Stage 7

Developmental timeline and staging designations for Smed embryogenesis. Timeline: days (d) post egg capsule deposition at 20˚C. Gray bars indicate time windows for RNA-Sequencing samples. Double headed arrows: time windows for Stages (S) S1-S8.

 


 

▻ Overview

▻ Stage Description

▻ Images

▻ Download Supplemental Table

▻ In Situ Hybridization Data

▻ Sequences

 

Back to Molecular Staging Resource


 

Overview

 

D9-D11. Organogenesis and organ maturation continues. Onset of gliding motility. [ PMID:28072387 ]

 

back to top


 

 

Stage Description

 

Elongated embryos continue to flatten, but have clearly adopted the bilaterally symmetric body plan of juvenile and adult animals. Pigmentation, if present, is sparse. Animals are motile: slow gliding locomotion is apparent, but animals cannot flip over. Mature, ciliated epidermal cells largely cover the dorsal and ventral surfaces of the embryos. A dense network of elongated, anteroposterior and circular fibers of body wall muscle is evident beneath the epidermis. Gut development continues: branching morphogenesis is evident, as is clear separation of the two posterior gut branches. piwi-1+ cells occupy the parenchymal space between the gut branches and along the tail stripe. Expression of embryonic gut markers ceases, and expression of mature gut markers becomes robust. Resorption of the temporary embryonic pharynx is complete, and definitive pharynx formation continues. The bilobed brain and ventral nerve cords are well developed, and lateral and commissural neurons continue to develop. The eyes, noted by the presence of developing pigment cups in live animals, first become visible during S7.

 

back to top


 

Images

Brightfield images of live Stage 7 (S7) embryos harvested for RNA-Sequencing (left), a paraffin embedded S7 embryo sectioned coronally and stained with hematoxylin and eosin (middle), and heat maps for S7 enriched transcripts (right). Black arrowhead: definitive pharynx. Scale bars: 100 µm.

 

Figure 1 – figure supplement 9. Mean centered expression and average RPKM profiles for S7 enriched transcripts. Organized by cluster membership presented shown in the heat map and S7 enriched transcript excel file (Figure 1 – source data 7). S2-S8: Stages 2-8. Y: Yolk.

 

 

 

back to top


 

Download Supplemental Table

 

 

Figure 1 – source data 7. S7 enriched transcripts from pairwise and/or mixed stage reference comparisons
Criteria for flagging differentially expressed transcripts:

Criteria for flagging differentially expressed transcripts: 1) Pairwise comparison (S6 vs S7): adjusted p-value < 1e-5 S7 vs mixed reference comparison: adjusted p-value <1e-20 2) log2 ratio ≥ 2.322 (5-fold upregulation, both comparisons) or log2 ratio ≤ -2.322 (5 fold downregulation, pairwise comparison only) 3) Average scaled RPKM value ≥ 1.0 for S7 4) Transcript has ≥ 1 ORF 5) Transcripts derived from transposase or retroviruses were omitted.

Tabs in this excel file contain 1) pairwise comparison data (if applicable), 2) mixed stage reference comparison data, 3) cluster membership, average RPKM values across embryogenesis (Y-S8), and in C4 and SX adults, as well as best BLASTx hits (E < 0.001) versus the NR, Swiss-Prot, C. elegans, D. melanogaster, D. rerio, X. tropicalis, M. musculus and H. sapiens REF-Seq databases, 4) GO analysis: Manually curated and categorized Biological Process (BP) GO IDs and 5) GO analysis: unabridged results. S2-S8: Stages 2-8. Y: Yolk. C4: C4 asexual adults. SX: Mature sexual adults

 

 

back to top


 

In Situ Hybridization Data

Smed IDGene NameAliasExpression PatternWISH Image
SMED30001362SMEDWI-3piwi-3neoblast
SMED30001900SMED30001900bruli-1neoblast
SMED30004304SMED30004304PCNAneoblast
SMED30005748HNF4hnf-4definitive gut, gamma neoblast
SMED30006796tyrosinasetyrosinaseeye, pigment cup
SMED30007290GATA456gata456adefinitive gut, gamma neoblast
SMED30007406SMEDWI-1piwi-1neoblast
SMED30008639MyoD-like proteinmyoDmuscle organ, muscle progenitor
SMED30013909tud-1tud-1neoblast
SMED30014446SMEDWI-2piwi-2neoblast
SMED30018353SMED30018353AGAT-1Category 3 cell, epidermal progenitor
SMED30018592ovoovoeye, photoreceptor neuron, pigment cup, trail cell
SMED30019097SOXP-1SOXP-1neoblast, sigma neoblast
SMED30021661SMED30021661CAVII-1protonephridia
SMED30022907SMED30022907Dj-sytnervous system
SMED30024586Pax6Apax6Anervous system, neural progenitor
SMED30024865SMED30024865vim-3Category 5 cell, definitive epidermis
SMED30025388SMED30025388Dj-mhcmuscle organ
SMED30025591porcupine-like proteinporcn-Adefinitive gut
SMED30026364SMED-P53p53Category 2 cell, epidermal progenitor, zeta neoblast
SMED30027428forkhead box A-1foxA1definitive pharynx
SMED30030007SMED30030007crocc, H.2.8bCategory 5 cell, definitive epidermis, protonephridia
SMED30030379SMED30030379pou2/3protonephridia
SMED30030594SMED30030594opsineye, photoreceptor neuron
SMED30030681SMED30030681ZPUF-6Category 4 cell, epidermal progenitor
SMED30035063SOXP-2SOXP-2neoblast, sigma neoblast
SMED30035904PROG-1prog-1, NB.21.11eCategory 2 cell, epidermal progenitor
Click to see image symbols and abbreviations
Abbreviation or symbolDefinition
Ooral hemisphere
Aaboral hemisphere
Ddorsal
Vventral
Llateral
black arrowheadembryonic pharynx
red arrowheaddefinitive pharynx
black arrowsprimitive gut
yellow arrowsprimitive ectoderm cells
cyan arrowsbrain
cyan arrowheadsnerve cords
blue arrowheadseye progenitors (trail cells)
purple arrowheadseyes
scale bar100 µm

 

back to top




Sequences

smed_20140614 transcript sequences for genes validated by in situ hybridization (above).

>SMED30007406 ID=SMED30007406|Name=SMED30007406|organism=Schmidtea mediterranea sexual|type=transcript|length=2730bp
AATCGAATACATAAAAATTTATTTGACACCAAATACAAAGAGACATTAATCTACAAGTAAAATAAGCGTTCGCGAATTCT
GTCATTTATCGCTGGAGGAGTAACACCACGATGAATCTTGCCAACGAGTTCAGCCAAACGATGGGCATAATGCGTTGGAA
CAGGAACTCGGATTGTTCCCATCCAGTTAAAATACAAATGTGTTAACGAATAAGTTATTTGCTGCAATACACTCGGAGAC
ATAACTGAAACCTCATTTGTTTTCTTGTTTGTAAACTTAGTGTCCATAAGAACATTATAATTCGTAGGAGATGCTGTACC
TTTAGTTGTTTTCTGAGACACCAAGTAAAATTCATAGAAATTGGGTTTCACTATTTTCTCATCAACCACAGTACCAGGAT
TTGGATTAGCCCCATCTTTGAAAAATTTAACACTAATTCTCTTCTTAACCACAACATAAATAATTTGGGGCAAAGTTTGA
TTTTCGTAAATTTTCTCTATCATTTTCATAACAGCATCAGTTTCGAACTTTTTGGTAAATGCTAACTGTGAATCTCCAAC
ACCGTCACGATAAATAATCAAACGAAGAGGCATAGTGTTAAATTTGTTTTGGAATGTTGTAAGGGCCGTTAGGAAGTTTT
TGCCCAAATTTTCGTGAAATTCATTTTTACCTTTAGATGAATTGACAAAACTGATATACTGAGAAAATTTGGCACTAATT
GAAAATACGGATGCTTGAACAGATCTTTTACCGGTTTTGCTATGAAAAGTATCCAATCCTACAATCATAGTCGGTGCCAT
TTTAAGATTAATACCCCATGGGTCGTATCCTAATTTAGAAAACATTTGCATAACTGATTTATCTGCAACCGTTTTACGAC
GTCGATCATCTCTATTACTTCCGTTTCTCTGCGTCACACACTGAGTCAATAGACCTGTAGACATTGTAAAATTCTTTACT
TTTGCGTAAACTTTATCATCAGGAATGAACACTAATGCCATATGTACCTTGCTTACACGAATAAAATCTGTTAAAGCGTC
TTCAACTTCATTGGATCGACATGAAGATATACTGTCCATTGTGTAATTGATTCTTAATCTTCCTATTTCTCTTTTAACAT
CTTCAATAAAATTGTTGAAGTGACTAGGGTTTCGATCAACAACCAGTACACCAAAACGATGAGCTGTGCCTTTAGGAACG
TCAAATTTAATTTCCCCAAACTTCCAATCATCAGGGATTTTAGTATTAATTTTAACTTCGTTTGAAAATATATCAACTGG
AGCCAATTCACGACCACGAATCGTAATCGGTTGTTCTTCAATACACATCCCCCAGCTCTTCATATAATCTTTTGATTTCC
CAGCTCCGGTCCACTTACAAAAATCTCTTATGTCATTTAATCGTTCTCTAGGCTCACGTTTCAATACGGTTCCTAAATTC
TTTTGCAAATTTATATTACTTCTTTCACTATCCGAAAATCCACATAAATAGCATAATTCACCTGGAATTGATAAACTTTG
ATCTGTTTCTGTAGGTCCTTCAGGTTCATTTTCAGTTTTTTTCTTTTGGGCGAACCATCGATCGCTTGACTCGCGATATA
ACAAATGGTTGTTTGTCATTTTTCAAATTAATGTTATACCGTTGCTTGAAATAATTCAAATAGGATATCTTTTTATCGCC
TAGCTGAACCTCGTCATTAACATCCATTTCTTTAATATCTGAAATTCTATACGTCTTGTTATTATACTTGGTAATTATGT
CCCTTCCTATTAATTGATCAATTTGATCTCGTCGATACACTGATACTACATTGTTTTCATTTAGAACACGATTAATTCTT
TCAAGATAAAGTAAAGTCGAAGCAGTTCCATTTTCATTTGTTCCTCTTGTAATTGTAGTAGAATACCCTCCTAATATCTT
GAAATTGTCCATTTTAAAAAAGCTAGGTCCTTCTCGAATACCACCACTTTCACAATTTGATCCCAGAAAAAATTGTCTAC
CAATTTTTTCTTGTCCCATAAATATTTGAATATTATTAAATACAATATTTATCATCTGATAATATTCTTCAGAATTTTTT
AAAAACGTCGTCAGCAATCGTATGGAAATTTCAACATCTTTGATAACTAAGTTTTCTGTATCTTCATCTGAGTGCCACTT
AGAAGTCGTAAATAATCTTCTGCCATCAAAACAAAATGGTTGACCATTATTTTTGCTGTTTGCATAAGCTAATAATAACT
CTAGCTTAGTACGGATACTTTTATTCTCCATAACTACATCATACATGTAAAATGGTCCTTCGACTTTAATATTAAAGTTA
GCGTAGTTAGACTTGAGACTAACTACTCTTCCATCTTTCCCTATTTTGTCTGTAACTGTATCAGGCTGTAAAGCAGGTTC
AATAATTGCGAATCTTCTTTGGAGACCTCCTCTTCTTGGTCTTAAATTGGGATCACTTGTAACATTAGTTGAATCCATTT
CGTAAATTTGAGTAAAAATGTTAAAACAAAGACTTCGGTTTAAATAAACAAAATATACTATGTAAAACGATAAATATAAT
TGCTTTAATGGTTTATGATTTGTATTATATAATAATAATAATTTAATTTCCCTGTGAATATTATATTAAAATATAGTAAA
AATTACTCGTAAATGTGTGTTAAAGTAATAGGATTAAATTAAAATAAACATTTTACGAAATAAGTTCTAGTCAATTATGA
AGTCTTTTCT
>SMED30024586 ID=SMED30024586|Name=SMED30024586|organism=Schmidtea mediterranea sexual|type=transcript|length=1992bp
GTTGGTTTTTCTAACAGATTTATTAATGCTAGATTGGCCGCTCAAGATTAATCATAATATTCTGCTACTTTACTGATATA
ATTTTTATACACGGTTACTACTACTCCTCTACTATTTTCGCATTGTTGGCTTCTCAAATTCAATCCCTGGGCATAAATCA
AACCGCTTCATTGACAAAATCCTTTTTGACACTACAAGAAATTGATTCAGTTACTGAAGTAGAAAATATACACAGTCGAA
ACCTATGACCGAATCGAATGAAGAGGAAATAAAAAATAAAAAGAAAGTTAAACGAGGACATTCAGGAATCAATCAATTAG
GTGGAATGTTTGTCAACGGTCGACCTTTGCCCGATTCGACCCGACAGAGAATCGTTGAGTTGGCTCACTCCGGAGCGAGA
CCATGTGATATTTCCCGAATCCTCCAAGTTTCCAATGGATGCGTCAGTAAAATCCTATGCAGATACTACGAAACCGGTTC
AATTCGACCGAAAGCCATCGGAGGCAGCAAACCAAGAGTAGCTACCAGTTCAGTTGTGTCGAAAATTGCCGCCTACAAAC
GTGAATGCCCGTCGATATTTTCTTGGGAAATTCGCGATAGATTATTACAGGAAGGGGTTTGCAATCAGGATAACATTCCC
AGTGTCTCTTCGATAAATCGTGTTCTACGCAGTTTGTCTAATGAAAACCAACGACATTTAGTTGCAGCAACTGGAATGTA
TGACAAACTGTCATTGTTAAGCGGCCAGCCTTGGTCTACTGCAGCTGCTCATGCGGCTTGGTATTCCAGTGCTGCAGCAG
CACATGGGTATGCTTCATCGACATTTCCCAATTGTGGTGCCTATGGAGGCTTAACCGGAATCGGAATTATCAATGGAATG
AGTACAGCCCACGCGGTAGCGTCAATTAATCAGTCGAATTCCGGGGTCACAAATTACCATGTTCAATCAACAACCGATAG
TTCCGACAAACACAAATCAGAAAAATATTCAGAATCCATTGCACATTCTGAATCGAATGCTTCCAGTGAGCCTGGCAACG
AATATATGTCCGGAGTAAAAAGTGAGAATGATGATATGAGAATTAAACTGAAAAGGAAACTTCAAAGAAATCGAACATCG
TTTTCAACAGATCAGCTTGATTCTTTGGAAAAAGAATTTGAACGAACTCATTATCCTGATGTATTCGCCAGAGAGAAATT
GGCAGACAAAATCAGTCTTCCAGAGGCGAGAATACAAGTTTGGTTTTCAAATCGAAGAGCAAAATGGAGACGAGAAGAAA
AACTTCGTCGACAACGGCAAAATCTTATGCTTGGTTCAAACGGAACAAGTTCTACTGCTGATACTAATGTAACAACAAAT
GGAAATACTCAATGTTTGTCGACAACCGGACAAAATTCAATGGGATTTTCTGGAATAAATGATATCAGAAACCAATTTGG
TGATGTTGGAATGCAAACACCTTCATTGTCGGCTGTAGCAGCTGCAGGAATGTACCATTCGGCAGTTGCCTCTGCTGCAG
ATCAGTATGCAAAATCAGCCGGTTTACCAAATCTTTCGCAATCGTCAATCAATTCTCCATATTCCTACATGGCAAATTTG
CAGTCGAGATCCAGTGGTTCCCAAATTGACTTGCCAAACGTTACAAGCAATTCAAATTCTTTTTACAACCCCGGATCAGT
TTATCCCCCAAGTTTATTTCAAGGTGTAATGAGAGGATATGACACCATTGGATATCCCAAGTATCCTTCAGCAATGTTTC
CAGGATCACTCGAAAGTAATAATAATATCAACCCTGCCGGTTTTCTTGCAAATAATATGTCTTCGAATTCATCTAAACCC
GATTACGATTTCTCAGCATTTAATCGGCCCAGCAATTATTGGACTCCGGTCGCATAAAATTGCACAAATGAATGAAAACA
ATTTCAAAAATTCCGAAACAACAATGATTAGAACAAAAAAAACATTTTTCTAAAATAGTTGTTAATTTAAAC
>SMED30018592 ID=SMED30018592|Name=SMED30018592|organism=Schmidtea mediterranea sexual|type=transcript|length=1211bp
GTCATATTGAACACTGAGACTAGCTATCAATAGCTGACAATTAGACGTATAAAATGTTAGGGTACGCCTTTTTGGCCATT
ATTTCACACCAAAATTTCCATGAGTATTTTTCTAATAAGCACTCTACTCGCAAACGATGACGAAATGCCCACAGATTTGT
CATCGAAAACTGAAAAGATTGAAAACCATGAAAAATCTGAAAGGAATCTCTGCAAGTATTCCAGTCAGTTTCTTTCCTGT
TTTTATTCACAGGAAATGTTGACACTACTTATGAGAAAAAATTTCATCAATCAATATTCATTTTATTTAAAGATTTTCTC
GGGGTTTCCACAATTCGTCGATAACTTCAACTTAGTAAATCCAACAGATTTCACCGTCAATTCAAATTCAACAACAATTT
TGCCCTCATTCAACTTCCATAAAACGTCATTGAATATCGAAATGAACACCTCACTGGCCAATTCTTCAAGCACTGGTAGG
TCGTCTCCAACTGAAACTGTGTCTGAAAATCTTTGGTTAGAAAAAGTAAAGGTGGAAAAATATTTCCATTTAATTGAAAA
TCTATCACAATCCCAAGAGAACATTGAAGACATTGTCAAAACGATCAAAGTCAAACGAAGAAATTTTGCTGAATATATTA
AGAAACTTTACCTAAGTGATCCAGCCAAATTTAAGTTGACAAATGGTGGAGATGGAATAGTAAATCCATTTAGAAAACAA
TTCAAAGAAGAACGAGATAAATCTATGGACAAATTTTGCATCGAAGTTAATCACAATTATCAATGTAAGATATGTAACAA
GGTGTTTCCTTCCAAAAAGCACATGCAACGTCATATACGTTCACACGGTGTAAATTTTGATTGGTTGTGTAAATATTGTT
TTAAACCGTTTATTGATTCCTACGATTTAAAACGACATACGAGAGTCCATACAGGAGTTCAACCATACAAATGTCAAAGT
TGCACAAGAAAATTCAGTCAACGATGCTCATTGGAAAGTCATCAGGTGAAAATCCATGGAGTAGCACTGAATTATCTATA
CAAAGAAAGAAGGAACAAGTTGTATCCGTGTGAAATCTGCAGTTATAGTACGTCTTGTAAAGCAACTTGGTTGAGTCACA
TCATTCAGGAGCACCCGAATTCACTTTATGCAAAAGAAGAAGCACTCAAAGGAAAATACAACTGACTTTGAAAAATATTG
ATTTTTCAAGC
>SMED30025591 ID=SMED30025591|Name=SMED30025591|organism=Schmidtea mediterranea sexual|type=transcript|length=3526bp
TTCCGATCTTTTCTTTTGAAATTTTTGAAATTTTAAATAAAATTAATGACAAAGGCAGAAAATCAGAGAACTACTAAAGC
ATCCGACTTCAAATTTGGAAAAGAAATCGGCCATGGCTCGTTCTCAACTGTAATGATAGCTAAGGAAATTTCTACCAATA
AACATTATGCTGCAAAAATTATTGATAAAGTTTTTATTTCTAAACAGCGAATGGTTAATACTGTTATGATTGAAAAAGAA
GTTCTCCGAAGAATAAATCACCAGTTTTTTGTATGTCTCAATTATACATTCCAAGATCCAGAGAGATTGTATTTTATTAT
ATCATATGCCGAACGAGGAGAACTTTTATCTCATTTAACAAGACTTTCGTGTTTTGATTTAACGTGCACACAATTTTATT
CCGCGGAAATTATTCTTGCATTAGAATATTTACATGGAATTAACGTTGTTCATCGAGATATAAAACCAGAAAATATTTTA
CTGAGTGAAAATATGCATATAAAAATTTGTGATTTTGGCAGTGCAATTATTATCGATAAACCAGATCTCAAGCCTTCTTC
TTTTACAGGTACAGCTCAATTCGTTTCTCCAGAAATGCTGGGATTCAGTAAAGAAACACGTGACAATAGCTATTCAGATG
AACCGAATTCTGATTCAGAGGAACATAGCGAAATTGAAGTTAAACGAACTAGTTCACCTGATAATTCTAGGGAAATATTA
TATCTAATGGACTTCTGGGCATTAGGATGCATCGTCTATCAAATGTTGTCTGGACGAATGCCATTTCACGTCAGGCATTC
ACGGCATGAATATGAAATTTTCCAAAAGATCCGAAATTTAAAATATGAGTTTCCGGTTGGGTTTGATGATACTGCTAAAG
ATTTTGTCTCTAAACTTCTTGTATTGAATCCACTGGAAAGATTAGGCAATCCATCCGATGGAAAGCACGCTGCTTTAAAA
GCCCACCCCCTTTTCCGTTCAATTGATTTCGAAATTATCGGATCACAAAAACCTCCGCTATTACTTCCAAATATTGAGCC
CATTGTTCAAAGTAATTGGGACGAAATTCCTGTTGGTTTTGAAGAAGCATGGAAATTCAATATCAAAAAAGAGTTTCAAG
AAATGGAAAAAGCCGATAAACAAAAATTATTGCAAAACCAAGAAAAACTAAATCCGTTTCATAGATTTGTACGCAATCGA
TTGATCATAAAACAAGGCATCTTGTACAAACGGCGTGGATTATTTACTCGTAAAAGAATGTTTCTATTAACTGAAGGACC
TCATTTATTTTATGTCGACCCCGATGCTATGCAATTTAAAAAAGAAGTCAGTCTAAACTTAATTACTGGCATAGAAGTAA
AAAATGACAAAGTATTTTATATCGTTACTAAAAGGCGAACATATTTTCTCGAAGATCCTTCAGCAAAGGCTGATGAATGG
CGACAGAGTATTGAATCGATTTGTGTAGAATATTATGGATCATTTAAATTATCCCCTGGCACTTGCACTCAAACGCCTCT
AGTTACATCATCTGAATCATAACTTTCGGTTTTATTTAAATTTATTTGTCATATAGAAAAAAATGTGAATTTAACGGTTT
TTAATATAATAATTTAATATTGGTTTGAATTCTTGTTTTTCATTTTAAAATTTAATGGATATAATTTAAATATTTTAATA
AATAAAAATATTCACATTGTTTTAATATTCTCTTTATGTCGTAATTGATAAATGATGCATTGTAAATGTATTTTACAACT
GATCTAAATGAAACCAATAGGAAACGAGTGGTTCGATGTCATGTGAATCAGCATGCAACCAATCATAGTTTTGTGATTCA
TTAAATATATTTTAAATTTTTAAAACAAATTAAATCACTTAATTAATTTTTAGACAATGTCACAATTTTATGGCGGATCC
ACGATATTGGCACCTCTATCGAACGTTATGGGTATACCAGTGGATCAAATTAATTTTATTGTGTGTAGTTTATTGTCAAT
CGGACTGGGTCAAATTATGCGACACAAATTCCCTCCTTCTAAATTGTCAGGAAGTACAAGAGGAATCATAGAAGCATTTT
TTGGAATACTAATTGTTCTTTTCTGCTTCGGATACCAAGTCAAGTATTTGTTACTACAATCAACAGTTTCCTATGTAATA
CTATTATTTTTGCCTTCACAAATATCAGCGCATTTGGTAACGTATTGGTGTATGGCTTTCATGGCGATAGTCCATTTATA
CAGGATGCATTACGATTACGGAGGTTATACTCTCGATATATCTGGTCCGGTTATGATTCAAACCCAAAAATTGACCAGCC
TCGCATTTAATCTTCTAGATGGACATCGAATAAATCAAGGAATAAAACTGCAACAGAGAAATCATGAATCTCACGCTGTG
AAAAAACTACCAGATGCAATCAAGTTTTTCGGTTACACATTCTACTTTCATGGTGTATTAGCGGGTCCTTTTGTATTCTA
CAATGAATATAAAGAATATATCACTGGATATGACGACAAGCATATTCCATGCTCCAAAAAGCAATTATCTTCAGCACTTT
GTTTATCAGTGATCCATGGATTATTAACAGCATATGTCGCACCGCAGTTTCCATATATATTTGTTTGCAGCACCGATTAC
CAACGGATGCATATGACTCGTAGAATAATGTTCACAATGATTTCATTTTTCCTCGTAAGACAAAAGTATTACTTTGCCTG
GTCAATGGTTGAAGCTGGTGCTCTTAGTACCGGATTGGGATATTGTGGAAAGGATAAAAACGGAGAGAATAATTGGTCGA
AAGTGAAAAATTACGATTTCATGGCAATCGAAAGCGGCAGTAGTTTGAAAGTGCTAGTGGACGGATGGAATATTTCCACA
ACAAGATGGCTCAGAGAATTAATTTATGAACGAGCTCCTTTATTCTGTCGGACAATTCTAGTTTTCACCGTCAGTGCATT
TTGGCATGGATTCTATCCTGGATATTATTTGATGTTTTTGACATTTTCTCTCTTTACGTTTTGCGCTAGAACCGTTAGGA
AACACATTCGACCATTGTTCATTGTCAGTCCAATTACACTTCAACTCTATCATGTTCTAACGAAAATATTCACAAATCTG
GCTTTAAATTACGGACAAGGACCATTTTATTTGCTGGAGTTTCAATCGGGACTTTTGTTTTGGAAGCCATATTACTTTTT
CGGACACGTTCTAGCAATGTTCTGCGTATTGACCTTGCAATTTCGGCCGATAATCAACGACAAAGTCAACATAATGAACA
ATGTTTTCACCAGAAAAGCCCAATATCGGTTTCAGAAACTAAAGATCCATTTGCAGAAAAAGTTGAGATGAAATTTTATT
GATTTTGATAATTTATATAAAATATTATAATTTTGTTTTTCGTTTTATTTTTATATCGATGAATTTATGATAAATGCTAA
ATATTCGATCCGGAATGAATTATTATTAATCTGGTTTTTATAATTGTTCATTTTTAATAGTTTTGTTTGTTTTTCGAAAA
TGGCGG
>SMED30008639 ID=SMED30008639|Name=SMED30008639|organism=Schmidtea mediterranea sexual|type=transcript|length=1606bp
GTTCATATTACCAACTGTTCGCCATTAATTCAGCCTGTTTTACGCCTCGTAACAACTGTTACTTCAACAATACCGATCCA
GCCCAATAAACAATGATACACTCCGGATCATTTCCAGGTTCCACTTGTCCGATTAACTATGACTATTCCGGTCCATACTC
AGCAGGTCTTGAGGCAGCTCCATTTTTAGTCAATCAAACCTGTCCATATAACACTGGAACAAATACAATGCCTCCTTCGT
TGTCACTAGTAGATAATATGATGATGAATAATTCCATGCATCTTTATGATAGACTGAATACTCATCATTCAGCGTCGTAT
TTTCCTCAGATTTTAAACAAAATCGAACAGAAATTACCAACAACCTCGAGTAAAACCACTCCATCAACATTGGTTTCAAC
ATCCTCCAATTCCATATCGAATTCTGAGTTTAATTCGTCGCGATCTTCGTCACAATTTCCAACATACGATTTGATTTCGT
CACTCAATAATAGCAACTACGACATGTACGATTCGCCCTATGCCGCCTATCTGGCCGCTGGTTATTATCAATCTCCTGGA
TTTGCGCTCAAACAGTACGACGCTGCTGGAACATCTCAACCATCAATGACAGATTTGTACCATTCATCACTAGCAGCCAG
TTCAGGCTTAAATTTGAATTATTCACAGCATAAATCGAGACATTTATCAGAAGATGCTGGATCATGCCAAGATCCGCAGT
CTCAAAATATCACAAGCAATAATCATCATAACAATTCGTATAGTCCAACAACTGCTGATTTCGGATCACCAAAAGCCTTA
TCAAGTAGCAGCCAGTCCATAAATGATGGAAGACAACCGACCAGTAGTAATTCCAGTCCTCAAAAACTATCACTAGCAAT
TGAACAACACTTATGTCCAAATAAAGAGGAACATGTGCTAGTTCCAGGGTCACATGGTCAATGCTTGTTGTGGGCCTGTA
AAGCTTGCAAAAAGAAAACGGTTCACGTTGATCGCCGCAAAGCGGCAACAATGCGTGAAAGACGTCGATTGAGAAAAGTG
AATGAAGCTTTTGAAACATTGAAACGAAGAACGAGCGGTAACCCAAATCAAAGAATGCCAAAAGTCGAAATTCTAAAGAA
CGCGATTGATTACATTGAGAGTTTGGAAGAGTTGTTGAATTCCGTGGGAAAATTACCTGCAACCGTTGGAGAATTGAAAG
AACGCCGCAAAAACAACCCAGAAAATTCGAGAACAGCAATCGCCGGAAAACAAAAGCCACTAAATAAAATTAATGATAAA
CAGAAAGCTGAAAACAAATATCCCGAGACCATCTGCAAACTCCCGACGACTAGGAAATCCTATGTTGCTTCCGACCTTGA
TCAGCAGATTTATCAATCAAACATGTTGAAGAGTTCAACTCTTGATCAACTTTCCTCGATAGTAGACAAAATCTCTACGA
CTAATACAACAATTGCCGACCATTCAATGGACGCTAAGCCCGAAAATAGTTGAATACATAACAAAACGCAACAAATATTA
TATTAACCTATTAATTTTGTTCTAAACTCGTTTGCCCTGATACATATTGTACATTTTCTTTCAATAGAATGTTCTTATAA
TTATAA
>SMED30014446 ID=SMED30014446|Name=SMED30014446|organism=Schmidtea mediterranea sexual|type=transcript|length=4773bp
ATTTAATTTTCGAAAAAAAATATGGAGGAAATACCAGTAAAAGTAGCTAAACTTGAAGCGAATGGAAGTGAAACAAGAGG
TAAAATGGGAAATCGTGGTGGCCTGAGAAGAACATTTAGAATTGTTGAACCTAACTTGCAACCTGCTGATATCACTGAAA
AAACAGGAAACATAGGAAGAACAGTTAAATTACAATCAAATTTTACCAAATTCTCTGTTTTGCGTTCAGAAAAGTTCATG
ATGTATGATTCCGTGTTTTCTCAAGTTGGTTTGTCACCCAAAGTAAAATTACAGTTTATTGTTCGAGTCTGCCAAGAAAA
TAAATTGCCAGGGGCTTTTTGTTTTGATGGAAGACGTCTATTTACTAGTGAAAAATGGCATGGAGAATCGGACATTCAAG
AATTTAGTCATGATGAAAAAAAAATGACACTAAGATTGGTATCAACTATCCTTCCTGAAACTGAAGAATATTACCAAATG
ATCAATGTATTACTCAATAATTTACAAGTAATGTTAGGTCAAGAAAGAATTGGTAAAGGTTATTTTTTAAGCCCAAATAT
TACAAAAGATGAAGTTCCCCGTAATTCTGGACCGACATTTTTTGAAACCAATAGTTTTAAAGTTCTTGGGGGCTTTGGTA
CAACTTTACAAAGAGGCACAAAACCAACTGGTGAATTAACCACTCTTTTATATATTGAGCGTATTAACAGAGTATTAAAC
GATAACTCTGTTATGAAGGCATACAACAGAAGAAGTATCGATCAGTTGATAGGCAGAGATATCATAACAAAATATAATAA
CAAAACTTATAGGATAAGTGAAATAAAAGAAATGAACGTAGATGAGAAATTTGAAATGGGTGGTAGAACTTTATCGTATG
CCGAATATTTTAAGGAACGATATAATATTCGATTAACTCAAGGCGATCAACCATTTGTTCTAACGCGAGTGAAGAAACCA
ATGCGTCGAGAAAGAAAGAAAAAAGACGAAGAAGGAGTGGAAAAAGAGAAAGAAAAAGAACGCGAAAAAGAGGCTCCAGA
AGAGAAGGACATGACTCTCAATATTCCTGGAGAGTTGTGTTTCTTATGTGGGTTTTCAGATCAAGAGAAATCGAATATGG
ATCTGCAGAAGAATTTAGGGTGCGTTTTAAAAAGAGAGCCACGTGAAAGATTGGATGATATACCAGCTTATTGTAACTGG
ATTAAAAATAGTGATGCGGCAACTGGAATGTGCAATAAATGGCAGCTGAAAATAGATAACAAACCATTAGAAATCGAAGG
TAGAGAATTACCTCCATGCGATGTAATAAGTGGTGGCAGCAAAATTAATGAAAAAATGGGAGATGATTGGAAATTTGGTC
GAGTTCAATTTGATATTAAGCGTGATCGTAAGCATGAAATCGATGTGGTCATCGTTGATCGAAATGACTTTCAGTATAAA
AATTTTATGAATGATGTGGAACAAGAATTAAGAAACATGAGAATTGATGCTCGAGTTGGAAAGGTTAATACTTGTGGTCC
AAATGATGTTGAAAGATGTTTGAATGATGCCGCTAGAAGTGGAAGTGGGTGTGCTAAAATGGCGCTGGTATTCGTCCCAG
ATGATAGAGTATATGCCAAGGTGAAATCATTTACCATGAGTACTGGTCTTTTAACCCAATGTGTAACAACACGTAATGGT
ACTAATAGAAACGATAAACGAAGAAAGGTGGTTTCAAGTAAAACCGTGATGCAAATATTTGCAAAATTCGGATATGATCC
ATGGACAGTTGAAATTAAATTGAGACCAACTATGATTGTCGGTATGGATACCTATCATAACAAGTCCAGCAAGAAATCAA
TTCAAGCATCTGTATTTTCGATCAACAGCACATTTACACAATATATGAGCTTTGTTAATTCTCCTAAAGGACGTCAGGAA
TTCCACGAAACTTTAGGCAAAAATTTCAATTTAGCGTTAGAAGATTTCAAGAAACGTTATGACATATTGCCCCAGCGAAT
TTTAGTCTTTAGAGATGGTGTTGGAGATAACCAACTTCAATTTACTAAAAATTTTGAAGTTGATGCAATGAAACCGCTTA
TTGAAAATATATACAAAGGCAACGGATTCCCTGTTCCACAAATCATTTATGTCATCGTAAAGAAAAGAGTCGGCACTAAG
CTTTTCAACAGAGGAAATAATCCAAATCCTGGAACTGTTGTGGATAAAGAAATTGTCAAACCGAATTTCTATGAATTTTT
CCTAGTTTCACAAAGAACAACGAAAGGAACTGCAACTCCAACTAATTATAATGTTTTAGAAGATACTCGATTGCTAACGA
AAAAAGGTACTATGGATCCTATGGCACCGAATGAGCTGCAAAAGATTACCTATGCTCTAACTCATTTATATTTCAATTGG
ATGGGAACTATCCGAGTTCCGGTTCCAGTGCATTATGCGCATAGATTGGCTGAATTAGTTGGAAAGGTGCATAAGGGCTC
TAATCCCGTTGCCATTAATGAAAGAATAAGAAATAGGCTCTTCTATTTATAAAAAGATCAAAACTTACATTTTTCTGTGT
TGATTACTATCCCAATTGTGGATTTAATTGTTTCTGAAAGCTGTTCATTCAAATTCTTCTGAAATCCATATTGATTCGTA
AGCAGCCTGTATTTGAATACTAAAATTGATAAAGTAGTTATAAGTATTGTAAAAGTATTAAATATTTGTTTATGTTATTC
GTAATACACTTGGGTTATTGCAATGTTTTAGTTGTTTTTCAATGATAATAAAGCTTAGCTGTATAAATTCTTTTAGGTTT
TTTAGAAGGTTTATTTATATCGTGTAATTGATTGTCGTGTTAATATTAATTAAATAAAAGTTTGATGTAATTGCTTTGTG
TTACGCATAATAAATCTTACGAAATTTCTGAATACAACTGCTGGTGATCGGGATATTGAATGCCGGGTCGTTTGAATTAA
TAATACAAATGCTTTCGATTATTGTCATTAATATTTTCTCCAGTGCGTAATGGGCCAGAGTTCCGGTGCCATGATTAATG
GTTCCTAAATTTTAGAAATAACATTTTGAATGACATGTTAAATGTGTATATAATAAATTTTCTAGTTTTTTTGCTAAGAT
TTTGAGAAATTTTAGTTACCTGTTTTTGTTAATTGCTTTGATAATTTCAATGCTGACACGTGCAGAATTTCACACATCTC
CAGCAGTCGACTGAATTCTTGGATTTTGTTTGATACAATTATGCTTGCAGATGTTATGGCGCATAGATCCAAGAAGGCTG
TGAATCTTGGGTCTTGTTTTGTAAAGGAAGCTTTGTAAAATATGATGGGACAGTTGCACATAAATTCTAGGAATCCAGAT
TTTAGGCAAGATTGAAGTAATGTTGAATGGTTCTATTATAGAATAATCAGTTGCACTTTTAGATAACCAATATACCACAA
AGAGCCATCCGCAAATTTTGAAAGCCCAAAGCATTGAATCGTTGTCTATGTTACTCAGTATAGACAGCAGTAAAATGGCG
CTTTTTTGATATTGTAAACCGAAATGATTACTAGAATTCATTGTTTCGTCAAGAGATTTCGCGAAACTCTGAATATTATC
TGATTGATTTGATACTATTCCTTGGAGTTTACAAATTGATTTCAGTTCCAAATTCATACTATTGTGTTCTGCTGATTTGC
TACTATTGGAGCTCTATAAGGAATTATTAGAATCAATTTTGGTTTGATAGTGGGTTTTGCAATCATTGGCTTATTGTGGG
TTGTGTAACCATGGAAGTAATTGTGAATAGTTATAGTGCTCGCTCTGCATAAAATAATATTTAATCAGTGCTTTAAAGTA
GATTTTTAACGATTATTATGAAAGATTTCTCTTATATATTAATGTTTTTGTATCCTTCAAAAGTTTACTAAAAATAATGC
ACATTTGAAATTTACGCGTTACCATAAAATGTCTGAAGTGGTCCAAAGCAATAAAAGCTTAAAAAGAAAGTTCTTGTTTT
TAAATGTATTGGGATATACTCCCACTAACCTTCCGTACTCCGCTGCCTCCCTTCCCATCACATACAATATTTGCTAGTTC
TACTTACAGAGTTGAAAATCGAAAAATTTTCCCAGTCAATGTCCATGATTATGCTGAATAAATTTTGTCCGAACATAATA
GAGATTGCCTCAGCCAGTATTTCTTTCGTTGTTGAGTTTTGATGAATGACATGTGAGACTAAATTTATGGACAACCATTG
ATTTTGGTTTTGCTGAAGTTGAGACTTCTTACGGTAAAGATAAACACGAAATAATGATAAACTCTAATCAAAAGATATTA
CAAACAAATATTATGATATCAAAACCTTCTGTCGAACCAAGGCACTTGTGTGAGATAATAAATGAAGAATGAATTCGAAA
AAGAAGTCATAATTCGAACATCGCTCCAGAATGCTGTCACTGACTTTGACTTCAATCACATTTTCCAATATTGAAATCAG
ACCGGCGATCACATGGACCCTTGATGATTCAGACTGACCACTGATTACGGGTTGATCGGTTAAATTATCTAGAGATTAAA
ATAATAGTCGGTAAAGGAAATTATCCATATAAACGGGAAACAGAAAAGTTTTAACCATGGTTTCAAAAGCTTTTGGGACT
ACCCCCAGCTTTGCAAAACAATTTTTTAACGCTCTTGTTATGACTTGAATCAACATTGTACAATTGTTACAATAGACTTG
ATGATTTACTTATTTACACCCCATCTAAATTGTTTCTTAACCCTTTGCCACCC
>SMED30026364 ID=SMED30026364|Name=SMED30026364|organism=Schmidtea mediterranea sexual|type=transcript|length=2047bp
CTCATGACAGTTTTATTAAAGTTACTATTATTAGGAATTCTGCGCGTTAAACTAGACATTATCGATGGCCCAGCAATATA
TTACTTCGGCTTTCGATCCAAACTTCACAACGTTACAGCATCAGACTTCAATACATTATAAATCCTCTCCAATTGAAATG
ATTGTTCCGATGCAATGCAACCAAAACCAAGCCACCTTATCTATAACCCCTGTTCATATTTCTCCATTTGTTAATATATC
AGATTCTAATAATCACAATTTGACGAATATCGTCGAGCCTGTTTCATCAAATACTATGTCTCCTGCTTTTAAATCCGACG
ACATGCCAACATTGTCTTCTTATCCAGGTCCGTATAATTTTCAAATCTTTATTCCCAACGGAGAATTTGATGAATCCAAA
AGAAAAGGACAGACATGTGTGTTTCAAACCGATAAAATGGGAAATCACCAATTATTTACCAAACCTCATCCTCATTATTG
GAGGTTAAATTATTCAGCTGATCCTTCTATGTCAACGGAAAACATGTATATTCGGATGGTTCCAGTTTTTGGGGATCCAG
AAAAAGCTCAATGCATTTTGGAAAGATGTGCAAAACACAAAGAAGTAACAACAGATGAAAATCACTGGAAATATCGTAGC
ATGCTCATTGTAGAAAAAACCTGTGCACATTACTTTCAGGATTCGGCAACGAAAAGAGTTTGCATTTTATTACCGTTTGA
AAAGCATGCGGAAGGAGAGATTTATTCTTCCGTCAACTGTCAATTTGCATGCTACAACAGTTGCTTTAATCAAGATTCAG
GTGGTCGGAAAACACTTTATTTAATCATCACTCTAGAATTTCTCGATAAAAAAACAAATAAATTCGATGTATGGGGTCGA
CAGTGTTTGCAATTTCGCAGTTGTGCTTGTCCAAGTAGAGACTGGAGAGATAAAAAGATTAAAGGCGATCCAGAAATGTT
ACTGAAATTCAAAGAAAAACGAATCAAAACCGAAGAAAAATTAAATAATTTGGTGATTTCTAAAAGCGTCCCTATTAATA
TGGGTGGAAAGGATGCTATCATAAGAGTTCTTCCCTCGTTGCCAGGACTCGATGACGCTATTAACGCATTAGTTTGCGGA
TACTTACTGAATCGAACAACCAACATAAGCGCAATAATAGCAGCATTTAATCAGATGAAAGACGTAGAACATTTAATTAT
CGATCAATTCACATCAAATTTAGATCAAAATACATGTGACAGTAAAAGTCCTTCACAAACTCCAGAGTCTCAGATTTCTC
CGAATACATCAAACCTTCAATTCAACGATTACGGTTCACTTTACGGTGAACCATGTCAACCCTATAGACCGATGCACCAG
CAAGTTGTTAATAATTTTTCCTCTCCAGGAATTTTCAGTAAAATACCTTTTGAAACTTATCCGGTTAGTTATGACATTAA
ACTTTCACATGAAATGCCGCAGCACTTTGATGAGCTGCCATCAGACAACTATAATAGACACTGAAAAATTGCGTCCTTCC
ACGTTTAAAATTGTATAAAAAATAATATGCTTGATTTTTATTTTTGCATTTGTTTTATTTTTTAATGTTGAAAATATTTA
CGTTTGTATTATTTTTTTTTGATTAGTAGTAGTAATGCTGCTTTCAAATTTTATTGAACTTTGATCAGTGATTTTTAATA
TTCAATGACCTGAATTTTTCATGCGTCTTGATGAGGGTTTGAGTGAAAAAATTATCAATTTCTTCACTTTGTCATGTGTG
CTATGTGCATTTATTGATGTATATAACAATATATGTGTAGATAAATTTTATTTTTGTATCCGATTTAGGTTTGCAGGCAC
GATGATGAGTGGTTTTTATTTTGTAAAAATTTTTCGAGATAACATGTGCTCAAATATCAATATTATATATGGTAACATAT
TTTTGCAATAAAAATGCATTTATTGTCAATTTGGCTATAAATTAAGTATCGTACGAATCAAGCAATATTTTATCATTGCT
GTCAATATTTTGTTGATAATTTTTTATTTGCTTTGTTAATAAAGAGC
>SMED30027428 ID=SMED30027428|Name=SMED30027428|organism=Schmidtea mediterranea sexual|type=transcript|length=2149bp
ATCACTTGGTGCTGCTTTTTGCCCCGATAAATCTCTCGGTGCTCCAAAATTTGTGTAAGCGAGCAAAAGATGATTGGGCA
ATTTCTAGCACGTCATTCGGCAACGATGTTTACAAGTTTCTCTGATTGGATGATAAAGTAGAAACTTTCCGAAAATGAAA
CTTCTCCGAACATGCGCATACCGACTGAAAATTAACTCTAAGCCAGCCAATGGAATTGAAGCAAAATTCAAGAGAATATT
AATTGACTTCGCGAATGAACTCAAATTTTCTATTGGCGTATTGTGTGTGCCTCATTGTGAGTGGTTGCGATCGCATCTCA
AATTATTTACACACAAAAAAATAACGCACACAGACATTGAATAGATATATTTGATCAAGTCAATATCACAATGTCAATAT
TAGCTTTTTCTGAAGAAAGAAGACGAACTAGAAGAAAAACAACAACGAAATAGATTCGATAAGGCTACTGAGCGATTTTC
ATAATCTAAATATTATTTTATTATTGATACGGACAAAAATTGGTCTTTTACCAAGTACTACTAGATTGTTGATAAAGAGA
GGTTATTTAGATGCTTGGAAAAAATCCTTATGAAACTGCAATGAGCAACGTGTATTCTCTACCTCCGGGAGGTTCTATTT
ACAATATGAACCCGATGAGTATATCATCAGCTGGCTACAACTCTCAACAAGTATCAACACTATCGTTGAACTTGACCGGA
ATCGGACCTCATTCATTAAGCCCAATGAGTGCAAGCATGTCGGGTATAGCTGCAATGGCCGGTGGAATGAGACAAGGTCT
TGAGTTGGGTCTTGGTAGAAGTGATAGTCCAAGAGATAAAAATTCAATTTCCAATAACAACCGACCATATCAAAGAAGTT
ACACTCATGCCAAGCCTCCATACAGTTATATAAGTTTGATAACAATGGCGATTCAAAATTCTCCAGTAAACATGTGCACT
CTATCGGAGATCTATCAATTCATTATGGATCATTTTCCATACTATCGTCAAAATCAACAGCGATGGCAGAATTCGATTCG
ACATTCTTTGTCCTTCAACGATTGCTTTGTTAAGGTTAGTAGAAGCCCAGAAAAACCAGGTAAAGGCTCATATTGGACCT
TGCATCCTCAATCAGGTAACATGTTTGAAAACGGTTGTTATCTCAGAAGACAAAAGCGATTCAAAGATCCACACAGAGAA
ATCGGCAGACAGAGTCAAAGAGCTGCCACTGGTCCTGGATCAAATGTCACAGAAAACAATCACGACAACGCATCGCAAGA
AGCTAGTGATAACGCAGAAAGTGATACGAAACCCAACATCAAGCAACTTGATTTATCAAGCGATCTCTTAACTAATCAAG
GTCATAATATTAAAAATACTAATCCAACTTCTGTTAGTCAGAGTTGTTCGATGTTTCATCGGAAAAAGGAAAACTGCTCA
CCAGTAGAAATGAAATTGAATAACCAAAACCAACAATCAAACCAGCAAGAACATCCACAAATCCATTACAATCCCAATCA
GCAATTCTACTCAAATCAGCAAAACATTTTCCAACAAAGTTCTCTTGATCATTACAGTCTATTAGCATCCGATGATCCTC
TTGGTCAAGGTATGCACTTGCCACCAGGTGCAAATAGTGTTTTCGGACTTTACGGGGCACATAACTTACCAAACGATGAT
CAAATTTCAGTGTCATTACCATCGATATCCTTATCCGGACATCCGTATGACAATTTATCAACAGCAATGGCATATCAATA
TGAAGCATCTCAACACAATTCTTCATTACTAACGACAAGTAATCCGTTCTCAATAGATCGTTTGATGCATCCAAGACTAG
TCGCTGCAGCGATGGGGGTCAGTCCCCATGATACTCTATACGCAGGAGCTACCGGCCCATCAGTTGATCTAGAACACATG
AAATACTACTCAAACTACAACAATGTGCCTCCTTATTCCTCTGCAATGTCTGACTACTACAAATATGTACAAAATCCTCA
GCCGGGCAACAGCGACATGAGTCTTTGAATTGAGTCCATTGAAGTCTACGGCAGTTTCCTCGAAATTTCACATTCAACCA
GATGTTTATCGCCTAATATAAAGCTGTGTTTTTTTATTTATTTACAATTAAATCTTTGTACAAGAGATC
>SMED30001362 ID=SMED30001362|Name=SMED30001362|organism=Schmidtea mediterranea sexual|type=transcript|length=3093bp
AATTAAGAGACAGCCATTTATGTTTATTTTTAAAATAAATAGTATATATTTAAGTTTCGAATTTTCAGCTACAATTTAAT
AGTACATAATTATACGATGTCAGGAAGTAGTGGAATAGGTAGAGGCCGCAGTCGTGGGCTGTTGATGCAAAAGTTTCTGA
ATAAAGATGTTCTTGTTCCTTCTGTTGAATCTTTAGAAGACAAAGCTCTTAATAAGCTAGGAATTCCACTTCCTGGGTCT
ACCGTAGAAAAAAATACAGAGTCAAGTTCTATATCAAGTGGAGATTCAAGAAGTAATCCCAGTGGAGATTCAAGAAATAA
CATAAAACTACAAGATAGTGATATTGAGAATCGCAATATTACCATTGTTACGCGACCATTATCCTGCATAGGCAGGGGTC
GGGGTTTAAGCAATCCCTCAAGTTTAACTACGTCATCGGGTAAATCGGATAAAATTACTGAAAACGAAGAACCTGGTCAA
ATTAAAAAGTTTGTAGGTCGCGGTAGAGGATTGTTGAATTCTCAGAAAGAATGTTCAAACTCTACTCCATCTGAAGTTTC
AAATGAATTGAAACAAATGAAAATTTCAAATGATGATAAAATGACGGTTTCTTCAGAAGCAAAGTCACAATTTGAGAACA
TTGAAAAACCTATTAGTAAATTTCGTCGACGCGAATATCCAACTCAAATAAAAGAACCATGTAATACAAGAAATGATTCA
TCGCCATCTTTAACTTTAAGTGCTAATTACGTTAAAGTTAGGACTACACAACCCCATATATATCAATACCATGTTTCCTT
TGCACCTCCGATAGATTCAAGGTTGATGAGAATTAAAATAGTTCAAGGGTTATCAGAATCAGATTTAGGGGTTGTCAAAG
AAGCAAGAGCTTTTGACGGTATGAATTTATACATTCCTCAACTTTTAAAAAATAAAGAGACAATAATTAAAGTAAACAAA
CCGACTGATAAGACTGTCGTGGATGTTAAAGTAGTTTTTACTAACAATGTTAATTTTAGTGAATGTCCTATGGTTTATAA
TGTTCTTTTTAAAAGAATTGAAAATTCCCTCAGAATGGTTAAAATTGGTAGGGATTATTTCTACCCTGAAAAAAAGATAG
TACTTGACCGTAGAAGGATGGAAATATGGCCGGGATATGTAACAAGTATCCAAAATTTTGACGGTGGTTTACTGTTACAA
TGCGATGTGTCACACAAAGTTATTCGAAATGATAGTGTGTATGACATAATGATGGAAATTAATAAAACTGTTAACAATAA
AGGTCAAATGCAAACTGCTGCGATTAATCAACTATTGGGTCAAATTGTGTTAACTCCTCACAATAACCGAAATTATAGAA
TTACTGATATAGATTGGGCTAAAAATTGTTTAAGTGAATTCGATAAAGGAGGCGAAAAAATTAGCTACCGGGATTATTTT
AAGAACACGTATGGGCTACAAATTCGTGATCTAGAGCAGCCTATGATAGTTAGTAAATCTAATAGCAGATCTGGTAAAAA
CCGAGGTCCCAAAGGATCAAAAGAAGTGGATGGTGGATTGGTCTATTTAATTCCAGAATTGTGTATGCTAACTGGTTTGA
CAGATGACATGATTAAAGATTTTCGTTTGATGAGAGAATTACACGAGCATTGTCGAGTTACTCCCAAGAAAAGACACGAA
GCCTTACTGGAATTCGTGGATAACATATATAGCTGTGAGGAAGCTAAGAAACTTTTAGGGTATTGGGGTATAACGATTGA
AAAGGACACTGTCAACATAAATGCTTGTAAAATGAATCCAGAAATGATATATTTTGGAAATGAAGCTTCTGTTAGTGCTG
GGGAACAAGCTGAATTTAAACAAGCCTTGGCACATAATAAAGTTATAGGTGGTATTCGTATTGAAAATTGGATATTAATT
TCTCCAAAAAGTTTACTGACAAAAGCAAATGGTCTGTTACAGGCTTTAATGAGCAAATCTCCTAGAGTTGGAGTTATGTT
TGGAAAACCCAAAATAGTTGAAATGAACAATGATCGAACAGAAGAGTATTTAAAAGAATTAAAGAGAAATGTGGCTCCTG
GTGTGCAGTTAGTAGTTACAATTTTATCTGCTGTTAGAGAAGATCGATACAATGCAATAAAAAAATTTTGTTATGTGGAT
TGTCCTGTTCCAAGTCAAGTGGTATTAGCCCAAACATTGAAAGAAGGGCCTAAATTAAATAGTGTGGCAGTTAATATAGC
CCTTCAAATAAACGCAAAATTAGGTGGAGAGCTGTGGGCTGTCAAAATACCTATTAAGAAGTTTATGGTTGTTGGACTTG
ATGTTTGGCATGATACTAAAGGGAGAAGTAGATCAGTTGGAGCCGTAGTTGGTTCAACTAATGCGCTATGCACAAGGTGG
TTTTCGAAATCGCATTTGCAAGAACAAGATAAAGAAATTATGTACGTATTACAGTCGTGTATGTTAAGCCTTTTAAAGGC
TTATTTTGAAGAAAATAATTTTTTGCCTGAGACTATCTTTATGTATAGGGATGGTGTTAGTGATGGTCAGTTAGGATATG
TTCAAAAAACTGAAATTGAACAATTCTTTAAAGTTTTTGAATCGTTTAGTGCTGATTATAAACCTAATATGGTATATAAT
GTTGTTCAAAAGAGAATAAATACTAGGCTCTATGTAAGTGATCCGAAAAATAAAGGACAAATAAATAACCCCAATCCTGG
TACAATTGTCGACCATACTGTTACGAGGGCTAACCTTTATGATTTTTTTCTTGTTTCTCAATCGGTTAGGCAGGGAACTG
TAACTCCGACGCATTACGTTGTTTTATGTGACAATTCTAAATACACTCCGCATCAGGTTCAGTTGATGGCTTATAAAACA
TGTCATATATATTACAATTGGCCGGGAACGGTTCGAGTACCAGCACCTTGTATGTATGCTCATAAATTGGCATATATGGT
TGGTCAGAATTTGAAAGCTGAACCTAGTAATCTTTTATGTGACAGACTTTTTTATTTGTAACATATGTGTTTCTATTTGT
ATTATTGTTAAACTGCATTTCGTAAAATAAATTAATTTCGTTATAAAAAAAAA
>SMED30025388 ID=SMED30025388|Name=SMED30025388|organism=Schmidtea mediterranea sexual|type=transcript|length=6089bp
TTTTTTTTCGAGTTTGTGCTAGAAATTAATTTCAGTTTGAAATTTTTTGCCTATTTCGAGTTCTTTGAAAACAATCTGAA
AACATGAACCCATCTGATCCCGATTTTCAATATCTCGGTGTCGACCGAAAAGCTTTAATGAAGCAGTATGGGGATTCCTT
TGACAGCAAGAAAAACTGTTGGATTCCTGACGAGAAAGAAGCCTTCATTGCGGCGACAATTGAAGATGCGTCTGGAGATG
TCTATACGGTCAAAACCGATAAAAGTGAAACCAAGACTGTTAAAAAGGACGAAATCGAACAAATGAATCCACCGAAATTT
TTGATGATTGAAGACATGGCAAATTTAACCTTTCTAAACGATGCCAGCGTTCTTGATAATTTAAGACAAAGATATTACAA
GAATCTGATTTATACCTACTCTGGACTGTTTTGTGTGACAATAAATCCATACAAAAGATTTCCAATTTACACCCCGCAGG
TGATTTCAAAATACAAAGGTAAACGACGAACTGAAATGCCTCCACATATTTTCTCGATATCCGACAATGCTTACACCAAC
ATGTTGGCGGACCGAGATAATCAATCTGTCTTAATTACTGGTGAAAGTGGAGCTGGGAAAACTGAAAATACAAAAAAAGT
TATCACTTATTTTGCACACGTTGCAGCTGCTACTAAAAAAGAAGAGGATGATACTGGAACTGGTCAAAAGAGAAAGGGAA
CATTGGAAGACCAAATCGTGCAAGCAAATCCTGTTTTAGAAGCATACGGTAACGCAAAAACTGTGCGAAACAACAATTCA
TCCAGATTTGGTAAATTCATTCGTATTCATTTCGGTACAAGTGGAAAAATAGCTGGAGCTGATATTGAATTTTACTTACT
CGAAAAATCGAGAGTAAATTCTCAACAGAAAGGTGAAAGAAACTATCACATTTTCTATCAAATTTTATCGAACGGAGGAA
AACCATTTCATGAAAAATTACTCATCTCTCCTGATCCAGCTTTGTATTCCTTCATTAATCAAGGTGAATTAACAATCGAT
GGAGTCGACGATGAAGAAGAAATGAAAATAACTGATGAAGCTTTCGACATTTTGGGATTTTCTGCCGAAGAAAAAATGAG
CTTGTTCAAGTGTACTTGCTCAATTTTAAACATGGGCGAAATGAAATTTAAACAAAGGCCAAGAGAAGAACAAGCCGAAG
CCGACGGTACTGCTGAAGCTGAGAAAGTGGCTTTTCTGTTGGGTGTCAATGCAAAAGATTTAATGCAATCGATTCTGAAA
CCGAAAGTTAAAGTTGGTAATGAATATGTCACAAAGGGGCAGAATAAAGATCAAGTTCTTTATTCGGTTGGTGCGCTAGC
AAAATCTCTTTACAACAGAATGTTTGCGTGGTTGGTTTTGAGAGTTAACAAAACCCTCGACACTAAAGTCAAGCGACAAT
TTTTCATCGGTGTTTTGGATATTGCCGGTTTCGAAATTTTCAATTTCAATGGATTTGAACAAATTTGTATTAATTACACC
AATGAAAGATTGCAGCAATTTTTTAACCATCACATGTTCGTGTTGGAACAGGAAGAGTACAAGAAGGAAGCGATCGATTG
GGAGTTCATTGATTTTGGAATGGATCTTCAAGCGTGCATTGAGCTCATTGAAAAGCCAATGGGTATTCTGTCAATCTTAG
AAGAAGAGTGCATGTTTCCGAAAGCATCTGATATGACATTTAAAGCAAAATTGTATGATAATCATCTCGGAAAAAGTCCC
AATTTTGGAAAGCCAAAACCTCCAAAACCCGGACAGGCTGAAGCTCACTTCGAATTGCATCACTATGCTGGCAGTGTGCC
ATACAATGTTACTGGTTGGCTGGAAAAGAATAAAGATCCTCTCAACGAAACTGTGATAAATCTACTTGCGGCAAGTAAAG
AGGCATTAGTTTCGAGTTTGTTTGCTCCGGCTGAAGATCCAAATAATACGGGTAAACGGAAAAAGGGTGGGGCCATGCAG
ACCATTTCTTCAACTCATAGGGAATCCTTGAATAAATTGATGAAAAATTTACAAAGTACCAGTCCACATTTTATCCGATG
CATTGTTCCAAACGAATTCAAACAACCTGGTGTAATCGACGCTCATTTGGTATTACATCAATTGCATTGTAACGGTGTCC
TTGAAGGCATCAGAATCTGTCGAAAGGGTTTCCCAAACAGAATGATTTATTCTGAATTTAAACAAAGATATTCTATCTTG
GCTCCAAATGCAATTCCACAGGGATTTGTTGAAGGCAAACAAGTAACGAGCAAAATTCTGGAAGCTGTTCAATTGGACAC
CAATCTTTACCGCCTGGGAAATACTAAGGTATTTTTCAAAGCTGGAACTTTGGCTGATTTAGAAGACATGCGTGATGAAA
AATTATCTTCACTGATTTCATTGTTTCAAGCTCAAATACGCGGATATTTGATGCGAAGACAATATAAAAAATTACAAGAT
CAGAGAGTTGCTCTATCTATCATTCAAAGAAATATTCGTAAATATCTTCTTCTGAGAACATGGCCATGGTGGAAATTGTA
TACCAAAGTTAAGCCACTTTTGAACATTGCTCGTCAAGAGGAAGAAATGAAAAAGGCCGCTGAAGAATTGACAAAATTAA
AGGAAGAATTCGAAAAAGTTGACAAATTCAAAAAAGAACTTGAAGAACAAAACGTCAAATTGTTGGAAGCTAAAAACGAT
TTGTTCTTACAATTACAAACCGAACAAGACAGTTTAGCCGATGCCGAGGAAAAGGTTTCAAAATTGGTTATGCAAAAAGC
CGATATGGAAGGAAGAATTAAAGAATTGGAAGATCACCTTCTAGAAGAAGAAGATAATGCTGCTGGACTGGAAGATATCA
AGAAGAAAATGCAGGGTGAGATTGAAGAGTTGAAAAAAGATGTTGTCGATTTGGAATCTTCATTACAAAAGGCTGAACAA
GAGAAAACCGCGAAAGATCAACAGATAAAATCGTTACAAGATCAAATGGCAAAACAAGAAGAAGAGATGAACAAATTGAA
AAAGGAGAAAAAGGCCGCCGATGAAGTGCAAAAGAAAACCGAAGAATCTCTACTAGCGGAAGAAGAGAAAGTCAAAAATC
TAAACAAAGCTAAAGCCAAATTGGAACAGACCATTGATGAGATGGAAGAAAACCTCTCGCGAGAACAGAAAATCCGAGCT
GACGTAGAAAAAGTTAAACGAAAAATCGAAACTGAACTGAAACAAACTCAAGAGACCGTAGACGATTTGGAAAGAGTAAA
ACGAGAATTAGAGGAACAATTGAAGCGCAAGGAAATGGAATTAGTCAATGCTTCATCGAAAATTGAAGACGAATCGGGAT
TAGTTGCCCAGCTTCAGAGGAAAATCAAAGAACTTCAAGCTCGAATTCAAGAATTGGAAGAAGATCTGGAAGCAGAAAGA
CAAGCCCGTGCAAAAGCAGAGAAAAGCCGACATCAACTCGAAGGCGAGTTGGAAGAATTGAGTGATCGACTGGAAGAACA
AGGAGGCGCAACCTCAGCTCAAATGGATCTCAATAAGAAGCGAGAGGCAGAATTAATGAAATTAAAGAGAGATTTAGAAG
AATCGAATATGCAACACGATCAGGTTATCGCACAAGCTCGAAAGAAGCAACAGGATGTTGTCAATGAATTCTCAGAACAG
CTCGATCAACTGCAGAAAGTCAAAGCTAAAGTTGAAAAAGAAAAGAATGAGATGAAAGAAGATTTAAATGACCTACAAGG
ACAGCTGGAATCATTAAATAAAGCCAAGGCTAACAGCGACAAACGAATCAAAGAAATCGAAGCTCAAAATTCCGAATTAC
AGGGCAAATTGGAAGAGGCAAATAGACATATCAATGATGCCAACAATACATCTGGAAAGAATCAACAAACCAATGCGGAA
CTCCAAGCACGTTTAGAAGAAGCCGAATCGCAAATCAATCAGCTGGGTAAAGTCAAGCAACAAATGCAGACTCAACTCGA
AGAAGCCAGGCAAATCGCTGAGGAAGAGTCGAGAGCAAAGGCTAAATTGAGTTCTGATGTTCGCAATCTCAATGCCGATT
TAGACAATCTCAGGGAGGCACTGGAAGAGGAAAATGAGAACAAAAGTGACATACAGAGACAGCTAGTTAAAGCTCAGGGA
GAAATGCAACAATTGAAGGCTAAATTCGAAGGCTCGGGATCCATTCGTTCAGAAGAGTTGGATGAAGCCAAGCGAAAGTT
TATGACACGAATCCATGAGCTGGAAGAGGAAGCTGAAACCGCCAAATCGAAAGCCGGACAACTAGAAAAAGTTAAAGCTC
GACTCCAAGGAGAAATCGAAGATATGCTGGTCGACGTTGACAGAGCGAATACACTCGCATCTCAGTTGGAAAAGAAGCAG
AAAACATTCGATAAAGTCGTGTCAGAATGGCAGCAGAAATATGCTGAATCTCAGGCGGAATTGGAAGCATCCCAGAGAGA
AAGCAGGACGATTTCAGCTGAGGTGTTTCGAATGAAAGCACAAATCGAAGAAAGTCAAGAGCAGTTGGAAAGCGTTAAAC
GGGAAAACAAAAATCTAGCAGATGAAATCCACGATTTGACAGAGCAAATCGGAGAAGGAGGTCGCAGTGTTCACGAAATC
GACAAAGCAAGGAAACGATTGGAAATGGAAAAGGAAGAATTGCAACATGCGTTAGAAGAAGCCGAACAAGCTTTGGAACA
GGAAGAAGCCAAGTCTCAACGATCACAACTGGAAATGAGCCAGATCAGACAAGAAATCGACAGGCGATTGGCTGAGAAGG
AAGAGGAATTCGAGGCCACTCGAGTCAATCATCAAAGAGCAATGGAGTCAATGGAAGCCTCACTTGAAGCCGAATCCAGA
GGCAGGGCTGAAGCAACGAAGATGAAAAAGAAACTGGAGCACGATATCGGTGAACTGGAAGTTGCAGTGGATACCGCCAA
CAGAATCCGATCGGAGCAAGAAAAGAACGCAAAGAAATTCCAGCAGCAAGTTCAAGAATTGCTATCAATGGTGGAGGATG
AGAAACACCAGAAGGATCAGATACGAGAGCAAACGACGATGACAGAAAGGAAATTGACAATGGTCCTGGCAGAGCTTGAG
GAGGTTCGTGGCTCATTGGAAAATTCCGAGAGAAACAGGAAAAATACCGAGAATGAGAAAATGGAAATAACTGATCGATT
GAATGAGTTGAGTGTCCAGAGCTCCGGTTTCATGGCTACCAAGCGGAAATTGGAAGCTGATTTGGCTGCTATGCAGTCCG
ATTTAGAGGAGGCCGCTACTGAAGCCCGACAAGCCAATGAACAAGCCAAGAAGGCTGTTGCTGACAGTGCGAGATTGTTT
GATGAAATCCGGCAAGAGCAGGAACACGCACAGCAAATCGATAAGATCAAGAAACAACTCGAGGCCCAAAATAAAGAATT
GCAAGCCAAATTAGATGAATCGGAGAATAATGCTTTGAAAGGTGGCAAAAAAGCCTTGAGCAAACTAGAGCAACGCGTTC
GTGAACTTGAAGCCGAATTAGACGGAGAACAAAAAAGACACGTTGAAAGTCAAAAGAACTCCAGAAAAGTTGAAAGACGG
CTTAAGGAGCTTGGATTACAAACCGACGAAGATAAGAAGAACCAAGAAAGATTGCAAGATCTGGTGGAGAAGCTTCAAGG
TAAAATCAAAACCTACAAACGCCAGGTGGAAGAGGCGGAAGAAATTGCTGCTGTAAACTTAGCAAAATACAGAAAGATCC
AACAGGAAATCGAAGATTCCGAAGAAAGAGCTGATCAAGCTGAACAAGCGTTGCAGAAGCTGAGGACCAAAAACCGCAGC
TCCGTTTCGACAGCGAGAGGCGGTAGCATGGCTCCCGGCATGACCACAGTGAAATCGACATCACTCTCTGTTTCGGCTTC
GAGCCGACGACAAGGTTCTAGTGTTTCCAGAGAGAGCTAAGTCAGAAATTCTAGTAACACAACGATAAATTATTAGGATT
TACTTAATTGACATTATTTGCATGTTATCAATTATTGGACACAATTTAGTGATGCTTTTATTTAATAAAATTTACATTTT
GAAAAAAAA
>SMED30030007 ID=SMED30030007|Name=SMED30030007|organism=Schmidtea mediterranea sexual|type=transcript|length=6612bp
GTTGTTTTTAAATCACTATTTTTTTTATTTCATCTGATTATAATTTTTTTTTATTGAAATTTGTATTTTGAAATTGGTGA
ACAATGAGTGAGATAGATTATTCCGCTATTGTTCGGAGACGCATTGGAGATATCGATGGGGATTCAAGTGAAGATTCCAG
TTCAAAGGGTTTGCTTCAAGTTAACTTGGAACTGAGAAAGCGCTTAGAGGAAGAACACAATGAGTATCGTAGAAAGCTGA
TAGTTTTCCAAGACAGCCAACAGAAACAAGCGCAATTGGTTCAAAGATTGCAGAAAAAGGTATTGCAATACAAAGAAAAA
TGCACGGAACTTGAATCTAAAATGCAATTTGGCGATTATGAGACTCGAAAAACGAAGTATGGAAGTCCAACGAATAACGG
CTATGGGTCGCGTAGTGAGAATCCCTACGACAATCTGGATTTGGAGAGCACACTCATTAAGTTAGAAGAGGAACAAAAAA
AAACAAATTATCTAACGGAGTTCAATGAACGGCTTCAAGAACAATTAACTCAAGCAACTCAATCAAACCAGAATTTGACG
AGAGACATCAGTAAGCTTTCCGAAGAATGGCAGAGATCAAGGGAGGAGCTTGAACAGAGAGAAAAAATTTGGCGAAATGA
AGAAATGTCATTTAATGACTATTTAGCATCTGAGCATTCGAATCTGCAAAATTTGCAACGCAATACGATAAATTTCCGCC
GTCAATTTATAGAATTGAAAGCTTCAACTGAACGGGAAATAAATAATTTGAAAAATGAATTCAACCGACAGGCACGCTGT
TTGCAAACTGCTTGTTCCAATCTTTCGTGCAACATGAAATCTGCAGAATCTAAACAACAATTGAGTACTGAACGAGAAAG
TCGGGACAAGTTGAATCTCGAAAATCAACTGCGAGAAAAAAACAGAGAATTAACTGATTACCAAACTCGGTATGAATGTG
AAATGACAGAATTGCAACACCGAGTGAAAGAATTAACAGTTCTCAGTGACAAACTGAAAATTCAAAACCTGGAAAAGGAT
CGAGCATTGACAGCTTTGCAAAGAATTAAGAATGGAGATACCGCAGGAGAAATAAATATGGAAGACAAAGCTACAAGAGT
TCTTATTGAAGACACAGAAAGTATGCATCAAGCACTTCGAAATATTTCTCAAGTAGTACTAAATGATTCTGACTATTTCG
ATGCAGAAGACACAGGATTTGAAACAGTTCGAAAGAATAATCGTTCGCCAAGTCCAAGGAGAAATCGTAGCGTCAGTCCT
AACTCAAGATCAGCTAAAACACCGCCATTTGCCGATGCAACGTATGCGGCGGTTCAGTCGGCTATAAATAAAAAATCTCT
ACAGATTCAAGAGCTTAAATCAAAATTAAACAGTTCTAAAGAGAGTTGTACAAACTTCAAAAGACAAATTGATGACAATG
AAAATGAACGTCGACGATTAGAGAATCAAGTTCTCGCCATGAGAGATGAAATTGAAAGTTTACGACGAGATAAAGATGAT
AGTTTTAGAGAAGCGGATCGGTTTAAAAATGCTCTGAACATCACTTCAAATGAACGAAGCCAATTGGAAAAGATTCGATC
ATCACTAAACGATCAAATTGAGCAGCAACTCACAGAAATTGAACGACTTAAGTCAGCCAATCACGAATTACAACGATTGA
GAGAGGCATTGGAAGATGAGCAAGAAGATACTAAAAAAGACTTAGAAAGACAAATTAAAGAAAGTGAAAGATGCCAACGA
TCGATTGATGTTTTGGAAGATAAAATAAGTCGATTTAAAGAAGACGTAGTTAATTACAAAGAGGCAATTAATAAATACCA
ATTAGAAAAAGAAGTATTGGTGCAAGAAAAGGATGAGATTGGTGATGCTTTAAGTCGTTGTGAAATTTCTAAAGCCGAAT
TAGAAATCGAGGTGAATAAACGGCAAACTATTGAAGTAAATTTGGAAGAAAACATTTCAAAATTATCCTCAGAAATCGAA
GAATTGAATGATAAGCGAGCTGAAAACCACAGAACTATTAAACAGCTGGAACATGAAAGAAGTTCTCTTTTGAATGAAAA
ACGATTTTTGGAACAAGAAAAAAGTGGTTTGAAAGATGAGCTTGTTCGATCTGAACAAGAGGCTCTTGGTTTGTCAAATG
AGAAAGCCATTCAACGTCAAAGAATCGAACAACTTGAAATTAATACAGAAAGATTAGAAGAAGAGTTATCGGAACTCAAT
CGAGAAAAGCTAGATCTTACTGAACAAATAGGCTGTTTGCAGAGGCAGAAATCGGCTCTTGCAGAAGAATTGTTGCAATG
TCGTAGAGAATTAGAACGATCTAATAACAGTGTCAACAACTTATCAAAAGAAAAGGAATATCTTACCAAAGAGAAAGGAG
AACTCGTCGTTCAAGTTACAGCTTGCGAAAGGGAAAATCGTCAACAGTCAGAAGTTATTGCTTCTTTGAATTCCGATAGA
GAACAACTGGAAGCTACTCTTTATGATGCTCAACAATTAATCATTCAGTTGGAAACTCGAAAAGAGCAATTAGAAGGCGA
AAACCAAGAGTTGATTGTGAAAAAAGAAAATCTAAATGGAGAACTAGTCAGATTACGACAAGAGTTTCAACTAGAATACG
AGAAGGTTGTTAATTCACGAGAACAATTAAATTGCAGATATCAACAAATGGATAAAGAATATAAGATGGCAATTCAACAA
GAGCGAGATTCTCATGCTGAAGATGTAGAAAGACTAACTAAGATAAACGAAAGCAATCGTCATGGATCTGAAAACGAACG
AGAAGAGCTTATTCATCGATTCAATATGGAGCGTGACGACATGATTCAAAATTACGAACAAGAGAAACAAGAAATGGCCC
AGGAAATCATGACGATCCAACGAGAACGAGATGACTCATTATTAATGGCGGAAAATGAAAAGCAGCAATCATTGAGTTTA
TTAGAACAAGAAAAATGTGCAATCAATGAAAAGCTTATCAAAACGCAATTTGAACTGCAATCGGTTGAGTCGGAATTGGA
TCGCATTAAAAAGGAGTCGTCCAATCGTCAGGAGCAAGACAAACAGAACATTGCCGGCTTGTCGAGTGAACTCAAATCAT
TTAGATCTCAATTTGAGGATAAATGCCAAAATCACGAAATGGAAGTTAAAAGCCTAAATAGTGGAATCAAGGATCTAACA
TTAATGAAAGATCAAGCTCTCAAAGAAGTCCATGATTTGCATACCGGATTAAAAATAGCTGAAGAAACCCGTGATAATTT
GCGTCGGGAAATCATGGAAATGAATCGGAAATTGAAAGAAGCTGAGGAAGCCAAAGAGCACTTAAAGCGTGAAATTAATG
AATTGAAACGTGGATTATGCGAAGAACAAAGGGAAAAAGAAAATGTTATTAACTCAAATGAGAATTTGAGAAAGAAAATT
AAAGATGTTGAAACAGAAAGAATTGATTTGCACAGACAAGTAACGGATTCCAAACAAAAGGTTGCAGTACAAGATGAACA
ATTGGTCAATTCCAAACAAGAGGTCAATGAGTTAAGAAACAATCTTAAAGACGTAGAAAAAGCTCGATTAGATGTCAAAA
GAGAGTTACAAGAACTCAGACGCCATATCAAAGAGCTAGATACGGAAAGGGGCAAATTGACTAAAGAAGTCAATGATTTG
CAAACTCGTGTTGCTAGAGATGAAGAAAAAGAGGATGAAGCTCGTCGGGAAAATTTCGGTCTCAAACAAAAAGTTGTTGA
AACGGAAGCTTCAAGAGAAGCCGTTCGTAAAGATCTTGCTAATGCTCAACGACATATTGTTGATTTGGAAAATGTTCTGC
AGAGCAAAGACAGAGATTTCAGTTCCATGGTGGAATCGAGCCGCCGGGATTATAGGAAACTTGCTGATGCGAGAAATAGC
CTGCAACAAGTATATGATACGATGGTGGCCGATAATAATGAGCTGAGAATTGCTCTCAGTGGAGCAGAAGGTCGGGTCAG
TGCTCTGGAGTCACACATCGCACGAGTTGAAGGAGCTAAGAAAGAAATTGAATTCAAATTGGCTTCTATCCATAGCTCAT
TGCGAAGGCTGATAGGATTCCGACAGGAGAATGTAGTTACTATTCGGTCGAGAAACAACTCCAAATCTCCAGTTAGAGGT
CGATCAGTTAGTCCTCTTAGAAGTAGGCCGGTGTCGCCAACCAAAGGATTTGACAATACCTATGCTACTACAACTGATGG
AAAAGGTAGCCCTATCCCGCGCACAGGGTCTCCGAGTTCTAAACGAAGGCAATTATCAAGATCTCCGTCTAATTGCGATT
TCAATCCAGTCGATATAAATCCAGAAGCAGTTCGTCTGGCCTTGCGAGAATTCGTACAGCAGTTGGTTGATGCTGAACGA
GATAGAGATGACGCTTTTGCTCAAGCTCGCAGCCTAGAATCTCGATTGAAAGAACAAGAAGAACAAAATGAATATGCTGA
AAACCGTTTACAACAACTACAACAAGCTCTGTGTGATGCAGAAGAAGACAAAAAAGGCATTGATGGAAGATTGTCATCAG
CCCAAACTGCCTTAATGATGCAAGAAGAGACTATTCGGCGCAATGAGAGAGATAGAAAAGCAATGGCGGAAAAGTTGAGT
AATTACGATAGAACATTTGCATCCATGGAATCAGAAAAACGACAATTGGAAGATCGGTTGAATAAATTCCGTCATCATGA
TGCCCGATTGGAAGAAGAACATAAGCAGAGCAAAAAAGCTATTGAAAATGCTGAAAATAGAATAACTCAGCTTCAGCTTG
CCAAGCGATCGTTAGAAGGAGATCTTCAAAGAATGAAAATGGCGTTGACAGATAAAGAAACAGAAACCGAAGTTTTGGAT
GACCGCGTAAATAGTTTACTCAAACAAATACAAGATCTCGAGGGAAAATCTCAATCACTTCAACTAACGATTGACAGAAT
GAGTGTCGCCCTTGCAAAAACTGAGGAAGAAGGCAGTTTTCATAAGGACAAAATGCAACAGTTGAATATGAGTTTGAGCA
CTCATTCACAACAACTGGAACAATTACAGAATAAGATTTCTCAATTACAAAAAGCACTCGGCAGTTCAGAACAAGATCGT
CGGCTCTTAGAGGAACGATTAGAAAGCTCTAAAGGAGCATTGCATGAGGCAAAACATCAAAATAATTTGTTGATGGAAAG
AATACAAATAATTCAATCCGATTTAAATGATTCGGAAAATCGTCGATCAGAATTGGAAGGATTAAATCGACAGAGTAACA
CTTTGATTGTACAAAGACAAGAAGCTGAACAAGAACTCAATCAAAAATATCAGAAATTGAACTCGGAGAAAAACACATTA
CAAGAGCGAGTGAATAGCATGCAACGAAATTTGGCTTTGGCAGAAGCAGAAAAACAAGAAATAATAAAAAACCACGGAAA
ATTGGAAAAGGATAGATCTGCCTTGAAAAAGAGTCTTGGAAAAGTTGAACGTCAGAAATTGAAAACCGAAGAAATTGCTA
GCAAAACTGTTTTTGAACGTTCAGAATTAGATCAAATTTTAAGGAGACTTGAAGATGAAAATTGTGAATTACAGAGACAA
GTTGGAATTCTTCAAAATCAATTAGCAGAAGCTGAGCAAGCTCACTGCCACCATTTGATGGAAATCAATTCCCGCCATCG
CCAGGAAATGTCCATGGAAATGGAGCATTTGAGAGCATCGAATGTTCAAATAGAACGAACTCTAGAAGGCAGAGAACGAG
CCCACAGACAAAGAGTTAAGGGTCTGGAAGAACAGATCTCCACCCTCAAAGACCAGCTGACTCATGAAATGCAGAGGCGG
ATGGATAGTGGATATTACGAGTCTACCAGAAAGTCTAATCAATACGATTCAACTGGTGACTTGCGACATGTTCTGGATTC
CAGTTTAACTCGAGTTGCAAAAGACCCTCAACTGGACGCAATGCTACTGGAAACCGAAGCCAGGCGACTCGATGAGTCGA
TATTCATGTGTGGCAGTCGTGATCAGTCTCCGACCCGGCAGAAGCGAATCGAAATGTCAAAGAAGTCCGCAGCCCCTAAC
AATTCCAATCGGCGATTAACTGCCGGCCGTCGCAAATGAACTCGGCCTGTTCCAGTCCGTCCAGAGATGTTATGAAGCCA
CTTTTTAGATGCGTGAGTGTGAGTTCGTGTTGGTGACTGATTCATTTTTAGTAAACAGATTCTGGATTTTTGTTTTTATT
GATAGTGTAATTTCCTAATGCAGATCTGATAGTTGACTTGTTGTTCTTACGTATTCGGTATTTGTGATTCACATAGTCTG
TCATTGTTACTGTGATTTATCCTCTGTGTGACTTTTGTGATTTACTTACTTTATTGCCCCTATAATCAATAAATGGATTT
ATCGATAGTTCAGCCCTCCCCTCCAGCCCTCGTTTTGGGATCCGTAAATTTTGTTTCAATTGAGATCATTATAGTGATTT
TATTCCTTCGAAACCAAACCTTTGGGAGGGACATAAAATTAAATTATTGATTTTTTATTATCTTAGAAGTGAAAGATGTT
TATTTCCCAAATTAACTAATATCAATAATAACTTTAATTTATATCTTCATTA
>SMED30018353 ID=SMED30018353|Name=SMED30018353|organism=Schmidtea mediterranea sexual|type=transcript|length=1408bp
CAAGGGTAGTTTGATTATTTAGAAAAAAAGGATTTCCACCGGTTTTCTGTGATAAAAATTGTACAAAAATGCTTACCAAA
ATTGCTAGATCTCTGCACGATCAGATTTCCATAAACGTTGTCAACAAATTGTCAGCTAGGTTATGCTCGTATACACCTGG
TAACAAAAAACACAGCCCGGTTTGGGCCTGGAATGAATGGGACCCATTAGAAGAAATCGTTTTGGGACTTCCAGATATGG
CATGTTGTCCAGAGATTTTACCAGAAGCCAAAGCTTGCATTTCGGAAAACAAATTTGATTTCCTTTTAAAACACAAAGGA
AAATATTGGAAGGATGTAATTGAACCAGAACACTACAAAATAATGCTAGATGAGCACAAGAACTTCATAAAGATTCTACA
AGGAGAAGGAGTTAAAGTCGTCCATCCAGAACCGATTGATTTCGCTAAAACGCTCTGTACTCCAAACTTTACTGCCCATG
GAGTCGACTGTGCGATGCCGAGAGATTTTCTATTAATTGTCGGAAATGAAATGATTGAGTCCACCATGACTTGGAGATCG
AGATATTTTGAATTTATGTGCTATAAAAAATTAATTAAAGATTACTGGAGCCGGGGCGCTAAATGGACAGCGGCACCAAA
GCCGATGTGTAAAGAAACACTTTTTAAAGAAAATTATCGTGCTGACGAAGATTCAACAGCATTTTTCGATGAAAAGACTT
CGATTCTAACGGAAGAGGAACCAGTTTTCGACGCCGCAGATTTCATTCGATGTGGTAGGGATATATTTGCGCATGTCAGT
CAGGTTAGCAACAATGCAGGAATTGAATGGGTACGTAGACATTTGGCACCGAAAGGAATTAGAGTTCATTCAATGAATTT
CGTTGACCCTAAACCAATGCATATTGACACGACACTTTTCACACCTCGGCCAGGCCTCGCGATAACATGCCCAGAAAGAC
CATGCTTACAAATTGGTATGCTTAAAAAAGCCGGCTGGGATGTTGTCGTTGCTCCTTATCCAGATATTGCAAAGAATTTC
CCATACTATATCAGCTCTCAATGGTTGTCTCTTAATGTTGTCATGTTGGATGAAAACCGAGTTCTCGTAGAGAAAGATGA
AATTGGAATTCAAAAACTGTTTGAAAAGTGTGGCATTACTCCTGTAAAAGTTCCATTCAAACACTGCTTTTCCATAGGAG
GTGGTATTCATTGCTGGACATCGGATGTTAGAAGGCGAGGAGACCTTCAAAACTATTTTGACTGGCCTCAAGAAATCTTG
GAGAAATTTGAAACTCACTGAATATCACAATTGAAAATATAAAGAACATAACTTTTCCAACGTATATTAATTATTTGTAA
TAAAATACACTGCTTACATCGTGTCAATTTTATTTACTGATTAATTAC
>SMED30005748 ID=SMED30005748|Name=SMED30005748|organism=Schmidtea mediterranea sexual|type=transcript|length=3066bp
GAAGAATAACAAAGAAATTTATTGCCAAACTAAAATACCCGGCCTATTTCATCAAAAAAAAAACAATCAAAAACACAAAT
CGCTACGAAAACTTGTATAAAAGATTCACATTAAAAGTCATCAATATTCCTCTTTTTTAAAGACTGATGATTCAGATTCT
TGGATCCGAATGGGGTGATCTGTTAGGAAGTGAGCTGTTGACGAGATAGCTGAATAGTTTGATCTGGAATTGTGCTGTTG
GTTCGCTTCCGATGATCTGTTGGCGATTGATTGAATTTGGCAGTTTTCTATCGGCGAGTTTGGAAGCGACTTGGTATAGG
CCACAAGAAGCGACGGATCAACGACATTTTGAGTGGAATTCACAGAAAGAGCTGGGTGGATTAGGTCATCTGAATTGGAA
GAATTTGAGCAGTTATGATTTGCGTCACTGTTATAGGCGTATTTTGACTGGTTGATCATGGGGAACCCTTGATCAAGGTT
GACCAAGAAATGGCTGGTATCCTGTGATAAATTGGAATGCTGATAAAGATTGATGGAATCATTGACGCATGAAAACAGAG
AAGGAACGCCGACTCTTTCATTTTTCAGCATCATCCCATCGCTGTTGATTATCATACCGAAGTTGCTATTGTCCTGGGAA
TTTTGCTGCATTATTTCAGTTCCTTGATTAACAAAAGCTCGATATATATTTCCTGAAGGCATCGACGTAGAACTTGGCAA
ATATGCACTCCATATTTTTGAGGCCGCTTCAGGTGATATGTTTTGGTTGTTGATATTGAGTAGGACACTGTCTGGCATGA
AAGGGGGAATTCCGTAGCAGTCCTGGTAAGTATATTTCGGTGAGGAAATCCTGTGGGAGTTAATTATATCCATGGAATCG
TTTTGATTATTGTTATTGTTCCCATCTGTTTCTGGATCTATGCTGAATACCCCTGGTGGATTGTCACCCAATAATGTTTC
AGATAACAAGCTATCAATCTCGGCTAATCCTGTCATTTTCATGAACTCGACCTTCTTTACCATCAGCTGGGTGACCAATC
TCAGATCAGGAATTGTCAGCAGCAATTCCCCGAATCTACCCGGCTTGTGGTATTGCTTGTCATTCATGTGGTTCATCAGG
TCCATTTGTATTTGGTATCGGCATCGTCTCACGAACTCCTTGCCAGACTCGCTGACTCTCGGATCAAAAAATACGATCGC
TTTCAAACAAGCGAATTCTGCGTCATCCAATTGCAATTCTCGCAGCGGAATGAACAGGTCGTCAAGGATGTGACTGGCTA
TTTCAGCGAAATGTTTGTCACTGGAGTTCCTACTGATGATAAGATTGTTTCCCAATAATAGCACATCGTCTTCGTCCAAT
TGAAACGACCGCCTTATTACTCCAAGAATTAGAATTTCTCCCGCGTGTGCTTTTAAAAGGGAAATTTGATCGCTCAAGTT
TAACTGTGAAAAACAAGGCAAAGACTTTGCCCAATTCACTAGAAGAAATAACTGATTTTTCATGGACTCGCAAACATCAG
GCACATCGGCATATCTGTTCATGTATTCCTGAGGATTCGGGGGCTTTTGTATTGCAACCCTTTGCTCGGCCTGCATCAAC
TGAGAAATGGAGAGAATGACATTCGGAGGAATATCATCAAACGACGATCTTCGAGTACTGATCCTATCTCGTTCATTTTG
AACCGCTGCTCGCTTCATTCCTACAAGAATGCATTTCTTTAGCCGACAATAACGGCATTGGTTTCGTTTATCCTTGTCCA
TTTTACAATTCCGATTGTACTGGCAAGTGTAGTTATTCTTCTTCCTCACTGACCTCCGAAAAAATCCTTTACAACCGTCA
CACGAGAAAGCCCCATAATGTTTTCCTGTAGCTTTGTCACTGCAAATGAGACAGAGTTGATTGTTTTCCATTCCTTCTGG
TCCCGACGCGTTAGACGCATAGACTTCATGTTGTTGCGAGGACACTGAAACGAAAACTATTTGATAATATTTGTACAAAA
CAACTGACAGATGGTTTCGGAAAAGGTTCAATGTTCAGCCATAGTTCAGCGAAAGGTCAAATTCCTGAACTACTATTTCA
AGGTATAAATTTGAATATATTGGTTTTGCCTCGTGCTAACAAAGTCCAGAAATATAATAAGCAAAGTCTGAATCGTGTAC
TTTGGATTTCTAGCCAGGGGCACACAATAACCTATATTTAATAGCAGTTCATTGCGTTCACTCGTTATTTCTCCGACTGA
ACTGCATTGCAGGAGGATCCGCAACCATGGAGATTTCATAATTATTATCAAAATGATAATAATAATAATTATTATGAGGT
ATTGTAAAAGAAAACGTAACTCACTTTCACTTTCCAATGGATATTGCATCGAGGAAGCGTTGCTGGAAATGGAAATCGGA
GCTGAATTGCTAGTCAATAGTTGATAGGAGAATGCTGGATTGAGGTTCGGATGCTGGGTAGACGTCATATAGAATTGGCT
CGACGGATTCGGTAAAATTATGGTGAAGTTTACAATCGAAGCTCAGATATAACGTATTATAATGAAGTATTATTAATAAA
CTGCAAGTAACGTGCGCGCATTCTGAAGTGGTTGATTGAGAATAATCAGTTCTTATTCGACAAATTCAGATAAAAAAGGC
ACCACTCGAATTGTTCAGCTGCGTCATGTGAATGCCGGAACGTTGTGCGTTGGCTGTTGGCAGATCAGCGCTCCGTGTTC
ACTGCAATCCGGATACACCAGACCACTTGAAATCGTTGCGAATTCAGCGTGTCGAGTGCATTGTGCGAGATCAGTATCGG
TGTGTATGTGTGTCTGCCTGTGTGCGTGTGGATGTGTGTGCTTGTCGAGTCGGTTGTGTGTTTATGAGTGTAACTGTGTC
GATTTGGTCGAATGCAGTAGCAGATAGCTGAAATGCGATTGTTCCTATTTTTCATTTAATATTGTTTTATGTTTTGTTTC
TATTTTTATAATTTAATTTATCAGTTTTTGTTTAGATTATGCAATCATTGTTTAATTTATTTTTGTCAATTTAAAATTTA
TTATTAATTAAATTATTATAATTATT
>SMED30019097 ID=SMED30019097|Name=SMED30019097|organism=Schmidtea mediterranea sexual|type=transcript|length=1596bp
GGAATAACAGCCAATTAGGGATCAGCTGCAATTTGGCCTATGATTGGACATTGATTTTTATAGTCTCAGGCGTTCTCAGC
TTACGTGTGCACCTTTTTAGTGGACACGTTAAATTTGATAGGTGCTTAGTGGTGTTGATTCCTGTTTGGAAACTGTATAT
AACCAAGGTTATTTGTTGCTTTGAGACAAATGCAACACAATCAAATAATTAATTATGCTATGTTCAAATTGTTCAAACAA
TCAGGATACTTTGAAATTATGGATGGTCCATTTAGCTTCTTGTCACCCATTACCTCCTGAATGGCTTAGTGAAAAGGCCA
AAGTATTAAATGATGACGAAAATCAGCGCCCCTATACAATTGTCACTGATTCCCGAAAAAGAAGGCGACGTCCAACCACA
CCAAGACCACTAAATACGTTCATGATTTTTTCGAGGCATATCAGACGAAATATTCTCTCAGTGTTTCCGGATGCATCAAA
TTCCCAATTAAGCAAAGAGCTTGGAATTTTATGGAAGAAAGTCACAAATGAAATTAAATCCCTTTATGAAGAAGAGGCAA
AGCGATTGGCTCAATTACATGCTCTTGAATTTCCCGATTATAAATATCAACCAAAGAAACGAGTCCGAAGATTTGGAAGA
GCGATTTATGATCGACAGCCCTGTACAACAGAAAGATCTAACTCAACTAGTGCAACAGACGAAGAAAATGGTAAAGACAA
TAATAGTGTTCAAGACGGTAGAAGATCAAGCGATATTGAGAATCAGTATATAAGATATTCAGTTTTGGGTAAAAATATTG
TAAAACGAGAATGTCAGTCCTTTAATAGTCCTTTAAAAAGCGACAACGTTAAATTGGAAACGCAAGAACAAGATTTTATC
CAAGCGATGCCCAAACCTCTAAACGTCCGAATAACGAATTACAACGAAAACAGTATATTTTTACGACAACAAAGATTACC
ATCAAGTAGCACAATGTATTTACTTCCTTCAGAAAACCTAATAATTAGTAATGGGATTATGGGATCACAGGACTTGGGTG
AGGATTATTGTAGAGAGTTGTATATAATTAATGATTTTTTCCCAGAAAATGTAAACATAGACGATGAAATTGATATAACA
GGAAACATTTTTAGCAATGATTTAGATTTAGAGTGGTCTGAAATTGATGAAAATTACAAACAAGATTTACCAAATCTTAA
TTCATTATTTCAACACTAATATATTTGATTTATAAAATATTTAAATATTTTTTATTAAACAGTCTTTTACATGTACATAT
AGTATTGGAACTCTTCTCTGACTTATAAGATAACAGAGATATTGTAATAAGATTAAATTGGTTATGTGTTTCGGTTTTTG
TAAGATTGGTAATTTTCAGAAGAATTTAGACTTTTTTCATGGAAATTGGAATTGAGAAACAAACTGAATAAAGAAACAAA
TTTTTGAAAAAAACGAAACAGATACTTATTATCAAAAGAAAATTATCTGAAGCATCGAGTCGGTATGAAAAATAAACTAA
TTAGTCAGAAAATTTTTGATGAAATAACGTCTAATGAAATTAAGATCTCCAAGGAATACTTTTTCTAACATTTGAT
>SMED30030594 ID=SMED30030594|Name=SMED30030594|organism=Schmidtea mediterranea sexual|type=transcript|length=1880bp
AATAAAATGAAATTTATAATGCCATTGGTATTTACACTGTGGTTAATAACGATAATAATCAGAATTTTTAATGATAAATA
TAGTAAACGATAACTAGTAACGGTAACCCTAATAATGAATGCTATATTACATATAGTAGTGTTACCAAAATTTTGGAATT
TAAAATAATAAGTTTATTATGAGTGACCATGATAATAAAAAAGATTTTTAAATAAAATGATAATATTACTATATAGTCGG
TTATAGTTCCGATTAGTCTACTATCGTAGACGTAATAAAAAGAGTTTAGTAACCTAATTTTCAATGTTTTTTGAAAGTTG
CTCGTCTCTATGGCAACTTATTATCGTAAGGAAAATTTTCTACTTCACTATGATATTTTCGGAGTGAATTTATTGATTTA
CATTCAAGGACTTTCACTATTGCATTTACTGAAGCGATCGTTTCATTTGGAACTCATATTTTCGCCCCTAATCGTTCTGG
AATTTATTATTTATGATCCTTTATCTGACCTTAAAAATTTTCATATTCATGAGTGTCCAATCTTTTGCCAATTTGGGAAA
TAAGCTCCTAGAAAATGCTACCTTCAATAATGAATCCCTTACAAAGTCAGTATGGCATTGGGATCCTGAATTTGAATCAA
TTGTCCATCCGTACTGGCGGACTTTTGATATGGTGCCAGAAGTTTATCATTATTTAGTTGGAGTGTATATTTCTATTGTT
GGAATATCGGGAGTTCTGGGAAATCTTCTTGTTCTTTACATATTTGCAAGCGCCAAAAGTTTAAGAACTCCTCCAAATAT
GTTTATAATGAGTTTAGCAATTGGAGATTTGACATTTTCTGCTGTGAATGGCTTCCCCTTACTTACTATTTCAAGTTTTA
ACACTCGATGGGCTTGGGGAAAATTAACGTGTGAGATTTATGGTTTCATCGGTGGTCTTTTTGGGTTTATATCCATCAAC
ACAATGGCACTAATTTCTCTGGATAGGTATTTTGTTATTGCCCAACCATTTCAAACAATGAAATCCCTGACAATCAAAAG
AGCAATAATCATGTTGGTTTTCGTATGGCTTTATTCATTAATTTGGTCAACACCGCCATTTTTTGGATATGGAAATTATG
TGCCGGAAGGATTTCAAACGTCTTGTACATTCGACTATTTGACCCAATCAAAAGGTAACATAATATTCAATATTGGGATG
TACATAGGAAATTTCATAATTCCCGTTGGAATAATTATATTTTGCTATTATCAAATTGTCAAAGCAGTGCGAGTACATGA
ATTAGAAATGTTAAAAATGGCTCAAAAGATGAATGCATCTCATCCAACTTCCATGAAAACGGGTGCAAAAAAGGCTGATG
TTCAAGCTGCAAAGATTTCTGTCATAATTGTCTTTTTATATATGTTATCATGGACACCATATGCAATAATTGCCCTTATG
GCTCTCACAGGGCGTAGAGATCATCTGAATCCATACACTGCAGAATTGCCGGTACTCTTTGCTAAGACCTCAGCTATGTA
CAACCCATTTATATACGCAATAAATCATCCAAAATTTCGAATTCAGCTGGAAAAGAAATTTCCATGTTTGATTTGTTGCT
GTCCACCAAAACCAAAAGAAAGGGACACTACAAGTGCAGCATCAGCAACGAAACCGAGTAAATATCAGAGTGAAAGAGAA
AGTTCAATGTCTCAACTGGATCCTGAAGACGATAAACAAGTCGTAGAAACCACCAAGAATCAAACCACAAGTGGACATAC
AAATGAAGCTTACGAGAGTGAACAGAAGTAGTTGATGAAACTAAATTATTCTATTTTTAATGACACTAGATCTTTATAAT
AATTTTATTTAAGGGAATGAGCACTGAATTTTGCGCAAAT
>SMED30030681 ID=SMED30030681|Name=SMED30030681|organism=Schmidtea mediterranea sexual|type=transcript|length=732bp
TATGGATATACATATAATAAAAAGATTCTTCGTTTTTCTCAAGCTTCCAAGTTATAGTTTCGTAGTTTTAAAAAAAAAAT
TATTATACCCTATTACTAAACAAATAAAATTTTAATTATCTCAAAAACGAAATCCACATTTTAAAAAGCTATGTTTTTAT
AAATTTTGTGCACTTTCATTCGATCACATTTTCCATATCTCTGATAGATCGGATCGCATCTCAAGTGCAATTGATGTGCT
AATTTGTCGCATCTGTGATCGATAATTTCGAATTTTCTGTAACACCATTTTCTGATGACCCGGATACCTTGATCGAGTTT
GGCGTACAAATTATCAATCTCTATTCGACATGACTCAGTTTGAACGTCAACGCATTTGTGATTTGCGATTTCTTCCTTAT
ATTTCAAATGAAAATGAGCTCGGCGTTCATAACAGGCCTTGTGGAGAACATAAGCCTTTTCATCGCATTTCCGATCGGCT
CTGGCCCAGTCTCTGTCACATTTAGTGACAGCATTGTAGAATCGGTATTCGTGTTTGCTGCACTCAGTAACGATAAAAAG
AATAGCCAAAAATATTATGTATTTCATTTTCAAAATAAATTTTGAAAAAAAAAAAAAAAAAAGATAAATTTACCGTATTC
AGCGATATTTTTCTTTGGCATAGCATACATAATATTTTCCATTTTAAAAATGAAATAAAATGAATAAGCAAGTTGTTTTA
ATCAATCATTAG
>SMED30021661 ID=SMED30021661|Name=SMED30021661|organism=Schmidtea mediterranea sexual|type=transcript|length=1073bp
CATACATATATATATATATATATTGAGACTATTCATTTTTTTCCATACAAAATTCAAACAAAATGAAACCATTTCTATTT
CTATTTTTATTTCTTGTCTCATCTCTTGATCTGAAGATCACCGAGGCTTCAGGCACCGGAAATTGGGGCTATACGTCAAC
CAGTGACATCAAAGGCCCCTCGGACTGGAAAGACATTAATCCAACTTGCGACGGAGCTCGGCAATCACCGATTGATATCG
TGACAAGAAGTGCGGTTTATTTGAAAGATTTACAAAGGATTGAAATTAAAAAAATTGACAACTTTGCTAACTTTTCCACT
CTCGAAAGACATGAAACCTCTATTTACTTAAAGCTTAATAACAGTTGGGGAATCACTTTCGGAGGAAATCAATGCCTAAG
ACCTGACTCCATTCATTGGCATTGGGGATCCAAGGGTACTTTAGGATCGGAACACTCTCTAGATGGGAAGCATTATCCAA
TAGAAGGCCATCTGTTGTCATATAATTGTATGAAATACAGTTCTTTGAATGAAGCAAAATCGAGTCCGGAAGGTCTTTAT
GTAATTGGTATTTTTTATAAAATCGGAAAAAAAAATATGTTAATTGACAAAATTATCCCGGCAATGCAAAGTCTGATTTC
CAGTAGTGATATCTCGAGCGTGATCATTAACGAGATTTCGGTGGAGGAAATTCTACCGAAAAATTTGGACAAGTATTATC
AATATGACGGCTCATTGACGACCCCTCCATGTACAGAAAACGTCAGGTGGACAGTGCTAAATGAAGAGCTAACTATAGAT
GAATCTCAATTGGAAGTTTTTCGCCAATTCGACTTCGAATCTCCCAATTCTGGGGAAATGGAGAACAATTTCCGACCAAT
CTTATCAAAGTTCAATGAAAAACGAACAATATATTCCTCATTCAAAACGGGGTCCAGTTAGACAATCTTATTATGGGTGC
TTTGTGCAATCTTCATGTGCCTGAATAGTCGATAATATGATGTTCATAACACTCAAATAGCACATTTAATTCATTTTGAT
TAACACTATTTTTCATTTCATTTATGTCAATTA
>SMED30007290 ID=SMED30007290|Name=SMED30007290|organism=Schmidtea mediterranea sexual|type=transcript|length=2033bp
AGGTAAGTGTCGTCATCACAAGTGGCTTTATTATTATCATTTAAATTTTTTATCATATTATCATTGATTGCTTGTTTTCC
TCATTCAAAATTTAACTGATTGTTATCAAGCTCATTTGATAACTCCAAATCTAATTGACACTCATGTAAATATCCCATTC
GAATTTCCGTTCCCGTCCGTAAGATCCACGATCCGACAATGTTTCTCCCATCGGTATTGTCGAATTCTCACCAGAGAAAC
TCACCAATAATGGACATTGTATCACCAAAATCCAACACCAGCAATCTGAATGCGTTGATCACGTATTCGAATTGTCCCAA
CATAGATCTACAGTCGAATGATCTGTCAGTGAACTTGACGAATTCTCAAAACTTCCACGAATTGGATCACAAAACCAATT
ACGGATACAAAGTTTCAAACAACGAGACAAAACTGAATGCTTTTCCATATTTAGCTCAATCGAACTTAACAGATTGCACA
ACAGACATCAGTGGAGATCTGAAAAATCCAAATTCACATCTCAACTATGGAAACGGAATTTCGTTCTCGGAATTTTCGAA
AATGTCCGAAACCAACATCCACGGATATCCGCCATATTGTTTCTCCACTAAACTGTTTCCCATTCCAAATCTACAAGAGA
AATCAATTATCAACGACAACTATTCCGTGAAATCCACCGCCGGAGGCTTTATCACCGAATCGAATGAGCATCAAAACTCT
GTAAATACTGGAAATTCCTACAATTCCAATTTAAGCTCATACAGAACGGTAATTCCCGCTCATTTTCATCTCTTCAATCA
GAATTCACCAGAATCGAACTCGTTTTACAATACGGCTTGGAACAACTATCCGTTTCAAATATCCCCAACTTATCCCATAC
AAAATCTACCGGATTCAACAATCAACTGGACAACAAACAATCAAATTCCAAGCAGCAATTTAGTTTTTGATCCCTGGAGC
TGTAAATCAAATCTTAATCTTCCTCCGATTAATGAATTCGGTTCCAATTGCGATGTCAGCAGAGAGTGTGTGAACTGTGG
AGCTAGCAATACTCAGTTGTGGTCCCGGGATAATTCTGGCTATTATTTGTGTGATGAATGCGACAGGTTCTCTCAAAACA
ACAGTAGAAACCTCGAAAAACTACCAACGAATCAAGTCTCATCAAGTACCGAAAATGAGTTCATGAAAAAATCCAATGCC
AACTTTCAACAATATGGAAAAAGATCCGACCTCGAATGCAGCAATTGTAAAATTACCAAGACTTCTTTATGGAGAAGAAA
CAACGAAGGAGAACCTGTCTGCAATGCTTGCGGCTTGTATTATAAATTACATAAGTCTCTAAGACCTCTTTCAATGAGGA
AAGAAGGAATACAAACAAGGAAAAGAAAACGGAAAACACAAATGAAACCGGTTTCCACTCATATTGCCAATAATCAAAAG
GTGCCGTCTTCAGAATCGTCATCAGAACAAAATCAGTTTATAAACACTGTGAAATCAAGTGAAAATTGCTATAACATGAT
TTCTGAAAATTCTCCAACATATATGCCAAATATATCAGTCCAGCCCTTCAATCACATTCTGAACTCCAGCCAATATCAAT
TCCAATCTACAGAAAATCCCATTAATCAATCATATTTAAATTCCTCAATCAAAAACAGCAATCCCTTTTACGATTCCGAA
AGTATACTTTATTCCTACAACAATTCAAACAAAATCAAAGATGAGCCCCTATTATCCATGGACAACGAACCGAAGCCCTA
TTCCTCAATCAACGAGAAAATTGACGTCAACTCCATAGTGAGAATTAATGAAATCTCAAACAATTCGAATTCGAGTTAAT
TATTCTGATCTACTTTTTAATTATATATTTAAGAACCGTATATACTTCGAAATATAATTTTAATGATAAAATTTTATATC
TAAAAAATGTAATTTTTAAGTGCGAATTATTAAGTATGCATTTAAATAGTGCAATTATTGTGGTAGTTATTTTTATTACT
AAATAAATGTTGTTTGTAAATTCGAGAATTTGT
>SMED30022907 ID=SMED30022907|Name=SMED30022907|organism=Schmidtea mediterranea sexual|type=transcript|length=1814bp
ATTTATTGAAAATTATTTTTTCTATTATTAGGAGAAAATTGATTATTTTTTTTTGACAAAATAAGTTTTGGATATATTTC
CCATTTGTTTGTATTCGTAAACCAATGAAGAATTCGACTCACGGATCGGATCATTCGGCCAGCAAGGCCAGTATGAAAAC
GAATGTGGAAAAATTTTGGCATGATCTCGGAAAAAAATTGCACATGGATCCAAAAGCATTAATAGGAGTAACAATCGGTT
TGGGAATATTGTTTTTGTTGTTCCTTTATTGCTTATGTAAAAAATGTGTTTTCAAGCGTCGAAAAAAGAAGGAAACGGCC
AAAAAAGGAGCCAAGGGAGTAGTCGATATGAAAAGTGCCCAATTGTTGGGGAATTCATATAAAGAAAAAATTCAACCCGA
TCTTGAAGAACTTGATGCAAACATGGAAGACAATGAAGGTGTAAAAGAAAAAGAAGATGTTCATTTAGGAAAATTACAAT
ATTCTCTAGATTATGATTTTCAGAAAGGAGAATTAACTGTTGGAGTTATTCAAGCAACTGATCTTCCAGCTATGGATATG
TCAGGAACATCAGATCCATATGTCAAATTATACCTTCTCCCAGACAAGAAAAAGAAATTCGAAACAAAGGTTCATAGGAA
AATTTTAAATCCTGTATTCAATGAAACTTTTGTTTTCAAAGTTCCTTTCAATGAAGTTGCATCGAAGACTTTGATTTTCA
ACGTTTATGACTTTGACAGATTTTCCAAACACGATCAAATCGGTCAAATAAAAGTACCATTGGGAGCTATAGATTTAGGT
CGAGTTATTGAAGAATGGAAGGAACTGGAATCTCCAGAAAACGATGGGGAAAAGGAAAACAGGTTGGGAGACATTTGTTT
CTCTTTAAGATACGTACCGACATCTGGAAAGCTTACAATAGTCATTTTGGAAGCAAAGAATCTTAAAAAAATGGATGTCG
GAGGATTGTCTGATCCATATGTTAAACTTTCCTTGATGCTTAATGGTAAACGAGTGAAGAAGAAGAAAACTACCATCAAA
AAGTATACACTAAATCCTTACTACAATGAATCATTTTCCTTTGAAGTACCATTCGAACAAATACAAAAAGTGAACTTGAT
CGTCACGGTTGTTGATTATGACAGAATCGGAACCAGCGAACCGATAGGTAGAATTGTTCTGGGATGTAACGCAACTGGAG
CAGAATTGCGACATTGGTCGGATATGTTGGCAAATCCCCGGCGACCAATCGCCCAGTGGCATACCCTCCAAGAGATGCCA
GAGAACAATTGATAGTGTTCGTTTGATGCTTTAAAGCGGTTTGCATAATTCGTGAAATAAGTTATCAAAATTTGAGAAAT
GTTTTTTTTTCTGAAACAAAAATGGCATGAGACAATATACCAGAGTTCATTAGTGTGTGGTTTCGTTGAATATTTTGGTG
GTGTTGCATCTTATCGTTTGTCCTCTAATCTAATAATGTTTTATTCTTTATATAGCTGATTTATTCTCGAGCGAAACATT
TTTTATGTGTACCAAAATACTTATGTCATAGCCATTGTGATTAGTCTGTAAACTATTGCGTAATAGCCCCTCTCATTGGC
TTTTTTTAAGAGTAGTGAGTTGGAAAAAAAAATACAAAAATGACTTCAATTGTTAAACATTACTCATATTTTATCAGTAA
GTTAACTTGCATATTTGCAGTTAATTATGGCATTTTATCTCTAAATCTCTGAAGCATGGCCTCAAGTCTTTTGTTTGTTT
TAATGTAATTATGTCTAGATGAGAATATTAAAATACTTCGGTTTATATAAAAGA
>SMED30024865 ID=SMED30024865|Name=SMED30024865|organism=Schmidtea mediterranea sexual|type=transcript|length=2214bp
GATCTTATAAATACAACATTAATTGTATAGTGAACTATGTTAGCCATTGAAATGGAGACAAGTAAAAAAATCGCAGTCAA
AACTACGAAACAAGAAGTAAGTGGAAGTGGAAGCTCTGGTGGACTAAATGAACAACAAGCTTTTGGAAGTGGTAGCTTTC
GAACCGGGTCTGGAGGTGTACAGATAAGTGCTAGTGGAGCAATTGGATCTAGCAGTTCAGGCGGAGTTAGTGGCACTGGC
GGAGTTGGTAGCATTGGTGGAGGCAGTGGTGCTGGTGGTGAAGGAACAGGAGCTAGCACAGTTATCACTACAAGCAGATC
TTATTATAAGCCTATCAGTCAACCTAGAAATAATTTAAAAGACTTACAAAAAACTTCTGGTATGAGTTACAGTGCACAAT
CAAACTCCCAGCAAGGTTTAAGTAATATTCCATTGATTAGGGGAGACAGTGTTGCTCTACAATCTGGAGTAACTTCAATG
AAAAAAGGACGAGCTCAAGAGAAAAGAGATCTTCAGGATCTGAATGAAAGATTCGCTAGTTACATTGAAAAAGCTCGATT
TCTAGAGGCGCAAAATAAACAGCTAGCCAATGAGATTGAAAAGTTAAAAGGTGGAACCGTCCAGGACAACTCAAAGATCA
AAGAAATCTATGAAGTCGAAATCAATCAACTTCGAGCTTTGGTAAATGAATCGGAAAAAAGCAAAGCTCCTTTAGAAGCT
CAAGTTGATTCTCTTGAATACGAAATTGATGATTTGAGAAAACGATTAATGATGCTGGAAGACATCAACTCTCAGTACAA
ATCCACCATCGATAAGCAACGCAAAGACATTTCTGGATTTGAAGGGGAATTGGTGGAGCTAAGAAGATTCAAAGGCACCC
AAGGTGCTGATGTAAATAAAGAAAAGGAAGAAGTAAAAACACTAAGAGACGATTTGAAAAAATTGAGACAAGATTATGAG
AAAGAAGCTCTAGCTCATCTCACCCTTGAACATGAATTACAAAGCTTGAAAGAAGCATTAGAATTCGAGAAACAAATACA
TGACACAGAAGTAAAAGAGCTGGCAACCGTTGCATATCGAGACCCAACGAAAGAAAATATGGTTTACTGGCAAAGCGAAA
TGGGACGCGCGTTACGAGACATTCAAACTGAATATGAAAACAAGCTTACAGGAATCAAACAAGAATTGGAGGCTTCTTAT
GGTTTACAAATGCAGGAAATACGAACAAGTAAAACCAGAGACAATGTGGAAACGACCCATTACAAAGAAGAGAACAGCCG
AATAAAATCTCAAATCCAAAGCATGAGATCGAGAATCGCTGATCTTGAGATGCAGAATGCTGAATACGAACACAACTTGA
ATAATATTCGTGCTAATTACGAAGAAACTCAAAGAAGTCTTGAATTGCAGTTGTTGTATTTGCAAGAGCAATTGACAGGA
ACTCAACAAGAATTGACAGTCGCTTTGACCGAACTCCAAAGCTTATTGGACGCGAAGTTGGGACTGGAATTAGAAATCGC
AGCCTATGCAAAACTATTAGAATTCGAAGAGAGTCGTGTCAATTTCTCTGGTGATGGCAACGCTACTTTATCTCAATTTA
TGAGTTTCACATCAAGTAGCGGAGCTGGAGGTGCTGGAGGGGCTGGAGGTGCTGGTGGTGCTGGAGGAGGAGGAGGAGGA
AGCAGTGGGTTCGGATCAGGAAGTAGAATTGGAGGGTCAAGTGGTTTCAGCGGAATGACAGAAAGAGAAACAACTGACTA
TCAGTCAAAACGAATGAAATTTAGACGAACGACAAAGGGAAACATTTCCATTGCAGAGACTGACCTTATAGGTTCAACAA
TTATTCTGGAAAATATTGGGACCAAAGTGGAATCACTCGAAGGTATGACTATTAAAAGAGTAGTCGACGGCAGCGAAAAT
AAAATCTCATTTACCATTTCCGGAAAAGTTAACTTAAATGCTGGTGAAAAGATTTCTCTTTGTGCCAAAGGGAAAATAAC
CGGCAAAGGACGAGAAATCGAAATTGATGATGCTTCATGGGGGGTTGGTAACAATGTCGTAACAACACTTTGTGATTCAG
AAGGAGCGGAAAAGGCAGCTCACTATCAAGAGGTTTCGGCCTAGAAACCTTGCTAAATATTAAACTGAATTTGTATGAAC
ATAACAAAATTTTTAGTAATTTAATAAAAGTTTATTATTTTATAAATCCAAAAA
>SMED30035063 ID=SMED30035063|Name=SMED30035063|organism=Schmidtea mediterranea sexual|type=transcript|length=2664bp
TGTACATTGAATTCAATATTTAATAGTGATTAACTTATCCAAATTTTCAGCCACTTTTAGTTTAATTTGCGTGTTTTGTT
GAGCAGTTTTTATTGGCGCATTTTATAAAAAATACAAAACCAATCCAAATCAGTTTGAATCATTGTCAGATTTTAGTCGT
GCAAGATACATTATTTCATTTTAATTCTCTAGCATATGACATTTAAACATGGAGCTGAATTACTCGTTGAATGATAATAA
TTTCAATTTACAATTAGAAAGCGAGTCCTTGACTTATTTCGATTTATGCCAAAAATGTTCAGCGTACCAAAATAGTCTTA
GAGACTGGATGAAACATTTAGTTGACAGACATCCTTTACCTATTCAGTGGATGAGTGATTTGGCAAATAATTTAACAGAT
GATAAATTATCTAAGCCATATTCGACCGTTACAGAATCCCGTAAAAAACGCAAGAAGCATATCACTCCAAGGCCATTGAA
TAGTTTCATGATATTTTCCAGACATTTAAGAAGAAATGTTCTTATTTTCTTTAGTGATGCTTCAAATTCAGAAATAAGCA
AACTTCTTGGGAAGTTATGGAATAACATTCCAGCTACCATTAAATCGATGTATGATAATGAAGCTAAAAAGCTTGCAATT
TTACACTCCAAAGAATTTCCTGAATATAAATATCAACCTAAAAAGAAAAAAAAACAATATCTAACGAAATGCCCCATTAA
TTCCACACCTTTGTCGAGTAATTCATATGAAAGTATTCAAGATATTAATTCAGTAACGGATACACTACAGAATTCATCTA
ACAACTTACAAAAGGAAAGTAATCCGACCTCTGTTTCGTCTTATGGAAGCAATCAGGAATGTAATAATTCATTTAAGAAT
CATAGTGTACAGTCCAGCAATTTTCCCAAAGAAATCAACCATAAACCAAGTAGAAAAATTGAAAAGCAATCGTGCAAAAT
AAGTTCCAATCAAATAATGGATGATTCAGAAGGGGCTGAATCCAGTCCATCATCATTTAAAAACACCATTAAAAATGAAA
TTTATTCCTCTTATAGTCCATTTCTAAATGAATCCCATAGCATTCTTTCAGATTTAAGTTACTCTTCGTCTCTCAATAAC
GTTTCAAAACACACTAGCGATTCCATTATAACGAATTCTCCTATCAGAGAAGAAATTGTCTTAGAAAATAATCAGCCCTC
TCAACAGAATAATATAAACAATTACCGACACGTATTTCAGAGAACTTCGACTCTATCCAACAGTTTGTTGACCCCTTTAA
CCATTGTCACAGAAAAAGTTGACGAACAGAAAGATCTTCCACCATCAAGAATCAATATCCGATATGTGAAAATTAACAAA
CTACCGATTCAAACAAAATCCGATTTCCCATTGACTGGATATTTTCAAAATTTCAATAACGACTCAAATCTTCATTTTCA
GAGTTCCATTCACGCCCTGAATACGACATTGACTCCAGATCTGTCGGTAAAACGCGAAGCCACTGTCAACAACAGCATGA
CAGATTATATCAATCGAAAACGTACAAATGTCGATCCACTTATCATCGATGATATATTTGAAAACGAACAATTTGAAGAT
GAGGAAGTGTTGAATTTTGACAATCCTGATAACAATAACAGTTCTCCTTGGTCGTTTAAATCGCCTAACTTTAAAATATC
TACCGGTTCCTCGACACTGTCAGACAATCCGTACAAAGAACAGTTTTGTTCTTCCCCGTTCCATCTATCAGAAACTGATA
CTCAACCGATTCCAGTTCAACGATTGCCAGCAATCGGCTCATGGTTAAAGTCAAACTATTCTGAATTCATGATCTGATCC
AATCTATTATTCTATTCAATTGTCTGTTTTCATACAATTAGGATTACTTGTTATGAATTCTAGCTGATTTTGAGTGTGTT
TATAAAGCTTTTGTAACGCCTTTTCTATACAGATGTTCGATATATATATATAAATAAATAAATATAAATATATAACAATT
TTATTGACATTGTACAGTATTCCATAAGCCCGATCTTGTAACGCATTTATTACTATACTCAATAGACCAATCTATATGTT
CTCATAATTTCTATGTTGTTATTGTACACGGGAATTATTACTATAAATGATGCGAATTTATCACTTTGTAATTGAGGGAA
ATTATCGATCAATTTGCGCTTTCAGACATTTTTCATGTATAAACTTGTTTTTCTCTTTTTTATCATCAAAAATTTAATTT
TTTTGATATCGCTATTCATCATATTATTATTCTCCGTTGCATTTGTTAGATTATGTAAATTTTTATATGAAAATGTTGTT
ATTTATTGTATTTTTATACGATTTTTTGCTTTGGATACACTTTTATCAAATCATATTGCCAGTGTGAGCATTTATTGGAC
TTGTTGTTATTGCTGCTGCTCGAATAATTGCTTCATACGGGGAGTCTCGATATTTTCATGAAGCGATTTTCATGGTTGCC
GCTCTCCGCCGCCGCCATTCGGTGTAAATATCAATTGCATTGCCAGCACGTTTTCTCAAACTCAATTTTTGTACTCAATT
TCAATTGATTTATGTTCATTTTATTTTTCATAGAAATGAGTAAATAAATTTTCATAAATAGTTTTGTTTTCAATATTTTT
AGGAAATTTGAATGTGTCTCTAGA
>SMED30001900 ID=SMED30001900|Name=SMED30001900|organism=Schmidtea mediterranea sexual|type=transcript|length=1713bp
CTTTTGAGGGAAAAATAATTCTTTTATTAATAATGTTTCATCATTGGAATATAAAATAAAATATTAGGAGAAAACATAAG
TTAACCAACAATATTAGCCACATATTTCGTTTAATTATTGGTCTATCACTTTTCATTTTAACCAATTGTCTTGAGATAAT
GGAGAGTTTATCCTTAATTTTTATTATAAATCACTGGTTTTGATAGACTTATTAACAATGGAAAATTATTTCAAACTTTT
CGTTGGTCAGATACCTCGAAATACACCAGATAAAGAAATTAGACTTATTTTTGAAGCTTTTGGACCAATCTTTGAATTTT
TAATTTTAAGGGACAAGAAAACTGGTTTTCATAAAGGATGTGCTTTTGTTACATTTTATCATAAAGACTCTGCAGAAAAT
TGTCAAAAGGCGTTACATGACAAGAAAATCCTAAACGGGATGAATCGACCACTTCAAGTGAAACCAGCTAAAAATAAGTT
AGCAAAAAATTCAAGTTTGAATGGGGAAAATCAGACAGAAGAGCAGGTTTTCAGTGATGAAAGGAAATTGTTTGTTGGAA
TGTTGAGTAAAAATCAAACTGATGAAAATGTACAAAATATGTTCACAAAATTTGGCAAAATCGAAGAGTGCACTGTATTG
AAAGACCAAAATGGAAATAGTAAAGGATGTGCCTTTGTCAAATTCGTGAACCACACCGATGCTTGTGCAGCAATAAACGC
TCTTCATGCCAGTCAAAAAATGGAGGGTGCTTCATCCAGCCTTGTGGTTAAATTTGCTGACACGGATAAACAAAAACAAA
TAAGAAAATTGCAGCAATATATTCCAGATTTAAGCATTTTAAATTCGCGCATTCCTATTAATATTCCATACTATTCACAA
TACGGTACAATAATTAATCCAGAATATAATTCAACAATTCCTTCAAACCAATATATTCGAAATTGTAACGAATATATTCT
TGCTGCTCAAATTCAACAAATAAATTTGTTTTCTAATTTATCATCGGTCTACCCATCTAATTCAATAGTGTCAATGCCAT
CCAGCCATCCGGTACCAATGATTGACTATTCTGTTCCTATTAACAACTTTCCACAAACTGACCAAATAACAATGAAACCA
ATTGTTGATATACAGCCAATACCTCCAGAAGCTGTACACCGAACCATCGTAACTCCAGGATCACTCTTATCATATCCTTT
TCTTAATGTTCAAATTCCTACAGTATATCCAAACGCCTTTTCCAATGGAAATTTAACAAGTACAACACAAAGTTCAACAG
ATGTGAAAACCACTCCTTTGCCAACAGGTCCTGAAGGCTGCAATCTATTTATTTATCATCTGCCACAAGAAATTGGTGAT
TTACAATTATATCAAATTTTTATGCATTTTGGAAACGTTATCAGTTCTAAAGTTTATGTTGACAGAGCAACAAATCAAAG
CAAATGTTTTGGATTTGTCAGCTACGATGATCCGGCATGTGCCAATGCCGCCATCAAATCTATGAATGGATATCATATCG
GAACAAAAAGATTAAAAGTTCAGTTAAAAAAACCAAAAGAAGCAATAAACGAAATGAAAAACTTCAATCAAATGTTATCA
TCAACTCCCGACATAAACCAAGTATTTTGTTCATCCTAATGATTGTGATATTTTACAGGATTTTCTCGACCATATTGAAA
GCCTGATTGGTGATATGTAAAATGACCCACCGT
>SMED30013909 ID=SMED30013909|Name=SMED30013909|organism=Schmidtea mediterranea sexual|type=transcript|length=2414bp
ATTTAGAAAATGGAGGCAACTTGCGATGTTTTTTTAACGAATTTACCTAAGTCGATTAATGAAGTAGTTGTGAAGAACTT
ATTTTCTTCTGCTGGGAAAGTGTTAAAAGTGAAAATAATAGATGACAAAAGAAACGAAAATCAGAAGCTATGCTTCGTTG
GATTTCGAACTATGGATGAAGCATTAGAAGCCGTCAGAATTGCAGATAAATCTGATGCGTTTGGTGATCCAATTAGAGCC
AGTATATCAAAGAAGTGTTTAGACGGAATGGAGAATAATCAAAATAGATCAAATAATAACAGAAATGATTCAAGTTATAA
AGGAACTGATTCATTTTCAAGAAAGAGTGATTCTAATTTCAAGGATAGTGAAAAGTATCCAACAAACAATGGTGACTTTG
CACAAGTAAATCGTTTAAACAACGTTGGAAGAGGAAGAGGAATCCAGACTAAAATTATTAGTGGTCCACCTTCATTCAAA
ACTAATGAAATTAAGTTAAACGATATTAAACTTAAAACAAAAGAACTGATTGACATCGAAATCGTCGATTTAAGTAGAGT
TGACATTATACTTATAAGGCCAGTAAAGTCAACGGAAAATTCAAAAATTGAAATAGCAGATTTATTGTCACAAATAAATT
CAAATAAATCGAATCTAATGCCAGTTGACTGTCCTAAAATAGGAGATTTTTGTCTTGCAAAATGGACTGAAGATGATTGC
TATTATCGGGCTGAATTGTTAGATATATTAAAGGATGGATCTTTCAAAGTTACTTTTGTTGATGAAGGAACTTCGGGTGA
TATTGTGACTGATTTGAAACACATTCCGACTGGTGCTTTACAGCAGTATCCTAAACAATTTTTGAAGGTTTCAATCGGTT
GCTCAGACGCAAAAGAATTAATGTCATTTATTTTACAAGAGTCTGAAGGAAAGGTGATTAAAATTTATTGGCTCGGAGAA
TATTGTGATTCCGTGCCTGTTGTAAATTTATTTCTGAATGAAGATGAAATTGTGGAAAAATATACCCAAATAAATAAAGT
AAATATCAGGAAAAAATTCTCACAGACATTTGATGATCTCCCAGTACATAACCTCGAAACTAATTCACATTTTTCAATAG
CACCATCAATGTATAAAAACCGAAATGATTTTATTCTTCAGATGAAAACTTTCTCGGTATCTTTAAAGCAAAAAAAATGT
CCTACGGTTTTACCAATTCCTGGTGATATATGTATATATGAGAAAAGGAATGCTAATGGCGAATCATTTCTTCGTTGTGT
TATATTAAGGCGCCAACTTTTTTCTTTTGACATCGAGTTAATAGATATCGGTGAAAAAATAATGAATGTTAATATTGATC
ACCTGTACACAGTCGAAGATATTCATGTAAAAGACGCTCCCTGTGCTATTACTTGCGATTTAGATAGTTCTATTAATATA
GATGGTATTAAGCTCCCTCAAGATTTGATCGATGGTGTTCTCTTTAATCTTAAAAAGTACAACAAAAATAATAAATACAC
TGTAAATTTCATTTTACCACAAAAGAAAGCTTATGAATATGCAAAAGTATCATATAAAGATTTGATTGGTAAAAGCTTTA
AAGTAATAATGTCGCACGTTGTCTCTCCCATTAATTTCTTTATTCAACTTGATGATGGAGAGCATCAGCTTGCACTTGGA
GATATTCAAGAAAAATTAAATATTAATTATAATGGATCACCATTCAAAAGTGCTAGCGATGTTAAAGAAACTCAGGCAGT
TATTGCTCCTTTTATTGTTTCCGGAAGTGATGCGGAACTTTTTCGGGCTTATGTTTTAGAGAAACGAAAGGAATCTCCAC
AAATTCATGTATTGTTTATTGATTATGGTAATGATGAATGGGTGAATTATGAAACTTTACTGAATACAAATGAAGAATTA
GTTTCTAAACCAGGTTTCGCAATACATTGTAAATTATCTCTAAATATTAAGAAGGAAGCGTGGAGTCACGCTATTGAATT
ATTTAATGATTTAGCTGGTTATACTGAAAATGACCAGGGGACGTTTGTAATGCAGGTTATTAGTGTCGATGGTGATTCGT
TAGTTGTGGACTTGATTTCAGAACTGAAAGGTTCGTTGACGGCCATCTTAGAAAAAAGTGGTACATGTGTAAAGTCCAAT
GAACCAATATGTAATGGAGGAGGACCCCAAGTTAAATTAAATGGCGTTTCAAATGATAAATCTCAATCAGCTATTCTTGA
AAATTTATCTGAAGGAGAATTATATAAAAAATTTATTGAACTAGAACGGAGATTAAGTGCTTTAGAGATATTGATGAAAT
AATGCTACCCGCGCAATTAGTATTATCAAATTATGATAATCTAGTCTTGATGTGTTTAAAATTTTGTATTTTAACATAAA
TTTATTCCGTGTTG
>SMED30030379 ID=SMED30030379|Name=SMED30030379|organism=Schmidtea mediterranea sexual|type=transcript|length=1625bp
AATTAGCTATGCGAGCTGCTTTATCAGGCATGACTGTGATAAAACTGTCATTATTTATGCGCATAATTTGCCGTTAGTAT
TTGCTCAACCAATTTGACGTTCAACAACAACAGCAACAACATCCACCACCTCCACCAACATCCTCATTATCATTATTATT
ATTGTCATGTTAACAAGCGGACTTAATCAGGAACAATCATCGCCTTTAACAATCGTAGGCATGAGTGAGTCTCAGTTTTT
CAACGAATCTATCAGATATTTGCCTCCGGAAACCGTGGAGAGACAAAGCCAATTTTATGCAAATAATAATTATCCCCTTG
GTGAGTTTTGGAATCCACAATCCGAATATGCACAATACTTGCAAAATACCCAGCCAGTCTCGGGGCCTCAATTCATTACT
TCGCCGGCGGTTGGAGAGGCATTCTATCCATCTCTTTATATCAATACTATCCATGAAAATGTATTACTACCTTCGGTTGA
TTCCTTCAATCCTCCCAGTGGATTTATGATTTCGGGATATTCACAGCAAGACCAAACCTTTCCCACGGTCAATGAACCGA
CGTATGACAATATCCCAAACAATTGGAATTATGTTGATCATTGGGTTGATTCCAAGCCAACAACAGTGAATTCTCAGCTG
TTGCCAACCTCGTCAATTTCCGCCGTCCCCATTCAGAATTCGTTTTGGGACTGCGAGTCGATTGACCAATCAGAATATTG
TCCCACAAATGTTGATACCGAGCTCCAAGATCAAATTGATTCCAACGGAGAAATCAGTAGACTCAATCAAAAGATTTCTA
CTGACGAGTTGGAGCAGTTTGCGAAAATTTTCAAACAGCGAAGAATCAAACTCGGATTTACACAAGCCGACGTCGGGTTA
GCCCTCGGTAATTTATACGGCAGCGTGTTCAGTCAAACAACAATTTGCCGGTTTGAGGCACTGCAGCTCAGTTTTAAAAA
CATGTGCAAACTTCGACCTCTGTTAGGGAAGTGGTTGCAAGAAGCCGACTCAACCGGATGTGCTCCGTCCGGTATTGACA
AAGTCACAGCTGCTGGACGAAAACGAAAAAAGCGAACCAGCATTGAGGTTGGAGTGAAAAATGCACTGGAATCTCACTTT
TCTCGACAAAGCAAACCGACAGCCCAAATCATTACACAGCTTGCAGACAGTCTCGGATTGGAAAAAGAAGTTGTCAGGGT
ATGGTTCTGTAATCGGCGACAGAAGGAAAAACGAATGACGCCTCCGCCACTGAATGGAACAAGCTCAGATTTATTTCCAC
ATCCTGGTTTAACTGTCGGAACTGATAGTTCTCCTCATTCCTCATCTCACAGTAATCATGATTCATTCTCGTCCATTGGT
AACCAGTCAAGCTTCAATCGAATAGGTGATCCCTCCTCGACTCATCCCGGAGTCATTGTCACATCTTGCGGTTATTACTA
TGGTCATGTTCCAAATGAATCACTTCTCAATTGTGGGCCTTACCCTCACAACATCATCAACAATTACGAATTCAGACAGT
CCAATGATCCCAATATCCTCAATGTCAAATCCGAGTGCATCAGCTGACTCATGTCGAACTCACCGAAAAGAAAGCTAATA
ATATTCTATTTCAATAATAATAAAA
>SMED30006796 ID=SMED30006796|Name=SMED30006796|organism=Schmidtea mediterranea sexual|type=transcript|length=1755bp
TGTCAGTTTAGTCATGCTCGTAATCACAATAGGCATAGTCTTTGCATCTTTCTTACCTTTGAGTGACTGCCTAATCCCAA
GGATTTGCAGTAGGAATGTCACTCTTTCTAATTCAACATGTTGTCCAATTTATAATGATTTTGTTTGCGGTGGTCCTTTT
CGTGGATCTTGTGAAGTCTCCATTCTTTTTCAAAATCACACTGAGCACTCGGATGTTATCACCGGAAAATTGGAAAATGA
CGACAGACTCAACTGGCCATCAAGATTTTTTAAATTTCTTTGCAGTTGCAAGTCAAACTATGATGGAATAGCCTGTGACA
AGTGTAAATCAGGGTGGCAAGGGGAAAACTGTGAGGTGGTCTCCCCGAGAAAGATTAGACAAAATATTCTTAACATGAGA
TCATACGATGTTTTTATTTTTTTATCGATACTGAACATCAGCAAATATCAGTTGGCCGATTTCCTGATCACAAATTCGTC
CTCAAACCTTCACTGTGACCCTGTCAATGAAGACAACATTCAATTGGTCAATGCTTCCATTTATGATACAATGGTTTACT
TACATTTCTATGCGTCCAGGAGTACAATGTCTAAAGAACTTATGGAATCCTGCACAGACAAGGATAACAAATTAGACTTC
GCTCATAAAGGTCCAGCTTTTTTTACATGGCACCGACATTATTTACTGATGTTTGAAGACTTATTAAGGAGTATTGCAGT
CGAACAATTTGGATATTATAATTTCACATTACCATATTGGGACTGGACGAATCAAATAACTTGTAATATATGTACAAATG
ACTTACTTGGCGATATTCCCACTGAAGATCAAGAATCTAACAGCACATTTTTTAAATGGAAACCGATTTGCCCTCAGAAA
CCTAACGATTTTGATTGTCATATTTGCGATCCAAGCCAGGAAGAACCTTTTTTATGGAGAAAATACTCATCAACGGTAGA
CAGACTTCCTAATCAGAACGAAATTGATGAGTTATTCTCAATCAACCAATATGATTCGGAGCCCTTCAATTCCAGCTCAT
TTAGTAGGAAAAGCTTTCGGAATTTTGCAGAGGGATATTATCGAGTTCATCCAAACTCAGATGATATGAAAATGAAAGAC
ATTGGGAAGGGACTCCCCCATCAAAATATCATGATGCATAATATGTTTTATCAATGGAACTTGGATGGATTTCACAACGA
GTCCCAATGATCCATTATTTCTACTACATCATACGTTTATGGACAAAATCTTTGAAATTTGGCTATTAAGAAATAGACGA
TCTACATACCCTGGGAAATCTTCAACACCAATCGGGCAGCATGCTGACGATTTTATTGTGCCTTTCCTTCCACTAATCAG
AAACAGGAATTTGTTTACTTCAGCAAATGAATTTGGCTACGCCTACGATAACAATATTGTTGGAAATAAATTGTTCACAA
ATCATCAACTAGATTTCGAAAAGAGCTCATCGGAAATTTACTACATCCTAACGGCAGTTGCCTTTGTAGTACTAGTTGCG
ATCGTCGTCGGATTGTACTGCTTCAGACCCAGTCAAATCAGTCACACGGCTTATGAATTCATTGAAGACCAGGAGCAGGA
GGAAAAGACAAATTACTTTAACAACAATGAAAAAATGCCTCTACTGAAATGACAAGCCATTTCTGATGACTATTATAATA
TTGTCACCTTAAATTTTCTTTGAAACAACTTTATTATTGACAAATTTTGAAGAATCCTTTTAAGCAAAATAAAGT
>SMED30004304 ID=SMED30004304|Name=SMED30004304|organism=Schmidtea mediterranea sexual|type=transcript|length=907bp
CTAAAAGGTAATAATTTAAATTTAATTAGAACATTGTTTTAATATTCGGTTATATTCTCCATTATTCTAAATTATGTTTG
AAGCAAAATTAATAAAAGGCGAAGTTTGGAAAAAGGTTATAGAAGCTATAAAAGACTTAGTACAAGAAGCAACATTGGAT
TGCTCAGAAAATGGAATTAGTCTTCAAGCCATGGATACATCTCATGTGTCCTTAGTTAGTATGCTTCTTCGAAGTGATGG
TTTTGAGACTTATCGATGTGATAGAAATGTCAATCTCGGTCTTAATATAACAAGTGTTTCAAAAATTTTAAAGGCGCTTG
GTAGTAATGATTCCCTAACAATGAAAGCCGCTGATTCAAGTGAAACAATTTCGCTTTTGATAGAATCTGCAAATGAAAAT
GAATTATCTGAATACGAAATAAAATTAATGGACTTGGATGGAGATCACTTAGGTATACCAGATACTGAATATAAGTGCAT
TGTGAAAATGCCGAGTTCAAAGTTACAAAGAATATGTCGAGATTTAAGCCAAATTGGAGAAGCAATCACGATTTGTGTTA
CTAAAGATGGTGTAACTTTTGCTGCTGCTGGAGATCTAGGAAAAGGAGCTATAAAACTTAATCAAAATTCTAGTGCTGAC
AAAGAAAATGAAGGAGTAACTATTGAAATGACCGAACCTGTTTCGATGACATATTCATTGAGGTATTTCAATATGTTTAC
AAAGGCTGCACCTCTTTCTTCTCAAGTATCTCTGTCGTTGACTGAAAATGTTCCAGCAGTTATTGAGTTCATAATCGAAG
ATTTGGGATTTATTCGATATTACCTAGCTCCTAAAATCGAAGACGACGAGTGAAAGTTTAACTATTAATGTTGTATGTTT
AATAGATGTTATTTTGTTTAAAAAAAA
>SMED30035904 ID=SMED30035904|Name=SMED30035904|organism=Schmidtea mediterranea sexual|type=transcript|length=728bp
GCAATATTTTGTCATGAATGTTTAATTGAAAAATATGAAAGTTTTAATTATATTTCTATTTGTGATTGCGTTCGCGTATA
TTGAATGCCGTCCTCAACATCTATTGGGGTTCATGAGGAAAGAAAAGTCCAAGCTAGAAAAAGACTCAGCAGATGACGTG
AAACAAGGAAAAGATTCGGATAAAAGCTCTGATAAATATTCACATGAAGGATCTAATAAAGAGTCTGACAAAGAGACAGA
TAAAGAAGAAGAAACTAATTCTAAGACTTCTGCAAAGTCTCCCGCCAAATCAAGTAGACGAAAGAAACAAGTGGAAAAAT
TGGAAGAAGAGGAAGGAGAAACTTTAAAAGAGAAATTAAAAGGACACATTACGAAAGCAGATTGCATGAAATTATACGAA
GAAACTGATAAATACTGCGATCCACTTTATTTGAAGCTCGACAAAGATTGCGACTGCAGATATGTGAAAGCATTGAATGA
CTACACGAAAAGATGGGACAGTTATCATTCCAAATGTGGTAGCAAATATGACAAAAAATGCCGAACCGAATTGCGAGCTT
TGGAGAATTGGTTTAATGGCCTTTATGATTCAATCGACGGCCACTGTGACGCAGAATATGACGCGCTGGATAAATATTGT
GACGTAGAATACAACAAAGTTGATCAATGTGAAAAAGGACAGAAAGTGTAATAAAATTGATTTGTAATAAAATTTATTAA
ATAAAAAA

 

back to top