neoblast



Overview

A heterogeneous population of pluripotent, somatic adult stem cells and lineage primed progenitors that are required for maintenance and regeneration of all cell types in planaria, including the germline.

 

neoblast

 

"NEOBLAST" TERM REFERENCES

PLANA_REF:0000004 , PMID:16311336 , PMID:21566185 , PMID:22899852

 

back to top


 

Tissue Description

 

The planarian neoblast population is wholly responsible for production of all differentiated cell types in these bilaterally symmetric, triploblastic animals (Baguñà J, 1989). In fact, transplantation of a single neoblast into a stem cell deficient host was sufficient for rescue and long-term reconstitution (Wagner et al., 2011), confirming the pluripotency of planarian somatic stem cells.

 

Neoblasts are abundant and widely distributed across the anteroposterior axis, occupying the parenchymal space surrounding the gut (Reddien et al., 2005). All neoblasts contain chromatoid bodies (Auladell, 1993; Hay, 1975; Hori, 1982; Morita, 1969) and express nuage genes, including piwi-1, and factors implicated in germ cell identity, genome surveillance and post-transcriptional regulation of gene expression (Guo et al., 2006; Palakodeti and Graveley, 2008; Reddien et al., 2005; Rouhana et al., 2010; Rouhana et al., 2012; Salvetti et al., 2005; Shibata, 1999; Solana et al., 2009; Wagner et al., 2012; Yoshida-Kashikawa et al., 2007). Neoblasts are the only cycling somatic cells in adults (Baguñà, 1976; Newmark and Sánchez Alvarado, 2000; Orii, 2005; Salvetti, 2000); quiescent neoblasts were not observed in BrdU pulse chase experiments (Newmark and Sánchez Alvarado, 2000). Mounting evidence suggests that the neoblast population contains pluripotent stem cells as well as cycling, lineage-primed progenitors (Reddien, 2013). Heterogeneous expression of developmental transcription factors (TFs) in neoblasts has been reported and likely reflects the diversity of lineage-primed progenitors within the compartment (Adler et al., 2014; Cowles et al., 2013; Currie and Pearson, 2013; Lapan and Reddien, 2011, 2012; März et al., 2013; Pearson and Sánchez Alvarado, 2010; Scimone et al., 2014; Scimone et al., 2011; van Wolfswinkel et al., 2014; Wenemoser et al., 2012).

Intensive efforts to define the term neoblast, and to characterize the presumed plurality of cell types within the asexual adult neoblast population, have generated numerous unreconciled molecular and functional criteria. At present gene expression signatures for neoblast subpopulations cannot be correlated with functional distinctions, should they exist, in self-renewal, pluripotency or cell fate restriction. It is not known whether hierarchical relationships exist between pluripotent cells and progenitors, whether cycling progenitors can dedifferentiate and/or interconvert, how stable subpopulations are over time, or when and how progenitors make an irreversible commitment to differentiation.

 

To investigate the embryonic origins of regeneration, we provide an ontogeny for the adult neoblast compartment. The molecular staging series facilitated identification of embryonic predecessors of adult neoblast lineages and the developmental transition when neoblast specification occurs. Heterochronic transplantation experiments suggest that the blastomere to neoblast transition occurs during S5. Adult neoblast lineages, including pluripotent stem cells and lineage-primed progenitors, are established as definitive organogenesis begins. Neoblast lineages, required for organ formation during embryogenesis, persist into adulthood, where they are redeployed for homeostatic maintenance of all differentiated tissues, including the germline, and formation of missing tissues during regeneration.

 

back to top


 

Figures

Figure 9: Ontogeny of the adult neoblast compartment. 

Asynchronously cycling piwi-1+ cells fuel embryogenesis, giving rise to all temporary and definitive tissues. During S2, some piwi-1+ blastomeres (purple cells) exit the cell cycle and differentiate into temporary embryonic tissues (primitive ectoderm, temporary embryonic pharynx and primitive endoderm). The remaining piwi-1+ blastomeres, located in the embryonic wall (purple cells, S3-S4), continue to divide and express both early embryo enriched transcripts (turquoise arrow) and adult asexual neoblast enriched transcripts (red arrow). As organogenesis begins during S5, early embryo enriched transcripts are downregulated throughout the compartment (purple cells transition into red). Concomitantly, progenitor subpopulations required for definitive organ formation are specified via the heterogeneous expression of developmental transcription factors within the piwi-1+ population (colored cells denote different progenitor subpopulations). Adult pluripotent neoblasts, themselves a lineage, are established during S5 (red cells). Embryonic donor cells harvested during or after S6 function similarly to adult neoblasts (cNeoblast activity, gray arrow). Pluripotent and lineage-primed neoblasts established during embryogenesis are maintained throughout the lifetime of the animal, where they are required for tissue maintenance during homeostasis and formation of new tissue during regeneration.

 

 

back to top


 

In Situ Hybridization Data

Smed IDAccessionNameAliasEnriched during stage(s)Tissue/PatternImages
SMED30001362ACC97187.1SMEDWI-3piwi-3blastomere, neoblast
SMED30001900SMED30001900bruli-1Stage 6, Stage 7, Stage 8blastomere, neoblast
SMED30004304SMED30004304PCNAblastomere, neoblast
SMED30007406Q2Q5Y9SMEDWI-1piwi-1blastomere, neoblast
SMED30010115AFJ24744.1ribonucleoside diphosphate reductase subunit M2-2RRM2-2blastomere, neoblast
SMED30013909AHC00376.1tud-1tud-1blastomere, neoblast
SMED30014446Q2Q5Y8SMEDWI-2piwi-2blastomere, neoblast
SMED30019097AFD29619.1SOXP-1SOXP-1blastomere, neoblast, sigma neoblast
SMED30033466SMED30033466blastomere, neoblast, primitive ectoderm, temporary embryonic pharynx
SMED30035063AFD29620.1SOXP-2SOXP-2blastomere, neoblast, sigma neoblast

 

back to top


Sequences

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30007406 ID=SMED30007406|Name=SMED30007406|organism=Schmidtea mediterranea sexual|type=transcript|length=2730bp
AATCGAATACATAAAAATTTATTTGACACCAAATACAAAGAGACATTAATCTACAAGTAAAATAAGCGTTCGCGAATTCT
GTCATTTATCGCTGGAGGAGTAACACCACGATGAATCTTGCCAACGAGTTCAGCCAAACGATGGGCATAATGCGTTGGAA
CAGGAACTCGGATTGTTCCCATCCAGTTAAAATACAAATGTGTTAACGAATAAGTTATTTGCTGCAATACACTCGGAGAC
ATAACTGAAACCTCATTTGTTTTCTTGTTTGTAAACTTAGTGTCCATAAGAACATTATAATTCGTAGGAGATGCTGTACC
TTTAGTTGTTTTCTGAGACACCAAGTAAAATTCATAGAAATTGGGTTTCACTATTTTCTCATCAACCACAGTACCAGGAT
TTGGATTAGCCCCATCTTTGAAAAATTTAACACTAATTCTCTTCTTAACCACAACATAAATAATTTGGGGCAAAGTTTGA
TTTTCGTAAATTTTCTCTATCATTTTCATAACAGCATCAGTTTCGAACTTTTTGGTAAATGCTAACTGTGAATCTCCAAC
ACCGTCACGATAAATAATCAAACGAAGAGGCATAGTGTTAAATTTGTTTTGGAATGTTGTAAGGGCCGTTAGGAAGTTTT
TGCCCAAATTTTCGTGAAATTCATTTTTACCTTTAGATGAATTGACAAAACTGATATACTGAGAAAATTTGGCACTAATT
GAAAATACGGATGCTTGAACAGATCTTTTACCGGTTTTGCTATGAAAAGTATCCAATCCTACAATCATAGTCGGTGCCAT
TTTAAGATTAATACCCCATGGGTCGTATCCTAATTTAGAAAACATTTGCATAACTGATTTATCTGCAACCGTTTTACGAC
GTCGATCATCTCTATTACTTCCGTTTCTCTGCGTCACACACTGAGTCAATAGACCTGTAGACATTGTAAAATTCTTTACT
TTTGCGTAAACTTTATCATCAGGAATGAACACTAATGCCATATGTACCTTGCTTACACGAATAAAATCTGTTAAAGCGTC
TTCAACTTCATTGGATCGACATGAAGATATACTGTCCATTGTGTAATTGATTCTTAATCTTCCTATTTCTCTTTTAACAT
CTTCAATAAAATTGTTGAAGTGACTAGGGTTTCGATCAACAACCAGTACACCAAAACGATGAGCTGTGCCTTTAGGAACG
TCAAATTTAATTTCCCCAAACTTCCAATCATCAGGGATTTTAGTATTAATTTTAACTTCGTTTGAAAATATATCAACTGG
AGCCAATTCACGACCACGAATCGTAATCGGTTGTTCTTCAATACACATCCCCCAGCTCTTCATATAATCTTTTGATTTCC
CAGCTCCGGTCCACTTACAAAAATCTCTTATGTCATTTAATCGTTCTCTAGGCTCACGTTTCAATACGGTTCCTAAATTC
TTTTGCAAATTTATATTACTTCTTTCACTATCCGAAAATCCACATAAATAGCATAATTCACCTGGAATTGATAAACTTTG
ATCTGTTTCTGTAGGTCCTTCAGGTTCATTTTCAGTTTTTTTCTTTTGGGCGAACCATCGATCGCTTGACTCGCGATATA
ACAAATGGTTGTTTGTCATTTTTCAAATTAATGTTATACCGTTGCTTGAAATAATTCAAATAGGATATCTTTTTATCGCC
TAGCTGAACCTCGTCATTAACATCCATTTCTTTAATATCTGAAATTCTATACGTCTTGTTATTATACTTGGTAATTATGT
CCCTTCCTATTAATTGATCAATTTGATCTCGTCGATACACTGATACTACATTGTTTTCATTTAGAACACGATTAATTCTT
TCAAGATAAAGTAAAGTCGAAGCAGTTCCATTTTCATTTGTTCCTCTTGTAATTGTAGTAGAATACCCTCCTAATATCTT
GAAATTGTCCATTTTAAAAAAGCTAGGTCCTTCTCGAATACCACCACTTTCACAATTTGATCCCAGAAAAAATTGTCTAC
CAATTTTTTCTTGTCCCATAAATATTTGAATATTATTAAATACAATATTTATCATCTGATAATATTCTTCAGAATTTTTT
AAAAACGTCGTCAGCAATCGTATGGAAATTTCAACATCTTTGATAACTAAGTTTTCTGTATCTTCATCTGAGTGCCACTT
AGAAGTCGTAAATAATCTTCTGCCATCAAAACAAAATGGTTGACCATTATTTTTGCTGTTTGCATAAGCTAATAATAACT
CTAGCTTAGTACGGATACTTTTATTCTCCATAACTACATCATACATGTAAAATGGTCCTTCGACTTTAATATTAAAGTTA
GCGTAGTTAGACTTGAGACTAACTACTCTTCCATCTTTCCCTATTTTGTCTGTAACTGTATCAGGCTGTAAAGCAGGTTC
AATAATTGCGAATCTTCTTTGGAGACCTCCTCTTCTTGGTCTTAAATTGGGATCACTTGTAACATTAGTTGAATCCATTT
CGTAAATTTGAGTAAAAATGTTAAAACAAAGACTTCGGTTTAAATAAACAAAATATACTATGTAAAACGATAAATATAAT
TGCTTTAATGGTTTATGATTTGTATTATATAATAATAATAATTTAATTTCCCTGTGAATATTATATTAAAATATAGTAAA
AATTACTCGTAAATGTGTGTTAAAGTAATAGGATTAAATTAAAATAAACATTTTACGAAATAAGTTCTAGTCAATTATGA
AGTCTTTTCT
>SMED30010115 ID=SMED30010115|Name=SMED30010115|organism=Schmidtea mediterranea sexual|type=transcript|length=1127bp
GTTTTTAATGAACTGAATCAGGTTTAATGCAAAATAGTCATTTTAATTTCTAGATAAATTAACAGTAATTCTTTCGAGAT
TAGATATTTATTATGGAGATTTTATTAACAGAAGATAAAAGTCGAATAGGATTTCTTAATATACAATATGAAGATATATG
GGAAATGTTTAATAAAGCTCGATCTTCATTTTGGACTGTAAATGAAGTTAATTTATCAAAAGATTTTGCTCACTGGAAAA
AAATGAATGACGATGAACGGTATTTCATTACTCACGTTCTTGCATTTTTTGCTGCCAGTGATGGAATTGTCAATGAAAAT
CTCGTCGAAAGATTCATTCAAGAAGTGAAAATTCCCGAAGCTGAGGCATTTTACAGTTTTCAAATTGCAATTGAAAACAT
TCATTCAGAAATGTATTCTCTATTAATCGATTCTTATGTTACTGATACAGAAACAAAGAATAAATTATTTAATGCCATCG
AAACTATGCCATGCGTTCAGAAAAAAGCTCAATGGGCATTGCGTTGGATTAGCGATAAAAAATCCACTTTTGGAACTAGA
GTTGTTGCATTTGCTGCTGTCGAGGGAATATTTTTCAGTGGTAGTTTTGCATCGATATTTTGGCTTAAAAAGCGTGGATT
AATGCCCGGATTATGTTTCAGCAACGAATTAATTAGCCGAGATGAAGGACTTCATTGCGATTTTGCTTGTTTGATGTTTA
AATATTTAAGTAGCAAACCGTCACCTGAACAAGTTTTGGATTTGATCAAAGAAGCTGTCGGAATCGAGAAGGAATTTCTC
ACCGACGCATTGCCGGTTTCATTGATTGGCATGAACGCTGAATCGATGTGTGAGTATATTGAATTTGTGGCCGACCGGCT
GCTGGTTGAATTGGGCTGTGACAAGTTCTGGAACACAGAGAACCCGTTGGATTTCATGGATAATATTTGCATCGATGGGA
AAACTAACTTCTTTGAGAAACGAGTCGGTGAATATTCCATGTCGAGCGTTGAGGACAAACACAAATTTGATGATGTCAAT
TTCGATATTGATTTTTGAGGGATTCCGTTTTTTGGCGCCAGTGTGCATTTAATGTGTTTTGGTTGTAATTGGCTATTTTT
GTTTGTT
>SMED30014446 ID=SMED30014446|Name=SMED30014446|organism=Schmidtea mediterranea sexual|type=transcript|length=4773bp
ATTTAATTTTCGAAAAAAAATATGGAGGAAATACCAGTAAAAGTAGCTAAACTTGAAGCGAATGGAAGTGAAACAAGAGG
TAAAATGGGAAATCGTGGTGGCCTGAGAAGAACATTTAGAATTGTTGAACCTAACTTGCAACCTGCTGATATCACTGAAA
AAACAGGAAACATAGGAAGAACAGTTAAATTACAATCAAATTTTACCAAATTCTCTGTTTTGCGTTCAGAAAAGTTCATG
ATGTATGATTCCGTGTTTTCTCAAGTTGGTTTGTCACCCAAAGTAAAATTACAGTTTATTGTTCGAGTCTGCCAAGAAAA
TAAATTGCCAGGGGCTTTTTGTTTTGATGGAAGACGTCTATTTACTAGTGAAAAATGGCATGGAGAATCGGACATTCAAG
AATTTAGTCATGATGAAAAAAAAATGACACTAAGATTGGTATCAACTATCCTTCCTGAAACTGAAGAATATTACCAAATG
ATCAATGTATTACTCAATAATTTACAAGTAATGTTAGGTCAAGAAAGAATTGGTAAAGGTTATTTTTTAAGCCCAAATAT
TACAAAAGATGAAGTTCCCCGTAATTCTGGACCGACATTTTTTGAAACCAATAGTTTTAAAGTTCTTGGGGGCTTTGGTA
CAACTTTACAAAGAGGCACAAAACCAACTGGTGAATTAACCACTCTTTTATATATTGAGCGTATTAACAGAGTATTAAAC
GATAACTCTGTTATGAAGGCATACAACAGAAGAAGTATCGATCAGTTGATAGGCAGAGATATCATAACAAAATATAATAA
CAAAACTTATAGGATAAGTGAAATAAAAGAAATGAACGTAGATGAGAAATTTGAAATGGGTGGTAGAACTTTATCGTATG
CCGAATATTTTAAGGAACGATATAATATTCGATTAACTCAAGGCGATCAACCATTTGTTCTAACGCGAGTGAAGAAACCA
ATGCGTCGAGAAAGAAAGAAAAAAGACGAAGAAGGAGTGGAAAAAGAGAAAGAAAAAGAACGCGAAAAAGAGGCTCCAGA
AGAGAAGGACATGACTCTCAATATTCCTGGAGAGTTGTGTTTCTTATGTGGGTTTTCAGATCAAGAGAAATCGAATATGG
ATCTGCAGAAGAATTTAGGGTGCGTTTTAAAAAGAGAGCCACGTGAAAGATTGGATGATATACCAGCTTATTGTAACTGG
ATTAAAAATAGTGATGCGGCAACTGGAATGTGCAATAAATGGCAGCTGAAAATAGATAACAAACCATTAGAAATCGAAGG
TAGAGAATTACCTCCATGCGATGTAATAAGTGGTGGCAGCAAAATTAATGAAAAAATGGGAGATGATTGGAAATTTGGTC
GAGTTCAATTTGATATTAAGCGTGATCGTAAGCATGAAATCGATGTGGTCATCGTTGATCGAAATGACTTTCAGTATAAA
AATTTTATGAATGATGTGGAACAAGAATTAAGAAACATGAGAATTGATGCTCGAGTTGGAAAGGTTAATACTTGTGGTCC
AAATGATGTTGAAAGATGTTTGAATGATGCCGCTAGAAGTGGAAGTGGGTGTGCTAAAATGGCGCTGGTATTCGTCCCAG
ATGATAGAGTATATGCCAAGGTGAAATCATTTACCATGAGTACTGGTCTTTTAACCCAATGTGTAACAACACGTAATGGT
ACTAATAGAAACGATAAACGAAGAAAGGTGGTTTCAAGTAAAACCGTGATGCAAATATTTGCAAAATTCGGATATGATCC
ATGGACAGTTGAAATTAAATTGAGACCAACTATGATTGTCGGTATGGATACCTATCATAACAAGTCCAGCAAGAAATCAA
TTCAAGCATCTGTATTTTCGATCAACAGCACATTTACACAATATATGAGCTTTGTTAATTCTCCTAAAGGACGTCAGGAA
TTCCACGAAACTTTAGGCAAAAATTTCAATTTAGCGTTAGAAGATTTCAAGAAACGTTATGACATATTGCCCCAGCGAAT
TTTAGTCTTTAGAGATGGTGTTGGAGATAACCAACTTCAATTTACTAAAAATTTTGAAGTTGATGCAATGAAACCGCTTA
TTGAAAATATATACAAAGGCAACGGATTCCCTGTTCCACAAATCATTTATGTCATCGTAAAGAAAAGAGTCGGCACTAAG
CTTTTCAACAGAGGAAATAATCCAAATCCTGGAACTGTTGTGGATAAAGAAATTGTCAAACCGAATTTCTATGAATTTTT
CCTAGTTTCACAAAGAACAACGAAAGGAACTGCAACTCCAACTAATTATAATGTTTTAGAAGATACTCGATTGCTAACGA
AAAAAGGTACTATGGATCCTATGGCACCGAATGAGCTGCAAAAGATTACCTATGCTCTAACTCATTTATATTTCAATTGG
ATGGGAACTATCCGAGTTCCGGTTCCAGTGCATTATGCGCATAGATTGGCTGAATTAGTTGGAAAGGTGCATAAGGGCTC
TAATCCCGTTGCCATTAATGAAAGAATAAGAAATAGGCTCTTCTATTTATAAAAAGATCAAAACTTACATTTTTCTGTGT
TGATTACTATCCCAATTGTGGATTTAATTGTTTCTGAAAGCTGTTCATTCAAATTCTTCTGAAATCCATATTGATTCGTA
AGCAGCCTGTATTTGAATACTAAAATTGATAAAGTAGTTATAAGTATTGTAAAAGTATTAAATATTTGTTTATGTTATTC
GTAATACACTTGGGTTATTGCAATGTTTTAGTTGTTTTTCAATGATAATAAAGCTTAGCTGTATAAATTCTTTTAGGTTT
TTTAGAAGGTTTATTTATATCGTGTAATTGATTGTCGTGTTAATATTAATTAAATAAAAGTTTGATGTAATTGCTTTGTG
TTACGCATAATAAATCTTACGAAATTTCTGAATACAACTGCTGGTGATCGGGATATTGAATGCCGGGTCGTTTGAATTAA
TAATACAAATGCTTTCGATTATTGTCATTAATATTTTCTCCAGTGCGTAATGGGCCAGAGTTCCGGTGCCATGATTAATG
GTTCCTAAATTTTAGAAATAACATTTTGAATGACATGTTAAATGTGTATATAATAAATTTTCTAGTTTTTTTGCTAAGAT
TTTGAGAAATTTTAGTTACCTGTTTTTGTTAATTGCTTTGATAATTTCAATGCTGACACGTGCAGAATTTCACACATCTC
CAGCAGTCGACTGAATTCTTGGATTTTGTTTGATACAATTATGCTTGCAGATGTTATGGCGCATAGATCCAAGAAGGCTG
TGAATCTTGGGTCTTGTTTTGTAAAGGAAGCTTTGTAAAATATGATGGGACAGTTGCACATAAATTCTAGGAATCCAGAT
TTTAGGCAAGATTGAAGTAATGTTGAATGGTTCTATTATAGAATAATCAGTTGCACTTTTAGATAACCAATATACCACAA
AGAGCCATCCGCAAATTTTGAAAGCCCAAAGCATTGAATCGTTGTCTATGTTACTCAGTATAGACAGCAGTAAAATGGCG
CTTTTTTGATATTGTAAACCGAAATGATTACTAGAATTCATTGTTTCGTCAAGAGATTTCGCGAAACTCTGAATATTATC
TGATTGATTTGATACTATTCCTTGGAGTTTACAAATTGATTTCAGTTCCAAATTCATACTATTGTGTTCTGCTGATTTGC
TACTATTGGAGCTCTATAAGGAATTATTAGAATCAATTTTGGTTTGATAGTGGGTTTTGCAATCATTGGCTTATTGTGGG
TTGTGTAACCATGGAAGTAATTGTGAATAGTTATAGTGCTCGCTCTGCATAAAATAATATTTAATCAGTGCTTTAAAGTA
GATTTTTAACGATTATTATGAAAGATTTCTCTTATATATTAATGTTTTTGTATCCTTCAAAAGTTTACTAAAAATAATGC
ACATTTGAAATTTACGCGTTACCATAAAATGTCTGAAGTGGTCCAAAGCAATAAAAGCTTAAAAAGAAAGTTCTTGTTTT
TAAATGTATTGGGATATACTCCCACTAACCTTCCGTACTCCGCTGCCTCCCTTCCCATCACATACAATATTTGCTAGTTC
TACTTACAGAGTTGAAAATCGAAAAATTTTCCCAGTCAATGTCCATGATTATGCTGAATAAATTTTGTCCGAACATAATA
GAGATTGCCTCAGCCAGTATTTCTTTCGTTGTTGAGTTTTGATGAATGACATGTGAGACTAAATTTATGGACAACCATTG
ATTTTGGTTTTGCTGAAGTTGAGACTTCTTACGGTAAAGATAAACACGAAATAATGATAAACTCTAATCAAAAGATATTA
CAAACAAATATTATGATATCAAAACCTTCTGTCGAACCAAGGCACTTGTGTGAGATAATAAATGAAGAATGAATTCGAAA
AAGAAGTCATAATTCGAACATCGCTCCAGAATGCTGTCACTGACTTTGACTTCAATCACATTTTCCAATATTGAAATCAG
ACCGGCGATCACATGGACCCTTGATGATTCAGACTGACCACTGATTACGGGTTGATCGGTTAAATTATCTAGAGATTAAA
ATAATAGTCGGTAAAGGAAATTATCCATATAAACGGGAAACAGAAAAGTTTTAACCATGGTTTCAAAAGCTTTTGGGACT
ACCCCCAGCTTTGCAAAACAATTTTTTAACGCTCTTGTTATGACTTGAATCAACATTGTACAATTGTTACAATAGACTTG
ATGATTTACTTATTTACACCCCATCTAAATTGTTTCTTAACCCTTTGCCACCC
>SMED30035063 ID=SMED30035063|Name=SMED30035063|organism=Schmidtea mediterranea sexual|type=transcript|length=2664bp
TGTACATTGAATTCAATATTTAATAGTGATTAACTTATCCAAATTTTCAGCCACTTTTAGTTTAATTTGCGTGTTTTGTT
GAGCAGTTTTTATTGGCGCATTTTATAAAAAATACAAAACCAATCCAAATCAGTTTGAATCATTGTCAGATTTTAGTCGT
GCAAGATACATTATTTCATTTTAATTCTCTAGCATATGACATTTAAACATGGAGCTGAATTACTCGTTGAATGATAATAA
TTTCAATTTACAATTAGAAAGCGAGTCCTTGACTTATTTCGATTTATGCCAAAAATGTTCAGCGTACCAAAATAGTCTTA
GAGACTGGATGAAACATTTAGTTGACAGACATCCTTTACCTATTCAGTGGATGAGTGATTTGGCAAATAATTTAACAGAT
GATAAATTATCTAAGCCATATTCGACCGTTACAGAATCCCGTAAAAAACGCAAGAAGCATATCACTCCAAGGCCATTGAA
TAGTTTCATGATATTTTCCAGACATTTAAGAAGAAATGTTCTTATTTTCTTTAGTGATGCTTCAAATTCAGAAATAAGCA
AACTTCTTGGGAAGTTATGGAATAACATTCCAGCTACCATTAAATCGATGTATGATAATGAAGCTAAAAAGCTTGCAATT
TTACACTCCAAAGAATTTCCTGAATATAAATATCAACCTAAAAAGAAAAAAAAACAATATCTAACGAAATGCCCCATTAA
TTCCACACCTTTGTCGAGTAATTCATATGAAAGTATTCAAGATATTAATTCAGTAACGGATACACTACAGAATTCATCTA
ACAACTTACAAAAGGAAAGTAATCCGACCTCTGTTTCGTCTTATGGAAGCAATCAGGAATGTAATAATTCATTTAAGAAT
CATAGTGTACAGTCCAGCAATTTTCCCAAAGAAATCAACCATAAACCAAGTAGAAAAATTGAAAAGCAATCGTGCAAAAT
AAGTTCCAATCAAATAATGGATGATTCAGAAGGGGCTGAATCCAGTCCATCATCATTTAAAAACACCATTAAAAATGAAA
TTTATTCCTCTTATAGTCCATTTCTAAATGAATCCCATAGCATTCTTTCAGATTTAAGTTACTCTTCGTCTCTCAATAAC
GTTTCAAAACACACTAGCGATTCCATTATAACGAATTCTCCTATCAGAGAAGAAATTGTCTTAGAAAATAATCAGCCCTC
TCAACAGAATAATATAAACAATTACCGACACGTATTTCAGAGAACTTCGACTCTATCCAACAGTTTGTTGACCCCTTTAA
CCATTGTCACAGAAAAAGTTGACGAACAGAAAGATCTTCCACCATCAAGAATCAATATCCGATATGTGAAAATTAACAAA
CTACCGATTCAAACAAAATCCGATTTCCCATTGACTGGATATTTTCAAAATTTCAATAACGACTCAAATCTTCATTTTCA
GAGTTCCATTCACGCCCTGAATACGACATTGACTCCAGATCTGTCGGTAAAACGCGAAGCCACTGTCAACAACAGCATGA
CAGATTATATCAATCGAAAACGTACAAATGTCGATCCACTTATCATCGATGATATATTTGAAAACGAACAATTTGAAGAT
GAGGAAGTGTTGAATTTTGACAATCCTGATAACAATAACAGTTCTCCTTGGTCGTTTAAATCGCCTAACTTTAAAATATC
TACCGGTTCCTCGACACTGTCAGACAATCCGTACAAAGAACAGTTTTGTTCTTCCCCGTTCCATCTATCAGAAACTGATA
CTCAACCGATTCCAGTTCAACGATTGCCAGCAATCGGCTCATGGTTAAAGTCAAACTATTCTGAATTCATGATCTGATCC
AATCTATTATTCTATTCAATTGTCTGTTTTCATACAATTAGGATTACTTGTTATGAATTCTAGCTGATTTTGAGTGTGTT
TATAAAGCTTTTGTAACGCCTTTTCTATACAGATGTTCGATATATATATATAAATAAATAAATATAAATATATAACAATT
TTATTGACATTGTACAGTATTCCATAAGCCCGATCTTGTAACGCATTTATTACTATACTCAATAGACCAATCTATATGTT
CTCATAATTTCTATGTTGTTATTGTACACGGGAATTATTACTATAAATGATGCGAATTTATCACTTTGTAATTGAGGGAA
ATTATCGATCAATTTGCGCTTTCAGACATTTTTCATGTATAAACTTGTTTTTCTCTTTTTTATCATCAAAAATTTAATTT
TTTTGATATCGCTATTCATCATATTATTATTCTCCGTTGCATTTGTTAGATTATGTAAATTTTTATATGAAAATGTTGTT
ATTTATTGTATTTTTATACGATTTTTTGCTTTGGATACACTTTTATCAAATCATATTGCCAGTGTGAGCATTTATTGGAC
TTGTTGTTATTGCTGCTGCTCGAATAATTGCTTCATACGGGGAGTCTCGATATTTTCATGAAGCGATTTTCATGGTTGCC
GCTCTCCGCCGCCGCCATTCGGTGTAAATATCAATTGCATTGCCAGCACGTTTTCTCAAACTCAATTTTTGTACTCAATT
TCAATTGATTTATGTTCATTTTATTTTTCATAGAAATGAGTAAATAAATTTTCATAAATAGTTTTGTTTTCAATATTTTT
AGGAAATTTGAATGTGTCTCTAGA
>SMED30001900 ID=SMED30001900|Name=SMED30001900|organism=Schmidtea mediterranea sexual|type=transcript|length=1713bp
CTTTTGAGGGAAAAATAATTCTTTTATTAATAATGTTTCATCATTGGAATATAAAATAAAATATTAGGAGAAAACATAAG
TTAACCAACAATATTAGCCACATATTTCGTTTAATTATTGGTCTATCACTTTTCATTTTAACCAATTGTCTTGAGATAAT
GGAGAGTTTATCCTTAATTTTTATTATAAATCACTGGTTTTGATAGACTTATTAACAATGGAAAATTATTTCAAACTTTT
CGTTGGTCAGATACCTCGAAATACACCAGATAAAGAAATTAGACTTATTTTTGAAGCTTTTGGACCAATCTTTGAATTTT
TAATTTTAAGGGACAAGAAAACTGGTTTTCATAAAGGATGTGCTTTTGTTACATTTTATCATAAAGACTCTGCAGAAAAT
TGTCAAAAGGCGTTACATGACAAGAAAATCCTAAACGGGATGAATCGACCACTTCAAGTGAAACCAGCTAAAAATAAGTT
AGCAAAAAATTCAAGTTTGAATGGGGAAAATCAGACAGAAGAGCAGGTTTTCAGTGATGAAAGGAAATTGTTTGTTGGAA
TGTTGAGTAAAAATCAAACTGATGAAAATGTACAAAATATGTTCACAAAATTTGGCAAAATCGAAGAGTGCACTGTATTG
AAAGACCAAAATGGAAATAGTAAAGGATGTGCCTTTGTCAAATTCGTGAACCACACCGATGCTTGTGCAGCAATAAACGC
TCTTCATGCCAGTCAAAAAATGGAGGGTGCTTCATCCAGCCTTGTGGTTAAATTTGCTGACACGGATAAACAAAAACAAA
TAAGAAAATTGCAGCAATATATTCCAGATTTAAGCATTTTAAATTCGCGCATTCCTATTAATATTCCATACTATTCACAA
TACGGTACAATAATTAATCCAGAATATAATTCAACAATTCCTTCAAACCAATATATTCGAAATTGTAACGAATATATTCT
TGCTGCTCAAATTCAACAAATAAATTTGTTTTCTAATTTATCATCGGTCTACCCATCTAATTCAATAGTGTCAATGCCAT
CCAGCCATCCGGTACCAATGATTGACTATTCTGTTCCTATTAACAACTTTCCACAAACTGACCAAATAACAATGAAACCA
ATTGTTGATATACAGCCAATACCTCCAGAAGCTGTACACCGAACCATCGTAACTCCAGGATCACTCTTATCATATCCTTT
TCTTAATGTTCAAATTCCTACAGTATATCCAAACGCCTTTTCCAATGGAAATTTAACAAGTACAACACAAAGTTCAACAG
ATGTGAAAACCACTCCTTTGCCAACAGGTCCTGAAGGCTGCAATCTATTTATTTATCATCTGCCACAAGAAATTGGTGAT
TTACAATTATATCAAATTTTTATGCATTTTGGAAACGTTATCAGTTCTAAAGTTTATGTTGACAGAGCAACAAATCAAAG
CAAATGTTTTGGATTTGTCAGCTACGATGATCCGGCATGTGCCAATGCCGCCATCAAATCTATGAATGGATATCATATCG
GAACAAAAAGATTAAAAGTTCAGTTAAAAAAACCAAAAGAAGCAATAAACGAAATGAAAAACTTCAATCAAATGTTATCA
TCAACTCCCGACATAAACCAAGTATTTTGTTCATCCTAATGATTGTGATATTTTACAGGATTTTCTCGACCATATTGAAA
GCCTGATTGGTGATATGTAAAATGACCCACCGT
>SMED30013909 ID=SMED30013909|Name=SMED30013909|organism=Schmidtea mediterranea sexual|type=transcript|length=2414bp
ATTTAGAAAATGGAGGCAACTTGCGATGTTTTTTTAACGAATTTACCTAAGTCGATTAATGAAGTAGTTGTGAAGAACTT
ATTTTCTTCTGCTGGGAAAGTGTTAAAAGTGAAAATAATAGATGACAAAAGAAACGAAAATCAGAAGCTATGCTTCGTTG
GATTTCGAACTATGGATGAAGCATTAGAAGCCGTCAGAATTGCAGATAAATCTGATGCGTTTGGTGATCCAATTAGAGCC
AGTATATCAAAGAAGTGTTTAGACGGAATGGAGAATAATCAAAATAGATCAAATAATAACAGAAATGATTCAAGTTATAA
AGGAACTGATTCATTTTCAAGAAAGAGTGATTCTAATTTCAAGGATAGTGAAAAGTATCCAACAAACAATGGTGACTTTG
CACAAGTAAATCGTTTAAACAACGTTGGAAGAGGAAGAGGAATCCAGACTAAAATTATTAGTGGTCCACCTTCATTCAAA
ACTAATGAAATTAAGTTAAACGATATTAAACTTAAAACAAAAGAACTGATTGACATCGAAATCGTCGATTTAAGTAGAGT
TGACATTATACTTATAAGGCCAGTAAAGTCAACGGAAAATTCAAAAATTGAAATAGCAGATTTATTGTCACAAATAAATT
CAAATAAATCGAATCTAATGCCAGTTGACTGTCCTAAAATAGGAGATTTTTGTCTTGCAAAATGGACTGAAGATGATTGC
TATTATCGGGCTGAATTGTTAGATATATTAAAGGATGGATCTTTCAAAGTTACTTTTGTTGATGAAGGAACTTCGGGTGA
TATTGTGACTGATTTGAAACACATTCCGACTGGTGCTTTACAGCAGTATCCTAAACAATTTTTGAAGGTTTCAATCGGTT
GCTCAGACGCAAAAGAATTAATGTCATTTATTTTACAAGAGTCTGAAGGAAAGGTGATTAAAATTTATTGGCTCGGAGAA
TATTGTGATTCCGTGCCTGTTGTAAATTTATTTCTGAATGAAGATGAAATTGTGGAAAAATATACCCAAATAAATAAAGT
AAATATCAGGAAAAAATTCTCACAGACATTTGATGATCTCCCAGTACATAACCTCGAAACTAATTCACATTTTTCAATAG
CACCATCAATGTATAAAAACCGAAATGATTTTATTCTTCAGATGAAAACTTTCTCGGTATCTTTAAAGCAAAAAAAATGT
CCTACGGTTTTACCAATTCCTGGTGATATATGTATATATGAGAAAAGGAATGCTAATGGCGAATCATTTCTTCGTTGTGT
TATATTAAGGCGCCAACTTTTTTCTTTTGACATCGAGTTAATAGATATCGGTGAAAAAATAATGAATGTTAATATTGATC
ACCTGTACACAGTCGAAGATATTCATGTAAAAGACGCTCCCTGTGCTATTACTTGCGATTTAGATAGTTCTATTAATATA
GATGGTATTAAGCTCCCTCAAGATTTGATCGATGGTGTTCTCTTTAATCTTAAAAAGTACAACAAAAATAATAAATACAC
TGTAAATTTCATTTTACCACAAAAGAAAGCTTATGAATATGCAAAAGTATCATATAAAGATTTGATTGGTAAAAGCTTTA
AAGTAATAATGTCGCACGTTGTCTCTCCCATTAATTTCTTTATTCAACTTGATGATGGAGAGCATCAGCTTGCACTTGGA
GATATTCAAGAAAAATTAAATATTAATTATAATGGATCACCATTCAAAAGTGCTAGCGATGTTAAAGAAACTCAGGCAGT
TATTGCTCCTTTTATTGTTTCCGGAAGTGATGCGGAACTTTTTCGGGCTTATGTTTTAGAGAAACGAAAGGAATCTCCAC
AAATTCATGTATTGTTTATTGATTATGGTAATGATGAATGGGTGAATTATGAAACTTTACTGAATACAAATGAAGAATTA
GTTTCTAAACCAGGTTTCGCAATACATTGTAAATTATCTCTAAATATTAAGAAGGAAGCGTGGAGTCACGCTATTGAATT
ATTTAATGATTTAGCTGGTTATACTGAAAATGACCAGGGGACGTTTGTAATGCAGGTTATTAGTGTCGATGGTGATTCGT
TAGTTGTGGACTTGATTTCAGAACTGAAAGGTTCGTTGACGGCCATCTTAGAAAAAAGTGGTACATGTGTAAAGTCCAAT
GAACCAATATGTAATGGAGGAGGACCCCAAGTTAAATTAAATGGCGTTTCAAATGATAAATCTCAATCAGCTATTCTTGA
AAATTTATCTGAAGGAGAATTATATAAAAAATTTATTGAACTAGAACGGAGATTAAGTGCTTTAGAGATATTGATGAAAT
AATGCTACCCGCGCAATTAGTATTATCAAATTATGATAATCTAGTCTTGATGTGTTTAAAATTTTGTATTTTAACATAAA
TTTATTCCGTGTTG
>SMED30033466 ID=SMED30033466|Name=SMED30033466|organism=Schmidtea mediterranea sexual|type=transcript|length=421bp
GATCTCACTATATAAATAAGTATTTGTCCCTATTAATTCATAACAATTATTCAACATGTCTGGTCGAGGTAAAGGAGGAA
AAGGACTAGGAAAAGGTGGAGCAAAGCGTCACAGAAAAGTCCTTCGTGATAACATTCAAGGTATCACAAAGCCAGCAATC
AGAAGATTAGCTCGTCGAGGTGGTGTTAAGAGAATTTCTGGATTGATATATGAAGAAACCCGAGGTGTTCTTAAAGTATT
CTTGGAAAATGTTATTAGAGACGCTGTGACATACACTGAGCACGCTAAGCGCAAGACAGTAACTGCCATGGATGTCGTCT
ATGCTTTGAAACGACAAGGAAGAACTTTGTACGGTTTTGGAGGTTAAATAACACTTTCATATTTGTGAATGTTTTAGCGG
CCCTCTTTAGGGCCACAAATG
>SMED30001362 ID=SMED30001362|Name=SMED30001362|organism=Schmidtea mediterranea sexual|type=transcript|length=3093bp
AATTAAGAGACAGCCATTTATGTTTATTTTTAAAATAAATAGTATATATTTAAGTTTCGAATTTTCAGCTACAATTTAAT
AGTACATAATTATACGATGTCAGGAAGTAGTGGAATAGGTAGAGGCCGCAGTCGTGGGCTGTTGATGCAAAAGTTTCTGA
ATAAAGATGTTCTTGTTCCTTCTGTTGAATCTTTAGAAGACAAAGCTCTTAATAAGCTAGGAATTCCACTTCCTGGGTCT
ACCGTAGAAAAAAATACAGAGTCAAGTTCTATATCAAGTGGAGATTCAAGAAGTAATCCCAGTGGAGATTCAAGAAATAA
CATAAAACTACAAGATAGTGATATTGAGAATCGCAATATTACCATTGTTACGCGACCATTATCCTGCATAGGCAGGGGTC
GGGGTTTAAGCAATCCCTCAAGTTTAACTACGTCATCGGGTAAATCGGATAAAATTACTGAAAACGAAGAACCTGGTCAA
ATTAAAAAGTTTGTAGGTCGCGGTAGAGGATTGTTGAATTCTCAGAAAGAATGTTCAAACTCTACTCCATCTGAAGTTTC
AAATGAATTGAAACAAATGAAAATTTCAAATGATGATAAAATGACGGTTTCTTCAGAAGCAAAGTCACAATTTGAGAACA
TTGAAAAACCTATTAGTAAATTTCGTCGACGCGAATATCCAACTCAAATAAAAGAACCATGTAATACAAGAAATGATTCA
TCGCCATCTTTAACTTTAAGTGCTAATTACGTTAAAGTTAGGACTACACAACCCCATATATATCAATACCATGTTTCCTT
TGCACCTCCGATAGATTCAAGGTTGATGAGAATTAAAATAGTTCAAGGGTTATCAGAATCAGATTTAGGGGTTGTCAAAG
AAGCAAGAGCTTTTGACGGTATGAATTTATACATTCCTCAACTTTTAAAAAATAAAGAGACAATAATTAAAGTAAACAAA
CCGACTGATAAGACTGTCGTGGATGTTAAAGTAGTTTTTACTAACAATGTTAATTTTAGTGAATGTCCTATGGTTTATAA
TGTTCTTTTTAAAAGAATTGAAAATTCCCTCAGAATGGTTAAAATTGGTAGGGATTATTTCTACCCTGAAAAAAAGATAG
TACTTGACCGTAGAAGGATGGAAATATGGCCGGGATATGTAACAAGTATCCAAAATTTTGACGGTGGTTTACTGTTACAA
TGCGATGTGTCACACAAAGTTATTCGAAATGATAGTGTGTATGACATAATGATGGAAATTAATAAAACTGTTAACAATAA
AGGTCAAATGCAAACTGCTGCGATTAATCAACTATTGGGTCAAATTGTGTTAACTCCTCACAATAACCGAAATTATAGAA
TTACTGATATAGATTGGGCTAAAAATTGTTTAAGTGAATTCGATAAAGGAGGCGAAAAAATTAGCTACCGGGATTATTTT
AAGAACACGTATGGGCTACAAATTCGTGATCTAGAGCAGCCTATGATAGTTAGTAAATCTAATAGCAGATCTGGTAAAAA
CCGAGGTCCCAAAGGATCAAAAGAAGTGGATGGTGGATTGGTCTATTTAATTCCAGAATTGTGTATGCTAACTGGTTTGA
CAGATGACATGATTAAAGATTTTCGTTTGATGAGAGAATTACACGAGCATTGTCGAGTTACTCCCAAGAAAAGACACGAA
GCCTTACTGGAATTCGTGGATAACATATATAGCTGTGAGGAAGCTAAGAAACTTTTAGGGTATTGGGGTATAACGATTGA
AAAGGACACTGTCAACATAAATGCTTGTAAAATGAATCCAGAAATGATATATTTTGGAAATGAAGCTTCTGTTAGTGCTG
GGGAACAAGCTGAATTTAAACAAGCCTTGGCACATAATAAAGTTATAGGTGGTATTCGTATTGAAAATTGGATATTAATT
TCTCCAAAAAGTTTACTGACAAAAGCAAATGGTCTGTTACAGGCTTTAATGAGCAAATCTCCTAGAGTTGGAGTTATGTT
TGGAAAACCCAAAATAGTTGAAATGAACAATGATCGAACAGAAGAGTATTTAAAAGAATTAAAGAGAAATGTGGCTCCTG
GTGTGCAGTTAGTAGTTACAATTTTATCTGCTGTTAGAGAAGATCGATACAATGCAATAAAAAAATTTTGTTATGTGGAT
TGTCCTGTTCCAAGTCAAGTGGTATTAGCCCAAACATTGAAAGAAGGGCCTAAATTAAATAGTGTGGCAGTTAATATAGC
CCTTCAAATAAACGCAAAATTAGGTGGAGAGCTGTGGGCTGTCAAAATACCTATTAAGAAGTTTATGGTTGTTGGACTTG
ATGTTTGGCATGATACTAAAGGGAGAAGTAGATCAGTTGGAGCCGTAGTTGGTTCAACTAATGCGCTATGCACAAGGTGG
TTTTCGAAATCGCATTTGCAAGAACAAGATAAAGAAATTATGTACGTATTACAGTCGTGTATGTTAAGCCTTTTAAAGGC
TTATTTTGAAGAAAATAATTTTTTGCCTGAGACTATCTTTATGTATAGGGATGGTGTTAGTGATGGTCAGTTAGGATATG
TTCAAAAAACTGAAATTGAACAATTCTTTAAAGTTTTTGAATCGTTTAGTGCTGATTATAAACCTAATATGGTATATAAT
GTTGTTCAAAAGAGAATAAATACTAGGCTCTATGTAAGTGATCCGAAAAATAAAGGACAAATAAATAACCCCAATCCTGG
TACAATTGTCGACCATACTGTTACGAGGGCTAACCTTTATGATTTTTTTCTTGTTTCTCAATCGGTTAGGCAGGGAACTG
TAACTCCGACGCATTACGTTGTTTTATGTGACAATTCTAAATACACTCCGCATCAGGTTCAGTTGATGGCTTATAAAACA
TGTCATATATATTACAATTGGCCGGGAACGGTTCGAGTACCAGCACCTTGTATGTATGCTCATAAATTGGCATATATGGT
TGGTCAGAATTTGAAAGCTGAACCTAGTAATCTTTTATGTGACAGACTTTTTTATTTGTAACATATGTGTTTCTATTTGT
ATTATTGTTAAACTGCATTTCGTAAAATAAATTAATTTCGTTATAAAAAAAAA
>SMED30004304 ID=SMED30004304|Name=SMED30004304|organism=Schmidtea mediterranea sexual|type=transcript|length=907bp
CTAAAAGGTAATAATTTAAATTTAATTAGAACATTGTTTTAATATTCGGTTATATTCTCCATTATTCTAAATTATGTTTG
AAGCAAAATTAATAAAAGGCGAAGTTTGGAAAAAGGTTATAGAAGCTATAAAAGACTTAGTACAAGAAGCAACATTGGAT
TGCTCAGAAAATGGAATTAGTCTTCAAGCCATGGATACATCTCATGTGTCCTTAGTTAGTATGCTTCTTCGAAGTGATGG
TTTTGAGACTTATCGATGTGATAGAAATGTCAATCTCGGTCTTAATATAACAAGTGTTTCAAAAATTTTAAAGGCGCTTG
GTAGTAATGATTCCCTAACAATGAAAGCCGCTGATTCAAGTGAAACAATTTCGCTTTTGATAGAATCTGCAAATGAAAAT
GAATTATCTGAATACGAAATAAAATTAATGGACTTGGATGGAGATCACTTAGGTATACCAGATACTGAATATAAGTGCAT
TGTGAAAATGCCGAGTTCAAAGTTACAAAGAATATGTCGAGATTTAAGCCAAATTGGAGAAGCAATCACGATTTGTGTTA
CTAAAGATGGTGTAACTTTTGCTGCTGCTGGAGATCTAGGAAAAGGAGCTATAAAACTTAATCAAAATTCTAGTGCTGAC
AAAGAAAATGAAGGAGTAACTATTGAAATGACCGAACCTGTTTCGATGACATATTCATTGAGGTATTTCAATATGTTTAC
AAAGGCTGCACCTCTTTCTTCTCAAGTATCTCTGTCGTTGACTGAAAATGTTCCAGCAGTTATTGAGTTCATAATCGAAG
ATTTGGGATTTATTCGATATTACCTAGCTCCTAAAATCGAAGACGACGAGTGAAAGTTTAACTATTAATGTTGTATGTTT
AATAGATGTTATTTTGTTTAAAAAAAA
>SMED30019097 ID=SMED30019097|Name=SMED30019097|organism=Schmidtea mediterranea sexual|type=transcript|length=1596bp
GGAATAACAGCCAATTAGGGATCAGCTGCAATTTGGCCTATGATTGGACATTGATTTTTATAGTCTCAGGCGTTCTCAGC
TTACGTGTGCACCTTTTTAGTGGACACGTTAAATTTGATAGGTGCTTAGTGGTGTTGATTCCTGTTTGGAAACTGTATAT
AACCAAGGTTATTTGTTGCTTTGAGACAAATGCAACACAATCAAATAATTAATTATGCTATGTTCAAATTGTTCAAACAA
TCAGGATACTTTGAAATTATGGATGGTCCATTTAGCTTCTTGTCACCCATTACCTCCTGAATGGCTTAGTGAAAAGGCCA
AAGTATTAAATGATGACGAAAATCAGCGCCCCTATACAATTGTCACTGATTCCCGAAAAAGAAGGCGACGTCCAACCACA
CCAAGACCACTAAATACGTTCATGATTTTTTCGAGGCATATCAGACGAAATATTCTCTCAGTGTTTCCGGATGCATCAAA
TTCCCAATTAAGCAAAGAGCTTGGAATTTTATGGAAGAAAGTCACAAATGAAATTAAATCCCTTTATGAAGAAGAGGCAA
AGCGATTGGCTCAATTACATGCTCTTGAATTTCCCGATTATAAATATCAACCAAAGAAACGAGTCCGAAGATTTGGAAGA
GCGATTTATGATCGACAGCCCTGTACAACAGAAAGATCTAACTCAACTAGTGCAACAGACGAAGAAAATGGTAAAGACAA
TAATAGTGTTCAAGACGGTAGAAGATCAAGCGATATTGAGAATCAGTATATAAGATATTCAGTTTTGGGTAAAAATATTG
TAAAACGAGAATGTCAGTCCTTTAATAGTCCTTTAAAAAGCGACAACGTTAAATTGGAAACGCAAGAACAAGATTTTATC
CAAGCGATGCCCAAACCTCTAAACGTCCGAATAACGAATTACAACGAAAACAGTATATTTTTACGACAACAAAGATTACC
ATCAAGTAGCACAATGTATTTACTTCCTTCAGAAAACCTAATAATTAGTAATGGGATTATGGGATCACAGGACTTGGGTG
AGGATTATTGTAGAGAGTTGTATATAATTAATGATTTTTTCCCAGAAAATGTAAACATAGACGATGAAATTGATATAACA
GGAAACATTTTTAGCAATGATTTAGATTTAGAGTGGTCTGAAATTGATGAAAATTACAAACAAGATTTACCAAATCTTAA
TTCATTATTTCAACACTAATATATTTGATTTATAAAATATTTAAATATTTTTTATTAAACAGTCTTTTACATGTACATAT
AGTATTGGAACTCTTCTCTGACTTATAAGATAACAGAGATATTGTAATAAGATTAAATTGGTTATGTGTTTCGGTTTTTG
TAAGATTGGTAATTTTCAGAAGAATTTAGACTTTTTTCATGGAAATTGGAATTGAGAAACAAACTGAATAAAGAAACAAA
TTTTTGAAAAAAACGAAACAGATACTTATTATCAAAAGAAAATTATCTGAAGCATCGAGTCGGTATGAAAAATAAACTAA
TTAGTCAGAAAATTTTTGATGAAATAACGTCTAATGAAATTAAGATCTCCAAGGAATACTTTTTCTAACATTTGAT

 

back to top


 

References

Adler, C.E., Seidel, C.W., McKinney, S.A., and Sánchez Alvarado, A. (2014). Selective amputation of the pharynx identifies a FoxA-dependent regeneration program in planaria. Elife 3, e02238.

 

Auladell, C., Garcia-Valero, J., and Baguñà, J. (1993). Ultrastructural localization of RNA in the chromatoid bodies of undifferentiated cells (neoblasts) in planarians by the RNase-gold complex technique. Journal of Morphology 216, 319-326.

 

Baguñà, J. (1976). Mitosis in the intact and regenerating planarian Dugesia mediterranea n.sp. I. Mitotic studies during growth, feeding and starvation. . Journal of experimental zoology 195, 53-64. 

 

Baguñà J, S.E., Auladell C (1989). Regeneration and pattern formation in planarians. III. Evidence that neoblasts are totipotent stem cells and the source of blastema cells. Development 107, 77-86.

 

Cowles, M.W., Brown, D.D., Nisperos, S.V., Stanley, B.N., Pearson, B.J., and Zayas, R.M. (2013). Genome-wide analysis of the bHLH gene family in planarians identifies factors required for adult neurogenesis and neuronal regeneration. Development 140, 4691-4702.

 

Currie, K.W., and Pearson, B.J. (2013). Transcription factors lhx1/5-1 and pitx are required for the maintenance and regeneration of serotonergic neurons in planarians. Development 140, 3577-3588. 

 

Guo, T., Peters, A.H., and Newmark, P.A. (2006). A Bruno-like gene is required for stem cell maintenance in planarians. Dev Cell 11, 159-169.

 

Hay, E.a.C., S. (1975). Fine structure studies on the planarian, Dugesia. I. Nature of the “neoblast” and other cell types in noninjured worms. Journal of ultrastructure research 50, 1-21.

 

Hori, I. (1982). An ultrastructural study of the chromatoid body in planarian regenerative cells. Journal of electron microscopy 31, 63-72.

 

Lapan, S.W., and Reddien, P.W. (2011). dlx and sp6-9 Control optic cup regeneration in a prototypic eye. PLoS Genet 7, e1002226.

 

Lapan, S.W., and Reddien, P.W. (2012). Transcriptome analysis of the planarian eye identifies ovo as a specific regulator of eye regeneration. Cell Rep 2, 294-307.

 

März, M., Seebeck, F., and Bartscherer, K. (2013). A Pitx transcription factor controls the establishment and maintenance of the serotonergic lineage in planarians. Development 140, 4499-4509.

 

Morita, M., Best, J., and Noel, J. (1969). Electron microscopic studies of planarian regeneration. I. Fine structure of neoblasts in Dugesia dorotocephala. . Journal of ultrastructure research 27, 7-23. 

 

Newmark, P.A., and Sánchez Alvarado, A. (2000). Bromodeoxyuridine specifically labels the regenerative stem cells of planarians. Dev Biol 220, 142-153.

 

Orii, H., Sakurai, T., and Watanabe, K. (2005). Distribution of the stem cells (neoblasts) in the planarian Dugesia japonica. Dev Genes Evol 215, 143-157. 

 

Palakodeti, D., Smielewska, M., Lu, Y.C., Yeo, G.W., and, and Graveley, B.R. (2008). The PIWI proteins SMEDWI-2 and SMEDWI-3 are required for stem cell function and piRNA expression in planarians. RNA 14, 1174-1186.

 

Pearson, B.J., and Sánchez Alvarado, A. (2010). A planarian p53 homolog regulates proliferation and self-renewal in adult stem cell lineages. Development 137, 213-221.

 

Reddien, P.W. (2013). Specialized progenitors and regeneration. Development 140, 951-957.

 

Reddien, P.W., Oviedo, N.J., Jennings, J.R., Jenkin, J.C., and Sánchez Alvarado, A. (2005). SMEDWI-2 is a PIWI-like protein that regulates planarian stem cells. Science 310, 1327-1330.

 

Rouhana, L., Shibata, N., Nishimura, O., and Agata, K. (2010). Different requirements for conserved post-transcriptional regulators in planarian regeneration and stem cell maintenance. Dev Biol 341, 429-443. 

 

Rouhana, L., Vieira, A.P., Roberts-Galbraith, R.H., and Newmark, P.A. (2012). PRMT5 and the role of symmetrical dimethylarginine in chromatoid bodies of planarian stem cells. Development 139, 1083-1094. 

 

Salvetti, A., Rossi, L., Lena, A., Batistoni, R., Deri, P., Rainaldi, G., Locci, M.T., Evangelista, M., and Gremigni, V. (2005). DjPum, a homologue of Drosophila Pumilio, is essential to planarian stem cell maintenance. Development 132, 1863-1874.

 

Salvetti, A., Rossi, L., Deri, P., and Batistoni, R. (2000). An MCM2-related gene is expressed in proliferating cells of intact and regenerating planarians. Developmental Dynamics 218, 603-614.

 

Scimone, M.L., Kravarik, K.M., Lapan, S.W., and Reddien, P.W. (2014). Neoblast specialization in regeneration of the planarian Schmidtea mediterranea. Stem Cell Reports 3, 339-352.

 

Scimone, M.L., Srivastava, M., Bell, G.W., and Reddien, P.W. (2011). A regulatory program for excretory system regeneration in planarians. Development 138, 4387-4398.

 

Shibata, N., Umesono, Y., Orii, H., Sakurai, T., Watanabe, K., and Agata, K. (1999). Expression of vasa (vas)-related genes in germline cells and totipotent somatic stem cells of planarians. Dev Biol 206, 73-87.

 

Solana, J., Lasko, P., and Romero, R. (2009). Spoltud-1 is a chromatoid body component required for planarian long-term stem cell self-renewal. Dev Biol 328, 410-421.

 

van Wolfswinkel, J.C., Wagner, D.E., and Reddien, P.W. (2014). Single-cell analysis reveals functionally distinct classes within the planarian stem cell compartment. Cell Stem Cell 15, 326-339.

 

Wagner, D.E., Ho, J.J., and Reddien, P.W. (2012). Genetic regulators of a pluripotent adult stem cell system in planarians identified by RNAi and clonal analysis. Cell Stem Cell 10, 299-311.

 

Wagner, D.E., Wang, I.E., and Reddien, P.W. (2011). Clonogenic neoblasts are pluripotent adult stem cells that underlie planarian regeneration. Science 332, 811-816.

 

Wenemoser, D., Lapan, S.W., Wilkinson, A.W., Bell, G.W., and Reddien, P.W. (2012). A molecular wound response program associated with regeneration initiation in planarians. Genes Dev 26, 988-1002.

 

Yoshida-Kashikawa, M., Shibata, N., Takechi, K., and Agata, K. (2007). DjCBC-1, a conserved DEAD box RNA helicase of the RCK/p54/Me31B family, is a component of RNA-protein complexes in planarian stem cells and neurons. Dev Dyn 236, 3436-3450.

 

back to top