renal system



Overview

The renal system in an anatomical system that maintains fluid balance and contributes to electrolyte balance, acid/base balance, and disposal of nitrogenous waste products.

 

Renal system

 

"RENAL SYSTEM" TERM REFERENCES

UBERON:0001008

 

back to top


 

Tissue Description

 

The transcription factors pou2/3, six1/2-2, eya, sal1, all of which were required for protonephridia specification during regeneration, as well as osr, a transcription factor expressed in protonephridial progenitors, showed enriched expression during S5 (Figure 1 – figure supplement 18 A, Figure 1 – source data 5) (Scimone et al., 2011). Scattered pou2/3+ cells were detected by WISH in S5 embryos (Figure 1 – figure supplement 18 B), and preferential accumulation of pou2/3+ cells around the presumptive D/V margin of the embryo was observed as tubules began to form during S6. Branching morphogenesis of the tubules proceeded during S6-S8, with a noted dorsolateral bias in positioning of the developing filtration units (Figure 1 – figure supplement 18 D). Transcripts with enriched expression in adult protonephridial cell type(s) were frequently expressed at low to undetectable levels prior to S5, and were upregulated during S5-S8 (Figure 1 – figure supplement 18 C) (Scimone et al., 2011; Vu, 2015; Wurtzel et al., 2015). crocc (rootletin), a marker of ciliated epithelial cells (Scimone et al., 2011), was expressed in the developing protonephridia during S6-S8 (Figure 1 – figure supplement 15 I).

 

back to top


 

Figures

Figure 1 - figure supplement 18: Molecular markers for the developing excretory system

A, C: Average RPKM per embryo for transcripts expressed in protonephridia progenitors (pou2/3, six1/2-2, sal1, eya, osr) (Scimone et al., 2011) (A) or differentiated protonephridia (Rink et al., 2011; Scimone et al., 2011; Wurtzel et al., 2015) (C).  Transcripts shown were enriched during S5, S6, S7 and/or S8 and are flagged in excel tables for S5-S8 enriched transcripts (Figure 1 – source data 5, Figure 1 – source data 6, Figure 1 – source data 7, Figure 1 – source data 8).

B, D: WISH developmental time course with riboprobes complementary to the protonephridial progenitor and tubule cell marker pou2/3 (B) or the non-ciliated tubule marker CAVII-1 (D) (blue), S2-S8. Anterior: top (S6-S8). D: dorsal. L: lateral. Red arrowheads: definitive pharynx. Scale bars: 100 µm.

 

 

back to top


 

In Situ Hybridization Data

Smed IDAccessionNameAliasEnriched during stage(s)Tissue/PatternImages
SMED30021661SMED30021661CAVII-1protonephridia
SMED30030007SMED30030007H.2.8b, croccCategory 5 cell, definitive epidermis, protonephridia
SMED30030379SMED30030379pou2/3protonephridia

 

back to top


Sequences

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30030007 ID=SMED30030007|Name=SMED30030007|organism=Schmidtea mediterranea sexual|type=transcript|length=6612bp
GTTGTTTTTAAATCACTATTTTTTTTATTTCATCTGATTATAATTTTTTTTTATTGAAATTTGTATTTTGAAATTGGTGA
ACAATGAGTGAGATAGATTATTCCGCTATTGTTCGGAGACGCATTGGAGATATCGATGGGGATTCAAGTGAAGATTCCAG
TTCAAAGGGTTTGCTTCAAGTTAACTTGGAACTGAGAAAGCGCTTAGAGGAAGAACACAATGAGTATCGTAGAAAGCTGA
TAGTTTTCCAAGACAGCCAACAGAAACAAGCGCAATTGGTTCAAAGATTGCAGAAAAAGGTATTGCAATACAAAGAAAAA
TGCACGGAACTTGAATCTAAAATGCAATTTGGCGATTATGAGACTCGAAAAACGAAGTATGGAAGTCCAACGAATAACGG
CTATGGGTCGCGTAGTGAGAATCCCTACGACAATCTGGATTTGGAGAGCACACTCATTAAGTTAGAAGAGGAACAAAAAA
AAACAAATTATCTAACGGAGTTCAATGAACGGCTTCAAGAACAATTAACTCAAGCAACTCAATCAAACCAGAATTTGACG
AGAGACATCAGTAAGCTTTCCGAAGAATGGCAGAGATCAAGGGAGGAGCTTGAACAGAGAGAAAAAATTTGGCGAAATGA
AGAAATGTCATTTAATGACTATTTAGCATCTGAGCATTCGAATCTGCAAAATTTGCAACGCAATACGATAAATTTCCGCC
GTCAATTTATAGAATTGAAAGCTTCAACTGAACGGGAAATAAATAATTTGAAAAATGAATTCAACCGACAGGCACGCTGT
TTGCAAACTGCTTGTTCCAATCTTTCGTGCAACATGAAATCTGCAGAATCTAAACAACAATTGAGTACTGAACGAGAAAG
TCGGGACAAGTTGAATCTCGAAAATCAACTGCGAGAAAAAAACAGAGAATTAACTGATTACCAAACTCGGTATGAATGTG
AAATGACAGAATTGCAACACCGAGTGAAAGAATTAACAGTTCTCAGTGACAAACTGAAAATTCAAAACCTGGAAAAGGAT
CGAGCATTGACAGCTTTGCAAAGAATTAAGAATGGAGATACCGCAGGAGAAATAAATATGGAAGACAAAGCTACAAGAGT
TCTTATTGAAGACACAGAAAGTATGCATCAAGCACTTCGAAATATTTCTCAAGTAGTACTAAATGATTCTGACTATTTCG
ATGCAGAAGACACAGGATTTGAAACAGTTCGAAAGAATAATCGTTCGCCAAGTCCAAGGAGAAATCGTAGCGTCAGTCCT
AACTCAAGATCAGCTAAAACACCGCCATTTGCCGATGCAACGTATGCGGCGGTTCAGTCGGCTATAAATAAAAAATCTCT
ACAGATTCAAGAGCTTAAATCAAAATTAAACAGTTCTAAAGAGAGTTGTACAAACTTCAAAAGACAAATTGATGACAATG
AAAATGAACGTCGACGATTAGAGAATCAAGTTCTCGCCATGAGAGATGAAATTGAAAGTTTACGACGAGATAAAGATGAT
AGTTTTAGAGAAGCGGATCGGTTTAAAAATGCTCTGAACATCACTTCAAATGAACGAAGCCAATTGGAAAAGATTCGATC
ATCACTAAACGATCAAATTGAGCAGCAACTCACAGAAATTGAACGACTTAAGTCAGCCAATCACGAATTACAACGATTGA
GAGAGGCATTGGAAGATGAGCAAGAAGATACTAAAAAAGACTTAGAAAGACAAATTAAAGAAAGTGAAAGATGCCAACGA
TCGATTGATGTTTTGGAAGATAAAATAAGTCGATTTAAAGAAGACGTAGTTAATTACAAAGAGGCAATTAATAAATACCA
ATTAGAAAAAGAAGTATTGGTGCAAGAAAAGGATGAGATTGGTGATGCTTTAAGTCGTTGTGAAATTTCTAAAGCCGAAT
TAGAAATCGAGGTGAATAAACGGCAAACTATTGAAGTAAATTTGGAAGAAAACATTTCAAAATTATCCTCAGAAATCGAA
GAATTGAATGATAAGCGAGCTGAAAACCACAGAACTATTAAACAGCTGGAACATGAAAGAAGTTCTCTTTTGAATGAAAA
ACGATTTTTGGAACAAGAAAAAAGTGGTTTGAAAGATGAGCTTGTTCGATCTGAACAAGAGGCTCTTGGTTTGTCAAATG
AGAAAGCCATTCAACGTCAAAGAATCGAACAACTTGAAATTAATACAGAAAGATTAGAAGAAGAGTTATCGGAACTCAAT
CGAGAAAAGCTAGATCTTACTGAACAAATAGGCTGTTTGCAGAGGCAGAAATCGGCTCTTGCAGAAGAATTGTTGCAATG
TCGTAGAGAATTAGAACGATCTAATAACAGTGTCAACAACTTATCAAAAGAAAAGGAATATCTTACCAAAGAGAAAGGAG
AACTCGTCGTTCAAGTTACAGCTTGCGAAAGGGAAAATCGTCAACAGTCAGAAGTTATTGCTTCTTTGAATTCCGATAGA
GAACAACTGGAAGCTACTCTTTATGATGCTCAACAATTAATCATTCAGTTGGAAACTCGAAAAGAGCAATTAGAAGGCGA
AAACCAAGAGTTGATTGTGAAAAAAGAAAATCTAAATGGAGAACTAGTCAGATTACGACAAGAGTTTCAACTAGAATACG
AGAAGGTTGTTAATTCACGAGAACAATTAAATTGCAGATATCAACAAATGGATAAAGAATATAAGATGGCAATTCAACAA
GAGCGAGATTCTCATGCTGAAGATGTAGAAAGACTAACTAAGATAAACGAAAGCAATCGTCATGGATCTGAAAACGAACG
AGAAGAGCTTATTCATCGATTCAATATGGAGCGTGACGACATGATTCAAAATTACGAACAAGAGAAACAAGAAATGGCCC
AGGAAATCATGACGATCCAACGAGAACGAGATGACTCATTATTAATGGCGGAAAATGAAAAGCAGCAATCATTGAGTTTA
TTAGAACAAGAAAAATGTGCAATCAATGAAAAGCTTATCAAAACGCAATTTGAACTGCAATCGGTTGAGTCGGAATTGGA
TCGCATTAAAAAGGAGTCGTCCAATCGTCAGGAGCAAGACAAACAGAACATTGCCGGCTTGTCGAGTGAACTCAAATCAT
TTAGATCTCAATTTGAGGATAAATGCCAAAATCACGAAATGGAAGTTAAAAGCCTAAATAGTGGAATCAAGGATCTAACA
TTAATGAAAGATCAAGCTCTCAAAGAAGTCCATGATTTGCATACCGGATTAAAAATAGCTGAAGAAACCCGTGATAATTT
GCGTCGGGAAATCATGGAAATGAATCGGAAATTGAAAGAAGCTGAGGAAGCCAAAGAGCACTTAAAGCGTGAAATTAATG
AATTGAAACGTGGATTATGCGAAGAACAAAGGGAAAAAGAAAATGTTATTAACTCAAATGAGAATTTGAGAAAGAAAATT
AAAGATGTTGAAACAGAAAGAATTGATTTGCACAGACAAGTAACGGATTCCAAACAAAAGGTTGCAGTACAAGATGAACA
ATTGGTCAATTCCAAACAAGAGGTCAATGAGTTAAGAAACAATCTTAAAGACGTAGAAAAAGCTCGATTAGATGTCAAAA
GAGAGTTACAAGAACTCAGACGCCATATCAAAGAGCTAGATACGGAAAGGGGCAAATTGACTAAAGAAGTCAATGATTTG
CAAACTCGTGTTGCTAGAGATGAAGAAAAAGAGGATGAAGCTCGTCGGGAAAATTTCGGTCTCAAACAAAAAGTTGTTGA
AACGGAAGCTTCAAGAGAAGCCGTTCGTAAAGATCTTGCTAATGCTCAACGACATATTGTTGATTTGGAAAATGTTCTGC
AGAGCAAAGACAGAGATTTCAGTTCCATGGTGGAATCGAGCCGCCGGGATTATAGGAAACTTGCTGATGCGAGAAATAGC
CTGCAACAAGTATATGATACGATGGTGGCCGATAATAATGAGCTGAGAATTGCTCTCAGTGGAGCAGAAGGTCGGGTCAG
TGCTCTGGAGTCACACATCGCACGAGTTGAAGGAGCTAAGAAAGAAATTGAATTCAAATTGGCTTCTATCCATAGCTCAT
TGCGAAGGCTGATAGGATTCCGACAGGAGAATGTAGTTACTATTCGGTCGAGAAACAACTCCAAATCTCCAGTTAGAGGT
CGATCAGTTAGTCCTCTTAGAAGTAGGCCGGTGTCGCCAACCAAAGGATTTGACAATACCTATGCTACTACAACTGATGG
AAAAGGTAGCCCTATCCCGCGCACAGGGTCTCCGAGTTCTAAACGAAGGCAATTATCAAGATCTCCGTCTAATTGCGATT
TCAATCCAGTCGATATAAATCCAGAAGCAGTTCGTCTGGCCTTGCGAGAATTCGTACAGCAGTTGGTTGATGCTGAACGA
GATAGAGATGACGCTTTTGCTCAAGCTCGCAGCCTAGAATCTCGATTGAAAGAACAAGAAGAACAAAATGAATATGCTGA
AAACCGTTTACAACAACTACAACAAGCTCTGTGTGATGCAGAAGAAGACAAAAAAGGCATTGATGGAAGATTGTCATCAG
CCCAAACTGCCTTAATGATGCAAGAAGAGACTATTCGGCGCAATGAGAGAGATAGAAAAGCAATGGCGGAAAAGTTGAGT
AATTACGATAGAACATTTGCATCCATGGAATCAGAAAAACGACAATTGGAAGATCGGTTGAATAAATTCCGTCATCATGA
TGCCCGATTGGAAGAAGAACATAAGCAGAGCAAAAAAGCTATTGAAAATGCTGAAAATAGAATAACTCAGCTTCAGCTTG
CCAAGCGATCGTTAGAAGGAGATCTTCAAAGAATGAAAATGGCGTTGACAGATAAAGAAACAGAAACCGAAGTTTTGGAT
GACCGCGTAAATAGTTTACTCAAACAAATACAAGATCTCGAGGGAAAATCTCAATCACTTCAACTAACGATTGACAGAAT
GAGTGTCGCCCTTGCAAAAACTGAGGAAGAAGGCAGTTTTCATAAGGACAAAATGCAACAGTTGAATATGAGTTTGAGCA
CTCATTCACAACAACTGGAACAATTACAGAATAAGATTTCTCAATTACAAAAAGCACTCGGCAGTTCAGAACAAGATCGT
CGGCTCTTAGAGGAACGATTAGAAAGCTCTAAAGGAGCATTGCATGAGGCAAAACATCAAAATAATTTGTTGATGGAAAG
AATACAAATAATTCAATCCGATTTAAATGATTCGGAAAATCGTCGATCAGAATTGGAAGGATTAAATCGACAGAGTAACA
CTTTGATTGTACAAAGACAAGAAGCTGAACAAGAACTCAATCAAAAATATCAGAAATTGAACTCGGAGAAAAACACATTA
CAAGAGCGAGTGAATAGCATGCAACGAAATTTGGCTTTGGCAGAAGCAGAAAAACAAGAAATAATAAAAAACCACGGAAA
ATTGGAAAAGGATAGATCTGCCTTGAAAAAGAGTCTTGGAAAAGTTGAACGTCAGAAATTGAAAACCGAAGAAATTGCTA
GCAAAACTGTTTTTGAACGTTCAGAATTAGATCAAATTTTAAGGAGACTTGAAGATGAAAATTGTGAATTACAGAGACAA
GTTGGAATTCTTCAAAATCAATTAGCAGAAGCTGAGCAAGCTCACTGCCACCATTTGATGGAAATCAATTCCCGCCATCG
CCAGGAAATGTCCATGGAAATGGAGCATTTGAGAGCATCGAATGTTCAAATAGAACGAACTCTAGAAGGCAGAGAACGAG
CCCACAGACAAAGAGTTAAGGGTCTGGAAGAACAGATCTCCACCCTCAAAGACCAGCTGACTCATGAAATGCAGAGGCGG
ATGGATAGTGGATATTACGAGTCTACCAGAAAGTCTAATCAATACGATTCAACTGGTGACTTGCGACATGTTCTGGATTC
CAGTTTAACTCGAGTTGCAAAAGACCCTCAACTGGACGCAATGCTACTGGAAACCGAAGCCAGGCGACTCGATGAGTCGA
TATTCATGTGTGGCAGTCGTGATCAGTCTCCGACCCGGCAGAAGCGAATCGAAATGTCAAAGAAGTCCGCAGCCCCTAAC
AATTCCAATCGGCGATTAACTGCCGGCCGTCGCAAATGAACTCGGCCTGTTCCAGTCCGTCCAGAGATGTTATGAAGCCA
CTTTTTAGATGCGTGAGTGTGAGTTCGTGTTGGTGACTGATTCATTTTTAGTAAACAGATTCTGGATTTTTGTTTTTATT
GATAGTGTAATTTCCTAATGCAGATCTGATAGTTGACTTGTTGTTCTTACGTATTCGGTATTTGTGATTCACATAGTCTG
TCATTGTTACTGTGATTTATCCTCTGTGTGACTTTTGTGATTTACTTACTTTATTGCCCCTATAATCAATAAATGGATTT
ATCGATAGTTCAGCCCTCCCCTCCAGCCCTCGTTTTGGGATCCGTAAATTTTGTTTCAATTGAGATCATTATAGTGATTT
TATTCCTTCGAAACCAAACCTTTGGGAGGGACATAAAATTAAATTATTGATTTTTTATTATCTTAGAAGTGAAAGATGTT
TATTTCCCAAATTAACTAATATCAATAATAACTTTAATTTATATCTTCATTA
>SMED30021661 ID=SMED30021661|Name=SMED30021661|organism=Schmidtea mediterranea sexual|type=transcript|length=1073bp
CATACATATATATATATATATATTGAGACTATTCATTTTTTTCCATACAAAATTCAAACAAAATGAAACCATTTCTATTT
CTATTTTTATTTCTTGTCTCATCTCTTGATCTGAAGATCACCGAGGCTTCAGGCACCGGAAATTGGGGCTATACGTCAAC
CAGTGACATCAAAGGCCCCTCGGACTGGAAAGACATTAATCCAACTTGCGACGGAGCTCGGCAATCACCGATTGATATCG
TGACAAGAAGTGCGGTTTATTTGAAAGATTTACAAAGGATTGAAATTAAAAAAATTGACAACTTTGCTAACTTTTCCACT
CTCGAAAGACATGAAACCTCTATTTACTTAAAGCTTAATAACAGTTGGGGAATCACTTTCGGAGGAAATCAATGCCTAAG
ACCTGACTCCATTCATTGGCATTGGGGATCCAAGGGTACTTTAGGATCGGAACACTCTCTAGATGGGAAGCATTATCCAA
TAGAAGGCCATCTGTTGTCATATAATTGTATGAAATACAGTTCTTTGAATGAAGCAAAATCGAGTCCGGAAGGTCTTTAT
GTAATTGGTATTTTTTATAAAATCGGAAAAAAAAATATGTTAATTGACAAAATTATCCCGGCAATGCAAAGTCTGATTTC
CAGTAGTGATATCTCGAGCGTGATCATTAACGAGATTTCGGTGGAGGAAATTCTACCGAAAAATTTGGACAAGTATTATC
AATATGACGGCTCATTGACGACCCCTCCATGTACAGAAAACGTCAGGTGGACAGTGCTAAATGAAGAGCTAACTATAGAT
GAATCTCAATTGGAAGTTTTTCGCCAATTCGACTTCGAATCTCCCAATTCTGGGGAAATGGAGAACAATTTCCGACCAAT
CTTATCAAAGTTCAATGAAAAACGAACAATATATTCCTCATTCAAAACGGGGTCCAGTTAGACAATCTTATTATGGGTGC
TTTGTGCAATCTTCATGTGCCTGAATAGTCGATAATATGATGTTCATAACACTCAAATAGCACATTTAATTCATTTTGAT
TAACACTATTTTTCATTTCATTTATGTCAATTA
>SMED30030379 ID=SMED30030379|Name=SMED30030379|organism=Schmidtea mediterranea sexual|type=transcript|length=1625bp
AATTAGCTATGCGAGCTGCTTTATCAGGCATGACTGTGATAAAACTGTCATTATTTATGCGCATAATTTGCCGTTAGTAT
TTGCTCAACCAATTTGACGTTCAACAACAACAGCAACAACATCCACCACCTCCACCAACATCCTCATTATCATTATTATT
ATTGTCATGTTAACAAGCGGACTTAATCAGGAACAATCATCGCCTTTAACAATCGTAGGCATGAGTGAGTCTCAGTTTTT
CAACGAATCTATCAGATATTTGCCTCCGGAAACCGTGGAGAGACAAAGCCAATTTTATGCAAATAATAATTATCCCCTTG
GTGAGTTTTGGAATCCACAATCCGAATATGCACAATACTTGCAAAATACCCAGCCAGTCTCGGGGCCTCAATTCATTACT
TCGCCGGCGGTTGGAGAGGCATTCTATCCATCTCTTTATATCAATACTATCCATGAAAATGTATTACTACCTTCGGTTGA
TTCCTTCAATCCTCCCAGTGGATTTATGATTTCGGGATATTCACAGCAAGACCAAACCTTTCCCACGGTCAATGAACCGA
CGTATGACAATATCCCAAACAATTGGAATTATGTTGATCATTGGGTTGATTCCAAGCCAACAACAGTGAATTCTCAGCTG
TTGCCAACCTCGTCAATTTCCGCCGTCCCCATTCAGAATTCGTTTTGGGACTGCGAGTCGATTGACCAATCAGAATATTG
TCCCACAAATGTTGATACCGAGCTCCAAGATCAAATTGATTCCAACGGAGAAATCAGTAGACTCAATCAAAAGATTTCTA
CTGACGAGTTGGAGCAGTTTGCGAAAATTTTCAAACAGCGAAGAATCAAACTCGGATTTACACAAGCCGACGTCGGGTTA
GCCCTCGGTAATTTATACGGCAGCGTGTTCAGTCAAACAACAATTTGCCGGTTTGAGGCACTGCAGCTCAGTTTTAAAAA
CATGTGCAAACTTCGACCTCTGTTAGGGAAGTGGTTGCAAGAAGCCGACTCAACCGGATGTGCTCCGTCCGGTATTGACA
AAGTCACAGCTGCTGGACGAAAACGAAAAAAGCGAACCAGCATTGAGGTTGGAGTGAAAAATGCACTGGAATCTCACTTT
TCTCGACAAAGCAAACCGACAGCCCAAATCATTACACAGCTTGCAGACAGTCTCGGATTGGAAAAAGAAGTTGTCAGGGT
ATGGTTCTGTAATCGGCGACAGAAGGAAAAACGAATGACGCCTCCGCCACTGAATGGAACAAGCTCAGATTTATTTCCAC
ATCCTGGTTTAACTGTCGGAACTGATAGTTCTCCTCATTCCTCATCTCACAGTAATCATGATTCATTCTCGTCCATTGGT
AACCAGTCAAGCTTCAATCGAATAGGTGATCCCTCCTCGACTCATCCCGGAGTCATTGTCACATCTTGCGGTTATTACTA
TGGTCATGTTCCAAATGAATCACTTCTCAATTGTGGGCCTTACCCTCACAACATCATCAACAATTACGAATTCAGACAGT
CCAATGATCCCAATATCCTCAATGTCAAATCCGAGTGCATCAGCTGACTCATGTCGAACTCACCGAAAAGAAAGCTAATA
ATATTCTATTTCAATAATAATAAAA

 

back to top


 

References

Scimone, M.L., Srivastava, M., Bell, G.W., and Reddien, P.W. (2011). A regulatory program for excretory system regeneration in planarians. Development 138, 4387-4398. 

Vu, H.T.-K., Jochen C Rink, Sean A McKinney, Melainia McClain, Naharajan Lakshmanaperumal, Richard Alexander, Alejandro Sánchez Alvarado (2015). Stem cells and fluid flow drive cyst formation in an invertebrate excretory organ. Elife 4, e07405.

Wurtzel, O., Cote, L.E., Poirier, A., Satija, R., Regev, A., and Reddien, P.W. (2015). A Generic and Cell-Type-Specific Wound Response Precedes Regeneration in Planarians. Dev Cell 35, 632-645.

 

back to top