blastomere



Overview

Blastomere (PLANA:0004517). An undifferentiated, cycling embryonic cell in Stage 1-5 embryos that expresses piwi-1, numerous adult asexual neoblast enriched genes, and early embryo enriched genes.

 

blastomere

 

"BLASTOMERE" TERM REFERENCES

PMID:28072387

 

back to top


 

Tissue Description

 



Stage 2 embryo undergoing dispersed cleavage, stained with piwi-1 riboprobes (red, blastomeres) and antibodies raised against the mitotic epitope H3S10p (green). Nuclei: DAPI (blue). Yellow arrow: dividing blastomere.


 

Zygote-derived blastomeres undergo dispersed cleavage among yolk cells: they divide asynchronously and are not in direct contact with one another (Bardeen, 1902; Cardona et al., 2005; Hallez, 1887; Ijima, 1884; Le Moigne, 1963; Metschnikoff, 1883; Vara et al., 2008).

 



Paraffin embedded S3 embryo sectioned and stained with hematoxylin and eosin (left) or piwi-1 riboprobes (blue) and eosin (pink, right). Black brackets denote embryonic wall. Yellow arrowhead: temporary embryonic pharynx. GC: yolk-filled gut cavity. Cyan arrows: piwi-1+ undifferentiated blastomeres. Scale bars: 100 µm. Inset (right): magnified view of a piwi-1+ cell. Inset scale bar: 25 µm.


 

During sphere formation (Stage 2), some blastomeres differentiate into temporary embryonic cell types that provide form and function to the embryo (Cardona et al., 2005; Hallez, 1887). Undifferentiated blastomeres remain in the embryonic wall of nascent spheres (Cardona et al., 2005; Hallez, 1887).

 

piwi-1 is expressed in all undifferentiated blastomeres of S3 embryos. 

SPIM reconstructed S3 embryo costained with piwi-1 (red) and EF1a-like-1 (green). piwi-1 is expressed in all undifferentiated blastomeres in the embryonic wall (piwi-1+, EF1a-like-1+ cells).  piwi-1 is not expressed in differentiated tissues marked by EF1a-like-1 alone, including the primitive ectoderm and temporary embryonic pharynx (green). Several fluorescent beads used for 3-dimensional reconstruction are visible (red).

 

Mitotic activity is restricted to piwi-1+ blastomeres, which cycle asynchronously.

SPIM reconstructed S4 embryo costained with piwi-1 and LYAG-like (both in green) and H3S10p antibodies (red). LYAG-like marks the temporary embryonic pharynx and is not expressed in piwi-1+ blastomeres. Several examples of piwi-1+, H3S10p+ cells are evident.

 

 

 

Cell cycle activity is restricted to blastomeres in the embryonic wall of S3-S5 embryos. All blastomeres are cycling, and they cycle asynchronously.

 

piwi-1+ blastomeres co-express the adult asexual neoblast enriched gene piwi-2.

SPIM reconstructed S4 embryo costained with piwi-1 (red) and piwi-2 (green). piwi-1+ blastomeres co-express the nuage factor piwi-2, and virtually all piwi-2+ cells co-express piwi-1. Several fluorescent beads used for 3-dimensional reconstruction are visible (green).

piwi-1+ blastomeres co-express the adult asexual neoblast enriched gene piwi-3.

SPIM reconstructed S4 embryo costained with piwi-1 (red) and piwi-3 (green). piwi-1+ blastomeres co-express the nuage factor piwi-3, and virtually all piwi-3+ cells co-express piwi-1.

 

piwi-1+ blastomeres co-express the adult asexual neoblast enriched gene tud-1.

SPIM reconstructed S4 embryo costained with piwi-1 (red) and tud-1 (green). piwi-1+ blastomeres co-express the nuage factor tud-1, and virtually all tud-1+ cells co-express piwi-1.

 

piwi-1+ blastomeres co-express the adult asexual neoblast enriched gene bruli-1.

SPIM reconstructed S4 embryo costained with piwi-1 (red) and bruli-1 (green). piwi-1+ blastomeres co-express the stem cell maintenance gene bruli-1, and virtually all bruli-1+ cells co-express piwi-1. Several fluorescent beads used 3-dimensional reconstruction are visible (red). 

 

 

 

Blastomeres express many adult asexual neoblast markers. Shared elements of the blastomere and neoblast expression signatures likely include genes implicated in DNA replication and repair, cell cycle control, chromatin remodeling and/or modification, genome surveillance and pluripotency, all prominent features of an evolutionarily conserved gene expression signature for metazoan primordial stem cells (Alie et al., 2015). For additional information, see Figure 4 and associated text.

 



Colorimetric WISH depicting expression of the early embryo enriched (EEE) transcripts tct-like, BTF3-like, DDX5-like and eIF4a-like (blue) in S2-S8 embryos. EEE transcript expression declines dramatically during S5 and remains low through subsequent stages.  Black arrowheads: temporary embryonic pharynx. Red arrowheads: definitive pharynx. O: oral. V: ventral. Scale bars: 100 µm.


 

 



Early Embryo Enriched transcripts were expressed throughout the piwi-1+ population in S3-S4 embryos.

Fluorescent double WISH with riboprobes against piwi-1 (red) and the EEE transcripts tct-like, BTF3-like, DDX5-like and eIF4a-like (green) in S4 embryos. Percentage piwi-1+ cells coexpressing the indicated EEE marker (red) and percentage EEE+ cells coexpressing piwi-1 (green) appear in lower left corner of merged images.


 

Blastomeres express early embryo enriched (EEE) transcripts, providing a molecular metric to distinguish the expression profiles of blastomeres and neoblasts. EEE transcripts expressed throughout the undifferentiated piwi-1+ blastomere population in S3-S4 embryos are downregulated as definitive organogenesis begins during S5. These transcripts likely represent a key temporal shift in the expression profile of piwi-1+ cells during embryogenesis. For additional information, see Figure 5 and associated text.

The blastomere to neoblast transition occurs during S5, as EEE transcripts are downregulated. Concomitantly, regulators of lineage commitment and differentiation are upregulated heterogeneously within the blastomere population. The observed changes in gene expression within the blastomere population mirror functional distinctions observed between S4, S5 and S6 embryonic donor cells in heterochronic transplantation assays. Blastomeres, albeit similar in many respects to adult neoblasts, do not persist in an adult microenvironment. In contrast, embryos undergoing organogenesis harbor cells with neoblast activity: they engraft, proliferate, differentiate and can ultimately rescue adult hosts devoid of stem cells from lethality. For additional information, see Figures 6-9 and associated text.

 

back to top


 

In Situ Hybridization Data

Smed IDAccessionNameAliasEnriched during stage(s)Tissue/PatternImages
SMED30018602ATP-dependent RNA helicase dbp2DDX5-likeStage 2, Stage 3, Stage 4blastomere, blastomere compartment, embryonic digestive system, primitive ectoderm, temporary embryonic pharynx
SMED30001900CUGBP Elav-like family member 3bruli-1Stage 6, Stage 7, Stage 8blastomere, blastomere compartment, neoblast compartment
SMED30003202Eukaryotic initiation factor 4A-IeIF4a-likeStage 2, Stage 3, Stage 4blastomere, blastomere compartment, embryonic digestive system, primitive ectoderm, temporary embryonic pharynx
SMED30033466Histone H4blastomere, blastomere compartment, embryonic digestive system, neoblast compartment, primitive ectoderm, temporary embryonic pharynx
SMED30004304Proliferating cell nuclear antigenPCNAblastomere, blastomere compartment, neoblast compartment
SMED30010115AFJ24744.1ribonucleoside diphosphate reductase subunit M2-2RRM2-2blastomere, blastomere compartment, neoblast compartment
SMED30007406Q2Q5Y9SMEDWI-1piwi-1blastomere, blastomere compartment, neoblast compartment
SMED30014446Q2Q5Y8SMEDWI-2piwi-2blastomere, blastomere compartment, neoblast compartment
SMED30001362ACC97187.1SMEDWI-3piwi-3blastomere, blastomere compartment, neoblast compartment
SMED30019097AFD29619.1SOXP-1SOXP-1blastomere, blastomere compartment, neoblast compartment, sigma neoblast
SMED30035063AFD29620.1SOXP-2SOXP-2blastomere, blastomere compartment, neoblast compartment, sigma neoblast
SMED30032088Spondin-1spondin1-likeStage 2, Stage 3, Stage 4blastomere, blastomere compartment, primitive ectoderm, primitive ectoderm cell
SMED30027646Transcription factor BTF3 homologBTF3-likeStage 2, Stage 3, Stage 4blastomere, blastomere compartment, embryonic digestive system, primitive ectoderm, temporary embryonic pharynx
SMED30025427Translationally-controlled tumor protein homologtct-likeStage 2, Stage 3, Stage 4blastomere, blastomere compartment, embryonic digestive system, primitive ectoderm, temporary embryonic pharynx
SMED30013909AHC00376.1tud-1tud-1blastomere, blastomere compartment, neoblast compartment

 

back to top


Sequences

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30010115 ID=SMED30010115|Name=ribonucleoside diphosphate reductase subunit M2-2|organism=Schmidtea mediterranea sexual|type=transcript|length=1127bp
GTTTTTAATGAACTGAATCAGGTTTAATGCAAAATAGTCATTTTAATTTCTAGATAAATTAACAGTAATTCTTTCGAGAT
TAGATATTTATTATGGAGATTTTATTAACAGAAGATAAAAGTCGAATAGGATTTCTTAATATACAATATGAAGATATATG
GGAAATGTTTAATAAAGCTCGATCTTCATTTTGGACTGTAAATGAAGTTAATTTATCAAAAGATTTTGCTCACTGGAAAA
AAATGAATGACGATGAACGGTATTTCATTACTCACGTTCTTGCATTTTTTGCTGCCAGTGATGGAATTGTCAATGAAAAT
CTCGTCGAAAGATTCATTCAAGAAGTGAAAATTCCCGAAGCTGAGGCATTTTACAGTTTTCAAATTGCAATTGAAAACAT
TCATTCAGAAATGTATTCTCTATTAATCGATTCTTATGTTACTGATACAGAAACAAAGAATAAATTATTTAATGCCATCG
AAACTATGCCATGCGTTCAGAAAAAAGCTCAATGGGCATTGCGTTGGATTAGCGATAAAAAATCCACTTTTGGAACTAGA
GTTGTTGCATTTGCTGCTGTCGAGGGAATATTTTTCAGTGGTAGTTTTGCATCGATATTTTGGCTTAAAAAGCGTGGATT
AATGCCCGGATTATGTTTCAGCAACGAATTAATTAGCCGAGATGAAGGACTTCATTGCGATTTTGCTTGTTTGATGTTTA
AATATTTAAGTAGCAAACCGTCACCTGAACAAGTTTTGGATTTGATCAAAGAAGCTGTCGGAATCGAGAAGGAATTTCTC
ACCGACGCATTGCCGGTTTCATTGATTGGCATGAACGCTGAATCGATGTGTGAGTATATTGAATTTGTGGCCGACCGGCT
GCTGGTTGAATTGGGCTGTGACAAGTTCTGGAACACAGAGAACCCGTTGGATTTCATGGATAATATTTGCATCGATGGGA
AAACTAACTTCTTTGAGAAACGAGTCGGTGAATATTCCATGTCGAGCGTTGAGGACAAACACAAATTTGATGATGTCAAT
TTCGATATTGATTTTTGAGGGATTCCGTTTTTTGGCGCCAGTGTGCATTTAATGTGTTTTGGTTGTAATTGGCTATTTTT
GTTTGTT
>SMED30007406 ID=SMED30007406|Name=SMEDWI-1|organism=Schmidtea mediterranea sexual|type=transcript|length=2730bp
AATCGAATACATAAAAATTTATTTGACACCAAATACAAAGAGACATTAATCTACAAGTAAAATAAGCGTTCGCGAATTCT
GTCATTTATCGCTGGAGGAGTAACACCACGATGAATCTTGCCAACGAGTTCAGCCAAACGATGGGCATAATGCGTTGGAA
CAGGAACTCGGATTGTTCCCATCCAGTTAAAATACAAATGTGTTAACGAATAAGTTATTTGCTGCAATACACTCGGAGAC
ATAACTGAAACCTCATTTGTTTTCTTGTTTGTAAACTTAGTGTCCATAAGAACATTATAATTCGTAGGAGATGCTGTACC
TTTAGTTGTTTTCTGAGACACCAAGTAAAATTCATAGAAATTGGGTTTCACTATTTTCTCATCAACCACAGTACCAGGAT
TTGGATTAGCCCCATCTTTGAAAAATTTAACACTAATTCTCTTCTTAACCACAACATAAATAATTTGGGGCAAAGTTTGA
TTTTCGTAAATTTTCTCTATCATTTTCATAACAGCATCAGTTTCGAACTTTTTGGTAAATGCTAACTGTGAATCTCCAAC
ACCGTCACGATAAATAATCAAACGAAGAGGCATAGTGTTAAATTTGTTTTGGAATGTTGTAAGGGCCGTTAGGAAGTTTT
TGCCCAAATTTTCGTGAAATTCATTTTTACCTTTAGATGAATTGACAAAACTGATATACTGAGAAAATTTGGCACTAATT
GAAAATACGGATGCTTGAACAGATCTTTTACCGGTTTTGCTATGAAAAGTATCCAATCCTACAATCATAGTCGGTGCCAT
TTTAAGATTAATACCCCATGGGTCGTATCCTAATTTAGAAAACATTTGCATAACTGATTTATCTGCAACCGTTTTACGAC
GTCGATCATCTCTATTACTTCCGTTTCTCTGCGTCACACACTGAGTCAATAGACCTGTAGACATTGTAAAATTCTTTACT
TTTGCGTAAACTTTATCATCAGGAATGAACACTAATGCCATATGTACCTTGCTTACACGAATAAAATCTGTTAAAGCGTC
TTCAACTTCATTGGATCGACATGAAGATATACTGTCCATTGTGTAATTGATTCTTAATCTTCCTATTTCTCTTTTAACAT
CTTCAATAAAATTGTTGAAGTGACTAGGGTTTCGATCAACAACCAGTACACCAAAACGATGAGCTGTGCCTTTAGGAACG
TCAAATTTAATTTCCCCAAACTTCCAATCATCAGGGATTTTAGTATTAATTTTAACTTCGTTTGAAAATATATCAACTGG
AGCCAATTCACGACCACGAATCGTAATCGGTTGTTCTTCAATACACATCCCCCAGCTCTTCATATAATCTTTTGATTTCC
CAGCTCCGGTCCACTTACAAAAATCTCTTATGTCATTTAATCGTTCTCTAGGCTCACGTTTCAATACGGTTCCTAAATTC
TTTTGCAAATTTATATTACTTCTTTCACTATCCGAAAATCCACATAAATAGCATAATTCACCTGGAATTGATAAACTTTG
ATCTGTTTCTGTAGGTCCTTCAGGTTCATTTTCAGTTTTTTTCTTTTGGGCGAACCATCGATCGCTTGACTCGCGATATA
ACAAATGGTTGTTTGTCATTTTTCAAATTAATGTTATACCGTTGCTTGAAATAATTCAAATAGGATATCTTTTTATCGCC
TAGCTGAACCTCGTCATTAACATCCATTTCTTTAATATCTGAAATTCTATACGTCTTGTTATTATACTTGGTAATTATGT
CCCTTCCTATTAATTGATCAATTTGATCTCGTCGATACACTGATACTACATTGTTTTCATTTAGAACACGATTAATTCTT
TCAAGATAAAGTAAAGTCGAAGCAGTTCCATTTTCATTTGTTCCTCTTGTAATTGTAGTAGAATACCCTCCTAATATCTT
GAAATTGTCCATTTTAAAAAAGCTAGGTCCTTCTCGAATACCACCACTTTCACAATTTGATCCCAGAAAAAATTGTCTAC
CAATTTTTTCTTGTCCCATAAATATTTGAATATTATTAAATACAATATTTATCATCTGATAATATTCTTCAGAATTTTTT
AAAAACGTCGTCAGCAATCGTATGGAAATTTCAACATCTTTGATAACTAAGTTTTCTGTATCTTCATCTGAGTGCCACTT
AGAAGTCGTAAATAATCTTCTGCCATCAAAACAAAATGGTTGACCATTATTTTTGCTGTTTGCATAAGCTAATAATAACT
CTAGCTTAGTACGGATACTTTTATTCTCCATAACTACATCATACATGTAAAATGGTCCTTCGACTTTAATATTAAAGTTA
GCGTAGTTAGACTTGAGACTAACTACTCTTCCATCTTTCCCTATTTTGTCTGTAACTGTATCAGGCTGTAAAGCAGGTTC
AATAATTGCGAATCTTCTTTGGAGACCTCCTCTTCTTGGTCTTAAATTGGGATCACTTGTAACATTAGTTGAATCCATTT
CGTAAATTTGAGTAAAAATGTTAAAACAAAGACTTCGGTTTAAATAAACAAAATATACTATGTAAAACGATAAATATAAT
TGCTTTAATGGTTTATGATTTGTATTATATAATAATAATAATTTAATTTCCCTGTGAATATTATATTAAAATATAGTAAA
AATTACTCGTAAATGTGTGTTAAAGTAATAGGATTAAATTAAAATAAACATTTTACGAAATAAGTTCTAGTCAATTATGA
AGTCTTTTCT
>SMED30004304 ID=SMED30004304|Name=Proliferating cell nuclear antigen|organism=Schmidtea mediterranea sexual|type=transcript|length=907bp
CTAAAAGGTAATAATTTAAATTTAATTAGAACATTGTTTTAATATTCGGTTATATTCTCCATTATTCTAAATTATGTTTG
AAGCAAAATTAATAAAAGGCGAAGTTTGGAAAAAGGTTATAGAAGCTATAAAAGACTTAGTACAAGAAGCAACATTGGAT
TGCTCAGAAAATGGAATTAGTCTTCAAGCCATGGATACATCTCATGTGTCCTTAGTTAGTATGCTTCTTCGAAGTGATGG
TTTTGAGACTTATCGATGTGATAGAAATGTCAATCTCGGTCTTAATATAACAAGTGTTTCAAAAATTTTAAAGGCGCTTG
GTAGTAATGATTCCCTAACAATGAAAGCCGCTGATTCAAGTGAAACAATTTCGCTTTTGATAGAATCTGCAAATGAAAAT
GAATTATCTGAATACGAAATAAAATTAATGGACTTGGATGGAGATCACTTAGGTATACCAGATACTGAATATAAGTGCAT
TGTGAAAATGCCGAGTTCAAAGTTACAAAGAATATGTCGAGATTTAAGCCAAATTGGAGAAGCAATCACGATTTGTGTTA
CTAAAGATGGTGTAACTTTTGCTGCTGCTGGAGATCTAGGAAAAGGAGCTATAAAACTTAATCAAAATTCTAGTGCTGAC
AAAGAAAATGAAGGAGTAACTATTGAAATGACCGAACCTGTTTCGATGACATATTCATTGAGGTATTTCAATATGTTTAC
AAAGGCTGCACCTCTTTCTTCTCAAGTATCTCTGTCGTTGACTGAAAATGTTCCAGCAGTTATTGAGTTCATAATCGAAG
ATTTGGGATTTATTCGATATTACCTAGCTCCTAAAATCGAAGACGACGAGTGAAAGTTTAACTATTAATGTTGTATGTTT
AATAGATGTTATTTTGTTTAAAAAAAA
>SMED30025482 ID=SMED30025482|Name=Histone H4|organism=Schmidtea mediterranea sexual|type=transcript|length=552bp
TGTCATTATCAAAATATTTTCAATATATAATAAATCAGAAATCACTAAACAGTCATTACTAAACTATTCTAACTCAAAAT
GTCTGGTCGAGGAAAAGGAGGAAAAGGCTTAGGTAAAGGTGGAGCTAAAAGACATAGAAAAGTTTTGCGAGACAACATCC
AAGGAATCACGAAACCAGCTATTAGAAGGTTAGCTCGCAGAGGTGGCGTGAAAAGAATTTCTGGTCTTATCTATGAAGAA
ACTAGAGGTGTTTTAAAGGTTTTCCTTGAAAACGTAATCAGAGATGCTGTTACTTACACTGAACATGCTAAGCGTAAGAC
AGTCACAGCTATGGATGTTGTTTATGCACTTAAACGACAAGGTCGTACTTTATACGGTTTTGGAGGGCCACAAATGTTGA
TTGTAGTGAATTGTTCAAATATTGTTATTCTATCTAGTAATTCTCAGCAATTTTATTAACGTTATTTAGAAATTAATTTT
ACAATTGCTAATTTCGAATGTTATATCTGGTGTCAATGTTCAGTTATATTATTTTACAAATGACTTGAAATG
>SMED30001900 ID=SMED30001900|Name=CUGBP Elav-like family member 3|organism=Schmidtea mediterranea sexual|type=transcript|length=1713bp
CTTTTGAGGGAAAAATAATTCTTTTATTAATAATGTTTCATCATTGGAATATAAAATAAAATATTAGGAGAAAACATAAG
TTAACCAACAATATTAGCCACATATTTCGTTTAATTATTGGTCTATCACTTTTCATTTTAACCAATTGTCTTGAGATAAT
GGAGAGTTTATCCTTAATTTTTATTATAAATCACTGGTTTTGATAGACTTATTAACAATGGAAAATTATTTCAAACTTTT
CGTTGGTCAGATACCTCGAAATACACCAGATAAAGAAATTAGACTTATTTTTGAAGCTTTTGGACCAATCTTTGAATTTT
TAATTTTAAGGGACAAGAAAACTGGTTTTCATAAAGGATGTGCTTTTGTTACATTTTATCATAAAGACTCTGCAGAAAAT
TGTCAAAAGGCGTTACATGACAAGAAAATCCTAAACGGGATGAATCGACCACTTCAAGTGAAACCAGCTAAAAATAAGTT
AGCAAAAAATTCAAGTTTGAATGGGGAAAATCAGACAGAAGAGCAGGTTTTCAGTGATGAAAGGAAATTGTTTGTTGGAA
TGTTGAGTAAAAATCAAACTGATGAAAATGTACAAAATATGTTCACAAAATTTGGCAAAATCGAAGAGTGCACTGTATTG
AAAGACCAAAATGGAAATAGTAAAGGATGTGCCTTTGTCAAATTCGTGAACCACACCGATGCTTGTGCAGCAATAAACGC
TCTTCATGCCAGTCAAAAAATGGAGGGTGCTTCATCCAGCCTTGTGGTTAAATTTGCTGACACGGATAAACAAAAACAAA
TAAGAAAATTGCAGCAATATATTCCAGATTTAAGCATTTTAAATTCGCGCATTCCTATTAATATTCCATACTATTCACAA
TACGGTACAATAATTAATCCAGAATATAATTCAACAATTCCTTCAAACCAATATATTCGAAATTGTAACGAATATATTCT
TGCTGCTCAAATTCAACAAATAAATTTGTTTTCTAATTTATCATCGGTCTACCCATCTAATTCAATAGTGTCAATGCCAT
CCAGCCATCCGGTACCAATGATTGACTATTCTGTTCCTATTAACAACTTTCCACAAACTGACCAAATAACAATGAAACCA
ATTGTTGATATACAGCCAATACCTCCAGAAGCTGTACACCGAACCATCGTAACTCCAGGATCACTCTTATCATATCCTTT
TCTTAATGTTCAAATTCCTACAGTATATCCAAACGCCTTTTCCAATGGAAATTTAACAAGTACAACACAAAGTTCAACAG
ATGTGAAAACCACTCCTTTGCCAACAGGTCCTGAAGGCTGCAATCTATTTATTTATCATCTGCCACAAGAAATTGGTGAT
TTACAATTATATCAAATTTTTATGCATTTTGGAAACGTTATCAGTTCTAAAGTTTATGTTGACAGAGCAACAAATCAAAG
CAAATGTTTTGGATTTGTCAGCTACGATGATCCGGCATGTGCCAATGCCGCCATCAAATCTATGAATGGATATCATATCG
GAACAAAAAGATTAAAAGTTCAGTTAAAAAAACCAAAAGAAGCAATAAACGAAATGAAAAACTTCAATCAAATGTTATCA
TCAACTCCCGACATAAACCAAGTATTTTGTTCATCCTAATGATTGTGATATTTTACAGGATTTTCTCGACCATATTGAAA
GCCTGATTGGTGATATGTAAAATGACCCACCGT
>SMED30019097 ID=SMED30019097|Name=SOXP-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1596bp
GGAATAACAGCCAATTAGGGATCAGCTGCAATTTGGCCTATGATTGGACATTGATTTTTATAGTCTCAGGCGTTCTCAGC
TTACGTGTGCACCTTTTTAGTGGACACGTTAAATTTGATAGGTGCTTAGTGGTGTTGATTCCTGTTTGGAAACTGTATAT
AACCAAGGTTATTTGTTGCTTTGAGACAAATGCAACACAATCAAATAATTAATTATGCTATGTTCAAATTGTTCAAACAA
TCAGGATACTTTGAAATTATGGATGGTCCATTTAGCTTCTTGTCACCCATTACCTCCTGAATGGCTTAGTGAAAAGGCCA
AAGTATTAAATGATGACGAAAATCAGCGCCCCTATACAATTGTCACTGATTCCCGAAAAAGAAGGCGACGTCCAACCACA
CCAAGACCACTAAATACGTTCATGATTTTTTCGAGGCATATCAGACGAAATATTCTCTCAGTGTTTCCGGATGCATCAAA
TTCCCAATTAAGCAAAGAGCTTGGAATTTTATGGAAGAAAGTCACAAATGAAATTAAATCCCTTTATGAAGAAGAGGCAA
AGCGATTGGCTCAATTACATGCTCTTGAATTTCCCGATTATAAATATCAACCAAAGAAACGAGTCCGAAGATTTGGAAGA
GCGATTTATGATCGACAGCCCTGTACAACAGAAAGATCTAACTCAACTAGTGCAACAGACGAAGAAAATGGTAAAGACAA
TAATAGTGTTCAAGACGGTAGAAGATCAAGCGATATTGAGAATCAGTATATAAGATATTCAGTTTTGGGTAAAAATATTG
TAAAACGAGAATGTCAGTCCTTTAATAGTCCTTTAAAAAGCGACAACGTTAAATTGGAAACGCAAGAACAAGATTTTATC
CAAGCGATGCCCAAACCTCTAAACGTCCGAATAACGAATTACAACGAAAACAGTATATTTTTACGACAACAAAGATTACC
ATCAAGTAGCACAATGTATTTACTTCCTTCAGAAAACCTAATAATTAGTAATGGGATTATGGGATCACAGGACTTGGGTG
AGGATTATTGTAGAGAGTTGTATATAATTAATGATTTTTTCCCAGAAAATGTAAACATAGACGATGAAATTGATATAACA
GGAAACATTTTTAGCAATGATTTAGATTTAGAGTGGTCTGAAATTGATGAAAATTACAAACAAGATTTACCAAATCTTAA
TTCATTATTTCAACACTAATATATTTGATTTATAAAATATTTAAATATTTTTTATTAAACAGTCTTTTACATGTACATAT
AGTATTGGAACTCTTCTCTGACTTATAAGATAACAGAGATATTGTAATAAGATTAAATTGGTTATGTGTTTCGGTTTTTG
TAAGATTGGTAATTTTCAGAAGAATTTAGACTTTTTTCATGGAAATTGGAATTGAGAAACAAACTGAATAAAGAAACAAA
TTTTTGAAAAAAACGAAACAGATACTTATTATCAAAAGAAAATTATCTGAAGCATCGAGTCGGTATGAAAAATAAACTAA
TTAGTCAGAAAATTTTTGATGAAATAACGTCTAATGAAATTAAGATCTCCAAGGAATACTTTTTCTAACATTTGAT
>SMED30029163 ID=SMED30029163|Name=Histone H4|organism=Schmidtea mediterranea sexual|type=transcript|length=537bp
AGGTTACAGTTTTTCAACTAATACCTCAAAGAAATAATGAAAGATGGACAGTAGAGTTTTGTCACCATCAGGAGACCAAG
TGTCATTTAGGATGATAATAGCCCAGTTAAGGAATCTTGCTGATCTAATCAATGCCAAAAATATTACAAAATTTCGATTT
AAAAGAAGCTAAAGGAGAAAAATTACACGGAAAAGTTCAGAGGTACAACATCCAAGGCATCCCTAGGTCTGCAATTAAAC
GATTAGCACAAAAAAGAGGTGTGAAAAGAATTCATGGGCTTATTTACAAAGAAACAATATATGTTATCAAGTTAGTCCTT
GAAAATGTCATCTTATATGATATTAAATACACATTGCAAGCCAAGCAAGAAACTTTTACTGCCAAGGATGTTTTTAATAT
TCTTGAATGTTTGGAGTTTTCTATTTTGTGATAACATCCTTCCCCAAATGAAAGTTATCAGATCATTTTGCAAAGTTTGT
GAGAAGGGATATATATTTACCAACAAGAAAAATGTTTTGAATTTAAGAATAGGACTC
>SMED30014446 ID=SMED30014446|Name=SMEDWI-2|organism=Schmidtea mediterranea sexual|type=transcript|length=4773bp
ATTTAATTTTCGAAAAAAAATATGGAGGAAATACCAGTAAAAGTAGCTAAACTTGAAGCGAATGGAAGTGAAACAAGAGG
TAAAATGGGAAATCGTGGTGGCCTGAGAAGAACATTTAGAATTGTTGAACCTAACTTGCAACCTGCTGATATCACTGAAA
AAACAGGAAACATAGGAAGAACAGTTAAATTACAATCAAATTTTACCAAATTCTCTGTTTTGCGTTCAGAAAAGTTCATG
ATGTATGATTCCGTGTTTTCTCAAGTTGGTTTGTCACCCAAAGTAAAATTACAGTTTATTGTTCGAGTCTGCCAAGAAAA
TAAATTGCCAGGGGCTTTTTGTTTTGATGGAAGACGTCTATTTACTAGTGAAAAATGGCATGGAGAATCGGACATTCAAG
AATTTAGTCATGATGAAAAAAAAATGACACTAAGATTGGTATCAACTATCCTTCCTGAAACTGAAGAATATTACCAAATG
ATCAATGTATTACTCAATAATTTACAAGTAATGTTAGGTCAAGAAAGAATTGGTAAAGGTTATTTTTTAAGCCCAAATAT
TACAAAAGATGAAGTTCCCCGTAATTCTGGACCGACATTTTTTGAAACCAATAGTTTTAAAGTTCTTGGGGGCTTTGGTA
CAACTTTACAAAGAGGCACAAAACCAACTGGTGAATTAACCACTCTTTTATATATTGAGCGTATTAACAGAGTATTAAAC
GATAACTCTGTTATGAAGGCATACAACAGAAGAAGTATCGATCAGTTGATAGGCAGAGATATCATAACAAAATATAATAA
CAAAACTTATAGGATAAGTGAAATAAAAGAAATGAACGTAGATGAGAAATTTGAAATGGGTGGTAGAACTTTATCGTATG
CCGAATATTTTAAGGAACGATATAATATTCGATTAACTCAAGGCGATCAACCATTTGTTCTAACGCGAGTGAAGAAACCA
ATGCGTCGAGAAAGAAAGAAAAAAGACGAAGAAGGAGTGGAAAAAGAGAAAGAAAAAGAACGCGAAAAAGAGGCTCCAGA
AGAGAAGGACATGACTCTCAATATTCCTGGAGAGTTGTGTTTCTTATGTGGGTTTTCAGATCAAGAGAAATCGAATATGG
ATCTGCAGAAGAATTTAGGGTGCGTTTTAAAAAGAGAGCCACGTGAAAGATTGGATGATATACCAGCTTATTGTAACTGG
ATTAAAAATAGTGATGCGGCAACTGGAATGTGCAATAAATGGCAGCTGAAAATAGATAACAAACCATTAGAAATCGAAGG
TAGAGAATTACCTCCATGCGATGTAATAAGTGGTGGCAGCAAAATTAATGAAAAAATGGGAGATGATTGGAAATTTGGTC
GAGTTCAATTTGATATTAAGCGTGATCGTAAGCATGAAATCGATGTGGTCATCGTTGATCGAAATGACTTTCAGTATAAA
AATTTTATGAATGATGTGGAACAAGAATTAAGAAACATGAGAATTGATGCTCGAGTTGGAAAGGTTAATACTTGTGGTCC
AAATGATGTTGAAAGATGTTTGAATGATGCCGCTAGAAGTGGAAGTGGGTGTGCTAAAATGGCGCTGGTATTCGTCCCAG
ATGATAGAGTATATGCCAAGGTGAAATCATTTACCATGAGTACTGGTCTTTTAACCCAATGTGTAACAACACGTAATGGT
ACTAATAGAAACGATAAACGAAGAAAGGTGGTTTCAAGTAAAACCGTGATGCAAATATTTGCAAAATTCGGATATGATCC
ATGGACAGTTGAAATTAAATTGAGACCAACTATGATTGTCGGTATGGATACCTATCATAACAAGTCCAGCAAGAAATCAA
TTCAAGCATCTGTATTTTCGATCAACAGCACATTTACACAATATATGAGCTTTGTTAATTCTCCTAAAGGACGTCAGGAA
TTCCACGAAACTTTAGGCAAAAATTTCAATTTAGCGTTAGAAGATTTCAAGAAACGTTATGACATATTGCCCCAGCGAAT
TTTAGTCTTTAGAGATGGTGTTGGAGATAACCAACTTCAATTTACTAAAAATTTTGAAGTTGATGCAATGAAACCGCTTA
TTGAAAATATATACAAAGGCAACGGATTCCCTGTTCCACAAATCATTTATGTCATCGTAAAGAAAAGAGTCGGCACTAAG
CTTTTCAACAGAGGAAATAATCCAAATCCTGGAACTGTTGTGGATAAAGAAATTGTCAAACCGAATTTCTATGAATTTTT
CCTAGTTTCACAAAGAACAACGAAAGGAACTGCAACTCCAACTAATTATAATGTTTTAGAAGATACTCGATTGCTAACGA
AAAAAGGTACTATGGATCCTATGGCACCGAATGAGCTGCAAAAGATTACCTATGCTCTAACTCATTTATATTTCAATTGG
ATGGGAACTATCCGAGTTCCGGTTCCAGTGCATTATGCGCATAGATTGGCTGAATTAGTTGGAAAGGTGCATAAGGGCTC
TAATCCCGTTGCCATTAATGAAAGAATAAGAAATAGGCTCTTCTATTTATAAAAAGATCAAAACTTACATTTTTCTGTGT
TGATTACTATCCCAATTGTGGATTTAATTGTTTCTGAAAGCTGTTCATTCAAATTCTTCTGAAATCCATATTGATTCGTA
AGCAGCCTGTATTTGAATACTAAAATTGATAAAGTAGTTATAAGTATTGTAAAAGTATTAAATATTTGTTTATGTTATTC
GTAATACACTTGGGTTATTGCAATGTTTTAGTTGTTTTTCAATGATAATAAAGCTTAGCTGTATAAATTCTTTTAGGTTT
TTTAGAAGGTTTATTTATATCGTGTAATTGATTGTCGTGTTAATATTAATTAAATAAAAGTTTGATGTAATTGCTTTGTG
TTACGCATAATAAATCTTACGAAATTTCTGAATACAACTGCTGGTGATCGGGATATTGAATGCCGGGTCGTTTGAATTAA
TAATACAAATGCTTTCGATTATTGTCATTAATATTTTCTCCAGTGCGTAATGGGCCAGAGTTCCGGTGCCATGATTAATG
GTTCCTAAATTTTAGAAATAACATTTTGAATGACATGTTAAATGTGTATATAATAAATTTTCTAGTTTTTTTGCTAAGAT
TTTGAGAAATTTTAGTTACCTGTTTTTGTTAATTGCTTTGATAATTTCAATGCTGACACGTGCAGAATTTCACACATCTC
CAGCAGTCGACTGAATTCTTGGATTTTGTTTGATACAATTATGCTTGCAGATGTTATGGCGCATAGATCCAAGAAGGCTG
TGAATCTTGGGTCTTGTTTTGTAAAGGAAGCTTTGTAAAATATGATGGGACAGTTGCACATAAATTCTAGGAATCCAGAT
TTTAGGCAAGATTGAAGTAATGTTGAATGGTTCTATTATAGAATAATCAGTTGCACTTTTAGATAACCAATATACCACAA
AGAGCCATCCGCAAATTTTGAAAGCCCAAAGCATTGAATCGTTGTCTATGTTACTCAGTATAGACAGCAGTAAAATGGCG
CTTTTTTGATATTGTAAACCGAAATGATTACTAGAATTCATTGTTTCGTCAAGAGATTTCGCGAAACTCTGAATATTATC
TGATTGATTTGATACTATTCCTTGGAGTTTACAAATTGATTTCAGTTCCAAATTCATACTATTGTGTTCTGCTGATTTGC
TACTATTGGAGCTCTATAAGGAATTATTAGAATCAATTTTGGTTTGATAGTGGGTTTTGCAATCATTGGCTTATTGTGGG
TTGTGTAACCATGGAAGTAATTGTGAATAGTTATAGTGCTCGCTCTGCATAAAATAATATTTAATCAGTGCTTTAAAGTA
GATTTTTAACGATTATTATGAAAGATTTCTCTTATATATTAATGTTTTTGTATCCTTCAAAAGTTTACTAAAAATAATGC
ACATTTGAAATTTACGCGTTACCATAAAATGTCTGAAGTGGTCCAAAGCAATAAAAGCTTAAAAAGAAAGTTCTTGTTTT
TAAATGTATTGGGATATACTCCCACTAACCTTCCGTACTCCGCTGCCTCCCTTCCCATCACATACAATATTTGCTAGTTC
TACTTACAGAGTTGAAAATCGAAAAATTTTCCCAGTCAATGTCCATGATTATGCTGAATAAATTTTGTCCGAACATAATA
GAGATTGCCTCAGCCAGTATTTCTTTCGTTGTTGAGTTTTGATGAATGACATGTGAGACTAAATTTATGGACAACCATTG
ATTTTGGTTTTGCTGAAGTTGAGACTTCTTACGGTAAAGATAAACACGAAATAATGATAAACTCTAATCAAAAGATATTA
CAAACAAATATTATGATATCAAAACCTTCTGTCGAACCAAGGCACTTGTGTGAGATAATAAATGAAGAATGAATTCGAAA
AAGAAGTCATAATTCGAACATCGCTCCAGAATGCTGTCACTGACTTTGACTTCAATCACATTTTCCAATATTGAAATCAG
ACCGGCGATCACATGGACCCTTGATGATTCAGACTGACCACTGATTACGGGTTGATCGGTTAAATTATCTAGAGATTAAA
ATAATAGTCGGTAAAGGAAATTATCCATATAAACGGGAAACAGAAAAGTTTTAACCATGGTTTCAAAAGCTTTTGGGACT
ACCCCCAGCTTTGCAAAACAATTTTTTAACGCTCTTGTTATGACTTGAATCAACATTGTACAATTGTTACAATAGACTTG
ATGATTTACTTATTTACACCCCATCTAAATTGTTTCTTAACCCTTTGCCACCC
>SMED30002168 ID=SMED30002168|Name=Spondin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=2693bp
CAATTGCTTAATAAAATTTTCCTTTCAATAATTACCGTAAAAGTTGATGAAATTAATTTTGAATATTTTATCCACTTTTT
TCATATTGAAATTTGATTTTGCTGAATGTTTCGGATTTTGTGACATTCAATTTCCGAAATCATACGTTGCCTTTTCCACT
AGATTCAATCTCTATACGAATCATGAAAAAGAAAAACTGACCAAAATCACCTCGTACATTCCTGATAAAACCTACGACAT
AACTGTGTCATTGAATGATAAAGCTATGCACGAAAAGTTGACAATAAAAGAAATATACGTCTTAGTCTCAAATGTTCACA
CGGAAATGGAAGAATTGTCGGAACATGACTGGAAAAACGCCGGTGAAGTGGTTTTTAATGTAACTCACGCATCCAAAACA
GAATATTGCCCCCAAAGAGCTTACGTTCAGTATTTATATACCCAACCCCAACATGTCACATTCTATTGGATAGCACCTAA
AATACCGAATTTTTGTATTAGAATAACAGTTATTTTGAAAATGAACGATTTGATTTCAGAAAGCAAATTCGAAGAAAGAT
CCCACTGGATATGTGAACAAAAAAGAAACAAAATGGATCAGATGCAAGCAGATCAATATGCATCTACCTCTTGCGCAATG
AAACAAAAAACTGATCCAGTTAAACAATGTAATATTGGATCAACAGCGGTATATAGAATGACAATTGAAAATAAATGGAA
TTTATTAAATCATTGGAAAGATTGGCCGGGCAAAGACGGGTATTCTCCTAAAATAACTCAATATCTCGGAGCTTCTCATT
CAAATGAGTTTAATATTTATCATCTTGGTGGAATGGCCAATGAAGGAGTTTCTCAGGTATGTGGAAACGGGAGCTACACT
GAATTGCAAAAGCAATTCTACAAAGCTGGGAACGGGATCATGACAGTTATATTGGCCAGGTCACTAGATGCGTCATCAAA
AACCAATAAAAGATCAGCACTGATTGTTGTAAATGCAACTCAACATTTGGTTAGTTTTCTTGCAAGACTTCATCCAAGTC
CCGATTGGTGCACAGGTCTAAGTAGATTTGATCTTTGTAACGGCTCATGCAAATGGCAAGAAAAATTTATCGTCCATTTA
TATCCTTGGGATGCCGGTGTTTACAGTGGAGAGACTTATTTAAATAAAAACGAGAAAACTAGACAGACTCCAATATGTCC
AATCACTAGCAGTTGGCCAAAGGATAACCCTTTCACGGTGATGAACGGAAAAATCAAAAATATCGGAGTGGTAACCTTCC
AATTAATACAAGAATATAACAAAAATGATAACCAGTATTGTAATTCTATTAATTCAATCCTTCAAGACGAAGCATACCAA
AATGAACCGAAATCCAGTGCTCTGAAATCAAATCCAGATAAAACCAGGCATTGCTTATTGTCAGAATGGAGTGAATGGAG
CTCTTGTTCAGAATCTTGTGGTAAAGGTGAAAAAACTCGTTACCGAAAACTGCTGAAAGGAAAATCCGAACAATGCATTG
AATCTTCCCTAACTAATACAGAGAGCTGTAGCAGTAAATGTTCGACAGTAATTTCATTCGAAACATGTTCGTTTCGCTTG
TGGGGCCAATGGAGCCCATGCAATGCTACTTGTTCCCAGAAGGGAATTATTCATAGGGAACGTGTTTTTATCAATGAACA
GGAAAAACACGAATGTATGCAATATTCCGAAATGAAAGCCTCTCTTGAATGTGCATTAGCAAGCGAGAGGTGCAAACCCG
ACGTGATCTGCAAGGAATATGTTTATCCTGGAGATTCGTGTTCTTGGTCTAGCCCATCACAAAGATTTTATTACGATTTT
TCTAGTGGAACTTGTAATGCATTTATTTACAAAGGCTGCTATGGGGGTCTGAATAATTTTCACACCTACGAGGAATGTAT
TTTACTCTGTCGACCAAAATTAAAAGAAACAGATCAAAGACGATTTAATACGCCAGAAACTTATCCCAACCGATGCGGAG
TTTCGATGACATGGGGAATCTTTTGTGATAGTCAATCTTCATCAAACCGTTGGTACTATGACAATATTAATAAAGAATGC
TACCGATTTCGTTTCGGGGGCTGTCGAGGGAATGCCAACAATTTCCGAACTAAAACTGAATGTCAAAATGTTTGCTTGAG
AGAAAAGTCTACTTCAACAACAACGACAACGATCAGTCAGCCAGTAACGGTAAGAAAAGTCTGCATCTATTCCAACTGGT
CGGACTGGAGTTCTTGTGATAACAACTGTCAAAATCAACAAACAAGAATAAGATTTTTAATTGAAAAAAATGACGACTGC
ACCGAAAGTATCAGTGAAACAAGAAAATGTCAATCAGAGAAATGCAATTCGCCAAATAACGGGTTTATTTCACTAAGGAA
TTGCAAGTATTCGAGTTGGTCGGAATGGTCGGCTTGTTCATCAAGATGCGGTCCTGGCGTTAGAGAGAGAAAGCGGAAGA
AACTTTCTCGTAATTGTAAACCGGAATTTCCGCAATTTACTGACCGAGAATCATGTTACAATGCTTGTGCTTATGACTGA
ATCCGGTAAAGAAAAAAAAACTGTCAATGTATTTGTGTCATGACATTTTACCTATTGTGCATTTCATTTTGTGAACTTTG
TTTGGTTTTTGATTTATTTTTTCTTGGTGTTTTTCTCTAGAATATGATTTGTT
>SMED30003202 ID=SMED30003202|Name=Eukaryotic initiation factor 4A-I|organism=Schmidtea mediterranea sexual|type=transcript|length=1324bp
ATTAATAACAATGGAAAATCCAGGAGAAATAGAAAGTAATTACGACAAAATAGTTGAATCATTTGAAGATTTAAACTTAA
AAGAAGATTTGTTAAGAGGAATCTTTGCTTATGGTTTTGAAAAACCTTCTGCTATTCAGAAGCGTGCTATTTTGCCAGCT
ATTGAAGGTCACGATGTCATTGCCCAAGCACAATCTGGAACCGGAAAAACTGCCACTTTCAGTATTGCTGTTTTGCAGAA
TATTGACACTTCTATCAATTCTACACAAGCTATTATTCTAGCACCTACCAGAGAACTTGCAGTTCAAATCCACAAAGTTA
TAATGACCCTTGGTGACTATATGGGAGCTAAATGTTGCTCATGCATTGGTGGAAGAAATGTCCGTGACGACATTAACAAT
TTGGAAAGTGGAATGCATGTTGTTGTCGGTACTCCAGGACGAGTTAAAGATATGATAAAGAAGGGCCATATTAAATCAGA
TTTCGTGAAAATGTTTGTCCTTGATGAAGCCGATGAAATGTTGAGTCGAGGTTTTCAAAATGACGTTTGTGAATGCGTTC
AATATTTATCTGCCGAAACCCAAAATTTCATTCTTTCTGCAACAATGCCAGATGAAGTTTTAAAAGTCAGTAACGAATTC
ATGAATAATCCAGTGAAAATTCTCGTTAAAAAAGAGGAATTGACTCTGGAAGGTATTCGTCAATTCTACGTTAACGTTAG
CCAAGAAGAATACAAATTTGATACCTTATGTGATTTATATGAATCTCTGACCATCACCCAAGCTGTCATTTTCTGTAACT
TCAAAAACAAAGTTATATTTTTAAATGATAACTTGAAAAGTAAAGGATTTGTTGTTTCATCAGTCCACGGTGACATGGAG
CAACAAGCTAGAGACCAGATTATGAAAGAGTTCCGAAGTGGATCAAGTAGAATTCTCATCACCACAGATTTGCTATGCCG
AGGTATTGACGTCCAACAAGTCTCAATGGTCATTAATTATGATTTGCCTAAAAACAAAGAAAATTATATTCATCGAATTG
GCAGAGGAGGCCGATTCGGAAGGAAAGGAGTTGCACTAAATTTTGTCACAGACAAAGATATTGCTGAAATGCAGGAGCTG
GAAAATTTTTATAACACCAAGATTGAAGAGATGCCCATTAATTTATCTGAATTCTTATAAATGATTTACCGCTATTTTTG
TAAATAAATTTTAATTTACAATTAAATTAGGTTATTCATAACTTCCTTTGTTACGTAATTTTTGCTATCTTATCTATTTT
TGTTAGTAATGTATTTATGCTGCGTCACATTTTTGTTGCAAATT
>SMED30020614 ID=SMED30020614|Name=ATP-dependent RNA helicase dbp2|organism=Schmidtea mediterranea sexual|type=transcript|length=2242bp
CTTCCGATCTATTTTGTTTAACTTTTTCTCACTTTTAAATAAATATTATTAATCCAAAATGTCAGATTGGTCTGACAATG
GAAGAGATCGTTCTGGAAAATACAATGGCAATGACAGAAGTGGTCGTCATGATCGAAGCGATCGTAATGATCGAAGTGAT
CGTAATGATCAAAAGGAACGAGGATTTAGAAGCAGTTATAGTGGTCATAATGATAAATATAGCAAAAATAGTAGAACCGA
AAGAAATGGATTTGATAAAAACAGGAAGGATAAATCTGATTGGAACGACAAATCCAGGCGATCTAGATCTCGTTCACCCT
ATAGTAATTATAGATCGAAAGATAACAAAAAGGATGAACAAACTTTAGAAGTTGTTGATTGGAAAACCCACAATTTAATT
CCATTTCAAAAAAATTTCTATAAGGAGAAAGCTGTTGTTTTGTGTAGATCACCAGATGAAGTTGAGAGATATCGTAAAAT
AAAAGAAATGACTGTTGCTGGGGATGATATAGCAAAACCAATATTCTCATTTAATGAAATTGATTTTGCTCCTGAAATAG
TGTCAGTGATTATTAAAAATGGATGGGTTGAACCAACCCCAATTCAAGCGCAAGGTTTGCCTATGGCATTAAGCGGTAAA
AATGTTGTAGGTATAGCGAGAACTGGTTCAGGCAAAACTGCCAGTTTCGTTATTCCAGCAATTGTTCATTTAAAAGCGCA
ACCTAGATTAAGAAAAGGTGATGGTCCCATATGTTTAATCATTGTTCCTACGAGAGAACTAGCTCAACAAGTACAAGGTG
TTGCAAATGATTTCTGCAAATCTTATGGTATTAAATCAGTGTGTTGTTATGGTGGAGCTCATAAAGGTGATCAGATTGGT
GAATTACGCAAAGGTGCGGAAATAGTAGTAGCTACCCCAGGTCGACTTATAGATTTACTAAAATGTGAAATAACAAATCT
TCATAGAACAACTTATGTTGTTCTTGATGAAGCTGATCGTATGTTGGATATGGGGTTTGAGCCTCAAATCAGGAAAATCT
TTAGTCAAATTAGACAAGATAGGCAGACCTTGATGTGGTCAGCTACTTGGCCACGAGAAGTTCAAAAATTGGCTCAAGAC
TTTCTTGGTAAATACATTCAAGTAAATATTGGATCTAGAGATCTGCATGCAAATCCTGATATACAACAGTTTGTTGAAAT
TGTCGATGAATATTCTAAAGATACAAGATTAATTGAAATAGTCAGGAAAAATGCTTGGGATAAAATGATAGTATTTACAG
AGACTAAGAAAAAGGCTGATAAGATTTGTGGATTACTTAGGTCTAGTGGTTTCAATTCCGGATCTATGCATGGTGATAAA
TCACAAAAAGATCGGGAATATATTTTACAAGGATTTAGGAATAAATCGTTGAATATTCTTGTTGCTACAGATGTGGCTAG
TAGAGGATTAGATGTTGACGACATTAAAATGGTCATCAATTATGATTTTCCTAATCAGTTTGAAGATTACATACATCGTA
TTGGAAGAACTGCGAGAAGTGGAAAAAGTGGAATGTCATATACATTTTTTAATAATAAAAGTGCAAAGAGTGCTTCATCA
CTTATTAAGATAATGGAAGAGGCTAAACAAATAGTTCCTGATAGTTTGTACAAAATGGCTTGTATTCCAAGAGATCGTCG
AAGAACAGACTTTCGTTTTCAACAGCCATTTTCTAATGGATTTTCTCAGCAGCAGTCAAATATATCCTCAATTGATTCTG
GTACTATAAAAAATCATTATACCGATTCGTCTAAGGAATATAATTTTGATAAACCTCACGTGACACCAGTTTCCCAGACA
AACGGAACACCACACAGAGTCAGTAGATTTGGTGATCGTATTACCCAGTTGCCAAGTTCTTTTACTTTACCACCTCCGAT
TGATAGTTTTGTTAATGATGTGCATTGTAAACCGGTTATACAACCACATCATCCTACTTCTAATGGAAATGTCAATGGTG
GTGTATATACGGATAATTTATCTGATTCTAATATATTTAACGATCCCAGATTTAATCACATGGCGTTTTACGGAGTACCT
CCTCCAATATTAAATGGATCTATTAAACCTTTGTCGTTTGAACGAGACTAGTGATTTTTCAATTTGTCATATCGTTGATA
TTATGAAATATTCGAGTTTTGTTTGACAGGTTAGTTCTTCAGTAATCATATTGTTTTTACGTAATAAATGTTGAGTTAAA
TG
>SMED30027646 ID=SMED30027646|Name=Transcription factor BTF3 homolog|organism=Schmidtea mediterranea sexual|type=transcript|length=541bp
AAATTAATTTGTTTAAATAAATTTCTTTAGAATCACGCAATGGACGGTTTTAAAATTAACACTGAAAAATTAGAAAAACT
TAGTAAGTTGTCGGAAAATGTCCGAACAGGTGGTAAAGGTACAATGAGACGAAAGAAGAAGGTCATTGTCAAGAGTTCAG
CAGCAGATGATAAGAAATTAGAGGCAACCTTCAAATCATTGTCAATGAGCCCGGTTCCAGTTGAAGAAGTAAACATGTTC
AAGGATGATGGAACTGTTATTAATTTCGTTAATCCAAAAGTCAATGTGTCACTTCCATGCAACACTCTCTCAGTTACTGG
AAAATCCGAAATTAAGCAATTGACCGAAATACTTCCAAAAGTTTGGCAACAACTTGGCCCACTTAAAGGAGATCTTTTCA
AGAAAATTGCACAAAACATGGAAAATCAAGCAACTGTCGAAGATATTGATGATGAAGACGATGACGTTCCAACTCTCGTC
ACAGACTTCGATCAACAAAGCAAATTGGAATAACTTTTTAATATCAATAAATTTTTTGGAC
>SMED30025427 ID=SMED30025427|Name=Translationally-controlled tumor protein homolog|organism=Schmidtea mediterranea sexual|type=transcript|length=570bp
AAGTAATACTTTTATCATTTAATTGAAAAAATGCTCATTTACAAGGATATTGTTGCCGGCGATGAGTTGTGCTCTGATAC
ATTCCCAATGACGATTGTCGACGATGTCGTTTACGAATTCAACGGAAGAAATATTACTATTAAAAACGGTATTTCTGACG
CCCTCTTTGGTGGAAATGCTTCAGAGGAAGCTGCTGGCGATGATGACGTTGCTGATTCGGACGAGACAGCAATTGACATT
GTATACAGCAACCGATTAGTCGAAATGAGCTTTGACAAGAAAGGTTACACGAGTTACATCAAAGGTTACATGAAAAGTAT
TTTGGAAAGATTGAATGCCACTAATAAAGAACGAGCTGAAATCTTCAAATCCAAAGTCGGTGCCTATGTTACAAAAATCA
TCAAAAATTTTGATGAATATCGTTTCTACTGTGGAGAGTCAATGAACCCTGACGGAATGATCATTCCATGCAATTACAGA
GAAGACCAAATTACCCCATACTTTGTTCTCTTCAAAGATGGCCTCGAAGAAGAAAAATGCTAGATTTCTGTTAAATAAAT
TTAGTGGAAC
>SMED30035063 ID=SMED30035063|Name=SOXP-2|organism=Schmidtea mediterranea sexual|type=transcript|length=2664bp
TGTACATTGAATTCAATATTTAATAGTGATTAACTTATCCAAATTTTCAGCCACTTTTAGTTTAATTTGCGTGTTTTGTT
GAGCAGTTTTTATTGGCGCATTTTATAAAAAATACAAAACCAATCCAAATCAGTTTGAATCATTGTCAGATTTTAGTCGT
GCAAGATACATTATTTCATTTTAATTCTCTAGCATATGACATTTAAACATGGAGCTGAATTACTCGTTGAATGATAATAA
TTTCAATTTACAATTAGAAAGCGAGTCCTTGACTTATTTCGATTTATGCCAAAAATGTTCAGCGTACCAAAATAGTCTTA
GAGACTGGATGAAACATTTAGTTGACAGACATCCTTTACCTATTCAGTGGATGAGTGATTTGGCAAATAATTTAACAGAT
GATAAATTATCTAAGCCATATTCGACCGTTACAGAATCCCGTAAAAAACGCAAGAAGCATATCACTCCAAGGCCATTGAA
TAGTTTCATGATATTTTCCAGACATTTAAGAAGAAATGTTCTTATTTTCTTTAGTGATGCTTCAAATTCAGAAATAAGCA
AACTTCTTGGGAAGTTATGGAATAACATTCCAGCTACCATTAAATCGATGTATGATAATGAAGCTAAAAAGCTTGCAATT
TTACACTCCAAAGAATTTCCTGAATATAAATATCAACCTAAAAAGAAAAAAAAACAATATCTAACGAAATGCCCCATTAA
TTCCACACCTTTGTCGAGTAATTCATATGAAAGTATTCAAGATATTAATTCAGTAACGGATACACTACAGAATTCATCTA
ACAACTTACAAAAGGAAAGTAATCCGACCTCTGTTTCGTCTTATGGAAGCAATCAGGAATGTAATAATTCATTTAAGAAT
CATAGTGTACAGTCCAGCAATTTTCCCAAAGAAATCAACCATAAACCAAGTAGAAAAATTGAAAAGCAATCGTGCAAAAT
AAGTTCCAATCAAATAATGGATGATTCAGAAGGGGCTGAATCCAGTCCATCATCATTTAAAAACACCATTAAAAATGAAA
TTTATTCCTCTTATAGTCCATTTCTAAATGAATCCCATAGCATTCTTTCAGATTTAAGTTACTCTTCGTCTCTCAATAAC
GTTTCAAAACACACTAGCGATTCCATTATAACGAATTCTCCTATCAGAGAAGAAATTGTCTTAGAAAATAATCAGCCCTC
TCAACAGAATAATATAAACAATTACCGACACGTATTTCAGAGAACTTCGACTCTATCCAACAGTTTGTTGACCCCTTTAA
CCATTGTCACAGAAAAAGTTGACGAACAGAAAGATCTTCCACCATCAAGAATCAATATCCGATATGTGAAAATTAACAAA
CTACCGATTCAAACAAAATCCGATTTCCCATTGACTGGATATTTTCAAAATTTCAATAACGACTCAAATCTTCATTTTCA
GAGTTCCATTCACGCCCTGAATACGACATTGACTCCAGATCTGTCGGTAAAACGCGAAGCCACTGTCAACAACAGCATGA
CAGATTATATCAATCGAAAACGTACAAATGTCGATCCACTTATCATCGATGATATATTTGAAAACGAACAATTTGAAGAT
GAGGAAGTGTTGAATTTTGACAATCCTGATAACAATAACAGTTCTCCTTGGTCGTTTAAATCGCCTAACTTTAAAATATC
TACCGGTTCCTCGACACTGTCAGACAATCCGTACAAAGAACAGTTTTGTTCTTCCCCGTTCCATCTATCAGAAACTGATA
CTCAACCGATTCCAGTTCAACGATTGCCAGCAATCGGCTCATGGTTAAAGTCAAACTATTCTGAATTCATGATCTGATCC
AATCTATTATTCTATTCAATTGTCTGTTTTCATACAATTAGGATTACTTGTTATGAATTCTAGCTGATTTTGAGTGTGTT
TATAAAGCTTTTGTAACGCCTTTTCTATACAGATGTTCGATATATATATATAAATAAATAAATATAAATATATAACAATT
TTATTGACATTGTACAGTATTCCATAAGCCCGATCTTGTAACGCATTTATTACTATACTCAATAGACCAATCTATATGTT
CTCATAATTTCTATGTTGTTATTGTACACGGGAATTATTACTATAAATGATGCGAATTTATCACTTTGTAATTGAGGGAA
ATTATCGATCAATTTGCGCTTTCAGACATTTTTCATGTATAAACTTGTTTTTCTCTTTTTTATCATCAAAAATTTAATTT
TTTTGATATCGCTATTCATCATATTATTATTCTCCGTTGCATTTGTTAGATTATGTAAATTTTTATATGAAAATGTTGTT
ATTTATTGTATTTTTATACGATTTTTTGCTTTGGATACACTTTTATCAAATCATATTGCCAGTGTGAGCATTTATTGGAC
TTGTTGTTATTGCTGCTGCTCGAATAATTGCTTCATACGGGGAGTCTCGATATTTTCATGAAGCGATTTTCATGGTTGCC
GCTCTCCGCCGCCGCCATTCGGTGTAAATATCAATTGCATTGCCAGCACGTTTTCTCAAACTCAATTTTTGTACTCAATT
TCAATTGATTTATGTTCATTTTATTTTTCATAGAAATGAGTAAATAAATTTTCATAAATAGTTTTGTTTTCAATATTTTT
AGGAAATTTGAATGTGTCTCTAGA
>SMED30035179 ID=SMED30035179|Name=Spondin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=889bp
AGAAAGGAACATGACCATTTTGAGACTTTTTTTCTTATTTATATTACTTATTAATTTATTCAGTAGTCGCAAATGTGCAA
ATTGTGAAAATCGATTCAAATCCGATAAATATTCAATTCAAAACGGTAACGGAGGATTCTATTTGTATTTCACTGACGAG
CATGGCAACCAAGTTGAAAGATTTCAGCCTGGAAAAATTCACCGAATCCTCGTCAAAAACGACATGATCGGAGTCAAGTT
TCACACATTTCAGTTGAAAGTCTTCCCGACTGAAAAGGTTAAAAGAAACGAATCGTTGGGAACTTTCAAATATCCCAAAT
TCATTACCGAGGATCCTCAATGTCCGGGAGTTTTCTCAAATAACAATAAACATCTCGTGTCCAAGGTCCATATCAACTGG
ATTGCGCCTCAATATCCGGAACAGTGCATCAATTTACAAGCAACCGTTGCCATGGACTCGAATCTTGTTTATCAGAATTC
TCACAACTTGCAAAAAACTGTTTGCTCCAATGAAATGTTTACTTTTATAAATGACAAGCCTATTGTAAACAATGGAATGA
AGACGGCTTACAAACAATGTTGCGCCTGTGGAACTGCAAGTTATCGGGTGACTTTTCATGGGTTATGGAACAAAACCACT
CATCCGCAAAACTGGCCCCAAGAAAAGAATCAGCTTCATTGGAGTGGCCCAGTTGGTCACCCACAATCATAATTACTTTA
TTTATCATTTGGGAAGTCAAGCATCCTATCCATTTAGCAGTGTCTGCACTACCGGAGGATCCACTGCGTTAAAGGAAGAA
TTCATATTACCTGAAAATAGATTAAATGTTAAGAGTCTCTTTACGTCAGGCTGGTTAAATGGGGAAGAACAGCTAAATGA
AGAGCGTTC
>SMED30030773 ID=SMED30030773|Name=ATP-dependent RNA helicase dbp2|organism=Schmidtea mediterranea sexual|type=transcript|length=1968bp
TTTCTTTAAACGCATTATTTTATTTAATATTTTAACTTTCCATTTACAATAACAATAATTTAAAAGATGAATTATAGATA
CAGAAGAGAAAGATCTCGATCTCCTATTAGCAGATTTGGAAGTAAATTTCAAAAGAAACAATTTGACTGTGAAATTACTA
AAATAGATTGGCCTACTATTAGGCTGATGCCATTTAAAAAAAACTTTTATATTGAGCACCCAATTGTGACTGCTAGAAGC
TCATACGAAATAGACAGATTTAGAAATGAAAAAGAAATGACAGTCGTTGGCAAAAATGTCCCACGGCCGATATTTAATTT
TAGTGAAATGAATTTTCCAAATTTTATTTTGACCACAATATTAAAAAATAAATGGGTTAGACCAACACCAATTCAGTGTC
AGGGTTGGCCAATGGCAATGAGTGGTCGAAATGTTGTTGGAATAGCACAAACAGGATCTGGAAAAACTGCAGCTTTTTTG
TTACCTGCTTTAATTCACATTCGAGCACAGCCGCCTCTTGTAGCTGGTGATGGTCCAATTTGCCTAGTTCTTGTGCCTAC
CAGAGAATTGGCACAGCAAGTTGAATCAGTTGTAGAAGAATTTGGCATATCAGGTGGATTCAATATGGTGTGTGTTTACG
GAGGCTCTGATCGGCAGAATCAAATAAAAAATTTACACACTAAACGCCCAGAGATATTAGTTGCTACACCAGGGCGCTTA
TTAGATCTCTTGAAACAAAACGAGACTAATCTAAGACGAACTACCTATTTAGTCTTAGATGAAGCTGATCGAATGCTCGA
TATGGGATTTGAACCACAAATACGCGCAGTTCTAAATCAAGTAAGACCTGATAGGCAAATGTTACTGTGGTCTGCAACCT
GGCCATTAGAAGTCAGGAGGTTGGCTGAAGATTTTTTAAATGAGTATATTCAAGTTAATATTGGGGCTATGTCATTACAC
GCCAATCATAATATCTGTCAGTATGTTGAAGTTATTGACGAATTTGGCAAAGAGCGTCGATTAATTGAGTTACTTAAACA
ATTTAATGGTTTGAAAACATTGGTGTTTGTCGCTCTAAAGAAAAGATGTGATAGAATGTCAGATATGTTGAATTCTAGAA
GCTTTAAAGCCTTAGCCATGCATGGAGATAAGCCTCAAAGAGAAAGAGAACGCGCACTTGAAAATTTCAGAAATGGTAGA
TCAAATATAATGGTTGCAACAGATGTCGCTTCAAGAGGATTAGACATTGATGACATAATGTTGGTAATAAACTATGATTT
TCCAACACAAATCGAAGATTATGTACACAGAATAGGCAGAACTGCCAGACAAGAAAAGAAAGGAACATCTTATACATTTT
TTACAAATAATGAAAAAAAACATGCTCAAAAATTAGTTTCAATTTTGGAAGAAGCTACTCAAAATATTTCGGATAAACTA
TATGATTTGGCGGAAGTTCCGTATTCGAGTCGCAAGAAGTCCACTGCAAATGTACCCAAAGGATTAGTAACAGGTACTCC
TGTAAATAACGATTGGGTAGATTCCGTTACTAATAAAAGAATGCCCAATAAATTTAATGGCGGTATTTCTCGTGATAACT
TTTCAAATGTGGAAAGCGATCATAGAAAGCCAGATTATTTTAAATATAATGGCAGACCGGAAGAAATAGAATCGTTTCCT
CCGAGTAATACTTCTTCATTTAGAGATTCCGGAAATTGGAGAAATAATGAGTCTTTTAATAATTACAACCAACCACAACA
GCAGCAGCAACATCAGCCTCCCTATACTAATAATAGCAATAGCTATAATTCAGCCAAAACTTTCAATTATAATGATGATT
TCAATTCTGTAGGAATCATTGCTAATAGATGGTAAACTTAGCTTATATGTTCTTGTTATATGTTGTAGTTTAAACTTTAA
TTGTAATCAAATTTGTTGTAATTATTTTAATTATTAATATTATTCTTT
>SMED30013909 ID=SMED30013909|Name=tud-1|organism=Schmidtea mediterranea sexual|type=transcript|length=2414bp
ATTTAGAAAATGGAGGCAACTTGCGATGTTTTTTTAACGAATTTACCTAAGTCGATTAATGAAGTAGTTGTGAAGAACTT
ATTTTCTTCTGCTGGGAAAGTGTTAAAAGTGAAAATAATAGATGACAAAAGAAACGAAAATCAGAAGCTATGCTTCGTTG
GATTTCGAACTATGGATGAAGCATTAGAAGCCGTCAGAATTGCAGATAAATCTGATGCGTTTGGTGATCCAATTAGAGCC
AGTATATCAAAGAAGTGTTTAGACGGAATGGAGAATAATCAAAATAGATCAAATAATAACAGAAATGATTCAAGTTATAA
AGGAACTGATTCATTTTCAAGAAAGAGTGATTCTAATTTCAAGGATAGTGAAAAGTATCCAACAAACAATGGTGACTTTG
CACAAGTAAATCGTTTAAACAACGTTGGAAGAGGAAGAGGAATCCAGACTAAAATTATTAGTGGTCCACCTTCATTCAAA
ACTAATGAAATTAAGTTAAACGATATTAAACTTAAAACAAAAGAACTGATTGACATCGAAATCGTCGATTTAAGTAGAGT
TGACATTATACTTATAAGGCCAGTAAAGTCAACGGAAAATTCAAAAATTGAAATAGCAGATTTATTGTCACAAATAAATT
CAAATAAATCGAATCTAATGCCAGTTGACTGTCCTAAAATAGGAGATTTTTGTCTTGCAAAATGGACTGAAGATGATTGC
TATTATCGGGCTGAATTGTTAGATATATTAAAGGATGGATCTTTCAAAGTTACTTTTGTTGATGAAGGAACTTCGGGTGA
TATTGTGACTGATTTGAAACACATTCCGACTGGTGCTTTACAGCAGTATCCTAAACAATTTTTGAAGGTTTCAATCGGTT
GCTCAGACGCAAAAGAATTAATGTCATTTATTTTACAAGAGTCTGAAGGAAAGGTGATTAAAATTTATTGGCTCGGAGAA
TATTGTGATTCCGTGCCTGTTGTAAATTTATTTCTGAATGAAGATGAAATTGTGGAAAAATATACCCAAATAAATAAAGT
AAATATCAGGAAAAAATTCTCACAGACATTTGATGATCTCCCAGTACATAACCTCGAAACTAATTCACATTTTTCAATAG
CACCATCAATGTATAAAAACCGAAATGATTTTATTCTTCAGATGAAAACTTTCTCGGTATCTTTAAAGCAAAAAAAATGT
CCTACGGTTTTACCAATTCCTGGTGATATATGTATATATGAGAAAAGGAATGCTAATGGCGAATCATTTCTTCGTTGTGT
TATATTAAGGCGCCAACTTTTTTCTTTTGACATCGAGTTAATAGATATCGGTGAAAAAATAATGAATGTTAATATTGATC
ACCTGTACACAGTCGAAGATATTCATGTAAAAGACGCTCCCTGTGCTATTACTTGCGATTTAGATAGTTCTATTAATATA
GATGGTATTAAGCTCCCTCAAGATTTGATCGATGGTGTTCTCTTTAATCTTAAAAAGTACAACAAAAATAATAAATACAC
TGTAAATTTCATTTTACCACAAAAGAAAGCTTATGAATATGCAAAAGTATCATATAAAGATTTGATTGGTAAAAGCTTTA
AAGTAATAATGTCGCACGTTGTCTCTCCCATTAATTTCTTTATTCAACTTGATGATGGAGAGCATCAGCTTGCACTTGGA
GATATTCAAGAAAAATTAAATATTAATTATAATGGATCACCATTCAAAAGTGCTAGCGATGTTAAAGAAACTCAGGCAGT
TATTGCTCCTTTTATTGTTTCCGGAAGTGATGCGGAACTTTTTCGGGCTTATGTTTTAGAGAAACGAAAGGAATCTCCAC
AAATTCATGTATTGTTTATTGATTATGGTAATGATGAATGGGTGAATTATGAAACTTTACTGAATACAAATGAAGAATTA
GTTTCTAAACCAGGTTTCGCAATACATTGTAAATTATCTCTAAATATTAAGAAGGAAGCGTGGAGTCACGCTATTGAATT
ATTTAATGATTTAGCTGGTTATACTGAAAATGACCAGGGGACGTTTGTAATGCAGGTTATTAGTGTCGATGGTGATTCGT
TAGTTGTGGACTTGATTTCAGAACTGAAAGGTTCGTTGACGGCCATCTTAGAAAAAAGTGGTACATGTGTAAAGTCCAAT
GAACCAATATGTAATGGAGGAGGACCCCAAGTTAAATTAAATGGCGTTTCAAATGATAAATCTCAATCAGCTATTCTTGA
AAATTTATCTGAAGGAGAATTATATAAAAAATTTATTGAACTAGAACGGAGATTAAGTGCTTTAGAGATATTGATGAAAT
AATGCTACCCGCGCAATTAGTATTATCAAATTATGATAATCTAGTCTTGATGTGTTTAAAATTTTGTATTTTAACATAAA
TTTATTCCGTGTTG
>SMED30012850 ID=SMED30012850|Name=Spondin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=2699bp
GGTGAATGAAAGATTGAAAGTAAACAAATTTATGAGACATTGACATTATTCATTTAACTTACATCACAGGACGACCAATA
TCACATAATACTTCTTCCTGTTTACAAGGTTGAAGTCGTTTATATAAATCGTCAAAGTCTCAGTTAAGATCATTGATATT
ATGAAAATTTACATCTTAATTTGGAATATCCTTTGGATGTTGCTATGTCTTCATTGGATGATCCAGGAAAGTTTTGCCAT
GAATACTAGAACCAATTGTTTTAAAATGCATAAAAAAACCTACCAAAAAGTCATGATGAAAGATGGAGAATTTCGAATAG
TAATTAGAGACATGAAAGGCAAAATGGCAGATAGATTCGAACCTGGTGAAAGCTATAGAATAATTTTGAATAATGCAATG
TATGGAATGGATTTCAGAGATTTTTCAATATTCGCGGCCTACGAGATGGAGGATTCGTTGCAAATGGAAAGTCATAAAAT
GATTCCCGATGAAGGACTTGGTCATTTTATTATAAATAAAAAATTTGGGTTGGTTGATTATAAATGTCCTAACAGAATGC
ATGGAAATGATAATATGTTTCTAACTTATGTAGAGTCGACATGGATAGCTCCGCATAATCCTATAAATTGTATTCGCTTT
GAGGCTCAAGTTGTAAAATTTGATTTTATGGTGTATGAAAGTATCGGACGTTTAGTAAAAGTTATTTGTCCAACAAAAAT
GTATAAAATGATTAGTGAAGAAAATAAAAACATGAAAATATCTAAACCTTTTGATGAGATGACTCCTATGGTTAAAGAAT
GTTGCGCTTGTGGAGTAGCGTCTTATAAAGTAACATTTATGGGGTTATGGTCAAAGAAAACTCATCCCAAAGATTGGCCA
AAACAAAAGAGCATGGTTCATTGGACCAATCTTATAGGGGCCACACATACTGGCGATTACTTTATATATTATAACGGTGG
TCAAGCAAGCCAGGCAGTTCAAAGTATTTGTTCATATGGAGATAGCACGGTTTTGAAACAGCAGTTCGCAGAAGAGACAA
TAAAACCGCATTTGAAGAGTTATTTTAATACTTCAGGCATGTGGAATGAAGACGAAATTGAACAGAGTAGATCGGGATTC
ATATCGGTTAATCGTACTCATCATTTCTTTAGCTTTCTCACAATGATGGGCCCAAGTCCTGATTGGTGTACTGGAGTAGC
AGCTGTAGACATGTGTATGAATGATTGTACATGGAAGGATGATTTCACCATGGATCTATTCCCATTTGATGCTGGAATTA
AAAACGGTTTCACATATTTCCCAGAAAATTCGGACAGGCAAGACATTCCTGATCCAATTAGAACAATCAACACTACATAT
ATGACCCAATTCCCTTTCACAGCAAATGTTCCAGTTGCCCGGGTAATTTATCAAAAGATCAAACCAAAACACAATTGGGA
GTGCACCAAGATGAATGCAAAACAAGTAAAAGAATTTGATGAAATGAATTCAAACAAAAACGGAAATTCTCAATTCGATG
GAAGTAGTTTGACGAAAAAACGCCGACACATTAACAAGAAAAGTCCCCTTGATGATCCGACTTTGGCCAATATGGCTACA
TTTTTGTGTATAACATCTCCATGGAGTGAGTGGACTAAATGTTCAGTTACGTGTGGCATTGGGACAGAGATGAGATCTCG
AGACATGTTGAAAAATGCTAAAACAGAATTATGTCGTCACTTACCTTTGCTTGAAAGTCGGACATGCGAAGGAAGAAAAC
GTTCGTGTGATTTCTCAGCACCATGTAGCCTTCTTTCCTGGTCAAGATGGGGTCCATGCAATGCAACTTGTGAGATGCAC
GGATACCAACAGAGATCTCGAATGTTTGCAAGATTTGAAGAAAAAGAGAAATGTCTCAAAAACAAAGAAAGACGATTTAA
AATTTTTGAAGAAAAACGGTGCAAAAAAGACACAGCCTTGTGTGACCCAGTTATTATATGTAGTGAGGGCCTAATAATGG
GCAGCAGCTGTGGCAAGCCTGTTATGAAATATTTCTATGATGCTGCCAAACACAGTTGTGTGCCTTTTGAATACCTCGGT
TGTAAAGGAAGTCTGAATAACTTTCCTTCTAAAATGTCTTGCGAAAAGACTTGCTTAGCAGCTGTCAATGCGCTGCCTCA
GTGGAGAAAAGACAAAATGGCTCACTTACAGTTTCAGTCTCAGTCGAATTCAGATAAACGAAAGAAAATGCCAACAATGG
CTAACAAATGTCGGCTTGAAGTAAAATACGGCGGAATGAATTGCGATGGAACAATGGGACCGGACATTCGATATTATTAT
GATAACAGAAATGGACGCTGTAGACAATTTAAATACACTGGCTGTGATGGGAATAGTAACAACTTCCGGTCTTATCACAG
CTGCATTAAGGCTTGCATGCCAGATCAAATCGACTTTATGAAAACTGCTCCGATCAAAGCTTGTCAAGTATCTGAGTGGT
CACATTGGGGTCCATGTTCTACGACCTGCGGTGTGGGAGAGAGATTCAAATGGCGATCTGTGCTTCGGCCGGCATTGAAT
GGCGGTCCAGCTTGTCCAGAGTTATTTCTATCGGAACCTTGTTTCGCGACAACTTGTTGAAAAATTTATATAAATTTTGT
ATCCATTTTTGATGACATTTATAATAATTTTATGGGTAAATATATTTTAGTTCTTCCTC
>SMED30025221 ID=SMED30025221|Name=Eukaryotic initiation factor 4A-I|organism=Schmidtea mediterranea sexual|type=transcript|length=374bp
GGAATGCATGTTGTAGTTGGAACTCCCGGAAGAGTAAAAGATATGCTAAAAAGAGGTCACATCAAATCAGAATACATCAA
AATGTTTGTACTTGATGAAGCTGATGAAATGTTGAGTCGAGGTTTCCAGGAAGATGTCTGTGAGTGTATTACTTATCTTG
AAGCCGACGCTCAAATGTTCATTTTATCTGCCACAATGCCCGATGAAGTTCTTACAGTAACAAAGAGATTCATGAAAGAT
CCGGTAAAGATCTTAGTCAAGACAGAAGAATTGACTTTGGAAGGAATACGACAATTTTATGTCAATGTTAGTCAAGAAGA
ATACAAATTTGACACTTTGACTGATCTCTATGAATCATTAACGATTACACAGGC
>SMED30032088 ID=SMED30032088|Name=Spondin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=1776bp
TTACCTGAAAATAGATTAAATGTTAAGAGTCTCTTTACGTCAGGCTGGTTAAATGGGGAAGAACAGCTAAATGAAGAGCG
TTCTGGATTCGTTTCTGTTAATAGAACTCATAATTTATTTAGTATGATTTCAATGATGGGACCAAGTCCGGATTGGTGTA
CCGGAGTGTCAGGAATCGATCTTTGTATGGACGGATGCAAATGGAAATCAAATCTAACAATTCCTCTTTATCCTATCGAC
GCTGGAATACAAACTGGAGAGACCTACAAACCAAATAATGTCACAAGACTTGATGAACCCGACACTATTAGAGAAATTAA
TAAAATTTGGATGAAAAGTAATCCTTTTACTCCAGATACTCCAGTAGCAGAAATCACCCTCACCAGAGTAGAGCCACAGA
AAGACACACAATGTGTTAAAACTCCAGTTAAGGGTGTAAATGAATTTCAAAATGCACAAAAAGAGTCTAGATCTAACACG
CTCGGTAGAAATGGTGCCGTGGAAAAATATAATGTTCTAGATGATCCTCAGTTAGCTCAAATGGCAAAAGCCTTTTGTGG
ATTTTCCGAATGGACCAGCTGGTCACCATGTTCCGTAAAATGTGGAGAAGGTGAAACGTCTCGTACTAGAAATTTGATAA
AAAACTTGAAAAATGAATTGTGTATTCAATTGCCAAGAAAGGAGCAAAAAAATTGTGCCGGTGCTCGATTGGAATGTGAT
CTCTCAAAGAAATGTAGTCTATTACCTTGGAGCTCATGGAGTCCGTGTTCTGCATCTTGTACAACTGAAGGGAAAATGAT
CAGAATTAGAAAATTTGCGAGGTCAAAAGAAAAGGACGAATGCATGAAAAACGTCAAACCAGAAATTATTCTTCAACAAG
TGAAAACTTGTAAATTGGATAAAACGGACTTCCGATGTGATCCGATATCAATTTGCAGCGCCGGTAAATTGGCACCTTGC
ATCAATGGTAAACCCAAGACGAGATTTTTCTACCACATCAAAACTGGAAAATGCGAACCGTTTAAATACTATGATTGCAA
AAAAGGAAATCTGAACAATTTCCCAACTATAGATTCATGTGAAAATGTTTGCTCTAAAGTTATTCAGGAATTACCAAAAA
TAAGACGATCTAATTTAGCCTTGCTTCAAGCAAGAACATCTTATTCAGCTGAAGAGAGTCTTTCGCAAAAAGCCAAAAAC
ATTCCGGAATTCTGCTTTCATGAAGTGGATTCCAGTAAGACCTGCATGAAATCCAAACCAAAGACAATCTGGTATTATAG
TCATCGAAATCGAAAATGCCAATCACTGGTGGATTATGATTGTAAAGGAACTTTAAATAAGTTTTCGACTTTCGACGATT
GCATGAAAACCTGCCGACCTGATTCACAACTCGAATCATTGAAACTTGATAAAGTAGATTGTCAGGTCTCTGAATGGAGT
TTATGGAGGCCATGTTCAAAGTCATGCGGTTGGGGAACTCAATACAAGAAAAGAGTCATTCAAAAGGATTCATTGAATGG
GGGCTTACCATGTCCGGTGCTATATGAATCTCGAAAATGCTTTTCCAAACCTTGTTAATCTGTCAATATTTATTTAAAAA
TTGTTTTTTGTGAATTATAATTTCTATTTCTTAATCTATTTGAAAATGTAATAAATATTACTTTGCGTATTTGATTTAGT
TTAAAGTTTTCTCATTGGTCAATCCGCCGTTGCTAACCAATGAGATCGGCTACTACATCAATTGCGATAATTGACAGTGG
TGAGCAAACCTTTAAG
>SMED30022389 ID=SMED30022389|Name=Proliferating cell nuclear antigen|organism=Schmidtea mediterranea sexual|type=transcript|length=915bp
GTTATTAACGTTATTGGACTATAGTTTTATTATCATAAATTTTTGAATAAAATTGAGATCTTCTTTTAATAATGCTATTT
GAAGCAAAATTAAATAAAGTAGATGCATTTAAAAAGCTGATTGATTCGGTTAAAGAATTAATCCAAGAAGCAGTTTTTGA
ATGTTCATCCAAAGGTATTGAATTACAAGCAATGGATAGTTCACATGTTAGTCTAATATTTCTTTTAATTAAAAAGCAAT
CTTTTTCGTCTTATAAATTTACGAGAAATGTATCTTTGGGTGTAAGTCTTGTAAGTCTATGTAAAATACTCAAACTTTCT
CAAATTAATGATTCAATTACAATTAAAGTTGATAATGAATGTGAAACAGTCGAATTTGTTTTCGAATCATCAGATAGTGA
TCGAATGTCTGAATTCAGTTTGAAGTTAATTGACTTGGATATTGACTGTTTAGCTATTCCGGAATCAGACTATGATTGCG
TAGCAACAATCCCGTCTGTAGAATTTAACAAAATATGCCAGCAATTAGCTGTTATTGGAAGCACTGTAACAATTGTAGTA
ACTAAACAGTCAATTCAATTTTCTTGCTCCGGAGACATGGGGAAAGGGAAAATATTATTAAATCAAACTGTAAATAAACC
GAGAATAGAAGATTCTATTAATATTGAAGTTGTTAATCCATTATCAATGGTTTACTCGCTTCGATTTTTTCATATATTCT
CGAAGGCCTATTCGCTTAGCAACAGAGTTTCTTTATCTTTTGCTAATAATTTCCCAGCTTTGGTGGAGTACAGCATGAAT
GAATTGGAAGGTCATCTACGATTTTACTTAGCTCCAAAATTAGATGATGATTGATTTTGCTCTTTTTCTAGTTTTGGGGT
GATATTTTAATTGTAGTGCTTTTTTAGTATGGTTA
>SMED30012543 ID=SMED30012543|Name=Spondin-1|organism=Schmidtea mediterranea sexual|type=transcript|length=2035bp
CTCCAATGAAATGTTTACTTTTATAAATGACAAGCCTATTGTAAACAATGGAATGAAGACGGCTTACAAACAATGTTGCG
CCTGTGGAACTGCAAGTTATCGGGTGACTTTTCATGGGTTATGGAACAAAACAACTCATCCAAAAGAATGGCCAGAAGAA
AAAGGTCAGCTTCATTGGACAGATCCTATTGGAGTCACCCATAATCATAATTACTTTATTTATCATTTGGGAGGACAAGC
TTCATTTGCGGTTGGTAGTGTATGTACAACAGGAAATTCGAGATCTTTGAAAGAGGAATTCACCTTACCTGAAAATAGAT
TAAATGTTAAGAGTCTCTTTACGTCAGGCTGGTTAAATGGGGAAGAACAGCTAAATGAAGAGCGTTCAGGATTCATTTCT
GTTAATAGAACTCATAATTTATTTAGTATGATTTCAATGATGGGACCAAGTCCGGATTGGTGTACCGGAGTGTCAGGAAT
CGATCTTTGTATGGAAGGATGCAAATGGAAATCAAATCTCACTATACCTTTGTTTCCGTTTGATGCTGGAATACAGACTG
GGGAAACCTATAAACCTGAATCTATTACTCGGCTTGATGAACCGGAGCCTATTAAAGAAATCAGTAAAATTTGGATGAAA
AGTAGTCCGTTTACACCGAATGTTCCTGTTGCTGAATTAATTCTGACAAGAATCTCTCCAAAGACCGACGAAAAATGTTC
TAAATCCCCTATGAAAAATGTTGATGAATTTAATAAGTCAAATGAATTAATAAAACAAAATTATCGCGGTAAAAATAAAG
GAATAGCAAAATATAATGTTCTTGATGACCCCCAGCTGGCTCAGATGGCAAAAGCTTTTTGTGGATTTTCTCAATGGGCT
AGCTGGTCTCGGTGTTCAGTGGATTGTGGAGTTGGGGAATCTTCTCGTAAGCGAGAGTTGATCAAGAATTTTAAAAATGA
ATTATGTGTCCAGCTGCCAAGGAAAGAAACCAGATATTGCTATGGTCGACGAAGAAATTGTGATTTTTCTATGAAATGTA
GTCTTCTTCCGTGGACTGAATGGACTAAATGTACTGCTACTTGTAAAGAAGCAGGAAAGATAGCAAGATCGAGAAGATTC
GTGAGGGAGGCGGAACGAGAAGAATGTTTGAGAGAAGTGACACCAACTACTAGACTATATGAGGAAAAGCCATGTAAACT
CGATCAAACTGACAGCCGCTGTGATCCAGTGTCAATTTGCAGTGCTGGAAAATTGCCTCCTTGTACTAGAGGTAAACGTC
AAACAAGATATTTCTATCACGTCAAGACTGGAAAATGTGAACCGTTTTTTTATTTTAATTTTTGCCAGATTGGCCTAAAC
AACTTTCGCACTGAGGTAGACTGTGAGAAAATGTGCGTTAAAGCCATTGGTCAGCTGCCTGGAATTAAAAGATCAAATTT
AGCTCTTTTGCAGTTTCGAACTTCTTATTCAGGAGACCTTTCTCAAAAAGAAACTAAAATACCAGCTCAATGTTTCAACG
AAATAGAATCAGTAAAGACATGTATTCATAAATCTCCAAGAACCGTATGGTACTACAGTCACCGAAACCAGAAATGTCGT
TCTTTGGTGGATTTCGGTTGTCAGGGAAGTTTGAATAAGTTTTCTTCTTTTGAACAATGCATGAAGATTTGTCGACCTAA
TTTACAGAGTCGTTCTTCAACATCTGATAAAGTAGACTGCCAGGTCTCTAATTGGAGTTCCTGGAGGCCTTGCTCTAAAA
GCTGTGGCAAAGGAACACAGATCAGAAAGCGAATAATTTATAAAGATTCTCTTAATGGTGGAGAACCTTGTCCACTTCTT
TACGATTCTAGAGATTGTTACGGTATATCTTGCAATTAGAGATAGCCATAACTATTTTAGTTTATAAAAGCATTCATCCA
GGCCACAGTTGAAAAGCATTTTAATTATTAATAAATTTTAGAATTGTTAATTTTAGTATTTTAGTATATTTTTGCTGTAT
TTAGTGCAAAAAAAAAAGACGGGTATAAAAAGGTG
>SMED30018602 ID=SMED30018602|Name=ATP-dependent RNA helicase dbp2|organism=Schmidtea mediterranea sexual|type=transcript|length=607bp
TATTCAAAAGATAAACGATTGTTAGAAGTTGTTAGCAAAACTCCACGGGACAAAATGATTGTGTTCGCAGAAACGAAAAG
GAAAGCTGATATGATTTGTTCTTTCCTACGTTCAAAACAATTCAGAGTTGGTGCAATGCATGGAGATAAGTCACAGAGCG
ACAGAGAATATATTCTTAATGGGTTTCGAGGTGAAAATTTAAATATTCTCGTGGCAACAGATGTAGCAAGCAGGGGTTTA
GATGTTGATGATATTAAAGTTGTAATCAATTACGACTTCCCTATTCAATTTGAAGATTACATTCATAGAATCGGTAGGAC
AGGCCGACGAGGAAAATCCGGTGTGTCTTATACATTTTTCAATAGAAAGAATTCGAAAAGTGCTCGTCAATTGGTGAAAG
TGATGGAAGAAGCTAATCAATCAGTTTCAGATAGTTTGTATGATCTTGCATATATACCAAGAAGTGAGCGTAGACAAAAT
TTCAATCGTCCGCCAATGCCAGTGCCGCAAGTAAATAATTATCAAGTACCTCCGCCTCAATATAATGGTGGAAATAACAT
GTATCCGCAACCAGATTTATATATGCAAAACGGAGCAGCACATCACA
>SMED30022078 ID=SMED30022078|Name=Translationally-controlled tumor protein homolog|organism=Schmidtea mediterranea sexual|type=transcript|length=629bp
GTCAAATATCTTAAATTTGTTTGTTTAAATACTTGTTTACACTAAACACTTTTATTTTGAAAGTTTATTCCACGATGTTA
ATTTACAAAGACATAATTTCGGATGATGAAATAAGCAGTGATTCATATCCAATGAAACTGATTGATGATATTGTGTACGA
ATTTAATGGAAAGAATATTACCATTAAAAATGGCATACCCGATGAAGCAATCGGTGGAAATAAATCTGCTGAAGGTGGAG
ATGATGATTATTCTGAATCATGTGAAACTCAAATAGACATAGTCTATGCTAATCGACTAGTAGAAATGAGTTATTCGAAA
AAAGAGTACACTACTTATATTAAGGATTACATGAAAAGAATACTCGATATTCTTAAAACTAAGAATCCTGCTCGAGTTGA
TGTATTTAAAACGAATGCTCAAAAATATATTACGGAAATTCTTAAAAATTTTAAAGAATACAAATTCTACACGGGTGAAT
CAATGAATCCTGATGCCATGGTAATTTTATGCAATTATCGGGAGGATCAAATTACTCCTTATTTCATCGTCTTTAAAGAT
GGTGTTGTGGAAGAAAAATGCTAGGCCAAATTGCCAATGGAATGTTATATTAATAAAGAATTGATTGAC
>SMED30001973 ID=SMED30001973|Name=Eukaryotic initiation factor 4A-I|organism=Schmidtea mediterranea sexual|type=transcript|length=361bp
ATCGAAACTAATTATGATAAAATTGTGGAGTCTTTTGAAGATCTAAATTTAAAAGAAGATTTGTTGAGAGGAATATTTGC
TTATGGTTTTGAAAAACCATCGGCAATTCAAAAAAGAGCCATTCTCCCAGCAATCGAAGGCCACGATGTCATTGCGCAAG
CACAATCCGGAACTGGTAAAACTGCCACTTTCAGCATCTCAGTTTTGCAAAACATTGACACTTCCATCAACAAAACTCAA
GCTATCATCTTAGCTCCAACTCGTGAATTGGCCCAACAAATTCATAAAGTCATCATGACAATCGGTGATTATTTGTCAGC
AAAATGTTGTGCATGCATCGGCGGAAGAAATGTAAGAGATG
>SMED30033466 ID=SMED30033466|Name=Histone H4|organism=Schmidtea mediterranea sexual|type=transcript|length=421bp
GATCTCACTATATAAATAAGTATTTGTCCCTATTAATTCATAACAATTATTCAACATGTCTGGTCGAGGTAAAGGAGGAA
AAGGACTAGGAAAAGGTGGAGCAAAGCGTCACAGAAAAGTCCTTCGTGATAACATTCAAGGTATCACAAAGCCAGCAATC
AGAAGATTAGCTCGTCGAGGTGGTGTTAAGAGAATTTCTGGATTGATATATGAAGAAACCCGAGGTGTTCTTAAAGTATT
CTTGGAAAATGTTATTAGAGACGCTGTGACATACACTGAGCACGCTAAGCGCAAGACAGTAACTGCCATGGATGTCGTCT
ATGCTTTGAAACGACAAGGAAGAACTTTGTACGGTTTTGGAGGTTAAATAACACTTTCATATTTGTGAATGTTTTAGCGG
CCCTCTTTAGGGCCACAAATG
>SMED30000837 ID=SMED30000837|Name=Histone H4|organism=Schmidtea mediterranea sexual|type=transcript|length=1387bp
ATTAACACTAAATTTTGTTTATATAATGATTAAATATTTCAATAATCAATTAATTGAAAAATGTCTGGTCGTGGTAAAGG
AGGAAAAGGGTTAGGAAAAGGTGGAGCCAAGCGTCATCGTAAGGTTTTACGTGATAACATTCAAGGAATAACTAAGCCGG
CAATTAGAAGATTAGCTCGTAGAGGCGGAGTAAAAAGAATATCTGGTTTAATTTACGAAGAAACTCGTGGTGTTCTCAAA
GTTTTCCTGGAAAATGTTATAAGAGACGCTGTTACTTATACTGAACATGCTAAGCGTAAGACAGTAACTGCAATGGATGT
TGTTTACGCTCTTAAACGCCAAGGAAGAACTTTATACGGATTCGGAGGTTAAATGTGAAACCAATGATATTTTAAGCTAA
CATTTATTTGTTGAGAATGTTTATGGTCCTCCTTAGGGCCACAATTTTTGATTGTTTACTTTATTTTGTTAGCATTACGT
AATTTTACAGTGATTGGTTATCTTGCTGGTTGTCTGAAATATTAAATAATAATATGCTATAATTAAATGATATTAGTATA
GAAAACAAAAATCGGTTTTATTGTTTGATCAACACAATGAATATGTTTATCAATTATCATCATTTCCAGTTTTTCGATTT
CAGTTGATAATAATTATTTGCGAATTTGTGATTATATTTTCTAATGGGTTGCGAGACATAAATGAGCGTGCAGATATCAC
ATGCGAACCTGGTTCATGTAGTGTTTTGAGCTACACACTGCAGATAGACGATCAAATCTATAAAGTGAAAAAAGGGTTCA
AATCAGCTTGCAGCACCAGACTATGTGAAAATTGTGCTCACAAAGGTGATTGGTCAATGAGACTGATTGACGGAAACAAA
TATATGGTACGACAAGTCAATAAATGTTTAACTAATAATATTTTGGCAGTTGAGCAACTTTTCACAAATTTATATACTCC
TGTCTCAGATTTTACATGCTCCTTGCATAAGTGCTCTAAATATAATTATTCTTATAATGGAAATATGATTAGCTTTAGCT
ATATAGGAGTTTGTGACCATTCTTACTGTGACTCATGCCGCTATTCCGACAATTGGAGTCTATTAACCGGATATTTGCAG
CGGACGACCATTTCATGTTATGTTGTCGATAAAATTAGACTTGAAGATTATTTTCTCATTCCAGAGTTTACCGAAACCTT
CTATACACTAATTCGGAAATTAGCAATAACTATAAGCTGCGCTTCATTTTTGTGTTTGGTGATCATTCTTTTGGTTTGTT
TTGCTAAAAAATGAGATCTTACAGAAGCTTTAAGGAACTTAATTTTATTTAACAATATATTTATACTTAGATCTAATGCT
TTGAATGATCCTTTCGCAAGTCCATCC
>SMED30014692 ID=SMED30014692|Name=Histone H4|organism=Schmidtea mediterranea sexual|type=transcript|length=464bp
AAATCTATATAAATCTTATATGAGATAAATGTCAGGTCGAGGAAAAGGTGGAAAAGGTCTTGGTAAAGGAGGTGCTAAGA
GGCACAGAAAAGTATTGCGTGATAATATTCAAGGAATCACTAAACCTGCAATTAGACGTTTAGCAAGAAGAGGTGGCGTT
AAACGAATATCTGGGCTGATTTATGAAGAAACACGAGGTGTGCTGAAGGTTTTTCTGGAAAATATCATCCGCGATGCTGT
CACATATACGGAACACGCGAAGCGAAAAACCGTGACTGCAATGGATGTTGTTTATGCTTTGAAACGTCAAGGTCGAACTC
TTTATGGGTTCGGTGGATAATCATTTTGTATTTTATTATTTAATGTTGTAATTGCTATAATTGTTGCTAGTATTAATCTT
ATTTTAATAAATTATTTAACTGGATTTTAATTTAAATATGTCGGTTTTGTAAATCCAATTTGTA
>SMED30001362 ID=SMED30001362|Name=SMEDWI-3|organism=Schmidtea mediterranea sexual|type=transcript|length=3093bp
AATTAAGAGACAGCCATTTATGTTTATTTTTAAAATAAATAGTATATATTTAAGTTTCGAATTTTCAGCTACAATTTAAT
AGTACATAATTATACGATGTCAGGAAGTAGTGGAATAGGTAGAGGCCGCAGTCGTGGGCTGTTGATGCAAAAGTTTCTGA
ATAAAGATGTTCTTGTTCCTTCTGTTGAATCTTTAGAAGACAAAGCTCTTAATAAGCTAGGAATTCCACTTCCTGGGTCT
ACCGTAGAAAAAAATACAGAGTCAAGTTCTATATCAAGTGGAGATTCAAGAAGTAATCCCAGTGGAGATTCAAGAAATAA
CATAAAACTACAAGATAGTGATATTGAGAATCGCAATATTACCATTGTTACGCGACCATTATCCTGCATAGGCAGGGGTC
GGGGTTTAAGCAATCCCTCAAGTTTAACTACGTCATCGGGTAAATCGGATAAAATTACTGAAAACGAAGAACCTGGTCAA
ATTAAAAAGTTTGTAGGTCGCGGTAGAGGATTGTTGAATTCTCAGAAAGAATGTTCAAACTCTACTCCATCTGAAGTTTC
AAATGAATTGAAACAAATGAAAATTTCAAATGATGATAAAATGACGGTTTCTTCAGAAGCAAAGTCACAATTTGAGAACA
TTGAAAAACCTATTAGTAAATTTCGTCGACGCGAATATCCAACTCAAATAAAAGAACCATGTAATACAAGAAATGATTCA
TCGCCATCTTTAACTTTAAGTGCTAATTACGTTAAAGTTAGGACTACACAACCCCATATATATCAATACCATGTTTCCTT
TGCACCTCCGATAGATTCAAGGTTGATGAGAATTAAAATAGTTCAAGGGTTATCAGAATCAGATTTAGGGGTTGTCAAAG
AAGCAAGAGCTTTTGACGGTATGAATTTATACATTCCTCAACTTTTAAAAAATAAAGAGACAATAATTAAAGTAAACAAA
CCGACTGATAAGACTGTCGTGGATGTTAAAGTAGTTTTTACTAACAATGTTAATTTTAGTGAATGTCCTATGGTTTATAA
TGTTCTTTTTAAAAGAATTGAAAATTCCCTCAGAATGGTTAAAATTGGTAGGGATTATTTCTACCCTGAAAAAAAGATAG
TACTTGACCGTAGAAGGATGGAAATATGGCCGGGATATGTAACAAGTATCCAAAATTTTGACGGTGGTTTACTGTTACAA
TGCGATGTGTCACACAAAGTTATTCGAAATGATAGTGTGTATGACATAATGATGGAAATTAATAAAACTGTTAACAATAA
AGGTCAAATGCAAACTGCTGCGATTAATCAACTATTGGGTCAAATTGTGTTAACTCCTCACAATAACCGAAATTATAGAA
TTACTGATATAGATTGGGCTAAAAATTGTTTAAGTGAATTCGATAAAGGAGGCGAAAAAATTAGCTACCGGGATTATTTT
AAGAACACGTATGGGCTACAAATTCGTGATCTAGAGCAGCCTATGATAGTTAGTAAATCTAATAGCAGATCTGGTAAAAA
CCGAGGTCCCAAAGGATCAAAAGAAGTGGATGGTGGATTGGTCTATTTAATTCCAGAATTGTGTATGCTAACTGGTTTGA
CAGATGACATGATTAAAGATTTTCGTTTGATGAGAGAATTACACGAGCATTGTCGAGTTACTCCCAAGAAAAGACACGAA
GCCTTACTGGAATTCGTGGATAACATATATAGCTGTGAGGAAGCTAAGAAACTTTTAGGGTATTGGGGTATAACGATTGA
AAAGGACACTGTCAACATAAATGCTTGTAAAATGAATCCAGAAATGATATATTTTGGAAATGAAGCTTCTGTTAGTGCTG
GGGAACAAGCTGAATTTAAACAAGCCTTGGCACATAATAAAGTTATAGGTGGTATTCGTATTGAAAATTGGATATTAATT
TCTCCAAAAAGTTTACTGACAAAAGCAAATGGTCTGTTACAGGCTTTAATGAGCAAATCTCCTAGAGTTGGAGTTATGTT
TGGAAAACCCAAAATAGTTGAAATGAACAATGATCGAACAGAAGAGTATTTAAAAGAATTAAAGAGAAATGTGGCTCCTG
GTGTGCAGTTAGTAGTTACAATTTTATCTGCTGTTAGAGAAGATCGATACAATGCAATAAAAAAATTTTGTTATGTGGAT
TGTCCTGTTCCAAGTCAAGTGGTATTAGCCCAAACATTGAAAGAAGGGCCTAAATTAAATAGTGTGGCAGTTAATATAGC
CCTTCAAATAAACGCAAAATTAGGTGGAGAGCTGTGGGCTGTCAAAATACCTATTAAGAAGTTTATGGTTGTTGGACTTG
ATGTTTGGCATGATACTAAAGGGAGAAGTAGATCAGTTGGAGCCGTAGTTGGTTCAACTAATGCGCTATGCACAAGGTGG
TTTTCGAAATCGCATTTGCAAGAACAAGATAAAGAAATTATGTACGTATTACAGTCGTGTATGTTAAGCCTTTTAAAGGC
TTATTTTGAAGAAAATAATTTTTTGCCTGAGACTATCTTTATGTATAGGGATGGTGTTAGTGATGGTCAGTTAGGATATG
TTCAAAAAACTGAAATTGAACAATTCTTTAAAGTTTTTGAATCGTTTAGTGCTGATTATAAACCTAATATGGTATATAAT
GTTGTTCAAAAGAGAATAAATACTAGGCTCTATGTAAGTGATCCGAAAAATAAAGGACAAATAAATAACCCCAATCCTGG
TACAATTGTCGACCATACTGTTACGAGGGCTAACCTTTATGATTTTTTTCTTGTTTCTCAATCGGTTAGGCAGGGAACTG
TAACTCCGACGCATTACGTTGTTTTATGTGACAATTCTAAATACACTCCGCATCAGGTTCAGTTGATGGCTTATAAAACA
TGTCATATATATTACAATTGGCCGGGAACGGTTCGAGTACCAGCACCTTGTATGTATGCTCATAAATTGGCATATATGGT
TGGTCAGAATTTGAAAGCTGAACCTAGTAATCTTTTATGTGACAGACTTTTTTATTTGTAACATATGTGTTTCTATTTGT
ATTATTGTTAAACTGCATTTCGTAAAATAAATTAATTTCGTTATAAAAAAAAA

 

back to top


 

References

Alie, A., Hayashi, T., Sugimura, I., Manuel, M., Sugano, W., Mano, A., Satoh, N., Agata, K., and Funayama, N. (2015). The ancestral gene repertoire of animal stem cells. Proc Natl Acad Sci U S A 112, E7093-7100.

Bardeen, C.R. (1902). Embryonic and regenerative development in planarians. Biol Bull 3, 262-288.

Cardona, A., Hartenstein, V., and Romero, R. (2005). The embryonic development of the triclad Schmidtea polychroa. Dev Genes Evol 215, 109-131.

Hallez, P. (1887). Embryogénie des Dendrocoeles d’eau douce, Vol 16.

Ijima, I. (1884). Untersuchungeniiber den Bau und die Entwicklungsgeschichte der stisswasser-Dendrocoelen(Tricladen). Vol Bd. 40.

Le Moigne, A. (1963). Etude du developpement embryonnaire de Polycelis nigra (Turbellarie - Triclade). Bulletin de la Societe Zoologique de France 88, 403-422.

Metschnikoff, E. (1883). Die embryologie von Planaria polychroa. Zeitschrift fur wissenschaftliche Zoologie 38, 331-354.

Vara, D.C., Leal-Zanchet, A.M., and Lizardo-Daudt, H. (2008). Embryonic development of Girardia tigrina (Girard, 1850) (Platyhelminthes, Tricladida, Paludicola). Braz J Biol 68, 889-895.

 

back to top