGGTTCATGAGGAAAGAAAAGTCCAAGCTAGAAAAAGACTCAGCAGATGACGTG
AAACAAGGAAAAGATTCGGATAAAAGCTCTGATAAATATTCACATGAAGGATCTAATAAAGAGTCTGACAAAGAGACAGA
TAAAGAAGAAGAAACTAATTCTAAGACTTCTGCAAAGTCTCCCGCCAAATCAAGTAGACGAAAGAAACAAGTGGAAAAAT
TGGAAGAAGAGGAAGGAGAAACTTTAAAAGAGAAATTAAAAGGACACATTACGAAAGCAGATTGCATGAAATTATACGAA
GAAACTGATAAATACTGCGATCCACTTTATTTGAAGCTCGACAAAGATTGCGACTGCAGATATGTGAAAGCATTGAATGA
CTACACGAAAAGATGGGACAGTTATCATTCCAAATGTGGTAGCAAATATGACAAAAAATGCCGAACCGAATTGCGAGCTT
TGGAGAATTGGTTTAATGGCCTTTATGATTCAATCGACGGCCACTGTGACGCAGAATATGACGCGCTGGATAAATATTGT
GACGTAGAATACAACAAAGTTGATCAATGTGAAAAAGGACAGAAAGTGTAATAAAATTGATTTGTAATAAAATTTATTAA
ATAAAAAA

 

back to top